expression of xylella fastidiosa fimbrial and afimbrial proteins during

Expression of Xylella fastidiosa fimbrial and afimbrial proteins during the biofilm

formation.

1

2

3

4

5

6

9

10

11

Caserta, R.1 2; Takita, M. A.1; Targon, M. L.1; Rosselli-Murai, L. K.2; de Souza, A. P.2;

Peroni, L.3; Stach-Machado, D. R.3; Andrade, A.4; Labate, C. A.4; Kitajima, E. W.5; Machado,

M.A.1; de Souza, A. A.1*

1. Centro APTA Citros Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis – 7

SP, BRAZIL, Zip code: 13490-970. 8

2. Universidade Estadual de Campinas/UNICAMP, Centro de Biologia Molecular e

Engenharia Genética, Departamento de Genética e Evolução, Instituto de Biologia, PO Box

6010, Campinas – SP, BRAZIL, Zip code: 13083-970.

3. Universidade Estadual de Campinas/UNICAMP, Laboratório de Imunologia Aplicada, 12

Departamento de Microbiologia e Imunologia, Rua Monteiro Lobato s/n, Campinas – SP, 13

BRAZIL, Zip code:13083-970. 14

15

16

17

18

19

20

21

22

23

24

25

4. Escola Superior de Agricultura “Luiz de Queiroz”/USP, Laboratório Max Feffer de

Genética de Plantas, Departamento de Genética, P.O. Box 83, Piracicaba - SP, BRAZIL, Zip

code: 13400-970.

5. Escola Superior de Agricultura “Luiz de Queiroz”/USP, Núcleo de Apoio à Pesquisa em

Microscopia Eletrônica aplicada à Pesquisa Agropecuária (NAP/MEPA), Piracicaba - SP,

BRAZIL, Zip code: 13418-900.

Running title: Adhesins in the X. fastidiosa biofilm formation

*Corresponding author: Alessandra Alves de Souza

Email: [email protected]

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02114-09 AEM Accepts, published online ahead of print on 14 May 2010

on March 15, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 27

The complete sequencing of the Xylella fastidiosa genome revealed characteristics that 28

were previously unknown for a phytopathogen. One characteristic of this genome was the 29

abundance of genes encoding proteins with adhesion functions related to biofilm formation, 30

an essential step for the colonization of the plant host or the insect vector. Among the 31

different proteins belonging to this class present in the genome of X. fastidiosa, we examined 32

the PilA2 and PilC fimbrial proteins, components of the type IV pili, and XadA1 and XadA2, 33

afimbrial adhesins. Polyclonal antibodies were raised against these four proteins and their 34

behavior during the biofilm development was assessed by Western blot and 35

immunofluorescence experiments assays. In addition, immunogold electron microscopy was 36

used to detect these proteins in bacteria present in xylem vessels of three different hosts 37

(citrus, periwrinkle and hibiscus). We verified that these proteins are present in the biofilm of 38

X. fastidiosa but show a differential regulation since their amounts varied temporally during 39

biofilm formation as well as spatially within the biofilms. The proteins were also detected in 40

bacteria colonizing the xylem vessels of infected plants. 41

42

Introduction 43

Aggregative growth is a common feature in the microbial world and its discovery 44

radically changed our concept of microbial growth dynamics. A cellular aggregate adhered to 45

a surface is known as biofilm. It exhibits important characteristics such as higher resistance to 46

antimicrobial compounds (55, 35), increased capacity of cells to uptake nutrients from the 47

environment (60), and higher efficiency in detoxification resulting from an increase in 48

expression of genes encoding efflux pumps (44). These characteristics give the biofilm cells a 49

great adaptative advantage. 50


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Biofilm growth also confers advantages to plant pathogens by promoting virulence 51

and protection against plant defense responses. Bacteria can colonize different niches in the 52

plant, from aerial surfaces to roots and the vascular system and biofilm formation can play a 53

role in all these sites of colonization. In the vessels, biofilm is very important since the cells 54

need to survive in a competitive habitat where plant defense compounds are produced in 55

response to infection (8). 56

Biofilm development is divided into at least five phases (i) reversible attachment, (ii) 57

irreversible attachment, (iii) beginning of maturation, (iv) mature biofilm, and (v) dispersion 58

(15, 51). In X. fastidiosa 9a5c strain, the maturation phase occurs between 15 and 20 days in 59

vitro while its dispersion happens between 25 and 30 days, as observed by our analysis of 60

biofilm formation using different methods including scanning electron microscopy and 61

quantification of exopolysaccharides, biomass, and total protein (unpublished data). The 62

establishment and development of biofilms of plant colonizing bacteria shares several features 63

with human bacterial pathogens such as the regulation by quorum sensing, nutrient starvation 64

regulation, and phase variation. Motility is also an important factor not only for the initiation 65

and development of the biofilm but also for dispersion (51). Attachment is mediated by 66

surface-associated structures, which includes both polysaccharides and proteins classified as 67

fimbrial and afimbrial adhesins, depending on the structure to which they contribute. Fimbrial 68

adhesins form filamentous structures, while afimbrial adhesins produce projections on the 69

outer membrane (24). 70

Xylella fastidiosa, a gram-negative phytopathogen that grows as a biofilm within both 71

plant xylem vessels and the cybarium of insect vectors, is a major threat for plant production 72

around the world. In Brazil, it has a major economic impact on citriculture since it causes 73

Citrus Variegated Chlorosis disease (CVC) (39, 36, 43). The biofilm formed by X. fastidiosa 74

blocks the xylem vessels of susceptible citrus plants impairing water flow. This blockage 75


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

leads to a drastic reduction in fruit size (33) and consequently, severe economic losses 76

resulting from reduced plant productivity (4). 77

Due to the economic damage caused by CVC, there has been a major effort to generate 78

more information about its biology. This led to the sequencing of the genome of this 79

pathogen. The X. fastidiosa genome harbors a wide variety of genes encoding adhesins (54). 80

Bacterial cell surface adhesins are important at the initial phases of adherence to surfaces as 81

well as in bacterium – bacterium interactions and microcolony development (17). Insight into 82

X. fastidiosa has also come from genome analysis of a strain of X. fastidiosa, which cause 83

Pierce's disease of grape (59). Studies on this strain showed that the cellular aggregation 84

process involves type I and type IV fimbrial adhesins. Both fimbriae present different 85

adhesion forces that help bacteria to adhere to the substrate (31, 11). Adhesion proteins have 86

also been demonstrated to mediate adherence to carbohydrates of the leafhopper foregut 87

surfaces (28). In addition, both fimbrial and afimbrial adhesins are important for plant 88

pathogenicity (42, 38). However, the expression of these proteins during X. fastidiosa biofilm 89

formation either in vitro or in planta is still poorly understood. For X. fastidiosa strains 90

causing CVC, nothing is known about the role of these proteins in pathogenicity or biofilm 91

formation although some adhesion-encoding genes such as pilA2, pilC, xadA1 and xadA2 92

were found to be up-regulated in either virulent strains of this pathogen or during biofilm 93

formation (14, 16). These results suggest that the biofilm mode of growth is important for the 94

colonization success of CVC X. fastidiosa in the citrus host. In this work we focused on the 95

temporal expression of the PilA2 and PilC fimbrial proteins and XadA1 and XadA2, afimbrial 96

adhesins, during the in vitro development of the CVC X. fastidiosa biofilm. We demonstrate 97

that the fimbrial and afimbrial adhesins exhibit very different temporal and spatial patterns of 98

expression during the biofilm development in vitro. Moreover, we also verified the presence 99


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

of these adhesins in X. fastidiosa cells in symptomatic plants from three different hosts (citrus, 100

periwinkle and hibiscus). 101

102

Material and Methods 103

X. fastidiosa strain and in vitro growth condition 104

X. fastidiosa subsp. Pauca strain 9a5c (52), for which a genome sequence is available 105

and obtained from INRA (Institut National de La Recherche Agronomique, Bordeaux, 106

