expression of chloroplast small heat shock proteins of c...

Expression of Chloroplast Small Heat Shock Proteins of C. album

under Different Abiotic Stresses

By

Noor Ul Haq

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University

Islamabad, Pakistan

2013

Expression of Chloroplast Small Heat Shock Proteins of C. album

under Different Abiotic Stresses

A thesis submitted in the partial fulfillment of the

requirement for the degree of

Doctor of Philosophy in

Biochemistry/Molecular Biology

By

Noor Ul Haq

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University

Islamabad, Pakistan

2013

(We commence) with the name of Allah

The most gracious (To begin with)*

The most Merciful (To the end)**

Dedicated To

My beloved parents, Brothers, Sisters

& Khateeb Mamoo (Late)

Acknowledgements

ACKNOWLEDGEMENTS

All praises for Almighty Allah the most compassionate, the most beneficent and ever

merciful, who gives me the power to do, the sight to observe and mind to think and judge.

Peace and blessings of Almighty Allah be upon His Prophet Hazrat Muhammad

(P.B.U.H) who exhorted his followers to seek knowledge from cradle to grave.

I feel a deep sense of gratitude and indeptness to my dignified supervisor, Dr.

Samina Shakeel, for her kind supervision, useful suggestions, consistent encouragement,

friendly behavior and dynamic supervision enabled me to complete this task successfully.

Furthermore, I am deeply obliged and thankful to Prof. Dr. Bushra Mirza as a

head of the department for providing me all possible facilities in this course of study.

I am indebted to all my honorable teachers especially Prof. Dr. Wasim Ahmad

and Prof. Dr. Salman Akbar Malik, whose teaching and useful suggestions in my

research field, has brought me to this stage of academic zenith.

It is great pleasure for me to mention the cooperation and morel support of my

lab fellows especially Shumaila for making software of cis-regulatory elements analysis.

I am thankful to Dr. Shakeel Ahmad for giving useful suggestions about the

software of cis-regulatory elements analysis.

The company of Dr. Musharraf Jelani, Dr. Muzammil Ahmad Khan, Dr. Rahmat

Ali Khan, Dr. Salman Basit and Saadullah Khan will ever be remembered.

Heartfelt, thanks are also extended to the workers in Biochemistry office specially

Tariq Mehmood, Fayaz Khan, Saeed2, Shoib and our lab attendant Muhammad Ashraf

for their co-operation and help in official documentation.

Special thanks to the Higher Education Commission of Pakistan for funding me

through indigenous scholarship and IRSIP programs as well as funding us for this work

under research grant # 1212.

Special Thanks to Prof. Dr. Dawn S. Luthe (Penn State University, USA) and Dr.

Scott A. Heckathorn (University of Toledo, USA) for their collaboration and great

suggestions to complete this project. I am greatly obliged and thankful to Prof. Dr. G.

Eric Schaller (Dartmouth College, USA) for his great favor to complete some part of my

research in his lab under IRSIP in collaboration with Dr. Dawn S. Luthe.

A lot of thanks to my friends; especially, Hamid Nawaz Khan, Dr. Sehroon Khan

Durrani, Azam Khan, Gulab Sher, Atlas Khan, Amir Afzal Khan, Adam Sher Khan,

Shafeeq Khan, Israr Khan, Ehsan Ullah, Tahir Ali, Rashid, Abdus Samad and Ihsan

Khan, who gave me company during my stay in University and helped me whenever I

needed it.

The occasion needs special mention of my beloved parents, whose uninterrupted

support in various aspects of my life and studies, kept me going with grace and honour

under the shades of their prayers. I can never repay their unlimited love and precious

prayers.

I extend my heartfelt gratitude to my brothers Abdul Haq and Izhar Ul Haq, my

sisters, my uncles Kanzul Hussain Mamoo and Taib Hussain Mamoo, my cousins Amir

Miraj, Amin-ud-Din, M. Tariq, Abdul Mabood, Awnul Mabood, Sadiq Amin, Noor-Ul-

Amin, Rooh-Ul-Amin, Yasir Amin, Rashid Amin, Sohail, Tufail, Zafar, Manzoor Tahir,

Masroor, Mahmood, Maqbool, Azam Tariq and Ashraf Tariq due to prayers and best

wishes.

May Almighty Allah shower His blessings and prosperity on all those who

assisted me in any way during my research work.

Noor Ul Haq

DECLARATION

I hereby declare that the work presented in the following thesis is my own efforts and that

the thesis is my own composition. No part of the thesis has been previously presented for

any other degree.

Noor Ul Haq

List of Contents

Expression of Chloroplast Small Heat Shock Proteins of C. album under Different

Abiotic Stresses

List of Contents

S. No. Title Page No.

1. List of abbreviation i

2. List of tables iv

3. List of figure v

4. Abstract 1

5. Chapter 01 Introduction 3

1.1 Types of Stresses 3

1.2 Different types of abiotic stresses and their effects 3

1.2.1 Heat stress 3

1.2.2 Cold stress 5

1.2.3 Metal stress 5

1.2.4 Salt stress 6

1.2.5 Drought stress 7

1.3 Major effects of abiotic stresses 7

1.3.1 Effect of abiotic stresses on plant physiology 8

1.3.2 Effect on gene expression 9

1.4 Heat shock proteins (HSPs) 9

1.4.1 Role of HSPs 9

1.4.2 Types of HSPs 10

1.4.2.1 High molecular weight heat shock proteins 10

1.4.2.1.1 HSP100 10

1.4.2.1.2 HSP90 11

1.4.2.1.3 HSP70 11

1.4.2.1.4 HSP60 12

1.4.2.2 Small heat shock proteins (sHSPs) 12

1.4.3 Chloroplast small heat shock proteins (Cp-sHSPs) 13

1.4.3.1 Role of chloroplast small heat shock proteins 14

1.5 HSP gene expression 15

1.6 HSP promoters 16

List of Contents


Abiotic Stresses

1.7 Cp-sHSP promoters 18

1.8 Aims and Objectives 20

5. Chapter 02 Analysis of C. album Ca-sHSP promoters for presence

of putative cis-regulatory elements 22

Abstract 22

2.1 Introduction 23

2.1.1 Promoter region of heat shock genes 24

Table 2.1 Types and sequences of the core motifs of Arabidopsis

thaliana 27

2.2 Materials and Methods 29

2.2.1 Promoter sequences 29

2.2.2 Alignment of Cp-sHSPs promoters 29

2.2.3 Tree construction 29

2.2.4 Analyses for putative regulatory motifs 29

2.3 Results and discussion 31

Figure 2.1. A consensus bootstraps parsimony tree based on promoter

sequences 35

Figure 2.2. Comparisons of putative promoter regions of C. album

(US ecotypes) chloroplast small HSPs 36

Figure 2.3. Complete promoter sequence of C. album Ca-sHSP gene,

NY-1 showing all putative cis-regulating elements 37




MS-1 showing all putative cis-regulating elements 39



Table 2.2. Comparisons of the HSE core motifs in Cp-sHSP promoters

isolated from both C. album ecotypes (US variety) 41

Figure 2.7. Promoter sequence of a representative C. album Ca-sHSP gene

and diagrammatical representation of C. album Ca-sHSP gene 42

List of Contents


Abiotic Stresses

6 Chapter 03 Dual role for Chenopodium album chloroplast

small heat shock protein: photosystem II protection

from heat and metal stresses 43

Abstract 43

3.1 Introduction 44


3.2.1 Plant materials, growth conditions and heat/metal stresses 48

3.2.2 Physiological parameters 48

3.2.2.1 Chlorophyll contents 48

3.2.2.2 Superoxide dismutase (SOD) 48

3.2.2.3 Peroxidase (POD) 49

3.2.3 Photosystem II efficiency 49

3.2.4 Statistical analysis 49

3.2.5 Identification of Cp-sHSP genes 49

3.2.6 PCR amplification of full length Cp-sHSPs 50

3.2.7 RNA isolation and reverse transcriptase reaction 50

3.2.7.1 Total RNA isolation 50

3.2.7.2 First strand cDNA synthesis 51

3.2.7.3 Reverse Transcriptase PCR (RT-PCR) 51

3.2.8 Sequencing of Cp-SHSPs 51

3.2.8.1 Purification of PCR product 51

3.2.8.2 Cloning of PCR purified product 52

3.2.8.3 Plasmid isolation 52

3.2.9 Relative quantification of Cp-sHSP transcripts in heat

and metal treated samples 53

3.2.10 Cp-sHSP protein expression by Immunoblotting 53

3.3 Results 54

3.3.1 Effect of heat/metal stress on physiological parameters 54

3.3.2 Effect of heat stress and cadmium on thermotolerance of

Photosystem II 55

3.3.3 Full-length Cp-sHSP gene sequencing 55

List of Contents


Abiotic Stresses

3.3.4 Heat/metal regulated expression of Cp-sHSP 56

3.4 Discussion 58

Figure 3.1. Effect of high temperature and metals stress on total chlorophyll

contents, peroxidase (POD), superoxide dismutase (SOD)

and Cp-sHSP transcript of C. album leaves 62

Figure 3.2. The effect of heat stress (left panel) and metal stress

(right panel) on thermotolerance of Photosystem II

efficiency and transcript levels 63

Figure 3.3. Effect of high temperature (a) and metals stress (b)

on Cp-sHSP transcript of C. album leaves 64

Figure 3.4. Amino acid sequence alignment of CaHSP26.13p

from heat & metal transcripts Pakistani ecotype (a) and

with four genes of two US ecotypes 65

Figure 3.5: Amino acid sequence alignment and phylogenetic

relationship of CaHSP26.13p with other plants 66

Figure 3.6: Effect of heat stress and metal stress on Cp-sHSP

transcript and protein 67

7 Chapter 04 Molecular characterization of Chenopodium album

chloroplast small heat shock protein and its expressions

in response to different abiotic stresses 68

Abstract 68

4.1 Introduction 69


4.2.1 Plant materials, growth conditions and heat/metal stresses 73

4.2.2 Physiological parameters 73

4.2.2.1 Chlorophyll contents 73

4.2.2.2 Superoxide dismutase (SOD) 74

4.2.2.3 Peroxidase (POD) 74

4.2.3 Photosystem II efficiency 74

4.2.4 Statistical analysis 74

4.2.5 Identification of Cp-sHSP genes 74

List of Contents


Abiotic Stresses

4.2.6 PCR amplification of full length Cp-sHSPs 75

4.2.7 RNA isolation and reverse transcriptase reaction 75

4.2.7.1 Total RNA isolation 75

4.2.7.2 First strand cDNA synthesis 75

4.2.7.3 Reverse Transcriptase PCR (RT-PCR) 76

4.2.8 Sequencing of Cp-SHSPs 76

4.2.8.1 Purification of PCR product 76

4.2.8.2 Cloning and sequencing of transcripts 76

4.2.9 Relative Quantification of Cp-sHSP transcripts in heat and metal

treated samples 76

4.2.10 Cp-sHSP protein expression by Immunoblotting 77

4.3 Results 78

4.3.1 Effect of cold/drought/salt stress on physiological parameters 78

4.3.2 Effect of cold/drought/salt stress on thermotolerance of

Photosystem II 78

4.3.3 Full-length Cp-sHSP gene sequencing 79

4.3.4 Cold/drought/salt regulated expression of Cp-sHSP 81

4.4 Discussion 84

Figure 4.1: Effect of low temperature, drought and salt stresses on total

chlorophyll contents, peroxidase (POD), superoxide dismutase

(SOD) and Cp-sHSP transcripit of C. album leaves 89

Figure 4.2. The effect of cold, drought and salt stress on thermotolerance

of Photosystem II efficiency and transcript levels 90

Figure 4.3: Amino acid sequence alignment of CaHSP26.13p from

all five (heat, metal, cold, drought and salt) stresses 91

Figure 4.4: Amino acid sequence alignment and phylogenetic

relationship of CaHSP26.13p with other plants 92

Figure 4.5: Effect of cold stress (a), drought stress (b) and salt

stress (c) on Cp-sHSP transcript of C. album leaves 93

Figure 4.6: Effect of cold, drought and salt stress on Cp-sHSP

transcript and protein 94

List of Contents


Abiotic Stresses

8 Conclusion 96

9 Future aspects 97

9 Chapter 5 References 98

10 Papers

11 Originality Report

List of abbreviations


Abiotic Stresses i

LIST OF ABBREVIATIONS

% Percent

µl Microliter

ABA Abscisic acid

AP-1 Activating protein 1

APX Ascorbate peroxidase

As Arsenic

AsA Ascorbic acid

ATP Adenosine tri-phosphate

AZC L-azetidine-2-carboxylic acid

CAT Catalase

Cat. Catalog

Cd Cadmium

CdCl2 Cadmium chloride

cDNA Complimentary DNA

Cp-sHSPs Chloroplast small heat shock proteins

CTAB Cetyl tri-methyl ammonium bromide

Cu Copper

DEPC Diethyl pyrocarbonate

DNA Deoxyribonucleic acid

DNase Deoxyribonuclease

dNTPs Deoxyribonucleotide tri-phosphate

EDTA Ethylene diamine tetra acetic acid

ER Endoplasmic reticulum

g Gram

GR Glutathione reductase

HCl Hydrochloric acid

hrs Hours

HSE Heat shock element



Abiotic Stresses ii

HSF Heat shock factor

HSP Heat shock protein

KDa Kilo dalton

LC Loading control

met Methionine

mg Miligram

MgCl2 Magnissium chloride

min Minutes

ml Millileter

mM Milimolar

MRC Molecular Research centre

MRE Metal response elements

mRNA Messenger Ribo nucleic acid

MS Mississippi

MT Metallothionein

NaCl Sodium chloride

NBD-1 Nuclear binding domain-1

NBD-2 Nuclear binding domain-2

NCBI National Centre for Biotechnology Information

ng Nanogram

Ni Nickel

nm Neno meter

NY New York

ºC Degree centigrade

OD Optical density

OEC oxygen evolving complex

Pb Lead

PCR Polymerase chain reaction

PSII Photosystem II

PVP Polyvenyl pyroledone



Abiotic Stresses iii

RNA Ribonucleic acid

ROS Reactive oxygen species

rpm Revolution per minute

SE Standard error

Sec Seconds

sHSPs Small heat shock proteins

SOD Superoxide dismutase

STRE Stress response elements

T.HCl Tris hydrochloric acid

TE Tris ethylene diamine tetra acetic acid

US United states

UV Ultra violet

v/v Volume/volume

w/v Weight/volume

Zn Zinc

β Beta

γ Gamma

μmol Micro molar

List of Tables


Abiotic Stresses iv

List of Tables


Table 2.1 Types and sequences of the core motifs of Arabidopsis thaliana 27

Table 2.2. Comparisons of the HSE core motifs in Cp-sHSP promoters

isolated from both C. album ecotypes (US variety) 41

List of Figures


Abiotic Stresses v

List of Figure


Figure 2.1 A consensus bootstraps parsimony tree based on promoter

sequences 35

Figure 2.2 Comparisons of putative promoter regions of C. album

(US ecotypes) chloroplast small HSPs 36

Figure 2.3 Complete promoter sequence of C. album Ca-sHSP gene,








Figure 2.7 Promoter sequence of a representative C. album Ca-sHSP gene

and diagrammatical representation of C. album Ca-sHSP gene 42

Figure 3.1 Effect of high temperature and metals stress on total chlorophyll

contents, peroxidase (POD), superoxide dismutase (SOD) and

Cp-sHSP transcript of C. album leaves 62

Figure 3.2 The effect of heat stress and metal stress on thermotolerance

of Photosystem II efficiency and transcript levels 63

Figure 3.3 Effect of high temperature and metals stress on Cp-sHSP

transcript of C. album leaves 64

Figure 3.4 Amino acid sequence alignment of CaHSP26.13p from heat &

metal transcripts Pakistani ecotype and with four genes of two

US ecotypes 65

Figure 3.5 Amino acid sequence alignment and phylogenetic relationship of

CaHSP26.13p with other plants 66

Figure 3.6 Effect of heat stress and metal stress on Cp-sHSP transcript and

protein 67

List of Figures


Abiotic Stresses vi

Figure 4.1 Effect of low temperature, drought and salt stresses on total

chlorophyll contents, peroxidase (POD), superoxide dismutase

(SOD) and Cp-sHSP transcript of C. album leaves 89

Figure 4.2 The effect of cold, drought and salt stress on thermotolerance of

Photosystem II efficiency and transcript levels 90

Figure 4.3 Amino acid sequence alignment of CaHSP26.13p from all five

(heat, metal, cold, drought and salt) stresses 91

Figure 4.4 Amino acid sequence alignment and phylogenetic relationship of

CaHSP26.13p with other plants 92

Figure 4.5 Effect of cold stress, drought stress and salt stress on

Cp-sHSP transcript of C. album leaves 93

Figure 4.6 Effect of cold, drought and salt stress on Cp-sHSP transcript and

protein 94

Abstract

Abstract


Abiotic Stresses 1

Abstract

Plant response to the altered environmental conditions usually includes initiations of

several defense mechanisms. One of these mechanisms is the heat shock proteins (HSPs)

production, a universal response. Chloroplast small heat shock proteins (Cp-sHSPs) are

known to protect Photosystem II under stress conditions in plants. Cp-sHSPs production

is positively correlated with the plant thermotolerance. While the protective role of HSPs

has been greatly recognized against several physiological stresses such as heat, metals,

cold and different developmental stages individually or in different combinations. Recent

progress in this field has revealed unique aspects of regulations of these genes under

stress. Cis-regulatory elements present in promoter regions with the combinations of

several factors dictate the gene expression levels and specific patterns. Not much is

known about the regulation and mechanism of action of Cp-sHSP genes in plant

protection.

We analyzed four novel promoters of Chenopodium album (two US ecotypes) Cp-sHSPs

for the presence of putative cis-regulatory motifs (Shakeel et al., 2011). Interestingly we

found more than one cis-regulatory elements in the promoter regions of these Ca-sHSPs

and based on this unique promoter architecture, we proposed a differential regulation of a

single Ca-sHSP gene under variety of different abiotic stresses including heat, metal,

cold, drought and salt stresses individually.

To analyze the Ca-sHSP gene expression patterns under different abiotic stress

conditions, we treated C. album (Pakistani ecotype) plants at different abiotic conditions

and initially studied the effect of above mentioned stresses on physiology of the plants.

On the basis of physiological data, we decided the lower and upper limits of stress

conditions for further analyses of Ca-sHSPs. Stress induced transcripts of Ca-sHSP genes

were sequenced individually and analyzed; our data showed that one novel Cp-sHSP

family member, CaHSP26.13p is regulated differently under different abiotic stresses.

This observation was based on 100% amino acid sequence similarities among these

transcripts.

Abstract


Abiotic Stresses 2

Relative abundance of transcript and protein levels was determined by real-time PCR

analysis and immunoblotting of C. album leaf samples treated with and without stress

conditions. Antibodies specific to methionine rich region were used for Cp-sHSPs

detection by immunoblotting. Interestingly we detected 1-2 bands of precursor and

processed Cp-sHSP proteins (~26 and 21KDa) depending upon the stress conditions,

while only precursor protein (~26KDa) with differential expression was detected in all

types of treatments suggesting the role of single Ca-sHSP in plant protection under heat,

metal, cold, drought and salt stress. Due to the absence of correlation between transcript

and protein levels in most of these cases, we speculate some role of post-transcriptional

regulation in plant protection by this mechanism. This study demonstrates multiple roles

of single C. album Cp-sHSP in variety of environmental conditions by differential

regulation and can be used to develop stress tolerant plant species to face the challenge of

next decade.

The data presented here has been published in the following articles.

1. Samina Shakeel, Noor Ul Haq, Scott A. Heckathorn, E. William Hamilton, Dawn

S. Luthe (2011). Ecotypic variation in chloroplast small heat-shock proteins and

related thermotolerance in Chenopodium album. Plant Physiology and

Biochemistry 49: 898-908.

2. Noor Ul Haq, Sana Raza, Dawn S. Luthe, Scott A. Heckathorn, Samina N Shakeel

(2012). Dual role for Chenopodium album chloroplast small heat shock protein:

Photosystem II protection from heat and metal stresses. Plant Molecular Biology

Reporter, DOI 10.1007/s11105-012-0516-5.

3. Noor Ul Haq, Muhammad Ammar, Dawn S. Luthe, Scott A. Heckathorn, Samina

N Shakeel. Molecular characterization of Chenopodium album chloroplast small

heat shock protein and its expressions in response to different abiotic stresses.

(Submitted to Plant Cell Reports).

Chapter 01

Introduction

Chapter 01 Introduction


Abiotic Stresses 3

1 Introduction

Several organisms respond to high temperature and other unfavorable growth conditions

by production of heat shock proteins (HSPs) (Parsell and Lindquist, 1993), a universal

and highly conserved phenomenon for cell survival differentially (Lindquist, 1986).

Many biotic/abiotic stresses affect the plant growth and production (Balestrasse et al.,

2010). Environmental stresses like drought, salt and high temperature have great effects

on plant physiology and crop production (Hong et al., 2009; Ahmad et al., 2010; Zhang

H et al., 2010; Zhang M et al., 2010). Although plant response to the stress varies with

the intensity, duration and combinations of different environmental stresses (Lefebvre et

al., 2009). All important growth mechanisms like development, biochemistry and

physiology can be affected by stresses (Jaleel et al., 2008; Tuteja et al., 2009). Many

genes can be turned on or off as a result of environmental stress which can lead to

increase production of many metabolites and proteins inside the cells to protect labile

components against the stress (Tuteja et al., 2009).

1.1 Types of stresses

Biotic and abiotic stresses are the two main factors affecting the plant growth and

production. Living organisms like fungi, bacteria and virus can create stress conditions

for the plants (Dangl and Jones, 2001) and ultimately lead to the activation of several

defense systems of plants (Collinge and Boller, 2001). Mostly changes in plant

physiology and biochemistry take place in response to abiotic stresses (Agarwal et al.,

2006). Non-living factors known as abiotic stress, have negative effects on plant growth

(Lefebvre et al., 2009). Any fluctuations in environmental conditions can lead the plants

to adopt several surveillance mechanisms against stressed conditions (Kvaalen and

Johnsen, 2008). We will mainly focus on some abiotic stresses to achieve the objectives

of this study.

1.2 Different types of abiotic stresses and their effects

1.2.1 Heat stress

Among abiotic stresses, high temperature stress is main factor affecting plants

productivity (Boyer, 1982). Nucleic acid and proteins structures, membrane fluidity,



Abiotic Stresses 4

osmolytes and metabolites concentrations can severely be changed by temperature

(Chinnusamy et al., 2007). Similarly the chloroplast photochemical activity is also

reported to be affected by heat stress (Ilik et al., 2003). Similarly the most sensitive part

of thylokoid membrane is photosystem II (PSII) (Lichtenthaler, 1998) and high

temperature can effect the light harvesting complexes and photosystem II reaction centre

(Keren et al., 1997).

Plants have to tolerate or adapt the variable environmental conditions and usually it is

very complex mechanism (Zinn et al., 2010). Cellular processes have to reprogram in

response to low and high temperature due to which many changes in transcription can

occur in many parts of the plants like leaves, pollens, roots and seedlings etc. (Kreps et

al., 2002; Frank et al., 2009). Duration, intensity and changed dose of temperature have

great effect upon plants (Thakur et al., 2010). Reactive oxygen species (ROS) production

can be increased by high and low temperature while cell death and oxidative damage was

also reported as a result of high temperature stress (Apel and Hirt, 2004). Previous studies

have shown the photosynthesis inhibition by high temperature (Zinn et al., 2010).

Similarly the oxygen evolving complex (OEC) of photosystem II was also shown to be

damaged (Strasser, 1997), due to disorganized thylakoid membrane (Gounaris et al.,

1984) and reduced activity of rubisco (Law and Crafts-Brandner, 1999).

Heat shock proteins (HSPs) production is a way to adapt under heat stressed conditions in

plants. HSPs are conserved in all organisms from prokaryotes to eukaryotes and are

important for protection of the cell (Lindquist, 1986). Activation of defense mechanisms

in response to heat shock is essential for survival of the cells at high temperature and

these mechanisms are not specific to only high temperature response but are also

important in the case of other types of stresses (Walther and Stein, 2009).

Macromolecules synthesis and processing also can be inhibited by heat stress, which can

block the cell cycle progression and proteins denaturation leading to increased lysosomal

and proteasomal degradation (Kuhl and Rensing, 2000). Heat shock causes up- or down

regulation of many genes (Sonna et al., 2002). HSPs are the major group of proteins

expressing in response to stress conditions in living organisms which function as

chaperones in prevention of denatured proteins, proteins mis-aggregation under stressed



Abiotic Stresses 5

conditions and changed cellular redox states (Parsell and Lindquist, 1993; Otterbein and

Choi, 2000).

1.2.2 Cold stress

Low temperature suppresses the plants growth without ceasing it’s cellular functions, and

can cause abnormalities at different levels of cell organization (Balestrasse et al., 2010).

Temperature is the main controlling stimulus for developmental changes from vegetative

stages till reproductive growth (Winfield et al., 2010). Low temperature stress may

damage the cell membranes (Xing and Rajashekar, 2001), can cause reduced cellular

respiration and increased ROS levels (Lee and Lur, 1997). Similarly the effects of high

light and low temperature stress were also observed on electron transport in thylakoid

membrane, reduced CO2 uptake by closure of stomata and reduced activity of rubisco

(Allen and Ort, 2001).

Low temperature stress can inhibit photosystem I and more pronounced effect was seen

in low irradiance (Li et al., 2004). Similarly photoinhibition of photosystem I has also

been observed in cold tolerant plants like winter rye (Ivanov et al., 1998), barley (Teicher

et al., 2000) especially under low irradiation.

Gene expression of several genes and proteins are also affected by low temperature stress

(Thomashow, 1999). Up and down-regulation of genes occur in plants by cold stress but

expression of many defensive genes has been shown up-regulated (Winfield et al., 2010).

Recently ~302 genes have been reported to be up-regulated by cold stress, while 88 genes

(27%) were down regulated (Fowler and Thomashow, 2002). The difference in

expression was also observed in different tissues of the plants including crown and leaves

(Ganeshan et al., 2008).

1.2.3 Metal stress

Heavy metals are very toxic for growth and development of plants (Bekesiova et al.,

2008) because metal ions in high concentration have negative effect on growth and

usually damage the roots, ultimately leads to develop several defensive mechanisms to

maintain the normal growth (Pavlikova et al., 2008). Heavy metals change membrane

permeability and potential by interactions with membrane components and alter their



Abiotic Stresses 6

enzymatic activity as well as inactivate mostly the regulatory and catalytic proteins

through complex formation with nitrogen, oxygen and sulphur atoms (Bekesiova et al.,

2008). Heavy metals are taken up by plants like essential nutrients and are transferred to

the aerial parts of plants through the same transport pathway like essential elements (Ma

et al., 2006; Ma et al., 2008).

Tolerance against heavy metal toxicity differs from species to species (Metwally et al.,

2005). Some plants do not show any phytotoxicity symptoms by accumulation of heavy

metals (Hart et al., 2006). However the plant growth is restricted badly and even the cell

death is caused by uptake of the heavy metals because of severe interruption of many

biochemical and physiological pathways (Ahsan et al., 2009). Essential ions can be

displaced by primary toxic mechanism of heavy metals like, Mg ions can be replaced by

Ni which leads to altered activity of ribulose-1,5-biphosphate carboxylated oxygenase

(Van Assche and Clijsters, 1986). Similarly variations in chlorophyll activity has also

been reported in one study (Kupper et al., 1996). Proteins can be destabilized by break up

of disulfide bridges due to heavy metals (Ahsan et al., 2009). While some heavy metals

interrupt the protein functions by their interactions with carboxyl and hydroxyl groups

(Sahr et al., 2005).

Heavy metal exposure can evoke different defense mechanisms of the plants. Among

them, one is the synthesis of metallothioneins (MTs) and cystein-rich polypeptides

phytochelatins (PCs) (Bekesiova et al., 2008). Besides this, γ-tocopherol methyl

transferase (γ-TMT) gene coding α-tocopherol has increased tolerance against heavy

metal in transgenic Brassica juncea (Yusuf et al., 2010). While transgenic tobacco plants

having OsCBSX4 gene of Oriza sativa were found more tolerant to heavy metal than

control plants (Singh et al., 2012). Recently HSPs expression has been shown e.g.

elevated chaperonin 60 family and HSP70 gene expression under heavy metal stress

including Ni (Ingle et al., 2005) and Cd (Kieffer et al., 2008).

1.2.4 Salt stress

Halophytes and glycophytes are two main groups of plants depending upon their response

to salinity stress; Halophytes are plants grown natively in saline environment while

glycophytes are plants having no tolerance to salt stress like halophytes (Kader and



Abiotic Stresses 7

Lindberg, 2010). Halophytes cover 1% of total world flora (Flowers and Colmer, 2008).

Crop growth and yield is negatively affected by salt stress in many ways e.g. NaCl salt

causes osmotic stress as well as ionic toxicity to plants (Kader and Lindberg, 2010).

Metabolic activities in cytosol may be affected by Na+ and Cl

- ions on entering into the

cell and affect the cell membrane (Hasegawa et al., 2000; Zhu, 2001). Similarly

decreased uptake of toxic ions like Na+ and Cl

- into cytosol and deactivation of these ions

have also been reported in vacuoles and apoplasts (Fukuda et al., 2004; Kader and

Lindberg, 2005). High salt concentration affects primarily photosynthesis and growth of

the plants (Munns et al., 2006) due to less availability of CO2 (Flexas et al., 2007) or

altered photosynthetic metabolism (Lawlor and Cornic, 2002).

1.2.5 Drought stress

Drought stress limits the crop production and quality. Changes in global climate and

unreliability of weather in future may increase the drought conditions in the world

(Bressan et al., 2009; Nadeau, 2009; Xiao et al., 2009). Plant production may be affected

by less water (Penfield, 2008; Weckwerth, 2008; Kim et al., 2009). Drought is

complicated process in which several cell micro and macro molecules are involved e.g.

DNA, RNA, carbohydrates, hormones, proteins, lipids and mineral elements etc. (Chae et

al., 2009). The situation becomes more critical when drought is related with high

temperature, low temperature or salt stress. These kind of combinatorial effects adversely

affect the plant growth, development and signal transduction (Halliwell, 2006; Ni et al.,

2009). Photosynthetic reactions need water and are greatly affected by environmental

stresses (Bray, 2004; Andjelkovic and Thompson, 2006). Metabolism in plants is also

affected by water deficiency because anabolism decreases with reduced synthase activity

and catabolism increases by increased hydrolytic enzymatic activity (Ni et al., 2009).

Low water contents can affect photosynthetic reactions in chloroplast due to less nutrients

uptake and ions transport (Boudsocq and Lauriere, 2005; Brooker, 2006).

1.3 Major effects of abiotic stresses

Plants are sessile organisms and face different environmental stress conditions during

their life cycle (Gill and Tuteja, 2010). Plant tolerance to stress varies among species and

varieties (Wentworth et al., 2006). These various kinds of stresses can cause several



Abiotic Stresses 8

changes in the plant physiology indicative of severity of stress and several types of gene

and protein expressions can help plants to coop with the given stress.

1.3.1 Effect of abiotic stresses on plant physiology

Plants can adopt several defensive mechanisms upon exposure to stress. Molecular

oxygen is transferred to reactive oxygen species (ROS) by high energy electron during

stress conditions (Mittler, 2002). Single oxygen, superoxide ions (O2-) and peroxides like

hydrogen peroxide (H2O2) are different types of reactive oxygen species and are usually

toxic to plants (Triantaphylides et al., 2008). ROS can damage about all cell

macromolecules including DNA (Tuteja and Sopory, 2008). In chloroplast, peroxisomes

and mitochondria, the concentration of reactive oxygen species have been reported

elevated due to stress conditions (Ahmad et al., 2010). ROS causes lipid peroxidation due

to free radicals and ultimately cell membrane becomes weak (McCord, 2000).

Peroxidation of unsaturated fatty acids increases the leakiness, decreases the fluidity and

damage to membrane proteins (Halliwell, 2006).

