fentanyl and its analogs desensitize the cloned mu opioid receptor - jpet, june 1998, 285(3),...

7/30/2019 Fentanyl and Its Analogs Desensitize the Cloned Mu Opioid Receptor - JPET, June 1998, 285(3), 1207-1218

1/12

Fentanyl and its Analogs Desensitize the Cloned Mu OpioidReceptor1

GEORGE BOT, ALLAN D. BLAKE, SHUIXING LI and TERRY REISINE

Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania

Accepted for publication April 3, 1998 This paper is available online at http://www.jpet.org

ABSTRACT

Fentanyl, and its structural analogs lofentanil and sufentanil, arepotent analgesics used clinically in the management of pain.However, the high analgesic potency of these compounds islimited by the development of tolerance after chronic use. To

investigate whether their tolerance development may be relatedto mu receptor desensitization, the cloned mouse mu receptoras well as mutant forms of the receptor were stably expressedin HEK 293 cells and tested for their response to continuousopioid treatment. Fentanyl and its analogs potently bound tothe mu receptor and effectively inhibited cAMP accumulation.Three-hour pretreatment of mu receptors with fentanyl and itsanalogs desensitized the mu receptor by uncoupling it fromadenylyl cyclase. The fentanyl analogs caused a slight internal-ization of the mu receptor as accessed by antibody binding to

the epitope-tagged mu receptor. Truncation of the mu receptorby removal of its carboxyl terminus at Glu341 did not affect theability of the fentanyl analogs to bind to and activate the mureceptor nor did it prevent the fentanyl analogs from desensi-

tizing the receptor. In a previous study we showed that mor-phine did not desensitize the cloned mu receptor even thoughit is a potent and effective agonist at the mu receptor. Mutagen-esis studies revealed that morphine interacts differently with themu receptor to activate it than do the fentanyl analogs whichmay explain its lack of desensitization of the mu receptor.These results indicate that desensitization of the mu receptormay be a molecular basis for the development of tolerance tofentanyl and its analogs.

Opioids induce a myriad of pharmacological actions andare used extensively in the management of pain. Althoughthree major receptors mediate the effects of opioids, most ofthe opioids used clinically in pain management, such asmorphine, methadone, fentanyl and codeine, have high affin-ity for the mu opioid receptor (Raynor et al., 1994).

Since the potent synthetic analgesic fentanyl was reportedin the early sixties (Janssen, 1965), the 4-anilidopiperidineclass of opioids, structurally distinct from the amply studiedmorphine analogs, have been the subject of much interest.Some of these compounds were found to have an analgesicpotency far greater than that of morphine (Janssen, 1982)and are used clinically as analgesics or analgesic/anesthetics.

However, the high analgesic potency of these compounds islimited by the development of tolerance, dependence andrespiratory depression. Despite the host ofin vivo animal andin vitro receptor binding studies (Maguire et al., 1992;Raynor et al., 1994), little is known about the functionalcellular consequence of fentanyl and its derivatives. Al-though both the morphine (morphinan) and fentanyl (4-ani-

lidopiperidine) class of compounds are believed to inducemost of their pharmacological actions by stimulating theopioid mu receptor, studies have suggested dissimilaritiesbetween the mechanisms involved in the antinociceptive ef-fects of compounds such as fentanyl and its analogues andmorphine. For example, antisense oligodeoxyribonucleotideagainst the subtype Gi2 protein antagonized morphine- butnot sufentanil-induced antinociception (Raffa et al., 1994)and the ATP-sensitive K channel blocker gliquidone antag-onized the antinociception produced by morphine but notthat induced by fentanyl and levorphanol (Ocana et al.,1995). This suggests that although these compounds may beinteracting with the same opioid receptor type, the mu recep-

tor, different intracellular effector mechanisms may be in-duced by them in producing their effects. Hence the molecu-lar determinants of receptor recognition may be differentthan for receptor activation.

Studies of opioid signal transduction has relied upon theuse of tumor cell lines expressing opioid receptors or brainhomogenates (Costa et al., 1992; Maguire et al., 1992; Lam-bert et al., 1993). These preparations, however, generallycontain a heterogeneous population of opioid receptors andhence do not lend themselves to the unequivocal character-ization of actions at a specific receptor subtype. Recent clon-

Received for publication June 18, 1997.1 This work was supported by National Institute of Drug Abuse Grant

DA05636 (A.D.B.) and DA08951 (T.R.).

ABBREVIATIONS: HEK, human embryonic kidney; G protein, guanine nucleotide-binding regulatory protein; G i and Go, G proteins mediating

inhibition and stimulation of adenylyl cyclase, respectively; DAMGO, [D-Ala2

,MePhe4

,Gly-ol5

]enkephalin; IBMX, isobutylmethylxanthine.

0022-3565/98/2853-1207$03.00/0THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 285, No. 3Copyright 1998 by The American Society for Pharmacology and Experimental Therapeutics Printed in U.S.A.JPET 285:12071218, 1998

1207


2/12

ing of the opioid receptors has allowed the study of thepharmacology and biochemistry of these receptors in identi-fying the receptor domains involved in ligand binding andintracellular effects and thus has also offered a better under-standing of opioid mechanisms with the promise of safer andmore effective analgesic agents (Reisine and Bell, 1993; Re-isine and Pasternak, 1996).

Tolerance development has been associated with both mor-

phine and fentanyl treatment after prolonged administration(Paronis and Holtzman, 1992). Morphine has also beenshown to desensitize the coupling of the cloned mu receptorto K channels (Blake et al., 1997b), uncoupling of which hasbeen suggested to be a molecular basis of tolerance develop-ment to morphine. Although the mechanisms underlying tol-erance/dependence are unknown, it has recently been corre-lated with modulation of adenylyl cyclase activity viaG-protein transduction systems (Nestler et al., 1993). How-ever, differential desensitization of mu opioid receptor-medi-ated inhibition of cAMP accumulation in selected rat brainregions after chronic morphine administration has been re-ported, with regions such as the nucleus accumbens and

caudate putamen exhibiting no change in contrast to thethalamus which exhibited desensitization (Noble and Cox,1996). Similarly, morphine has been reported not to uncouplethe cloned mu receptor from adenylyl cyclase (Blake et al.,1997a). This suggests that adaptive responses occurring dur-ing morphine administration are not identical in all opiate-sensitive neuronal populations and that morphine may se-lectively desensitize some, but not all, intracellular functionsof the mu receptor.

In an effort to gain cellular insight into the structure/activity relationship for the fentanyl class of opioids we havestably expressed the mouse mu opioid receptor in humanHEK 293 cells. We then investigated whether fentanyl, andits structural analogs (fig. 1) can regulate the cloned mousemu receptor. We showed that fentanyl, sufentanil and lofen-tanil uncoupled the cloned mu receptor from adenylyl cyclasethat distinguished this class of opioids from morphine thathas been reported not to regulate mu receptor/adenylyl cy-clase coupling (Blake et al., 1997a). Desensitization by thefentanyl analogs was not dependent on the presence of theC-terminus of the mu receptor indicating that posttransla-tional modification of the intracellular loops of the receptormay be involved in the desensitization process. The differen-tial ability of fentanyl and morphine to desensitize the cou-pling of the mu receptor from adenylyl cyclase may be due todifferences in the ability of these opiates to interact with andactivate the mu receptor since mutation of the conserved

Asp114 of the mu receptor to an asparagine abolished mor-phine stimulation but had minimal effects on fentanyl analogactivation. These findings show that morphine and fentanylinteract differently with the same receptor to cause distinctadaptive responses that may be linked to long-term func-tional consequences associated with their use.