France) was used in all studies. Bacteria were extracted from petioles of symptomatic plants 107

ground in phosphate buffer saline (PBS) and the suspension was spread on periwinkle wilt 108

medium (PW) (9). The first colonies were observed between ten to fifteen days after 109

inoculation and such cells were inoculated into 50mL of PW medium and grown at 130rpm 110

and 28ºC. These cultures were transferred weekly to new media (one week corresponds to one 111

passage) and used to obtain both the biofilm and planktonic cells. The biofilms were 112

recovered from the first (7 days, 14 generations) to the eighth (56 days, 112 generations) 113

passage. Planktonic cells which no longer formed a biofilm were collected after the 114

eighteenth passage (126 days, 252 generations) in PW medium, and used after the 10th

day of 115

growth. For X. fastidiosa 9a5c strain, the doubling time corresponds to 12 hours. 116

117

Construction of expression vectors 118

In order to amplify highly antigenic regions of the target proteins for antibody 119

production, primers were designed to flanking coding sequences carrying hydrophilic and 120

antigenic regions (Lasergene 99 DNASTAR, Inc.). More than one pair of primers were 121

designed for different antigenic regions of the fimbrial proteins PilA2 [Tfp pilus assembly 122

protein, major pilin FimA/PilA (Type IV fimbrillin)] (LBI ORF ID: XF2539) and PilC (Type 123

IV fimbrial assembly protein PilC) (LBI ORF ID: XF 2538), and the afimbrial proteins 124


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

XadA2 (Surface protein adhesin YadA-like) (LBI ORF ID: XF 1529) and XadA1 (Surface 125

protein adhesin YadA-like) (LBI ORF ID: XF 1516). These proteins were originally 126

annotated as FimA, PilC, Hsf and UspA1 but later were re-annotated as noted above; the 127

current accepted annotation can be accessed at www.xylella.lncc.br. Sites for EcoRI and 128

HindIII were placed at the 5´ and 3´ regions of each primer, for directional cloning in pET28a 129

(Novagen). The software Primer Select from Lasergene99 (DNASTAR, Inc.) was used to 130

design the primers. The primers sequences are listed in Table 1. 131

The PCR mix used for obtaining the amplicons contained 100ng of total 9a5c DNA, 132

50ng of each primer Forward (F) and Reverse (R), 2.5mM of dNTP, 1.25µL of 50mM 133

MgSO4, 2.5µL of 10X buffer (Invitrogen), 1 unit de Taq Platinum High Fidelity (Invitrogen) 134

and Milli-Q H2O to 25µL. The amplification was done by one cycle at 94ºC for 3 min, 135

followed by 35 cycles of 55ºC for 1 min, 72

ºC for 1.5 min and 94

ºC for 1 min, and 10 min at 136

72ºC for further extension. The amplified fragments were analyzed in 1% agarose gel stained 137

with ethidium bromide, and visualized under UV light. The fragments were excised from the 138

gel and purified using the ‘GFXTM

PCR DNA and Gel Band Purification’ kit (Amersham 139

Biosciences). The amplicons were cloned in the pGEM-T vector (Promega). E. coli DH5α 140

competent cells were transformed with the constructions and the transformants were grown in 141

LB containing 100µg/mL of ampicilin. 142

The recombinant plasmids were sequenced with the two primers used for amplification 143

of the target genes and primers for pGEM-T vector (T7 and SP6 promoter primers). For 144

sequencing the xadA1-1 and xadA1-2 fragments (1.5Kb and 2.0Kb, respectively), internal 145

primers were also used in order to obtain the full nucleotide sequences. The reactions were 146

prepared according to Applied Biosystems instructions for DNA Sequencing Kit Big Dye 147

Terminator Cycle Sequencing Ready Reaction, v 3.0, and the resulting DNAs were run in the 148

ABI 3730 automatic sequencer (Applied Biosystems). The quality of the cloned DNA 149


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

fragment was confirmed through similarity searches against the X. fastidiosa database using 150

BlastN and BlastX (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi) tools. Plasmids 151

containing sequences with 100% of identity with the expected nucleotide sequences were 152

cleaved with EcoRI and HindIII (Invitrogen) for directional cloning in pET28a using T4 DNA 153

Ligase (Invitrogen). pET28a is designed for expression of the recombinant protein fused to a 154

six amino acid His-tag in both the N and C-terminal regions of the protein. Rosetta competent 155

cells of E. coli were transformed with the recombinant plasmids and the selection conducted 156

in LB plates containing 100µg/mL of kanamycin. PCR colony screen was used for false 157

positive exclusion. 158

159

Expression of the target proteins and purification 160

The induction of the target proteins was performed using 1mM of IPTG in 100mL of 161

culture and two hours incubation at 37ºC. For the proteins that appeared in the insoluble 162

phase, a lower temperature of induction was used (25ºC). The cells were collected by 163

centrifugation at 4000xg for 20 min at 8ºC, suspended in 1mL of buffer 1 (Tris 50mM, NaCl 164

300mM pH7.5) containing 1mg/mL lysozyme and 1mM of PMSF (Phenyl Methyl Sulphonyl 165

Fluoride), and lysed by sonication on ice, in an ultrasonic cell disruptor (Unique). The cell 166

debris and supernatant were precipitated by centrifugation at 12,000rpm for 15 min at 8ºC and 167

the expression pattern of each sample was monitored by SDS – PAGE performed using 12% 168

or 15% separation gel under reducing conditions according to Laemmli (30) and stained with 169

Coomassie brilliant blue R-250 and distained with methanol/acetic acid. 170

Soluble proteins were purified through an Immobilized Metal Affinity Chromatography 171

(IMAC) column packed with 1.0mL of nickel-nitrilotriacetic acid (Ni-NTA) resin. Bound 172

proteins were eluted with 4mL of 200mM of imidazole in 50mM Tris pH7.5, 300mM NaCl. 173


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

Fractions were used to estimate total protein concentration (Bradford assay) and analyzed by 174

SDS-PAGE. 175

Even at low induction temperatures PilC was found only in the insoluble fraction of the 176

extract. Therefore, this protein was cut out of the gel for immunization purpose. 177

178

Identification of purified proteins by LC-MS/MS 179

After obtaining the target proteins, we confirmed their identity through mass 180

spectrometry analysis. For that, the samples were excised from SDS – Page gel and digested 181

according to Celedon (5), using trypsin (Invitrogen), before sequence analysis. The peptide 182

mixtures were identified by on-line chromatography using a Cap-LC coupled to a Q-TOF 183

Ultima API mass spectrometer (Waters). Five microliters of sample were loaded onto a 184

nanoease trapping column 0.18 x 23.5mm (Waters) for pre-concentration, followed by peptide 185

separation in a LC nanoease column Symmetry 300 C18 3.5µm, 75x100mm (Waters). 186

Peptides were eluted in a 60 min linear gradient of solvent B [95 % (v/v) ACN, 0.1% (v/v) 187

formic acid in water] at a flow rate of 250nLmin-¹. Solvent A consisted of [5 % (v/v) ACN, 188

0.1% (v/v) formic acid in water]. The whole analysis was performed using a positive ion 189

mode at a 3kV needle voltage. The mass range was set from 300 to 2000m/z, and the MS/MS 190

spectra acquired for the most intense peaks (≥ 15 counts). Multiple charged precursor ions 191

were selected for fragmentation and peptide sequencing using automated data dependent 192

acquisition (DDA) MassLynx software (Waters), switching from the MS to MS/MS mode and 193

then returning to the MS. The resulting fragmented spectra were processed using the 194

ProteinLynx v4.0 software (Waters). The MASCOT MS/MS Ion Search 195

(www.matrixscience.com) was used to blast the sequences against the SwissProt and NCBI nr 196

databases. Combined MS-MS/MS searches were conducted with parent ion mass tolerance at 197

50ppm, MS/MS mass tolerance of 0.1Da, carbamidomethylation of cysteine (fixed 198


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

modification) and methionine oxidation (variable modification). According to MASCOT 199

probability analysis, only significant (P < 0.05) hits were accepted. 200

Antibody production 201

The antibodies against the target proteins were obtained in New Zealand White 202

rabbits. The purified proteins as well as PilC (excised from an SDS gel) were individually 203

mixed with Freund’s complete adjuvant (Sigma) and injected into individual rabbits. Two 204

additional injections of proteins mixed with Freund’s incomplete adjuvant were done at 10 205

and 20 days after the first injection. The concentration of inoculated proteins reached 150µg. 206