Reactive oxygen species affects DNA. Singlet oxygen attacks guanine, while H2O2 does

not react with DNA itself and OH- is most active in this reaction (Wiseman and Halliwell,

1996). ROS modify 8-Hydroxyguanine (Tuteja et al., 2009) and MDA makes conjugation

with guanine and cause damage to DNA (Jeong et al., 2005). Gene expression is

regulated by methylation of cytosines, which can be changed by oxidative modification

of DNA (Halliwell, 2006). Similarly other macromolecules including proteins can also be

affected by ROS and ultimately affect the signaling pathways and expression of many

genes (Thannickal and Fanburg, 2000). Different non-enzymatic and enzymatic

antioxidants like catalase (CAT), glutathione reductase (GR), Superoxide dismutase

(SOD), ascorbate peroxidase (APX) and ascorbic acid (AsA) are also affected by reactive

oxygen species (Sharma and Dietz, 2009). ROS are harmful to photosynthesis and can

cause irreversible damage of photosynthetic components (Foyer and Shigeoka, 2011).

Different kinds of stresses can cause several changes in the plant physiological

parameters and the level or that changes compared to normal growth conditions can be

used for prediction of severity of stress. There are several examples where researchers

used the above parameters to test the effects of given stress or combinations of stresses.



Abiotic Stresses 9

e.g. effect of heat stress on Eupatorium adenophorum (Lu et al., 2008), Cd on

Ceratophyllum demersum (Mishra et al., 2008), UV on Azolla pinnata and Azolla

filiculoides (Masood et al., 2008), cold stress on rice (Bonnecarrere et al., 2011) and

drought stress on Fraxinus ornus (Fini et al., 2012) etc.

1.3.2 Effect on gene expression

Change in gene expression of several defense related plant genes occurs under stress

conditions is basic defense mechanism. Similarly heat shock proteins expression is

necessary for adaptations against high temperature stress (Feder and Hofmann, 1999). In

the case of heat stress, HSPs function as chaperones and protect sensitive cell organelles

or mechanisms from dangerous effects of heat stress (Lindquist, 1986). Many other

proteins besides HSPs are also produced and regulated differentially in response to high

temperature stress (Wahid et al., 2007). The synthesis of heat shock proteins (HSPs) and

acquisition of stress tolerance in plants can be environmentally induced by heat stress and

several other stresses including drought, heavy metal, cold and oxidative stresses

(Anderson et al., 1994; Schoffl et al., 1997; Heckathorn et al., 1998; Heckathorn et al.,

2002; Heckathorn et al., 2004; Fu et al., 2005; Gulli et al., 2005; Shakeel et al., 2011).

1.4 Heat shock proteins (HSPs)

Heat shock response was first characterized in Drosophila salivary glands (Ritossa,

1962). Heat shock proteins were identified in the result of transcription and translation in

chromosomal puffs having active sites (Ashburner and Bonner, 1979). Most of heat

shock proteins have chaperone activity and have ability of proteins protection from

damage (Taylor and Benjamin, 2005). All organisms from bacteria to humans show

response to changed environmental conditions by production of heat shock proteins

(Lindquist, 1986).

1.4.1 Role of HSPs

One of the most thoroughly characterized responses is the induction of heat shock

proteins when cells or organisms are exposed to supra-optimal temperatures and other

environmental stresses. HSP genes show response to different abiotic stress factors like

drought, high temperature, low temperature and salt stress (Cho and Hong, 2004). Heat



Abiotic Stresses 10

shock proteins with low expression in normal growth conditions have different functions

like chaperone function, proteins folding, proteins aggregation prevention and targeting

of improperly folded proteins to specific pathway or for degradation (Kalmar and

Greensmith, 2009). Heat shock proteins show tissue and organelle specific expression.

This quick response in terms of HSP expression differs in sensitive tissue/organs to

protects cell metabolic apparatus for survival and adaptation under stress conditions

(Huang and Xu, 2008).

1.4.2 Types of HSPs

On the basis of molecular weight, heat shock proteins are classified in two classes i.e.

high molecular weight heat shock proteins (HSP40, HSP60, HSP70, HSP90 and HSP100)

and low molecular weight heat shock proteins (sHSPs) range from 15-30KDa (Tower,

2009).

1.4.2.1 High molecular weight heat shock proteins

High molecular weight heat shock proteins are of different classes based on molecular

weight i.e. HSP60, HSP70, HSP90 and HSP100 as explained below.

1.4.2.1.1 HSP100

HSP100 is a protein family, present in both eukaryotes and prokaryotes (Agarwal et al.,

2001). HSP100 possess two subunits described primarily in bacteria, 1) ATP-dependent

unfoldase, a large-subunit (ClpA) and 2) protease, a small-subunit ClpP (Gottesman et

al., 1990). ClpP (proteolytic) subunit is associated with bacterial ClpA protein, while

chaperonion function is supposed to be performed by large subunit only in eukaryotes

(Agarwal et al., 2001). Generally nucleotide-binding domain 1 & 2 (NBD1 & NBD2),

middle domain, amino and carboxyl domains are five parts of HSP100 (Batra et al.,

2007).

HSP100 genes are also heat induced only, not by other abiotic stresses (Agarwal et al.,

2002), but previously few researchers also studied the expression of a member of Hsp100

family under salt, cold and abscisic acid (ABA) stresses besides heat stress (Pareek et al.,

1995). There is possibility of more than one gene or family member with differential

expression in each of the above case (Campbell et al., 2001). Similarly over-expression



Abiotic Stresses 11

of Hsp100 has also been reported due to high temperature in different plants like

Arabidopsis thaliana (Schirmer et al., 1994), rice (Pareek et al., 1995), wheat and

tobacco (Campbell et al., 2001), maize (Nieto-Sotelo et al., 1999) and soybean (Lee et

al., 1994). Plants HSP100 expression is also regulated differentially under different

developmental stages (Queitsch et al., 2000). That can be the one reason of high

concentration in HSP100 in mature seeds of several plant species (Singla et al., 1998).

The role of Hsp104 in repairing the heat denatured proteins was confirmed by induced

protein aggregation under heat stress in yeast (Parsell et al., 1994).

1.4.2.1.2 HSP90

HSP90 is present in both prokaryotes and eukaryotes (Wegele et al., 2004). Heat shock

proteins of 90KDa have two conserved regions (N- and C-terminal domains), charged

linker region present between N- and C-terminal regions (Pearl and Prodromou, 2000).

HSP90 is involved in activation of component proteins in signal transduction, folding,

assembling and proteins transporting (Garavaglia et al., 2009). HSP90 has been studied

in detail in Arabidopsis, seven different isoforms were identified based on structure; four

were cytosolic and three were shown to localize in chloroplast, mitochondria and

endoplasmic reticulum (Krishna and Gloor, 2001). One of four Cytosolic isoforms, were

expressed by heat while the others were expressed constitutively (Yabe et al., 1994).

1.4.2.1.3 HSP70

There are four groups of heat shock proteins of 70KDa in plants with highly conserved

C-terminal region (He et al., 2008). HSP70 is also named as heat shock cognates because

of their expression under normal conditions in plants (Sung et al., 2001). HSP70 plays

important role in many environmental conditions especially under high temperature stress

(Wu et al., 1988; Miersch and Grancharov, 2008). These proteins also function in

stabilizing the unstable proteins (Garavaglia et al., 2009), folding and proteins transport

to different cellular compartments (Fink, 1999).

There are four different groups located in four different subcellular compartments of cell

e.g. endoplasmic reticulum, plastids, mitochondria and cytosol (Nikolaidis and Nei,

2004). Two subtypes of cytosolic HSP70 have been shown differential expression in



Abiotic Stresses 12

normal and stressed environmental conditions i.e. heat inducible HSP70 expressed at low

level under normal growth conditions. While other forms changed their locations with

environmental conditions and some heat shock cognate HSP70 (HSC70) were

constitutively expressed under normal growth conditions (Mahroof et al., 2005).

1.4.2.1.4 HSP60

Heat shock proteins of 60KDa are found in eukaryotes and prokaryotes and perform

function in stressed and un-stressed cells (Craig et al., 1993) encoded by nuclear DNA

(Reading et al., 1989). In bacteria, HSP60 performs role in assembling of proteins to

form oligomeric complexes and their transportation through plasma membrane (Craig et

al., 1993). While in the case of eukaryotes, HSP60 is involved in organelle (mitochondria

and chloroplast) specific proteins folding (Craig et al., 1993).

1.4.2.2 Small heat shock proteins (sHSPs)

All plant small heat shock proteins (15-30KD) are nuclear encoded and based on their

cellular localization can be further divided into six classes (Gao et al., 2011). Two of

these classes are cytoplasmic and located in nucleus and remaining groups are

mitochondrial, chloroplast, endoplasmic reticulum (ER) and endomembrane localized

(Banzet et al., 1998; Dafny-Yelin et al., 2008). These all proteins are encoded by six

nuclear gene families (Waters et al., 1996). While recently, Heckathorn et al., (1999)

explained five classes of sHSPs and their localization very specifically i.e. class I and

class II are present in cytosol and three (class III, class IV and class V) are localized in

endoplasmic reticulum, mitochondria and plastids (e.g. chloroplast), respectively. Also in

literature class VI has been included in the above five classes of small heat shock proteins

which is located in endoplasmic reticulum (LaFayette et al., 1996). Small heat shock

proteins have three main parts i.e. C-terminal region, N-terminal region and α-crystallin

domain. Small HSPs are characterized by α-crystalline domain of 100 amino acids

sequence (Kappe et al., 2002) followed by N-terminal region with variable length at one

side and C-terminal region at another side (Nakamoto and Vigh, 2007). These N-terminal

and C-terminal extensions are highly variable regions of sHSPs (de Jong et al., 1998).

These three domains are conserved in all small heat shock proteins (Laksanalamai and

Robb, 2004) and sHSPs have different cellular substrates in stress conditions (e.g.



Abiotic Stresses 13

oxidative and high temperature stresses) to perform chaperonin functions (Nakamoto and

Vigh, 2007).

Small heat shock proteins are present mostly in the form of monomers and composed of a

conserved carboxyl-terminal heat shock domain of 100 amino acids residues and two

highly conserved domains i.e. consensus-I and consensus-II (Vierling, 1991). Monomer

of sHSPs is much smaller in size about 20KDa (Sundby et al., 2005). Homo-oligomeric

complexes of size 200-750kDa are formed with combinations of 9-24 subunits of small

heat shock proteins (Siddique et al., 2003). While in plants, 200-250kDa oligomeric

complexes can be formed by 12 subunits (Kirschner et al., 2000; van Montfort et al.,

2001). This sHSP oligomerization is essential to perform chaperonion functions to ensure

assembly, correct folding, transport of novel and removal of abnormal proteins

(Gkouvitsas et al., 2008).

Many researchers have reported sHSP expression in different plants like tomato (Frank et

al., 2009), cotton (Maqbool et al., 2010), Arabidopsis (Dafny-Yelin et al., 2008), Agave

(Lujan et al., 2009), sugarcane (Tiroli and Ramos, 2007), carrot (Malik et al., 1999),

tobacco (Hamilton Iii and Coleman, 2001) and maize (Cao et al., 2010) etc. Expression

of these sHSPs in different plants showed their importance in adaptations to the

environmental stresses (Gao et al., 2011). Small heat shock proteins are expressed under

heat stress conditions and accumulated upto >1% of leaf total proteins (Hsieh et al.,

1992). In eukaryotes other than plants have one to four genes for sHSPs while plants have

about thirty to sixty genes for sHSPs (Knight and Ackerly, 2001). Small heat shock

protein genes usually differentially expressed in different plant species based on their

related thermotolerance of particular genotypes (Park et al., 1997) and also within the

same species upon environmental conditions (Downs et al., 1998).

1.4.3 Chloroplast small heat shock proteins (Cp-sHSPs)

The CP-sHSPs are synthesized as a precursor in the cytoplasm and then imported to the

chloroplast (Vierling, 1991). Chloroplast specific small heat shock proteins (Cp-sHSPs)

were identified in chloroplasts few years back (Kloppstech et al., 1985; Restivo et al.,

1986; Vierling et al., 1986). These are sHSPs located in chloroplasts as the name shows

but contain a highly conserved region called methionine rich region or consensus-III at



Abiotic Stresses 14

N-terminal region with other regions characteristics of sHSPs (Chen and Vierling, 1991).

Oligomerization of chloroplast specific small heat shock proteins is affected by the

methionine (met) residue oxidation in heat stress conditions (Gustavsson et al., 1999).

Stable high molecular weight complexes of approximately 200KDa are formed by

chloroplast specific small heat shock proteins (Chen et al., 1994). Cp-sHSPs play

important role in photosystem protection under stress conditions.

1.4.3.1 Role of chloroplast small heat shock proteins

Cp-sHSPs protect photosynthesis of plants in the case of oxidative and high temperature

stress conditions by protecting photosystem II or other parts of thylakoids (Nakamoto et

al., 2000). Photosystem I is more stable under high temperature stress than photosystem

II (Heckathorn et al., 2002). Although photosynthesis is protected through more than one

mechanism like avoiding permanent proteins aggregation, chloroplast membrane

stabilization (Torok et al., 2001) but chloroplast specific small heat shock proteins also

play important role in this protection (Hamilton and Heckathorn, 2001).

Several chloroplast sHSP genes have been isolated and characterized from many plants

under multiple stresses and proposed to protect Photosystem II (PSII), the most stress-

labile component of the photosynthetic apparatus, during heat, high light, salt, and

oxidative stress (Heckathorn et al., 1998; Downs et al., 1999a; Downs et al., 1999b;

Heckathorn et al., 1999; Hamilton and Heckathorn, 2001; Heckathorn et al., 2002). These

studies suggest that sHSPs play an important role in plant adaptations to environmental

stress. However, in plants and other organisms, specific cellular targets or mechanisms

protected by sHSPs remained unidentified (Arrigo and Landry, 1994; Downs and

Heckathorn, 1998).

Recently, it has been demonstrated that Cp-sHSPs protect photosynthetic electron

transport during heat stress in vitro (Heckathorn et al., 1998). Protection of electron

transport during heat stress was specific to Photosystem II (Heckathorn et al., 1998;

Downs et al., 1999a; Downs et al., 1999b; Heckathorn et al., 1999; Hamilton and

Heckathorn, 2001; Heckathorn et al., 2002). During heat stress, the Cp-sHSPs appear to

associate with oxygen-evolving-complex (OEC) proteins of PSII (and to a lesser extent,

the PSII reaction centers protein, D1). As independently confirmed by some researchers



Abiotic Stresses 15

(Miyao-Tokutomi et al., 1998; Nakamoto et al., 2000), these Cp-sHsps protect PSII from

heat-related inactivation primarily by protecting the OEC proteins and oxygen evolution,

but they do not repair previously inactivated PSII.

1.5 HSP gene expression

Transcription of any gene is regulated qualitatively and quantitatively by promoters

(Kang et al., 2003). Usually three categories of promoters can regulate any gene

expression. i.e. constitutive, spatiotemporal and inducible promoters. Constitutive

promoters direct the gene expression virtually in every tissue and usually independent of

developmental and environmental factors. Spatiotemporal promoters direct the

expression of target gene in specific tissue. While inducible promoters are not dependent

on endogenous factors but depend upon environmental conditions and their external

stimulus (Potenza et al., 2004). The promoter regions are usually thought to be the key

cis-regulatory regions to control the transcription of said gene. Almost all promoters have

same core sequence with initiator, TATA-box and transcription factor binding specific

cis-acting motifs specific to target genes (Peremarti et al., 2010).

Undesirable phenotypes are produced when plants have high constitutive expression of

target gene or transcription factor in transgenic plants like decrease in growth and seed

production was observed in transgenic Arabidopsis with 35S:DREB1A, used to enhance

the stress tolerance (Kasuga et al., 1999). Delayed growth, irregular development and

decreased seed production have been observed due to constitutive expression of

35S:CBF1 in transgenic tomato (Hsieh et al., 2002), 35S:Adc in transgenic rice (Capell et

al., 1998) and 35S:TPS1 in the case of transgenic tobacco (Romero et al., 1997). So

transgenic plants can also be generated to accumulate the transgene products only with

stress inducible promoters which can cause no morphological abnormalities (Yi et al.,

2010). Different stress inducible promoters have also been identified and characterized in

different plants like cor6.6 and kin1 in the case of Arabidopsis (Wang et al., 1995), Hva1

in the case of barley (Xiao and Xue, 2001) and in the case of rice, Rab16A promoter has

been isolated (Rai et al., 2009).

Quantitative variations in Cp-sHSPs are positively correlated with photosynthetic

protection and whole-plant thermotolerance among cultivars, ecotypes, and in distantly



Abiotic Stresses 16

related species (Heckathorn et al., 1996; Park et al., 1996; Downs et al., 1998;

Heckathorn et al., 1998). In similar study, a heat sensitive bentgrass variant was failed to

accumulate Cp-sHSP isoforms that were present in the heat tolerant variant (Wang and

Luthe, 2003). However the functional consequence of natural variations in Cp-sHSPs is

still unknown. These variations can be related to the frequency of temperature stress

experienced by a species during evolution and eventually become part of physiological

adaptations that are characteristic of thermotolerant plant species (Heckathorn et al.,

1996; Downs et al., 1998; Shakeel et al., 2011).

1.6 HSP promoters

Relatively less is known about the regulation of organelle-localized sHSPs under a

particular stress or combinations of stresses. The expression of these genes is known to

be regulated mainly at the transcriptional level. In the case of sHSPs, several promoters

of sHSP genes have been studied in plants, e.g. AtHSP18.2 promoter in Arabidopsis

thaliana (Takahashi et al., 1992) and hairy roots in Nicotiana tabacum (Lee et al., 2007).

While sHSP induction has been shown by the use of soybean promoter (GmHSP17.3B)

for gene expression studies in Physcomitrella patens (Saidi et al., 2007). Similarly heat

stress has induced the expression of sHSP by Oshsp16.9A promoter in rice (Guan et al.,

2004). Small HSPs are also known to express in low temperature, osmotic, salinity,

oxidative, chemical stresses and wounding as well as in different developmental stages

(Sun et al., 2002).

Plants response to environmental and developmental changes by changed expression of

several genes. There is a complex network of heat shock transcription factor (HSF) and

HSP genes expressed by interactions of heat shock elements (HSEs) and HSFs (Guan et

al., 2010). Heat shock factors which are more than 20 in numbers (Nover et al., 2001),

regulate the heat shock response both in vivo and in vitro (Guo et al., 2008). Under heat

stress, HSFs bind to HSEs present in the promoter regions of HSPs to control the gene

expression under stress conditions to increase thermotolerance (Lee et al., 1995;

Wunderlich et al., 2003).

Eukaryotic HSEs have conserved HSF binding domains with alternate units of 5'-

nGAAn-3' and to ensure the binding, each HSE should have at least three inverted repeats



Abiotic Stresses 17

of units like 5'-nGAAnnTTCnnGAAn-3' called as perfect heat shock elements (Scharf et

al., 2001). While in some cases imperfect HSEs are also reported in plants, e.g. in

Arabidopsis thaliana (Busch et al., 2005) and in yeast, some heat stress inducible genes

contain the HSE like sequences little different from nGAAn (Sakurai and Takemori,

2007). So it may be assumed that cis-acting promoter sequences unlike the classic heat

shock elements might be able to play role in induced heat shock response. The initial unit

may be either TTC or GAA but TTC is biologically more active in yeast cells and is

capable to bind with two HSF trimmers instead of one (Bonner et al., 1994). An efficient

HSE can function in the presence of a 5-bp addition between the two repeating units

(Amin et al., 1988). Binding of heat shock factors to DNA is very cooperative and in vivo

deviations from nGAAn sequence can be tolerated because multiple heat shock elements

promote the interaction among multiple heat shock factor trimers (Topol et al., 1985;

Xiao et al., 1991; Bonner et al., 1994). These sequence variations of the heat shock

elements of a specific heat shock gene may change their affinity to heat shock factors, in

the result transcriptional activation may be varied which ultimately changes the response

of heat shock genes (Santoro et al., 1998).

HSPs can have variations in the heat shock elements which regulate the HSP expression

differently. These elements have little difference in the arrangement and location of the

basic units (nGAAn) of heat shock elements. For example, HSE1 (tGAAgcTTCtgGAAt),

HSE2 (agTCtcGAAacGAAaaGAActTTCtgGAAt), HSE3 (gGAAgaaTCcaGAAt) have

been found in the promoter region of AtHsp90-1 gene (Haralampidis et al., 2002).

Besides these elements, some other regulatory motifs have also been reported having role

in HSP regulation. e.g. gap-type 1 (nTTCnnGAAn[5bp]nGAAn), gap-type 2

(nTTCn[1bp]nGAAn[5bp]nGAAn) and gap-type 3 (nTTCn[2bp]nGAAn[5bp]nGAAn).

Also some TTC-rich type regulatory elements having 2-4 units of nTTCn separated by 0-

8bp, have been reported to bind with HsfA1a of Arabidopsis e.g. TTC-rich 3

(nTTCnnTTCn[8bp]nTTCn[1bp]nTTCn) and 1 (nTTCn[1bp]nTTCn[6bp]nTTCn). But

there are some TTC-rich regions having no binding capability with HsfA1a e.g. TTC-rich

4 (nTTCn[3bp]nTTCn) and 2 (nTTCn[5bp]nTTCn[4bp]nTTCn) (Guo et al., 2008).



Abiotic Stresses 18

Similarly there are many other cis-regulatory motifs present in the promoter regions of

HSPs for regulation of HSPs under different stress conditions. e.g. metal response

elements (MRE), stress response elements (STRE), and CAAT boxes C/EBP (Amin et

al., 1988; Xiao and Lis, 1988; Schoffl et al., 1998). MRE has also been found in the

promoter region of metalothionein genes of plants and animals which are activated by

heavy metal stress (Karin et al., 1987; Culotta and Hamer, 1989; Whitelaw et al., 1997).

Similarly, STRE (AGGGG) is another stress related element and is activated by many

abiotic stresses in yeast (Martinez-Pastor et al., 1996).

1.7 Cp-sHSP promoters

Many researchers have studied the effect of environmental stresses on expression of

chloroplast specific small heat shock proteins (Cp-sHSPs) in different plants like in the

case of Lycopersicon esculentum (Preczewski et al., 2000) and Chenopodium album

(Downs et al., 1999b) etc. But relatively less is known about the regulation of organelle-

localized sHSPs especially Cp-sHSPs under multiple stresses. The expression of these

genes is known to be regulated mainly at the transcriptional level. Several conserved

motifs have been identified to have quantitative effects on the expression of heat shock

gene like AtHsp90 (Haralampidis et al., 2002), which shows the combinatorial interaction

of cis-elements to cope with multiple stresses. However the role of cis-elements in the

regulation of single or multiple pathways other than heat shock response, has not been

identified as of yet.

Here we will compare the promoter regions of C. album (two different US ecotypes)

sHSPs and will analyze for the presence of cis-regulatory elements in this study. We will

also isolate and characterize novel Cp-sHSP genes from C. album (Pak variety) treated

with multiple stresses. These comparisons will provide us informations about the

regulation and expression of Cp-sHSPs under different types of abiotic stresses. To our

knowledge, this work would be the first attempt of such investigation of the organelle

specific small heat shock proteins expressed under multiple stresses in plants.

Chenopodium album (C. album) has been selected as a plant model in our study for gene

expression under abiotic stresses. It belongs to a large botanical genus with the same

name Chenopodium and family Chenopodiaceae. Chenopodium album is a C3 plant



Abiotic Stresses 19

located in plain areas having simple pointed leaves with whitish appearance at lower side

of leaves. As abiotic stress affects photosynthesis mainly Photosystem II and Cp-sHSPs

production and expression pattern should vary under stress conditions differentially. This

novel Cp-sHSP gene, protein and promoter sequences can be very helpful for plants by

transformation studies against abiotic stresses.



Abiotic Stresses 20

1.8 Aims and Objectives

The principal objective of this study is to find out the presence of correlation among the

regulation of Cp-sHSP gene/genes under multiple environmental stresses in plants. We

hypothesized that the same Cp-sHSP gene is regulated differently under multiple stress

pathways. So the presence of same Cp-sHSP gene or family under heat, metal, cold,

drought or salt stress differently will prove the evidences of existence of differential

regulation. Following are the stepwise objectives of this study.

To analyze and characterize already known C. album chloroplast small heat shock

protein (Cp-sHSP) promoters for the presence of putative cis-regulating elements.

To study the effect of different environmental stresses including heat, heavy metal,

cold, drought and salt stresses on physiology of C. album (Pakistani ecotype).

To isolate & characterize novel Cp-sHSP family members from Pakistani C. album

ecotype, regulated by different environmental stresses to find out differential

regulation of these genes at transcriptional & post-translational levels.

We will present the experimental data and related interpretations of above mentioned

objectives in different chapters of this thesis. First we will analyze the parameters of

already known four Cp-sHSP genes of C. album (US ecotypes) for the presence of cis-

regulatory motifs and will be presented in Chapter # 2, entitled “Analysis of C. album

CasHSP promoters for the presence of putative cis-regulatory motifs”. Then C. album

(Pak ecotype) will be treated with heat, heavy metal, cold, drought and salt stresses

followed by initial analyses of physiological parameters to measure the sensitivity of

plants to stress and to check the Cp-sHSP expression at transcript and proteins levels.

This work will be explained in two chapters; data of individual heat and heavy metal

stress effects on C. album will be shown in Chapter # 3, entitled “Dual role for

Chenopodium album chloroplast small heat shock protein: photosystem II protection

from heat and metal stresses”. While Chapter # 4, entitled “Molecular characterization of

Chenopodium album chloroplast small heat shock protein and its expressions in response



Abiotic Stresses 21

to different abiotic stresses” will include the information of effect of cold, drought and

salt stress on C. album physiology and Cp-sHSPs expression levels.

Chapter 02

Analysis of C. album

Ca-sHSP promoters for

presence of putative cis-

regulatory elements

Chapter 02 Analysis of Ca-sHSP gene promoter for putative cis-regulatory motifs


Abiotic Stresses 22

Title:

Analysis of C. album Ca-sHSP promoters for presence of putative cis-regulatory

elements

Abstract

Fluctuations in environmental conditions can have adverse effects on plants growth and

production due to their sessile nature. Photosystem II is one of the most labile

components of photosynthesis affected by stress conditions. Chloroplast specific small

heat shock proteins (Cp-sHSPs) production has already been shown correlated with

thermotolerance of plants under heat stress. These genes can also be regulated by

interactions of one or more heat shock factors (HSF) and other cis-regulatory elements

present in the promoter regions of Cp-sHSP genes. Promoter architecture, cis-regulatory

elements, and their interactions with HSFs can play important role in differential

expression of these sHSPs. Here we analyzed and compared four newly isolated Cp-

sHSP promoters from different Chenopodium album family members (two US ecotypes)

by using different bioinformatics tools. Interestingly we found 1-4 heat shock elements

(HSEs) and evidences for more than one putative cis-regulated element, necessary for

regulation of Cp-sHSP gene under different abiotic stresses including heat stress. This

novel and unique promoter architecture of C. album Cp-sHSP has been proposed to play

some important role in regulation of Cp-sHSP expression under different types of abiotic

stresses. In this chapter we will analyze the above mentioned promoters by using

different bioinformatics tools, and will explore the evidences of differential regulation of

Cp-sHSPs under different types of stresses including heat, metal, cold, salt and drought

stress. This study will provide a platform and deep insight about Cp-sHSP promoters and

their potential use for production of stress tolerant plants through transformation or plant

breeding techniques to face the challenges of next few decades.

Publication Reference:

Samina Shakeel, Noor Ul Haq, Scott A. Heckathorn, E. William Hamilton, Dawn S.

Luthe (2011). Ecotypic variation in chloroplast small heat-shock proteins and related

thermotolerance in Chenopodium album. Plant Physiology and Biochemistry 49: 898-

908.



Abiotic Stresses 23

2.1 Introduction

Plants develop special mechanisms for survival in changed environmental conditions like

heat stress (Chauhan et al., 2011). Exposure to high temperatures can cause the cell death

or irreversible damage to the plants and sub-lethal high temperatures usually initiate heat

shock response (Burke et al., 2000). Heat shock proteins act as molecular chaperons and

are expressed under stressed conditions (Schoffl et al., 1998). There are two major types

of HSPs, High molecular weight heat shock proteins (60-100KDa) and low molecular

weight (15-30KDa) or small heat shock proteins (Lindquist and Craig, 1988). Many

researchers have studied the production of sHSPs in response to high temperature stress

in different plants (Heckathorn et al., 1998; Heckathorn et al., 2002; Wang and Luthe,

2003; Guo et al., 2007; Shakeel et al., 2011).

Small HSPs are produced predominantly in response to heat stress and are correlated with

plants thermotolerance (Vierling, 1991; Sanmiya et al., 2004; Guo et al., 2007; Shakeel et

al., 2011). Besides heat stress, sHSPs play important role in plant protection from other

types of stresses, e.g., increased expression of sHSPs in γ-radiation has been observed in

tomato (Ferullo et al., 1994), induction of mitochondrial sHSPs in suspension culture of

tomato due to oxidative stress (Banzet et al., 1998), increased production of cytosolic

sHSP in the leaves of parsley (Eckey-Kaltenbach et al., 1997) and increased endoplasmic

localized sHSPs expression in potato tubers due to low temperature stress (van Berkel et

al., 1994). This shows different roles of plant sHSPs in different biotic and abiotic stress.

The HSP expression patterns vary according to the type of stress, its duration and

mechanism of gene regulation in particular plant species. Expression studies have shown

the constitutive expression and heat induced expression of HSP90 in the case of

Arabidopsis while AtHsp90 gene expression has been induced by arsenite or cadmium

treatments (Takahashi et al., 1992; Milioni and Hatzopoulos, 1997). Similarly some

members of this family has also been shown having differential expression under

different developmental stages like during pollen grain development (Marrs et al., 1993;

Haralampidis et al., 2002), in flowers (Takahashi et al., 1992; Krishna et al., 1995), in

shoot and root meristematic apices (Koning et al., 1992), seed germination (Reddy et al.,

1998) and during embryogenesis (Marrs et al., 1993). Involvement of HSP90s was also



Abiotic Stresses 24

shown in different morpho-genetically, hormonally and developmentally regulated

processes (Dhaubhadel et al., 1999; Ludwig-Muller et al., 2000; Berardini et al., 2001;

Ma et al., 2002; Mussig et al., 2002). Their expression data showed that HSP90 was

differentially regulated and expressed in different developmental and environmental

processes. HSP90 machinery may have key role in buffering capability of genetic

variation (Queltsch et al., 2002). The same kind of buffering capabilities have been

studied in Drosophila too (Rutherford and Lindquist, 1998). Seven family members of

AtHsp90 gene have been reported in Arabidopsis, located to different organalles in the

cell (Milioni and Hatzopoulos, 1997; Krishna and Gloor, 2001). Chloroplast related

members of HSP90 gene family has also been shown to play a key role in the

development of plastids (Cao et al., 2003). Heat shock genes expression is supposed to be

regulated mainly at transcriptional level and cis-regulatory elements present within the

promoter region and these elements, can play important role in HSP gene expression

(Prasinos et al., 2005)

Small heat shock proteins are classified into five groups based on their localization and

function within the cell e.g. Classes I and II have function and localization in cytosol and

the other three classes are thought to localized in mitochondria, endoplasmic reticulum

and chloroplast (Vierling, 1991; Waters et al., 1996). Chloroplast small heat shock

proteins (Cp-sHSPs) are encoded in nucleus followed by translation in cytoplasm and

transportation into the chloroplast (Vierling, 1991; Wang and Luthe, 2003). Besides the

consensus-I and II regions, which are present in all sHSPs, another highly conserved

region specific to Cp-sHSPs is consensus-III region or methionine rich region (Wang and

Luthe, 2003; Shakeel et al., 2011). Heat stress affects the photosystems specially

photosystem II (Berry and Bjorkman, 1980). Cp-sHSPs play role in protection of

photosystem II under heat stress (Heckathorn et al., 1998; Heckathorn et al., 2002; Burua

et al., 2003; Wang and Luthe, 2003; Shakeel et al., 2011).

2.1.1 Promoter Region of Heat Shock Genes

The expression level of heat shock protein is of primary importance, as it has been shown

positively correlated with the plant thermotolerance (Heckathorn et al., 1998; Shakeel et

al., 2011). The promoter region is present at the upstream region of the first exon of HSP



Abiotic Stresses 25

gene. The upstream region of genes contains many conserved sequences and patterns. It

has the core promoter region with TATA box and other conserved cis-elements. The

sequence of this region is very important as many transcription factors can bind to this

region to regulate differential expression of Cp-sHSPs.

Heat shock factors (HSFs) which are more than 20 in numbers (Nover et al., 2001),

regulate the heat shock response both in vivo and in vitro (Guo et al., 2008). In the case

of heat stress, HSFs bind to heat shock elements (HSEs) present in the promoter regions

of HSP genes to control sHSP expression under stress conditions to enhance the

thermotolerance (Lee et al., 1995; Zhang et al., 2001; Wunderlich et al., 2003; Zhang et

al., 2003). Eukaryotic HSEs have conserved HSF binding motifs with alternate units of

5'-nGAAn-3'. To ensure the binding, each HSE should have at least three inverted repeats

like 5'-nGAAnnTTCnnGAAn-3' called as perfect heat shock elements (Scharf et al.,

2001). While in some cases imperfect HSEs are also reported in plants e.g., in

Arabidopsis (Busch et al., 2005) and yeast etc. Some other heat inducible genes also

contain the HSEs like sequences (Sakurai and Takemori, 2007). So it may be concluded

that cis-acting promoter sequences unlike the classic heat shock elements, might be able

to play similar roles in induced heat shock responses. The initial pentamer may be either

TTC or GAA but TTC is biologically more active in yeast cells and is capable to bind

with two HSF trimmers instead of one (Bonner et al., 1994). An efficient HSE can

function in the presence of a 5-bp addition between the two repeating units (Amin et al.,

1988). Binding of heat shock factors to DNA is very cooperative and in vivo deviations

from nGAAn sequence can also be tolerated because multiple heat shock elements

promote the interactions among multiple HSF trimers (Topol et al., 1985; Xiao et al.,

1991; Bonner et al., 1994). These sequence variations of the HSEs of a specific heat

shock gene may change their affinity to different heat shock factors leading to differential

transcriptional activation which ultimately changes further in response to heat stress

(Santoro et al., 1998).

Besides the HSE architecture, the number of HSEs is also important for HSP expression

(Shakeel et al., 2011). Because more than one HSFs are reported with genetic and

functional redundancy in the same organism (Nover et al., 2001). HsfA1a of Arabidopsis



Abiotic Stresses 26

has ability to bind with stress responsive elements and TT-rich sequence besides the G-

and P-type HSEs (Guo et al., 2008). Rice Oshsp17.3 gene has 9-bp AZC (L-azetidine-2-

carboxylic acid) responsive element, which functions as an alternative HSF binding site

(Guan et al., 2010). So it is thought that the heat shock proteins are regulated by a

network of HSFs. Recently specific interactions of the imperfect HSEs and HSFs has also

been shown important for the expression of small heat shock protein sHSP genes in

Arabidopsis and sunflower (Carranco et al., 1999; Almoguera et al., 2002; Díaz-Martín et

al., 2005; Nishiwaza et al., 2006; Kotak et al., 2007).

Besides these cis-regulatory elements, many other elements like HSE1

(tGAAgcTTCtgGAAt), HSE2 (agTCtcGAAacGAAaaGAActTTCtgGAAt), HSE3

(gGAAgaaTCcaGAAt) and two STREs (AGGGG) were shown in the promoter region of

AtHsp90-1 gene (Haralampidis et al., 2002). Not only heat stress but many other types of

stresses like nutrient starvation, low pH and osmotic stress have also been shown

regulated by STREs (Siderius and Mager, 1997).

Heat stress signaling of a target gene is mediated by Arabidopsis thaliana HsfA1a (Lee et

al., 1995). In non-stress conditions HsfA1a is present in a latent, monomeric state while

HSE trimerizes and binds to HsfA1a in cis-acting heat shock elements (HSEs) on the

promoters of HSP genes. Which then induces HSP expression and enhances the

thermotolerance (Lee et al., 1995; Zhang et al., 2001; Wunderlich et al., 2003; Zhang et

al., 2003). In vitro binding assay (Hubel and Schoffl, 1994; Lee et al., 1995; Mishra et

al., 2002), demonstrated that HsfA1a and other plant HSF members bind to tandem

inverted repeats of the short consensus sequence nGAAn which is called HSE e.g

nTTCnnGAAnnTTCn, called perfect HSE. HsfA1a binds to other novel motifs besides

the perfect heat shock elements. Three subunits of the elements are arranged with the gap

of one, two and five nucleotides to compose three gap-type motifs. For example in the

case of Arabidopsis, gap-type 1 is composed by consecutive first two units followed by

third unit separated with 5bp like (nTTCnnGAAn[5bp]nGAAn), gap-type 2 has first two

units separated by 1bp and third units located after 5bp space like

(nTTCn[1bp]nGAAn[5bp]nGAAn) and two nucleotide separation between the first two

units, composes the gap-type 3 element (nTTCn[2bp]nGAAn[5bp]nGAAn) (Guo et al.,



Abiotic Stresses 27

2008). Similarly some TTC-rich type motifs (2-4 direct nTTCn repeats) were also found

in Arabidopsis, separated by 0-8bp. Binding analyses showed the interaction of HsfA1a

with TTC-rich type-3 (nTTCnnTTCn[8bp]nTTCn[1bp]nTTCn) and type-1

(nTTCn[1bp]nTTCn[6bp]nTTCn), while HsfA1a was not observed to bind with, TTC-

rich type-4 (nTTCn[3bp]nTTCn) and type-2 (nTTCn[5bp]nTTCn[4bp]nTTCn) (Guo et

al., 2008). These binding analyses showed that the number of the units and gap between

two units have vital role in recognition.

Similarly the presence other cis-regulatory motifs in the promoter regions of HSPs can

ensures the high grade tight regulation of HSP gene in a given stress like, metal response

elements (MRE), stress response elements (STRE), CAAT boxes C/EBP and heat shock

elements (HSE) (Amin et al., 1988; Xiao and Lis, 1988; Schoffl et al., 1998). Role of the

HSEs and their interaction with the specific factors during development and heat stress

has also been studied (Yabe et al., 1994; Marrs and Sinibaldi, 1997). Presence of several

other elements like STRE and CCAAT-box have been shown linked to differential

expression of different classes of heat shock genes (Rieping and Schoffl, 1992; Chinn and

Comai, 1996; Haralampidis et al., 2002). C/EBP transcription factors binding site i.e.

perfect CCAAT sequence, plays role to increase the activation of the promoter and co-

operates the heat shock elements (Williams and Morimoto, 1990; Rieping and Schoffl,

1992). Heavy metal induced promoters have been shown to contain MREs in the case of

metalothionein genes of plants and animals (Karin et al., 1987; Culotta and Hamer, 1989;

Whitelaw et al., 1997).

Table 2.1. Types and sequences of the core motifs of Arabidopsis thaliana.



Abiotic Stresses 28

Msn2p/Msn4p is a transcriptional activator and binds to STRE (AGGGG) in response to

many stresses in yeast (Martinez-Pastor et al., 1996) while in the case of Arabidopsis,

two STRE differ from each other based on flanking sequences, have slow migration of

HsfA1a-DNA complexes (Guo et al., 2008). These regulatory elements control the

expression of the genes under different environmental conditions, development and tissue

specific expression (Haralampidis et al., 2002).

Although all of these previous studies helped us to understand of the role of HSPs and

their regulation but still not much is known about the regulation and cis-regulatory

elements of Cp-sHSP promoters. In this chapter, we will first compare different promoter

sequences of previously known plant Cp-sHSPs for the presence of HSEs and other cis-

regulatory motifs. We will also use recently isolated the novel Cp-sHSP promoters of two

US ecotypes of Chenopodium album for analysis of putative cis-regulatory elements with

the help of a homemade algorithm “ProHSE” (Unpublished data) especially designed for

this purpose by Shumaila (a graduate student). Then the presence of conserved putative

motifs will be related to the novel Cp-sHSP gene isolation and characterization based on

expression studies under multiple stresses in following chapters.



Abiotic Stresses 29

2.2 Materials and Methods

2.2.1 Promoter sequences

Cp-sHSPs promoter sequences of Arabidopsis thaliana (Atg27670), Glycine max

(Gmhs17.5E, Gmhs17.6L, Gmhs17.5M), Chenopodium album (CaHsp26.26m,

CaHsp26.23n, CaHsp25.04m, CaHsp25.99n), Ferocactus wisilizenii (FwHsp23.99),

Agave americana (AaHsp26.8), Spartina alterniflora (SaHsp26.69), Agrostis stolinefera

(ApHsp26.7) and Oryza sativa (OsHsp26.6) were downloaded from NCBI database to

analyze for the presence of putative cis-regulatory elements, similarities and evolutionary

relationships.

2.2.2 Alignment of Cp-sHSPs promoters

All above mentioned promoter sequences were aligned using BioEdit program to check

similarities among these diverse plant promoters through alignments.

2.2.3 Tree construction

Consensus bootstraps parsimony tree was constructed to check the evolutionary

relationship among the plants based on Cp-sHSPs promoter sequences.

2.2.4 Analyses for putative regulatory motifs

Promoters sequences were analyzed by PlantCARE (Rombauts et al., 1999) and ProHSE

software which was specially designed by a graduate student in our lab for identifications

of cis-regulatory motifs detection. This software was used to detect different cis-

regulatory elements like heat shock elements, their types (perfect and imperfect), metal

response elements (MREs), stress response elements (STREs), C/EBP binding sites, gap-

type heat shock elements and TTC-rich type elements etc.

The algorithm to find the occurrence of the putative regulatory motifs in the Cp-sHSP

promoters is as follows,

Step0. Read the data file in an array S []. Compute the length L of the array S. Set the

loop parameter N=0 and input the motive in string M of length LM.

Step1. Set the string variable M1 =S [N: N+LM-1].



Abiotic Stresses 30

Setp2. Compare string M with string M1. If both are same then save the index N in

another array K.

Step3. Check if N is greater than or equal to L-LM then terminate the program and go to

step5.

Step4. Otherwise set N=N+1 and go to step 1.

Step5. Display the occurrences of the motive by finding the length of the array K and the

contents give positions of the motives in the data file.



Abiotic Stresses 31

2.3 Results and discussion

Promoter is the upstream region of gene with all controlling cis-regulating elements to

which the transcription factors bind. Promoters are of different types based on their

expression and architecture of cis-regulating elements. There are some highly conserved

sequences in promoters like initiator, TATA-box and plant or gene specific cis-acting

region where transcription factor binds. In short the promoters control whether the said

gene should express or not depends upon the transcription factors availability and the

conditions or environment (Peremarti et al., 2010).

To check the promoter regions of Cp-sHSP, the promoter sequences of Arabidopsis

thaliana (Atg27670), Glycine max (Gmhs17.5E, Gmhs17.6L, Gmhs17.5M),

Chenopodium album (CaHsp26.26m, CaHsp26.23n, CaHsp25.04m, CaHsp25.99n),

Ferocactus wisilizenii (FwHsp23.99), Agave americana (AaHsp26.8), Spartina

alterniflora (SaHsp26.69), Agrostis stolinefera (ApHsp26.7) and Oryza sativa

(OsHsp26.6) were downloaded and used for analysis. First multiple sequence alignment

was done by using the entire above mentioned promoter sequences of diverse group of

plants to find the similarity and the presence of conserved motifs and elements. Our data

showed no much similarity among these promoters, as we selected really diverse plant

species. We constructed phylogenetic tree to check the evolutionary relationship among

these promoters (Figure 2.1). A consensus bootstraps parsimony tree based on these

promoter sequences showed the diverse nature of promoter sequences as expected and

tree can be divided mainly in two groups of monocots and dicots. While the promoters of

C. album Cp-sHSP family members grouped together because of high similarity among

the isoforms of the same gene.

Based on our preliminary analysis of all of the above parameters, we observed some

unique characteristics in the promoter regions of C. album Cp-sHSPs. Almost similar

features were presumably studied in Arabidopsis AtHSP90 (Prasinos et al., 2005). So we

decided to explore further the unique promoters of C. album Cp-sHSP architecture.

Promoters of four Cp-sHSP genes of US ecotypes of C. album (two genes from heat

sensitive NY ecotype, CaHsp25.99n and CaHsp26.23n, while two from heat tolerant MS

ecotype, CaHsp26.04m and CaHsp26.26m) were further analyzed for the presence of



Abiotic Stresses 32

putative cis-regulatory elements. Cp-sHSPs of NY ecotype, CaHsp25.99n and

CaHsp26.23n will be referred as NY-1 and NY-2 for clarity, while MS ecotype genes,

CaHsp26.04m and CaHsp26.26m will be referred as MS-1 and MS-2. The 5'-untranslated

region of NY-1 and MS-1 were less similar than the corresponding regions of NY-2 and

MS-2. Overall, there was a greater difference in the 5'-untranslated region sequences

between NY-1 and MS-1 than between these regions in NY-2 and MS-2 (Figure 2.2).

Promoter regions of these four Cp-sHSP genes of two ecotypes of C. album (Shakeel et

al., 2011) were also analyzed for the presence of putative regulatory elements. Our results

showed that the cis-regulatory elements architecture of Cp-sHSP genes vary within the

ecotypes and even among family members of same ecotype. NY-1 gene promoter has one

gap-type 1 (AGAACCCAGAAACTTCA), one gap-type 3

(CTTCTACTTTCAGGCTGAAT), two copies of gap-type 4 (CTTCACGATTTCT and

CTTCACTCTTCT) and two copies of STRE (AGGGG and AGGG) as given in Figure

2.3. NY-2 gene promoter contains two copies of gap-type 1 element

(TGAAGAGAATTCCCGAAT and AGAACCCAGAAACTTCA), one STRE (AGGGG)

and three copies of TTC rich regions (TTTCACTCATTCT, CTTCACGATTTCT and

CTTCACTCTTCA) elements (Figure 2.4). Two gap-type 1 elements

(TGAAGAGACTTCCCGAAT and AGAACCCAGAAACTTCA), one STRE

(AGGGG), two TTC-rich type 4 regions (TTTCACGATTTCT and CTTCACTCTTCT)

were present in the promoter region of MS-1 gene (Figure 2.5). While MS-2 gene

promoter contains one gap-type 1 (AGAACCCAGAAACTTCA), one gap-type 3

(CTTCTACTTTCAGGCTGAAT), two copies of STRE (AGGGG, AGGGG) and two

copies of TTC-rich type 4 regions (CTTCACGATTTCT and CTTCACTCTTCT) (Figure

2.6). The physical position of TATA box, homopurine stretch and different heat shock

elements from start codon is given in Figure 2.7. According to the previous studies,

plants may contain the imperfect heat shock elements due to multiple heat shock factors

present in the genome which change the genetic redundancy and functional

diversifications (Nover et al., 2001). Therefore the complex network of HSFs may

regulate the plant HSP genes (Guan et al., 2010). Similarly, in Arabidopsis and

sunflower, differential induction of specific members of sHSP genes has been observed

due to the combination of HSF specifically with an imperfect HSE (Carranco et al., 1999;



Abiotic Stresses 33

Almoguera et al., 2002; Rojas et al., 2002; Díaz-Martín et al., 2005; Nishiwaza et al.,

2006; Kotak et al., 2007).

Heat shock proteins expression is usually regulated by binding of heat shock factors

(HSFs) to the perfect heat shock elements (HSE). The promoter regions of heat tolerant

and heat sensitive ecotypes of C. album (US variety) were analyzed for the presence of

perfect HSEs (nTTCnnGAAnnTTC). Our data showed several HSEs with many

variations in the conserved motifs like TTC-rich 4 (nTTCn[3bp]nTTCn) sequences, Gap

type-1 (nTTCnnGAAn[5bp]nTTCn), Gap type-2 (nTTCn[1bp] nGAAn[5bp]nTTCn) and

STRE (AGGGG), all these elements are reported to be potential binding sites of heat

shock factors (Guo et al., 2008). Conclusively HSE numbers, types and architecture of C.

album Cp-sHSP promoters of two ecotypes were unique and novel suggesting the role of

other types of HSEs in Cp-sHSP expression other than perfect HSEs (Table 2.2). We only

found perfect Gap type-1 motif in MS-2 genes with many other imperfect motifs.

Similarly one imperfect and one perfect TTC-rich 4 element was also found in each

promoter as shown in Table 2.2. Interestingly we found that heat tolerant ecotype (MS-2)

has different promoter architecture than MS-1, NY-1 and NY-2 promoters. The same

gene showed constitutive expression in MS ecotype under control conditions (Shakeel et

al., 2011). Similarly, no STRE was found in the case of NY-1 promoter as shown in

Table 2.2 (Shakeel et al., 2011).

Many other putative regulatory elements and transcription-factor binding sites were also

found in the promoters of all four Ca-sHSP genes shown in Figure 2.7A. All promoters

tested have a distinct homopurine stretch of about 20-30 bases (also known as a nuclear

matrix attachment site or MARs), which has been reported to have role in transgene

expression stabilization and enhanced transcriptional regulation of a gene (Abranches et

al., 2005). We also found C/EBP or CCAAT box (enhances the activity of HSE), STRE

(activated by heat stress, low pH, osmotic stress and nutrient starvation etc.) and AP1

(activated by CdCl2 or sodium arsenite etc.). These cis-regulatory elements have been

reported playing role in different stress conditions. Metal responsive element (MRE) is

present in promoter region of the stress related genes and controls their expression under

metal stress. One or more copies of MRE have been reported in the case of different



Abiotic Stresses 34

stress related genes, e.g. multiple copies of MRE were found in promoter region of

metallothionein (MT) genes (Karin et al., 1984; Stuart et al., 1985), which are activated

by Cd metal stress (Yamada and Koizumi, 2002). Similarly, AtHSP90-3 promoter of

Arabidopsis, has been reported to response to heavy metal stress (Milioni and

Hatzopoulos, 1997) and has one MRE like box (Prasinos et al., 2005). STRE is activated

by many stress conditions like ethanol, weak organic acids, low pH, oxidative and

osmotic stress and nitrogen starvation (Marchler et al., 1993; Ruis and Schuller, 1995).

Induction of HO-1 gene of animals has been induced by AP-1 elements in response to

sodium arsenite (Lu et al., 1998) and cadmium chloride (Alam, 1994).

Interestingly AtHsp90-1 gene of Arabidopsis thaliana has been reported to be regulated

by combined effect of different cis-regulatory elements (Haralampidis et al., 2002) and

also the same combined effect has been studied in Helianthus annuus (Díaz-Martín et al.,

2005). The presence of similar kind of cis-acting elements in Cp-sHSPs of C. album

ecotypes suggests that these genes are also potential candidates for differential gene

regulation in response to multiple abiotic stresses and because of the presence of these

elements we propose that different types of abiotic stresses like, heat, metal, cold,

drought and salt can initiate or regulate the production of Cp-sHSPs in C. album. If this

will be the case then these genes and promoters will be potentially used in plant

transformation to meet the challenges of upcoming global warming in near future. Next

chapters will focus on the identification and characterization of Cp-sHSP genes under

different types of abiotic stresses.



Abiotic Stresses 35

Figure 2.1. A consensus bootstraps parsimony tree based on promoter sequences.

The promoter sequences of sHSP from diverse group of plants were used to obtain a

parimony tree after 100 bootstrap replicates. The numbers above the branches indicate

the percentage of times the species, which are to the right, grouped together in the

bootstrap tree.



Abiotic Stresses 36

Figure 2.2. Comparisons of putative promoter regions of C. album (US ecotypes)

chloroplast small HSPs. Four newly isolated C. album gene sequences (NY-1, NY-2,

MS-1 and MS-2) were aligned together to find out the similarities among these isoforms.

Chapter 02 Analysis of CasHSP gene promoter for putative cis-regulatory motifs

Expression of Chloroplast Small Heat Shock Proteins of C. album under Different Abiotic Stresses 37

Figure 2.3. Complete promoter sequence of C. album Ca-sHSP gene, NY-1 showing all putative cis-regulating elements.



Figure 2.4. Complete promoter sequence of C. album Ca-sHSP gene, NY-2 showing all putative cis-regulating elements.



Figure 2.5. Complete promoter sequence of C. album Ca-sHSP gene, MS-1 showing all putative cis-regulating elements.



Figure 2.6. Complete promoter sequence of C. album Ca-sHSP gene, MS-2 showing all putative cis-regulating elements.



Abiotic Stresses 41

Table 2.2. Comparisons of the HSE core motifs in Cp-sHSP promoters isolated from

both C. album ecotypes (US variety).



Abiotic Stresses 42

Figure 2.7. Promoter sequence of a representative C. album Ca-sHSP gene and

diagrammatical representation of C. album Ca-sHSP gene. A) Complete promoter

sequence of a representative C. album Ca-sHSP gene, MS-1 showing the putative

elements including TATA box, ATG, transcriptional cis-regulatory elements and other

motifs, including HSE (heat-shock elements), AP1 (activated by CdCl2 or sodium

arsenite, etc.), STRE site (activated by heat stress, low pH, osmotic stress and nutrient

starvation, etc.), C/EBP or CCAAT box (enhances the activity of HSE) and MRE site

(binding site of heavy metal stress factors). Dots on the HSE represent the GAA repeats.

B) A diagrammatical representation of C. album Ca-sHSP gene, MS-2 showing all the

putative upstream regulatory elements.

Chapter 03

Dual role for

Chenopodium album

chloroplast small heat

shock protein:

photosystem II

protection from heat

and metal stresses

Chapter 03 Dual Role of C. album Cp-sHSP in Heat and Metal stresses


Abiotic Stresses 43

Title:

Dual role for Chenopodium album chloroplast small heat shock protein:

photosystem II protection from heat and metal stresses

Abstract

The chloroplast small heat shock proteins (Cp-sHSPs) protect Photosystem II and

thylakoid membranes during heat and other types of stresses with varied levels of Cp-sHSP

production correlated to plant thermotolerance. Cp-sHSPs of Chenopodium album has

already been shown heat regulated with novel promoter architecture containing some

conserved regulatory motifs (Shakeel et al., 2011). To investigate whether the same or

different Cp-sHSP isoforms are involved in plant protection under heat and metal stress,

we isolated and characterized a novel Cp-sHSP isoform: CaHSP26.13p from Pakistani C.

album ecotype. We treated C. album plants with heat and metal stress and sequenced the

transcript. Presence of same CaHSP26.13p transcript in heat and metal treated plants shows

the evidence of differential regulation. Analysis of this Cp-sHSP has confirmed the

presence of all conserved domains common to previously-examined species with high

degree of similarity to other isoforms. Gene expression analysis has indicated that this Cp-

sHSP transcript level was maximum at 37°C for 4hrs (heat stress) and 20mM cadmium

(metal stress). Immunoblot analysis revealed that (1) in case of heat stress, the maximum

expression of precursor and processed protein was at 37°C and; (2) only precursor protein

of ~26KDa was produced in case of metal stress with highest expression when treated

with 15mM cadmium. Transcript and protein levels were not correlated, suggesting the

evidence of post-transcriptional regulation. This study demonstrates the dual role of C.

album Cp-sHSP in heat and metal stress tolerance by differential regulation.

Publication References:

Noor Ul Haq, Sana Raza, Dawn S. Luthe, Scott A. Heckathorn, Samina N Shakeel

(2012). Dual role for Chenopodium album chloroplast small heat shock protein:

Photosystem II protection from heat and metal stresses. Plant Molecular Biology

Reporter, DOI 10.1007/s11105-012-0516-5.



Abiotic Stresses 44

3.1 Introduction

Plants are exposed to many biotic (living) and abiotic (non-living) stresses (Balestrasse et

al., 2010). The immediate response of different organisms to heat stress is the production

of a conserved set of proteins known as heat shock proteins (HSPs). These proteins are

classified based on their molecular weights. Small HSPs (sHSPs) vary in size 15 to 43kD

and are quite diverse and abundant in plants. Further classification of small HSPs

depends upon their cellular localization like cytoplasm, chloroplast, nucleus, endoplasmic

reticulum or mitochondria (Sun et al., 2002). These sHSPs can also be induced during

different developmental stages of plants (Wehmeyer et al., 1996; Almoguera et al., 1998;

Downs et al., 1999; Sun et al., 2001; Heckathorn et al., 2004; Ashby et al., 2009; Colinet

et al., 2009; Zhu et al., 2010) and by other abiotic stresses (cold, drought, or salinity etc.).

Small HSPs over production play significant role in plant development and stress

tolerance (Vierling, 1991; Guo et al., 2007; Banti et al., 2008; Scott and Logan, 2008).

Positive correlation between the production of sHSPs and response to the stress leads to

their important role in protection against stress conditions (Sun et al., 2002). The exact

mechanism of sHSP action is not known. Their chaperoning activity may play some role

in protection against stress (Sun et al., 2002).

Heavy metals are toxic to plants (Bekesiova et al., 2008) and high concentration of metal

ions in plants can cause negative effect on growth and damages the roots of the plants for

which plants develop mechanisms to maintain the normal growth conditions (Pavlikova

et al., 2008). Tolerance against heavy metal toxicity differs with species and even variety

(Metwally et al., 2005). Heavy metals change the membrane permeability and potential

by interaction with membrane components and alter the enzyme activity as well as

inactivation of most regulatory and catalytic proteins may take place by complex

formation of heavy metals with nitrogen, oxygen and sulphur atoms (Bekesiova et al.,

2008). Fertilizers utilization and increased production of industries may increase the

environmental heavy metal (Kováèik et al., 2009). Presence of the heavy metals in the

soil at toxic level may limit the biological efficiency and productivity of the plants

(Clemens, 2006; Kirkham, 2006). Some heavy metals are the essential plants

micronutrients like nickel (Ni), copper (Cu) and zinc (Zn) while others like arsenic (As),



Abiotic Stresses 45

lead (Pb) and cadmium (Cd) have no known biological role in plants but are willingly

taken up by the plants (Kirkham, 2006). Heavy metal can be picked by plants and cause

plants growth and respiration inhibition, ultra-structural damage to plant cells like

mitochondria, chloroplast and cell nucleus as well as quantity and activity of important

enzymes in many metabolic pathways (Smeets et al., 2005).

Our environment is polluted with cadmium and its several forms. Cadmium accumulation

in natural reservoirs of water can affect the algal growth (Klass et al., 1974). It can also

taken up by the roots of higher plants and affect their growth. It has been shown to affect

directly to the photosynthesis by affecting photosystem II (Li and Miles, 1975; Dong et

al., 2005). Environment is polluting with heavy metals and growth of several plants and

organisms have been affected (Singh et al., 1997). Plants usually accumulate these metals

in their tissues and ultimately affect the growth and production. Similarly the rate of

photosynthesis have been shown to decrease by increasing the metal concentration, e.g,

copper negatively affects the chlorophyll contents, photosystem II and thylakoid

membrane stabilization (Ralph and Burchett, 1998; Vinit-Dunand et al., 2002). The exact

mechanism of metal accumulation, plant response or tolerance is not yet known. Recent

reports have shown the involvement of small heat shock protein in plant protection under

stress (Cobbett, 2000; Hall, 2002; Heckathorn et al., 2004). Small molecular weight heat

shock proteins genes are involved in the heat shock response in low temperature,

osmotic, salinity, oxidative, chemical stresses and wounding as well as in embryogenesis

like developmental stages (Sun et al., 2002). In one study, tomato sHSP levels have been

shown to increase under different developmental stages and cold stress (Sabehat et al.,

1998; Sun et al., 2002).

Chloroplast sHSPs (Cp-sHSPs) are nuclear encoded proteins with two highly conserved

regions (present in sHSPs) and a Met-rich domain, which is unique only in chloroplast

sHSPs (Chen and Vierling, 1991). Cp-sHSPs have been shown to protect the most

thermolabile photosystem II (PSII) (Heckathorn et al., 1998). Usually this protection of

electron transport is partly mediated by physical Cp-sHSP binding for stabilization of

oxygen-evolving-complex proteins of PSII (Downs et al., 1999; Heckathorn et al., 2002)

and thylakoid membranes (Torok et al., 2001).



Abiotic Stresses 46

However a direct correlation of chloroplast sHSP contents and PSII protection has been

shown (Heckathorn et al., 2002; Wang and Luthe, 2003; Shakeel et al., 2011). Similarly

Cp-sHSPs have also been reported to protect photosynthesis under heat, heavy metals and

other oxidative stress (Heckathorn et al., 1998; Nakamoto et al., 2000; Torok et al., 2001;

Heckathorn et al., 2004). Qualitative and quantitative Cp-sHSP variations are positively

correlated with plant thermotolerance among cultivars, ecotypes, and in even in distantly

related species (Downs et al., 1999; Preczewski et al., 2000; Valcu et al., 2008). Also, the

production of additional Cp-sHSP isoforms was genetically correlated with improved

heat tolerance in bentgrass (Park et al., 1996; Wang and Luthe, 2003).

Interaction of heat shock elements (HSEs) and heat shock transcription factor (HSFs)

regulate the expression of small heat shock proteins (Guan et al., 2010). Heat shock

elements (HSE) are conserved region and contain the inverted repeats of five unit

sequence “nGAAn” (Amin et al., 1988). HSEs found in the nearest promoter region of

heat shock proteins genes, are composed of three adjacent inverted repeats at least i.e.

nTTCnnGAAnnTTCn (Xiao and Lis, 1988; Perisic et al., 1989). Many HSFs may bind at

a time with HSEs while more than one HSEs are present in the promoters of heat shock

factors target genes (Xiao et al., 1991). AtHsp90-1 gene of Arabidopsis was shown to be

expressed by the interaction of heat shock elements and transcription binding sites

including CCAAT/enhancer binding protein element (C/EBP), activation proteins 1 (AP-

1) and metal regulatory element (MRE) (Haralampidis et al., 2002).

Despite the fact that intensive research has been done on Cp-sHSP production in several

plants, the molecular mechanism involving the gene regulation and its potential targets

are still unknown. Our previous work on C. album has shown the presence of more than

one Cp-sHSP family member in two different US ecotypes (Shakeel et al., 2011). A

strong correlation between promoter architecture, Cp-sHSP expression and C. album

thermotolerance was observed. Interestingly we found some putative regulatory motifs in

the promoter regions of these Cp-sHSPs including AP1 (activated by CdCl2), STRE

(activated by heat stress, osmotic stress, low pH and nutrient deficiency etc.) and MRE

(heavy metal stress factors binding site) etc. (Shakeel et al., 2011). We hypothesized that

some or all family members of Cp-sHSPs may have more than one role in C. album or in



Abiotic Stresses 47

other words the same Cp-sHSP gene can be regulated differently under heat or metal

stress. To test this we treated Pakistani C. album ecotype with high temperature stress and

metal stress. First the effect of stress on plant physiology and photosystem II was

evaluated followed by Cp-sHSP gene isolation and characterization. Furthermore we

presented an evidence of dual role of same Cp-sHSP gene to protect plant from heat and

metal stress.



Abiotic Stresses 48


3.2.1 Plant materials, growth conditions and heat/metal stresses

Chenopodium album (common name Bathou) is an odourless, branching, annual herb

with stalk, opposite and simple leaves. C. album is the C3 dicotyledons weed belongs to

family Chenopodiaceae. Optimum growth temperature for C. album is 25ºC. Seeds were

grown in 3×5 inch pots and then transferred to growth chamber at either low (26°C/20°C

day/night) growth temperature regimes with 350μmol/m2 per second photosynthetic

photon flux density (PPFD). Plants with 6-8 leaves were used for heat and metal stress

treatment as described below.

Heat treatment was given to the plants in sterilized incubation buffer (1% [w/v] sucrose,

1 mM K-PO4 pH6.0, 0.02% [v/v] Tween-20) at 37ºC for 1-5 hours (Shakeel et al., 2011).