Methods

Cell culture. HEK 293 cells were grown and maintained in min-imal essential medium with Earles salts (Life Technologies, Inc.,Westbury, NY) containing 10% fetal calf serum, 100 U ml1 penicil-

lin and streptomycin sulfate in 10% CO2 at 37C. The mouse mu

opioid receptor gene modified with the FLAG epitope (DYKDDDDK)at the amino terminus was a gift from Dr. Mark von Zastrow,University of California at San Francisco. The mouse mu opioidreceptor, the D114N mutant and the carboxyl-terminal truncatedmutant cDNA in the expression vector pcDNA3 (Invitrogen, Carls-

bad, CA) were stably transfected into HEK 293 cells by a modifica-tion of the calcium phosphate protocol (Chen and Okayama, 1988).Briefly, HEK 293 cell monolayers at approximately 70% confluencewere transfected with 30 g of plasmid. After an overnight incuba-tion at 37C, the medium was removed and the cells were treatedwith 5 ml of phosphate buffered saline containing 10% glycerol for 10min at room temperature. Cells were then washed twice with phos-phate-buffered saline and incubated for 48 hr at 37C in growthmedium. Stable transformants were selected in growth medium con-taining 1 mg ml1 Geneticin (Life Technologies, Inc., Grand Is., NY)and maintained in T 75-cm2 tissue culture flasks in 10% CO2 at 37C.

Mutagenesis of the cloned mu opioid receptor. The mousemu opioid receptor cDNA was mutated using the Altered Site in vitroMutagenesis system (Promega Corp., Madison, WI). To mutate as-partic acid 114 (in the putative second transmembrane domain) to anasparagine, the mu receptor cDNA was subcloned into pALTER anda single-stranded template was produced. The 21-mer oligonucleo-tide GCTAAGGCGTTTGCCAGAGCA containing the desired muta-tion was annealed to the single-stranded template. After annealing,T4 DNA polymerase and T4 DNA ligase were employed for elonga-tion and ligation. The heteroduplex DNA was used to transform therepair-minus Escherichia coli strain BMH 71-18 mut S. Transfor-mants were selected by growth on LB plates containing 125 g/mlampicillin. The mutation was confirmed by dideoxyDNA sequencingand the cDNA was excised and subcloned into EcoRI-EcoRV site inthe expression vector pcDNA3.

Generation of the carboxyl terminal truncation mu mu-

tant. The mu opioid receptor cDNA was mutated using a commer-cially available in vitro mutagenesis system (Altered Sites, Promega

Corp.). To produce the carboxyl terminal truncation mutant, an

Fig. 1. Chemical structures of fentanyl analogs included in this study.

1208 Bot et al. Vol. 285


3/12

ochre termination codon (UAA) was introduced by oligonucleotidedirected mutagenesis at Glu341, which is predicted to be at theinterface of the putative seventh transmembrane region and intra-cellular carboxyl terminal tail of the receptor. The product cDNA wassubcloned into pcDNA3 and sequenced to verify the presence of thestop codon at Glu341.

Radioligand binding studies. Receptor binding studies wereperformed using membranes from stably transfected HEK 293 cellsexpressing the mu WT or D114N or mu-TRUNC mutant cDNA.

Membranes were prepared and receptor binding studies conductedas described (Raynor et al., 1994) and as noted in the table and figurelegends. Briefly, cell monolayers were harvested in 6 ml of buffercontaining 50 mM Tris-HCl (pH 7.8) containing 1 mM EDTA, 5 mMMgCl2, 10 g ml

1 leupeptin, 10 g ml1 pepstatin and 200 g ml1

bacitracin and placed on ice. A cell pellet was prepared by centrifu-gation at 24,000 g for 7 min at 4C and was homogenized in thesame buffer using a Polytron (Brinkman Instruments, Westbury,NY) at setting 2.5 for 30 sec. The cell homogenate was centrifuged at48,000 g for 20 min at 4C and the resulting cell pellet wasresuspended by homogenization and placed on ice for the bindingassays. Binding assays were carried out at 25C for 40 min in a final

volume of 200 l with 5 nM [3H]-diprenorphine as radioligand and 1M diprenorphine to define nonspecific binding. The binding reac-

tion was terminated by the addition of ice-cold 50 nM Tris-HCl (pH7.8) and rapid filtration over FP-100 Whatman (Clifton, NJ) GF/Bglass-fiber filters that were pretreated with 0.5% polyethyleneimineand 0.1% bovine serum albumin. The filters were rinsed with 12 mlof ice-cold buffer, and the bound radioactivity was determined usinga liquid scintillation counter.

For agonist pretreatment studies, a 10-fold concentrated stock ofagonist was diluted into growth medium and added to individualculture flasks. The final concentration of all agonists used in regu-lation studies was 1 M. Cell monolayers were harvested at thetimes indicated in the table and figure legends.

cAMP accumulation studies. Stably transfected HEK 293 cellswere subcultured in 12-well culture plates and allowed to recover for72 hr before the experiments. For agonist pretreatment, the growthmedium was replaced containing 1 M ligand. After 3 hr pretreat-

ment, the medium was removed and replaced with 1 ml of growthmedia containing 0.5 mM IBMX and the cells were incubated for 30min at 37C. The medium was then removed and replaced with freshmedium, with or without 10 M forskolin and opioids and the cellstransferred to 37C. After 5 min the medium was removed, 1.0 ml of0.1 N HCl was added and the monolayers frozen at 20C. Fordetermination of the cAMP content of each well, the monolayerswere thawed, placed on ice, sonicated and the intracellular cAMPlevels measured by radioimmunoassay (Amersham plc, Bucking-hamshire, UK). Data obtained from the dose-response curves wereanalyzed by nonlinear regression analysis with GraphPad Prism 2(GraphPad Software, Inc., San Diego, CA).

Radiolabeling of the M2 monoclonal antibody. The monoclo-nal antibody M2 against the FLAG epitope was purchased fromEastman Kodak (New Haven, CT). The antibody radioiodination wasperformed by a chloramine T procedure previously reported (Blake etal., 1997a). Briefly, 250 g of M2 antibody were incubated in 200 mMNaPO4 buffer (pH 7.3) with 0.5 mCi of Na

125I and the reactioninitiated with 100 l of chloramine T (0.5 mg ml1 in NaPO4 buffer).

After 30 sec at room temperature, the reaction was terminated by theaddition of 100 l of sodium metabisulfite (1.25 mg ml1 in NaPO4buffer). The iodinated protein was separated from free 125I by columnchromatography with Sephadex G-25, aliquots from the collectedfractions were counted in a LKB -scintillation counter and thenstored at 4C.

Antibody binding to cell monolayers. After agonist treatmentof cell monolayers, the cells were treated with 1.5% paraformalde-hyde in phosphate-buffered saline for 10 min at room temperatureand then incubated for 30 min at 37C in growth medium containing

10% fetal calf serum. After aspiration, approximately 200,000 cpm of

125I-M2 antibody in growth medium containing 10% fetal calf serum,was added to individual wells in 24-well plates. After a 30-minincubation at 37C, the monolayers were washed in medium, solu-bilized with 0.5 ml of 1 N NaOH and bound radioactivity was countedin a -scintillation counter. Nonspecific radiolabeled antibody bind-ing was determined in the presence of 10 M FLAG peptide (DYK-DDDDK; Eastman Kodak) and accounted for 20% or less of the totalbinding.

