for review only - arts & sciences pagespages.wustl.edu/files/pages/imce/olsen/hi0001.pdf · 111...

For Review O

nly

Adaptive gains through repeated gene loss: parallel evolution of cyanogenesis polymorphisms in the genus

Trifolium (Fabaceae)

Journal: Philosophical Transactions B

Manuscript ID: Draft

Article Type: Research

Date Submitted by the Author: n/a

Complete List of Authors: Olsen, Kenneth; Washington University, Biology; Kooyers, Nicholas; Washington University, Biology; University of Virginia, Biology Small, Linda; Washington University, Biology

Issue Code: Click here to find the code for your issue.:

PLANT

Subject: Evolution < BIOLOGY, Genetics < BIOLOGY, Ecology < BIOLOGY, Plant Science < BIOLOGY

Keywords:

balanced polymorphism, chemical defense, clover (Trifolium L.), cyanogenic glucosides, copy number variation (CNV), molecular adaptation

http://mc.manuscriptcentral.com/issue-ptrsb

Submitted to Phil. Trans. R. Soc. B - Issue

For Review O

nly

1

2

3

4

Adaptive gains through repeated gene loss: 5

Parallel evolution of cyanogenesis polymorphisms in the genus Trifolium (Fabaceae) 6

7

8

9

Kenneth M. Olsen1*, Nicholas J. Kooyers

1,2, and Linda L. Small

1 10

1. Department of Biology, Washington University, St. Louis, MO 63130 USA 11

2. Present address: Department of Biology, University of Virginia, Charlottesville VA, 12

22904 13

14

*Corresponding author. Campus Box 1137, Department of Biology, Washington 15

University, 1 Brookings Dr., St. Louis, MO 63130-4899 USA. Email: [email protected] 16

Ph. 1-314-935-7013, Fax. 1-314-935-4432 17

18

Key words: balanced polymorphism, chemical defense, clover (Trifolium L.), cyanogenic 19

glucosides, copy number variation (CNV), molecular adaptation 20

21

Running title: Evolution of clover cyanogenesis 22

23

Page 1 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

2

Abstract 24

Variation in cyanogenesis (hydrogen cyanide release following tissue damage) was first 25

noted in populations of white clover more than a century ago, and subsequent decades of 26

research have established this system as a classic example of an adaptive chemical defense 27

polymorphism. Here we document polymorphisms for cyanogenic components in several 28

relatives of white clover, and we determine the molecular basis of this trans-specific 29

adaptive variation. One hundred thirty-nine plants, representing 13 of the 14 species 30

within Trifolium Section Trifoliastrum, plus additional species across the genus, were 31

assayed for cyanogenic components (cyanogenic glucosides and their hydrolyzing enzyme, 32

linamarase) and for the presence of underlying cyanogenesis genes (CYP79D15 and Li, 33

respectively). One or both cyanogenic components were detected in seven species, all 34

within Section Trifoliastrum; polymorphisms for the presence/absence of components were 35

detected in six species. In a pattern that parallels our previous findings for white clover, all 36

observed biochemical polymorphisms correspond to gene presence/absence 37

polymorphisms at CYP79D15 and Li. Relationships of DNA sequence haplotypes at the 38

cyanogenesis loci and flanking genomic regions suggest independent evolution of gene 39

deletions within species. This study thus provides evidence for the parallel evolution of 40

adaptive biochemical polymorphisms through recurrent gene deletions in multiple species. 41

42

43

Page 2 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

3

Since the Modern Synthesis, a major goal of evolutionary biology has been to 44

understand the connection between genes and their adaptive roles in nature. With recent 45

advances in genomic techniques, it is becoming increasingly possible to study the 46

molecular basis and genomic architecture of phenotypes in wild species [1–3]. However, 47

while genomic data can now be amassed at a rapid rate, the study of adaptation still 48

requires in-depth understanding of a species’ ecology and the relationship between 49

phenotypes and fitness in nature. Thus, species where the adaptive significance of 50

phenotypic variation has been extensively documented can be particularly attractive study 51

systems for understanding the genetic basis of adaptation. 52

We have focused on one such system in studying the molecular evolution of an 53

adaptive chemical defense polymorphism in white clover (Trifolium repens L., Fabaceae). 54

White clover is polymorphic for cyanogenesis (hydrogen cyanide release following tissue 55

damage), with both cyanogenic and acyanogenic plants occurring in natural populations. 56

This polymorphism was first documented more than a century ago [4,5], and the selective 57

factors that maintain it have been examined in dozens of studies over the last seven 58

decades (reviewed in refs. [6–8]). In the present study, we extend the examination of this 59

adaptive variation to white clover’s relatives within the genus Trifolium, with the goals of 60

assessing the occurrence of cyanogenesis polymorphisms in related clover species and the 61

molecular evolutionary forces that have shaped this trans-specific adaptive variation. 62

63

The white clover cyanogenesis polymorphism. Trifolium repens is a native species 64

of Eurasia and has become widely naturalized in temperate regions worldwide as a 65

component of lawns, pastures, and roadsides. Cyanogenic white clover plants are 66

differentially protected from small, generalist herbivores, including gastropods, voles and 67

Page 3 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

4

insects [9–12]. At the same time, populations show climate-associated clinal variation in 68

cyanogenesis, with acyanogenic plants predominating at higher latitudes and elevations 69

[13,14]. The apparent selective advantage of the acyanogenic form in cooler climates may 70

reflect fitness tradeoffs between energetic investment in cyanogenesis vs. reproductive 71

output in regions of high and low herbivore pressure [15–17]. Cyanogenesis frequencies 72

also appear to be influenced by aridity, with cyanogenic morphs differentially represented 73

in drier regions [18,19]. Whether primarily shaped by biotic or abiotic factors, the fact that 74

climate-associated cyanogenesis clines have evolved repeatedly in this species — both in 75

native populations [13,14,20–23] and in the introduced species range [7,19,24,25] — 76

suggests that the selective forces maintaining this adaptive polymorphism are strong and 77

geographically pervasive. 78

The cyanogenic phenotype in clover requires the production of two biochemical 79

components that are separated in intact tissue and brought into contact with cell rupture: 80

cyanogenic glucosides (lotaustralin and linamarin), which are stored in the vacuoles of 81

photosynthetic tissue; and their hydrolyzing enzyme, linamarase, which is stored in the cell 82

wall (reviewed in ref. [6]). Acyanogenic clover plants may lack cyanogenic glucosides, 83

linamarase, or both components. Inheritance of the two cyanogenic components is 84

controlled by two independently segregating Mendelian genes [26–28]. The gene Ac 85

controls the presence/absence of cyanogenic glucosides, and Li controls the 86

presence/absence of linamarase; for both genes, the dominant (functional) allele confers 87

the presence of the component. Thus, plants that possess at least one dominant allele at 88

both genes (Ac_, Li_) are cyanogenic, while homozygous recessive genotypes at either or 89

both genes (acac, lili) lack one or more of the required components. The presence or 90

Page 4 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

5

absence of each component can be determined for individual plants with leaf tissue assays 91

using colorimetric HCN test paper [29] and exogenously-added cyanogenic components 92

(method described in ref. [30]). In addition to these discrete cyanogenesis polymorphisms, 93

there is also wide quantitative variation in production of the two cyanogenic components 94

among plants that produce the compounds. This variation is attributable to a combination 95

of factors, including phenotypic plasticity, allelic variation at Ac and Li, and unlinked 96

modifier genes [31,32]; (K. Olsen, unpublished observations). 97

In past studies, we have documented the molecular basis of the Ac/ac and Li/li 98

biochemical polymorphisms in white clover. The ac and li nonfunctional alleles 99

correspond respectively to gene deletions at two unlinked loci: CYP79D15, which encodes 100

the cytochrome P450 protein catalyzing the first dedicated step in cyanogenic glucoside 101

biosynthesis [33]; and Li, which encodes the linamarase protein [30]. Thus, the Ac/ac and 102