The quality of the antibodies was tested by direct enzyme-linked immunosorbent assay 207

(ELISA), using 3µg of the target proteins as antigens and PBS buffer as negative control. The 208

antibodies dilution varied from 1:10,000 to 1:256,000. The antibodies yielded positive 209

reactions even at 1:250,000 dilution and no cross-reaction was observed with any of the other 210

proteins used for antibody production. 211

212

Total protein extraction of X. fastidiosa biofilm growth phases 213

Three replicate experiments were carried out for biofilm protein extraction. Cells 214

grown in PW medium until the eighth passage were transferred to flasks containing 50mL of 215

medium and grown under the conditions described above. The biofilms formed attached to the 216

glass at the medium-air interface were collected at 3, 5, 10, 15, 20, and 30 days of growth, 217

corresponding to the different developmental biofilm phases (15), and total protein was 218

extracted. For this procedure, the medium was discarded and 1mL of wash buffer (Tris pH8.0 219

50mM; NaCl 25mM; EDTA 5mM pH8.0; 2% Triton X-100) was used to collect biofilm cells. 220

Lysozyme and PMSF (1mM each) were added to the extract and the samples kept on ice for 221

20 min. Cell lysis was obtained by sonication, followed by centrifugation at 10,000xg for 10 222


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

min. The supernatant and pellet were used for protein analysis. For planktonic condition, the 223

cells were obtained after the eighteenth passage when no biofilm was observed at the 224

medium-air interface and collected through centrifugation at 6,000xg for 5 min. Total protein 225

was extracted by treating the cells as described for the biofilms. For all the biological 226

experiments carried out, the amount of total protein obtained from each biofilm phase was 227

normalized before loading the gel, based on a BSA standard curve comparison, which 228

presented an R2 = 0.956. 229

230

Western blot assays 231

X. fastidiosa proteins from different biofilm developmental phases and planktonic 232

growth were quantified according to the procedure described by Lowry (32). For the Western 233

blot assays, 6 µg of proteins for each of the growth conditions were separated in 9 % or 12% 234

SDS-PAGE (sodium dodecyl sulfate polyacrilamide gel electrophoresis), depending on the 235

protein size. Individual Western blot experiments were done for each of the antibodies tested 236

and preimmune rabbit antiserum was used to verify a possible unspecific cross-reaction. After 237

electrophoresis, gels were incubated in Tris glycine buffer (48mM Tris; 39mM glycine; 238

0.04% SDS; 20% methanol) for 1h and the proteins were transferred to A nitrocellulose 239

membrane (Hybond - C Ultra, Amersham) according to the specifications of the manufacturer 240

(Pharmacia) for the Multiphor II Novablot Electrophoretic transfer unit. Membranes were 241

treated according to Amersham's Hybond TM – C nitrocellulose membrane protocol, using 242

TBS buffer (150mM NaCl; 10mM Tris-HCl pH 8.0), blocking period of 16 hours, and 243

incubation with antibodies in a 1:10,000 dilution for 6 hours. The membranes were incubated 244

with a 1:10,000 dilution of goat anti-rabbit alkaline phosphatase conjugate (Sigma) for 1 hour 245

at 37°C, and washed 3 times with 1X TBS, 0.1% Tween-20. For detection of the proteins, the 246

membranes were incubated in freshly prepared substrate solution (0.1M Tris-HCl pH 9.5; 247


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

0.1M NaCl, 5mM MgCl2, 2mg 5-bromo 4-chloro 3-indolyl phosphate and 4mg Nitro Blue 248

Tetrazolium). When the desired staining was achieved, the reaction was stopped by washing 249

the membranes in distilled water. At least three membranes for each biological experiment 250

were tested. 251

Quantification of signal intensity was determined using Image J 1.42q 252

(http://rsb.info.nih.gov/ij) software. The values were used for statistical analyses (t-test, 253

P≤0.05). 254

255

Immunofluorescence of the target proteins in X. fastidiosa biofilm 256

For the immunofluorescence analysis, the biofilms were obtained in cover glasses 257

placed at the bottom of 24 wells Nunclon delta SI Multidishes (Nunc A/S, Roskilde, 258

Denmark) containing 1mL of liquid PW medium in each well. For each time point one plate 259

was used, where 100µL of a pre-inoculum of X. fastidiosa 9a5c (OD = 0.1) were added to 260

four different wells. These culture plates were maintained static at 28ºC and analyzed after 3, 261

5, 10, 15, 20, and 30 days of growth. The PW medium was gently removed from the wells 262

with a pipette, and the biofilm adhered to glass cover was washed, according to Roper (49) 263

but without fixing the cells since the aim of this work was to evaluate just the adhered cells. 264

Each of the antibodies and the preimmune sera were used individually in a dilution of 265

1:1,000. For the localization of proteins in the formed biofilms, we used 1mL of Goat anti-266

rabbit IgG rhodamine conjugated (Santa Cruz Biotechnlogy, Inc., California, USA) in 267

1:10,000 dilution in PBS buffer. The staining of biofilm cells was done with Syto 9 diluted 268

1:600 in MilliQ autoclaved H2O. The images were taken using oil immersion lens (numerical 269

aperture, 1.0) in an Olympus UIS2 Fluorescence microscope using, for Syto 9, a filter that 270

permits an excitation wavelength between 460 and 490nm and emission wavelength between 271

500 and 520nm, and for rhodamine images, a filter that allowed an excitation wavelength 272


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

between 510 and 550nm and emission wavelength between 570 and 590nm. To verify a 273

possible non-specific fluorescent signal, two negative controls were prepared from biofilms at 274

30 days of growth, one without secondary rhodamine conjugate antibodies, and another 275

without primary antibody incubation. 276

277

Immunogold transmission electron microscopy of symptomatic plants 278

Small fragments of petioles from citrus (sweet orange Citrus sinensis cv. Pera), 279

periwinkle (Catharantus roseus) and hibiscus (Hibiscus schizopetalus) infected by X. 280

fastidiosa were fixed in a modified Karnovksy solution (2% paraformaldehyde, 2.5% 281

glutaraldehyde in 0.05M cacodylate buffer, pH 7.2 with 0.001M CaCl2) for 1 to 2 h. These 282

plants were naturally infected by X. fastidiosa, whose presence was confirmed by previous 283

PCR assays. Citrus exhibited characteristic symptoms of CVC, while periwinkle had a general 284

chlorosis and stunting and hibiscus, leaf scald symptoms (29). Fixed tissues were dehydrated 285

in ethanol series (30%, 50%, 70%, 90%) for about 10 min each and then transferred to chilled 286

100% ethanol. Dehydrated tissues were infiltrated with a mixture of ethanol 100% and 287

LRWhite resin (1:1) for 6 h at 4ºC and overnight with pure LRWhite at 4ºC. Infiltrated tissues 288

were then transferred to size 3 gelatin capsules filled with pure LR White and let polymerize 289

at 60ºC for 2 days. Embedded tissues were cut in thin sections in a Leica UC 6 290

ultramicrotome equipped with a Diatome diamond knife and the sections mounted in 100 291

mesh nickel grids covered with Formvar films. Immunolocalization assays with antibodies 292

against the target proteins were done according to the protocol of Vandenbosch (58). As 293

controls for the experiment, images of non-infected xylem vessels of infected plants, the wall 294

of infected xylem vessels, and parenchyma were evaluated and compared. The background 295

was reduced by adjusting the antibodies dilution to 1:250. About 40 immunogold tests for 296

each plant with at least eighty sections per test were done generating a minimum of twenty 297


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

images for each protein in each plant species in the experiment. Transmission electron 298

microscopic examinations were done in a Zeiss EM 900 electron microscope at 80 KV and 299

the images, registered digitally. 300

301

Results 302

Protein purification, polyclonal antibodies and Western blot analysis 303

Clones containing recombinant plasmids produced the proteins of interest in sufficient 304

amounts for further purification. The recombinant proteins PilA2, XadA2 and XadA1 were 305

obtained in the soluble fraction of the protein extracts. In contrast, PilC was present only in 306

the insoluble fraction, even when low induction temperatures were used. The fractions 307

containing PilA2, XadA2 and XadA1 were purified through IMAC and it was possible to 308

recover high amounts of purified proteins after elution with imidazole. For PilC, we excised 309

the band corresponding to the target protein directly from the polyacrylamide gel. The 310

induction and purification were monitored by SDS-Page (data not shown). The identity of the 311

purified proteins was confirmed by LC-MS/MS (data not shown). The proteins were 312

inoculated in rabbits for antibody production. 313

The amount of fimbrial and afimbrial proteins in biofilms was verified in Western blot 314

using cells obtained at 3, 5, 10, 15, 20, and 30 days of growth (Fig. 1), corresponding to the 315

initial adhesion of the cells to the substrate (3 and 5 days), microcolonies formation (10 days), 316

early development of the biofilm architecture (15 days), mature biofilm (20 days), and after 317

some apparent dispersion had occurred (30 days) (unpublished data). Analysis of PilA2, PilC, 318

and XadA2 revealed proteins with apparent molecular masses of approximately 15KDa, 319

55KDa, and 200KDa respectively. These masses are in accordance with the expected for these 320

proteins (http://www.lbi.ic.unicamp.br/xf/). For XadA1, Western blot revealed a band of 321

approximately 70KDa (Fig. 1D) when the predicted molecular mass for XadA1 from X. 322


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

fastidiosa 9a5c is 98KDa. Since contamination was excluded by the analysis of mass 323

spectrometry (Table 2), there is apparently a cleavage of the protein or its genome annotation 324

is wrong. 325

The temporal pattern of abundance of both fimbrial proteins, PilA2 and PilC, was 326

similar and statistically significant differences were observed between the initial and later 327

phases of biofilm formation (Figs. 1A and 1B). The afimbrial proteins showed different 328

patterns of abundance from each other in Western blot analyses. Very little protein was 329

observed at the beginning of biofilm formation for XadA2. By ten days, the amount of this 330

protein had increased but statistically significant increase over that of young biofilm cells was 331

only observed after 30 days of growth (Fig. 1C). XadA1 was produced rather constitutively, 332

and there was no statistically significant difference in the amount of XadA1 protein at any 333

biofilm phase (Fig. 1D). 334

To verify if these adhesins are associated with the biofilm growth condition, we 335

compared their abundance with that in planktonic cells. Under our experimental conditions, 336

none of the evaluated adhesins was detected in planktonic growth of X. fastidiosa (data not 337

shown). 338

339

Immunofluorescence of adhesion proteins in biofilms grown in vitro 340

In order to localize the adhesion proteins during X. fastidiosa biofilm formation in 341

vitro we performed immunolabeling of the proteins and visualized them by fluorescence 342

microscopy. PilA2 and PilC fimbrial proteins were apparent throughout biofilm development 343

by the third day. However, by the twentieth and thirtieth day, the proteins seem to be more 344

concentrated in some parts of the biofilm than others (Figs. 2 and 3). The afimbrial protein 345

XadA2 was not observed in small cell aggregates on the third day of growth but could be seen 346

by the fifth day of biofilm growth, when cellular aggregates were a little larger. By the tenth 347


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

day, when the biofilm began to show a multilayered organization, this protein was quite 348

evident, suggesting a possible role in cell-cell adhesion and three-dimensional structuring 349

(Fig. 4). XadA1 exhibited a biofilm distribution that was quite different from the other 350

proteins (Fig. 5). At the tenth day, when biofilm maturation has started, this protein was 351

primarily present in gaps in the biofilm structure. At the fifteenth and twentieth days, when 352

the biofilm is thickest, this protein is localized in a somewhat different arrangement, with the 353

proteins primarily located in discrete spots, forming an “island-like” pattern within the 354

biofilm. No other protein showed such a pattern. The expression of XadA1 remained 355

localized in “island-like” inclusions on the thirtieth day, even though the spots were less 356

numerous compared to earlier phases of growth and the labeling seemed not to be as tightly 357

linked to the biofilm (Fig. 5). 358

359

Localization of adhesion proteins in different host plants infected with Xylella 360

fastidiosa. 361

To verify the localization of these bacterial proteins in vivo, we analyzed X. fastidiosa 362

cells present in sections of xylem vessels of infected periwinkle, hibiscus, and citrus leaves 363

exhibiting disease symptoms. As PilA2 is one of the rod-forming units of the type IV pili, 364

immunogold labeling demonstrated its occurrence in cell membranes and outside the cells in 365

all tested hosts (Figs. 6A, 6B, 6C). PilC protein, which is involved in pilus assembly, was also 366

detected in the three tested hosts, but mainly in the bacterial cell membrane (Figs. 6D, 6E, 367

6F). In contrast, the afimbrial proteins were detected outside the cells. XadA2 was outside of 368

the cell but close to the outer membrane of cells in the three plant hosts (Figs. 7A, 7B, 7C)., 369

The high level of background labeling for XadA1 in periwinkle did not allow the analysis of 370

this protein in this plant but little labeling of host materials were seen in hibiscus and citrus 371

enabling XadA1 to be visualized in these species. Similar to XadA2, most of this protein was 372


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

observed to be close to the outer membrane but some labeling was also found at more distant 373

sites (Figs. 7D, 7E, 7F). 374

375

Discussion 376

Hierarchically-ordered gene expression circuits are characteristic of biofilms (41). In 377

the present work we demonstrated that adhesion proteins are expressed temporally throughout 378

biofilm development in an orderly pattern. X. fastidiosa biofilm development can be divided 379

into five different phases including initial attachment, microcolony formation, beginning of 380

maturation, mature biofilm, and dispersion (15). Growth of biofilms is a well-known behavior 381

among bacteria and, in X. fastidiosa it is a necessary condition for symptoms development 382

due to the occlusion of the xylem vessel (1, 42). A study of the Pierce's disease X. fastidiosa 383

Temecula strain suggested that the colonization of vessels is related to the capacity of 384

adhesion and twitching motility, mediated by adhesion proteins (12). 385

Type IV pili are important for adhesion and twitching motility in bacteria (37, 2, 21, 386

45, 47, 31, 13). As expected, the variation in the amounts of PilA2 and PilC showed a 387

somewhat similar temporal pattern during X. fastidiosa biofilm formation since they are 388

involved in type IV pili assembly. Higher amounts were observed at the beginning of 389

development and the dispersion phase when cells might be expected to be more motile. Type 390

IV pili must thus have different roles during biofilm development, with adhesion to the 391

surface and twitching motility associated with biofilm spread early in development. The 392

observation that PilA2 and PilC proteins are present in spots in the biofilm is intriguing and 393

suggests that the labeled cells may be released from the biofilm not only as individual cells 394

but also as clusters. Twitching may take place very early in the biofilm development, being a 395

behavior necessary for the formation of macrocolonies. It is known that twitching motility 396


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

allows the existing microcolonies to join and form macrocolonies that will develop into the 397

mature biofilm (57). 398

Immunogold electron microscopy of these fimbrial proteins in periwinkle, hibiscus 399

and citrus revealed that they were located in the same sub-cellular compartment of the X. 400

fastidiosa biofilm. PilA2 was located in the cell membrane as well as outside the cell while 401

PilC was preferentially close to the membrane. This observation is in agreement with the 402

expected localization for the anchoring of immature pilus subunits and their assembly (25, 403

26). The low amount of PilA2 observed is not unexpected since the assembly of the rod could 404

block the epitopes of this protein, with only the epitopes of proteins that are in the initial 405

assembly steps of the pili available for interaction with the antibody (25). 406

The afimbrial protein XadA1 was detected in all phases of biofilm development and 407

XadA2 mainly at later phases of the biofilm development. Western blot analysis of XadA1 408

revealed a protein smaller than expected. This protein is very similar to UspA1 of M. 409

catarrhalis, for which a reduction in size was previously reported; this size reduction was also 410

dependent on the temperature to which the protein was subjected (22, 40). The discrepancy 411

between the expected and observed size of XadA1 could be due to the same factors as those 412

apparently affecting UspA1 processing. Detection of XadA1 in all phases of biofilm 413

formation suggests a possible role in the initial adhesion to surfaces as well as in cellular 414

aggregation. UspA1 of M. catarrhalis is important for adhesion to other cells and thus in 415

biofilm formation (46). It is noteworthy that XadA1 mutants of X. fastidiosa Temecula were 416

reported to be defective in adhesion as single cells to glass surfaces but that cell-cell 417

aggregates could still form. Thus XadA1 is apparently involved in initial adhesion of 418