Results

To investigate the agonist regulation of the cloned opioidmu receptor, the wild-type cDNA and the mutant forms of themu receptor that contained an aspartate to asparagine sub-stitution at amino acid 114 (D114N) and the carboxyl-mutanttruncated at Glu341 (mu-TRUNC) were stably expressed inHEK 293 cells. Pharmacological characterization of the sta-bly transformed cells was carried out, using radioligand bind-ing and the functional inhibition of forskolin-stimulatedcAMP accumulation, as previously described (Raynor et al.,1994; Blake et al., 1997a). Saturation binding with the radio-

ligand, 3H-diprenorphine, demonstrated a dissociation con-stant (Kd) of 1.9 0.2 nM and receptor density level (Bmax) of2.3 0.1 pmol mg1 protein for the wild-type mu receptorand 1.3 0.2 nM and 4.4 1.6 pmol mg1 protein for themu-TRUNC mutant and 1.3 0.3 nM and 3.7 0.6 pmolmg1 protein for the D114N mutant mu receptor. No specificradioligand binding was detected in untransfected HEK 293cells (data not shown). These results were comparable tothose reported in other surrogate cell lines (Raynor et al.,1994; Costaet al., 1992; Maguireet al., 1992) and in HEK 293cells (Blake et al., 1997a). Although we have used the sametransfected cells under the same conditions as in our previ-ous study (Blake et al., 1997a), differences in cell batches

may have contributed to the 3-fold lower Bmax value for thewild-type mu receptor obtained in our study. The analysis ofcompetitive radioligand binding data with 3H-diprenorphineshowed that fentanyl and its analogs, sufentanil and lofen-tanil, bound potently to the mu receptor with nanomolaraffinities (table 1), comparable to those previously reported(Raynor et al., 1994).

Studies on opioid receptors expressed in HEK 293 cellshave shown that these receptors are coupled to the inhibitionof adenylyl cyclase and to G proteins of the Gi or Go family

TABLE 1

Binding potencies (Ki, nM S.E.) to inhibit [3H]Diprenorphine to the

cloned mouse mu wild-type (-WT) and the mu-TRUNC mutant opioid

receptors stably expressed in HEK 293 cells

Ligand-WT -TRUNC

Ki values (nM)

Fentanyl 1.01 0.4 1.04 0.2Lofentanil 0.14 0.01 0.28 0.03Sufentanil 0.45 0.02 0.42 0.02Nalbuphine 17.7 2.1 14.6 2.1Levorphanol 5.7 1.7 3.5 1.1

Binding potencies of opioid ligands for HEK 293 cell membranes expressing themu wild-type and mu-TRUNC mutant opioid receptors. All competition bindingassays were performed as described in Methods with [3H]-diprenorphine as radio-ligand and 1 M diprenorphine to define nonspecific binding (Raynor et al., 1994).Competition inhibition curves were generated from radioligand binding data (ligandconcentration range from 1061013 M) and analyzed using GraphPad Prism 2(GraphPad Software, Inc., San Diego, CA). The inhibitory binding constants (Ki)were calculated from the IC50 values. The results represent the mean S.E. for

three separate inhibition curves, each assayed in duplicate.

1998 Fentanyl Desensitizes Mu-Receptor 1209


4/12

(Arden et al., 1995; Blake et al., 1997a). The cloned mureceptor expressed in HEK 293 cells was functionally activeand mediated agonist inhibition of forskolin stimulatedcAMP accumulation (table 2). Fentanyl, sufentanil and lofen-tanil potently and effectively inhibited cAMP accumulation(table 2). Their potencies were comparable to the full-agonistlevorphanol (table 2) and to those of morphine and DAMGOpreviously reported in HEK 293 cells (Blake et al., 1997a).Lower maximal levels of cAMP accumulation for fentanylhave been reported by others in SH-SY5Y human neuroblas-toma cells (Lambert et al., 1993).

The extent of maximal inhibition of nalbuphine comparedto fentanyl (% max. inhibition: 58.0 5.6, n 3; 81.3 1.9,

n 3; Students t test, P .017) suggests that nalbuphinemay have partial agonist activity at the mu receptor. Theinability of nalbuphine to maximally inhibit forskolin-stim-ulated cAMP accumulation in the HEK 293 cells, the moder-ate binding affinity exhibited for the cloned mu receptor(table 1) and the lower functional efficacy compared to thebinding affinity (table 1) are consistent with the reportedpartial agonist activity of this opioid (Walker and Young,1993).

Inhibition of maximal cAMP accumulation was blocked bythe mu selective antagonist naloxone. Naloxone (1 M) sig-nificantly decreased (data not shown) the maximal inhibitoryeffects of the mu selective agonists fentanyl, lofentanil,sufentanil and nalbuphine. Previous investigations haveshown that overnight treatment with pertussis toxin alsodecreased the maximal inhibitory capacity of the mu selec-tive and nonselective agonists (Blake et al., 1997a) confirm-ing that the cloned mu receptor coupled to adenylyl cyclasevia Gi and/or Go proteins in the HEK 293 cells used in ourstudy.Mu receptor desensitization. Although mu agonists can

inhibit cAMP accumulation, previous studies have indicated

that prolonged treatment with morphine, levorphanol andDAMGO did not desensitize the mu receptor stably expressedin HEK 293 cells (Blake et al., 1997a). However, drugs usedin the treatment of opioid addiction methadone and bu-prenorphine, did desensitize the mu receptor after a 3-hrpretreatment (Blake et al., 1997a). To further investigate theeffects of agonist regulation on the cloned mu receptor, a 3-hrpretreatment with the agonists fentanyl, lofentanil, sufen-tanil and nalbuphine was used. This time period was based

TABLE 2

Relative potencies of opioid agonists in inhibiting forskolin stimulated intracellular cAMP production for the cloned mouse -opioid receptor (-WT) and the D114N and -TRUNC mutants stably expressed in HEK 293 cells

Ligand

Mu Opioid Receptor/Mutant

-WT D114N mutant -TRUNC mutant

EC50 (nM)Max.

inhibition (%) EC50 (nM)Max.


inhibition (%)

Morphine 2.4 1.1 71.7 2.8 213. 72a 18.3 11.4b ND NDFentanyl 0.15 0.1 81.3 1.9 0.8 0.1a 54.3 0.3b 0.53 0.14 87.3 0.3a

Lofentanil 0.03 0.01 82.0 1.8 0.3 0.1a 74.7 2.3 0.08 0.1 84.7 2.1Sufentanil 0.3 0.1 81.0 1.0 0.5 0.1 76.8 2.4 0.002 0.001b 81.7 2.6Nalbuphine 1.5 0.8 58.0 5.6 3.1 1.1 47.7 4.6 14.4 0.6b 42.7 6.4Levorphanol 1.0 0.1 79.0 2.4 25.3 8.1a 42.5 6.1b 0.38 0.15a 77.7 2.6

Agonist inhibition of cAMP accumulation by wild-type, D114N an d mu-TRUNC mutant mu receptors stably expressed in HEK 293 cells. For generation of cAMP results,cell monolayers were treated for 30 min at 37C with growth medium containing 0.5 mM IBMX. After treatment, the medium was replaced with growth medium containingagonist over the concentration range 1012 to 106 with 10 M forskolin, incubated for 5 min at 37C and then assayed for intracellular cAMP levels as described inMethods. The EC50 values were determined by nonlinear regression computer analysis of the dose-response curves generated using GraphPad Prism 2. Maximal inhibitionof forskolin-stimulated cAMP accumulation was that obtained at the 1 M concentration and is expressed as a percentage of the forskolin control. Both results represent themean S.E. of at least three separate experiments, each performed and assayed in duplicate. Statistical significance (P .05) was determined by a paired Students t test.

a P .05 (Students t test, compared to wild-type).b P .01.ND, Not determined.

TABLE 3

Agonist (106 M) pretreatment (3 hr) effects on opioid inhibition of forskolin-stimulated cAMP levels for mu-WT opioid receptor expressed in HEK293 cells

Ligand

-WT Untreated Cells

-WT Agonist Pretreated Cells

EC50 (nM)Max.


inhibition (%)

Fentanyl 0.15 0.1 80.3 2.4 4.6 1.1a 66.7 3.8a

Lofentanil 0.03 0.01 80.7 1.8 1000 0.0Sufentanil 0.3 0.1 81.0 1.0 21.5 6.1a 25.0 2.5b

Nalbuphine 1.5 0.8 58.0 5.6 11.1 5.7b 38.3 3.7a

Effects of agonist pretreatment on opioid inhibition of cAMP accumulation for the mu-wt opioid-receptor. HEK 293 cell monolayers were either untreated (control) ortreated (pretreated) for 3 hr at 37C with 1 M of appropriate ligand (fentanyl, lofentanil, sufentanil or nalbuphine). After 30-min incubation with 0.5 mM IBMX at 37C,cells were then incubated with 10 M forskolin and 1 M of appropriate ligand for 5 min at 37C and then assayed for intracellular cAMP levels as described in Methods.The pretreatment results were compared to results for cells that did not undergo pretreatment. Maximal inhibition of forskolin-stimulated cAMP accumulation was thatobtained at the 1 M concentration and is expressed as a percentage of the forskolin control. For cells pretreated for 3 hr with fentanyl, lofentanil, sufentanil and nalbuphine,the forskolin-stimulated cAMP levels were 10.2 0.9, 3.5 0.6, 5.4 0.5 and 8.8 0.7 pmol cAMP/mg cellular protein, respectively. The corresponding control(nonpretreated) cells for each group were 7.1 0.7, 5.4 0.6, 5.9 0.3 and 5.5 0.6 pmol cAMP/mg cellular protein, respectively. These forskolin-stimulated levels weretypically 5- to 20-fold more than basal cAMP values for each group. Both treated and untreated results represent the mean S.E. of at least three separate experiments,each performed and assayed in duplicate. Statistical significance (P .05) was determined by a paired Students t test.

a P .05 (Students t test, compared to untreated).b

P .01.



5/12

on previous studies examining effects of other drug treat-ments on the opioid mu receptor (Blake et al., 1997a). Time-course studies on the regulation of mu receptor by etorphine,buprenorphine and methadone revealed that maximum reg-ulation occurs at 3 hr. For those drugs that have been foundnot to regulate the mu receptor in this time course, such asmorphine and DAMGO, extended overnight pretreatmentswere also without any effect (Blake et al., 1997a).

Pretreatment of the mu receptor with fentanyl for 3 hrdesensitized the mu receptor and caused a 30-fold reductionin the potency of fentanyl to inhibit cAMP accumulation(table 3; fig. 2, a and b). Lofentanil and sufentanil also de-

sensitized the mu receptor with lofentanil treatment abolish-

ing the coupling of the mu receptor to adenylyl cyclase (table3; fig. 3, ac). The desensitization after fentanyl pretreat-ment was in marked contrast to the lack of desensitizationreported for the mu receptor expressed in HEK 293 cells bymorphine and DAMGO reported previously (Blake et al.,1997a). This suggests that drugs of abuse of the morphineclass may have different intracellular adaptive effects follow-ing interaction with the mu receptor than those of the fent-

anyl class. The ability of the partial agonist nalbuphine todesensitize the mu receptor (table 3) was similar to the actioninduced by another partial agonist buprenorphine which alsodesensitized the mu receptor (Blake et al., 1997a).

The functional desensitization observed after agonist pre-treatment may be due to reduced cell-surface receptor den-sity induced by the agonist. To assess the effects of agonistpretreatment on receptor expression on the cell surface, aniodinated monoclonal antibody against the amino-terminalFLAG epitope was used. Binding of 125I-M2 antibody to theextracellular epitope FLAG amino terminus of the mu recep-tor would reflect presence of receptor whether the bindingsite is occupied or not. The extent of loss of receptors from the

cell surface would be reflected in the reduction in mean125

Iradioactivity. At present, the amino terminus of the mousemu receptor is predicted to be an extracellular site not knownto be directly involved in ligand binding (Surratt et al., 1994).Labeling was conducted in a similar manner as described byKeith et al. (1996) for the delta-receptor and Blake et al.(1997a) for the mu receptor.

Pretreatment with fentanyl and lofentanil caused a smallinternalization of the mu receptor (fig. 4). The internalizationdid not correlate with the magnitude of mu receptor desen-sitization because lofentanil, which abolished coupling of themu receptor to adenylyl cyclase, caused no greater magni-tude of internalization than fentanyl that caused only a 17%reduction in maximal accumulation of adenylyl cyclase (table3). However, sufentanil, which dramatically desensitized themu receptor, did not induce receptor internalization. Theseresults suggest that the time course for desensitization andinternalization for the mu receptor are not the same andappear to be agonist dependent. Furthermore, internaliza-tion and desensitization were not dependent on the potencyof the agonists because levorphanol, which is as potent andeffective an agonist as the fentanyl analogs in inhibitingcAMP accumulation, caused no desensitization nor internal-ization (figs. 4 and 5 in Blake et al., 1997a).Mu-TRUNC mutant. For a number of G protein-linked

receptors, the C-terminal region, which is rich in phosphateacceptor serine and threonine residues, has been proposed to

be involved in receptor desensitization (Lohse, 1993). To in-vestigate the role of the C-terminus of the mu receptor indesensitization, the receptor was truncated by engineering astop codon in the receptor cDNA corresponding to amino acidresidue 341, at the interface of transmembrane seven and theC-terminus. The truncated mu receptor (mu-TRUNC) boundfentanyl analogs as well as levorphanol and nalbuphine withsimilar affinities as did the wild-type mu receptor (table 1).Furthermore, both fentanyl and lofentanil were as potentand effective in inhibiting cAMP accumulation via the muTRUNC mutant as via the wild-type mu receptor (table 2)indicating that the C-terminus of the mu receptor was notessential for coupling to adenylyl cyclase. However, despite

the similarity in binding potency, levorphanol exhibited a

Fig. 2. Fentanyl desensitization of fentanyl inhibition of forskolin-stim-ulated cAMP accumulation. Dose-dependent fentanyl inhibition of fors-kolin-stimulated cAMP levels from (s) control and () 1 M fentanylpretreated cell monolayers expressed as (A) % of control and (B) as actual

values (fmol/10 l). Bar graphs represent forskolin (FSK) stimulationalone obtained for control and treated groups. Monolayers were pre-treated for 3 hr with 1 M fentanyl at 37C. After treatment, the mediumwas replaced with growth medium containing fentanyl over the concen-tration range 1011 to 106 with 10 M forskolin, incubated for 5 min at37C and then assayed for intracellular cAMP levels as described underMethods. Intracellular cAMP levels were measured using a commer-cially available cAMP radioimmunoassay kit (Amersham, Buckingham-shire, UK). The inhibition of forskolin-stimulated cAMP accumulation isexpressed as a percentage of the forskolin control. Intracellular cAMPlevels of the cells incubated with forskolin alone served as controls(100%). Forskolin-stimulated cAMP levels were typically 5- to 20-foldhigher than basal values. Basal levels were subtracted from the forskolinlevels obtained. The data presented are the means S.E. of three or moreseparate experiments, each performed in duplicate.



