f pepe et al. nature 000 , 1-4 (2013) doi:10.1038/nature12768

F Pepe et al. Nature 000, 1-4 (2013) doi:10.1038/nature12768 The hot, rocky planet Kepler-78b placed on a planetary mass–radius diagram.

Upload: marisa

Post on 05-Jan-2016

26 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

The hot, rocky planet Kepler-78b placed on a planetary mass–radius diagram. F Pepe et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12768. - PowerPoint PPT Presentation

TRANSCRIPT

F Pepe et al. Nature 000, 1-4 (2013) doi:10.1038/nature12768

The hot, rocky planet Kepler-78b placed on a planetary mass–radius diagram.

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

GI Motility online (May 2006) | doi:10.1038/gimo48

Published in Nature Materials (2016) doi:10.1038/nmat4569

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

doi:10.1038/nature06481 LETTERS

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

GI Motility online (May 2006) | doi:10.1038/gimo31

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

GI Motility online (May 2006) | doi:10.1038/gimo6

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Biotechnology: doi:10.1038/nbt

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

doi:10.1038/nature12886 Neanderthal from the Altai

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

17 September 2009 doi:10.1038/nature08355 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/ncomms1280 molecular dynamics of single

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS