function of c/ebpδ in a regulatory circuit that ... · 8 supplementary table 2 . gene name tfbs...

1

Function of C/EBPδ in a regulatory circuit that discriminates

between transient and persistent TLR4-induced signals

Vladimir Litvak, Stephen A. Ramsey, Alistair G. Rust , Daniel E. Zak ,

Kathleen A. Kennedy , Aaron E. Lampano, Matti Nykter, Ilya

Shmulevich & Alan Aderem

Nature Immunology: doi:10.1038/ni.1721

2

Supplementary figure 1

Figure 1. Strategy to identify critical regulatory circuits in LPS-stimulated

macrophages

mRNA from LPS-stimulated wild-type macrophages is subjected to microarray analysis

(I). LPS-induced genes are clustered according to temporal induction profiles (II). TFs in

cluster 1 are identified (III). Motif scanning analysis predicts genes in cluster 2 contained

promoter binding sites for cluster 1 TFs (IV). Putative binding sites are validated using

chromatin immunoprecipitation (ChIP) assays (V). Using temporal ChIP we establish the

kinetics of promoter occupancy (VI). Next, using kinetic data, we predict the

transcriptional circuitry (VII). Computational simulations predict novel functions (VIII)

that are then tested in vitro and in vivo (IX).


3


Figure 2 NF-κB inhibition ablates LPS-induced Il6 transcription in WT and Atf3-/-

macrophages

WT and Atf3-/-

macrophages were stimulated with 10ng/ml LPS for 4hr in the presence or

absence of 25μM sc-514. LPS induced Il6 mRNA levels were measured in WT and Atf3-/-

macrophages by quantitative real-time RT-PCR analysis. Data represent the average of

three independent experimental values ± standard error.


4


Figure 3 NF-κB inhibition ablates LPS-induced Il6 transcription in WT and Cebpd-

expressing Raw cells

WT (mock-trasfected) and C/EBPδ expressing Raw cells were stimulated with 10ng/ml

LPS for 4hr in the presence or absence of 25μM sc-514. LPS induced IL-6 production

was measured using ELISA. Data represent the average of three independent

experimental values ± standard error.


5


Figure 4 Analysis of robustness of model predictions

The model-predicted Il6 time-course expression was examined under simultaneous

variation of all seven free kinetic parameters (i.e., the seven parameters that were

determined by minimizing the error for recapitulating measured time-course protein and

mRNA levels). The parameters were simultaneously varied by adding a value to each

parameter equal to 0.2 times the estimated value of the variable, times a value sampled

from the unit-variance, zero-mean normal distribution. The noise-perturbed value of

each variable was not allowed to fall below 0.05 times the estimated value of the

variable, to ensure no negative values would occur from this sampling procedure. An

ensemble of 1,000 sets of perturbed parameter values were generated, and the LPS-

pulsing simulations were carried out for each parameter set. These results indicate that

the model predictions are robust with respect to systematic, simultaneous variation of the

seven free parameters.


6


Figure 5 Computational simulations of TLR4-induced Il6 mRNA production using

measured Rel binding as an input in the model.

Simulations of Il6 transcriptional response to variable-duration TLR4 signaling were

carried out using the fractional temporal binding data for NF-κB (Rel) to the Il6

promoter. The chromatin immunoprecipitation data were used as the time-

inhomogeneous term in the model. In our model short-duration pulses were predicted to

induce only low-level Il6 mRNA production while persistent stimulation was predicted to

super-induce Il6 transcription (Fig. 5a). Super-induction of Il6 was predicted to be absent

in Cebpd-null macrophages as shown in Figure 5b.


7

Supplementary table 1

Cluster 1 TFs Cluster 2 TFs

Arid5a Irf1 Aff1 Irf2 Phf6

Atf3 Junb Ahr Irf7 Plagl2

Bcl6 Jundm2 Arid4a Irf8 Pml

Ccrn4l Klf7 Arid5b Klf3 Pou2f2

Cebpb Maff Bach1 Lhx2 Ppargc1b

Cited2 Mxd1 Batf Lztfl1 Rest

Egr1 Nfil3 Bcl3 Max Rnf24

Egr2 Prdm1 Cebpd Mitf Spen

Egr3 Rel Creb5 Mizf Stat1

Etv3 Relb Crebl2 Mycl1 Stat2

Fos Trps1 Crem Nab2 Stat3

Hivep1 Daxx Ncoa7 Stat5a

Dr1 Nfix Surb7

Etv6 Nfkb1 Tcf4

Foxp1 Nfkb2 Thrap2

Foxp4 Nfxl1 Tle3

Hivep2 Nmi Zhx2

Hlx1 Nr3c1

Hmgn3 Pcaf

Table 1 LPS-induced early (cluster 1) and intermediate (cluster 2) transcription

factors

Macrophages from wild-type mice were stimulated with 10ng/ml LPS for 20, 40, 60, 80,

120, 180, 240 and 360 minutes. Total RNA was isolated and subjected to microarray

analysis. A total of 78 TFs were detected in the early (cluster 1) and the intermediate

(cluster 2) upregulated clusters.


8


Gene name TFBS start TFBS end MotifLocator score TF Matrix

Batf -100 -87 0.828948 ATF3_Q6

Batf -276 -267 0.897335 NFKAPPAB_01

Batf -275 -266 0.935841 NFKAPPAB_01

Batf -17 -8 0.842801 NFKAPPAB_01

Batf -274 -265 0.851224 NFKAPPAB_01

Batf -275 -266 0.849571 NFKAPPAB_01

Cebpd -85 -72 0.831249 ATF3_Q6

Cebpd -454 -441 0.832038 ATF3_Q6

Cebpd -117 -108 0.891018 NFKAPPAB_01

Lztfl1 -118 -105 0.845329 ATF3_Q6

Lztfl1 -243 -234 0.833526 NFKAPPAB_01

Lztfl1 -178 -169 0.885277 NFKAPPAB_01

Lztfl1 -178 -169 0.842789 NFKAPPAB_01

Ncoa7 -65 -52 0.864355 ATF3_Q6

Ncoa7 -230 -217 0.826403 ATF3_Q6

Ncoa7 -349 -336 0.824904 ATF3_Q6

Ncoa7 -35 -26 0.838645 NFKAPPAB_01

Ncoa7 -34 -25 0.83704 NFKAPPAB_01

Ncoa7 -35 -26 0.834725 NFKAPPAB_01

Nfkb1 -74 -61 0.900155 ATF3_Q6

Nfkb1 -74 -61 0.838193 ATF3_Q6

Nfkb1 -281 -272 0.855114 NFKAPPAB_01

Nfkb1 -184 -175 0.972974 NFKAPPAB_01

Nfkb1 -183 -174 0.828075 NFKAPPAB_01

Nfkb1 -184 -175 0.881183 NFKAPPAB_01

Nfkb1 -280 -271 0.851982 NFKAPPAB_01

Nfkb2 -311 -298 0.82831 ATF3_Q6

Nfkb2 -368 -359 0.849427 NFKAPPAB_01

Nfkb2 -281 -272 0.872247 NFKAPPAB_01

Nfkb2 -105 -96 0.83523 NFKAPPAB_01

Nfkb2 -158 -149 0.940216 NFKAPPAB_01

Nfkb2 -281 -272 0.824049 NFKAPPAB_01

Nfkb2 -368 -359 0.828768 NFKAPPAB_01

Tcf4 -300 -287 0.83214 ATF3_Q6

Tcf4 -156 -147 0.868601 NFKAPPAB_01

Zhx2 -122 -109 0.827123 ATF3_Q6

Zhx2 -122 -109 0.84091 ATF3_Q6

Zhx2 -71 -62 0.822952 NFKAPPAB_01

Zhx2 -91 -82 0.869612 NFKAPPAB_01

Table 2 NF-κB and ATF3 binding site location in the promoter regions of

intermediate (cluster 2)TFs genes


9

NFκB and ATF3 binding sites were identified by scanning of 1kbp 5’ promoter regions

of 55 intermediate TFs, using MotifLocator and the TRANSFAC matrices. Individual

matrix thresholds were set to only report predictions above the percentile of 0.067%.

Predicted targets were further filtered using an additional constraint: 150bp proximity

limit between putative NFκB and ATF3 binding sites. Each binding site predicted

location is shown, relative to the TSS.


Gene Name TFBS start TFBS end MotifLocator score TF Matrix

Cebpd -85 -72 0.831249 ATF3_Q6

Cebpd -454 -441 0.832038 ATF3_Q6

Cebpd -117 -108 0.891018 NFKAPPAB_01

Cebpd -732 -721 0.911786 CEBP_Q2_01

Table 3 NF-κB C/EBPδ, and ATF3 binding site locations in the Cebpd gene

promoter.

NFκB, C/EBPδ and ATF3 binding sites were identified by scanning of 1kbp 5’ promoter

region of Cebpd gene, using MotifLocator and the TRANSFAC matrices. Individual

matrix thresholds were set to only report predictions above the percentile of 0.067%.

Each binding site predicted location is shown, relative to the TSS.


10


Gene name TFBS start TFBS end

MotifLocator score TF Matrix

0610009K11Rik -355 -345 0.88666 ATF1_Q6 0610009K11Rik -358 -345 0.84555 ATF3_Q6 0610009K11Rik -67 -54 0.977768 CEBP_Q2 0610009K11Rik -67 -56 0.942138 CEBP_Q2 0610009K11Rik -67 -54 0.924769 CEBPB_02 0610009K11Rik -67 -60 0.944345 CREB_01 0610009K11Rik -8 -1 1.05594 CREB_01 0610009K11Rik -473 -462 1.00908 CREB_02 0610009K11Rik -475 -464 0.897148 CREB_Q2 0610009K11Rik -470 -465 1.05978 CREB_Q3 0610009K11Rik -357 -346 0.906759 CREB_Q4 0610009K11Rik -69 -58 0.888842 CREBP1_Q2 0610009K11Rik -67 -60 0.990329 CREBP1CJUN_01 0610009K11Rik -67 -60 0.919389 CREBP1CJUN_01 0610009K11Rik -8 -1 0.978931 CREBP1CJUN_01 0610009K11Rik -70 -57 0.850784 NFKB_Q6 1110018G07Rik -362 -349 0.846494 ATF3_Q6 1110018G07Rik -86 -73 0.907356 CEBPB_01 1110018G07Rik -359 -352 0.920646 CREB_01 1110018G07Rik -460 -449 0.896136 CREB_Q2 1110018G07Rik -360 -355 1.09337 CREB_Q3 1110018G07Rik -460 -449 0.895526 CREB_Q4 1110018G07Rik -362 -352 0.937878 CREB_Q4 1110018G07Rik -460 -449 0.880881 CREBP1_Q2 1110018G07Rik -359 -352 0.946784 CREBP1CJUN_01 1110018G07Rik -880 -869 0.806218 NFKB_C 1200002N14Rik -447 -437 0.91219 ATF1_Q6 1200002N14Rik -86 -76 0.898705 ATF1_Q6 1200002N14Rik -450 -437 0.849099 ATF3_Q6 1200002N14Rik -89 -76 0.880408 ATF3_Q6 1200002N14Rik -77 -64 0.927974 CEBP_Q2 1200002N14Rik -77 -66 0.936108 CEBP_Q2 1200002N14Rik -77 -64 0.981114 CEBPA_01 1200002N14Rik -77 -64 1.01725 CEBPB_02 1200002N14Rik -447 -440 0.951898 CREB_01 1200002N14Rik -448 -443 1.07712 CREB_Q3 1200002N14Rik -450 -440 0.935177 CREB_Q4 1200002N14Rik -86 -76 0.926089 CREB_Q4 1200002N14Rik -88 -77 0.875601 CREBP1_Q2 1200002N14Rik -447 -440 0.914951 CREBP1CJUN_01 1200002N14Rik -447 -440 0.926461 CREBP1CJUN_01 1200002N14Rik -255 -246 0.934324 NFKAPPAB_01 1200002N14Rik -255 -246 0.88826 NFKAPPAB65_01


11

1200002N14Rik -256 -245 0.878498 NFKB_C 1200002N14Rik -257 -244 0.857163 NFKB_Q6 1200002N14Rik -257 -244 0.855687 NFKB_Q6 1200002N14Rik -256 -241 0.893826 NFKB_Q6_01 2310035C23Rik -764 -754 0.956921 ATF1_Q6 2310035C23Rik -711 -700 0.936923 CEBP_Q2 2310035C23Rik -423 -414 0.947004 NFKAPPAB_01 2310035C23Rik -255 -246 0.920954 NFKAPPAB_01 2310035C23Rik -423 -414 0.877904 NFKAPPAB65_01 2310035C23Rik -256 -247 0.84666 NFKAPPAB65_01 2310035C23Rik -255 -246 0.867009 NFKAPPAB65_01 2310035C23Rik -424 -413 0.902073 NFKB_C 2310035C23Rik -331 -318 0.851304 NFKB_Q6 2310035C23Rik -425 -412 0.839342 NFKB_Q6 2310035C23Rik -257 -244 0.853776 NFKB_Q6 2310035C23Rik -424 -409 0.887913 NFKB_Q6_01 2410081M15Rik -454 -441 0.927158 ATF3_Q6 2410081M15Rik -97 -84 0.941179 CEBPB_01 2410081M15Rik -228 -221 0.948915 CREB_01 2410081M15Rik -451 -444 0.923661 CREB_01 2410081M15Rik -451 -444 0.941014 CREB_01 2410081M15Rik -228 -221 0.940135 CREB_01 2410081M15Rik -453 -442 0.903928 CREB_Q2 2410081M15Rik -453 -442 0.933352 CREB_Q4 2410081M15Rik -230 -219 0.894751 CREBP1_Q2 2410081M15Rik -451 -444 0.926013 CREBP1CJUN_01 2410081M15Rik -451 -444 0.969821 CREBP1CJUN_01 2410081M15Rik -798 -789 0.865442 NFKAPPAB_01 2410081M15Rik -338 -329 0.846038 NFKAPPAB65_01 4930578N16Rik -99 -86 0.890278 ATF3_Q6 4930578N16Rik -739 -728 0.971671 CEBP_Q2 4930578N16Rik -739 -726 0.954365 CEBPA_01 4930578N16Rik -739 -726 0.907098 CEBPB_01 4930578N16Rik -96 -89 1.04681 CREB_01 4930578N16Rik -96 -89 1.05717 CREB_01 4930578N16Rik -96 -85 0.917223 CREB_02 4930578N16Rik -98 -87 0.907552 CREB_Q2 4930578N16Rik -98 -87 0.923858 CREB_Q2 4930578N16Rik -711 -700 0.886552 CREB_Q2 4930578N16Rik -93 -88 1.07712 CREB_Q3 4930578N16Rik -97 -92 1.06252 CREB_Q3 4930578N16Rik -98 -87 0.944724 CREB_Q4 4930578N16Rik -98 -87 0.959642 CREB_Q4 4930578N16Rik -96 -86 0.990065 CREB_Q4 4930578N16Rik -99 -89 0.951055 CREB_Q4 4930578N16Rik -98 -87 1.00131 CREBP1_Q2 4930578N16Rik -98 -87 1.00372 CREBP1_Q2 4930578N16Rik -96 -89 1.04561 CREBP1CJUN_01


12

4930578N16Rik -96 -89 1.0557 CREBP1CJUN_01 4930578N16Rik -758 -747 0.823 NFKB_C A030007L17Rik -173 -163 0.896541 ATF1_Q6 A030007L17Rik -553 -540 0.953141 CEBP_Q2 A030007L17Rik -553 -540 0.924338 CEBPA_01 A030007L17Rik -173 -166 0.952232 CREB_01 A030007L17Rik -173 -166 1.05168 CREB_01 A030007L17Rik -173 -162 0.919998 CREB_02 A030007L17Rik -175 -164 0.906135 CREB_Q2 A030007L17Rik -170 -165 1.06252 CREB_Q3 A030007L17Rik -175 -164 0.939157 CREB_Q4 A030007L17Rik -173 -163 1.00896 CREB_Q4 A030007L17Rik -175 -164 0.988292 CREBP1_Q2 A030007L17Rik -175 -164 0.92322 CREBP1_Q2 A030007L17Rik -173 -166 0.979426 CREBP1CJUN_01 A030007L17Rik -173 -166 0.98932 CREBP1CJUN_01 A030007L17Rik -300 -291 0.859912 NFKAPPAB_01 A030007L17Rik -302 -291 0.816743 NFKB_C A030007L17Rik -302 -289 0.83902 NFKB_Q6 A530016O06Rik -268 -255 0.943645 CEBP_Q2 A530016O06Rik -268 -257 1.00787 CEBP_Q2 A530016O06Rik -268 -255 0.982228 CEBPA_01 A530016O06Rik -268 -255 0.991309 CEBPB_01 A530016O06Rik -874 -861 0.915007 CEBPB_01 A530016O06Rik -268 -255 0.946713 CEBPB_02 A530016O06Rik -927 -922 1.06232 CREB_Q3 A530016O06Rik -326 -315 0.831898 NFKB_C A530023O14Rik -933 -922 0.943117 CEBP_Q2 A530023O14Rik -441 -430 0.901973 CREB_Q2 A530023O14Rik -441 -430 0.893256 CREB_Q4 A530023O14Rik -44 -35 0.89465 NFKAPPAB_01 A530023O14Rik -44 -35 0.875977 NFKAPPAB65_01 A530023O14Rik -45 -30 0.830933 NFKB_Q6_01 Agrn -69 -56 0.922637 CEBPB_01 Agrn -352 -345 0.920371 CREB_01 Agrn -354 -343 0.916483 CREB_Q4 Agrn -911 -902 0.851657 NFKAPPAB_01 Agrn -101 -92 0.848638 NFKAPPAB_01 Agrn -911 -902 0.842529 NFKAPPAB65_01 Agrn -101 -92 0.837113 NFKAPPAB65_01 Agrn -102 -91 0.862775 NFKB_C Agrn -912 -901 0.811537 NFKB_C Ahr -867 -854 0.940661 CEBPB_01 Ahr -147 -136 0.994741 CREB_02 Ahr -144 -139 1.07456 CREB_Q3 Ahr -147 -137 0.920631 CREB_Q4 Ahr -789 -780 0.848638 NFKAPPAB_01 Ahr -789 -780 0.837113 NFKAPPAB65_01


13

Ahr -790 -779 0.833449 NFKB_C AI451557 -325 -312 0.972332 CEBP_Q2 AI451557 -323 -312 0.929472 CEBP_Q2 AI451557 -325 -312 0.970664 CEBPB_01 AI451557 -325 -312 0.912572 CEBPB_02 AI451557 -322 -315 0.928382 CREB_01 AI451557 -324 -313 0.934911 CREB_Q2 AI451557 -319 -314 1.07456 CREB_Q3 AI451557 -324 -313 0.925527 CREB_Q4 AI451557 -322 -312 0.957978 CREB_Q4 AI451557 -77 -68 0.858934 NFKAPPAB_01 AI451557 -77 -68 0.932173 NFKAPPAB_01 AI451557 -77 -68 0.89182 NFKAPPAB65_01 AI451557 -78 -67 0.877214 NFKB_C AI451557 -578 -567 0.859192 NFKB_C AI451557 -79 -66 0.861008 NFKB_Q6 AI451557 -579 -566 0.871446 NFKB_Q6 AI451557 -78 -63 0.876671 NFKB_Q6_01 Aim2 -845 -832 0.915284 CEBPB_01 Aim2 -357 -350 0.973796 CREBP1CJUN_01 Aim2 -357 -350 0.977734 CREBP1CJUN_01 Aim2 -313 -304 0.856951 NFKAPPAB_01 Angpt1 -114 -104 0.873677 ATF1_Q6 Angpt1 -701 -690 0.963349 CEBP_Q2 Angpt1 -617 -604 0.918729 CEBPB_01 Angpt1 -793 -780 0.909545 CEBPB_01 Angpt1 -703 -690 0.91258 CEBPB_02 Angpt1 -645 -640 1.07099 CREB_Q3 Angpt1 -706 -697 0.85056 NFKAPPAB_01 Angpt1 -560 -551 0.885511 NFKAPPAB_01 Angpt1 -840 -831 0.849552 NFKAPPAB_01 Angpt1 -560 -551 0.87986 NFKAPPAB65_01 Angpt1 -839 -830 0.90284 NFKAPPAB65_01 Angpt1 -840 -831 0.949485 NFKAPPAB65_01 Angpt1 -841 -830 0.833826 NFKB_C Angpt1 -562 -549 0.869553 NFKB_Q6 Angpt1 -841 -828 0.846991 NFKB_Q6 Angpt1 -842 -829 0.900429 NFKB_Q6 Angpt1 -561 -546 0.842925 NFKB_Q6_01 Angpt1 -841 -826 0.897754 NFKB_Q6_01 Ankrd22 -601 -588 0.871691 ATF3_Q6 Ankrd22 -127 -114 1.05694 CEBP_Q2 Ankrd22 -125 -114 0.992726 CEBP_Q2 Ankrd22 -127 -116 0.976266 CEBP_Q2 Ankrd22 -206 -195 0.948906 CEBP_Q2 Ankrd22 -127 -114 1.00466 CEBPA_01 Ankrd22 -127 -114 0.908777 CEBPB_01 Ankrd22 -127 -114 0.915086 CEBPB_01


14

Ankrd22 -127 -114 0.959412 CEBPB_02 Ankrd22 -127 -114 0.936585 CEBPB_02 Ankrd22 -424 -417 0.921878 CREBP1CJUN_01 Ankrd22 -939 -928 0.82112 NFKB_C Appl1 -109 -99 0.936874 ATF1_Q6 Appl1 -112 -99 0.866283 ATF3_Q6 Appl1 -342 -329 0.907797 CEBPB_01 Appl1 -706 -699 0.928531 CREB_01 Appl1 -341 -330 0.933749 CREB_Q2 Appl1 -340 -335 1.06232 CREB_Q3 Appl1 -376 -371 1.07099 CREB_Q3 Appl1 -707 -702 1.06485 CREB_Q3 Appl1 -341 -330 0.925659 CREB_Q4 Appl1 -342 -332 0.925052 CREB_Q4 Appl1 -378 -368 0.912645 CREB_Q4 Appl1 -111 -100 0.884531 CREBP1_Q2 Appl1 -111 -100 0.896899 CREBP1_Q2 Appl1 -140 -131 0.853352 NFKAPPAB_01 Appl1 -51 -42 0.868019 NFKAPPAB_01 Appl1 -50 -41 0.968023 NFKAPPAB_01 Appl1 -140 -131 0.928233 NFKAPPAB_01 Appl1 -50 -41 0.963081 NFKAPPAB_01 Appl1 -140 -131 0.864564 NFKAPPAB65_01 Appl1 -139 -130 0.926666 NFKAPPAB65_01 Appl1 -51 -42 0.974216 NFKAPPAB65_01 Appl1 -477 -468 0.853756 NFKAPPAB65_01 Appl1 -50 -41 0.910083 NFKAPPAB65_01 Appl1 -140 -131 0.851818 NFKAPPAB65_01 Appl1 -50 -41 0.921992 NFKAPPAB65_01 Appl1 -51 -40 0.856007 NFKB_C Appl1 -141 -130 0.816673 NFKB_C Appl1 -51 -40 0.927006 NFKB_C Appl1 -141 -130 0.818809 NFKB_C Appl1 -52 -39 0.892246 NFKB_Q6 Appl1 -52 -39 0.879075 NFKB_Q6 Appl1 -142 -129 0.860941 NFKB_Q6 Appl1 -51 -36 0.992544 NFKB_Q6_01 Appl1 -145 -130 0.907317 NFKB_Q6_01 Appl1 -52 -37 0.914593 NFKB_Q6_01 Appl1 -55 -40 0.861671 NFKB_Q6_01 Appl1 -141 -126 0.86866 NFKB_Q6_01 Armcx6 -556 -543 0.886277 ATF3_Q6 Armcx6 -447 -436 0.948012 CEBP_Q2 Armcx6 -566 -555 0.942449 CEBP_Q2 Armcx6 -568 -555 0.967476 CEBPA_01 Armcx6 -449 -436 0.937513 CEBPA_01 Armcx6 -568 -555 0.929866 CEBPB_01 Armcx6 -49 -38 0.976114 CREB_02


15

Armcx6 -557 -546 0.910198 CREB_02 Armcx6 -46 -41 1.06637 CREB_Q3 Armcx6 -556 -546 0.92335 CREB_Q4 Armcx6 -47 -36 0.894664 CREBP1_Q2 Armcx6 -251 -242 0.867454 NFKAPPAB_01 Armcx6 -253 -240 0.84327 NFKB_Q6 Armcx6 -252 -237 0.840418 NFKB_Q6_01 Armcx6 -253 -238 0.83408 NFKB_Q6_01 Atp6v1e1 -430 -420 0.919853 ATF1_Q6 Atp6v1e1 -880 -869 0.957004 CEBP_Q2 Atp6v1e1 -880 -867 0.931172 CEBPB_01 Atp6v1e1 -258 -249 0.853483 NFKAPPAB_01 Atp6v1e1 -258 -249 0.871799 NFKAPPAB65_01 Atp6v1e1 -259 -248 0.81424 NFKB_C B3gnt5 -123 -112 0.930159 CEBP_Q2 B3gnt5 -521 -510 0.945174 CEBP_Q2 B3gnt5 -123 -110 0.935062 CEBPA_01 B3gnt5 -123 -110 0.972297 CEBPB_01 B3gnt5 -72 -61 0.931024 CREB_02 B3gnt5 -69 -64 1.06637 CREB_Q3 B3gnt5 -30 -21 0.84988 NFKAPPAB_01 BB146404 -837 -826 0.937742 CEBP_Q2 BB146404 -839 -826 0.941433 CEBPA_01 BB146404 -526 -519 0.931302 CREBP1CJUN_01 BB146404 -585 -576 0.860443 NFKAPPAB_01 BB146404 -585 -576 0.852274 NFKAPPAB_01 BB146404 -586 -575 0.810164 NFKB_C BC006779 -157 -147 0.867972 ATF1_Q6 BC006779 -15 -5 1.00871 ATF1_Q6 BC006779 -18 -8 0.909628 ATF1_Q6 BC006779 -218 -208 0.903398 ATF1_Q6 BC006779 -814 -803 0.926653 CEBP_Q2 BC006779 -15 -8 0.922858 CREB_01 BC006779 -15 -5 0.93696 CREB_Q4 BC006779 -31 -22 0.872004 NFKAPPAB_01 BC006779 -31 -22 0.880779 NFKAPPAB_01 BC006779 -30 -21 0.838643 NFKAPPAB65_01 BC006779 -31 -22 0.875344 NFKAPPAB65_01 BC006779 -32 -21 0.841986 NFKB_C BC006779 -33 -20 0.874975 NFKB_Q6 BC006779 -347 -334 0.868818 NFKB_Q6 BC006779 -32 -17 0.857676 NFKB_Q6_01 Bex1 -730 -719 0.933256 CEBP_Q2 Bex1 -17 -6 0.942604 CREB_Q2 Bex1 -17 -6 0.937436 CREB_Q4 Bex1 -17 -6 0.890583 CREBP1_Q2 Bex1 -822 -813 0.847546 NFKAPPAB65_01 Birc3 -873 -860 0.921168 CEBPB_01


16

Birc3 -155 -142 0.905295 CEBPB_01 Birc3 -312 -305 0.923171 CREBP1CJUN_01 Birc3 -62 -53 0.858626 NFKAPPAB_01 Birc3 -62 -53 0.859549 NFKAPPAB_01 Birc3 -61 -52 0.953304 NFKAPPAB_01 Birc3 -62 -53 0.898738 NFKAPPAB65_01 Birc3 -61 -52 0.962554 NFKAPPAB65_01 Birc3 -62 -51 0.806954 NFKB_C Birc3 -63 -52 0.831707 NFKB_C Birc3 -62 -51 0.805697 NFKB_C Birc3 -66 -51 0.901932 NFKB_Q6_01 Bmp2 -968 -958 0.895062 ATF1_Q6 Bmp2 -786 -776 0.894606 ATF1_Q6 Bmp2 -368 -355 0.900164 ATF3_Q6 Bmp2 -544 -531 0.983212 CEBPA_01 Bmp2 -544 -531 0.979194 CEBPB_02 Bmp2 -554 -543 0.917081 CREB_02 Bmp2 -869 -858 0.893838 CREB_Q4 Bmp2 -968 -958 0.927372 CREB_Q4 Bmp2 -869 -858 0.881397 CREBP1_Q2 Bmp2 -289 -280 0.858846 NFKAPPAB_01 Bmp2 -289 -280 0.88897 NFKAPPAB_01 Bmp2 -290 -279 0.891765 NFKB_C Bmp2 -291 -278 0.843115 NFKB_Q6 Bmp2 -294 -279 0.907943 NFKB_Q6_01 Bst1 -121 -111 0.880109 ATF1_Q6 Bst1 -121 -111 0.880109 ATF1_Q6 Bst1 -703 -690 0.923852 CEBPB_01 Bst1 -703 -690 0.923852 CEBPB_01 Bst1 -927 -918 0.870893 NFKAPPAB_01 Bst1 -927 -918 0.870893 NFKAPPAB_01 Bst1 -927 -918 0.851687 NFKAPPAB65_01 Bst1 -927 -918 0.851687 NFKAPPAB65_01 Bst1 -928 -917 0.834288 NFKB_C Bst1 -928 -917 0.834288 NFKB_C Bst1 -45 -32 0.844249 NFKB_Q6 Bst1 -45 -32 0.844249 NFKB_Q6 Btg2 -166 -156 0.960974 ATF1_Q6 Btg2 -270 -260 0.939419 ATF1_Q6 Btg2 -150 -140 0.86825 ATF1_Q6 Btg2 -169 -156 0.870664 ATF3_Q6 Btg2 -153 -140 0.913596 ATF3_Q6 Btg2 -153 -140 0.989221 ATF3_Q6 Btg2 -169 -156 0.886501 ATF3_Q6 Btg2 -700 -687 0.952066 CEBPA_01 Btg2 -270 -263 0.941746 CREB_01 Btg2 -166 -159 1.06343 CREB_01 Btg2 -166 -159 1.04681 CREB_01