6/12

small increase whereas sufentanil exhibited a large increase

in potency compared to the wild-type mu receptor, suggestingan increase in their coupling to adenylyl cyclase via the muTRUNC mutant (table 2). All three fentanyl analogs desen-sitized the mu-TRUNC receptor (table 4; fig. 5, a and b), withlofentanil and sufentanil analogs exhibiting a far greatereffect on efficacy and potency than fentanyl, demonstratingthat the C-terminus is not essential for these compounds forreceptor regulation.

Nalbuphine is traditionally considered to be a mixed opioidagonist/antagonist (Reisine and Pasternak, 1996) with a lowdependence profile and lower efficacy than morphine. Mor-phine pretreatment failed to desensitize both the wild-typemu receptor (Blake et al., 1997a) and the mu-TRUNC recep-

tor (data not shown). However, unlike morphine (Blake et al.,

1997a), nalbuphine desensitized the mu receptor causing a

7-fold affinity reduction and a 34% reduction in maximalinhibition of cAMP accumulation (table 3; fig. 6, a and b). Thedesensitization was not associated with internalization of themu receptor (fig. 4). In contrast to the findings with thefentanyl analogs, nalbuphine did not desensitize the mu-TRUNC receptor (table 4; fig. 6c), indicating that desensiti-zation by nalbuphine did require the presence of the C-terminus. These findings indicate that fentanyl analogs arelikely to desensitize the mu receptor via a different mecha-nism than that mediating the effects of the mixed agonist/antagonist nalbuphine.

D114N mutant. The ability of fentanyl analogs to desen-sitize the mu receptor and the lack of mu receptor regulation

by morphine and levorphanol reported previously (Blake et

Fig. 3. Desensitization of lofentanil and sufentanil inhibition of forskolin-stimulated cAMP accumulation. Dose-dependent lofentanil inhibition offorskolin-stimulated cAMP levels from (s) control and () 1 M lofentanil pretreated cell monolayers expressed as (A) % of control and (B) as actual

values (fmol/10 l). C, Dose-dependent sufentanil inhibition of forskolin-stimulated cAMP levels from (s) control and () 1 M sufentanil-pretreatedcell monolayers expressed as actual values (fmol/10 l). Bar graphs represent forskolin (FSK) stimulation alone obtained for control and treatedgroups. Monolayers were pretreated for 3 hr with 1 M lofentanil or sufentanil at 37C. After treatment, the medium was replaced with growthmedium containing lofentanil or sufentanil over the concentration range 1012 to 106 with 10 M forskolin, incubated for 5 min at 37C and thenassayed for intracellular cAMP levels as described in Methods. The results represent the mean S.E. from at least three independent experiments,each performed and assayed in duplicate. Statistical significance (P .05) was determined by a paired Students t test.



7/12

al., 1997a) may be due to different interactions that thesecompounds may exhibit with the mu receptor that may cause

their distinct cellular adaptive responses. To test whetherthese drugs have different determinants for activation, apoint mutation was made in the second transmembrane do-main of the mu receptor to change Asp114 to asparagine(D114N). Previous studies have shown that this conservedamino acid was necessary for morphine to bind to the mureceptor with high affinity and to activate the receptor toinhibit cAMP accumulation (Heerdinget al., 1994; Surratt etal., 1994). Similarly, we found that morphine had a greatlyreduced potency and efficacy in inhibiting cAMP accumula-tion via the D114N mutant (table 2) than the wild-type mureceptor. Similarly, levorphanol, which as morphine, has alsobeen found not to desensitize the mu receptor (Blake et al.,

1997a), also exhibited a marked reduction in its potency andefficacy to inhibit cAMP accumulation via the D114N mutantas reflected in a rightward shift of the dose-response curve(table 2; fig. 7).

In contrast, the fentanyl analogs were effective in inhibit-ing cAMP accumulation via the D114N mutant (fig. 8, a andb). Similarly, the ability of nalbuphine to stimulate the mureceptor to inhibit cAMP accumulation was not dependentupon the Asp114 residue (fig. 8c). These findings indicate thatfentanyl analogs and nalbuphine, which desensitize the mureceptor in terms of inhibition of cAMP accumulation, inter-act differently with the mu receptor than do opioids such asmorphine and levorphanol that do not desensitize the recep-

tor.

Discussion

In our study we have stably expressed an epitope-taggedmouse mu receptor (Kaufman et al., 1995), a mutant mureceptor with substituted asparagine for the aspartate resi-due at position 114 (D114N) (Heerdinget al., 1994; Surratt etal., 1994) and a mutant mu receptor lacking the carboxyl-terminal domain in HEK 293 cells and the functional activity

of fentanyl analogs via these receptors were examined. Themouse mu receptor bound the fentanyl analogs with highaffinity as well as the nonselective agonist levorphanol andthe partial mu agonist nalbuphine.

Although morphine and fentanyl are used extensively inthe management of pain, a major limitation to their clinicaleffectiveness is the development of tolerance. However, opi-oids are not all equal in their abilities to produce tolerance orto elicit responses in animals that have been rendered toler-ant. For example, in a drug discrimination study, chronicmorphine injections to rats induced tolerance to the analgesicresponses of both morphine and fentanyl, but chronic admin-istration of an equieffective dose of fentanyl did not producetolerance (Paronis and Holtzman, 1992). Similarly, patientswith cancer-related pain refractory to morphine did not ex-hibit tolerance to fentanyl or sufentanil (Paix et al., 1995).This suggests that although both morphine and fentanyl mayinteract with the mu opioid receptor, they may induce dis-tinct types of biochemical cellular adaptations.

Our results suggest that the molecular basis for tolerancedevelopment to morphine and fentanyl may be different.Although the fundamental basis of tolerance is poorly under-stood, it may be linked to the desensitization of the receptorsand their uncoupling from cellular effector systems (Lohse,1993). Both the cloned delta and kappa receptors have beenreported to desensitize after continuous agonist exposure,with an uncoupling from adenylyl cyclase and a reduction in

the inhibition of cAMP accumulation (Blake et al., 1997b).However, mu receptor coupling to the inhibition of adenylylcyclase has been found to be resistant to desensitization asup to 24 hr of pretreatment with morphine failed to uncouplethe cloned mu receptor, stably expressed in HEK 293 cells,from adenylyl cyclase (Blake et al., 1997a). In contrast, fen-tanyl and its analogs lofentanil and sufentanil, desensitizedthe mu receptor after 3 hr pretreatment, greatly reducing theability of the receptor to couple to adenylyl cyclase.

Studies of mammalian cell lines that endogenously expressopioid receptors have focused on the role of receptor desen-sitization and down-regulation in the development of opioidtolerance (Nestler, 1992). To a large extent, receptor desen-

sitization has been found to occur in the absence of signifi-cant receptor down-regulation and our results indicate thatthis is a likely mechanism by which fentanyl induces toler-ance. The desensitization could involve an uncoupling of themu receptor from G proteins linking the receptor to effectorsystems and/or internalization of the mu receptor as has beenreported previously for etorphine acting upon the mu recep-tor (Blake et al., 1997a) and upon the delta receptor (Bot etal., 1997) expressed in HEK 293 cells. Our results suggestthat the former mechanism is most likely to be involved infentanyl desensitization because fentanyl, and its analogs,only induced a small internalization of the mu receptor andthe internalization induced was not correlated with the mag-

nitude of the desensitization induced by each compound. A

Fig. 4. Agonist pretreatment effects on 125I-M2 monoclonal antibodybinding to membranes prepared from HEK 293 cells stably expressing

the -FLAG cDNA. HEK 293 cells were plated in 24-well plates andpretreated with the appropriate agonist for 3 hr at 37C. After agonisttreatment the cell monolayers were processed as described under Meth-ods. Histograms represent cumulative effects at 3 hr. Total 125I-M2binding was in the range of 3914 173 cpm for untreated cells; nonspe-cific binding, determined in the presence of 10 M FLAG peptide, wasless than 20% of the total bound counts. The results are presented aspercent of untreated control monolayers and are the mean S.E. of atleast three experiments. Statistical significance was determined bypaired Students t test with significance defined as P .05.



8/12

similar result has recently been reported for levorphanolacting upon the delta receptor which caused a 400-fold re-duction in agonist potency to inhibit cAMP accumulationwith a minimal effect on receptor internalization (Bot et al.,1997). This suggests that the phenomena of desensitizationand internalization may occur via interrelated but distinct

processes and/or pathways.

Although we have not addressed the issue whether desen-sitization to fentanyl analogs results in a cross-desensitiza-tion to other agonists such as morphine or nalbuphine, wehave previously shown that cross-desensitization may be ag-

onist dependent. We have measured the effects of buprenor-phine pretreatment on the ability of etorphine to stimulatethe mu receptor. Buprenorphine pretreatment has been re-ported to desensitize the mu receptor to further buprenor-phine stimulation (Blake et al., 1997a). After such pretreat-ment, however, etorphine was still able to stimulate the mureceptor to inhibit cAMP accumulation (A. Blake, G Bot andT. Reisine, unpublished results). As different agonists appearto be dependent on different regions of the mu receptor forbinding and induction of subsequent intracellular effects,desensitization to a particular agonist may, or may not, ex-tend to other agonists.

Studies by Arden et al. (1995) have suggested that uncou-

pling of mu receptors from adenylyl cyclase may involvephosphorylation of the receptor by protein kinases as the mureceptor contains sites for phosphorylation in the first andthird intracellular domain and in the C-terminus (Reisineand Bell, 1993). In support of this notion, it has been shownrecently that both chronic morphine and heroin increasedprotein kinase activity in the nucleus accumbens of rats (Selfet al., 1995) and immunoblotting techniques have shown adecrease in protein kinase C levels in certain brain regions ofheroin addicts (Busquets et al., 1995). Furthermore, opioid-inhibited protein phosphorylation mediated through adeny-lyl cyclase in rat brain membranes has also been reported(Fleming et al., 1992). Truncation of the mu receptor to

remove the serine- and threonine-rich C-terminus did notprevent mu receptor desensitization by fentanyl analogs, in-dicating that if phosphorylation is involved in mu receptordesensitization, then it must involve modification of residuesin the intracellular loops of the receptor. The amino acidsequences of the intracellular loops of the three cloned opioidreceptors are almost identical (Reisine and Bell, 1993), sug-gesting that if phosphorylation of the residues in these intra-cellular domains is involved in mu receptor desensitization,it may also be common to the other opioid receptors, the deltaand kappa receptors, which have been demonstrated to un-dergo desensitization (Blake et al., 1997b).

Behavioral studies in humans and animals have suggested

that nalbuphine is a mixed agonist/antagonist at opioid re-

TABLE 4

Agonist (106M) pretreatment (3 hr) effects on opioid inhibition of forskolin-stimulated cAMP levels for mu-TRUNC mutant opioid receptorexpressed in HEK 293 cells

Ligand

-TRUNC Untreated Cells -TRUNC Agonist Pretreated Cells

EC50 (nM)Max.


inhibition (%)

Fentanyl 0.53 0.14 87.3 0.3 9.8 1.3a 91.3 0.3a

Lofentanil 0.08 0.1 84.7 2.1 36.9 12.2b 18.0 6.8c

Sufentanil 0.002

0.001 81.7

2.6 10.7

2.2a

27.3

2.7c

Nalbuphine 14.4 3.0 42.7 6.4 8.3 1.3 48.3 5.2

Effects of agonist pretreatment on opioid inhibition of cAMP accumulation for the mu-TRUNC mutant receptor. HEK 293 cell monolayers were either untreated (control)or treated (pretreated) for 3 hr at 37C with 1 M of appropriate ligand (fentanyl, lofentanil, sufentanil or nalbuphine). After 30 min incubation with 0.5 mM IBMX at 37C,cells were then incubated with 10 M forskolin and 1 M of appropriate ligand for 5 min at 37C and then assayed for intracellular cAMP levels as described in Methods.Both treated and untreated results represent the mean S.E. of at least three separate experiments, each performed and assayed in duplicate. Statistical significance (P .05) was determined by a paired Students t test.

a P .01 (Students t test, compared to untreated).b P .05.c P .001.

Fig. 5. Fentanyl and lofentanil effects on forskolin-stimulated cAMPaccumulation in mu-TRUNC mutant receptor expressing HEK 293 cells.

A, Dose-dependent fentanyl inhibition of forskolin-stimulated cAMP lev-els from (s) control and () 1 M fentanyl-pretreated cell monolayers.Monolayers were pretreated for 3 hr with 1 M fentanyl at 37C and theconcentration-dependent effects of fentanyl on intracellular cAMP accu-mulation determined. B, Dose-dependent lofentanil inhibition of forsko-lin-stimulated cAMP levels from (s) control and () 1 M lofentanil-pretreated cell monolayers. Monolayers were pretreated for 3 hr with 1M lofentanil at 37C and the concentration dependent effects of lofen-tanil on intracellular cAMP accumulation determined. The results rep-resent the mean S.E. from three independent experiments, each per-formed and assayed in duplicate.



9/12

ceptors, used in the treatment of mild to moderate pain, andcan produce mu agonist or mu antagonist effects dependingon the experimental procedure (Walker and Young, 1993;Zacny et al., 1997). Our study suggests that nalbuphine maybe acting as a partial agonist at the mu receptor in that its

effectiveness in inhibiting cAMP accumulation via the wild-type mu receptor was less than that exhibited by the fullagonists such as fentanyl and morphine (Blake et al., 1997a).However, unlike morphine (Blake et al., 1997a), nalbuphinedesensitized the wild-type mu receptor without any signifi-cant receptor internalization. This ability to desensitize mayhave contributed to the reported ability of nalbuphine, whencoadministered with morphine, to prevent development oftolerance and dependence to the antinociceptive effects ofmorphine in rats (Lee et al., 1997). This suggests that partialagonists with this ability may be useful in extending theclinical efficacy of the more commonly used opiates such asmorphine to which tolerance readily develops.

In contrast to fentanyl desensitization that did not require

the C-terminus of the mu receptor, nalbuphine induced de-sensitization was dependent on the C-terminus. This sug-gests that although fentanyl and nalbuphine were able todesensitize the wild-type mu receptor, separate domains ofthe receptor are involved in their desensitization process and

that they have different requirements for receptor regula-tion. The involvement of distinct regions of the mu receptorin agonist regulation points to the possibility of distinct bio-chemical mechanisms being responsible for the agonist-me-diated desensitization of the receptor and perhaps in theinduction of tolerance.