Li/li biochemical polymorphisms in white clover arise through two independently 103

segregating gene presence/absence (PA) polymorphisms. A recent molecular evolutionary 104

analysis of the genomic sequences flanking these PA polymorphisms indicates that, for 105

both loci, the gene-absence alleles have evolved repeatedly in white clover through 106

recurrent gene deletion events [8]. 107

108

Cyanogenesis in other clover species. While most studies of clover cyanogenesis 109

have focused on T. repens, the trait has also been examined to a limited extent in related 110

clover species. The legume genus Trifolium includes approximately 255 species found in 111

temperate and subtropical regions worldwide [34], and T. repens falls within Section 112

Trifoliastrum, a clade comprising approximately 14 closely related species with a circum-113

Mediterranean distribution [35]. The presence of one or both cyanogenic components has 114

Page 5 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

6

been previously reported in five other Trifolium species, all within Trifoliastrum: T. 115

isthmocarpum (reportedly monomorphic for AcAc LiLi) [36]; T. nigrescens (primarily 116

AcAc LiLi, with rare occurrence of ac and li alleles reported in T. nigrescens ssp. 117

nigrescens) [36,37]; T. montanum and T. ambiguum (both species lili while polymorphic 118

for Ac/ac) [36]; and T. occidentale (primarily AcAc lili, with rare occurrence of ac alleles) 119

[36,38]. Phylogenetic relationships within Trifoliastrum generally lack resolution; the 120

positions of two species, T. montanum and T. ambiguum, are best resolved, with these taxa 121

forming a species-pair that is phylogenetically distinct from other members of the clade 122

[35]. 123

The occurrence of polymorphisms for cyanogenic components in at least four 124

Trifolium species besides white clover raises intriguing questions on the origin and long-125

term evolution of this adaptive variation. The fact that gene PA polymorphisms underlie 126

both the Ac/ac and Li/li polymorphisms in white clover might suggest that this same 127

molecular basis would occur in related species. On the other hand, null alleles at 128

cyanogenesis genes can easily arise through simple loss-of-function mutations that do not 129

require genomic deletion events (see ref. [39]), which suggests that other mutational 130

mechanisms (e.g., frameshifts, premature stop codons) might also be responsible. 131

A related question concerns the evolutionary persistence of Ac/ac and Li/li alleles. 132

Evolutionary studies of other adaptive PA polymorphisms, particularly those involving 133

plant pathogen resistance genes (R-genes), have revealed signatures of long-term balancing 134

selection, which are consistent with the selective maintenance of ancient gene-presence 135

and gene-absence alleles [40–42]. For Trifolium, the close phylogenetic relationships 136

within Trifoliastrum suggest that selectively-maintained alleles might easily pre-date the 137

Page 6 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

7

diversification of the clade and be shared across species boundaries. On the other hand, 138

the fact that ac and li gene-deletion alleles have evolved repeatedly within white clover [8] 139

might instead suggest a high enough gene deletion rate that all Ac/ac and Li/li allelic 140

variation would be species-specific. For adaptive PA polymorphisms, genealogical 141

relationships between gene-presence and -absence alleles can be assessed by examining 142

sequences adjacent to the PA locus, as these sequences are present in all plants but are 143

linked to the PA variation [8,40–42]. 144

In the present study, we address three specific questions on the origin and 145

persistence of cyanogenesis polymorphisms in Trifolium: 1) What is the distribution of 146

cyanogenic components and polymorphisms for these components among white clover’s 147

closest relatives in Trifolium Section Trifoliastrum, and more broadly across the genus? 2) 148

What is the molecular basis of any observed cyanogenesis polymorphisms in these 149

species? Specifically, are these PA polymorphisms, as in white clover, or are other 150

mutational mechanisms involved? and 3) Does the evolution of these polymorphisms pre-151

date species diversification, or has there been independent evolution of the polymorphisms 152

within species? Our results suggest that cyanogenesis polymorphisms occur in multiple 153

Trifoliastrum species, that they have evolved independently in the different species in 154

which they occur, and that this parallel evolution has occurred through a conserved 155

mutational mechanism involving gene deletion events. 156

157

Materials and Methods 158

Sampling. Seeds of 139 Trifolium accessions were obtained either through the 159

USDA National Plant Germplasm System or from other sources (see Supporting 160

Information, Table S1) and grown in the Washington University greenhouse. Samples 161

Page 7 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

8

included 119 accessions representing 13 of the 14 species within Trifolium Sect. 162

Trifoliastrum; remaining accessions included five species in Sect. Involucrarium (sister 163

clade to Sect. Trifoliastrum), three species in Sect. Vesicastrum (sister clade to the clade 164

comprising Sects. Involucrarium and Trifoliastrum), and individual species representing 165

more distantly related Trifolium lineages (Sect. Trifolium, Sect. Trichocephalum, and 166

Subgenus Chronosemium) (Table S1). 167

Species within Sect. Trifoliastrum are native to the Mediterranean and Eurasia and 168

occur across a diverse range of habitats in temperate and subtropical regions [34,35]. 169

Three species in the clade are known to be polyploid (T. ambiguum, T. repens, and T. 170

uniflorum). In the case of white clover, which is allotetraploid, the Ac and Li genes occur 171

within only one of its two parental genomes, suggesting that this species may have 172

originated through the hybridization of a cyanogenic and an acyanogenic diploid 173

progenitor [37,43]. Proposed progenitors within Trifoliastrum have included T. 174

occidentale, T. nigrescens ssp. petrisavii, T. pallescens, and an unknown lineage 175

[35,37,43,44]. 176

One plant per named accession was used in genetic characterizations unless 177

cyanogenesis assays (described below) revealed intra-accession variation in cyanogenesis 178

phenotype; in those rare cases, representative plants of each cyanogenesis phenotype were 179

included (see Table S1). Because of morphological ambiguities among Trifolium species, 180

the species identity for each individual plant was determined by PCR-amplifying and 181

sequencing the nuclear ITS rDNA region and the cpDNA trnL intron and performing blast 182

searches against published data [35]. ITS and trnL sequences are individually diagnostic 183

for most Trifolium species, and the two-locus combination was diagnostic for all species 184

Page 8 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

9

examined in this study. Primers and PCR conditions for ITS and trnL sequencing are 185

described by Ellison et al. [35]. Inferred species identities for all accessions are indicated 186

in Table S1. 187

188

Phenotypic and genetic analyses. Cyanogenesis assays to determine the presence 189

or absence of cyanogenic components (cyanogenic glucosides, linamarase) in each plant 190

were performed using leaf tissue in a modified Feigl-Anger HCN assay, as described 191

previously for white clover [30,33]. For genetic analyses, genomic DNA was extracted 192

from fresh leaf tissue using either Nucleon Phytopure extraction kits (Tepnel Life 193

Sciences, Stamford CT) or the protocol of Porebski et al. [45]. Two methods were 194

employed to screen plants for the presence or absence of the Li and CYP79D15 loci. First, 195

PCR was performed using primers specific for each gene. For Li, most amplifications used 196

the following primer pair: Lin_01aF: ACATGCTTTTAAACCTCTTCC, Lin_05dR: 197

TGGGCTGGTCCATTTGATTTAAC; an alternative forward primer was used in some 198

reactions: Lin_01eF CCATCACTACTACTCATATCCATGCT. Both primer 199

combinations amplify nearly the entire 3.9 kb Li gene. For CYP79D15, PCR was 200

performed with the following primer pair, which amplifies nearly the entire 1.7 kb gene: 201