While control plants were kept at 25ºC. Leaf samples were collected for physiological

analysis and frozen for molecular analysis. Different concentrations of cadmium (Cd),

copper (Cu) and nickel (Ni) metals were used for metal stress. Plants were separated from

soil and their roots were cleaned softly with distilled water. Roots were dipped in metal

solution of 5mM, 10mM, 15mM, 20mM and 25mM concentrations for six hours. While

for control samples, plants were remained in normal growth conditions. Leaf tissues were

collected and used for physiological tests and remaining kept at -80ºC for RNA isolation.

3.2.2 Physiological parameters

3.2.2.1 Chlorophyll contents

Leaf tissues (~0.5g) were used for chlorophyll contents measurement dipped in 10ml

DMSO (Hiscox and Israelstam, 1979). Samples were heated at 65°C for 2hrs and

Nanodrop 1000 spectrophotometer (Thermoscientific) was used to take absorbance at

645nm and 665nm). Chlorophyll contents were calculated as,

Total chlorophyll = 20.2OD645 + 8.02OD665.

3.2.2.2 Superoxide dismutase (SOD)

Phosphate buffer (pH 7) containing 1% PVP was used to homogenize all the treated

samples in three replicates with the help of pastel and mortar. The homogenate was



Abiotic Stresses 49

centrifuged for 15 minutes at 3000rpm at 4°C and supernatant was used for superoxide

dismutase measurement at 560nm after 20 minutes exposure in light, reference was

treated in dark conditions. Absorbance was calculated by using Nanodrop 1000

spectrophotometer (Thermoscientific). Superoxide dismutase was determined

(Beauchamp and Fridovich, 1971).

3.2.2.3 Peroxidase (POD)

POD measurement was done by mixing enzyme extract with p-phenylenediamine (0.1%),

0.05% H2O2 and 1.35ml 100mM MES buffer (pH 5.5) for assay (Vetter et al., 1958;

Gorin and Heidema, 1976). Change in absorbance was taken at 485nm for 3 minutes.

Peroxidase enzyme value was calculated using following formula:

POD = final reading – initial reading

3

3.2.3 Photosystem II efficiency

To examine the effect of acute heat and metal treatments on thermotolerance of in situ

Photosystem II efficiency in light-adapted plants was determined from chlorophyll

fluorescence analysis (Fv'/Fm') (Wang et al., 2008). Plants were grown at 25-26°C and ca.

1000 umol m-2

s-1

PAR, and then plants were heat or metal stressed as explained above.

Then Fv'/Fm' was measured at midday on recently-expanded fully-illuminated leaves of

intact plants at their respective treatment conditions.

3.2.4 Statistical analysis

All experiments were replicated three times at each levels and statistical analysis was

done using one way ANOVA by SPSS16 software. Data was considered statistically

significant when differences among treatments was occurred as P<0.05.

3.2.5 Identification of Cp-sHSP genes

The CTAB method with some modification was used for genomic DNA isolation from

leaves of C. album (Zhang and Stewart, 2000). Degenerate primers were used to amplify

the most conserved met-rich and Consensus-I regions of Cp-sHSPs (Shakeel et al., 2011) by

using PCR conditions: denaturation at 95C, then 94C for 45sec, 54C for 45sec, 72C



Abiotic Stresses 50

for 1min, a total of 29 cycles, with final extension step at 72C for 5min followed by

holding at 15C for 15min. The PCR products were then sequenced and confirmed.

3.2.6 PCR Amplification of full length Cp-sHSPs

Degenerate and gene specific primers were used for amplification of partial and full-length

gene for genome walking and cDNA RACE (Shakeel et al., 2011). PCR amplification was

done with initial polymerase activation at 95°C, 10 min; then 45 cycles at 95°C, 10sec;

67°C, 0.5sec; 72°C, 11sec. PCR conditions were optimized for an amplification efficiency

of 95% for all primer pairs used. The PCR reactions were carried out in a final volume of

25µL using 150ng DNA as template with Taq DNA polymerase (Sigma Chemical Co., St.

Louis, MO, USA). The products were separated by agarose gel electrophoresis followed by

sequencing.

3.2.7 RNA Isolation and reverse transcriptase reaction

3.2.7.1 Total RNA isolation

Treated and control plants were used for total RNA isolation by using RNeasy® Plant Mini

kit (Qiagen) with on column DNase I treatment. Leaf tissues (0.1g) were homogenized

thoroughly with mortar and pestle in presence of liquid Nitrogen. Almost 450µl of RLT

buffer (10µl β-mercaptoethanol per 1ml of buffer) was added and mixture was transferred

into purple colored spin tube (provided with kit). Tubes were centrifuged at 13000rpm for

2 minutes, supernatant was mixed with 0.5 volume of ethanol and transferred to pink

RNasy spin column. Followed by centrifugation at 10000rpm for 15sec. Flow through was

discarded. Spin columns were washed with 350µl RW1 buffer; centrifuged at 10000rpm

for 15sec and discarded the flow through. 80µl of DNase I incubation mix (10µl DNase

gently mixed with 70µl RDD buffer) was added directly to each sample column and kept

at room temperature for 15 minutes. RW1 buffer (350µl) was added in RNeasy spin

column and centrifuged for 30sec at 10000rpm. Flow through was discarded and washed

twice with 500µl RPE buffer. RNase free water (30µl) was added to the column and was

kept at room temperature for 5 minute followed by centrifugation at 10000rpm for 2

minutes and elution of RNA samples. RNA quantity was measured by NanoDrop 1000 and

quality was evaluated by agarose gel electrophoresis. Approximately 3µg of total RNA of



Abiotic Stresses 51

each treated and control sample was reverse transcribed into cDNA by using Oligo dT

primers and RNase H-minus reverse transcriptase from ThermoScript RT-PCR System

(Invitrogen, Carlsbad, CA). Three biological and three experimental replicates were used for

cDNA synthesis.

3.2.7.2 First strand cDNA synthesis

First strand cDNA of 3µg was synthesized with Revert Aid first strand cDNA synthesis

Kit (Fermentas Cat. # K1621) with the protocol provided by supplier and oligo dT primers

were used for cDNA synthesis. Reaction mixture (RNA, Reaction Buffer, dNTPs Mix,

Oligo(dT)18 Primers, RiboLock™ RNase Inhibitor, RevertAid™ Reverse Transcriptase,

DEPC-treated Water) was incubated at 42°C for 60 minutes and terminated the reaction by

heating at 70°C for 10 minutes.

3.2.7.3 Reverse Transcriptase PCR (RT-PCR)

First strand cDNA was amplified with Cp-sHSP gene specific primers (Shakeel et al.,

2011). Reaction mixture (total volume 25µl) was prepared by adding 10ng cDNA

sample, 10X Taq buffer {750 mM Tris-HCl (pH 8.8 at 25°C), 200mM (NH4)2SO4, 0.1%

(v/v) Tween 20}, 0.2mM dNTPs, 2mM MgCl2, 1.25units Taq DNA polymerase

(Fermentas), 0.2mM each primer. Thermocycler conditions used were: denaturation at

95°C for 5 minutes, then at 95°C for 1 minute, 58°C for 1 minute, 72°C for 2.5 minute,

40 cycles and final extension at 72°C. 10µl of each amplified product was checked on 1%

agarose gel.

3.2.8 Sequencing of Cp-SHSPs

3.2.8.1 Purification of PCR product

PCR products were purified by using QIAquick® Gel Extraction Kit (Catalog # 28704

and 28706) according to manufacturer’s instructions. Amplified PCR products was

excised from agarose gel and weighed the gel slice. QG buffer (three volumes) was added

to one volume (100mg gel ~100µl) of gel and incubated the mixture at 50°C for 10

minutes. Gel slice was completely dissolved and equal volume of Isopropanol was added.

Mixture was added to the QIAquick spin column and centrifuged at 13000rpm for 1

minute. Flow through was discarded and 500µl QG buffer was added to QIAquick spin



Abiotic Stresses 52

column followed by spin at 13000rpm for 1 minute. PE buffer (750µl) was added to wash

QIAquick spin column two times to remove the residual wash buffer. EB buffer (50µl,

10mM Tris.Cl, pH 8.5) was added to the column and kept for 2 minutes. To elute the

DNA, column was centrifuged at 13000rpm for 2 minutes.

3.2.8.2 Cloning of PCR purified product

PCR product was cloned using Invitrogen cloning kit (pCR®8/GW/TOPO

®TA

Cloning®Kit, Catalog # K2500-20) according to manufacturer’s protocol. Purified PCR

product (4µl) was mixed with 1µl salt solution and TOPO® vector (1µl) gently, kept at

room temperature for 5 minutes. One vial (50µl) of One Shot® E. coli cells were freeze

thawed and mixed with 2µl TOPO® cloning mixture, followed by incubation on ice for

30 minutes. Bacterial cells were heat stressed at 42°C with immediate transfer to ice.

About 250µl LB medium (1% (w/v) Tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v)

NaCl, pH 7.5) was added to the cells and incubated at 37°C for 1hr with continuous

shaking. Transformed bacterial culture (50µl) was spread on prewarmed LB agar plates

containing 100µg/ml spectinomycin and incubated at 37°C overnight. Individual colonies

were used for plasmid extraction next day.

3.2.8.3 Plasmid isolation

Plasmid DNA was purified using QIAprep Spin Miniprep Kit (Catalog # 27104)

according to provider’s instructions. Bacterial cells were resuspended in P1 buffer

(250µl) and 250µl P2 buffer, mixed thoroughly and 350µl of N3 buffer was added

followed by centrifugation at 13000rpm for 10 minutes. Supernatant was passed through

QIAprep spin column provided with kit for 60sec at 13000rpm. Flow through was

discarded and column was washed twice with 0.75ml PE buffer. QIAprep spin column

was further centrifuged at 13000rpm for 60sec to remove residual wash buffer and

Plasmid was eluted with 50µl elution buffer (10mM Tris-HCl, pH 8.5). Purified plasmid

DNA was used for sequencing by using TOPO vector specific primers GW1 (5´-

GTTGCAACAAATTGATGAGCAATGC-3´) and GW2 (5´-

GTTGCAACAAATTGATGAGCAATTA-3´).



Abiotic Stresses 53

3.2.9 Relative Quantification of Cp-sHSP transcripts in heat and metal treated

samples

Relative quantification of Cp-sHSP transcript was done by using β-tubilin gene as a

reference gene for real-time PCR (Applied Bio-system 7500). Reaction mixture (10µl)

was prepared by mixing 5.2µl Maxima SYBR Green qPCR Master Mix (2X), forward

and reverse primers (0.2mM each primer) and 8-10ng cDNA. Three biological and three

experimental replicates was used for each sample in two step cycling procedure. Pre-

treatment of Uracil DNA Glycosylase (UDG) was given at 50ºC for 2 minutes to degrade

double stranded DNA present in reaction mixture followed by 40 cycles of denaturation

at 95ºC for 15sec, annealing and extension at 58ºC for 1 minute. Non-treated and non-

template controls were also used as calibrator and to check amplification. Data was

analyzed by ABI SDS software.

3.2.10 Cp-sHSP protein expression by Immunoblotting

Leaf tissues (0.2g) were homogenized in 2ml of SDS-PAGE sample buffer (0.0625 M

Tris-HCl pH 6.8, 25% (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) mercaptoethanol, 0.01%

(w/v) bromophenol blue). Protein concentrations were measured using the RC/DC

Protein Quantification Kit, (Bio-Rad). Almost 25ng of each protein sample was loaded on

SDS-PAGE Mini-PROTEAN cell (Bio-Rad Laboratories, Hercules, CA, USA) followed

by transfer onto nitrocellulose membranes (Sigma Chemical Co., St. Louis, MO, USA)

by using a semidry electroblotter (Owl Separation Systems, Portsmouth, NH, USA) for

1hr. The primary antibody, Abmet, which specifically recognizes the methionine-rich

region of Cp-sHSPs in plants (Downs and Heckathorn, 1998), was used at a dilution of

1:4,000 (v/v). While Bip antibody was used as internal control. The Cp-sHSPs were

detected by Super Signal West Femto Maximum Sensitivity Substrate (PIERCE,

Rockford, IL), according to the manufacturer’s instructions.



Abiotic Stresses 54

3.3 Results

3.3.1 Effect of heat/metal stress on physiological parameters

To check the effect of heat and metal stress on physiology of C. album plants, we

checked the chlorophyll contents, peroxidase enzymes (POD) and superoxide dismutase

(SOD) after heat and metal stress. Heat stress was given to the plants at 37°C for 1-5hrs.

Plants were kept at 37°C while all the control plants were kept at 25°C. Our results have

shown gradual decrease in the total chlorophyll contents with increased exposure to heat

stress at 37°C (Figure 3.1a), this temperature is almost 10°C higher than the optimal

growth temperature of C. album. Interestingly SOD has been significantly increased

under heat stress, which shows the increased level of reactive oxygen species (ROS)

production under heat stress, while peroxidase activity was decreased (Figure 3.1a).

We also analyzed the effect of dose response of three metals including cadmium (Cd),

nickel (Ni) and copper (Cu) on C. album plants to find the best conditions for Cp-sHSP

production and molecular analysis. Plant roots were dipped in Cd, Ni and Cu metal

solutions of 5mM, 10mM, 15mM, 20mM and 25mM concentrations while plants for

control samples were kept in normal growth conditions. Leaf tissues were used to

determine the total chlorophyll, superoxide dismutase and peroxidase enzymes activities.

Our data showed reduction of total chlorophyll contents in the case of all three heavy

metals used (Figure 3.1a). The maximum effect was seen in the case of Cd in our

conditions. SOD and POD have been significantly increased under all metal treatments as

expected (Figure 3.1a). The effect of Cd was more pronounced as compared to other two

metals.

Heat and metal treatment was given to the plants to examine the Cp-sHSP transcript.

Total RNA was isolated in three biological replicates from treated and control conditions

samples. RNA was first analyzed for its quality and quantity followed by cDNA synthesis

by pulling equal amount of RNA from all three replicates using reverse transcriptase

enzyme. RT-PCR was done by using Cp-sHSP gene specific primers to amplify the most

conserved region of Cp-sHSPs (Shakeel et al., 2011). Cp-sHSP transcript was

accumulated in the case of heat stressed samples at 37°C for four hours and in the case of

20mM Cd stresses (Figure 3.1b). While no Cp-sHSP expression was seen in case of non-



Abiotic Stresses 55

treated controls and samples treated with other metals (Ni and Cu). We used β-tubilin

transcript as loading control for RT-PCR analysis. We selected 37°C for 1-5hrs for heat

stress and 5-20mM Cd solution for metal stress for further molecular analysis. Based on

these RT-PCR results in the case of heat and metal (Cd) stresses, we decided to check the

effect of high temperature (different time points) and Cd metal (dose response) on

photosynthesis rate of the plants.

3.3.2 Effect of heat stress and cadmium on thermotolerance of Photosystem II

The effect of acute heat treatment and increasing concentrations of cadmium (metal)

stress on thermotolerance of in situ Photosystem II efficiency in light-adapted plants was

individually determined from chlorophyll fluorescence analysis (Fv'/Fm') as described in

(Wang et al., 2008). Plants were first grown at 24-26°C and ca. 1000 mmol m-2

s-1

PAR,

and then were heat stressed at 37°C for 1-5hrs, after which Fv'/Fm' was measured at

midday on recently-expanded fully-illuminated leaves of intact plants at their respective

treatments for heat stress. For metal stress, the plants were first treated with different

concentrations of cadmium (Cd) before chlorophyll fluorescence analysis (Fv'/Fm'). Both

types of stresses affected the Photosystem II efficiency and significant reduction in

Fv'/Fm' ratios was observed as shown in Figure 3.2 (a and b). These results also support

the use of cadmium solution for metal stress.

3.3.3 Full-length Cp-sHSP gene sequencing

Approximately 800bp fragment was amplified by using degenerate primers covering the

methionine rich region of Cp-sHSP (Shakeel et al., 2011) from genomic DNA and

~400bp fragment from heat and metal treated transcripts (Figure 3.2 c & d, respectively).

The absence of respective transcripts in the control leaf tissues (without heat or metal stress)

showed the evidence of stress induced regulation of Cp-sHSPs in C. album. RT-PCR was

performed for CaHSPp and β-tubilin gene to check their expression in control and heat

(different time points) and Cd metal (different dose response) treated samples (Figure 3.3

a & b). We see CaHSPp gene amplification in all heat and metal treated samples while

not in control conditions and negative control samples showing no CaHSPp gene

expression in normal growth conditions while β-tubilin gene amplification bands in all

control and heat/metal treated samples, showed endogenous expression of β-tubilin gene.



Abiotic Stresses 56

Also β-tubilin gene amplification in all samples (excluding negative control) shows the

loading of transcript in PCR reactions of all control and heat/metal treated samples.

Transcription starts site and full length gene (CaHSP26.13p) was identified by cDNA

RACE using C. album-specific primers (Pakistani ecotype). Similarly the same gene

transcript was amplified and sequenced from C. album plant after heat and metal stress

individually. The sequence analyses of both of these transcripts have shown 100%

similarity (Figure 3.4a), provides an evidence of regulation under heat and metal stress in

C. album. Comparisons of CaHSP26.13p sequence with already known four genes of C.

album (Shakeel et al., 2011) have shown 99.8% similarity (Figure 3.4b), while highly

conserved regions were aligned by multiple alignments of translated amino acid sequence

of CaHSP26.13p with other known genes (Figure 3.5a). The deduced amino acid

sequences contained a transit peptide and three highly conserved regions, including the met-

rich region, consensus II, and consensus I. Similarly the coding region of CaHSP26.13p

was interrupted by presence of a single intron (~479bp). Similarly phylogenetic analysis

of precursor CaHSP26.13p protein (including transit peptide) sequence and previously-

known Cp-sHSPs of different plant species showed high sequence similarity and the

presence of two major groups of monocots and eudicots indicates the diverse nature of

Cp-sHSP proteins in these plants (Figure 3.5b). Conclusively, these results indicate that

the same CaHSP26.13p gene is regulated by heat and metal stress in C. album as

predicted before from promoter sequences analysis in previous study (Shakeel et al.,

2011).

3.3.4 Heat/metal regulated expression of Cp-sHSP

Effect of temperature on CaHSP26.13p transcript accumulation was previously shown

(Shakeel et al., 2011), we selected heat stress at 37°C for maximum Cp-sHSP

accumulations. To check the expression pattern of Ca-sHSP gene at transcript level,

relative quantification was done for heat treated against control conditions samples.

While time course of heat treatment at 37°C showed rapidity of transcript accumulation in

response to heat stress (Figure 3.6a) by real-time PCR and Cp-sHSP accumulation began

within 1hr of heat stress, and increased consistently with the time. Maximum transcript was

produced after four hours of heat stress. In case of protein, two bands of ~26 and 21KDa



Abiotic Stresses 57

were observed indicating the accumulations of unprocessed precursor and stromal

(processed) forms of Cp-sHSP respectively under heat stress. Both forms had maximum

protein expression after four hours of heat stress, after prolonged stress the proteins were

degraded (Figure 3.6a). Time course response of both transcript and protein studies were

thus consistent, no evidence of post-transcriptional regulation was observed in the case of

heat stress.

Metal effect on the levels of Cp-sHSP transcript and protein accumulations was

determined by dose response analysis, where different concentrations of cadmium stress

were imposed for 6hrs; non-treated samples were used as controls. β-tubilin was used as

internal control for determining the relative mRNA abundance by real-time PCR. The

overall pattern of metal-induced transcript accumulation increased with the higher

concentrations of metal treatment. Maximum amount of CaHSP26.13p transcript was

accumulated in plant samples treated with 20mM cadmium solution (Figure 3.6b). While

interestingly, only unprocessed precursor form (~26KDa protein) was detected in the case

of metal stress in given duration of time. The protein levels increased with increasing the

dose of metal treatment until reach a maximum expression level at 15mM concentration

of cadmium solution, with a reduction from this peak (Figure 3.6b). We speculate that this

larger unprocessed precursor protein has dual role in plant protection against heat and metal

stress. Absence of correlation of transcript and protein levels under metal stress is indicative

of some important role of post-transcriptional regulations in protection of plants from metal

stress and related tolerance.



Abiotic Stresses 58

3.4 Discussion

Abiotic stress signaling is a complex mechanism in plants, our knowledge of molecular

mechanism of heat and other abiotic stresses is still limited. Production of Cp-sHSPs in

plants under stress has been shown correlated with the thermotolerance in many studies

(Vierling, 1991; Downs and Heckathorn, 1998; Heckathorn et al., 1998; Preczewski et

al., 2000; Heckathorn et al., 2002; Barua et al., 2003; Wang and Luthe, 2003;

Heckathorn et al., 2004; Barua et al., 2008; Shakeel et al., 2011). Nevertheless, their

regulation at gene and protein levels under abiotic stress condition in non-model plants is

largely unknown. Recently we showed the evidence of more than one putative stress

regulatory elements in the promoter regions of C. album Cp-sHSPs (Shakeel et al., 2011).

Presence of these regulatory elements in the promoters of Cp-sHSPs shows their

important role in regulation of Cp-sHSPs under more than one type of stresses in plants.

To explore this possibility, we isolated and characterized a novel gene named,

CaHSP26.13p from Pakistani ecotype of C. album. Taking all together, we provide

evidence of the expression of same Cp-sHSP transcript under heat and metal stress based

on sequence similarities.

High temperature is the main abiotic stress factor which affects the plants growth and

productivity (Huang and Xu, 2008). Heat stress can inhibit the photosystem II by

damaging the cell membrane and even may cause the cell death (Xu et al., 2006). Cp-

sHSPs protect PSII during heat stress (Osteryoung and Vierling, 1994; Heckathorn et al.,

1998; Heckathorn et al., 2002; Wang and Luthe, 2003; Heckathorn et al., 2004; Neta-Sharir

et al., 2005). The Cp-sHSPs associate with oxygen-evolving-complex (OEC) proteins of

PSII during stress (Heckathorn et al., 2002) and addition of Cp-sHSPs to thylakoids

membranes help to protect PSII against heat inactivation in vitro (Heckathorn et al., 1998).

Production of the reactive oxygen species (ROS) like singlet oxygen (1O2), hydrogen

peroxide (H2O2), hydroxyl radical (•OH) and superoxide anion (O2

-), is one mechanism to

injure the plants (Liu and Huang, 2000). Plants protect their cells from this stress or

injury production of antioxidant enzymes like glutathione reductase (GR), ascorbate

peroxidase (APX), catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD)

and antioxidant materials like glutathione (GSH) and ascorbic acid (AsA) because these



Abiotic Stresses 59

agents can scavenge the ROS. Selection of minimum duration of heat stress and the best

concentration of heavy metal used is important for plant response to stress. We treated C.

album plants at 37°C for 1-5hrs (heat stress) and with different concentrations of different

heavy metals (metal stress) and checked the effect of heat and metal stress on

photosynthesis and physiological parameters. Our results demonstrate a significant

decrease in total chlorophyll contents with the increase duration of heat stress and with

the increase of concentrations of metal stress, i.e. cadmium (Cd), nickel (Ni) and copper

(Cu. We selected Cd metal because of its more pronounced effect on plants. Decrease in

total chlorophyll contents due to heavy metal, has also been reported in different plants

like Zea mays (Krantev et al., 2008), Kandelia candel and Bruguiera gymnorrhiza

(Huang and Wang, 2010), Brassica juncea (Alam et al., 2007) and Triticum aestivum

(Gajewska and Sklodowska, 2007). POD has also been decreased and superoxide

dismutase (SOD) was increased due to heat stress showing increased level of reactive

oxygen species (ROS) production due to heat stress because several enzymatic

antioxidant such as superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD)

while some non-enzymatic antioxidants like ascorbate, flavonoids and proline can

metabolize the ROS (Arora et al., 2002). Plants produce catalase (CAT), peroxidase

(POD) and superoxide dismutase (SOD) to reduce the reactive oxygen species (ROS) and

decrease their harmful effects (Chen et al., 2010). So increased activities of antioxidant

enzymes may be correlated with increased production of reactive oxygen species

(Drazkiewicz et al., 2003). Similarly, Cp-sHSP transcript was only accumulated in case

of heat treated samples at 37°C for four hours and 20mM Cd treated samples. Based on

these results we selected 37°C for 1-5hrs for heat stress and 5-20mM Cd solution for

metal stress for further molecular analysis. The effect of acute heat treatment and

cadmium on thermotolerance of in situ Photosystem II efficiency was further analyzed.

Both types of stresses affected the Photosystem II efficiency and significant reduction in

Fv'/Fm' ratios was observed. Furthermore, C. album Cp-sHSP have been shown to interact

physically with PSII (oxygen evolving complex) under heat stress conditions

(Heckathorn et al., 2002).

Thus based on all the physiological data and preliminary evidence of Cp-sHSP transcript

accumulation, we selected the above mentioned parameters for heat and Cd stress for



Abiotic Stresses 60

further molecular analysis and gene isolations. Full-length CaHSP26.13p gene was

cloned and sequence was identified by cDNA RACE using C. album-specific primers

(Pakistani ecotype). Sequencing of both transcripts from heat and metal stressed samples

have shown 100% similarity, provides an evidence of presence of a single genes with

different regulation under heat and metal stress in C. album as expected (Shakeel et al.,

2011).

Effect of temperature on CaHSP26.13p transcript accumulation was previously shown

(Shakeel et al., 2011). Our results have shown a rapid increase of transcript accumulation

in response to heat stress in time course studies by real-time PCR. Maximum transcript was

produced after four hours of heat stress. Precursor and stromal (processed) forms of Cp-

sHSP were also observed in this ecotype of C. album as reported earlier in case of other

ecotypes under heat stress (Shakeel et al., 2011). Time course response of both transcript

and protein studies were thus consistent, no evidence of post-transcriptional regulation

was observed in case of heat stress as reported before (Shakeel et al., 2011). Protection of

photosynthesis has already been reported and the expression of Cp-sHSPs depend upon the

time and duration of heat stress (Heckathorn et al., 1998; Wang and Luthe, 2003).

Similarly metal effects on the levels of Cp-sHSP transcript and protein accumulations

were also determined. The overall pattern of metal-induced transcript accumulation

increased with the higher concentrations of metal treatment. Maximum amount of

CaHSP26.13p transcript was accumulated in plant samples treated with 20mM cadmium

solution. Interestingly, only one unprocessed (precursor) Cp-sHSP form (~26KDa protein)

was observed in case of Cd stress and maximum protein expression was in the samples

treated with 15mM cadmium solution. Heavy metals are reported to damage the soluble

and insoluble phases of chloroplast membranes (Hall, 2002). Once the heavy metal start

accumulating and cause damage to the chloroplast membranes then Cp-sHSPs are produced

to protect the photosynthesis as shown by Heckathorn et al., (2004). Based on this we

speculate that this larger unprocessed precursor protein performs dual role in plant

protection against heat and metal stress. Absence of correlation of transcript and protein

levels under metal stress is indicative of some important role of post-transcriptional

regulations in protection of plants from metal stress and related tolerance. Protection of



Abiotic Stresses 61

photosynthesis under heavy metal stress has already been reported in Zea mays by

Heckathorn et al., (2004). There can be more than one mechanism of photosynthesis

protection by Cp-sHSPs, like these proteins can help in protein aggregation and chloroplast

membrane stability (Torok et al., 2001) or by production of antioxidants (Hamilton and

Heckathorn, 2001).

Small heat shock proteins genes are known to be involved in the heat shock response in

low temperature, osmotic, salinity, oxidative, chemical stresses and wounding as well as

in embryogenesis like developmental stages (Sun et al., 2002). Relatively less is known

about the regulation of these organelle-localized sHSPs under a particular stress or

combination of multiple stresses. The expression of these genes is known to be regulated

mainly at the transcriptional level. Several conserved motifs have been identified to have

quantitative effects on the expression of certain heat shock gene like AtHsp90

(Haralampidis et al., 2002), which shows the combinatorial interaction of Cis-elements to

coop with multiple stresses. However, the role of cis-elements in regulation of single or

multiple pathways other than heat shock response, have not been identified as of yet.

Taken all together this study provides a correlation of presence of conserved motifs and

HSE’s in the promoter regions of C. album to regulate the accumulation of same isoforms

of Cp-sHSP under heat and metal stress. This unique ability of C. album Cp-sHSP to

express and protect plants from heat and metal stress can be potentially utilized for plant

breeding and engineering to produce heat and metal tolerant plants or transgenic plants

with rapid and over expressed Cp-sHSPs to coop with severe environmental challenges.



Abiotic Stresses 62

Figure 3.1. Effect of high temperature and metals stress on total chlorophyll

contents, peroxidase (POD), superoxide dismutase (SOD) and Cp-sHSP transcript

of C. album leaves. (a) C. album plants were exposed to heat stress at 37°C for 1-5hrs

and treated with different concentrations of metals including nickel (Ni), cadmium (Cd)

and copper (Cu). All the treated and control plants were used to determine chlorophyll

contents, peroxidase (POD), superoxide dismutase (SOD) and relative abundance of

transcript. Each value represents the mean ±SE of three replicates. (b) Effect of high

temperature and metals stress on Cp-sHSP transcript. RNA was isolated from controls

(C) and treated samples (heat-stressed at 37°C for 4hrs and metal stress including Ni, Cd

and Cu for 6hrs. Transcript levels of Cp-sHSP (mRNA) were determined by RT-PCR by

using gene specific primers and β-tubilin as an internal control gene to normalize the

data. 5µl of each amplified product was loaded on 1.5% agarose gel for visualizations.



Abiotic Stresses 63

Figure 3.2. The effect of heat stress (left panel) and metal stress (right panel) on

thermotolerance of Photosystem II efficiency and transcript levels. The effect of

acute heat treatments on thermotolerance of in situ Photosystem II efficiency in light-

adapted plants was determined from chlorophyll fluorescence analysis (Fv'/Fm') as in

Wang et al., (2008). Plants were grown at 25-26°C and ca. 1000 mmol m-2

s-1

PAR, and

then some plants were heat stressed at 37°C for 1-5hrs, after which Fv'/Fm' was measured

at midday on recently-expanded fully-illuminated leaves of intact plants at their (a)

respective temperature and (b) treated with different concentrations of cadmium. Total

RNA was isolated from all controls (C) and heat/metal treated samples (T) of C. album in

three individual replicates. (c) PCR and RT-PCR analysis of Cp-sHSP with and without

heat stress. (d) PCR and RT-PCR analysis of Cp-sHSP with and without metal stress.



Abiotic Stresses 64

Figure 3.3. Effect of high temperature (a) and metals stress (b) on Cp-sHSP

transcript of C. album leaves. Total RNA was isolated from all controls (C) and

heat/metal treated samples of C. album in three individual replicates (1, 2 & 3 in

heat/metal treatment case). (a) RT-PCR analysis of CaHSPp and β-tubilin (as an internal

control) genes with and without heat stress. (b) RT-PCR analysis of CaHSPp and β-

tubilin (as an internal control) genes with and without metal stress.



Figure 3.4. Amino acid sequence alignment of CaHSP26.13p from heat & metal transcripts Pakistani ecotype (a) and with four

genes of two US ecotypes. (a) Alignment of deduced amino-acid sequences of CaHSP26.13p isolated from C. album Pakistani

ecotype. (b) Alignment of deduced amino-acid sequences of CaHSP26.13p isolated from C. album Pakistani ecotype with four genes

(CaHSP25.99n, CaHSP26.23n, CaHSP26.04m and CaHSP26.26m) from two US ecotypes (two genes from each) (Shakeel et al.,

2011). Alignment of deduced amino-acid sequences of heat and metal transcripts shows 100% similarity indicating that the same gene

is regulated by heat and metal stresses individually while amino-acid sequences of CaHSP26.13p shows high similarity with those of

US ecotypes and the small difference is due to the ecotypes change.



Abiotic Stresses

66

Figure 3.5: Amino acid sequence alignment and phylogenetic relationship of

CaHSP26.13p with other plants. (a) Alignment of deduced amino-acid sequences of

CaHSP26.13p isolated from C. album Pakistani ecotype. Bold lines at the top indicate the

transit peptide (I) and three conserved regions [met-rich region (II), con-II (III) and I (IV)

regions]. (b) Phylogenetic relationships of the CaHSP26.13p among diverse plants based

on whole-protein sequences, including transit peptide.