Differences in interaction with the mu receptor may alsocontribute to the variations in the abilities of morphine andfentanyl to desensitize the mu receptor. Previous studieshave suggested that Asp114 in the second transmembranedomain of the mu receptor was essential for morphine bind-ing (Surratt et al., 1994; Heerding et al., 1994). Mutation ofAsp114 residue to an asparagine reduced the ability of mor-

phine to inhibit adenylyl cyclase activity to 25% of the wild-

Fig. 6. Nalbuphine effects on forskolin-stimulated cAMP accumulation in mu-WT and mu-TRUNC mutant receptor expressing HEK 293 cells.Dose-dependent nalbuphine inhibition of forskolin-stimulated cAMP levels from (s) control and () 1 M nalbuphine pretreated cell monolayersexpressing the mu-WT receptor expressed as (A) % of control and (B) as actual values (fmol/10 l). Bar graphs represent forskolin (FSK) stimulationalone obtained for control and treated groups. Monolayers were pretreated for 3 hr with 1 M nalbuphine at 37C and the concentration-dependenteffects of nalbuphine on intracellular cAMP accumulation determined. C, Dose-dependent nalbuphine inhibition of forskolin-stimulated cAMP levelsfrom (s) control and ( ) 1 M nalbuphine-pretreated cell monolayers expressing the mu-TRUNC mutant receptors. Monolayers were pretreated for3 hr with 1 M nalbuphine at 37C and the concentration-dependent effects of nalbuphine on intracellular cAMP accumulation determined.



10/12

type mu receptor expressed in COS cells (Surratt et al.,1994). Consistent with the results of Surratt et al. (1994), wefound that morphine and levorphanol were ineffective ininhibiting cAMP accumulation via the D114N mutant. Incontrast, sufentanil and nalbuphine were just as potent andeffective in inhibiting cAMP accumulation via the D114 mu-tant as via the wild-type mu receptors. In general thosecompounds, fentanyl, sufentanil, lofentanil and nalbuphine,

that desensitized the mu receptor, were not dependent uponthe Asp114 residue for activation of the mu receptor to inhibitcAMP accumulation. The necessity of Asp114 for morphineand levorphanol to stimulate the mu receptor and the lack ofits requirement for the fentanyl analogs and nalbuphineactivation, indicates that these compounds have differentdeterminants in the mu receptor for activation. By interact-ing with the mu receptor differently, the fentanyl analogsand nalbuphine may activate adaptive cellular responsesthat result in mu receptor/adenylyl cyclase uncoupling. Incontrast, morphine may not stimulate these cellular path-ways, even though fentanyl and morphine both bind to thesame receptor and are equally effective in inhibiting adenylyl

cyclase.The ability of the mu-TRUNC mutant receptor to effec-

tively couple to adenylyl cyclase and bind agonists with high

Fig. 8. Effects of sufentanil, lofentanil and nalbuphine on inhibition of forskolin-stimulated cAMP accumulation for the (s) mu wild-type and the ( )D114N mutant opioid receptor. A, Dose-dependent sufentanil inhibition of forskolin-stimulated cAMP levels. B, Dose-dependent lofentanil inhibitionof forskolin-stimulated cAMP levels. C, Dose-dependent nalbuphine inhibition of forskolin-stimulated cAMP levels. Cell monolayers were plated in12-well dishes, and the concentration-dependent effects of sufentanil, lofentanil or nalbuphine on intracellular cAMP accumulation was determined

as described in Methods. The data presented are the means S.E. of three or more separate experiments, each performed in duplicate.

Fig. 7. Effects of levorphanol on inhibition of forskolin-stimulated cAMPaccumulation for the (s) mu wild-type and the ( ) D114N mutant opioidreceptor. Stably transfected HEK 293, expressing either the wild-typemu-receptor or the D114N mutant, were plated in 12-well plates and theconcentration-dependent effects of levorphanol on intracellular cAMPaccumulation determined. The results represent the mean S.E. from

three independent experiments, each performed and assayed in dupli-cate.



11/12

affinity suggests that the C-terminus of the mu receptor isnot essential for associating the receptor with G proteins toinhibit cAMP accumulation and suggests that the intracellu-lar loops of the mu receptor may be more critical for G proteincoupling. These results agree with others who have alsoshown that the C-terminus of the mouse delta receptor (Cve-jic et al., 1996) and a partial truncation of the rat mu receptor(Surratt et al., 1994) were not essential for agonist inhibition

of cAMP accumulation. The agonist bound mu receptor hasbeen proposed to couple to a number of subclasses of Gproteins namely the Gi1, Gi2, Gi3, Go, Gs and Gq sub-classes (Prather et al., 1995; Standifer et al., 1996). Interest-ingly, all three opioid receptors are capable of interactingwith these G proteins (Prather et al., 1995; Standifer et al.,1996) and the three opioid receptors have almost identicalamino acid sequences in their intracellular loops (Reisineand Bell, 1993). The ability of the mu-TRUNC receptor tofunctionally couple to adenylyl cyclase suggests that thethree opioid receptor, mu, delta and kappa, may act viasimilar molecular mechanisms to couple to cellular effectorsystems.

Differences in the affinity of the ligand-bound receptor forG proteins has been suggested to underlie the lower activityof partial agonists (Tota and Schimerlik, 1990). The lowerefficacy of nalbuphine, compared to fentanyl, might resultfrom its inability to induce or stabilize a conformationalchange (Kenakin, 1995) in the receptor to a state whichassociates with G proteins. Evidence that partial agonistsinduce similar receptor conformational changes to full ago-nists but with a reduced magnitude has been suggested fromstudies by Benovic et al. (1988). Differential activation ofinhibitory G-protein -subunits by nalbuphine compared tofentanyl may also exist (Gettys et al., 1994). Recently it hasbeen reported that, after binding to their receptors, opioidsexhibit different efficacy and/or potency in the activation ofdifferent classes of G proteins (Garzon et al., 1997). Evidencealso indicates that a single opioid receptor type can interactwith several G proteins (Prather et al., 1995) which, in turn,can couple to more than one effector (Gintzler and Xu, 1991)and these may integrate coincident signals from differentG-protein subtypes (Lustig et al., 1993). Different agonistsmay affect distinct arrays of G proteins. Hence, multiple Gprotein subunits are able to influence the actions of a singleopioid agonist. This may contribute to their ability to desen-sitize or not the mu receptor and hence to their ability toinduce tolerance.

Our results suggest that the agonist morphine interactsdifferently with the mu receptor to activate it than do ago-

nists such as nalbuphine and the fentanyl analogs. Thisability to desensitize, or not, may play a role in the degree oftolerance to the analgesic effects induced by a particularagonist and may be useful in the development of novel opi-oids with limited abuse potential after continued use.

Acknowledgments

The authors thank Mr. John C. Freeman for his expert technicalassistance and Mr. John Hines for performing the original mutagen-esis on the mu-receptor cDNA.

References

Arden JR, Segredo V, Wang Z, Lameh J and Sadee W (1995) Phosphorylation andagonist-specific intracellular trafficking of an epitope-tagged -opioid receptor in

HEK293 cells. J Neurochem 65:16361645.

Benovic JL, Staniszewski C, Mayor F, Caron MG and Lefkowitz RJ (1988) Activityof partial agonists for stimulation of adenylate cyclase correlates with ability topromote receptor phosphorylation. J Biol Chem 263:38933897.

Blake AD, Bot G, Li S, Freeman J and Reisine T (1997a) Differential opioid agonistregulation of the mouse -opioid receptor. J Biol Chem 272:782790.

Blake AD, Bot G, Tallent M, Law SF, Li S, Freeman J and Reisine T (1997b)Molecular regulation of opioid receptors. Receptors and channels 5:231235.

Bot G, Blake AD, Li S and Reisine T (1997) Opioid regulation of the mouse -opioidreceptor expressed in human embryonic kidney 293 cells. Mol Pharmacol 52:272281.

Busquets X, Escribe P, Sastre M and Garcia-Sevialla JA (1995) Loss of proteinkinase C-alpha beta in brain of heroin addicts and morphine dependent rats.