Temecula cells (17). In the mature biofilm phase, XadA1 is distributed in an “island-like” 419

pattern, suggesting that it may have a role in biofilm structuring by altering cell-cell adhesion 420

and aggregation. However this hypothesis needs to be further investigated. 421


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

The other afimbrial protein evaluated in our work, XadA2, was observed mainly only 422

after ten days, indicating that it is not likely involved in adherence to the substrate but instead 423

is involved in cell-cell adhesion associated with higher cell density. A protein similar to 424

XadA2 from H. influenzae is known to have specific domains (Hia) contributing to adherence 425

to mammalian cells in vitro (7), and directing attachment to specific proteins (19). These 426

domains are present in the X. fastidiosa protein (Fig. 8) and they could mediate protein-427

protein interactions. XadA1 and XadA2 belong to the family of trimeric autotransporters and 428

as such, they may have adhesive activity that mediates bacterial interaction with either host 429

cells or their own extracellular matrix proteins, or even other unknown proteins (7). Even 430

though X. fastidiosa XadA1 protein resembles UspA1 and YadA, two of the most studied 431

proteins of the family, it contains more hep-hag repetitive regions (Fig. 8). XadA2 has 432

similarity to Hsf from H. influenza, but in X. fastidiosa there are many more domains related 433

to adhesive functions, such as the hep-hag and hemagglutinin domains (Pfam domains 434

PF05658 and PF05662) (Fig. 8). Additionally, analysis of XadA2 reveals the presence of 435

motifs that are unique to proteins from X. fastidiosa (Pfam domain PF06669) (Fig. 8). These 436

structural characteristics suggest that XadA1 and XadA2 may have distinct functions in 437

relation to the biofilm formation and host-interaction. 438

These afimbrial adhesins may complement the role of other afimbrial adhesins such as 439

the hemagglutinins. In X. fastidiosa strain Temecula, the hxfA gene encodes one of the 440

hemagglutinins. A mutant for this gene showed increased virulence and monolayer biofilm 441

formation in vivo, suggesting that this would allow a faster colonization of the xylem vessels, 442

thus causing more severe symptoms (18). This observation suggests that in X. fastidiosa, Hxf 443

may be related to aggregation and therefore biofilm growth may be a form of avoiding a rapid 444

colonization of the host, which is undesirable for the pathogen since it could ultimately lead to 445

the death of its plant host. 446


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

XadA1 and XadA2 immunogold labeling was detected close to the cell membrane, in 447

a pattern similar to that reported for YadA from Y. enterocolitica in which aggregation by the 448

protein head domain located outside the cell directed such localization (23). However some 449

XadA1 was also detected far from the cell and together with the immunofluorescence 450

observations of apparent protein aggregates away from cells, suggests that this protein is 451

secreted to the environment. This hypothesis and the possible roles of such secreted proteins 452

needs to be further investigated. 453

Interestingly, the expression of most of the genes encoding the proteins studied in this 454

work, during the biofilm formation in vitro (14), does not correlate well with the protein 455

accumulation at a given time that was detection by Western blot analysis. The expression of 456

xadA2 for instance, was detected mainly at the fifth and tenth days of biofilm formation in 457

vitro yet we observed the presence of the proteins mainly after the tenth day of the biofilm 458

development. It is intriguing that such a lag between gene expression and protein appearance 459

would occur. It seems likely that differential patterns of transcription, translation, and protein 460

degradation might occur during biofilm development. Translation could be affected by small 461

regulatory RNAs mediated by gacA. The activity of small RNAs related to gacA has been 462

demonstrated for Pseudomonas aeruginosa and also for X. fastidiosa (27, 53). In the later 463

case, regulation via gacA is directly affects xadA1 and xadA2 expression, and thus cell-to-cell 464

adhesion and biofilm formation (53). These small RNAs could post-transcriptionally regulate 465

the expression of a variety of proteins including afimbrial adhesins, thus explaining the delay 466

in the production of these adhesins during the biofilm formation. The regulation of these 467

genes could also be mediated through a DSF-dependent (diffusible signal factor) signaling 468

system. Mutations in rpfF, which is responsible for the synthesis of DSF in X. fastidiosa, 469

impairs biofilm formation in the insect vector (43) and leads to higher virulent in plants due to 470

an increased ability to move in the xylem vessel (6, 43). 471


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

Both fimbrial and afimbrial proteins are involved with biofilm formation in X. 472

fastidiosa in vitro. The expression of these adhesins seems to vary substantially at different 473

phases of the biofilm development suggesting differential contribution to various biofilm 474

processes. The variation in the spatial distribution pattern of these proteins in the biofilm also 475

suggests that they contribute in different ways to biofilm functions. The detection of these 476

proteins in xylem vessels of infected plants indicates that biofilms within plants may resemble 477

those produced in vitro and that such structures likely contribute to the infection process. 478

479

Acknowledgements 480

The authors would like to thank Dr. Steven Lindow for critical revision of the manuscript 481

and Renato Salaroli for transmission electron microscopy technical support. This work was 482

supported by research grants from Fundação de Amparo à Pesquisa do Estado de São Paulo 483

(FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) 484

(Proc. Numbers 04/14576-2, 06/52681-8 and INCT-Citros 08/57909-2, 573848/08-4). 485

M.A.T., A.P.S., E.W.K, C.A.L, M.A.M. and A.A.S. are recipient of a research fellowship 486

from CNPq. 487

488

Literature cited 489

1. Almeida, R. P. P., E. F. Pereira, A. H. Purcell, and J. R. S. Lopes. 2001. 490

Multiplication and movement of a citrus strain of Xylella fastidiosa within sweet 491

orange. Plant Dis. 85:382-386. 492

2. Bahar, O., T. Goffer, and S. Burdman. 2009. Type IV Pili are required for virulence, 493

twitching motility, and biofilm formation of Acidovorax avenae subsp. Citrull. Mol. 494

Plant-Microbe Interact. 22:909-920. 495


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

3. Bateman A., E. Birney, L. Cerruti, R. Durbin, L. Etwiller, S. R. Eddy, S. Griffiths-496

Jones, K. L. Howe, M. Marshall, and E. L. Sonnhammer. 2002. "The Pfam protein 497

families database". Nucleic Acids Res. 30:276-280. 498

4. Bové, J. M. and A. J. Ayres. 2007. Etiology of three recent diseases of citrus in São 499

Paulo State: sudden death, variegated chlorosis and huanglongbing. IUBMB Life 500

59:346-354. 501

5. Celedon, P. A. C., A. Andrade, K. C. Xavier, M. C. C. G. Carvalho, D. G. G. 502

Caldas, D. H., Moon, R. T., Carneiro, S. Oda, and C. A. Labate. 2007. Proteomic 503

analysis of the cambial region in juvenile Eucalyptus grandis at three ages. Proteomics 504

7:1-17. 505

6. Chatterjee, S., K. L. Newman, and S. E. Lindow. 2008. Cell-to-Cell Signaling in 506

Xylella fastidiosa Suppresses Movement and Xylem Vessel Colonization in Grape. 507

Mol. Plant-Microbe Interact. 21:1309-1315. 508

7. Cotter, S. E., H. J. Yeo, T. Juehne, and J. W. St Geme III. 2005. Architecture and 509

adhesive activity of the Haemophilus influenzae Hsf adhesin. J. Bacteriol. 187:4656-510

4664. 511

8. Danhorn, T. and C. Fuqua. 2007. Biofilm Formation by Plant-Associated Bacteria. 512

Annu. Rev. Microbiol. 61:401-422. 513

9. Davis, M. J., W. J. French, and N. W. Schaad. 1981. Axenic culture of the bacteria 514

associated with phony disease of peach and plum scald. Curr. Microbiol. 5:311-316. 515

10. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2007. Mutations in type I and type 516

IV pilus biosynthetic genes affect twitching motility rates in Xylella fastidiosa. J. 517