Abiotic Stresses

67

Figure 3.6: Effect of heat stress and metal stress on Cp-sHSP transcript and protein.

(a) Temperature dependent response of Cp-sHSP protein and transcript. Total protein and

mRNA was isolated from leaf tissues of C. album leaf tissues after heat stress at 37C for

1-5hrs and control leaves were incubated at 25C. Quantitative real-time PCR was

conducted using gene specific primers of all Cp-sHSP genes to analyze relative Cp-sHSP

expression. β-tubilin was used as internal controls to normalize samples. Total protein

(60mg) from leaves were extracted from the above mentioned heat treated samples and

separated on SDS-PAGE for immunoblot analysis, using antibody specific to Cp-sHSP

(Heckathorn et al., 1998) normalized relative to the Bip loading control (LC). Message

levels for Cp-sHSPs (mRNA) were determined by real time PCR.

(b) Cd dose response expression patterns of Cp-sHSP at protein and transcript levels.

Total protein and mRNA was isolated from C. album leaf tissues after Cd stress at 37C

of 0-25mM for 6hrs; unstressed leaves (controls) were kept in normal growth conditions.

Real-time PCR was conducted using gene specific primers to analyze relative Cp-sHSP

expression. β-tubilin was used as internal controls to normalize samples. Total protein

(60mg) from metal treated and control samples were separated on SDS-PAGE for

immunoblot analysis, using antibody specific to Cp-sHSP was normalized relative to the

Bip loading control (LC).

Chapter 04

Molecular

characterization of

Chenopodium album

chloroplast small heat

shock protein and its

expressions in response

to different abiotic

stresses

Chapter 04 Multiple Role of Chenopodium album Cp-sHSP under abiotic stresses


Abiotic Stresses 68

Title:

Molecular characterization of Chenopodium album chloroplast small heat shock

protein and its expressions in response to different abiotic stresses

Abstract

Plants being sessile organisms have to cope with different environmental stresses during

their whole life cycles. The genetic makeup of plants, type, intensity and duration of

stress are important determinants for developing different mechanisms for stress

tolerance in plants against that particular stress. Photosystem II is one of the most labile

part affected by stress. The chloroplast small heat shock proteins (Cp-sHSPs) protect

Photosystem II and thylakoid membranes during heat stress. Previously we reported more

than one putative stress related cis-regulatory elements in the promoter regions of

Chenopodium album and proposed their role in differential regulation of Cp-sHSPs under

more than one type of stress (Shakeel et al., 2011). Our previous results showed the

presence of same transcript of a novel newly isolated CaHSP26.13p under heat and metal

stress in chapter 03 (Haq et al., 2012).

To examine whether the same or different Cp-sHSP family members are involved in plant

protection against cold, drought and salt stress, we sequenced the Cp-sHSP from samples

treated with different types of stresses and compared with each other. Analysis of these

putative Cp-sHSPs has confirmed the presence of all conserved domains common to

previously-examined species with high degree of similarity to other isoforms. Sequence

analysis has shown the presence of same CaHSP26.13p gene in C. album regulated

differently under cold, drought or salt stress individually, provides evidence of differential

regulations of the same gene by different environmental conditions. Gene expression

analysis by using real-time PCR has indicated the differential expression in the case of

cold, drought and salt stress. Immunoblot analysis revealed the presence of precursor Cp-

sHSP of ~26KDa with different expression levels in each case. Transcript and protein

levels were not correlated, suggesting the role of post-transcriptional regulation in this

plant protection against abiotic stress. Conclusively this study demonstrates the multiple

roles of same C. album Cp-sHSP under cold, drought or salt stress tolerance.



Abiotic Stresses 69

4.1 Introduction

Plants growth is usually affected by even slight changes in environmental conditions

including, cold, increased CO2, salinity, high temperature and drought etc. either

individually or by combinations of different types of stresses (Ahuja et al., 2010). Plants

may change the molecular programming for their adaptation according to changes in

climate (Chen et al., 2006; Chae et al., 2009; Jin et al., 2009; Legnaioli et al., 2009;

Ramirez et al., 2009; Ning et al., 2010). This can effect at proteome, transcriptome and

metabolome levels in response to fluctuating environmental conditions (Li et al., 2008;

Shulaev et al., 2008; Barkla et al., 2009; Chae et al., 2009; Cseke et al., 2009; Zeller et

al., 2009). Genes involved in defense mechanism against environmental stresses can be

usually divided in two groups, the genes involved in direct protection from stress and the

genes involved in cross talks of signal transduction pathways to protect plants from stress

(Hasegawa et al., 2000; Seki et al., 2002).

Low temperature stress may badly affect the plants distribution and productivity (Gupta

and Deswal, 2012), protein and nucleic acid conformation, membrane fluidity

(Chinnusamy et al., 2007), photosynthesis (Yu et al., 2002) and ROS production (Xu et

al., 2008). Similarly cold stress inhibits Photosystem II (PSII) by affecting electron

transport chain (Jeong et al., 2002). Photosystem II can be affected directly by oxidative

stress or indirectly by damaged to repair ability of different photosynthetic components

(Jeong et al., 2002; Nishiyama et al., 2006).

Drought is also known to limit the plant growth (Engelbrecht et al., 2007; Ramirez et al.,

2009; Seo et al., 2009; Ning et al., 2010), stem lengthening, leaf development and

stomatal movements (Engelbrecht et al., 2007). Plant responses to drought stress can

affect plant at molecular, cellular or whole plant levels (Chaves et al., 2009). As a whole

plant growth and photosynthesis decreases due to closure of stomata (Lawlor and Cornic,

2002) and reduction in the photosynthetic enzymes activity (Chaves et al., 2009;

Aranjuelo et al., 2010). At cellular level, ROS accumulation takes place and is harmful

for the cell, ultimately can affect photosynthetic apparatus (Foyer and Noctor, 2009;

Dietz and Pfannschmidt, 2011). While at molecular levels, several changes in the protein



Abiotic Stresses 70

synthesis can occur by changing the expression pattern (down- or up-regulation) of

defense related genes (Deeba et al., 2012).

Salinity damages about 50% irrigated and 20% agricultural land throughout the world

(Rhoades and Loveday, 1990; Flowers and Yeo, 1995). Plant growth and productivity is

reduced by higher concentrations of salt in the soil or water (Koca et al., 2007). Salt

stress has negative effect on germination, growth, physiology and productivity of the

plants by causing osmotic and ionic stresses (Iterbe-Ormaetxe et al., 1998) as well as

decreased photosynthetic efficiency (Munns, 2002; Sudhir and Murthy, 2004; Zobayed et

al., 2005), reduced chlorophyll biosynthesis (Khan, 2003), reduced lipid metabolism and

proteins biosynthesis (Geissler et al., 2009). Environmental stresses including salt stress,

can cause oxidative stress and production of reactive oxygen species (ROS), which leads

to plant injuries (Dat et al., 2000) by destroying the structure and function of the

membranes (Granger et al., 1986).

Heat shock proteins play important role in plant adaptations under stressed conditions

(Lindquist, 1986; Seki et al., 2002; Hong et al., 2003; Cho and Hong, 2006). Based on

molecular weight, heat shock proteins are classified into small molecular weight heat

shock proteins (~16-30KDa) and high molecular weight (40-110KDa) heat shock

proteins (Kalmar and Greensmith, 2009). Plant sHSPs are nuclear encoded proteins and

are divided into several subgroups based on their localization to different cellular

components like mitochondria, endoplasmic reticulum, chloroplast and cytoplasm

(Vierling, 1991; Boston et al., 1996; Waters et al., 1996). Small HSPs synthesis takes

place in heat shock response (HSR) and has been shown correlated with the plant

thermotolerance (Vierling, 1991). Recent studies showed that sHSPs protect the plants

from various type of environmental stresses other than high temperature stress (Guo et

al., 2007), e.g., elevated levels of tomato sHSP by exposure to γ-radiations (Ferullo et al.,

1994), increased mitochondrial sHSP expression under oxidative stress (Banzet et al.,

1998), high levels of cytosolic sHSP expression under ozone fumigation and

pathogenesis in parsley (Eckey-Kaltenbach et al., 1997) and increased potato cytosolic

sHSP expression under cold stress conditions etc. (van Berkel et al., 1994).



Abiotic Stresses 71

Nuclear encoded chloroplast small heat shock proteins (Cp-sHSPs) have three most

conserved regions named as Consensus I, II and III. Two conserved regions (consensus

region I & II) are present in all small heat shock proteins and while the third one

(consensus region III) is only specific to chloroplast small heat shock proteins and is also

called as methionine rich region (Chen and Vierling, 1991). Cp-sHSPs have crucial role

in photosynthetic protection against photo-inhibition and oxidative stress (Downs et al.,

1999). Similarly, plastid sHSPs have shown to play scavenging role for reactive oxygen

species like antioxidants (Hamilton and Heckathorn, 2001) and Cp-sHSPs play role in

PSII protection against oxidative and heat stress (Heckathorn et al., 1998; Wang and

Luthe, 2003; Shakeel et al., 2011; Kim et al., 2012).

Like other genes, Cp-sHSPs are also regulated by interaction of several heat shock factors

or heat shock elements for the regulation of HSP expression in plants (Mittal et al.,

2012). A class of eukaryotic heat shock elements called as perfect element (5'-

nGAAnnTTCnnGAAn-3') should have at least three adjacent inverted repeats of 5'-

nGAAn-3' to which heat shock factors (HSFs) can bind efficiently (Scharf et al., 2001).

Plants also contain perfect and imperfect heat shock elements for change the genetic

redundancy and functional diversification (Nover et al., 2001; Shakeel et al., 2011).

Therefore in Arabidopsis and sunflower, the complex network of HSFs have shown to

regulate the plant HSP genes (Guan et al., 2010). Specific members of sHSP genes have

been shown differentially induced by the combinations of HSFs specifically with

presence of an imperfect HSE in the promoter (Carranco et al., 1999; Almoguera et al.,

2002; Rojas et al., 2002; Díaz-Martín et al., 2005; Nishiwaza et al., 2006; Kotak et al.,

2007).

Previously, we have reported more than one family members of Cp-sHSP gene in

Chenopodium album, US ecotypes (Shakeel et al., 2011). Our previous data suggested

the presence of more than one putative stress related elements in promoter regions of Cp-

sHSP genes and their presence was related with their differential regulation under stress

conditions. Similarly we also presented some evidences about the involvement of one

CaHSP26.13p gene with differential regulation under heat and metal stress (chapter 03).

Here we present the evidences for the multiple role of CaHSP26.13p gene to protect plant



Abiotic Stresses 72

from cold, drought and salt stress conditions. We treated C. album plants with cold,

drought and salt stress. Full length transcripts were sequenced and compared followed by

differential expression studies of this novel family member of Cp-sHSP at proteins level.



Abiotic Stresses 73


4.2.1 Plant materials, growth conditions and heat/metal stresses

Chenopodium album (common name Bathou) is an odourless, annual herb with stalk,

opposite and simple leaves. C. album is a C3 dicotyledons weed belongs to family

Chenopodiaceae. Optimum growth temperature for C. album is 25ºC. Seeds were grown

in 3×5 inch pots and then transferred to growth chamber at either low (26°C/20°C

day/night) growth temperature regimes with 350μmol/m2 per second photosynthetic

photon flux density (PPFD). Plants with 6-8 leaves were used for each type of stress

treatment as described below.

Cold stress was given to the plants at 4°C with and without pre-heat treatment. Pre-heat

treatment was given to the plants at 30 & 37°C for 30 minutes before cold stress

exposure. Leaf samples were collected after 1hr, 3hrs, 5hrs and 7hrs of cold treatment at

4°C. Leaf samples were collected and stored at -80ºC for physiological and molecular

analysis. For drought stress, plants were separated from soil; roots were washed with

distilled water and were kept on clean filter paper for 1hr, 3hrs and 5hrs. The leave

samples were collected and used physiological and molecular analysis while control plant

samples were taken from plants grown under normal growth conditions. Similarly

different concentrations of NaCl salt were used for salt stress. Plants were separated from

the soil; roots were cleaned by distilled water and dipped in sodium chloride (NaCl) salt

solutions of 150mM, 200mM, 400mM, 600mM and 800mM concentrations. Leaf tissues

were collected after 4hrs of treatment to check the effect of salt stress on physiology of

the plants and Ca-sHSP gene expression analysis.

4.2.2 Physiological parameters

4.2.2.1 Chlorophyll contents

Leaf tissues (~0.5g) were used for chlorophyll contents measurement dipped in 10ml

DMSO (Hiscox and Israelstam, 1979). Samples were heated at 65°C for 2hrs and

Nanodrop 1000 spectrophotometer (Thermoscientific) was used to measure absorbance at

645nm and 665nm). Chlorophyll contents were calculated as,

Total chlorophyll = 20.2OD645 + 8.02OD665.



Abiotic Stresses 74

4.2.2.2 Superoxide dismutase (SOD)

Superoxide dismutase activity was determined using method of (Beauchamp and

Fridovich, 1971). Phosphate buffer (pH 7) containing 1% PVP was used to homogenize

all the treated samples in three replicates with the help of pastel and mortar. The

homogenate was centrifuged for 15 minutes at 3000rpm at 4°C and supernatant was used

for superoxide dismutase measurement at 560nm after 20 minutes exposure in light,

reference was treated in dark conditions. Absorbance was calculated by using Nanodrop

1000 spectrophotometer (Thermoscientific).

4.2.2.3 Peroxidase (POD)

POD measurement was done by mixing enzyme extract was p-phenylenediamine (0.1%),

0.05% H2O2 and 1.35ml 100mM MES buffer (pH 5.5) for assay (Vetter et al., 1958;

Gorin and Heidema, 1976). Changes in absorbance were recorded at 485nm for 3

minutes. Peroxidase enzyme value was calculated using following formula:

POD = final reading – initial reading

3

4.2.3 Photosystem II efficiency

To examine the effect of cold, drought and salts treatments on thermotolerance of in situ

Photosystem II efficiency in light-adapted plants was determined from chlorophyll

fluorescence analysis (Fv'/Fm') (Wang et al., 2008). Plants were grown at 25-26°C and ca.

1000 umol m-2

s-1

PAR, and Fv'/Fm' was measured at midday on recently-expanded fully-

illuminated leaves of intact plants after their respective stress treatments.

4.2.4 Statistical analysis

All experiments were replicated three times at each level and statistical analyses were

done by using one way ANOVA by SPSS16 software. Data was considered statistically

significant when differences among treatments was occurred as P<0.05.

4.2.5 Identification of Cp-sHSP genes

The CTAB method with some modification was used for genomic DNA isolation from

leaves of C. album (Zhang and Stewart, 2000). Degenerate primers were used to amplify

the most conserved met-rich and Consensus-I regions of Cp-sHSPs (Shakeel et al., 2011)



Abiotic Stresses 75

by using PCR conditions: denaturation at 95C, then 94C for 45sec, 54C for 45sec,

72C for 1min, a total of 29 cycles, with final extension step at 72C for 5min followed

by holding at 15C for 15min. The PCR products were then sequenced and confirmed.

4.2.6 PCR Amplification of full length Cp-sHSPs

Degenerate and gene specific primers were used for amplification of partial and full-

length gene for genome walking and cDNA RACE (Shakeel et al., 2011). PCR

amplification was done with initial polymerase activation at 95°C, 10 min; then 45 cycles

at 95°C, 10sec; 67°C, 0.5sec; 72°C, 11sec. PCR conditions were optimized for an

amplification efficiency of 95% for all primer pairs used. The PCR reactions were carried

out in a final volume of 25µL using 150ng DNA as template with Taq DNA polymerase

(Sigma Chemical Co., St. Louis, MO, USA). The products were separated by agarose gel

electrophoresis followed by sequencing.

4.2.7 RNA Isolation and reverse transcriptase reaction

4.2.7.1 Total RNA isolation

Treated and control plants were used for total RNA isolation using RNeasy® Plant Mini kit

(Qiagen) with on column DNase I treatment as given in chapter 3. RNA quantity was

measured by NanoDrop 1000 and quality was evaluated by agarose gel electrophoresis.

Approximately 3µg of total RNA of each treated and control sample was reverse transcribed

into cDNA by using Oligo dT primers and RNase H-minus reverse transcriptase from

ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA). Three biological and three

experimental replicates were used for cDNA synthesis.

4.2.7.2 First strand cDNA synthesis

First strand cDNA of 3µg was synthesized with Revert Aid first strand cDNA synthesis

Kit (Fermentas Cat. # K1621) with the protocol provided by supplier and oligo dT

primers were used for cDNA synthesis. Reaction mixture (RNA, Reaction Buffer, dNTPs

Mix, Oligo(dT)18 Primers, RiboLock™ RNase Inhibitor, RevertAid™ Reverse

Transcriptase, DEPC-treated Water) was incubated at 42°C for 60 minutes and

terminated the reaction by heating at 70°C for 10 minutes.



Abiotic Stresses 76

4.2.7.3 Reverse Transcriptase PCR (RT-PCR)

First strand cDNA was amplified with Cp-sHSP gene specific primers (Shakeel et al.,

2011). Reaction mixture (total volume 25µl) was prepared by adding 10ng cDNA

sample, 10X Taq buffer {750 mM Tris-HCl (pH 8.8 at 25°C), 200mM (NH4)2SO4, 0.1%

(v/v) Tween 20}, 0.2mM dNTPs, 2mM MgCl2, 1.25units Taq DNA polymerase

(Fermentas), 0.2mM each primer. Thermocycler conditions used were: denaturation at

95°C for 5 minutes, then at 95°C for 1 minute, 58°C for 1 minute, 72°C for 2.5 minute,

40 cycles and final extension at 72°C. 10µl of each amplified product was checked on 1%

agarose gel.

4.2.8 Sequencing of Cp-SHSPs

4.2.8.1 Purification of PCR product

PCR products were purified by using QIAquick® Gel Extraction Kit (Catalog # 28704

and 28706) according to manufacturer’s instructions and given in chapter 3.

4.2.8.2 Cloning and sequencing of transcripts

PCR product was cloned using Invitrogen cloning kit (pCR®8/GW/TOPO

®TA

Cloning®Kit, Catalog # K2500-20) according to manufacturer’s protocol. Transformed

bacterial culture (50µl) was spread on prewarmed LB agar plates containing 100µg/ml

spectinomycin and incubated at 37°C overnight. Individual colonies were used for

plasmid extraction next day. Plasmid DNA was purified using QIAprep Spin Miniprep

Kit (Catalog # 27104) according to provider’s instructions and sequenced.

4.2.9 Relative Quantification of Cp-sHSP transcripts in heat and metal treated

samples

Relative quantification of Cp-sHSP transcript was done by using β-tubilin gene as a

reference gene for real-time PCR (Applied Bio-system 7500). Reaction mixture (10µl)

was prepared by mixing 5.2µl Maxima SYBR Green qPCR Master Mix (2X), forward

and reverse primers (0.2mM each primer) and 8-10ng cDNA. Three biological and three

experimental replicates was used for each sample in two step cycling procedure. Pre-

treatment of Uracil DNA Glycosylase (UDG) was done at 50ºC for 2 minutes to degrade

double stranded DNA present in reaction mixture followed by 40 cycles of denaturation



Abiotic Stresses 77

at 95ºC for 15sec, annealing and extension at 58ºC for 1 minute. Non-treated and non-

template controls were also used as calibrator and to check the amplification. Data was

analyzed by ABI SDS software.

4.2.10 Cp-sHSP protein expression by Immunoblotting

Leaf tissues (0.2g) were homogenized in 2ml of SDS-PAGE sample buffer (0.0625 M

Tris-HCl pH 6.8, 25% (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) mercaptoethanol, 0.01%

(w/v) bromophenol blue). Protein concentrations were measured using the RC/DC

Protein Quantification Kit, (Bio-Rad). Almost 25ng of each protein sample was loaded on

SDS-PAGE Mini-PROTEAN cell (Bio-Rad Laboratories, Hercules, CA, USA) followed

by transfer onto nitrocellulose membranes (Sigma Chemical Co., St. Louis, MO, USA)

by using a semidry electroblotter (Owl Separation Systems, Portsmouth, NH, USA) for

1hr. The primary antibody, Abmet, which specifically recognizes the methionine-rich

region of Cp-sHSPs in plants (Downs and Heckathorn, 1998), was used in a dilution of

1:4,000 (v/v). While Bip antibody was used as an internal control. The Cp-sHSPs were

detected by Super Signal West Femto Maximum Sensitivity Substrate (PIERCE,

Rockford, IL) according to the manufacturer’s instructions.



Abiotic Stresses 78

4.3 Results

4.3.1 Effect of cold/drought/salt stress on physiological parameters

To find out the best conditions for isolations and expression of C. album Cp-sHSP genes,

we treated C. album plants with cold/drought and salt stress individually for

physiological analysis.

Cold stress was given to the plants at 4°C for different time periods (1hr, 3hrs, 5hrs and

7hrs). Our data showed that the total chlorophyll was decreased by low temperature stress

and the lowest level was observed after 7hrs of cold treatment. While significant increase

in superoxide dismutase and peroxidase enzymes was also observed with increased

duration of cold stress (Figure 4.1a). Drought treatment was given to the plants for 1-5hrs

as explained else where and control samples were kept at normal growth conditions.

Total chlorophyll was decreased with prolonged exposure to drought stress as expected

while the levels of superoxide dismutase and peroxidase enzymes were increased (Figure

4.1b). Similarly different concentrations of salt were also used to see the effect of salt on

C. album plants. We observed initially increase in total chlorophyll contents followed by

decrease at very high concentration of salt stress (Figure 4.1c). Statistically significant

increase in superoxide dismutase and peroxidase enzymes was also observed under high

salt concentrations (Figure 4.1c).

All the above results show significant effect of different concentrations and doses of cold,

drought and salt stress on C. album plants. Although the level and severity of each stress

was different for different treatments. Based on this important data, we selected few

specific conditions in each case for further molecular analysis and expression studies of

Cp-sHSP in C. album.

4.3.2 Effect of cold/drought/salt stress on thermotolerance of Photosystem II

The effect of cold, drought and salt stress on thermotolerance of in situ Photosystem II

efficiency in light-adapted plants was individually determined from chlorophyll

fluorescence analysis (Fv'/Fm') as described in (Wang et al., 2008). Plants were first

grown at 24-26°C and ca. 1000 mmol m-2

s-1

PAR, and treated with cold, drought and salt

stress followed by Fv'/Fm' measurement at midday on recently-expanded fully-illuminated



Abiotic Stresses 79

leaves of intact plants. Our data showed the effect of all stress treatments on the

photosynthetic rate of plants (Figure 4.2a, c & e). In the case of cold and drought stresses,

the photosynthesis rate (Fv'/Fm') was decreased but interestingly in the case of salt stress,

the Fv'/Fm' ratio was first increased at 150mM salt exposure and then decreased at higher

levels (Figure 4.2e).

To check initially the best conditions for accumulations of Cp-sHSP transcripts in cold

(3hrs at 4°C), drought (3hrs) and salt (200mM) treated samples, RT-PCR was performed

with degenerate primers (Shakeel et al., 2011) selected from the most conserved regions

of Cp-sHSPs (Shakeel et al., 2011). Somehow, only cold treatment at 4°C could not

initiate the Cp-sHSP accumulations or may be the transcript level was really low to

detect. So we slightly modified our procedure for cold treatment by giving pre-heat

treatment to plants at 37°C for 30 minutes followed by cold stress (Guo et al., 2007), all

the appropriate controls were used to avoid any misleading results. Our data showed the

presence of ~400bp fragments only in case of pre-heat treated samples (Figure 4.3a).

Absence of transcript in the case of control samples confirmed the cold induced

expression of Cp-sHSPs. Similarly, a significant amount of ~400bp Cp-sHSP transcript

accumulation was also observed in case of drought and salt treated samples (Figure 4.3b

& c).

Conclusively accumulations of Cp-sHSP transcripts in case of each type of stress shows

that these stress conditions can be used for isolation and characterizations of full length

Cp-sHSP transcripts and ultimately the respective genes in C. album.

4.3.3 Full-length Cp-sHSP gene sequencing

To isolate full length Ca-sHSP transcript/gene from cold, drought and salt treated

samples; we sequenced and analyzed the respective transcripts from Pakistani ecotype of

C. album. Sequence analysis of translated amino acid sequence of CaHSP26.13p isolated

from all types of treated samples showed presence of transit peptides and three highly

conserved regions, including the met-rich region, consensus II, and consensus I common to

all Cp-sHSPs.



Abiotic Stresses 80

The sequence analysis of all above three transcripts and translated proteins showed 100%

similarity with each other and with the previously identified CaHSP26.13p transcripts

isolated from heat and metal treated C. album (Pak ecotype) samples as given in chapter

3. The presence of same Cp-sHSP transcript (CaHSP26.13p) in heat, metal, cold, drought

and salt treated samples provides the evidence of regulation of same gene by different

environmental factors (Figure 4.3a).

We also compared CaHSP26.13p sequence of C. album (Pak ecotype) with already known

sequences of four family members of C. album (US ecotypes) (Shakeel et al., 2011). Our

data showed almost 99.8% similarity of CaHSP26.13p sequence to already reported Cp-

sHSPs of US ecotype of C. album. Only one amino acid difference (histidine H) was

observed in US ecotype and Pakistani ecotype in the region of transit peptide. Translated

CaHSP26.13p sequence was almost similar to CaHSP26.04m, CaHSP26.26m and

CaHSP26.23n with few differences in the transit peptide region (Figure 4.3b). This data

shows that this is a novel Cp-sHSP family member and expressed at transcript level under

cold, drought and salt stresses in C. album (Pakistani ecotype).

We also used CaHSP26.13p protein sequences for homology searches by BLAST (NCBI)

for initial confirmations of Cp-sHSPs and Cp-sHSP sequences of many other plants like

Vitis vinifera, Glycine max, Medicago truncatula, Senecio crataegifolius, Agrostis

stolonifera, Triticum aestivum, Arabidopsis thaliana, Oryza sativa, Agave Americana,

Spartina alterniflora, Ferocactus wislizenii, Solanum lycopersicum were downloaded.

Alignment of CaHSP26.13p protein sequence with the different homologues and

orthologues of Cp-sHSPs showed the presence of three highly conserved regions

(Consensus I, II & III) and transit peptide (IV),

Similarly phylogenetic analysis of CaHSP26.13p protein (including transit peptide) and

previously-known Cp-sHSPs of different plant species showed high sequence similarity

and the presence of two major groups of monocots and eudicots, indicative of diverse

nature of Cp-sHSP proteins among these selected plants (Figure 4.4b). Conclusively,

these results indicated that the same CaHSP26.13p gene is present in C. album (Pakistani

ecotype) and produces different transcripts under cold, drought and salt stresses as



Abiotic Stresses 81

predicted previously from unique promoter architecture of C. album (US ecotypes) in

previous study (Shakeel et al., 2011).

4.3.4 Cold/drought/salt regulated expression of Cp-sHSP

After initial confirmation and Cp-sHSP transcript analysis, we wanted to see the relative

expression of Cp-sHSPs treated with different types of stresses by real-time PCR in

comparison to control (non-treated) samples. For this purpose we checked the presence of

CaHSP26.13p transcript in C. album plants after cold, drought and salt treatment by

semi-quantitative RT-PCR by using gene specific primers to amplify ~300-400bp Cp-

sHSP fragments. β-tubilin was used as internal control. Cold stress alone at 4°C could not

initiate CaHSP26.13 gene expression. So we modified our method by addition of pre-heat

treatment as described before and significant amount of CaHSP26.13 transcript

expression was detected in different samples in cold (4°C) stress after pre-heat treatment

at 37°C for 30 minutes (Figure 4.5a). Similarly drought and salt regulated Cp-sHSP

expression was also observed in treated samples as compared to non-treated samples

(Figure 4.5b & c). Absence of CaHSP26.13 transcript in control conditions VS cold

stress conditions at 4°C (without pre-heat treatment) indicates the cold stress regulated

Cp-sHSP expression in the plants.

Finally we checked the effect of different duration of cold/drought stress and dose

response of salt stress on CaHSP26.13p transcript and protein levels by real-time PCR

and western blotting. Quantitative real-time PCR was conducted by using the above gene

specific primers to amplify ~300-400bp Cp-sHSP fragment to analyze the relative Cp-

sHSP expression. β-tubilin was used as internal control to normalize the data. While,

immunoblot analyses were done by using antibody specific to methionine rich region of

Cp-sHSP (Heckathorn et al., 1998) and relative levels of Cp-sHSPs were examined based

on the average of three experiments and normalized with Bip expression as loading

control (LC).

CaHSP26.13p gene was activated by pre-heat treatment at 37°C for 30 minutes plus cold

stress at 4°C, our data showed maximum transcript accumulation in 3hrs cold pre-heat

treated sample (Figure 4.6b). Pre-heat treatment at 37°C in case of cold stress resulted

higher levels of CaHSP26.13p transcript accumulation as compared to cold stress without



Abiotic Stresses 82

pre-treatment. Initially the Cp-sHSP expression under cold stress was less and then

reached to maximum levels in 3hrs of cold treatment followed by degradation due to

continuous chilling stress at 4°C. In the case of proteins, we detected only unprocessed

proteins (~26KDa) in 1-7hrs cold treated samples with maximum level of expression at

cold treatment for 1hr. Interestingly, pre-heat treated as well as control samples showed

no Cp-sHSP production (Figure 4.6b). Absence of Cp-sHSP in 37°C treated sample,

provides evidence that this particular Cp-sHSP isoform is regulated somehow at low

temperature stress too with and without pre-heat treatments.

To further exclude the possibility of Cp-sHSP transcript accumulation due to pre-heat

treatment at 37°C, we treated the plant samples at 30°C (much lower temperature near to

control conditions) for 30 minutes followed by cold stress and then real-time PCR was

done. Relative transcript abundance in this case showed same pattern of Cp-sHSP

accumulation in both cases (pre-heat treated samples at 30°C and 37°C followed by cold

stress), but relatively less transcript level was observed or in other words we can say that

preheat treated samples showed higher basal levels of CaHSP26.13p (Figure 4.6a). This

difference in basal levels of Cp-sHSPs at 37°C and 30°C pre-heat treatment for cold

stress does not affect Cp-sHSP production pattern. It only increases the basal level at

37°C treatment, which makes it easy for relative abundance analysis. This proved that

CaHSP26.13p gene is regulated by low temperature stress with or without pre-heat

treatment into different expression levels.

Similarly the Cp-sHSP gene expression patterns at transcript and protein levels were also

examined after drought stress. Transcript level was increased as a whole with maximum

transcript accumulation in 1-3hrs of drought stress (Figure 4.6c). While maximum levels of

unprocessed Cp-sHSP protein (~26KDa protein) was produced after 3hrs of drought stress.

Degradation of this Cp-sHSP form was also observed after 5hrs of drought stress as

expected due to disruption of cell metabolism after prolonged stress. Absence of Cp-sHSPs

expression in control samples shows the stress regulated expression of Cp-sHSP (Figure

4.6c). Difference in Cp-sHSP transcript and protein expression patterns provides evidence of

significant role of post-transcriptional modification in this plant under drought stress.



Abiotic Stresses 83

We also checked Cp-sHSP expression pattern in C. album samples treated with different

concentrations of salt. Ca-sHSP transcript level increased consistently with increase in

salt concentration and maximum transcript was accumulated in 800mM salt treated

sample (Figure 4.6d). While our data of western blotting for Cp-sHSP proteins expression

showed that unprocessed precursors Cp-sHSP form of ~26KDa was accumulated into

maximum levels in the case of 400mM salt treated sample (Figure 4.6d). Variation in

transcript and proteins level of Cp-sHSP provides evidence of post-transcriptional

modification under salt stress.

Taken all these results together, this data supports our initial hypothesis that Ca-sHSP

proteins may have multiple role in plant protection against cold, drought and salt stresses.

Absence of correlation in the expression pattern of CaHSP26.13p transcript and proteins

provides an evidence of post-transcriptional modification in C. album plant protection

against cold, drought and salt stress.