J Neurochem 64:247252.Chen CA and Okayama H (1988) Calcium phosphate-mediate gene transfer: A high

efficient transfection system for stable transforming cells with plasmid DNA.Biotechniques 6:632638.

Costa EM, Hoffman BB and Loew GH (1992) Opioid agonists binding and responsesin SH-SY5Y cells. Life Sci 50:7381.

Cvejic S, Trapaidze N, Cyr C and Devi LA (1996) Thr353, located within the COOH-terminal tail of the d opiate receptor, is involved in receptor down-regulation.

J Biol Chem 271:40734076.Fleming LM, Ponjee G and Childers SR (1992) Inhibition of protein phosphorylation

by opioid-inhibited adenylyl cyclase in rat brain membranes. J Pharmacol ExpTher 260:14161424.

Garzon J, Garcia-Espana A and Sanchez-Blazquez P (1997) Opioids binding mu anddelta receptors exhibit diverse efficacy in the activation of G i2 and Gx/z transducerproteins in mouse periaqueductal gray matter. J Pharmacol Exp Ther 281:549557.

Gettys TW, Fields TA and Raymond JR (1994) Selective activation of inhibitoryG-protein -subunits by partial agonists of the human 5-HT1A receptor. Biochem-istry 33:42834290.

Gintzler AR and Xu H (1991) Different G proteins mediate the opioid inhibition orenhancement of evoked [5-methione]-enkephalin release. Proc Natl Acad Sci USA88:47414745.

Heerding J, Raynor K, Kong H, Yu L and Reisine T (1994) Mutagenesis reveals thatagonists and peptide antagonists bind in fundamentally distinct manners to therat mu receptor than do nonpeptide antagonists. Regul Peptides 54:119120.

Janssen PA (1965) 1-Aralkyl-4-(n-aryl-carbonyl-amino)-piperidines and related com-pounds. U.S. Pat. Off. 3, 164, 600.

Janssen PAJ (1982) Potent new analgesics, taylor-made for different purposes. ActaAnaesthes Scand 26:262268.

Kaufman DL, Keith DE, Anton B, Tian J, Magendoz K, New,am D, Tran TH, Lee DS,Wen C, Xia Y-R, Lussis JA and Evans CJ (1995) Characterization of the murine opioid receptor gene. J Biol Chem 270:1587715883.

Kenakin T (1995) Agonist-receptor efficacy. I. Mechanisms of efficacy and receptorpromiscuity. Trends Pharmacol Sci 16:188192.

Keith D, Murray SR, Zaki P, Chu PC, Lissin D, Kang L, Evans CJ and von ZastrowM (1996) Morphine activates opioid receptors without causing their rapid inter-nalization. J Biol Chem 271:1902119024.

Lambert DG, Atcheson R, Hirst RA and Rowbotham DJ (1993) Effects of morphine

and its metabolites on opiate receptor binding, cAMP formation and [3H]nora-drenaline release from SH-SY5Y cells. Biochem Pharmacol 46:11451150.Lee S-C, Wang J-J, Ho S-T and Tao P-L (1997) Nalbuphine coadministered with

morphine prevents tolerance and dependence. Anesth Analg 84:810815.Lohse MJ (1993) Molecular mechanisms of membrane receptor desensitization.

Biochim Biophys Acta 1179:171188.Lustig KD, Conklin BR, Herzmark P, Taussig R and Bourne HR (1993) Type II

adenylyl cyclase intergrates coincident signals from GS, Gi and Gq. J Biol Chem268:1390013905.

Maguire P, Tsai N, Kamal J, Cometta-Morini C, Upton C and Loew G (1992)Pharmacological profiles of fentanyl analogs at , and opiate receptors. Eur

J Pharmacol 213:219225.Nestler EJ (1992) Molecular mechanisms of drug addiction. J Neurosci 12:2439

2450.Nestler EJ, Hope BT and Widnell KL (1993) Drug addiction: A model for the

molecular basis of neural plasticity. Neuron 11:9951106.Noble F and Cox BM (1996) Differential desensitization of mu- and delta-opioid

receptors in selected neural pathways following chronic morphine treatment. Br JPharmacol 117:161169.

Ocana M, Del Pozo E, Barrios M and Baeyens JM (1995) Subgroups among-opioid

receptor agonists distinguished by ATP-sensitive K channel-acting drugs. Br JPharmacol 114:12961302.

Paix A, Coleman A, Lees J, Grigson J, Brooksbank M, Thorne D and Ashby M (1995)Subcutaneous fentanyl and sufentanil infusion substitution for morphine toler-ance in cancer pain management. Pain 63:263269.

Paronis CA and Holtzman SG (1992) Development of tolerance to the analgesicactivity of mu agonists after continuous infusion of morphine, meperidine orfentanyl in rats. J Pharmacol Exp Ther 262:19.

Prather PL, McGinn TM, Claude PA, Liu-Chen LY, Loh HH and Law PY (1995)Properties of a kappa-opioid receptor expressed in CHO cells: interaction withmultiple G-proteins is not specific for any individual G

subunit and is similar to

that of other opioid receptors. Mol Brain Res 29:336346.Raffa RB, Martinez RP and Connelly CD (1994) G-protein antisense oligodeoxyribo-

nucleotides and -opioid supraspinal antinociception. Eur J Pharmacol 258:R5R7.

Raynor K, Kong H, Chen Y, Yasuda K, Yu L, Bell GI and Reisine T (1994) Pharma-cological characterization of the cloned -, -, and -opioid receptors. Mol Phar-macol 45:330334.

Reisine T and Bell G (1993) Molecular biology of the opiate receptors. Trends

Neurosci 16:506510.



12/12

Reisine T and Pasternak G (1996) Opioid analgesics and antagonists, in The Phar-macological Basis of Therapeutics (Hardman JG, Limbard LE, Molinoff PB, Rud-don RW and Gilman AG eds) pp 521555, McGraw-Hill, New York.

Self DW, McClenahan AW, Beitner-Johnson D, Terwilliger RZ and Nestler EJ (1995)Biochemical adaptations in the mesolimbic dopamine system in response to heroinself-administration. Synapse 21:312318.

Standifer KM, Rossi GC and Pasternak GW (1996) Differential blockade of opioidanalgesia by antisense oligodeoxynucleotides directed against various G protein subunits. Mol Pharmacol 50:293298.

Surratt CK, Johnson PS, Moriwaki A, Seidleck BK, Blaschak CJ, Wang JB and Uhl GR(1994) -m opiate receptor: Charged transmembrane domain amino acids are criticalfor agonist recognition and intrinsic activity. J Biol Chem 269:2054820553.

Tota MR and Schimerlik MI (1990) Partial agonist effects on the interaction between

the atrial muscarinic receptor and the inhibitory guanine nucleotide-binding pro-tein in a reconstituted system. Mol Pharmacol 37:9961004.

Walker EA and Young AM (1993) Discriminative-stimulus effects of the low efficacymu agonist nalbuphine. J Pharmacol Exp Ther 267:322330.

Zacny JP, Conley K and Marks S (1997) Comparing the subjective, psychomotor andphysiological effects of intravenous nalbuphine and morphine in healthy volun-teers. J Pharmacol Exp Ther 280:11591169.

Send reprint requests to: Dr. George Bot, Dept. of Pharmacology, Univer-sity of Pennsylvania School of Medicine, 36th St. and Hamilton Walk, Phila-delphia, PA 19104.


fentanyl and its analogs desensitize the cloned mu opioid receptor - jpet, june 1998, 285(3),...

Documents