Bacteriol. 189:7507-7510. 518


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

11. De La Fuente, L., E. Montanes, Y. Meng, Y. Li, T. J. Burr, H. C. Hoch, and M. 519

Wu. 2007. Assessing adhesion forces of type I and type IV pili of Xylella fastidiosa 520

using a microfluidic flow chamber. Appl. Environ. Microbiol. 73:2690-2696. 521

12. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2007. Mutations in type I and type 522

IV pilus biosynthetic genes affect twitching motility rates in Xylella fastidiosa. J. 523

Bacteriol. 189:7507-7510. 524

13. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2008. Autoaggregation of Xylella 525

fastidiosa cells is influenced by type I and type IV pili. Appl. Environ. Microbiol. 526

74:5579-5582. 527

14. De Souza, A. A., M. A. Takita, E. O. Pereira, H. D. Coletta-Filho, and M. A. 528

Machado. 2005. Expression of pathogenicity-related genes of Xylella fastidiosa in 529

vitro and in planta. Curr. Microbiol. 50:223-228. 530

15. De Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. M. Yanai, N. 531

H. Muto, R. C. Oliveira, L. R. Nunes, and M. A. Machado. 2004. Gene expression 532

profile of the plant pathogen Xylella fastidiosa during biofilm formation in vitro. 533

FEMS Microbiol. Lett. 237:341-353. 534

16. De Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. H. Goldman, 535

G. M. Yanai, N. H. Muto, R. C. Oliveira, L. R. Nunes, and M. A. Machado. 2003 536

Analysis of gene expression in two growth states of Xylella fastidiosa and its 537

relationship with pathogenicity. Mol. Plant-Microbe Interact.16:867-875. 538

17. Feil, H., W. S. Feil, and S. E. Lindow. 2007. Contribution of fimbrial and afimbrial 539

adhesins of Xylella fastidiosa to attachment to surfaces and virulence to grape. 540

Phytopathology 97:318-324. 541

18. Guilhabert, M. R. and B. C. Kirkpatrick. 2005. Identification of Xylella fastidiosa 542

antivirulence genes: hemagglutinin adhesins contribute to X. fastidiosa biofilm 543


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

maturation and colonization and attenuate virulence. Mol. Plant-Microbe 544

Interact.18:856-868. 545

19. Hallström, T., E. Trajkovska, A. Forsgren, and K. Riesbeck. 2006. Haemophilus 546

influenzae surface fifbrils contribute to serum resistance by interacting with 547

vitronectin. J. Immun. 177:430-436. 548

20. Henderson, I. R. and J. P. Nataro. 2001. Virulence functions of autotransporter 549

proteins. Infect. Immun. 69:1231-1243. 550

21. Heinz P. Hahn. 1997. The type-4 pilus is the major virulence-associated adhesin of 551

Pseudomonas aeruginosa – a review. Gene 192:99-108. 552

22. Hill, D. J. and M. Virji. 2003. A novel cell-binding mechanism of Moraxella 553

catarrhalis ubiquitous surface protein UspA: specific targeting of the N-domain of 554

carcinoembryonic antigen-related cell adhesion molecules by UspA1. Mol. Microbiol. 555

48:117-129. 556

23. Hoickzyc, E., A. Roggenkamp, M. Reichenbecher, A. Lupas, and J. Heeseman. 557

2000. Structure and sequence analysis of Yersinia YadA and Moraxella UspAs reveal 558

a novel class of adhesins. EMBO J. 19:5989-5999. 559

24. Hultgren, S. J., S. Abraham, M. Caparon, P. Falk, J. W. St. Geme III, and S. 560

Normark. 1993. Pilus and nonpilus bacterial adhesins: Assembly and function in cell 561

recognition. Cell 73:887-901. 562

25. Hultgren, S. J., S. Normark, and S. N. Abraham. 1991. Chaperone-assisted 563

assembly and molecular architecture of adhesive pili. Annu. Rev. Microbiol. 45:383-564

415. 565

26. Jones, C. H., P. Danese, J. Pinkner, T. Silhavy, and S. J. Hultgren. 1997. 566

Chaperone-assisted membrane release and folding pathway sensed by two signal 567

transduction systems. EMBO J. 16:6394-6406. 568


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

27. Kay, E., B. Humair, V. Dénervaud, K. Riedel, S. Spahr, L. Eberl, C. Valverde, 569

and D. Haas. 2006. Two GacA-dependent small RNAs modulate the Quorum-Sensing 570

response in Pseudomonas aeruginosa. J. Bacteriol. 188:6026-6033. 571

28. Killiny, N. and R. P. P. Almeida. 2009. Xylella fastidiosa afimbrial adhesins mediate 572

cell transmission to plants by leafhopper vectors. Appl. Environ. Microbiol. 75:521-573

528. 574

29. Kitajima, E. W., H. D. Coletta-Filho, M. A. Machado, and Q. S. Novaes. 2000. 575

Escaldadura das folhas de Hibiscus schizopetalus associada à infecção por Xylella 576

fastidiosa em Brasília, DF. Fitopatol. Bras. 25(Suppl.):S323. {Meeting abstract 577

published in journal supplement.} 578

30. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the 579

head of bacteriophage T4. Nature 227:680-685. 580

31. Li, Y., G. Hao, C. D. Galvani, Y. Meng, L. De La Fuente, H. C. Hoch, and T. J. 581

Burr. 2007. Type I and type IV pili of Xylella fastidiosa affect twitching motility, 582

biofilm formation and cell–cell aggregation. Microbiology 153:719-726. 583

32. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein 584

measurement with the Folin-phenol reagent. J. Biol. Chem. 193:265-275. 585

33. Luban, S. and D. Kihara. 2007. Comparative genomics of small RNAs in bacterial 586

genomes. OMICS: A Journal of Integrative Biology 11:58-73. 587

34. Machado, E. C., J. A. Quaggio, A. M. M. A. Lagôa, M. Ticelli, and P. R. Furlani. 588

1994. Trocas gasosas e relações hídricas em laranjeiras com clorose variegada dos 589

citros. Rev. Bras. Fisiol. Veg. 6:53-57. 590

35. Mah, T. F., B. Pitts, B. Pellock, G. C. Walker, P. S. Stewart, and G. A. O’Toole. 591

2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. 592

Nature 426:306-310. 593


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

36. Marques, L. L. R., H. Ceri, G. P. Manfio, D. M. Reid, and M. E. Olson. 2002. 594

Characterization of biofilm formation by Xylella fastidiosa in vitro. Plant Dis. 86:633-595

638. 596

37. J. S. Mattick. 2002. Type IV pili and twitching motility. Ann. Rev. Microbiol. 597

56:289-314. 598

38. Meng, Y., Y. Li, C. D. Galvani, G. Hão, J. N. Turner, T. J. Burr, and H. C. Hoch. 599

2005. Upstream migration of Xylella fastidiosa via pilus-driven twitching motility. J. 600

Bacteriol. 187:5560-5567. 601

39. Michelmore, R. 2000. Genomic approaches to plant disease resistance. Curr. Opinion 602

in Plant Biol. 3:125-131. 603

40. McMichael, J. C., M. J. Fiske, R. A. Fredenburg, D. N. Chakravarti, K. R. 604

VanDerMeid, V. Barniak, J. Caplan, E. Bortell, S. Baker, R. Arumugham, and D. 605

Chen. 1998. Isolation and characterization of two proteins from Moraxella catarrhalis 606

that bear a common epitope. Infect. Immun. 66:4374-4381. 607

41. Nadell, C. D., J. B. Xavier, and K. R. Foster. 2008. The sociobiology of biofilms. 608

FEMS Microbiol. Rev. 33: 206-224. 609

42. Newman K. L., R. P. P. Almeida, A. H. Purcell, and S. E. Lindow. 2003. Use of a 610

Green Fluorescent Strain for Analysis of Xylella fastidiosa Colonization of Vitis 611

vinifera. Appl. Environ. Microbiol. 69:7319-7327. 612

43. Newman K. L., R. P. P. Almeida, A. H. Purcell, and S. E. Lindow. 2004. Cell-cell 613

signaling controls Xylella fastidiosa interactions with both insects and plants. Proc. 614

Natl. Acad. Sci. U.S.A. 101:1737-1742. 615

44. Nishino K., E. Nikaido, and A. Yamaguchi. 2007. Regulation of multidrug efflux 616

systems involved in multidrug and metal resistance of Salmonella enterica serovar 617