Abiotic Stresses 84

4.4 Discussion

Environmental stresses can have adverse effect on all organisms including plants. Usually

plants develop mechanisms against the sub-lethal changes in environmental conditions.

Several studies have co-related the production of Cp-sHSPs with the tolerance against

different abiotic stresses like cold stress (Guo et al., 2007), metal stress (Heckathorn et

al., 2004), heat stress (Knight and Ackerly, 2001; Heckathorn et al., 2002; Wang and

Luthe, 2003; Shakeel et al., 2011; Chauhan et al., 2012; Kim et al., 2012; Shakeel et al.,

2012) and oxidative stress (Vierling et al., 1986; Lee et al., 2000; Kim et al., 2012). Little

is known about the genes having multiple roles against abiotic stresses in the case of non

model plants. Recently we have reported about the presence of putative stress related

elements in the promoter region of Cp-sHSP genes of C. album (Shakeel et al., 2011).

Presence of these putative elements in the promoter region shows their importance in

more than one type of stresses. To investigate this, we isolated and characterized the Cp-

sHSP transcript of C. album (Pakistani ecotype). Here we present the evidences for the

regulation of the same Cp-sHSP gene under multiple abiotic stresses i.e. cold, drought

and salt stresses.

Cold stress affects the plants productivity and distribution throughout the world

(Theocharis et al., 2012). Some visible symptoms like necrosis, chlorosis and wilting

may be observed due to the changed physiological and biochemical functions (Ruelland

and Zachowski, 2010). Many other changes have been co-related with cold stress like

change in the composition and even in the structure of cell membrane (Uemura and

Steponkus, 1999; Matteucci et al., 2011), modification in the protoplasmic flow and

relocation of calcium ion within the cell (Knight et al., 1998). Change in electron flow to

another pathways as well as cellular leakage of amino acids and electrolytes may take

place due to low temperature stress (Seo et al., 2010). Enzyme activities and protein

content may also be changed (Ruelland and Zachowski, 2010). Plants can recover from

the brief exposure to cold stress while in the case of delayed exposure, plants necrosis or

death may be caused (Theocharis et al., 2012). To decrease the harmful effect of ROS,

plants produce enzymatic antioxidants like guaiacol peroxidase (GPX), catalase (CAT)

and superoxide dismutase (SOD) (Foyer et al., 1994) as well as ascorbate (AsA) and



Abiotic Stresses 85

glutathione (GSH) like non-enzymatic antioxidants (Liu et al., 2009). We observed

decrease in total chlorophyll contents with increase in time duration at low temperature

i.e. 4°C. Our data is supported by decrease in total chlorophyll of Paspalum dilatatum at

low temperature (Soares-Cordeiro et al., 2010). Statistical significant increase in

Superoxide dismutase and peroxidase enzymes was observed due to low temperature

stress. Increase in SOD enzyme has also been reported due to low temperature stress in

the case of Hippophae rhamnoides (Gupta and Deswal, 2012) and cucumber (Li et al.,

2011). Also researchers have shown increase in POD enzymes due to low temperature in

Eupatorium adenophorum (Lu et al., 2008), which supports our results.

Water deficiency affects plants growth and development (Cushman and Bohnert, 2000)

and causes seedling mortality (Villar-Salvador et al., 2004; Jorge et al., 2006). Drought

conditions may cause different reactions in the plant cells like reduced NADP+ is

generated due to stomata closure (Wilkinson and Davies, 2002) and superoxide radical

(O2•-) is formed (Cadenas, 1989). Reactive oxygen species (ROS) are generated due to

low water stress and cause cell death by membrane injury, lipid peroxidation, nucleic

acid and protein degradation (Apel and Hirt, 2004). We checked the effect of time course

of drought stress and measured total chlorophyll, SOD and POD of C. album plants.

Total chlorophyll showed declining trend with increased stress duration, while SOD and

POD were increased significantly. Similarly Decrease in total chlorophyll due to drought

stress, has been reported in plants like Picea abies (Ditmarova et al., 2009). Decrease in

total chlorophyll in drought stress was reported due to lowering capacity of the plants for

light harvesting (Mafakheri et al., 2010) and may be due to oxidative stress. Decrease in

chlorophyll contents may also be due to chlorophyll degradation and pigment photo-

oxidation (Shukla et al., 2012). SOD present in different compartments of the cell, may

activate the disproportionation of H2O2, O2 and O2•- (Fridovich, 1995). Many researchers

have reported increase in SOD due to drought stress (Franca et al., 2007; Ahmad et al.,

2010; Pandey et al., 2010; Faize et al., 2011).

Salt is another type of stress which affects plants badly due to three factors e.g. 1) change

in water status of the plant due to osmotic effect, 2) oxidative stress due to increase in ion

toxicity and 3) nutritional disturbance due to the change in essential nutrients absorption



Abiotic Stresses 86

(Hasegawa et al., 2000; Zhu, 2001; Munns, 2002). Our data showed increased total

chlorophyll initially with high concentration of the salt and maximum chlorophyll

contents were observed in 400mM salt treated sample. Chlorophyll contents were

decreased at very high concentration of salt. This increase in total chlorophyll contents

has co-relation with initial increase in the photosynthesis rate with salt treatment in our

case. The same pattern of initial increase and then decrease in total chlorophyll contents

due to salt stress, has been reported in Avicennia officinalis (Saravanavel et al., 2011).

SOD and POD have significantly increased by salt stress to C. album, showing the co-

relation with increased production of ROS due to salt stress. Increase in SOD and POD

enzymes activities due to salt stress, has been reported by many researchers in different

plants like rice (Nounjan et al., 2012), Lolium perenne (Hu et al., 2012) and safflower

(Siddiqi et al., 2011).

Thermotolerance of in situ Photosystem II efficiency was checked under cold, drought

and salt stresses. All three types of stresses affected the Photosystem II efficiency and

Fv'/Fm' ratios were decreased in stressed conditions. In the case of salt stress,

Photosystem II efficiency was increased initially with decrease in Fv'/Fm' ratios after high

dose of salt applied. These results of increased Photosystem II efficiency correlate with

the initial increased concentration of total chlorophyll contents in our case of salt

treatment. Cp-sHSP transcript was detected in cold treated with pre-heat treatment,

drought and salt treated samples while not in control conditions samples showing that

CaHSP26.13p gene is regulated by multiple stresses.

Based on above physiological data of C. album plants treated with cold, drought and salt

stresses, we selected following conditions for molecular analysis and Cp-sHSP gene

isolation. No CaHSP26.13p transcript was initially observed in the case of cold treatment

at 4°C without any pre-heat treatment showing no activation of CaHSP26.13p gene by

cold stress only. CaHSP26.13p gene was up-regulated by pre-heat treatment similar to in

CaHSP26 gene of sweet pepper which was activated by cold stress with pre-heat

treatment (Guo et al., 2007). Full length CaHSP26.13p gene in C. album (Pakistani

ecotype) was isolated and sequenced. Sequences of all three transcripts of cold, drought



Abiotic Stresses 87

and salt stressed samples were 100% similar showing that the same CaHSP26.13p gene is

regulated by multiple stresses as expected (Shakeel et al., 2011).

While real-time PCR data of cold stress with pre-heat treatment of 30°C showed less

basal level of CaHSP26.13p gene and the maximum transcript level of CaHSP26.13p

gene was observed in the case of 3hrs treated sample at 4°C after pre-heat treatment at

30°C for 30 minutes which was almost equal to the basal level. When cold stress was

given after pre-heat treatment at 37°C for 30 minutes then we observed proper activation

of CaHSP26.13p gene. Interestingly CaHSP26.13p gene was activated with highest level

of transcript at 37°C and the transcript level was first decreased in 1hr cold treated

sample but increased transcript level was observed after prolonged cold treatment with

highest level in 3hrs cold treated sample.

Only one unprocessed (precursor) Cp-sHSP form (~26KDa protein) was observed in the

cold treated samples with maximum level in 1hr cold treated sample but interestingly

there were no Cp-sHSP proteins detected in 37°C treated sample for 30 minutes showing

no protein synthesis at 37°C at-least for 30 minutes. CaHSP26.13p gene expression

showed no co-relation between transcript and proteins levels which indicates that post-

transcriptional modification occurs. Many researchers have correlated the accumulation

of sHSPs with tolerance against low temperature stress (Sabehat et al., 1996; Soto et al.,

1999; Neta-Sharir et al., 2005).

We also checked the expression pattern of CaHSP26.13p gene at transcript and proteins

level under drought stress. Transcript level was induced as a whole with highest transcript

accumulation in 1hr drought treated sample. Drought stress caused accumulation of only

one unprocessed Cp-sHSP (~26KDa proteins) in all drought treated samples with

maximum proteins level in the case of 3hrs treatment. We did not observe co-relation

between transcript and proteins level of CaHSP26.13p gene giving an evidence of post-

transcriptional modification.

Dose response of CaHSP26.13p gene at transcript and proteins level under salt stress

showed increased transcript level with high salt concentration with maximum transcript

accumulation in sample treated with 800mM salt. Similar to those of cold and drought

stresses, here we also observed only unprocessed Cp-sHSP (~26KDa proteins) with



Abiotic Stresses 88

maximum level in 400mM salt treated sample. Absence of correlation between

CaHSP26.13p gene transcript and proteins levels showed evidence of post-transcriptional

regulation.

Small HSPs are involved in heat shock response against different abiotic stresses,

wounding and developmental stages (Sun et al., 2002). Relative less is known about the

regulation of the organelle localized sHSPs under specific stress or combination of many

stresses. Transcriptional regulation may play role in expression of these genes. Different

conserved motifs have been reported to have quantitative effects on the expression of

AtHsp90 gene (Haralampidis et al., 2002), which shows the combinatorial interaction of

cis-regulatory elements to cope with multiple stresses. However, the role of Cis-elements

in regulation of single or multiple pathways other than heat shock response, have not

been identified as of yet. Taken all together this study provides a correlation of presence

of conserved motifs and HSE’s in the promoter regions of C. album to regulate the

accumulation of same isoforms of Cp-sHSP under cold, drought and salt stress. This

unique ability of C. album Cp-sHSP to express and protect plants from cold, drought and

salt stress can be potentially utilized for plant breeding and engineering to produce cold,

drought and salt tolerant plants or transgenic plants with rapid and over expressed Cp-

sHSPs to coop with severe environmental challenges.



Abiotic Stresses 89

Figure 4.1: Effect of low temperature, drought and salt stresses on total chlorophyll

contents, peroxidase (POD), superoxide dismutase (SOD) and Cp-sHSP transcript

of C. album leaves. C. album plants were exposed to cold stress at 4°C for 1-7hrs,

drought stress for 1-5hrs and treated with different concentrations of salt. All the treated

and control plants were used to determine chlorophyll contents, superoxide dismutase

(SOD) and peroxidase (POD). Each value represents the mean ±SE of three replicates. (a)

Total chlorophyll, SOD and POD of cold treated and control samples, (b) Total

chlorophyll, SOD and POD of drought treated and control samples and (c) Total

chlorophyll, SOD and POD of salt treated and control samples.



Abiotic Stresses 90

Figure 4.2. The effect of cold, drought and salt stress on thermotolerance of

Photosystem II efficiency and transcript levels. The effect of acute cold treatments on

thermotolerance of in situ Photosystem II efficiency in light-adapted plants was

determined from chlorophyll fluorescence analysis (Fv'/Fm') as in Wang et al., (2008).

Plants were grown at 25-26°C and ca. 1000mmol m-2

s-1

PAR and were cold treated at

4°C for 1-7hrs, after which Fv'/Fm' was measured at midday on recently-expanded fully-

illuminated leaves of intact plants at their (a) respective time at 4°C, (c) drought stress

and (e) treated with different concentrations of salt. Total RNA was isolated from all of

the controls (C) and treated samples (T) cold stress from leaves of C. album in three

individual replicates. (b) PCR and RT-PCR analysis of Cp-sHSP with and without pre-

heat treatment cold stress. (d) PCR and RT-PCR analysis of Cp-sHSP with and without

drought stress. (f) PCR and RT-PCR analysis of Cp-sHSP with and without salt stress.



Figure 4.3: Amino acid sequence alignment of CaHSP26.13p from all five (heat, metal, cold, drought and salt) stresses. (a)

Proteins sequences were obtained from Ca-sHSP gene sequences of all five stresses (heat, heavy metal, cold, drought and salt) and

were aligned using BioEdit software. Amino acid sequences of CaHSP26.13p from all five stresses are the same and 100% similar to

each other i.e. same gene is activated by all five abiotic stresses. (b) CaHSP26.13p protein sequence alignment with four Cp-sHSPs of

C. album US ecotypes. CaHSP26.13p protein is closest to CaHSP25.99n and also has too much similarity with other three Cp-sHSPs

of US ecotypes.



Abiotic Stresses 92

Figure 4.4: Amino acid sequence alignment and phylogenetic relationship of

CaHSP26.13p with other plants. (A) Alignment of deduced amino-acid sequences of

CaHSP26.13p isolated from C. album Pakistani ecotype. Bold lines at the top indicate the

transit peptide (I) and three conserved regions [met-rich region (II), con-II (III) and I (IV)

regions]. (B) Phylogenetic relationships of the CaHSP26.13p among diverse plants based

on whole-protein sequences, including transit peptide.



Abiotic Stresses 93

Figure 4.5: Effect of cold stress (a), drought stress (b) and salt stress (c) on Cp-sHSP

transcript of C. album leaves. Total RNA was isolated from all controls (C) and

cold/drought/salt treated samples of C. album in three individual replicates (1, 2 & 3 in

cold/drought/salt treatment case). (a) RT-PCR analyses of CaHSPp and β-tubilin (as an

internal control) genes in control and cold stressed (with and without pre-heat treatment)

samples. (b) RT-PCR analyses of CaHSPp and β-tubilin (as an internal control) genes

with and without drought stress. (c) RT-PCR analyses of CaHSPp and β-tubilin (as an

internal control) genes with and without salt stress.



Abiotic Stresses 94

Figure 4.6: Effect of cold, drought and salt stress on Cp-sHSP transcript and

protein. (a) Low temperature dependent response of Cp-sHSP transcript. Total RNA was

isolated from C. album leaf tissues after cold stress at 4C with pre-heat treatment at

30C for 30 minutes and control leaves were incubated at 25C. Quantitative real-time

PCR was conducted using gene specific primers of Cp-sHSP gene to analyze relative Cp-

sHSP expression. β-tubilin was used as internal controls to normalize samples. (b) Low

temperature dependent response of Cp-sHSP transcript and proteins. Total RNA was

isolated from C. album leaf tissues after cold stress at 4C with pre-heat treatment at

37C for 30 minutes and control leaves were incubated at 25C. Quantitative real-time

PCR was conducted using gene specific primers of Cp-sHSP gene to analyze relative Cp-

sHSP expression. β-tubilin was used as internal controls to normalize samples. Total



Abiotic Stresses 95

proteins (60mg) from leaves were extracted from the above mentioned cold treated

samples and separated on SDS-PAGE for immunoblot analysis, using antibody specific

to Cp-sHSP (Heckathorn et al., 1998). (c) Drought response expression patterns of Cp-

sHSP at protein and transcript levels. Total protein and RNA was isolated from C. album

leaf tissues after drought stress at for 1-5hrs; unstressed leaves (controls) were kept in

normal growth conditions. Quantitative real-time PCR was conducted using gene specific

primers of Cp-sHSP gene to analyze relative Cp-sHSP expression. β-tubilin was used as

internal controls to normalize samples. Total protein (60mg) from the leaves were

extracted from the above mentioned metal treated samples and separated on SDS-PAGE

for immunoblot analysis, using antibody specific to Cp-sHSP (Heckathorn et al., 1998).

(d) Salt dose dependent response of Cp-sHSP protein and transcript. Total protein and

RNA were isolated from leaf tissues of C. album leaf tissues after salt stress for 4hrs and

unstressed leaves (controls) were kept in normal growth conditions. Quantitative real-

time PCR was conducted using gene specific primers of Cp-sHSP gene to analyze

relative Cp-sHSP expression. β-tubilin was used as internal controls to normalize

samples. Total protein (60mg) from leaves were extracted from the above mentioned salt

treated samples and separated on SDS-PAGE for immunoblot analysis, using antibody

specific to Cp-sHSP (Heckathorn et al., 1998), normalized relative to the Bip loading

control (LC). Message levels for Cp-sHSPs (mRNA) were determined by real time PCR.

Conclusion

Conclusion


Abiotic Stresses 96

Conclusion

The main objective of this study was to check the effect of different abiotic stresses on

the expression of Cp-sHSP gene of C. album. First of all, we analyzed the promoter

region of C. album (US ecotypes) for the presence of putative cis-regulatory motifs.

Based on the presence of different stress related regulatory motifs in the promoter region

of Ca-sHSPs, we hypothesized that the same gene may have differential role in different

abiotic stresses. We checked the effect of multiple abiotic stresses on Ca-sHSP gene

transcript and protein levels and finally unique and novel findings support our hypothesis.

Different conclusive points are as follows.

Presence of more than one cis-regulatory element in Cp-sHSP promoters of

Chenopodium album (US ecotypes) shows a unique promoter architecture and

related thermotolerance.

Isolation and characterizations of novel full length Ca-sHSP transcripts from all leaf

samples treated with heat, metal, cold, drought and salt stress individually.

Relative expression of Cp-sHSP gene products and proteins of C. album (Pakistani

ecotype) under different abiotic stress conditions like heat, heavy metal, low

temperature, drought and salt stress.

Demonstration of multiple roles of a single C. album Cp-sHSP family member in

variety of environmental conditions by differential regulation.

Future aspects

Future aspects


Abiotic Stresses 97

Future aspects

(1) To explore the roles/regulations and weight matrixes of TFs of CaHSP26.13p

under combinations of abiotic stresses.

(2) Expression analysis of Cp-sHSP promoter with a reporter gene to examine the

expression patterns and interactions of transcription factors with yeast one hybrid system

in model plants like Arabidopsis or tobacco.

Chapter 05

References

Chapter 05 References


Abiotic Stresses 98

References

Abranches R, Shultz RW, Thompson WF, Allen GC (2005). Matrix attachment regions

and regulated transcription increase and stabilize transgene expression. Plant Biotechnol J

3: 535-543.

Agarwal M, Katiyar-Agarwal S, Grover A (2002). Plant Hsp100 proteins: structure,

function and regulation. Plant sciences 163: 397-405.

Agarwal M, Katiyar-Agarwal S, Sahi C, Gallie DR, Grover A (2001). Arabidopsis

thaliana Hsp100 proteins: kith and kin. Cell Stress Chaperones 6: 219-224.

Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006). Role of DREB transcription

factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep 25: 1263-1274.

Ahmad P, Jaleel CA, Salem MA, Nabi G, Sharma S (2010). Roles of enzymatic and

nonenzymatic antioxidants in plants during abiotic stress. Crit Rev Biotechnol 30: 161-

175.

Ahsan N, Renaut J, Komatsu S (2009). Recent developments in the application of

proteomics to the analysis of plant responses to heavy metals. Proteomics 9: 2602-2621.

Ahuja I, de Vos RC, Bones AM, Hall RD (2010). Plant molecular stress responses face

climate change. Trends Plant Sci 15: 664-674.

Alam J (1994). Multiple elements within the 5' distal enhancer of the mouse heme

oxygenase-1 gene mediate induction by heavy metals. J Biol Chem 269: 25049-25056.

Alam MM, Hayat S, Ali B, Ahmad A (2007). Effect of 28- homobrassinolide treatment

on nickel toxicity in Brassic juncea. Photosynthetica 45: 139-142.

Allen DJ, Ort DR (2001). Impacts of chilling temperatures on photosynthesis in warm-

climate plants. Trends Plant Sci 6: 36-42.

Almoguera C, Prieto-Dapena P, Jordano J (1998). Dual regulation of a heat shock

promoter during embryogenesis: stage-dependent role of heat shock elements. Plant J 13:

437-446.



Abiotic Stresses 99

Almoguera C, Rojas A, Diaz-Martin J, Prieto-Dapena P, Carranco R, Jordano J (2002). A

seed-specific heat-shock transcription factor involved in developmental regulation during

embryogenesis in sunflower. J Biol Chem 277: 43866-43872.

Almoguera C, Rojas A, Diaz-Martin J, Prieto-Dapena P, Carranco R, Jordano J (2002). A

seed-specific heat-shock transcription factor involved in developmental regulation during

embryogenesis in sunflower. J Biol Chem 277: 43866-43872.

Amin J, Ananthan J, Voellmy R (1988). Key features of heat shock regulatory elements.

Mol Cell Biol 8: 3761-37619.

Anderson JV, Li QB, Haskell DW, Guy CL (1994). Structural organization of the spinach

endoplasmic reticulum-luminal 70-kilodalton heat-shock cognate gene and expression of

70-kilodalton heat-shock genes during cold acclimation. Plant Physiol 104: 1359-1370.

Andjelkovic V, Thompson R (2006). Changes in gene expression in maize kernel in

response to water and salt stress. Plant Cell Rep 25: 71-79.

Apel K, Hirt H (2004). Reactive oxygen species: metabolism, oxidative stress, and signal

transduction. Annu Rev Plant Biol 55: 373-399.

Aranjuelo I, Molero G, Erice G, Avice JC, Nogues S (2010). Plant physiology and

proteomics reveals the leaf response to drought in alfalfa (Medicago sativa L.). J Exp Bot

62: 111-123.

Arora A, Sairam RK, Srivastava GC (2002). Oxidative stress and antioxidant system in

plants. Curr Sci 82: 1227–1238.

Arrigo AP, Landry J (1994). Expression and function of the low-molecular-weight heat

shock proteins. In: The biology of heat shock proteins and molecular chaperones, edited

by Morimoto RI, Tissieres A, Georgopoulos C. Cold Spring Harbor Laboratory Press:

Cold Spring Harbor, NY, p 335-373.

Ashburner M, Bonner JJ (1979). The induction of gene activity in drosophilia by heat

shock. Cell 17: 241-254.



Abiotic Stresses 100

Ashby RS, Megaw PL, Morgan IG (2009). Changes in retinal alphaB-crystallin (cryab)

RNA transcript levels during periods of altered ocular growth in chickens. Exp Eye Res

90: 238-243.

Balestrasse KB, Tomaro ML, Batlle A, Noriega GO (2010). The role of 5-aminolevulinic

acid in the response to cold stress in soybean plants. Phytochemistry 71: 2038-2045.

Banti V, Loreti E, Novi G, Santaniello A, Alpi A, Perata P (2008). Heat acclimation and

cross-tolerance against anoxia in Arabidopsis. Plant Cell Environ 31: 1029-1037.

Banzet N, Richaud C, Deveaux Y, Kazmaier M, Gagnon J, Triantaphylides C (1998).

Accumulation of small heat shock proteins, including mitochondrial HSP22, induced by

oxidative stress and adaptive response in tomato cells. Plant J 13: 519-527.

Barkla BJ, Vera-Estrella R, Hernandez-Coronado M, Pantoja O (2009). Quantitative

proteomics of the tonoplast reveals a role for glycolytic enzymes in salt tolerance. Plant

Cell 21: 4044-4058.

Barua D, Downs CA, Heckathorn SA (2003). Variation in chloroplast small heat-shock

protein function is a major determinant of variation in thermotolerance of photosynthetic

electron transport among ecotypes of Chenopodium album. Functional Plant Biology 30:

1071-1079.

Barua D, Heckathorn SA, Coleman JS (2008). Variation in heat-shock proteins and

photosynthetic thermotolerance among natural populations of Chenopodium album L.

from contrasting thermal environments: implications for plant responses to global

warming. J Integr Plant Biol 50: 1440-1451.

Batra G, Chauhan VS, Singh A, Sarkar NK, Grover A (2007). Complexity of rice Hsp100

gene family: lessons from rice genome sequence data. J Biosci 32: 611-619.

Beauchamp C, Fridovich I (1971). Superoxide dismutase: improved assay and an assay

applicable to acrylamide gels. Analytical Biochemistry 44: 276-287.

Bekesiova B, Hraska S, Libantova J, Moravcikova J, Matusikova I (2008). Heavy-metal

stress induced accumulation of chitinase isoforms in plants. Mol Biol Rep 35: 579-588.




Berardini TZ, Bollman K, Sun H, Poethig RS (2001). Regulation of vegetative phase

change in Arabidopsis thaliana by cyclophilin 40. Science 291: 2405-2407.

Bernhard Teicher H, Lindberg Moller B, Vibe Scheller H (2000). Photoinhibition of

Photosystem I in field-grown barley (Hordeum vulgare L.): Induction, recovery and

acclimation. Photosynth Res 64: 53-61.

Berry J, Bjorkman O (1980). Photosynthetic response and adaptation to temperature in

higher plants. Annu Rev Plant Physiol 31: 491-543.

Bonnecarrere V, Borsani O, Diaz P, Capdevielle F, Blanco P, Monza J (2011). Response

to photoxidative stress induced by cold in japonica rice is genotype dependent. Plant Sci

180: 726-732.

Bonner JJ, Ballou C, Fackenthal DL (1994). Interactions between DNA-bound trimers of

the yeast heat shock factor. Mol Cell Biol 14: 501-508.

Boston RS, Viitanen PV, Vierling E (1996). Molecular chaperones and protein folding in

plants. Plant Mol Biol 32: 191-222.

Boudsocq M, Lauriere C (2005). Osmotic signaling in plants: multiple pathways

mediated by emerging kinase families. Plant Physiol 138: 1185-1194.

Boyer JS (1982). Plant productivity and environment. Science 218: 443-448.

Bray EA (2004). Genes commonly regulated by water-deficit stress in Arabidopsis

thaliana. J Exp Bot 55: 2331-2341.

Bressan R, Bohnert H, Zhu JK (2009). Abiotic stress tolerance: from gene discovery in

model organisms to crop improvement. Mol Plant 2: 1-2.

Brooker RW (2006). Plant-plant interactions and environmental change. New Phytol 171:

271-284.

Burke JJ, o’Mahony PJ, Olive MJ (2000). Isolation of Arabidopsis mutants lacking

components of acquired thermotolerance. Plant Physiol 123: 575-587.

Burua D, Downs CA, Heckathorn SA (2003). Variation in chloroplast small heat shock

protein function is a major determinant of variation in thermotolerance of photosynthetic




electron transport among ecotypes of Chenopodium album. Funct Plant Biol 30: 1071-

1079.

Busch W, Wunderlich M, Schoffl F (2005). Identification of novel heat shock factor-

dependent genes and biochemical pathways in Arabidopsis thaliana. Plant J 41: 1-14.

Cadenas E (1989). Biochemistry of oxygen toxicity. Annu Rev Biochem 58: 79-110.

Campbell JL, Klueva NY, Zheng HG, Nieto-Sotelo J, Ho TD, Nguyen HT (2001).

Cloning of new members of heat shock protein HSP101 gene family in wheat (Triticum

aestivum (L.) Moench) inducible by heat, dehydration, and ABA(1). Biochim Biophys

Acta 1517: 270-277.

Cao D, Froehlich JE, Zhang H, Cheng C-L (2003). The chlorateresistant and

photomorphogenesis-defective mutant cr88 encodes a chloroplast targeted HSP90. The

Plant Journal 33: 107-118.

Cao Z, Jia Z, Liu Y, Wang M, Zhao J, Zheng J, Wang G (2010). Constitutive expression

of ZmsHSP in Arabidopsis enhances their cytokinin sensitivity. Mol Biol Rep 37: 1089-

1097.

Capell T, Escobar C, Liu H, Burtin D, Lepri O, Christou P (1998). Over-expression of the

oat arginine decarboxylase cDNA in transgenic rice (Oryza sativa L.) affects normal

development patterns in vitro and results in putrescine accumulation in transgenic plants.

Theor Appl Genet 97: 246-254.

Carranco R, Almoguera C, Jordano J (1999). An imperfect heat shock element and

different upstream sequences are required for the seed-specific expression of a small heat

shock protein gene. Plant Physiol 121: 723-730.

Chae L, Sudat S, Dudoit S, Zhu T, Luan S (2009). Diverse transcriptional programs

associated with environmental stress and hormones in the Arabidopsis receptor-like

kinase gene family. Mol Plant 2: 84-107.

Chauhan H, Khurana N, Agarwal P, Khurana P (2011). Heat shock factors in rice (Oryza

sativa L.): genome-wide expression analysis during reproductive development and

abiotic stress. Mol Genet Genomics 286: 171-187.




Chauhan H, Khurana N, Nijhavan A, Khurana JP, Khurana P (2012). The Wheat

Chloroplastic Small Heat Shock protein (sHSP26) is involved in Seed Maturation and

germination and Imparts Tolerance to Heat Stress. Plant Cell Environ

Chaves MM, Flexas J, Pinheiro C (2009). Photosynthesis under drought and salt stress:

regulation mechanisms from whole plant to cell. Ann Bot 103: 551-560.

Chen CH, Zhou QX, Cai Z, Wang YY (2010). Effects of soil polycyclic musk and

cadmium on pollutant uptake and biochemical responses of wheat (Triticum aestivum).

Arch Environ Contam Toxicol 59: 564-573.

Chen J, Burke JJ, Velten J, Xin Z (2006). FtsH11 protease plays a critical role in

Arabidopsis thermotolerance. Plant J 48: 73-84.

Chen Q, Osteryoung K, Vierling E (1994). A 21-kDa chloroplast heat shock protein

assembles into high molecular weight complexes in vivo and in organelle. J Biol Chem

269: 13216-13223.

Chen Q, Vierling E (1991). Analysis of conserved domains identifies a unique structural

feature of a chloroplast heat shock protein. Mol Gen Genet 226: 425-431.

Chinn AM, Comai L (1996). The heat shock cognate 80 gene of tomato is flanked by

matrix attachment regions. Plant Molecular Biology 32: 959-968.

Chinnusamy V, Zhu J, Zhu JK (2007). Cold stress regulation of gene expression in

plants. Trends Plant Sci 12: 444-451.

Cho EK, Hong CB (2004). Molecular cloning and expression pattern analyses of heat

shock protein 70 genes from Nicotiana tabacum. J Plant Biol 47: 149–159.

Cho EK, Hong CB (2006). Overexpression of tobacco NtHSP70-1 contributes to

drought-stress tolerance in plants. Plant Cell Rep 25: 349-358.

Clemens S (2006). Toxic metal accumulation, responses to exposure and mechanisms of

tolerance in plants. Biochimie 88: 1707-1719.

Cobbett CS (2000). Phytochelatins and their roles in heavy metal detoxification. Plant

Physiol 123: 825-832.




Colinet H, Lee SF, Hoffmann A (2009). Temporal expression of heat shock genes during

cold stress and recovery from chill coma in adult Drosophila melanogaster. Febs J 277:

174-185.

Collinge M, Boller T (2001). Differential induction of two potato genes, Stprx2 and

StNAC, in response to infection by Phytophthora infestans and to wounding. Plant Mol

Biol 46: 521-529.

Craig EA, Gambill BD, Nelson RJ (1993). Heat shock proteins: molecular chaperones of

protein biogenesis. Microbiol Rev 57: 402-414.

Cseke LJ, Tsai CJ, Rogers A, Nelsen MP, White HL, Karnosky DF, Podila GK (2009).

Transcriptomic comparison in the leaves of two aspen genotypes having similar carbon

assimilation rates but different partitioning patterns under elevated [CO2]. New Phytol

182: 891-911.

Culotta VC, Hamer DH (1989). Fine mapping of a mouse metallothionein gene metal

response element. Mol Cell Biol 9: 1376-1380.

Cushman JC, Bohnert HJ (2000). Genomic approaches to plant stress tolerance. Curr

Opin Plant Biol 3: 117-124.

Dafny-Yelin M, Tzfira T, Vainstein A, Adam Z (2008). Nonredundant functions of

sHSP-CIs in acquired thermotolerance and their role in early seed development in

Arabidopsis. Plant Mol Biol 67: 363–373.

Dangl JL, Jones JD (2001). Plant pathogens and integrated defence responses to

infection. Nature 411: 826-833.

Dat J, Vandenabeele S, Vranova E, Van Montagu M, Inze D, Van Breusegem F (2000).