17

Btg2 -170 -159 0.967858 CREB_02 Btg2 -168 -157 0.910124 CREB_Q2 Btg2 -272 -261 0.890304 CREB_Q2 Btg2 -163 -158 1.06252 CREB_Q3 Btg2 -167 -162 1.0919 CREB_Q3 Btg2 -168 -157 0.904093 CREB_Q4 Btg2 -168 -157 0.947326 CREB_Q4 Btg2 -272 -261 0.931193 CREB_Q4 Btg2 -166 -156 1.0025 CREB_Q4 Btg2 -270 -260 0.928521 CREB_Q4 Btg2 -153 -143 0.929648 CREB_Q4 Btg2 -150 -140 0.917817 CREB_Q4 Btg2 -169 -159 0.996699 CREB_Q4 Btg2 -168 -157 0.943978 CREBP1_Q2 Btg2 -168 -157 0.936316 CREBP1_Q2 Btg2 -166 -159 1.0618 CREBP1CJUN_01 Btg2 -166 -159 1.04561 CREBP1CJUN_01 Btg2 -267 -252 0.834727 NFKB_Q6_01 Camp -658 -645 0.867529 ATF3_Q6 Camp -658 -645 0.880002 ATF3_Q6 Camp -276 -263 0.938653 CEBP_Q2 Camp -276 -265 0.947462 CEBP_Q2 Camp -276 -263 0.956844 CEBPA_01 Camp -276 -263 0.903292 CEBPB_01 Camp -135 -122 0.909086 CEBPB_01 Camp -276 -263 0.975238 CEBPB_02 Camp -655 -648 0.940188 CREB_01 Camp -652 -647 1.06455 CREB_Q3 Camp -287 -278 0.867443 NFKAPPAB_01 Camp -288 -273 0.842414 NFKB_Q6_01 Car13 -140 -127 0.914935 CEBPB_01 Car13 -114 -103 1.00714 CREB_02 Car13 -112 -101 0.892462 CREB_Q2 Car13 -111 -106 1.08082 CREB_Q3 Car13 -113 -103 0.914525 CREB_Q4 Car13 -112 -101 0.879757 CREBP1_Q2 Car13 -183 -174 0.853634 NFKAPPAB_01 Car13 -182 -173 0.957231 NFKAPPAB_01 Car13 -182 -173 0.966301 NFKAPPAB65_01 Car13 -184 -171 0.838215 NFKB_Q6 Car13 -185 -172 0.84325 NFKB_Q6 Car13 -187 -172 0.835392 NFKB_Q6_01 Ccl12 -81 -68 0.849179 ATF3_Q6 Ccl12 -797 -786 0.937833 CEBP_Q2 Ccl12 -797 -784 0.934363 CEBPB_02 Ccl12 -237 -226 0.874398 CREBP1_Q2 Ccl12 -128 -119 0.855228 NFKAPPAB_01 Ccl12 -128 -119 0.858075 NFKAPPAB65_01


18

Ccl12 -18 -9 0.870031 NFKAPPAB65_01 Ccl12 -17 -8 0.852309 NFKAPPAB65_01 Ccnd2 -706 -695 0.934074 CEBP_Q2 Ccnd2 -708 -695 0.929232 CEBPA_01 Ccnd2 -708 -695 0.929243 CEBPB_02 Ccnd2 -9 -2 0.922792 CREB_01 Ccnd2 -791 -782 0.851289 NFKAPPAB_01 Ccnd2 -791 -782 0.856198 NFKAPPAB65_01 Ccnd2 -792 -777 0.841361 NFKB_Q6_01 Ccng2 -249 -239 0.878988 ATF1_Q6 Ccng2 -417 -404 0.942357 CEBP_Q2 Ccng2 -415 -404 0.976642 CEBP_Q2 Ccng2 -417 -404 0.943197 CEBPA_01 Ccng2 -417 -404 0.937795 CEBPB_01 Ccng2 -417 -404 0.940228 CEBPB_02 Ccng2 -246 -235 0.957944 CREB_02 Ccng2 -913 -904 0.879312 NFKAPPAB_01 Ccng2 -329 -320 0.876527 NFKAPPAB65_01 Ccng2 -913 -904 0.85972 NFKAPPAB65_01 Ccng2 -914 -903 0.83173 NFKB_C Ccng2 -25 -14 0.802454 NFKB_C Ccng2 -913 -902 0.802603 NFKB_C Ccng2 -914 -901 0.864699 NFKB_Q6 Ccng2 -914 -899 0.853069 NFKB_Q6_01 Ccr3 -445 -432 0.857233 ATF3_Q6 Ccr3 -79 -68 0.937158 CEBP_Q2 Ccr3 -81 -68 0.938049 CEBPB_01 Ccr3 -308 -299 0.8703 NFKAPPAB_01 Ccr3 -308 -299 0.970681 NFKAPPAB_01 Ccr3 -309 -300 0.845311 NFKAPPAB65_01 Ccr3 -308 -299 0.972025 NFKAPPAB65_01 Ccr3 -309 -298 0.806433 NFKB_C Ccr3 -309 -298 0.872471 NFKB_C Ccr3 -310 -297 0.936252 NFKB_Q6 Ccr3 -313 -298 0.890526 NFKB_Q6_01 Cish -133 -123 0.909358 ATF1_Q6 Cish -63 -50 0.922901 CEBP_Q2 Cish -551 -540 0.93824 CEBP_Q2 Cish -63 -50 0.963449 CEBPA_01 Cish -63 -50 0.957753 CEBPB_02 Cish -869 -864 1.06637 CREB_Q3 Cish -969 -960 0.853698 NFKAPPAB_01 Cish -580 -571 0.892402 NFKAPPAB_01 Cish -581 -572 0.884882 NFKAPPAB_01 Cish -581 -572 0.879259 NFKAPPAB65_01 Cish -968 -959 0.899644 NFKAPPAB65_01 Cish -581 -570 0.820289 NFKB_C Cish -582 -571 0.833147 NFKB_C


19

Cish -583 -570 0.880747 NFKB_Q6 Cish -583 -570 0.867445 NFKB_Q6 Cish -582 -569 0.879768 NFKB_Q6 Cish -973 -958 0.830542 NFKB_Q6_01 Cish -582 -567 0.888237 NFKB_Q6_01 Creb5 -302 -289 0.967122 CEBP_Q2 Creb5 -85 -74 0.942915 CEBP_Q2 Creb5 -300 -289 0.95762 CEBP_Q2 Creb5 -302 -289 0.978884 CEBPA_01 Creb5 -87 -74 0.929222 CEBPA_01 Creb5 -87 -74 0.937259 CEBPB_01 Creb5 -302 -289 0.916283 CEBPB_01 Creb5 -84 -74 0.915026 CREB_Q4 Creb5 -210 -199 0.872777 CREBP1_Q2 Creb5 -210 -199 0.877943 CREBP1_Q2 Creb5 -645 -636 0.953048 NFKAPPAB65_01 Creb5 -578 -569 0.837103 NFKAPPAB65_01 Creb5 -689 -676 0.858925 NFKB_Q6 Crim1 -146 -133 0.853041 ATF3_Q6 Crim1 -834 -823 0.972367 CEBP_Q2 Crim1 -836 -823 0.928424 CEBPA_01 Crim1 -836 -823 0.970921 CEBPB_01 Crim1 -582 -571 0.928184 CREB_02 Crim1 -145 -134 0.889781 CREB_Q2 Crim1 -145 -134 0.919794 CREB_Q4 Crim1 -146 -136 0.924114 CREB_Q4 Crim1 -222 -211 0.876598 CREBP1_Q2 Crim1 -768 -759 0.8566 NFKAPPAB_01 Crim1 -431 -422 0.855473 NFKAPPAB_01 Crim1 -430 -421 0.888405 NFKAPPAB_01 Crim1 -767 -758 0.857511 NFKAPPAB_01 Crim1 -768 -759 0.935144 NFKAPPAB65_01 Crim1 -767 -758 0.95708 NFKAPPAB65_01 Crim1 -769 -758 0.816871 NFKB_C Crim1 -768 -757 0.863953 NFKB_C Crim1 -769 -756 0.945282 NFKB_Q6 Crim1 -768 -753 0.840158 NFKB_Q6_01 Crim1 -769 -754 0.842496 NFKB_Q6_01 Crim1 -139 -124 0.834164 NFKB_Q6_01 Crim1 -435 -420 0.870356 NFKB_Q6_01 Crim1 -772 -757 0.899967 NFKB_Q6_01 Csf1 -667 -654 0.961314 CEBPA_01 Csf1 -790 -777 0.904227 CEBPB_01 Csf1 -594 -581 0.941698 CEBPB_02 Csf1 -670 -659 0.912348 CREB_Q2 Csf1 -669 -664 1.064 CREB_Q3 Csf1 -722 -717 1.06602 CREB_Q3 Csf1 -670 -659 0.93979 CREB_Q4


20

Csf1 -671 -661 0.911737 CREB_Q4 Csf1 -668 -661 0.93768 CREBP1CJUN_01 Csf1 -155 -146 0.863285 NFKAPPAB_01 Csf1 -154 -145 0.968456 NFKAPPAB_01 Csf1 -154 -145 0.951439 NFKAPPAB65_01 Csf1 -155 -144 0.955876 NFKB_C Csf1 -156 -143 0.853492 NFKB_Q6 Csf1 -156 -143 0.938989 NFKB_Q6 Csf1 -159 -144 0.922828 NFKB_Q6_01 Csf3 -180 -170 0.95953 ATF3_Q6 Csf3 -86 -73 0.92901 CEBP_Q2 Csf3 -84 -73 0.928554 CEBP_Q2 Csf3 -140 -129 0.924336 CEBP_Q2 Csf3 -272 -259 0.922248 CEBPB_02 Csf3 -180 -173 1.02438 CREB_01 Csf3 -180 -173 0.922787 CREBP1CJUN_01 Csf3 -180 -173 0.957965 CREBP1CJUN_01 Csf3 -630 -621 0.88172 NFKAPPAB_01 Csf3 -840 -831 0.891352 NFKAPPAB_01 Csf3 -630 -621 0.892918 NFKAPPAB_01 Csf3 -161 -152 0.867861 NFKAPPAB_01 Csf3 -631 -622 0.904973 NFKAPPAB_01 Csf3 -388 -379 0.852845 NFKAPPAB_01 Csf3 -33 -24 0.880908 NFKAPPAB_01 Csf3 -630 -621 0.906331 NFKAPPAB65_01 Csf3 -631 -622 0.870224 NFKAPPAB65_01 Csf3 -33 -24 0.875468 NFKAPPAB65_01 Csf3 -841 -830 0.896446 NFKB_C Csf3 -632 -621 0.823379 NFKB_C Csf3 -163 -152 0.821009 NFKB_C Csf3 -631 -620 0.892679 NFKB_C Csf3 -389 -378 0.812333 NFKB_C Csf3 -164 -151 0.86783 NFKB_Q6 Csf3 -842 -829 0.844989 NFKB_Q6 Csf3 -632 -619 0.855565 NFKB_Q6 Csf3 -34 -19 0.842539 NFKB_Q6_01 Csf3 -844 -829 0.875923 NFKB_Q6_01 Csf3 -841 -826 0.838647 NFKB_Q6_01 Csf3 -631 -616 0.885164 NFKB_Q6_01 Csf3 -635 -620 0.836776 NFKB_Q6_01 Csf3 -389 -374 0.835922 NFKB_Q6_01 Cxcl1 -321 -311 0.879466 ATF1_Q6 Cxcl1 -637 -624 0.92818 CEBPA_01 Cxcl1 -262 -251 0.93979 CREB_02 Cxcl1 -259 -254 1.06637 CREB_Q3 Cxcl1 -136 -127 0.874403 NFKAPPAB_01 Cxcl1 -668 -659 0.870083 NFKAPPAB_01 Cxcl1 -135 -126 0.937632 NFKAPPAB_01