Typhimurium. J. Bacteriol. 189:9066-9075. 618


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

45. O'Toole G. A., and R. Kolter. 1998. Flagellar and twitching motility are necessary 619

for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304. 620

46. Pearson, M. M., C. A. Laurence, S. E. Guinn, and E. J. Hansen. 2006. Biofilm 621

formation by Moraxella catarrhalis in vitro: roles of the UspA1 adhesin and the Hag 622

hemagglutinin. Infec. Immun. 74:1588-1596. 623

47. Prince, A. 1992. Adhesins and receptors of Pseudomonas aeruginosa associated with 624

infection of the respiratory tract. Microb. Pathog. 13:251-260. 625

48. Reimmann, C., C. Valverde, E. Kay, and D. Haas. 2005. Posttranscriptional 626

repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting 627

together with RsmA in the biocontrol Sstrain Pseudomonas fluorescens CHA0. J. 628

Bacteriol. 187:276-285. 629

49. Roper M. C., L. C. Greve, J. M. Labavitch, and B. C. Kirkpatrick. 2007. 630

Detection and visualization of an exopolysaccharide produced by Xylella fastidiosa in 631

vitro and in planta. Appl. Environ. Microbiol. 73:7252-7258. 632

50. Rojas, M. C., J. H. Ham, D. Wen-Ling, J. J. Doyle, and A. Collmer. 2002. HecA, a 633

member of a class of adhesins produced by diverse pathogenic bacteria, contributes to 634

the attachment, aggregation, epidermal cell killing, and virulence phenotypes of 635

Erwinia chrysanthemi EC16 on Nicotiana clevelandii seedlings. Proc. Natl. Acad. Sci. 636

U.S.A. 99:13142-13147. 637

51. Sauer, K., A. K. Camper, G. D. Ehrlich, J. W. Costerton, and D. G. Davies. 2002. 638

Pseudomonas aeruginosa displays multiple phenotypes during development as a 639

biofilm. J. Bacteriol. 184:1140-1154. 640

52. Schaad, N. W., E. Postnikova, G. Lacy, M. B. Fatmi, and C. J. Chang. 2004. 641

Xylella fastidiosa subspecies: X. fastidiosa subsp. piercei, subsp. nov., X. fastidiosa 642


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

subsp. multiplex subsp. nov., and X. fastidiosa subp. pauca subsp. nov. Syst. Appl. 643

Microbiol. 27:290-300. 644

53. Shi, X. Y., C. K. Dumenyo, R. Hernandez-Martinez, H. Azad, and D. A. Cooksey. 645

2009. Characterization of regulatory pathways in Xylella fastidiosa: genes and 646

phenotypes controlled by gacA. Appl. Environ. Microbiol. 75:2275-2283. 647

54. Simpson A. J. G., F. C. Reinach, P. Arruda, F. A. Abreu, M. Acencio, R. 648

Alvarenga, L. M. C. Alves, J. E. Araya, G. S. Baia, C. S. Baptista, M. H. Barros, 649

E. D. Bonaccorsi, S. Bordin, J. M. Bové, M. R. S. Briones, M. R. P. Bueno, A. A. 650

Camargo, L. E. A. Camargo, D. M. Carraro, H. Carrer, N. B. Colauto, C. 651

Colombo, F. F. Costa, M. C. R. Costa, C. M. Costa-Neto, L. L. Coutinho, M. 652

Cristofani, E. Dias-Neto, C. Docena, H. El-Dorry, A. P. Facincani, A. J. S. 653

Ferreira, V. C. A. Ferreira, J. A. Ferro, J. S. Fraga, S. C. França, M. C. Franco, 654

M. Frohme, L. R. Furlan, M. Garnier, G. H. Goldman, M. H. S. Goldman, S. L. 655

Gomes, A. Gruber, P. L. Ho, J. Hoheisel, M. L. Junqueira, E. L. Kemper, J. P. 656

Kitajima, J. E. Krieger, E. E. Kuramae, F. Laigret, M. R. Lambais, L. C. C. 657

Leite, E. G. M. Lemos, M. V. F. Lemos, S. A. Lopes, C. R. Lopes, J. A. Machado, 658

M. A. Machado, A. M. B. N. Madeira, H. M. F. Madeira, C. L. Marino, M. V. 659

Marques, E. A. L. Martins, E. M. F. Martins, A. Y. Matsukuma, C. F. M. Menck, 660

E. C. Miracca, C. Y. Miyaki, C. B. Monteiro-Vitorello, D. H. Moon, M. A. Nagai, 661

A. L. T. O. Nascimento, L. E. S. Netto, A. Nhani Jr, F. G. Nobrega, L. R. Nunes, 662

M. A. Oliveira, M. C. de Oliveira, R. C. de Oliveira, D. A. Palmieri, A. Paris, B. 663

R. Peixoto, G. A. G. Pereira, H. A. Pereira Jr., J. B. Pesquero, R. B. Quaggio, P. 664

G. Roberto, V. Rodrigues, A. J. de M. Rosa, V. E. de Rosa Jr., R. G. de Sá, R. V. 665

Santelli, H. E. Sawasaki, A. C. R. da Silva, A. M. da Silva, F. R. da Silva, W. A. 666

Silva Jr., J. F. da Silveira, M. L. Z. Silvestri, W. J. Siqueira, A. A. de Souza, A. P. 667


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

de Souza, M. F. Terenzi, D. Truffi, S. M. Tsai, M. H. Tsuhako, H. Vallada, M. A. 668

Van Sluys, S. Verjovski-Almeida, A. L. Vettore, M. A. Zago, M. Zatz, J. Meidanis 669

and J. C. Setubal. 2000. The genome sequence of the plant pathogen Xylella 670

fastidiosa. Nature 406:151-157. 671

55. Stewart, P. S. and J. W. Costerton. 2001. Antibiotic resistance of bacteria in 672

biofilms. Lancet 358:135-138. 673

56. St. Geme III, J. W., D. Cutter, and S. J. Barenkamp. 1996. Characterization of the 674

genetic locus enconding Haemophilus influenzae type b surface fibrils. J. Bacteriol. 675

178:6281-6287. 676

57. Toutain, C. M., C. C. Nicki, and G. A. O'Toole. 2004. Molecular basis of biofilm 677

development by pseumonads, p. 43-63. In M. Ghannoum and G. A. O'Toole (ed.), 678

Microbial Biofilms. ASM Press, Washington, DC. 679

58. Vandenbosch, K. 1990. Immunogold labeling, p.181-218. In J.L. Hall and C. Hawesc 680

(ed.), Electron microscopy of plant cells. Academic Press, San Diego, CA. 681

59. Van Sluys M. A., C. B. Monteiro-Vitorello, L. E. Camargo, C. F. Menck, A. C. 682

Da Silva, J. A. Ferro, M. C. Oliveira, J. C. Setubal, J. P. Kitajima, and A. J. 683

Simpson. 2002. Comparative genomic analysis of plant-associated bacteria. Ann. Rev. 684