CYP_Fb TGGACTTTTTTGCTTGTTGTGATATT, CYP_Rb 202

GCAGCCAATCTTGGTTTTGC. PCR conditions for Li and CYP79D15 are described in 203

[30] and [33], respectively. The absence of a PCR product after three or more attempts 204

provided preliminary evidence suggesting the absence of the corresponding cyanogenesis 205

gene. 206

As a second method to screen for the presence or absence of the cyanogenesis 207

genes, Southern hybridizations were performed using probes specific to CYP79D15, Li, or 208

Page 9 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

10

to a gene closely related to Li that encodes a noncyanogenic glucosidase (‘Li-paralog’; see 209

ref. [30]). The CYP79D15 probe (CYP1) spans approximately half of the gene, including 210

the single intron; the Li probe (L1) corresponds to a 0.9 kb portion of Li intron 2; and the 211

Li-paralog probe (P1) corresponds to the equivalent intron of the noncyanogenic 212

glucosidase gene [30,33]. While not involved in cyanogenesis, the Li-paralog is 213

genetically very similar to Li (94% nucleotide sequence identity), so that there is some 214

cross-hybridization between genes in Southern hybridizations; probing specifically for the 215

Li-paralog is therefore useful in confirming that weak bands detected in hybridizations of 216

lili plants do not correspond to the Li gene (see ref. [30]). Protocols for Li and CYP79D15 217

Southern hybridizations followed those used previously for white clover [30,33]. Genomic 218

DNA digests for Southerns were performed primarily using the restriction enzyme AseI, 219

which is predicted to cut once within the L1 probe and to be a non-cutter within the CYP1 220

probe; thus, hybridizations would be expected to reveal two bands for Li if it is present as a 221

single-copy gene and one band for CYP79D15 if it is present as a single-copy gene. 222

For plants where PCR screening and Southern hybridizations indicated the 223

presence of a given cyanogenesis gene, PCR products were cloned into pGEM-T Easy 224

vectors (Promega) and sequenced using reaction conditions and internal primers as 225

described previously [30,33]. A minimum of three clones per PCR product were 226

sequenced (with four or more clones sequenced for many accessions). DNA sequencing 227

was performed using an ABI 3130 capillary sequencer in the Biology Department of 228

Washington University. Creation of contigs and DNA sequence aligning and editing were 229

performed using Biolign version 4.0.6 [46]. Singletons observed in individual clones were 230

treated as artifacts of polymerase error and removed, yielding one definitive haplotype 231

Page 10 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

11

sequence per accession. DNA sequences are available on GenBank (accessions 232

XXXXXX-XXXXXX). 233

DNA sequences adjacent to an adaptive PA polymorphism can provide information 234

on the evolution of the linked gene-presence and gene-absence alleles [8,40–42]. In a 235

previous study of white clover, we used genome-walking to identify sequences 236

immediately flanking CYP79D15 and Li to characterize the boundaries of gene-deletion 237

alleles and to test for molecular signatures of balancing selection [8]. Two downstream 238

regions were identified as occurring within 325 bp of the boundaries of most ac and li 239

gene-deletion alleles: 3CYP-2.34, a 1.14-kb region starting 2.34 kb downstream of the 240

CYP79D15 stop codon; and 3Li-6.65, 0.9-kb region located 6.65 kb downstream of the Li 241

stop codon. For the present study, orthologs of these T. repens sequences were targeted in 242

the other Trifoliastrum species to assess phylogenetic relationships of gene-presence and 243

gene-absence haplotypes within and among species. Amplicons were cloned and 244

sequenced as described above for the cyanogenesis genes. If gene-presence and gene-245

absence haplotypes for a given species are more closely related to each other than to 246

haplotypes in other species, this would suggest independent evolution of PA 247

polymorphisms within species. 248

Phylogenetic relationships among haplotypes were assessed using maximum 249

likelihood (ML) analyses for each sequenced locus, with the best-fit model of nucleotide 250

substitution selected in jModelTest 2.1.4 [47,48] based on likelihood scores for 88 251

different models. The GTR model of molecular evolution was employed for all sequence 252

data sets based on jModelTest results. ML trees were generated in PhyML 3.0 [49] via the 253

ATGC web platform (http://atgc.lirmm.fr/phyml/), with default settings for tree searching 254

Page 11 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

12

and bootstrap analysis. For T. repens, three representative haplotypes were included from 255

previous analyses for the CYP79D15 and Li datasets [30,33]; for loci flanking the 256

cyanogenesis loci, three haplotypes apiece for gene-presence and gene-absence alleles 257

were used [8]. Outside of Trifolium, no clear orthologs of the Li gene are known, and the 258

closest putative ortholog of CYP79D15 occurs in Lotus japonicus, where the 259

corresponding gene is unalignable in noncoding regions; therefore, midpoint rooting was 260

used for the Trifolium haplotype trees. 261

262

Results 263

Cyanogenesis polymorphisms occur in multiple Trifolium species. Biochemical 264

assays for the presence or absence of cyanogenic glucosides and linamarase revealed a 265

diversity of patterns for the production of cyanogenic components among Trifolium species 266

in Section Trifoliastrum. Results of cyanogenesis assays are summarized in Table 1. 267

Within this clade, which also includes white clover, one or both cyanogenic components 268

were detected in seven of the twelve species tested. This set of seven species includes all 269

four species where cyanogenesis polymorphisms have been reported previously (T. 270

ambiguum, T. montanum, T. nigrescens, and T. occidentale) [36–38], as well as T. 271

isthmocarpum, which was previously reported to be monomorphic for the production of 272

both components [36]. Five of the seven species were found to be polymorphic for the 273

presence/absence of cyanogenic glucosides, and two were polymorphic for linamarase 274

production. Only one species, T. isthmocarpum, was polymorphic at both Ac/ac and Li/li, 275

as is found in white clover. Given the small sample sizes for some of the tested species, it 276

is quite possible that expanded sampling could reveal additional cyanogenesis 277

polymorphisms among species of this clade. In contrast to members of Trifoliastrum, no 278

Page 12 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

13

cyanogenic components were detected in any Trifolium species outside of this clade (Table 279

S1). 280

All cyanogenesis polymorphisms are PA polymorphisms. We successfully PCR-281

amplified the 1.7-kb CYP79D15 gene in all plants that produce cyanogenic glucosides, and 282

the gene was never amplified in plants lacking these compounds. Similarly, we were able 283

to amplify the entire 3.9-Kb Li gene in nearly all plants producing linamarase (only partial 284

gene amplification was successful for four accessions; Table S1), while it was never 285

amplified in plants lacking the enzyme. 286

Since the Ac/ac and Li/li biochemical polymorphisms in white clover correspond to 287

gene PA polymorphisms at CYP79D15 and Li respectively (Olsen et al. 2007, 2008), these 288

PCR results suggested that PA polymorphisms might also account for the biochemical 289

polymorphisms in other Trifolium species. We therefore used Southern hybridizations to 290

test for a relationship between the production of cyanogenic components and gene 291

presence/absence across Trifoliastrum. In all cases, the presence or absence of cyanogenic 292

components (Table 1) matches the presence or absence of detectable bands in Southern 293

hybridizations. 294

Representative results of CYP79D15 Southern hybridizations for AseI genomic 295

DNA digests are shown in Figure 1 (see also Fig. S1). For every species where the Ac/ac 296

biochemical polymorphism was detected, plants that lack cyanogenic glucosides (acac 297

genotypes) also lack bands corresponding to the 0.9 kb CYP probe. Interestingly, for 298

plants that possess the gene, there appears to be variation in gene copy number, with 1-2 299

bands present among individuals of three species (T. montanum, T. ambiguum, T. 300

isthmocarpum; Fig. 1 a,b,d), and up to three clear bands present in T. nigrescens ssp. 301