Dual action of the active oxygen species during plant stress responses. Cell Mol Life Sci

57: 779-795.

de Jong WW, Caspers GJ, Leunissen JA (1998). Genealogy of the alpha-crystallin--small

heat-shock protein superfamily. Int J Biol Macromol 22: 151-162.




Deeba F, Pandey AK, Ranjan S, Mishra A, Singh R, Sharma YK, Shirke PA, Pandey V

(2012). Physiological and proteomic responses of cotton (Gossypium herbaceum L.) to

drought stress. Plant Physiol Biochem 53: 6-18.

Dhaubhadel S, Chaudhary S, Dobinson KF, Krishna P (1999). Treatment with 24-

epibrassinolide, a brassinosteroid, increases the basic thermotolerance of Brassica napus

and tomato seedlings. Plant Molecular Biology 40: 333-342.

Díaz-Martín J, Almoguera C, Prieto-Dapena P, Espinosa JM, Jordano J (2005).

Functional Interaction between Two Transcription Factors Involved in the

Developmental Regulation of a Small Heat Stress Protein Gene Promoter. Plant

Physiology 139: 1483-1494.

Dietz KJ, Pfannschmidt T (2011). Novel regulators in photosynthetic redox control of

plant metabolism and gene expression. Plant Physiol 155: 1477-1485.

Ditmarova L, Kurjak D, Palmroth S, Kmet J, Strelcova K (2009). Physiological responses

of Norway spruce (Picea abies) seedlings to drought stress. Tree Physiol 30: 205-213.

Dong J, Wu FB, Zhang GP (2005). Effect of cadmium on growth and photosynthesis of

tomato seedlings. J Zhejiang Univ Sci B 6: 974-980.

Downs CA, Coleman JS, Heckathorn SA (1999a). The chloroplast 22-kD heat-shock

protein: a lumenal protein that associates with the oxygen evolving complex and protects

Photosystem II during heat stress. J Plant Physiol

Downs CA, Heckathorn SA (1998). The mitochondrial small heat-shock protein protects

NADH:ubiquinone oxidoreductase of the electron transport chain during heat stress in

plants. FEBS Lett 430: 246-250.

Downs CA, Heckathorn SA, Bryan JK, Coleman JS (1998). The methionine-rich low-

molecular-weight chloroplast heat-shock protein: evolutionary conservation and

accumulation in relation to thermotolerance. Am J Bot 85: 175-183.

Downs CA, Ryan SL, Heckathorn SA (1999b). The chloroplast small heat shock protein:

evidence for a general role in protecting photosystem II against oxidative stress and

photoinhibition. J Plant Physiol 155: 488-496.




Drazkiewicz M, Skozynska-Polit E, Wanke M, Swiezewska E (2003). The activity of

antioxidant enzymes in Arabidopsis thaliana exposed to colchicine and H2O2. Cell Mol

Biol Lett 8: 777-781.

Eckey-Kaltenbach H, Kiefer E, Grosskopf E, Ernst D, Sandermann HJ (1997).

Differential transcript induction of parsley pathogenesis-related proteins and of a small

heat shock protein by ozone and heat shock. Plant Mol Biol 33: 343-350.

Engelbrecht BM, Comita LS, Condit R, Kursar TA, Tyree MT, Turner BL, Hubbell SP

(2007). Drought sensitivity shapes species distribution patterns in tropical forests. Nature

447: 80-82.

Faize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G, Clemente-Moreno

MJ, Alcobendas R, Artlip T, Hernandez JA (2011). Involvement of cytosolic ascorbate

peroxidase and Cu/Zn-superoxide dismutase for improved tolerance against drought

stress. J Exp Bot 62: 2599-2613.

Feder ME, Hofmann GE (1999). Heat-shock proteins, molecular chaperones, and the

stress response: evolutionary and ecological physiology. Annu Rev Physiol 61: 243-282.

Ferullo JM, Nespoulous L, Triantaphylides C (1994). Gamma-ray-induced changes in the

synthesis of tomato pericarp protein. Plant Cell Environ 17: 901-911.

Fini A, Guidi L, Ferrini F, Brunetti C, Di Ferdinando M, Biricolti S, Pollastri S, Calamai

L, Tattini M (2012). Drought stress has contrasting effects on antioxidant enzymes

activity and phenylpropanoid biosynthesis in Fraxinus ornus leaves: An excess light

stress affair? J Plant Physiol 169: 929-939.

Fink AL (1999). Chaperone-mediated protein folding. Physiol Rev 79: 425-449.

Flexas J, Diaz-Espejo A, Galmes J, Kaldenhoff R, Medrano H, Ribas-Carbo M (2007).

Rapid variations of mesophyll conductance in response to changes in CO2 concentration

around leaves. Plant Cell Environ 30: 1284-1298.

Flowers T, Yeo A (1995). Breeding for salinity resistance in crop plants: where next?

Aust J Plant Physiol 22: 875-884.




Flowers TJ, Colmer TD (2008). Salinity tolerance in halophytes. New Phytol 179: 945-

963.

Fowler S, Thomashow MF (2002). Arabidopsis transcriptome profiling indicates that

multiple regulatory pathways are activated during cold acclimation in addition to the CBF

cold response pathway. Plant Cell 14: 1675-1690.

Foyer CH, Descourvieres P, Kunert KJ (1994). Protection against oxygen radicals: an

important defence mechanism studied in transgenic plants. Plant Cell Environ 17: 507-

523.

Foyer CH, Noctor G (2009). Redox regulation in photosynthetic organisms: signaling,

acclimation, and practical implications. Antioxid Redox Signal 11: 861-905.

Foyer CH, Shigeoka S (2011). Understanding oxidative stress and antioxidant functions

to enhance photosynthesis. Plant Physiol 155: 93-100.

Franca MB, Panek AD, Eleutherio EC (2007). Oxidative stress and its effects during

dehydration. Comp Biochem Physiol A Mol Integr Physiol 146: 621-631.

Frank G, Pressman E, Ophir R, Althan L, Shaked R, Freedman M, Shen S, Firon N

(2009). Transcriptional profiling of maturing tomato (Solanum lycopersicum L.)

microspores reveals the involvement of heat shock proteins, ROS scavengers, hormones,

and sugars in the heat stress response. J Exp Bot 60: 3891-3908.

Fridovich I (1995). Superoxide radical and superoxide dismutases. Annu Rev Biochem

64: 97-112.

Fu X, Zhang H, Zhang X, Cao Y, Jiao W, Liu C, Song Y, Abulimiti A, Chang Z (2005).

A dual role for the N-terminal region of Mycobacterium tuberculosis Hsp16.3 in self-

oligomerization and binding denaturing substrate proteins. J Biol Chem 280: 6337-6348.

Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka Y (2004).

Function, intracellular localization and the importance in salt tolerance of a vacuolar

Na(+)/H(+) antiporter from rice. Plant Cell Physiol 45: 146-159.

Gajewska E, Sklodowska M (2007). Effect of nickel on ROS content and antioxidative

enzyme activities in wheat leaves. Biometals 20: 27-36.




Ganeshan S, Vitamvas P, Fowler DB, Chibbar RN (2008). Quantitative expression

analysis of selected COR genes reveals their differential expression in leaf and crown

tissues of wheat (Triticum aestivum L.) during an extended low temperature acclimation

regimen. J Exp Bot 59: 2393-2402.

Gao C, Jiang B, Wang Y, Liu G, Yang C (2011). Overexpression of a heat shock protein

(ThHSP18.3) from Tamarix hispida confers stress tolerance to yeast. Mol Biol Rep

Garavaglia BS, Garafalo CG, Orellano EG, Ottado J (2009). Hsp70 and Hsp90

expression in citrus and pepper plants in response to Xanthomonas axonopodis pv. Citri

Eur J Plant Pathol 123: 91-97.

Geissler N, Hussin S, Koyro HW (2009). Interactive effects of NaCl salinity and elevated

atmospheric CO2 concentration on growth, photosynthesis, water relations and chemical

composition of the potential cash crop halophyte Aster tripolium L. Environ Exp Bot 65:

220-231.

Gill SS, Tuteja N (2010). Polyamines and abiotic stress tolerance in plants. Plant Signal

Behav 5:

Gkouvitsas T, Kontogiannatos D, Kourti A (2008). Differential expression of two small

Hsps during diapause in the corn stalk borer Sesamia nonagrioides (Lef.). J Insect

Physiol 54: 1503-1510.

Gorin N, Heidema FT (1976). Peroxidase activity in golden delicious apples as a possible

parameter of ripening and senescence. Journal of Agricultural and Food Chemistry 24:

200-201.

Gottesman S, Squires C, Pichersky E, Carrington M, Hobbs M, Mattick JS, Dalrymple B,

Kuramitsu H, Shiroza T, Foster T, et al. (1990). Conservation of the regulatory subunit

for the Clp ATP-dependent protease in prokaryotes and eukaryotes. Proc Natl Acad Sci U

S A 87: 3513-3517.

Gounaris K, Brain ARR, Quinn PJ, Williams WP (1984). Structural reorganization of

chloroplast thylakoid membranes in response to heat-stress. Biochimica et Biophysica

Acta 766: 198–208.




Granger DN, Hollwarth ME, Parks DA (1986). Ischemia-reperfusion injury: role of

oxygen-derived free radicals. Acta Physiol Scand Suppl 548: 47-63.

Guan JC, Jinn TL, Yeh CH, Feng SP, Chen YM, Lin CY (2004). Characterization of the

genomic structures and selective expression profiles of nine class I small heat shock

protein genes clustered on two chromosomes in rice (Oryza sativa L.). Plant Mol Biol 56:

795-809.

Guan JC, Yeh CH, Lin YP, Ke YT, Chen MT, You JW, Liu YH, Lu CA, Wu SJ, Lin CY

(2010). A 9 bp cis-element in the promoters of class I small heat shock protein genes on

chromosome 3 in rice mediates L-azetidine-2-carboxylic acid and heat shock responses. J

Exp Bot 61: 4249-4261.

Gulli M, Rampino P, Lupotto E, Marmirolia N, Perrotta C (2005). The effect of heat

stress and cadmium ions on the expression of a small hsp gene in barley and maize.

Journal of Cereal Science 42: 25-31.

Guo L, Chen S, Liu K, Liu Y, Ni L, Zhang K, Zhang L (2008). Isolation of heat shock

factor HsfA1a-binding sites in vivo revealed variations of heat shock elements in

Arabidopsis thaliana. Plant Cell Physiol 49: 1306-1315.

Guo SJ, Zhou HY, Zhang XS, Li XG, Meng QW (2007). Overexpression of CaHSP26 in

transgenic tobacco alleviates photoinhibition of PSII and PSI during chilling stress under

low irradiance. J Plant Physiol 164: 126-136.

Gupta R, Deswal R (2012). Low Temperature Stress Modulated Secretome Analysis and

Purification of Antifreeze Protein from Hippophae rhamnoides, a Himalayan Wonder

Plant. J Proteome Res 11: 2684-2696.

Gustavsson N, Harndahl U, Emanuelsson A, Roepstorff P, Sundby C (1999). Methionine

sulfoxidation of the chloroplast small heat shock protein and conformational changes in

the oligomer. Protein Sci 8: 2506-2512.

Hall JL (2002). Cellular mechanisms for heavy metal detoxification and tolerance. J Exp

Bot 53: 1-11.




Halliwell B (2006). Reactive species and antioxidants. Redox biology is a fundamental

theme of aerobic life. Plant Physiol 141: 312-322.

Hamilton EW, Heckathorn SA (2001). Mitochondrial adaptations to NaCl. Complex I is

protected by anti-oxidants and small heat shock proteins, whereas complex II is protected

by proline and betaine. Plant Physiol 126: 1266-1274.

Hamilton Iii EW, Coleman JS (2001). Heat-shock proteins are induced in unstressed

leaves of Nicotiana attenuata (Solanaceae) when distant leaves are stressed. Am J Bot

88: 950-955.

Haq NU, Raza S, Luthe DS, Heckathorn SA, Shakeel SN (2012). Dual role for

Chenopodium album chloroplast small heat shock protein: Photosystem II protection

from heat and metal stresses. Plant Molecular Biology Reporter DOI 10.1007/s11105-

012-0516-5.

Haralampidis K, Milioni D, Rigas S, Hatzopoulos P (2002). Combinatorial interaction of

cis elements specifies the expression of the Arabidopsis AtHsp90-1 gene. Plant Physiol

129: 1138-1149.

Hart JJ, Welch RM, Norvell WA, Kochian LV (2006). Characterization of cadmium

uptake, translocation and storage in near-isogenic lines of durum wheat that differ in

grain cadmium concentration. New Phytol 172: 261-271.

Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000). Plant Cellular and Molecular

Responses to High Salinity. Annu Rev Plant Physiol Plant Mol Biol 51: 463-499.

He Z, Xie R, Wang Y, Zou H, Zhu J, Yu G (2008). Cloning and characterization of a heat

shock protein 70 gene, MsHSP70-1, in Medicago sativa. Acta Biochim Biophys Sin

(Shanghai) 40: 209-216.

Heckathorn SA, Downs CA, Coleman JS (1999). Small Heat Shock Proteins Protect

Electron Transport in Chloroplasts and Mitochondria During Stress. Amer Zool 39: 865-

876.




Heckathorn SA, Downs CA, Sharkey TD, Coleman JS (1998). The small, methionine-

rich chloroplast heat-shock protein protects photosystem II electron transport during heat

stress. Plant Physiol 116: 439-444.

Heckathorn SA, Mueller JK, LaGuidice S, Zhu B, Barrett T, Blair B, Dong Y (2004).

Chloroplast small heat-shock proteins protect photosynthesis during heavy metal stress.

Am. J. Bot. 91: 1312-1318.

Heckathorn SA, Poeller GJ, Coleman JS, Hallberg RL (1996). Nitrogen availability alters

patterns of accumulation of heat stress-induced proteins in plants. Oecologia 105: 413-

418.

Heckathorn SA, Ryan SL, Baylis JA, Wang D, Hamilton IEW, Cundiff L, Luthe DS

(2002). In vivo evidence from an Agrostis stolonifera selection genotype that chloroplast

small heat-shock proteins can protect photosystem II during heat stress. Funct Plant Biol

29: 933-944.

Hiscox JD, Israelstam GF (1979). A method for the extraction of chlorophyll from leaf

tissue without maceration. Canadian Journal of Botany 57: 1332-1334.

Hong B, Ma C, Yang Y, Wang T, Yamaguchi-Shinozaki K, Gao J (2009). Over-

expression of AtDREB1A in chrysanthemum enhances tolerance to heat stress. Plant Mol

Biol 70: 231-240.

Hong SW, Lee U, Vierling E (2003). Arabidopsis hot mutants define multiple functions

required for acclimation to high temperatures. Plant Physiol 132: 757-767.

Hsieh MH, Chen JT, Jinn TL, Chen YM, Lin CY (1992). A class of soybean low

molecular weight heat shock proteins : immunological study and quantitation. Plant

Physiol 99: 1279-1284.

Hsieh TH, Lee JT, Charng YY, Chan MT (2002). Tomato plants ectopically expressing

Arabidopsis CBF1 show enhanced resistance to water deficit stress. Plant Physiol 130:

618-626.




Hu L, Li H, Pang H, Fu J (2012). Responses of antioxidant gene, protein and enzymes to

salinity stress in two genotypes of perennial ryegrass (Lolium perenne) differing in salt

tolerance. J Plant Physiol 169: 146-156.

Huang B, Xu C (2008). Identification and characterization of proteins associated with

plant tolerance to heat stress. J Integr Plant Biol 50: 1230-1237.

Huang GY, Wang YS (2010). Physiological and biochemical responses in the leaves of

two mangrove plant seedlings (Kandelia candel and Bruguiera gymnorrhiza) exposed to

multiple heavy metals. J Hazard Mater 182: 848-854.

Hubel A, Schoffl F (1994). Arabidopsis heat shock factor: isolation and characterization

of the gene and the recombinant protein. Plant Mol Biol 26: 353-362.

Ilik P, Kouril R, Kruk J, Mysliwa-Kurdziel B, Popelkova H, Strzalka K, Naus J (2003).

Origin of chlorophyll fluorescence in plants at 55-75 degrees C. Photochem Photobiol 77:

68-76.

Ingle RA, Smith JA, Sweetlove LJ (2005). Responses to nickel in the proteome of the

hyperaccumulator plant Alyssum lesbiacum. Biometals 18: 627-641.

Iterbe-Ormaetxe I, Escuredo PR, Arrese-Igor C, Becana M (1998). Oxidative damage in

pea plants exposed to water deficit of paraquat. Plant Physiol 161: 173-181.

Ivanov AG, Morgan RM, Gray GR, Velitchkova MY, Huner NP (1998).

Temperature/light dependent development of selective resistance to photoinhibition of

photosystem I. FEBS Lett 430: 288-292.

Jaleel CA, Manivannan P, Lakshmanan GM, Gomathinayagam M, Panneerselvam R

(2008). Alterations in morphological parameters and photosynthetic pigment responses of

Catharanthus roseus under soil water deficits. Colloids Surf B Biointerfaces 61: 298-303.

Jeong SW, Choi SM, Lee DS, Ahn SN, Hur Y, Chow WS, Park YI (2002). Differential

susceptibility of photosynthesis to light-chilling stress in rice (Oryza sativa l.) depends on

the capacity for photochemical dissipation of light. Mol Cells 13: 419-428.

Jeong YC, Nakamura J, Upton PB, Swenberg JA (2005). Pyrimido[1,2-a]-purin-10(3H)-

one, M1G, is less prone to artifact than base oxidation. Nucleic Acids Res 33: 6426-6434.




Jin CW, Du ST, Chen WW, Li GX, Zhang YS, Zheng SJ (2009). Elevated carbon dioxide

improves plant iron nutrition through enhancing the iron-deficiency-induced responses

under iron-limited conditions in tomato. Plant Physiol 150: 272-280.

Jorge I, Navarro RM, Lenz C, Ariza D, Jorrin J (2006). Variation in the holm oak leaf

proteome at different plant developmental stages, between provenances and in response

to drought stress. Proteomics 6: 207-214.

Kader MA, Lindberg S (2005). Uptake of sodium in protoplasts of salt-sensitive and salt-

tolerant cultivars of rice, Oryza sativa L. determined by the fluorescent dye SBFI. J Exp

Bot 56: 3149-3158.

Kader MA, Lindberg S (2010). Cytosolic calcium and pH signaling in plants under

salinity stress. Plant Signal Behav 5: 233-238.

Kalmar B, Greensmith L (2009). Induction of heat shock proteins for protection against

oxidative stress. Adv Drug Deliv Rev 61: 310-318.

Kang TJ, Kwon TH, Kim TG, Loc NH, Yang MS (2003). Comparing constitutive

promoters using CAT activity in transgenic tobacco plants. Mol Cells 16: 117-122.

Kappe G, Leunissen JA, de Jong WW (2002). Evolution and diversity of prokaryotic

small heat shock proteins. Prog Mol Subcell Biol 28: 1-17.

Karin M, Haslinger A, Heguy A, Dietlin T, Cooke T (1987). Metal-responsive elements

act as positive modulators of human metallothionein-IIA enhancer activity. Molecular

and Cellular Biology 7: 606-613.

Karin M, Haslinger A, Holtgreve H, Richards RI, Krauter P, Westphal HM, Beato M

(1984). Characterization of DNA sequences through which cadmium and glucocorticoid

hormones induce human metallothionein-IIA gene. Nature 308: 513-519.

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999). Improving

plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible

transcription factor. Nat Biotechnol 17: 287-291.




Keren N, Berg A, van Kan PJ, Levanon H, Ohad I (1997). Mechanism of photosystem II

photoinactivation and D1 protein degradation at low light: the role of back electron flow.

Proc Natl Acad Sci U S A 94: 1579-1584.

Khan NA (2003). NaCl inhibited chlorophyll synthesis and associated changes in

ethylene evolution and antioxidative enzyme activities in wheat. Biol Plant 47: 437-440.

Kieffer P, Dommes J, Hoffmann L, Hausman JF, Renaut J (2008). Quantitative changes

in protein expression of cadmium-exposed poplar plants. Proteomics 8: 2514-2530.

Kim KH, Alam I, Kim YG, Sharmin SA, Lee KW, Lee SH, Lee BH (2012).

Overexpression of a chloroplast-localized small heat shock protein OsHSP26 confers

enhanced tolerance against oxidative and heat stresses in tall fescue. Biotechnol Lett

Kim MC, Chung WS, Yun DJ, Cho MJ (2009). Calcium and calmodulin-mediated

regulation of gene expression in plants. Mol Plant 2: 13-21.

Kirkham MB (2006). Cadmium in plants on polluted soil: Effects of soil factors,

hyperaccumulation, and amendments. Geoderma 137: 19–32.

Kirschner M, Winkelhaus S, Thierfelder JM, Nover L (2000). Transient expression and

heat-stress-induced co-aggregation of endogenous and heterologous small heat-stress

proteins in tobacco protoplasts. Plant J 24: 397-411.

Klass E, Rowe DW, Massaro EJ (1974). The effect of cadmium on population growth of

the green alga. Scenedesmus quadracauda. Bull Environ Contam Toxicol 12: 442-445.

Kloppstech K, Meyer G, Schuster G, Ohad I (1985). Synthesis, transport and localization

of a nuclear coded 22-kd heat-shock protein in the chloroplast membranes of peas and

Chlamydomonas reinhardi. Embo J 4: 1901-1909.

Knight CA, Ackerly DD (2001). Correlated evolution of chloroplast heat shock protein

expression in closely related plant species. Am J Bot 88: 411-418.

Knight H, Brandt S, Knight MR (1998). A history of stress alters drought calcium

signalling pathways in Arabidopsis. Plant J 16: 681-687.




Koca M, Bor M, Ozdemir F, Turkan I (2007). The effect of salt stress on lipid

peroxidation, antioxidative enzymes and proline content of sesame cultivars. Environ Exp

Bot 60: 344-351.

Koning AJ, Rose R, Comai L (1992). Developmental expression of tomato heat-shock

cognate protein 80. Plant Physiol 100: 801-811.

Kotak S, Vierling E, Baumlein H, von Koskull-Doring P (2007). A novel transcriptional

cascade regulating expression of heat stress proteins during seed development of

Arabidopsis. Plant Cell 19: 182-195.

Kováèik J, Klejdus B, Hedbavny J, Štork F, Baèkor M (2009). Comparison of cadmium

and copper effect on phenolic metabolism, mineral nutrients and stress-related parameters

in Matricaria chamomilla plants. Plant Soil 320: 231–242.

Krantev A, Yordanova R, Janda T, Szalai G, Popova L (2008). Treatment with salicylic

acid decreases the effect of cadmium on photosynthesis in maize plants. J Plant Physiol

165: 920-931.

Kreps JA, Wu Y, Chang HS, Zhu T, Wang X, Harper JF (2002). Transcriptome changes

for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol 130: 2129-

2141.

Krishna P, Gloor G (2001). The Hsp90 family of proteins in Arabidopsis thaliana. Cell

Stress Chaperones 6: 238-246.

Krishna P, Sacco M, Cherutti JF, Hill S (1995). Cold-Induced Accumulation of hsp90

Transcripts in Brassica napus. Plant Physiol 107: 915-923.

Kuhl NM, Rensing L (2000). Heat shock effects on cell cycle progression. Cell Mol Life

Sci 57: 450-463.

Kupper H, Kupper F, Spiller M (1996). Environmental relevance of heavy metal

substituted chlorophylls using the example of water plants. J Exp Bot 47: 259–266.

Kvaalen H, Johnsen O (2008). Timing of bud set in Picea abies is regulated by a memory

of temperature during zygotic and somatic embryogenesis. New Phytol 177: 49-59.




LaFayette PR, Nagao RT, O'Grady K, Vierling E, Key JL (1996). Molecular

characterization of cDNAs encoding low-molecular-weight heat shock proteins of

soybean. Plant Mol Biol 30: 159-169.

Laksanalamai P, Robb FT (2004). Small heat shock proteins from extremophiles: a

review. Extremophiles 8: 1-11.

Law RD, Crafts-Brandner SJ (1999). Inhibition and acclimation of photosynthesis to heat

stress is closely correlated with activation of ribulose-1,5-bisphosphate

Carboxylase/Oxygenase. Plant Physiol 120: 173-182.

Lawlor DW, Cornic G (2002). Photosynthetic carbon assimilation and associated

metabolism in relation to water deficits in higher plants. Plant Cell Environ 25: 275-294.

Lee BH, Won SH, Lee HS, Miyao M, Chung WI, Kim IJ, Jo J (2000). Expression of the

chloroplast-localized small heat shock protein by oxidative stress in rice. Gene 245: 283-

290.

Lee JH, Hubel A, Schoffl F (1995). Derepression of the activity of genetically engineered

heat shock factor causes constitutive synthesis of heat shock proteins and increased

thermotolerance in transgenic Arabidopsis. Plant J 8: 603-612.

Lee KT, Chen SC, Chiang BL, Yamakawa T (2007). Heat-inducible production of beta-

glucuronidase in tobacco hairy root cultures. Appl Microbiol Biotechnol 73: 1047-1053.

Lee TM, Lur HS (1997). Role of abscisic acid in cold tolerance of rice (Oryza sativa L.)

seedlings. II. Modulation of free polyamine levels. Plant Science 126: 1-10.

Lee YR, Nagao RT, Key JL (1994). A soybean 101-kD heat shock protein complements

a yeast HSP104 deletion mutant in acquiring thermotolerance. Plant Cell 6: 1889-1897.

Lefebvre V, Kiani SP, Durand-Tardif M (2009). A focus on natural variation for abiotic

constraints response in the model species Arabidopsis thaliana. Int J Mol Sci 10: 3547-

3582.

Legnaioli T, Cuevas J, Mas P (2009). TOC1 functions as a molecular switch connecting

the circadian clock with plant responses to drought. Embo J 28: 3745-3757.




Li EH, Miles CD (1975). Effects of cadmium on photoreaction II of chloroplasts. Plant

Science Letters 5: 33-40.

Li P, Ainsworth EA, Leakey AD, Ulanov A, Lozovaya V, Ort DR, Bohnert HJ (2008).

Arabidopsis transcript and metabolite profiles: ecotype-specific responses to open-air

elevated [CO2]. Plant Cell Environ 31: 1673-1687.

Li Q, Yu B, Gao Y, Dai AH, Bai JG (2011). Cinnamic acid pretreatment mitigates

chilling stress of cucumber leaves through altering antioxidant enzyme activity. J Plant

Physiol 168: 927-934.

Li XG, Duan W, Meng QW, Zou Q, Zhao SJ (2004). The function of chloroplastic

NAD(P)H dehydrogenase in tobacco during chilling stress under low irradiance. Plant

Cell Physiol 45: 103-108.

Lichtenthaler HK (1998). The stress concept in plants: an introduction. Ann N Y Acad

Sci 851: 187-198.

Lindquist S (1986). The heat-shock response. Annu Rev Biochem 55: 1151-1191.

Lindquist S, Craig EA (1988). The heat shock proteins. Annu Rev Genet 22: 631-677.

Liu X, Huang B (2000). Heat stress injury in relation to membrane lipid peroxidation in

creeping bentgrass. Crop Sci 40: 503-510.

Liu ZJ, Zhang XL, Bai JG, Suo BX, Xu PL, Wang L (2009). Exogenous paraquat

changes antioxidant enzyme activities and lipid peroxidation in drought-stressed

cucumber leaves. Sci Hortic 121: 138-143.

Lu P, Sang WG, Ma KP (2008). Differential responses of the activities of antioxidant

enzymes to thermal stresses between two invasive Eupatorium species in China. J Integr

Plant Biol 50: 393-401.

Lu P, Sang WG, Ma KP (2008). Differential responses of the activities of antioxidant

enzymes to thermal stresses between two invasive Eupatorium species in China. J Integr

Plant Biol 50: 393-401.




Lu TH, Lambrecht RW, Pepe J, Shan Y, Kim T, Bonkovsky HL (1998). Molecular

cloning, characterization, and expression of the chicken heme oxygenase-1 gene in

transfected primary cultures of chick embryo liver cells. Gene 207: 177-186.

Ludwig-Muller J, Krishna P, Forreiter C (2000). A glucosinolate mutant of Arabidopsis

is thermosensitive and defective in cytosolic hsp90 expression after heat stress. Plant

Physiology 123: 949-958.

Lujan R, Lledias F, Martinez LM, Barreto R, Cassab GI, Nieto-Sotelo J (2009). Small

heat-shock proteins and leaf cooling capacity account for the unusual heat tolerance of

the central spike leaves in Agave tequilana var. Weber. Plant Cell Environ 32: 1791-

1803.

Ma JF, Tamai K, Yamaji N, Mitani N, Konishi S, Katsuhara M, Ishiguro M, Murata Y,

Yano M (2006). A silicon transporter in rice. Nature 440: 688-691.

Ma JF, Yamaji N, Mitani N, Xu XY, Su YH, McGrath SP, Zhao FJ (2008). Transporters

of arsenite in rice and their role in arsenic accumulation in rice grain. Proc Natl Acad Sci

U S A 105: 9931-9935.

Ma L, Gao Y, Qu L, Chen Z, Li J, Zhao H, Deng XW (2002). Genomic evidence for

COP1 as a repressor of light-regulated gene expression and development in Arabidopsis.

Plant Cell 14: 2383-2398.

Mafakheri A, Siosemardeh A, Bahramnejad B, Struik PC, Sohrabi E (2010). Effect of

drought stress on yield, proline and chlorophyll contents in three chickpea cultivars. Aust

J Crop Sci 4: 580-585.

Mahroof R, Zhu KY, Neven L, Subramanyam B, Bai J (2005). Expression patterns of

three heat-shock protein 70 genes among developmental stages of the red flour beetle,

Tribolium castaneum (Coleoptera: Tenebrionidae). Comp Biochem Physiol A Mol Integr

Physiol 141: 247-256.

Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999). Modified expression of a

carrot small heat shock protein gene, hsp17. 7, results in increased or decreased

thermotolerancedouble dagger. Plant J 20: 89-99.




Maqbool A, Abbas W, Rao AQ, Irfan M, Zahur M, Bakhsh A, Riazuddin S, Husnain T

(2010). Gossypium arboreum GHSP26 enhances drought tolerance in Gossypium

hirsutum. Biotechnol Prog 26: 21-25.

Marchler G, Schuller C, Adam G, Ruis H (1993). A Saccharomyces cerevisiae UAS

element controlled by protein kinase A activates transcription in response to a variety of

stress conditions. Embo J 12: 1997-2003.

Marrs KA, Casey ES, Capitant SA, Bouchard RA, Dietrich PS, Mettler IJ, Sinibaldi RM

(1993). Characterization of two maize HSP90 heat shock protein genes: expression

during heat shock, embryogenesis, and pollen development. Dev Genet 14: 27-41.

Marrs KA, Sinibaldi RM (1997). Deletion analysis of the maize hsp82, hsp81, and

hsp17.9 promoters in maize and transgenic tobacco: contributions of individual heat

shock elements and recognition by distinct protein factors during both heat shock and

development. Maydica 42: 211-226.

Martinez-Pastor MT, Marchler G, Schuller C, Marchler-Bauer A, Ruis H, Estruch F

(1996). The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are

required for transcriptional induction through the stress response element (STRE). Embo

J 15: 2227-2235.

Masood A, Zeeshan M, Abraham G (2008). Response of growth and antioxidant enzymes

in Azolla plants (Azolla pinnata and Azolla filiculoides) exposed to UV-B. Acta Biol

Hung 59: 247-258.

Matteucci M, D'Angeli S, Errico S, Lamanna R, Perrotta G, Altamura MM (2011). Cold

affects the transcription of fatty acid desaturases and oil quality in the fruit of Olea

europaea L. genotypes with different cold hardiness. J Exp Bot 62: 3403-3420.

McCord JM (2000). The evolution of free radicals and oxidative stress. Am J Med 108:

652-659.

Metwally A, Safronova VI, Belimov AA, Dietz KJ (2005). Genotypic variation of the

response to cadmium toxicity in Pisum sativum L. J Exp Bot 56: 167-178.