Phytopathol. 40:169-189. 685

60. Zaini P. A., A. C. Fogaça, F. G. N. Lupo, H. I. Nakaya, R. Z. N. Vêncio, and A. 686

M. da Silva. 2008. The iron stimulon of Xylella fastidiosa includes genes for type IV 687

pilus and colicin V-like bacteriocins J. Bacteriol. 190:2368-2378. 688

689

690

691

692


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

Table 1: Sequences of primers used to amplify target genes. 693

1. Forward sequences. 694

2. Reverse sequences.695

Primer name Primer sequence (5´- 3´) Fragment

size

eco_for (F)1

GAATTCTGGGGCACGAGCTTTTTAGAT pilC-1

rev_hind4 (R)2

AAGCTTCAGCCCTGACCAGATTGCGATAA

568pb

eco_for (F)1

GAATTCTGGGGCACGAGCTTTTTAGAT pilC-2

hind_rev1 (R)2

AAGCTTTTCCCTTCAGAGCCTCAATGTTC

646pb

eco_for5 (F)1

GAATTCGAAGAGCGCTTATGGGTGTGG pilC-3

hind_rev5 (R)2

AAGCTTCAGCCCTGACCAGATTGCGATAAAG

586pb

f_eco2 (F)1

GAATTCCAAGGCGTCGACTCGGTTGCTCTA xadA1-1

r_hind1 (R)2

AAGCTTTCGCCGAAATGCTGACACCACTT

1.564Kb

feco_long5(F)1

GAATTCGTGGCGGCATCGGTGAAG xadA1-2

rhind_in4 (R)2

AAGCTTTAGCCGCCGCCATACTGTTA

2.056Kb

f_eco (F)1

CGAATTCAAAGTTAAGGGCAACTCTCAAGT pilA2-1

rev_hind (R)2

TAAGCTTTTATTTAGAGGCAATGCATCCAGAAGGT

148pb

f2_eco (F)1

GGAATTCAATTATGTCGCCAGGTCCCAACT pilA2-2

rev_hind (R)2


450pb

f_eco_int (F)1

CGAATTCATGAAGAAGCAACAAGGTTTTA pilA2-3

rev_hind (R)2


520pb

f1_eco (F)1

TGAATTCGCGGGCAGCAAGGTGATTAGC xadA2-7

R_hind (R)2

CAAGCTTAGCGTTCACCCCTTATC

882pb

f_ecolong (F)1

GAATTCGCGGGTGCAGTGTCA xadA2-8

r1_hind (R)2

CAAGCTTAATTCCCACCTCAATACATCC

1.6Kb

f1_eco (F)1

TGAATTCGCGGGCAGCAAGGTGATTAGC xadA2-9

r1_hind (R)2

CAAGCTTAATTCCCACCTCAATACATCC

1Kb


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

Table 2: XadA1 sequencing by ESI Q-TOF. Sequence matched are showed in bold. 696

1. Molecular weight in Daltons 697

2. Isoeletric point 698

3. Experimental average mass of sample in Daltons 699

4. Calculated average mass of sample in Daltons 700

5. Parts per million 701

702

703

Protein hits Accession Score Mr (Da)1

pI2 Coverage (%)

Peptides matched

Observed Mr(expt) (Da)3

Mr(calc) (Da)4

Ppm5 Score Peptide

Surface-exposed outer

membrane protein XF1516

[imported] - Xylella fastidiosa

C82672 405 98281 7.17 10

6 759.3655 1516.7164

1516.7845

-44.89 82 R.ATANAIGSSVLGVDSR.A

769.3839 1536.7532

1536.7532

0.02 39 R.TYEANVLSIGSGNGR.G

799.9739 1597.9332

1597.8060

79.6 52 R.IVNVGDGIGNNDAVNK.S

880.9922 1759.9698

1759.8952

42.4 84 K.SQLDGVTASVNDVAASVK.T

894.9738 1787.9330

1787.9265

3.65 97 K.SQLDGVTASVNDVVASVK.N

994.5337 1987.0528

1987.0586

-2.89 56 K.VVSGVAVSDSSVAANAQVLSK.G


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

Figure captions 704

Figure 1: Analysis of proteins in different biofilm growth phases. Total protein was 705

isolated from biofilm cells, normalized by Lowry quantification and evaluated in Western 706

blots using (A) Anti-PilA, (B) Anti-PilC, (C) Anti-XadA2, and (D) Anti-XadA1 antibodies. 707

The bands were quantified using ImageJ software. The values correspond to the average 708

obtained in three independent experiments. Error bars represent the standard error of the 709

mean. 710

711

Figure 2: Fluorescence labeling of PilA in the X. fastidiosa biofilm grown on glass 712

slides. Cells in different growth phases of the biofilm were marked in green using the nucleic 713

acid staining dye Syto 9 and the red spots correspond to the antibody recognition of PilA 714

(secondary antibody labeled with rhodamine). Cells were visualized with oil immersion lens 715

(numerical aperture, 1.0) in an Olympus UIS2 Fluorescence microscopy using, for Syto 9, 716

excitation wavelength between 460 and 490nm and emission wavelength between 500 and 717

520nm, and for rhodamine, excitation wavelength between 510 and 550nm and emission 718

wavelength between 570 and 590nm. White bars represent 10µm. In the first column are the 719

images representing the PilA labeling, with X. fastidiosa cells depicted in red. In the second 720

column are the pictures representing the Syto 9 staining, with X. fastidiosa cells depicted in 721

green. The pictures in the third column are the superposed images of the two channels (green 722

and red). The presence of PilA is depicted by red or orange colors in small cell clusters and in 723

biofilm structure in the first column. 724

725

Figure 3: Fluorescence labeling of PilC in the X. fastidiosa biofilm grown on glass 726

slides. Cells were stained with Syto 9, labeled with an anti-PilC antibody and visualized under 727

the fluorescence microscope. The first column represents the immunolabeling of PilC and the 728


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

second column the green channel. The third column represents the superposed images of the 729

two channels, green and red. 730

731

Figure 4: Fluorescence labeling of XadA2 in the X. fastidiosa biofilm grown on glass 732

slides. Cells were stained with Syto 9, labeled with an anti-XadA2 antibody and visualized 733

under the fluorescence microscope. The first column represents the immunolabeling of 734

XadA2 and the second column the green channel. The third column represents the superposed 735

images of the two channels, green and red. 736

737

Figure 5: Fluorescence labeling of XadA1 in the X. fastidiosa biofilm grown on glass 738

slides. Cells were stained with Syto 9, labeled with an anti-XadA1 antibody and visualized 739

under the fluorescence microscope. The first column represents the immunolabeling of 740

XadA1 and the second column the green channel. The third column represents the superposed 741

images of the two channels, green and red. The arrows indicate gaps in biofilm at 10 days 742

after inoculation in which immunolabeling reveals the presence of XadA1 protein, as 743

visualized in panels H and I, respectively. 744

745

Figure 6: Immunogold electron microscopy of plant xylem vessels infected with X. 746

fastidiosa. The sections were labeled with the anti-PilA2 and anti-PilC antibodies and 747

visualized under transmission electron microscopy in a Zeiss EM 900 microscope. A. X. 748

fastidiosa cells labeled with anti-PilA antibodies inside citrus vessels. B. X. fastidiosa cells 749

labeled with anti-PilA antibodies inside periwinkle vessels. C. X. fastidiosa cells labeled with 750

anti-PilA antibodies inside hibiscus vessels. D. X. fastidiosa cells labeled with anti-PilC 751

antibodies inside citrus vessels. E. X. fastidiosa cells labeled with anti-PilC antibodies inside 752


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

periwinkle vessels. F. X. fastidiosa cells labeled with anti-PilC antibodies inside hibiscus 753

vessels. Arrows indicate labeling of PilA2 or PilC proteins. 754

755

Figure 7: Immunogold electron microscopy of plant xylem vessels infected with X. 756

fastidiosa. Different plant hosts were sectioned and the X. fastidiosa cells were labeled either 757

with the anti-XadA2 or XadA1 antibodies. A. Labeling of citrus vessels with the anti-XadA2 758

antibody. B. Labeling of periwinkle vessels with the anti-XadA2 antibody. C. Labeling of 759

hibiscus vessels with the anti-XadA2 antibody. D. Labeling of citrus vessels with the anti-760

XadA1. E and F. Labeling of hibiscus vessels with the anti-XadA1 antibody. Arrows indicate 761

labeling of XadA2 or XadA1 proteins. 762

763

Figure 8: Comparison of XadA2 and XadA1 proteins. The XadA2 proteins from X. 764

fastidiosa 9a5c (A) and Temecula (B) strains were compared with the Hsf protein from H. 765

influenzae (C), in relation to the structure. The structures of the XadA1 proteins from X. 766

fastidiosa 9a5c (D) and Temecula (E) strains were compared with UspA1 from M. catarrhalis 767

(F) and YadA from Y. enterocolitica (G). All of the C-termini are YadA-like domains, red 768

boxes indicate HIM domains, light green boxes indicate Hep_Hag repetitive regions, dark 769

blue indicate X. fastidiosa surface protein related motifs, yellow boxes indicate domains of 770

unknown functions. 771

772

773

774

775

776

777


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

expression of xylella fastidiosa fimbrial and afimbrial proteins during

Documents