Page 13 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

14

meneghinianum (Fig. S1). This band variation is not correlated with ploidy, as only one of 302

these species is a known polyploid (T. ambiguum) [35]. Nor is it attributable to AseI 303

restriction site variation within the probed gene region, as no such nucleotide variation was 304

observed in any CYP79D15 DNA sequences (described below). Within T. nigrescens, the 305

banding pattern for subspecies nigrescens is recognizably distinct from that of the other 306

two subspecies (petrisavii and meneghinianum) (Fig. S1), consistent with the genomic and 307

morphological divergence of this subspecies from the other two (see ref. [50]). 308

For the two species where linamarase production was detected, results of Southern 309

hybridizations for the Li gene are shown in Figure 2 (see also Fig. S2). The L1 probe, 310

designed to be specific to the Li gene, contains one AseI restriction site, so that the 311

occurrence of two bands on a Southern blot is consistent with the occurrence of a single Li 312

gene copy. Because of high nucleotide similarity between Li and the noncyanogenic Li-313

paralog, hybridizations using the L1 probe are not entirely specific to the Li gene. 314

Therefore, we also performed hybridizations using the P1 probe, designed to be specific to 315

the Li-paralog, as a way of identifying bands that do not correspond to Li (see Methods). 316

For T. nigrescens, where a single lili individual was observed, the two bands that are 317

evident in all Li_ individuals (at ~0.9 Kb and 1.4 Kb) are absent in this individual (Fig. 2a), 318

and the one band that is present (at ~2 Kb) shows strong hybridization to the P1 probe (Fig. 319

2b). Thus, the bands corresponding to the Li gene are not present in the lili accession. 320

Similarly, for T. isthmocarpum, all individuals with detectable linamarase production show 321

two bands at ~0.5 kb and ~0.8 kb that are absent in lili plants; weaker bands are also 322

present in Li_ plants at ~2 kb as well as at various sizes in lili plants (Fig. 2c). 323

Hybridization with the P1 probe indicates that these weaker bands are more similar to the 324

Page 14 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

15

Li-paralog sequence (Fig. 2d). These patterns confirm that, as with T. nigrescens, there are 325

no bands present in lili accessions that correspond to the Li gene. 326

In a pattern similar to CYP79D15, there appears to be some Li gene copy number 327

variation among plants that carry the gene. Most notably, three individuals of T. 328

nigrescens ssp. meneghinianum show extra bands at ~4.0 kb that hybridize strongly to the 329

L1 probe with negligible cross-hybridization to P1 (Fig. 2 a,b), consistent with the 330

presence of additional Li gene copies. As with CYP79D15, this banding variation is not 331

obviously attributable to AseI restriction site variation or polyploidy. 332

333

Cyanogenesis polymorphisms have evolved independently within species. The 334

two cyanogenesis genes were PCR-amplified, cloned and sequenced for all Ac_ plants and 335

all but four Li_ plants (Table S1). Maximum likelihood trees for the two genes are shown 336

in Figures 3 and 4. For both CYP79D15 and Li, the haplotypes are generally grouped by 337

species with high bootstrap support. This pattern is especially evident for CYP79D15, 338

where eight species are represented in the tree (Fig. 3). While phylogenetic relationships 339

within Trifoliastrum are incompletely resolved [35], the CYP79D15 tree is also compatible 340

with known species relationships. For example, T. ambiguum and T. montanum are 341

grouped as a species-pair with 100% bootstrap support, consistent with neutral gene 342

phylogenies [35]. The CYP79D15 tree also confirms the genetic distinctness of T. 343

nigrescens ssp. nigrescens as observed in Southern hybridizations (see above); haplotypes 344

of this subspecies form a distinct clade with 77% bootstrap support. For Li, where there 345

are only three species with linamarase production, haplotypes for two of the species, T. 346

isthmocarpum and T. repens, form species-specific clades, each with 100% bootstrap 347

support; these clades are nested within T. nigrescens haplotypes on the midpoint-rooted 348

Page 15 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

16

tree (Fig. 4). For both CYP79D15 and Li sequences, there is no sharing of haplotypes 349

among species, as would be expected if they predated the diversification of the clade. 350

By definition, Li and CYP79D15 sequences represent only the gene-presence 351

alleles for each locus. In contrast, sequences flanking a PA polymorphism can be used to 352

directly assess evolutionary relationships between gene-presence and gene-absence alleles 353

[8,40–42]. If gene-deletion alleles have evolved independently within species, then 354

flanking sequences for gene-presence and gene-absence alleles would be expected to group 355

by species. To test this hypothesis, we targeted sequences immediately downstream of the 356

Li and CYP79D15 PA polymorphisms for PCR and sequencing. The targeted loci, 3CYP-357

2.34 (a ~1.4 kb region located 2.34 kb downstream of the CYP79D15 stop codon) and 3Li-358

6.65 (a ~0.9 kb region located 6.65 kb downstream of the Li stop codon) are located at the 359

boundaries of the most common cyanogenesis gene-deletion alleles for each gene in white 360

clover [8]. 361

For Li, we were unable to PCR-amplify the targeted flanking sequence in lili 362

accessions of the two species besides white clover that produce linamarase (T. 363

isthmocarpum, T. nigrescens; Table 1); therefore, we could not assess genealogical 364

relationships between gene-presence and –absence haplotypes. In contrast, we 365

successfully amplified the targeted CYP79D15-flanking sequence in plants with and 366

without cyanogenic glucoside production in two species besides white clover that are 367

polymorphic at Ac/ac (T. suffocatum, T. uniflorum). For both species, haplotypes are 368

grouped by species with high bootstrap support (Fig. 5), providing strong evidence that the 369

PA polymorphisms have evolved independently in each species. Taken together with the 370

observations that all observed biochemical polymorphisms correspond to gene PA 371

Page 16 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

17

polymorphisms (Figs. 1, 2), and that ac and li alleles have evolved recurrently within white 372

clover [8], this finding suggests that the cyanogenesis polymorphisms in Trifoliastrum 373

have evolved independently in each species where they occur, and that they have done so 374

through the parallel evolution of gene-deletion alleles. 375

376

Discussion 377

Variation for cyanogenesis was first identified in white clover more than a century 378

ago [4,5]. Subsequent decades of ecological and genetic research have established this 379

polymorphism as a textbook example of adaptive variation maintained by opposing 380

selective forces [51,52]. In the present study, we have documented that polymorphisms for 381

cyanogenic components also occur in several of white clover’s relatives in Trifolium 382

Section Trifoliastrum (Table 1). Moreover, our data suggest that these polymorphisms 383

have evolved independently in each species, through recurrent gene deletion events giving 384

rise to gene presence/absence (PA) polymorphisms (Figs. 1-5). 385

386

Distribution of cyanogenic components among Trifolium species. The observed 387

distribution of cyanogenic components in Trifoliastrum raises intriguing questions about 388

the adaptive function of these compounds outside of T. repens. While cyanogenic 389

glucosides were detected in seven of the twelve species tested, linamarase was only 390

detected in two of these species (Table 1). Thus, there are several species where one of the 391

two required components for cyanogenesis is present, but where the other component is 392

either absent or too rare to be detected in our sampling. Kakes and Chardonnens [38] 393

observed a similar pattern in their extensive sampling of >750 T. occidentale plants; no 394

plants with linamarase production were detected in this species although >75% of samples 395

Page 17 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

18

produced cyanogenic glucosides. These patterns suggest a potential selective advantage 396

for the production of cyanogenic glucosides in the absence of their hydrolyzing enzyme, at 397

least under some environmental conditions. 398

Two potential explanations, which are not mutually exclusive, could most easily 399

account for this asymmetric distribution of cyanogenic components. The first is that the 400

adaptive role of cyanogenic glucosides as a chemical defense may not always require the 401

presence of linamarase. Gastropods, which are major clover herbivores, possess 402

glucosidase enzymes in their guts that are capable of hydrolyzing cyanogenic glucosides 403

[9,15]. Thus, if post-ingestion cyanogenesis (rather than cyanogenesis at the initial leaf-404

tasting stage) is sufficient to deter further herbivore damage, cyanogenic glucosides alone 405

could serve as an effective defense against this class of herbivores. Empirical data are 406

inconclusive regarding this hypothesis. In controlled snail grazing experiments, Kakes 407

[15] observed five-fold higher survivorship for white clover seedlings that produce 408

cyanogenic glucosides relative to those without them, with the presence or absence of 409

linamarase having no effect on herbivore deterrence. In contrast, Dirzo and Harper [9] 410

found that both cyanogenic glucosides and enzyme are required for differential protection 411

against slug herbivory. 412

A second explanation for the asymmetric distribution is that cyanogenic glucosides 413

may serve adaptive functions unrelated to herbivore deterrence. Cyanogenic glucosides 414

can be metabolized in plants without the release of hydrogen cyanide, and there is evidence 415

that they can serve as nitrogen storage and transport compounds (reviewed in ref. [53]) and 416

as signaling regulators in stress response [54]. Consistent with this hypothesis, recent data 417

from white clover populations suggest that regional variation in aridity may act as a 418

Page 18 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

19

selective factor in maintaining the Ac/ac polymorphism, independent of the Li/li 419

polymorphism [19] (Kooyers et al., unpublished observations). Several Trifoliastrum 420

species span a wide range of habitats, including alpine meadows, temperate forest edges, 421

steppes, pastures, and coastal cliffs (Zohary & Heller 1984). Thus, it is plausible that for 422

some species, regional variation in selective pressures that are unrelated to HCN release 423

may play a role in maintaining the Ac/ac polymorphism. Ecological genetic studies of the 424

sort employed in white clover will be useful in testing this hypothesis. 425

426

Molecular evolution of cyanogenesis polymorphisms. A striking finding from this 427

study is that the cyanogenesis polymorphisms have apparently evolved multiple times in 428

species of Trifoliastrum, and that in all cases they have evolved through gene deletions 429

(Figs. 1-2, 5). To our knowledge, this study represents the first documented case of the 430

recurrent, parallel evolution of adaptive PA polymorphisms across a group of related 431

species. Following the discovery that the unlinked Ac/ac and Li/li polymorphisms in white 432

clover both correspond to gene PA polymorphisms, we had previously proposed that the 433

pattern might be attributable to that species’ allotetraploid origin, as genomic deletions are 434

common following polyploidization events (discussed in ref. [33]). Subsequent analyses in 435

white clover called into question that hypothesis, as molecular signatures in flanking 436

sequences indicate recurrent gene deletions within this species rather than long-term 437

balancing selection [8]. Results of the present study further refute a role for 438

polyploidization in the evolution of these polymorphisms; only two of the six polymorphic 439

species in Table 1 are polyploid (T. ambiguum, T. uniflorum) [35]. The present findings 440

instead suggest that there is some underlying lability in the genomic regions containing 441

Page 19 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

20

CYP79D15 and Li across species of Trifoliastrum, which has allowed for the repeated 442

evolution of gene PA variation (e.g., ref. [55]). As has been discussed in the context of T. 443

repens cyanogenesis gene deletions [8], tandemly repeated sequences — potentially 444

including gene copy-number variation at the cyanogenesis genes themselves — may be a 445

critical causal mechanism underlying this process. 446

447

Evolutionary origins of Trifolium cyanogenesis. Both cyanogenesis genes show 448

high nucleotide similarity across Trifoliastrum. The two most divergent CYP79D15 449

haplotypes (between two accessions of T. isthmocarpum and T. nigrescens; Fig. 3) are 450

~95% identical with all silent variation considered; similarly, the two most divergent Li 451

sequences (also between T. isthmocarpum and T. nigrescens) are ~98% identical across all 452

sites (Fig. 4). This close genetic similarity strongly suggests that the gene sequences are 453

orthologous across the clade, and that the presence of cyanogenesis is therefore ancestral 454

for Trifoliastrum. Interestingly, CYP79D15 also appears to be orthologous to the 455

functionally equivalent gene of a somewhat distantly related cyanogenic legume, Lotus 456

japonicus [56], a species that falls outside the large vicioid-legume clade to which 457

Trifolium belongs [35]. Exons of the T. repens CYP79D15 sequence are 93% identical to 458

those of the L. japonicus CYP79D3 gene. This close sequence similarity suggests that 459

cyanogenesis may have existed in the shared common ancestor of these taxa, predating the 460

divergence of the vicioid clade (comprising at least 11 genera; ref. [35]) from other legume 461

lineages. 462

In marked contrast to its possible ancestral state among vicioid legumes, 463

cyanogenesis appears to be absent in most clades within Trifolium, as well as in closely 464

Page 20 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

21

related genera. We detected no cyanogenic component production in Trifolium species 465

outside of Trifoliastrum (Table S1; see also ref. [36]), and PCR screening and Southern 466

hybridizations for species outside of this clade have revealed no evidence of the underlying 467

cyanogenesis genes (K. Olsen, unpublished observations). Similarly, reports of 468

cyanogenesis in closely related vicioid-legume genera (e.g., Melilotus, Trigonella, 469

Medicago) are sporadic or absent [57], and blasts of the Trifolium cyanogenesis gene 470

sequences against the reference genome of Medicago truncatula reveal no clear orthologs. 471

Thus, if cyanogenesis is ancestral among vicioid legumes, it has apparently been lost 472

repeatedly on a macroevolutionary time scale, a pattern that echoes our findings for the 473

cyanogenesis genes within Trifoliastrum. 474

475

Conclusions. For the clover cyanogenesis system, it remains to be seen whether 476

there are particular structural features of the Trifolium genome that have facilitated the 477

repeated, parallel evolution of gene deletions at the CYP79D15 and Li loci. Similarly, 478

much remains to be learned about the selective factors that maintain the Ac/ac and Li/li 479

polymorphisms among Trifoliastrum species, and the extent to which these factors differ 480

from those shaping the classic white clover adaptive polymorphism. Regardless of the 481

specific mechanisms at play, our observations that the cyanogenesis polymorphisms occur 482

across multiple ecologically and geographically diverse clover species suggest that the 483

forces maintaining this variation are long-standing and present across a wide range of 484

environments. 485

486

487

488

Page 21 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

22

Acknowledgments 489

The authors express sincere thanks to Mike Vincent (Miami University of Ohio) and Nick 490

Ellison (AgResearch New Zealand) for generously providing seed samples; to Mike Dyer 491

and staff of the Washington University greenhouse for their expertise in germinating and 492

maintaining clover samples; and to members of the Olsen laboratory for helpful comments 493

and discussion. Funding for this project was provided through a National Science 494

Foundation CAREER award to KMO (DEB-0845497). 495

496

497

Page 22 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

23

References 498

499

1 Orsini, L., Andrew, R. & Eizaguirre, C. 2013 Evolutionary ecological genomics. 500

Molecular Ecology 22, 527–31. (doi:10.1111/mec.12177) 501

2 Narum, S. R., Buerkle, C. A., Davey, J. W., Miller, M. R. & Hohenlohe, P. A. 2013 502

Genotyping-by-sequencing in ecological and conservation genomics. Molecular 503

Ecology 22, 2841–7. (doi:10.1111/mec.12350) 504

3 Primmer, C. R., Papakostas, S., Leder, E. H., Davis, M. J. & Ragan, M. A 2013 505

Annotated genes and nonannotated genomes: cross-species use of Gene Ontology in 506

ecology and evolution research. Molecular Ecology, in press. 507

(doi:10.1111/mec.12309) 508

4 Mirande, M. M. 1912 Sur la présence de l’acide cyanhydrique dans le trèfle rampant 509

(Trifolium repens L.). Comptes Rendus de l’Academie des Sciences, Paris 155, 651–510

653. 511

5 Armstrong, H., Armstrong, E. & Horton, E. 1913 Herbage Studies. II.-Variation in 512

Lotus corniculatus and Trifolium repens: (cyanophoric plants). Proceedings of the 513

Royal Society B 86, 262–269. (doi:10.1098/rspb.1913.0021) 514

6 Hughes, M. A. 1991 The cyanogenic polymorphism in Trifolium repens L. (white 515

clover). Heredity 66, 105–115. (doi:10.1038/hdy.1991.13) 516

7 Kooyers, N. J. & Olsen, K. M. 2012 Rapid evolution of an adaptive cyanogenesis 517

cline in introduced North American white clover (Trifolium repens L.). Molecular 518

Ecology 21, 2455–68. (doi:10.1111/j.1365-294X.2012.05486.x) 519

8 Olsen, K. M., Kooyers, N. J. & Small, L. L. 2013 Recurrent gene deletions and the 520

evolution of adaptive cyanogenesis polymorphisms in white clover (Trifolium 521

repens L.). Molecular Ecology 22, 724–38. (doi:10.1111/j.1365-522

294X.2012.05667.x) 523

9 Dirzo, R. & Harper, J. 1982 Experimental Studies on Slug-Plant Interactions: III. 524

Differences in the Acceptability of Individual Plants of Trifolium Repens to Slugs 525

and Snails. Journal of Ecology 70, 101–117. 526

10 Pederson, G. A. & Brink, G. E. 1998 Cyanogenesis effect on insect damage to 527

seedling white clover in a bermudagrass sod. Agronomy Journal 90, 208. 528

(doi:10.2134/agronj1998.00021962009000020015x) 529

11 Saucy, F., Studer, J., Aerni, V. & Schneiter, B. 1999 Preference for Acyanogenic 530

White Clover (Trifolium repens) in the vole Arvicola terrestris: I. Experiments with 531

Page 23 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

24

two varieties. Journal of Chemical Ecology 25, 1441–1454. 532

(doi:10.1023/A:1020943313142) 533

12 Viette, M., Tettamanti, C. & Saucy, F. 2000 Preference for acyanogenic white 534

clover (Trifolium repens) in the vole Arvicola Terrestris. II. Generalization and 535

further investigations. Journal of Chemical Ecology 26, 101–122. 536

(doi:10.1023/A:1005441528235) 537

13 Daday, H. 1954 Gene frequencies in wild populations of Trifolium repens II. 538

Distribution by altitude. Heredity 8, 377–384. (doi:10.1038/hdy.1954.40) 539

14 Daday, H. 1954 Gene frequencies in wild populations of Trifolium repens I. 540

Distribution by latitude. Heredity 8, 61–78. (doi:10.1038/hdy.1954.5) 541

15 Kakes, P. 1989 An analysis of the costs and benefits of the cyanogenic system in 542

Trifolium repens L. Theoretical and Applied Genetics 77, 111–118. 543

(doi:10.1007/BF00292324) 544

16 Pennings, S. C. & Silliman, B. R. 2005 Linking biogeography and community 545

ecology: latitudinal variation in plant–herbivore interaction strength. Ecology 86, 546

2310–2319. (doi:10.1890/04-1022) 547

17 Salazar, D. & Marquis, R. J. 2012 Herbivore pressure increases toward the equator. 548

Proceedings of the National Academy of Sciences of the United States of America 549

109, 12616–20. (doi:10.1073/pnas.1202907109) 550

18 Caradus, J. R., Mackay, A. C., Charlton, J. F. L. & Chapman, D. F. 1990 551

Genecology of white clover (Trifolium repens L.) from wet and dry hill country 552

pastures. New Zealand Journal of Agricultural Research 33, 377–384. 553

(doi:10.1080/00288233.1990.10428434) 554

19 Kooyers, N. J. & Olsen, K. M. 2013 Searching for the bull’s eye: agents and targets 555

of selection vary among geographically disparate cyanogenesis clines in white 556

clover (Trifolium repens L.). Heredity in press. (doi:10.1038/hdy.2013.71) 557

20 Till-Bottraud, I., Kakes, P. & Dommée, B. 1988 Variable phenotypes and stable 558

distribution of the cyanotypes of Trifolium repens L. in Southern France. Acta 559

Oecologica 9, 393–404. 560

21 De Araújo, A. M. 1976 The relationship between altitude and cyanogenesis in white 561

clover (Trifolium repens, L.). Heredity 37, 291–293. (doi:10.1038/hdy.1976.89) 562

22 Pederson, G. A., Fairbrother, T. E. & Greene, S. L. 1996 Cynogenesis and climatic 563

relationships in U.S. white clover germplasm collection and core subset. Crop 564

Science 36, 427. (doi:10.2135/cropsci1996.0011183X003600020035x) 565

Page 24 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

25

23 Majumdar, S., De, K. K. & Banerjee, S. 2004 Influence of two selective factors on 566

cyanogenesis polymorphism of Trifolium repens L. in Darjeeling Himalaya. Journal 567

of Plant Biology 47, 124–128. (doi:10.1007/BF03030642) 568

24 Daday, H. 1958 Gene frequencies in wild populations of Trifolium repens L. III. 569

World distribution. Heredity 12, 169–184. (doi:10.1038/hdy.1958.22) 570

25 Ganders, F. R. 1990 Altitudinal clines for cyanogenesis in introduced populations of 571

white clover near Vancouver, Canada. Heredity 64, 387–390. 572

(doi:10.1038/hdy.1990.48) 573

26 Coop, I. E. 1940 Cyanogenesis in white clover (Trifolium repens L.). III. A study of 574

linamarase, the enzyme which hydrolyses lotaustralin. New Zealand Journal of 575

Science and Technology A. 22, 71B–83B. 576

27 Corkill, L. 1942 Cyanogenesis in white clover (Trifolium repens L.) V. The 577

inheritance of cyanogenesis. New Zealand Journal of Science and Technology B 23, 578

178–193. 579

28 Melville, J. & Doak, B. W. 1940 Cyanogenesis in white clover (Trifolium repens 580

L.). II. Isolation of the glucosidal constituents. New Zealand Journal of Science and 581

Technology A. 22, 67B–71B. 582

29 Feigl, F. & Anger, V. 1966 Replacement of benzidine by copper ethylacetoacetate 583

and tetra base as spot-test reagent for hydrogen cyanide and cyanogen. Analyst 91, 584

282–4. 585

30 Olsen, K. M., Sutherland, B. L. & Small, L. L. 2007 Molecular evolution of the Li/li 586

chemical defence polymorphism in white clover (Trifolium repens L.). Molecular 587

Ecology 16, 4180–93. (doi:10.1111/j.1365-294X.2007.03506.x) 588

31 Hughes, M. A., Stirling, J. D. & Collinge, D. B. 1984 The inheritance of 589

cyanoglucoside content in Trifolium repens L. Biochemical Genetics 22, 139–51. 590

(doi:10.1007/BF00499294) 591

32 Hayden, K. J. & Parker, I. M. 2002 Plasticity in cyanogenesis of Trifolium repens 592

L.: inducibility, fitness costs and variable expression. Evolutionary Ecology 593

Research 4, 155–168. 594

33 Olsen, K. M., Hsu, S.-C. & Small, L. L. 2008 Evidence on the molecular basis of 595

the Ac/ac adaptive cyanogenesis polymorphism in white clover (Trifolium repens 596

L.). Genetics 179, 517–526. (doi:10.1534/genetics.107.080366) 597

34 Zohary, M. & Heller, D. 1984 The Genus Trifolium. Jerusalem: Israel Academy of 598

Sciences and Humanities. 599

Page 25 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

26

35 Ellison, N. W., Liston, A., Steiner, J. J., Williams, W. M. & Taylor, N. L. 2006 600

Molecular phylogenetics of the clover genus (Trifolium—Leguminosae). Molecular 601

Phylogenetics and Evolution 39, 688–705. (doi:10.1016/j.ympev.2006.01.004) 602

36 Gibson, P. B., Barnett, O. W. & Gillingham, J. T. 1972 Cyanoglucoside and 603

hydrolyzing enzyme in species related to Trifolium repens. Crop Science 12, 708–604

709. 605

37 Williams, W. M. & Williamson, M. L. 2001 Genetic polymorphism for 606

cyanogenesis and linkage at the linamarase locus in Trifolium nigrescens Viv. 607

subsp. nigrescens. Theoretical and Applied Genetics 103, 1211–1215. 608

(doi:10.1007/s001220100612) 609

38 Kakes, P. & Chardonnens, A. N. 2000 Cyanotypic frequencies in adjacent and 610

mixed populations of Trifolium occidentale Coombe and Trifolium repens L. are 611

regulated by different mechanisms. Biochemical Systematics and Ecology 28, 633–612

649. (doi:10.1016/S0305-1978(99)00110-6) 613

39 Takos, A. et al. 2010 Genetic screening identifies cyanogenesis-deficient mutants of 614

Lotus japonicus and reveals enzymatic specificity in hydroxynitrile glucoside 615

metabolism. Plant Cell 22, 1605–19. (doi:10.1105/tpc.109.073502) 616

40 Tian, D., Araki, H., Stahl, E., Bergelson, J. & Kreitman, M. 2002 Signature of 617

balancing selection in Arabidopsis. Proceedings of the National Academy of 618

Sciences of the United States of America 99, 11525–30. 619

(doi:10.1073/pnas.172203599) 620

41 Stahl, E. A, Dwyer, G., Mauricio, R., Kreitman, M. & Bergelson, J. 1999 Dynamics 621

of disease resistance polymorphism at the Rpm1 locus of Arabidopsis. Nature 400, 622

667–71. (doi:10.1038/23260) 623

42 Shen, J., Araki, H., Chen, L., Chen, J.-Q. & Tian, D. 2006 Unique evolutionary 624

mechanism in R-genes under the presence/absence polymorphism in Arabidopsis 625

thaliana. Genetics 172, 1243–50. (doi:10.1534/genetics.105.047290) 626

43 Badr, A., Sayed-Ahmed, H., El-Shanshouri, A. & Watson, I. E. 2002 Ancestors of 627

white clover (Trifolium repens L.), as revealed by isozyme polymorphisms. 628

Theoretical and Applied Genetics 106, 143–8. (doi:10.1007/s00122-002-1010-5) 629

44 Hand, M. L. et al. 2008 Identification of homologous, homoeologous and 630

paralogous sequence variants in an outbreeding allopolyploid species based on 631

comparison with progenitor taxa. Molecular Genetics and Genomics 280, 293–304. 632

(doi:10.1007/s00438-008-0365-y) 633

45 Porebski, S., Bailey, L. G. & Baum, B. 1997 Modification of a CTAB DNA 634

extraction protocol for plants containing high polysaccharide and polyphenol 635

Page 26 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

27

components. Plant Molecular Biology Reporter 15, 8–15. 636

(doi:10.1007/BF02772108) 637

46 Hall, T. 2001 BioLign alignment and multiple contig editor. http://en.bio-638

soft.net/dna/BioLign.html 639

47 Guindon, S. & Gascuel, O. 2003 A simple, fast, and accurate algorithm to estimate 640

large phylogenies by maximum likelihood. Systematic Biology 52, 696–704. 641

(doi:10.1080/10635150390235520) 642

48 Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. 2012 jModelTest 2: more 643

models, new heuristics and parallel computing. Nature Methods 9, 772. 644

(doi:10.1038/nmeth.2109) 645

49 Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W. & Gascuel, O. 646

2010 New algorithms and methods to estimate maximum-likelihood phylogenies: 647

assessing the performance of PhyML 3.0. Systematic Biology 59, 307–21. 648

(doi:10.1093/sysbio/syq010) 649

50 Williams, W., Ansari, H. A., Ellison, N. W. & Hussain, S. W. 2001 Evidence of 650

three subspecies in Trifolium nigrescens Viv. Annals of Botany 87, 683–691. 651

(doi:10.1006/anbo.2001.1399) 652

51 Dirzo, R. & Sarukhan, J. 1984 Perspectives on Plant Population Ecology. 653

Sunderland, Massachusetts: Sinauer. 654

52 Silvertown, J. & Charlesworth, D. 2001 Introduction to Plant Population Biology, 655

4th Edition. Oxford: Wiley-Blackwell. 656

53 Møller, B. L. 2010 Functional diversifications of cyanogenic glucosides. Current 657

Opinion in Plant Biology 13, 338–47. (doi:10.1016/j.pbi.2010.01.009) 658

54 Siegień, I. & Bogatek, R. 2006 Cyanide action in plants — from toxic to regulatory. 659

Acta Physiologiae Plantarum 28, 483–497. (doi:10.1007/BF02706632) 660

55 Kern, A. D. & Begun, D. J. 2008 Recurrent deletion and gene presence/absence 661

polymorphism: telomere dynamics dominate evolution at the tip of 3L in 662

Drosophila melanogaster and D. simulans. Genetics 179, 1021–7. 663

(doi:10.1534/genetics.107.078345) 664

56 Forslund, K., Morant, M., Jørgensen, B., Olsen, C. E., Asamizu, E. & Sato, S. 2004 665

Biosynthesis of the nitrile glucosides rhodiocyanoside A and D and the cyanogenic 666

glucosides lotaustralin and linamarin in Lotus japonicus. Plant Physiology 135, 71–667

84. (doi:10.1104/pp.103.038059) 668

Page 27 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

28

57 Seigler, D., Maslin, B. & Conn, E. 1989 Cyanogenesis in the Leguminosae. In 669

Advances in Legume Biology: Proceedings of the Second International Legume 670

Conference, St. Louis, Missouri, 23-27 June 1986, held under the auspices of the 671

Missouri Botanical Garden and the Royal Botanic Gardens, Kew. (eds C. Stirton & 672

J. Zarucchi), pp. 645–672. St. Louis, MO. 673

674

675

Page 28 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

29

Figure Legends 676

677

Figure 1. Southern hybridizations for CYP79D15 in Trifolium species with the Ac/ac 678

polymorphism. Ac+ and ac- correspond respectively to accessions with and without 679

detectable levels of cyanogenic glucosides in HCN assays. The presence of a single band 680

is consistent with the occurrence of CYP79D15 as a single-copy gene. (a) T. montanum 681

accessions, left to right: PI 234940, PI 542854b, PI 542861, PI 611617, MU-349b, PI 682

542811, KEW 0010849b, PI 611633, PI 205314, PI 418851, PI 440734, PI 542846, PI 683

542850, PI 542854a, PI 611651, MU-349a; (b) T. ambiguum accessions, left to right: PI 684

604743, PI 604720, PI 440712, PI 502614, PI 405124, PI 604749, PI 598987, PI 604752, 685

MU-347, PI 440693, PI 641674, PI 604703; (c) T. occidentale, T. uniflorum, and T. 686

suffocatum accessions, left to right: PI 214207 (T. repens positive control), Leca de Palma, 687

exAZ 4720, MU-353, KEW 0055322, PI 641364, PI 641363, PI 351076, PI 369138b, PI 688

516460, PI 369138c, PI 369138a, PI 369135, MU-084; (d) T. isthmocarpum accessions, 689

left to right: MU-209a, PI 517109, PI 517110, PI 517111, PI 517112, PI 203664, MU-116, 690

MU-209b, PI 338675, PI 535692, PI 535571, PI 202517, PI 653511. 691

692

Figure 2. Southern hybridizations for the Li gene and Li-paralog in Trifolium species 693

with the Li/li polymorphism. Li+ and li- correspond respectively to accessions with and 694

without detectable levels of linamarase in HCN assays. The L1 and P1 probes correspond 695

respectively to Li and to the noncyanogenic Li-paralog. The presence of two bands with 696

the L1 probe is consistent with the occurrence of Li as a single-copy gene (see Methods). 697

Arrows indicate expected locations of bands corresponding to the Li gene. For (a) (L1 698

Page 29 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

30

probe) and (b) (P1 probe), T. nigrescens accessions include five plants per subspecies, with 699

subspecies petrisavii, meneghinianum, and nigrescens from left to right as follows: PI 700

120132, PI 249855, PI 298478, PI 583447, PI 583448, PI 120120, PI 120139, PI 238156, 701

PI 287173, PI 304380, PI 210354, PI 233723, PI 419310, PI 419408, PI 591672. For (c) 702

(L1 probe) and (d) P1 probe, T. isthmocarpum accessions are as follows, from left to right: 703

MU-209a, PI 517109, PI 517110, PI 517111, PI 517112, PI 203664, MU-116, MU-209b, 704

PI 338675, PI 535692, PI 535571, PI 202517, PI 653511. 705

706

Figure 3. CYP79D15 maximum likelihood haplotype tree. Numbers along branches 707

indicate percentage bootstrap support; only values >50% are shown. Haplotype labels 708

correspond to accessions as indicated in the Supporting Information (Table S1); colors 709

indicate taxa, including subspecies designations (see Table 1). Taxon abbreviations are as 710

follows: T. ambiguum (ambi; brown), T. isthmocarpum (isth; pink), T. montanum ssp. 711

humboldtianum (monh; light blue), T. montanum ssp. montanum (mont; dark blue), T. 712

nigrescens ssp. meneghinianum (nigm; orange), T. nigrescens ssp. nigrescens (nign; red), 713

T. nigrescens ssp. petrisavii (nigp; beige), T. occidentale (occi; dark green), T. repens 714

(repens; light green); T. suffocatum (suff; black), T. uniflorum (unif; yellow). 715

716

Figure 4. Li maximum likelihood haplotype tree. Numbers along branches indicate 717

percentage bootstrap support; only values >50% are shown. Haplotype labels correspond 718

to accessions as indicated in the Supporting Information (Table S1). Taxon abbreviations 719

are as follows: T. isthmocarpum (isth; pink), T. nigrescens ssp. meneghinianum (nigm; 720

Page 30 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

31

orange), T. nigrescens ssp. nigrescens (nign; red), T. nigrescens ssp. petrisavii (nigp; 721

beige), T. repens (repens; light green). 722

723

Figure 5. 3CYP-2.34 maximum likelihood haplotype tree. Numbers along branches 724

indicate percentage bootstrap support; only values >50% are shown. Haplotype labels 725

correspond to accessions as indicated in the Supporting Information (Table S1). Taxon 726

abbreviations are as follows: T. repens (repens; dark green); T. suffocatum (suff; black), T. 727

uniflorum (unif; yellow). Ac+ and ac- correspond respectively to plants that do or do not 728

possess the CYP79D15 gene. 729

730

Page 31 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

32

731

Table 1. Cyanogenesis polymorphisms in sampled species of Trifolium Sect. 732

Trifoliastrum. Numbers in parentheses indicate sample sizes. Subspecies designations 733

follow the taxonomy of Ellison et al. (2006). 734

Species

Ac_ Li_

Ac_ lili

acac Li_

acac lili

T. ambiguum (13)

—

7

—

6

T. cernuum (5) — — — 5

T. glomeratum (5) — — — 5

T. isthmocarpum (16) 8 7 — 1

T. montanum

subsp. montanum (17) — 9 — 8

subsp. humboldtianum (2) 1 1

T. nigrescens

subsp. nigrescens (7) 6 1 — —

subsp. petrisavii (7) 7 — — —

subsp. meneghinianum (6) 6 — — —

T. occidentale (9) — 9 — —

T. pallescens (3) — — — 3

T. retusum (8) — — — 8

T. suffocatum (5) — 1 — 4

T. thallii (1) — — — 1

T. uniflorum (4)

— 2 — 2

735

736

Page 32 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

(a) T. montanum (b) T. ambiguum Ac+ ac- Ac+ ac-

23.3

9.4

6.6

4.4

2.3

Kb

2.0

0.5

0.9

Ac+ ac- Ac+ ac-

23.3

9.4

6.6

4.4

2.3

Kb

2.0

0.9

Fig. 1 CYP79D15

(c) T. occidentale, uniflorum, suffocatum

(d) T. isthmocarpum

Page 33 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

(b) P1: T. nigrescens

Li+ li-

23.3

9.4

6.6

4.4

2.3

Kb

2.0

0.9

Li+ li-

(a) L1: T. nigrescens

Fig. 2 Li and paralog

(c) L1: T. isthmocarpum (d) P1: T. isthmocarpum

Li+ li- 23.3

9.4

6.6

4.4

2.3

Kb

2.0

0.9

Li+ li-

0.5

Page 34 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

Fig. 3 CYP79D15 ML tree

89

71

93

98

96 97 100

52 62

100

70

67

100

60

56

100

77 79 75

77

55

100

100

CYP_occi05!CYP_occi09!CYP_occi08!CYP_occi07!CYP_occi06!CYP_occi04!CYP_occi03!CYP_occi02!CYP_occi01!

CYP_repens01!CYP_repens02!

CYP_repens03!CYP_unif02!CYP_unif01!

CYP_suff01!CYP_isth12!

CYP_isth11!CYP_isth13!CYP_isth14!CYP_isth15!CYP_isth04!

CYP_isth07!CYP_isth08!CYP_isth03!

CYP_isth09!CYP_isth02!



CYP_ambi06!CYP_ambi05!

CYP_ambi02!CYP_ambi01!CYP_ambi07!CYP_ambi03!CYP_ambi04!

CYP_mont01!CYP_monh10!

CYP_mont07!CYP_mont04!CYP_mont02!CYP_mont03!CYP_mont08!

CYP_mont06!CYP_mont09!

CYP_mont05!CYP_nign04! CYP_nign01!

CYP_nign05!CYP_nign02!

CYP_nign03!CYP_nign07!

CYP_nign06!CYP_nigm03!

CYP_nigm04!CYP_nigm06!

CYP_nigp01!CYP_nigp02!


CYP_nigp06!CYP_nigm05!

CYP_nigm02!CYP_nigm01!


Page 35 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

100

75

60

100

89

54 80

51

100

100

83

90

100 Li_repens02!

Li_repens03!

Li_repens01!

Li_isth08!

Li_isth07!

Li_isth06!

Li_isth05!

Li_isth04!

Li_isth03!

Li_isth02!

Li_isth01!

Li_nigp05!

Li_nigp06!

Li_nigp01!

Li_nigp03!

Li_nigp02!

Li_nign02!

Li_nign03!

Li_nigp04!

Li_nign04!

Li_nigm03!

Li_nigm05!

Li_nigm04!

Li_nign01!

Li_nigm01!

Li_nigm02!

Fig. 4 Li ML tree

Page 36 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Review O

nly

3CYP_suff02 ac-!

3CYP_suff01 Ac+!

3CYP_suff03 ac-!

3CYP_suff04 ac-!

3CYP_suff05 ac-!

3CYP_repens02 Ac+!

3CYP_repens04 ac-!

3CYP_repens01 Ac+!

3CYP_repens06 ac-!

3CYP_repens03 Ac+!

3CYP_repens05 ac-!

3CYP_unif01 ac-!

3CYP_unif02 Ac+!

3CYP_unif03 ac-!

100

99

52

100

74

100

100

Fig. 5 3CYP-2.34 ML tree

Page 37 of 37



123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

for review only - arts & sciences pagespages.wustl.edu/files/pages/imce/olsen/hi0001.pdf · 111...

Documents