Miersch J, Grancharov K (2008). Cadmium and heat response of the fungus Heliscus

lugdunensis isolated from highly polluted and unpolluted areas. Amino Acids 34: 271-

277.

Milioni D, Hatzopoulos P (1997). Genomic organization of hsp90 gene family in

Arabidopsis. Plant Mol Biol 35: 955-961.

Mishra S, Srivastava S, Tripathi RD, Dwivedi S, Shukla MK (2008). Response of

antioxidant enzymes in coontail (Ceratophyllum demersum L.) plants under cadmium

stress. Environ Toxicol 23: 294-301.

Mishra SK, Tripp J, Winkelhaus S, Tschiersch B, Theres K, Nover L, Scharf KD (2002).

In the complex family of heat stress transcription factors, HsfA1 has a unique role as

master regulator of thermotolerance in tomato. Genes Dev 16: 1555-1567.

Mittal D, Enoki Y, Lavania D, Singh A, Sakurai H, Grover A (2012). Binding affinities

and interactions among different heat shock element types and heat shock factors in rice

(Oryza sativa L.). FEBS J 278: 3076-3085.

Mittler R (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:

405-410.

Miyao-Tokutomi M, Lee B-H, Mizusawa N, Yamamoto N (1998). Active oxygen and

photoinhibition of photosystem II. Photosynthesis: Mechanisms and Effects. Proceedings

of the International Congress on Photosynthesis 17-22, 13: 2097-2102.

Munns R (2002). Comparative physiology of salt and water stress. Plant Cell Environ 25:

239-250.

Munns R, James RA, Lauchli A (2006). Approaches to increasing the salt tolerance of

wheat and other cereals. J Exp Bot 57: 1025-1043.

Mussig C, Fischer S, Altmann T (2002). Brassinosteroid-regulated gene expression. Plant

Physiol 129: 1241-1251.

Nadeau JA (2009). Stomatal development: new signals and fate determinants. Curr Opin

Plant Biol 12: 29-35.




Nakamoto H, Suzuki N, Roy SK (2000). Constitutive expression of a small heat-shock

protein confers cellular thermotolerance and thermal protection to the photosynthetic

apparatus in cyanobacteria. FEBS Lett 483: 169-174.

Nakamoto H, Vigh L (2007). The small heat shock proteins and their clients. Cell Mol

Life Sci 64: 294-306.

Neta-Sharir I, Isaacson T, Lurie S, Weiss D (2005). Dual role for tomato heat shock

protein 21: protecting photosystem II from oxidative stress and promoting color changes

during fruit maturation. Plant Cell 17: 1829-1838.

Ni FT, Chu LY, Shao HB, Liu ZH (2009). Gene expression and regulation of higher

plants under soil water stress. Curr Genomics 10: 269-280.

Nieto-Sotelo J, Kannan KB, Martinez LM, Segal C (1999). Characterization of a maize

heat-shock protein 101 gene, HSP101, encoding a ClpB/Hsp100 protein homologue.

Gene 230: 187-195.

Nikolaidis N, Nei M (2004). Concerted and nonconcerted evolution of the Hsp70 gene

superfamily in two sibling species of nematodes. Mol Biol Evol 21: 498-505.

Ning J, Li X, Hicks LM, Xiong L (2010). A Raf-like MAPKKK gene DSM1 mediates

drought resistance through reactive oxygen species scavenging in rice. Plant Physiol 152:

876-890.

Nishiwaza A, Yabuta Y, Yoshida E, Maruta T, Yoshimura K, Shigeoka S (2006).

Arabidopsis heat shock transcription factor as a key regulator in response to several types

of environmental stress. The Plant Journal 48: 535-547.

Nishiyama Y, Allakhverdiev SI, Murata N (2006). A new paradigm for the action of

reactive oxygen species in the photoinhibition of photosystem II. Biochim Biophys Acta

1757: 742-749.

Nounjan N, Nghia PT, Theerakulpisut P (2012). Exogenous proline and trehalose

promote recovery of rice seedlings from salt-stress and differentially modulate

antioxidant enzymes and expression of related genes. J Plant Physiol 169: 596-604.




Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD (2001). Arabidopsis and

the heat stress transcription factor world: how many heat stress transcription factors do

we need? Cell Stress and Chaperones 6: 177-189.

Osteryoung KW, Vierling E (1994). Dynamics of small heat shock protein distribution

within the chloroplasts of higher plants. J Biol Chem 269: 28676-28682.

Otterbein LE, Choi AM (2000). Heme oxygenase: colors of defense against cellular

stress. Am J Physiol Lung Cell Mol Physiol 279: L1029-1037.

Pandey V, Ranjan S, Deeba F, Pandey AK, Singh R, Shirke PA, Pathre UV (2010).

Desiccation-induced physiological and biochemical changes in resurrection plant,

Selaginella bryopteris. J Plant Physiol 167: 1351-1359.

Pareek A, Singla SL, Grover A (1995). Immunological evidence for accumulation of two

high-molecular-weight (104 and 90 kDa) HSPs in response to different stresses in rice

and in response to high temperature stress in diverse plant genera. Plant Mol Biol 29:

293-301.

Park SY, Chang KC, Shivaji R, Luthe DS (1997). Recovery from Heat Shock in Heat-

Tolerant and Nontolerant Variants of Creeping Bentgrass. Plant Physiol 115: 229-240.

Park S-Y, Shivaji R, Krans JV, Luthe DS (1996). Heat shock response in heat tolerant

and non-tolerant variants of Agrostis palustris Huds. Plant Physiol 111: 515-524.

Parsell DA, Kowal AS, Singer MA, Lindquist S (1994). Protein disaggregation mediated

by heat-shock protein Hsp104. Nature 372: 475-478.

Parsell DA, Lindquist S (1993). The function of heat-shock proteins in stress tolerance:

degradation and reactivation of damaged proteins. Annu Rev Genet 27: 437-496.

Pavlikova D, Pavlik M, Staszkova L, Motyka V, Szakova J, Tlustos P, Balik J (2008).

Glutamate kinase as a potential biomarker of heavy metal stress in plants. Ecotoxicol

Environ Saf 70: 223-230.

Pearl LH, Prodromou C (2000). Structure and in vivo function of Hsp90. Curr Opin

Struct Biol 10: 46-51.




Penfield S (2008). Temperature perception and signal transduction in plants. New Phytol

179: 615-628.

Peremarti A, Twyman RM, Gomez-Galera S, Naqvi S, Farre G, Sabalza M, Miralpeix B,

Dashevskaya S, Yuan D, Ramessar K, Christou P, Zhu C, Bassie L, Capell T (2010).

Promoter diversity in multigene transformation. Plant Mol Biol 73: 363-378.

Perisic O, Xiao H, Lis JT (1989). Stable binding of Drosophila heat shock factor to head-

to-head and tail-to-tail repeats of a conserved 5 bp recognition unit. Cell 59: 797-806.

Potenza C, Aleman L, Sengupta-Gopalan C (2004). Targeting transgene expression in

research, agricultural, and environmental applications: promoters used in plant

transformation. In Vitro Cell Dev Biol Plan 40: 1–22.

Prasinos C, Krampis K, Samakovli D, Hatzopoulos P (2005). Tight regulation of

expression of two Arabidopsis cytosolic Hsp90 genes during embryo development. J Exp

Bot 56: 633-644.

Preczewski P, Heckathorn SA, Downs CA, Coleman JS (2000). Photosynthetic

thermotolerance is positively and quantitatively correlated with production of specific

heat-shock proteins among nine genotypes of tomato. Photosynthetica 38: 127-134.

Queitsch C, Hong SW, Vierling E, Lindquist S (2000). Heat shock protein 101 plays a

crucial role in thermotolerance in Arabidopsis. Plant Cell 12: 479-492.

Queltsch C, Sangster TA, Lindquist S (2002). Hsp90 as a capacitor of phenotypic

variation. Nature 417: 618-624.

Rai M, He C, Wu R (2009). Comparative functional analysis of three abiotic stress-

inducible promoters in transgenic rice. Transgenic Res 18: 787-799.

Ralph PJ, Burchett MD (1998). Photosynthetic response of Halophila ovalis to heavy

metal stress. Environmental Pollution 103: 91-101.

Ramirez V, Coego A, Lopez A, Agorio A, Flors V, Vera P (2009). Drought tolerance in

Arabidopsis is controlled by the OCP3 disease resistance regulator. Plant J 58: 578-591.

Reading DS, Hallberg RL, Myers AM (1989). Characterization of the yeast HSP60 gene

coding for a mitochondrial assembly factor. Nature 337: 655-659.




Reddy R, Chaudhary S, Patil P, Krishna P (1998). The 90 kDa heat shock protein (hsp90)

is expressed throughout Brassica napus seed development and germination. Plant

Science 131: 131-137.

Restivo FM, Tassi E, Maestri E, Lorenzoni C, Puglisi PP, Mamiroli N (1986).

Identification of chloroplast associated heat-shock proteins in Mcotiana plumbaginifolia

protoplasts. Curr Genet 11: 145-149.

Rhoades J, Loveday J (1990). Salinity in irrigated agriculture. In: Steward, B.A., Nielsen,

D.R. (Eds.), American Society of Civil Engineers, Irrigation of Agricultural Crops

(Monograph30). American Society of Agronomists, pp. 1089-1142.

Rieping M, Schoffl F (1992). Synergistic effect of upstream sequences, CCAAT box

elements, and HSE sequences for enhanced expression of chimaeric heat shock genes in

transgenic tobacco. Mol Gen Genet 231: 226-232.

Ritossa FM (1962). A new puffing pattern induced by a temperature shock and DNP in

Drosophila. Experientia 18: 571–573.

Rojas A, Almoguera C, Carranco R, Scharf KD, Jordano J (2002). Selective activation of

the developmentally regulated Ha hsp17.6 G1 promoter by heat stress transcription

factors. Plant Physiol 129: 1207-1215.

Rombauts S, Dhais P, Montagu MV, Rouz P (1999). PlantCARE, a plant cis-acting

regulatory element database. Nucleic Acids Res 27(1): 295-296.

Romero C, Belles JM, Vaya JL, Serrano R, Culianez-Macia FA (1997). Expression of the

yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic

phenotypes include drought tolerance. Planta 201: 293-297.

Ruelland E, Zachowski A (2010). How plants sense temperature. Environ Exp Bot 69:

225-232.

Ruis H, Schuller C (1995). Stress signaling in yeast. Bioessays 17: 959-965.

Rutherford SL, Lindquist S (1998). Hsp90 as a capacitor for morphological evolution.

Nature 396: 336-342.




Sabehat A, Lurie S, Weiss D (1998). Expression of small heat-shock proteins at low

temperatures. Plant Physiol 117: 651-658.

Sabehat A, Weiss D, Lurie S (1996). The correlation between heat shock protein

accumulation and persistence and chilling tolerance in tomato fruit. Plant Physiol 110:

531-537.

Sahr T, Voigt G, Paretzke HG, Schramel P, Ernst D (2005). Caesium-affected gene

expression in Arabidopsis thaliana. New Phytol 165: 747-754.

Saidi Y, Domini M, Choy F, Zryd JP, Schwitzguebel JP, Goloubinoff P (2007).

Activation of the heat shock response in plants by chlorophenols: transgenic

Physcomitrella patens as a sensitive biosensor for organic pollutants. Plant Cell Environ

30: 753-763.

Sakurai H, Takemori Y (2007). Interaction between heat shock transcription factors

(HSFs) and divergent binding sequences: binding specificities of yeast HSFs and human

HSF1. J Biol Chem 282: 13334-13341.

Sanmiya K, Suzuki K, Egawa Y, Shono M (2004). Mitochondrial small heat-shock

protein enhances thermotolerance in tobacco plants. FEBS Lett 557: 265-268.

Santoro N, Johansson N, Thiele DJ (1998). Heat shock element architecture is an

important determinant in the temperature and transactivation domain requirements for

heat shock transcription factor. Mol Cell Biol 18: 6340-6352.

Saravanavel R, Ranganathan R, Anantharaman P (2011). Effect of sodium chloride on

photosynthetic pigments and photosynthetic characteristics of Avicennia officinalis

seedlings. Recent Research in Science and Technology 3: 177-180.

Scharf KD, Siddique M, Vierling E (2001). The expanding family of Arabidopsis

thaliana small heat stress proteins and a new family of proteins containing alpha-

crystallin domains (Acd proteins). Cell Stress Chaperones 6: 225-237.

Schirmer EC, Lindquist S, Vierling E (1994). An Arabidopsis heat shock protein

complements a thermotolerance defect in yeast. Plant Cell 6: 1899-1909.




Schoffl F, Prandl R, Hinderhofer K, Reindl A (1997). Molecular and applied aspects of

the heat stress response and of common stress tolerance in plants. Acta Physiologiae

Plantarum 19: 549-550.

Schoffl F, Prandl R, Reindl A (1998). Regulation of the heat-shock response. Plant

Physiol 117: 1135-1141.

Scott I, Logan DC (2008). Mitochondrial morphology transition is an early indicator of

subsequent cell death in Arabidopsis. New Phytol 177: 90-101.

Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju

A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai

J, Hayashizaki Y, Shinozaki K (2002). Monitoring the expression profiles of 7000

Arabidopsis genes under drought, cold and high-salinity stresses using a full-length

cDNA microarray. Plant J 31: 279-292.

Seo PJ, Kim MJ, Park JY, Kim SY, Jeon J, Lee YH, Kim J, Park CM (2010). Cold

activation of a plasma membrane-tethered NAC transcription factor induces a pathogen

resistance response in Arabidopsis. Plant J 61: 661-671.

Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Lee YH, Park WJ, Park CM

(2009). The MYB96 transcription factor mediates abscisic acid signaling during drought

stress response in Arabidopsis. Plant Physiol 151: 275-289.

Shakeel S, Haq NU, Heckathorn SA, Hamilton EW, Luthe DS (2011). Ecotypic variation

in chloroplast small heat-shock proteins and related thermotolerance in Chenopodium

album. Plant Physiol Biochem 49: 898-908.

Shakeel SN, Haq NU, Heckathorn S, Luthe DS (2012). Analysis of gene sequences

indicates that quantity not quality of chloroplast small HSPs improves thermotolerance in

C4 and CAM plants. Plant Cell Reports DOI 10.1007/s00299-012-1307-z.

Sharma SS, Dietz KJ (2009). The relationship between metal toxicity and cellular redox

imbalance. Trends Plant Sci 14: 43-50.




Shukla N, Awasthi RP, Rawat L, Kumar J (2012). Biochemical and physiological

responses of rice (Oryza sativa L.) as influenced by Trichoderma harzianum under

drought stress. Plant Physiol Biochem 54: 78-88.

Shulaev V, Cortes D, Miller G, Mittler R (2008). Metabolomics for plant stress response.

Physiol Plant 132: 199-208.

Siddiqi EH, Ashraf M, Al-Qurainy F, Akram NA (2011). Salt-induced modulation in

inorganic nutrients, antioxidant enzymes, proline content and seed oil composition in

safflower (Carthamus tinctorius L.). J Sci Food Agric 91: 2785-2793.

Siddique M, Port M, Tripp J, Weber C, Zielinski D, Calligaris R, Winkelhaus S, Scharf

KD (2003). Tomato heat stress protein Hsp16.1-CIII represents a member of a new class

of nucleocytoplasmic small heat stress proteins in plants. Cell Stress Chaperones 8: 381-

394.

Siderius M, Mager WH (1997). General stress response: in search of a common

denominator. In S Hohmann, WH Mager, eds, Yeast Stress Responses. Springer-Verlag,

Heidelberg, pp 213-230.

Singh AK, Kumar R, Pareek A, Sopory SK, Singla-Pareek SL (2012). Overexpression of

Rice CBS Domain Containing Protein Improves Salinity, Oxidative, and Heavy Metal

Tolerance in Transgenic Tobacco. Mol Biotechnol

Singh RP, Tripathi RD, Sinha SK, Maheshwari R, Srivastava HS (1997). Response of

higher plants to lead contaminated environment. Chemosphere 34: 2467-2493.

Singla SL, Pareek A, Grover A (1998). Plant Hsp 100 family with special reference to

rice. J Bioscience 23: 337-345.

Smeets K, Cuypers A, Lambrechts A, Semane B, Hoet P, Van Laere A, Vangronsveld J

(2005). Induction of oxidative stress and antioxidative mechanisms in Phaseolus vulgaris

after Cd application. Plant Physiol Biochem 43: 437-444.

Soares-Cordeiro AS, Driscoll SP, Arrabaca MC, Foyer CH (2010). Dorsoventral

variations in dark chilling effects on photosynthesis and stomatal function in Paspalum

dilatatum leaves. J Exp Bot 62: 687-699.




Sonna LA, Fujita J, Gaffin SL, Lilly CM (2002). Invited review: Effects of heat and cold

stress on mammalian gene expression. J Appl Physiol 92: 1725-1742.

Soto A, Allona I, Collada C, Guevara MA, Casado R, Rodriguez-Cerezo E, Aragoncillo

C, Gomez L (1999). Heterologous expression of a plant small heat-shock protein

enhances Escherichia coli viability under heat and cold stress. Plant Physiol 120: 521-

528.

Strasser BJ (1997). Donor side capacity of Photosystem II probed by chlorophyll a

fluorescence transients. Photosynthesis Research 52: 147–155.

Stuart GW, Searle PF, Palmiter RD (1985). Identification of multiple metal regulatory

elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature

317: 828-831.

Sudhir P, Murthy SDS (2004). Effects of salt stress on basic processes of photosynthesis.

Photosynthetica 42: 481-486.

Sun W, Bernard C, van de Cotte B, Van Montagu M, Verbruggen N (2001). At-

HSP17.6A, encoding a small heat-shock protein in Arabidopsis, can enhance

osmotolerance upon overexpression. Plant J 27: 407-415.

Sun W, Van Montagu M, Verbruggen N (2002). Small heat shock proteins and stress

tolerance in plants. Biochim Biophys Acta 1577: 1-9.

Sundby C, Harndahl U, Gustavsson N, Ahrman E, Murphy DJ (2005). Conserved

methionines in chloroplasts. Biochim Biophys Acta 1703: 191-202.

Sung DY, Kaplan F, Guy CL (2001). Plant Hsp70 molecular chaperones: protein

structure, gene family, expression and function. Physiol Plant 113: 443-451.

Takahashi T, Naito S, Komeda Y (1992). Isolation and analysis of the expression of two

genes for the 81-kilodalton heat-shock proteins from Arabidopsis. Plant Physiol 99: 383-

390.

Takahashi T, Naito S, Komeda Y (1992). The Arabidopsis hsp18.2 promoter/gus gene

fusion in transgenic Arabidopsis plants—a powerful tool for the isolation of regulatory

mutants of the heat-shock response. Plant J 2: 751–761.




Taylor RP, Benjamin IJ (2005). Small heat shock proteins: a new classification scheme in

mammals. J Mol Cell Cardiol 38: 433-444.

Thakur P, Kumar S, Malik JA, Berger JD, Nayyar H (2010). Cold stress effects on

reproductive development in grain crops: an overview. Environmental and Experimental

Botany 67: 429-443.

Thannickal VJ, Fanburg BL (2000). Reactive oxygen species in cell signaling. Am J

Physiol Lung Cell Mol Physiol 279: L1005-1028.

Theocharis A, Clement C, Barka EA (2012). Physiological and molecular changes in

plants grown at low temperatures. Planta

Thomashow MF (1999). Plant cold acclimation: freezing tolerance genes and regulatory

mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599.

Tiroli AO, Ramos CH (2007). Biochemical and biophysical characterization of small heat

shock proteins from sugarcane. Involvement of a specific region located at the N-

terminus with substrate specificity. Int J Biochem Cell Biol 39: 818-831.

Topol J, Ruden DM, Parker CS (1985). Sequences required for in vitro transcriptional

activation of a Drosophila hsp 70 gene. Cell 42: 527-537.

Torok Z, Goloubinoff P, Horvath I, Tsvetkova NM, Glatz A, Balogh G, Varvasovszki V,

Los DA, Vierling E, Crowe JH, Vigh L (2001). Synechocystis HSP17 is an amphitropic

protein that stabilizes heat-stressed membranes and binds denatured proteins for

subsequent chaperone-mediated refolding. Proceedings of the National Academy of

Sciences of the United States of America 98: 3098-3103.

Tower J (2009). Hsps and aging. Trends Endocrinol Metab 20: 216-222.

Triantaphylides C, Krischke M, Hoeberichts FA, Ksas B, Gresser G, Havaux M, Van

Breusegem F, Mueller MJ (2008). Singlet oxygen is the major reactive oxygen species

involved in photooxidative damage to plants. Plant Physiol 148: 960-968.

Tuteja N, Ahmad P, Panda BB, Tuteja R (2009). Genotoxic stress in plants: shedding

light on DNA damage, repair and DNA repair helicases. Mutat Res 681: 134-149.




Tuteja N, Sopory SK (2008). Plant signaling in stress: G-protein coupled receptors,

heterotrimeric G-proteins and signal coupling via phospholipases. Plant Signal Behav 3:

79-86.

Uemura M, Steponkus PL (1999). Cold acclimation in plants: relationship between the

lipid composition and the cryostability of the plasma membrane. J Plant Res 112: 245-

254.

Valcu CM, Lalanne C, Plomion C, Schlink K (2008). Heat induced changes in protein

expression profiles of Norway spruce (Picea abies) ecotypes from different elevations.

Proteomics 8: 4287-4302.

Van Assche F, Clijsters H (1986). Inhibition of photosynthesis in Phaseolus valgaris by

treatment with toxic concentration of Zinc: effects on electron transport and

photophosphorylation. Physiol Plant 66: 717–721.

van Berkel J, Salamini F, Gebhardt C (1994). Transcripts accumulating during cold

storage of potato (Solanum tuberosum L.) tubers are sequence related to stress-responsive

genes. Plant Physiol 104: 445-452.

van Montfort RL, Basha E, Friedrich KL, Slingsby C, Vierling E (2001). Crystal

structure and assembly of a eukaryotic small heat shock protein. Nat Struct Biol 8: 1025-

1030.

Vetter JL, Steinberg MP, Nelson AI (1958). Quantitative determination of peroxidase in

sweet corn. Journal of Agricultural and Food Chemistry 6: 39-41.

Vierling E (1991). The roles of heat shock proteins in plants. Annu Rev Plant Physiol

Plant Mol Biol 42: 579-620.

Vierling E, Mishkind ML, Schmidt GW, Key JL (1986). Specific heat shock proteins are

transported into chloroplasts. Proc Natl Acad Sci 83: 361-365.

Villar-Salvador P, Planelles R, Oliet J, Penuelas-Rubira JL, Jacobs DF, Gonzalez M

(2004). Drought tolerance and transplanting performance of holm oak (Quercus ilex)

seedlings after drought hardening in the nursery. Tree Physiol 24: 1147-1155.




Vinit-Dunand F, Epron D, Alaoui-Sossé B, Badot PM (2002). Effects of copper on

growth and on photosynthesis of mature and expanding leaves in cucumber plants. Plant

Sci 163: 53-58.

Wahid A, Gelani S, Ashraf M, Foolad MR (2007). Heat tolerance in plants: an overview.

Environ Exp Bot 61: 199–223.

Walther W, Stein U (2009). Heat-responsive gene expression for gene therapy. Adv Drug

Deliv Rev 61: 641-649.

Wang D, Barua D, Joshi P, LaCroix J, Hamilton EW, Heckathorn SA (2008). Effects of

elevated CO2 on the tolerance of photosynthesis to acute heat stress in 11 (C3, C4, and

CAM) species. American Journal of Botany 95: 1-13.

Wang D, Luthe DS (2003). Heat sensitivity in a bentgrass variant. Failure to accumulate

a chloroplast heat shock protein isoform implicated in heat tolerance. Plant Physiol 133:

319-327.

Wang H, Datla R, Georges F, Loewen M, Cutler AJ (1995). Promoters from kin1 and

cor6.6, two homologous Arabidopsis thaliana genes: transcriptional regulation and gene

expression induced by low temperature, ABA, osmoticum and dehydration. Plant Mol

Biol 28: 605-617.

Waters ER, Lee GJ, Vierling E (1996). Evolution, structure and function of the small heat

shock proteins in plants. J Exp Bot 47: 325-338.

Weckwerth W (2008). Integration of metabolomics and proteomics in molecular plant

physiology--coping with the complexity by data-dimensionality reduction. Physiol Plant

132: 176-189.

Wegele H, Muller L, Buchner J (2004). Hsp70 and Hsp90--a relay team for protein

folding. Rev Physiol Biochem Pharmacol 151: 1-44.

Wehmeyer N, Hernandez LD, Finkelstein RR, Vierling E (1996). Synthesis of small heat-

shock proteins is part of the developmental program of late seed maturation. Plant

Physiol 112: 747-457.




Wentworth M, Murchie EH, Gray JE, Villegas D, Pastenes C, Pinto M, Horton P (2006).

Differential adaptation of two varieties of common bean to abiotic stress: II. Acclimation

of photosynthesis. J Exp Bot 57: 699-709.

Whitelaw CA, Le Huquet JA, Thurman DA, Tomsett AB (1997). The isolation and

characterization of type II metallothionein-like genes from tomato (Lycopersicon

esculentum L.). Plant Mol Biol 33: 503-511.

Wilkinson S, Davies WJ (2002). ABA-based chemical signalling: the co-ordination of

responses to stress in plants. Plant Cell Environ 25: 195-210.

Williams GT, Morimoto RI (1990). Maximal stress-induced transcription from the human

HSP70 promoter requires interactions with the basal promoter elements independent of

rotational alignment. Mol Cell Biol 10: 3125-3136.

Winfield MO, Lu C, Wilson ID, Coghill JA, Edwards KJ (2010). Plant responses to cold:

Transcriptome analysis of wheat. Plant Biotechnol J 8: 749-771.

Wiseman H, Halliwell B (1996). Damage to DNA by reactive oxygen and nitrogen

species: role in inflammatory disease and progression to cancer. Biochem J 313 ( Pt 1):

17-29.

Wu CH, Caspar T, Browse J, Lindquist S, Somerville C (1988). Characterization of an

HSP70 Cognate Gene Family in Arabidopsis. Plant Physiol 88: 731-740.

Wunderlich M, Werr W, Schoffl F (2003). Generation of dominant-negative effects on

the heat shock response in Arabidopsis thaliana by transgenic expression of a chimaeric

HSF1 protein fusion construct. Plant J 35: 442-451.

Xiao BZ, Chen X, Xiang CB, Tang N, Zhang QF, Xiong LZ (2009). Evaluation of seven

function-known candidate genes for their effects on improving drought resistance of

transgenic rice under field conditions. Mol Plant 2: 73-83.

Xiao FH, Xue GP (2001). Analysis of the promoter activity of late embryogenesis

abundant protein genes in barley seedlings under conditions of water deWci. Plant Cell

Rep 20: 667–673.




Xiao H, Lis JT (1988). Germline transformation used to define key features of heat-shock

response elements. Science 239: 1139-1142.

Xiao H, Perisic O, Lis JT (1991). Cooperative binding of Drosophila heat shock factor to

arrays of a conserved 5 bp unit. Cell 64: 585-593.

Xing W, Rajashekar CB (2001). Glycine betaine involvement in freezing tolerance and

water stress in Arabidopsis thaliana. Environ Exp Bot 46: 21-28.

Xu PL, Guo YK, Bai JG, Shang L, Wang XJ (2008). Effects of long-term chilling on

ultrastructure and antioxidant activity in leaves of two cucumber cultivars under low

light. Physiol Plant 132: 467-478.

Xu S, Li J, Zhang X, Wei H, Cui L (2006). Effects of heat acclimation pretreatment on

changes of membrane lipidperoxidation, antioxidant metabolites, and ultra structure of

chloroplast in two cool-season turgrass species under heat stress. Environ Exp Bot 56:

274-285.

Yabe N, Takahashi T, Komeda Y (1994). Analysis of tissue-specific expression of

Arabidopsis thaliana HSP90-family gene HSP81. Plant Cell Physiol 35: 1207-1219.

Yamada H, Koizumi S (2002). DNA microarray analysis of human gene expression

induced by a non-lethal dose of cadmium. Ind Health 40: 159-166.

Yi N, Kim YS, Jeong MH, Oh SJ, Jeong JS, Park SH, Jung H, Choi YD, Kim JK (2010).

Functional analysis of six drought-inducible promoters in transgenic rice plants

throughout all stages of plant growth. Planta 232: 743-754.

Yu JQ, Zhou YH, Huang LF, Allen DJ (2002). Chill-induced inhibition of

photosynthesis: genotypic variation within Cucumis sativus. Plant Cell Physiol 43: 1182-

1188.

Yusuf MA, Kumar D, Rajwanshi R, Strasser RJ, Tsimilli-Michael M, Govindjee, Sarin

NB (2010). Overexpression of gamma-tocopherol methyl transferase gene in transgenic

Brassica juncea plants alleviates abiotic stress: physiological and chlorophyll a

fluorescence measurements. Biochim Biophys Acta 1797: 1428-1438.




Zeller G, Henz SR, Widmer CK, Sachsenberg T, Ratsch G, Weigel D, Laubinger S

(2009). Stress-induced changes in the Arabidopsis thaliana transcriptome analyzed using

whole-genome tiling arrays. Plant J 58: 1068-1082.

Zhang H, Mao X, Wang C, Jing R (2010). Overexpression of a Common Wheat Gene

TaSnRK2.8 Enhances Tolerance to Drought, Salt and Low Temperature in Arabidopsis.

PLoS One 5: e16041.

Zhang J, Stewart JMD (2000). Economical and Rapid Method for Extracting Cotton

Genomic DNA. The Journal of Cotton Science 4: 193-201.

Zhang L, Eggers-Schumacher G, Schoffl F, Prandl R (2001). Analysis of heat-shock

transcription factor-DNA binding in Arabidopsis suspension cultures by UV laser

crosslinking. Plant J 28: 217-223.

Zhang L, Lohmann C, Prandl R, Schoffl F (2003). Heat stress-dependent DNA binding of

Arabidopsis heat shock transcription factor HSF1 to heat shock gene promoters in

Arabidopsis suspension culture cells in vivo. Biol Chem 384: 959-963.

Zhang M, Li G, Huang W, Bi T, Chen G, Tang Z, Su W, W S (2010). Proteomic study of

Carissa spinarum in response to combined heat and drought stress. Proteomics 10: 3117-

3129.

Zhu JK (2001). Plant salt tolerance. Trends Plant Sci 6: 66-71.

Zhu Y, Zhu J, Wan X, Zhang T (2010). Gene expression of sHsps, Hsp40 and Hsp60

families in normal and abnormal embryonic development of mouse forelimbs. Toxicol

Lett 193: 242-251.

Zinn KE, Tunc-Ozdemir M, Harper JF (2010). Temperature stress and plant sexual

reproduction: uncovering the weakest links. J Exp Bot 61: 1959-1968.

Zobayed SMA, Afreen F, Kozai T (2005). Temperature stress can alter the

photosynthetic efficiency and secondary metabolite concentrations in St. John’s wort.

Plant Physiol. Biochem 43: 977-984.

Publications

Originality Report

Foreign Referees

names

Names of Foreign Referees

1. Dr. C. Robertson McClung

Professor

Department of Biological Sciences, Dartmouth College,

Class of 1978 Life Sciences Center, 78 College Street,

Hanover, New Hampshire 03755, USA

Tel. No. +1-603-646-3940

E-mail: [email protected]

2. Dr. Brad Binder

Assistant Professor

Room 343 Hesler Biology Building, Cellular and Molecular Biology Department,

University of Tennessee-Knoxville, Knoxville, TN 37996

Ph: +1-865-974-7994

Fax: +1-865-974-6306

Email: [email protected]

3. Dr. Xin-Guang Zhu

Professor

System Biology Group, Room # 346.

Main Building. Shanghai Institutes for Biological Sciences,

Chinese Academy of Sciences, 320 Yue Yang Road. Shanghai 200031, China

Tel. No. +86-027-68752412

E-mail: [email protected]

mailto:[email protected]



expression of chloroplast small heat shock proteins of c...

Documents