21

Cxcl1 -667 -658 0.901728 NFKAPPAB_01 Cxcl1 -668 -659 0.966371 NFKAPPAB_01 Cxcl1 -136 -127 1.00728 NFKAPPAB_01 Cxcl1 -677 -668 0.895217 NFKAPPAB65_01 Cxcl1 -135 -126 0.919424 NFKAPPAB65_01 Cxcl1 -667 -658 0.887961 NFKAPPAB65_01 Cxcl1 -668 -659 0.921697 NFKAPPAB65_01 Cxcl1 -136 -127 1.00695 NFKAPPAB65_01 Cxcl1 -154 -145 0.84229 NFKAPPAB65_01 Cxcl1 -755 -746 0.928137 NFKAPPAB65_01 Cxcl1 -136 -125 0.844703 NFKB_C Cxcl1 -669 -658 0.849447 NFKB_C Cxcl1 -137 -126 0.921526 NFKB_C Cxcl1 -137 -126 0.812803 NFKB_C Cxcl1 -669 -658 0.85496 NFKB_C Cxcl1 -668 -657 0.825046 NFKB_C Cxcl1 -136 -125 0.812062 NFKB_C Cxcl1 -756 -745 0.857001 NFKB_C Cxcl1 -668 -657 0.821797 NFKB_C Cxcl1 -138 -125 0.888645 NFKB_Q6 Cxcl1 -137 -124 0.863827 NFKB_Q6 Cxcl1 -138 -125 0.880212 NFKB_Q6 Cxcl1 -757 -744 0.920017 NFKB_Q6 Cxcl1 -670 -657 0.893329 NFKB_Q6 Cxcl1 -670 -657 0.921232 NFKB_Q6 Cxcl1 -669 -656 0.926145 NFKB_Q6 Cxcl1 -756 -741 0.858665 NFKB_Q6_01 Cxcl1 -141 -126 0.836203 NFKB_Q6_01 Cxcl1 -140 -125 0.868934 NFKB_Q6_01 Cxcl1 -673 -658 0.853059 NFKB_Q6_01 Cxcl1 -137 -122 0.966921 NFKB_Q6_01 Cxcl1 -669 -654 0.887391 NFKB_Q6_01 Cxcl1 -159 -144 0.846266 NFKB_Q6_01 Cxcl1 -672 -657 0.874754 NFKB_Q6_01 Cxcl2 -471 -461 0.896531 ATF1_Q6 Cxcl2 -477 -464 0.928821 CEBP_Q2 Cxcl2 -660 -647 0.933001 CEBPB_01 Cxcl2 -471 -461 0.927506 CREB_Q4 Cxcl2 -470 -459 0.902591 CREBP1_Q2 Cxcl2 -97 -88 0.874403 NFKAPPAB_01 Cxcl2 -96 -87 0.937632 NFKAPPAB_01 Cxcl2 -97 -88 0.97115 NFKAPPAB_01 Cxcl2 -78 -69 0.853874 NFKAPPAB_01 Cxcl2 -695 -686 0.90017 NFKAPPAB65_01 Cxcl2 -96 -87 0.919424 NFKAPPAB65_01 Cxcl2 -97 -88 0.972473 NFKAPPAB65_01 Cxcl2 -78 -69 0.858665 NFKAPPAB65_01 Cxcl2 -694 -685 0.847988 NFKAPPAB65_01


22

Cxcl2 -97 -86 0.844703 NFKB_C Cxcl2 -98 -87 0.908527 NFKB_C Cxcl2 -79 -68 0.83445 NFKB_C Cxcl2 -99 -86 0.86153 NFKB_Q6 Cxcl2 -99 -86 0.888126 NFKB_Q6 Cxcl2 -98 -83 0.918571 NFKB_Q6_01 Cxcl2 -101 -86 0.830255 NFKB_Q6_01 Cxcl2 -79 -64 0.841313 NFKB_Q6_01 Cxcl3 -79 -64 0.876918 NFKB_Q6_01 Cxcl3 -78 -63 0.867208 NFKB_Q6_01 Cxcl3 -74 -59 0.841636 NFKB_Q6_01 Cxcl3 -75 -60 0.931145 NFKB_Q6_01 Cxcl3 -76 -63 0.960641 NFKB_Q6 Cxcl3 -75 -62 0.905699 NFKB_Q6 Cxcl3 -76 -63 0.875659 NFKB_Q6 Cxcl3 -75 -64 0.922211 NFKB_C Cxcl3 -74 -63 0.807014 NFKB_C Cxcl3 -74 -63 0.858628 NFKB_C Cxcl3 -75 -64 0.801053 NFKB_C Cxcl3 -74 -65 0.976008 NFKAPPAB65_01 Cxcl3 -73 -64 0.9233 NFKAPPAB65_01 Cxcl3 -74 -65 0.974855 NFKAPPAB_01 Cxcl3 -73 -64 0.941694 NFKAPPAB_01 Cxcl3 -74 -65 0.874135 NFKAPPAB_01 Cxcl3 -818 -805 0.844753 ATF3_Q6 Cxcl3 -135 -124 0.897823 CEBP_Q2_01 D16Ertd472e -45 -32 0.864883 ATF3_Q6 D16Ertd472e -699 -686 0.952215 CEBP_Q2 D16Ertd472e -699 -686 0.955008 CEBPA_01 D16Ertd472e -654 -641 0.91007 CEBPB_01 D16Ertd472e -763 -754 0.848459 NFKAPPAB65_01 Daxx -663 -653 0.99958 ATF1_Q6 Daxx -666 -656 0.881734 ATF1_Q6 Daxx -246 -233 0.911764 CEBPB_01 Daxx -192 -181 0.917096 CREB_Q2 Daxx -90 -85 1.05621 CREB_Q3 Daxx -192 -181 0.893543 CREB_Q4 Daxx -663 -653 0.926415 CREB_Q4 Daxx -694 -687 0.9073 CREBP1CJUN_01 Daxx -888 -879 0.855706 NFKAPPAB65_01 Ddx3y -118 -108 0.87725 ATF1_Q6 Ddx3y -93 -80 0.94355 CEBP_Q2 Ddx3y -101 -88 0.946034 CEBP_Q2 Ddx3y -189 -178 0.925332 CEBP_Q2 Ddx3y -93 -82 0.947156 CEBP_Q2 Ddx3y -93 -80 0.950521 CEBPA_01 Ddx3y -191 -178 0.945354 CEBPA_01 Ddx3y -93 -80 0.912579 CEBPB_01


23

Ddx3y -93 -80 0.932971 CEBPB_02 Ddx3y -90 -83 0.940086 CREB_01 Ddx3y -94 -83 1.01301 CREB_02 Ddx3y -92 -81 0.927306 CREB_Q2 Ddx3y -79 -74 1.05755 CREB_Q3 Ddx3y -91 -86 1.07456 CREB_Q3 Ddx3y -92 -81 0.915014 CREB_Q4 Ddx3y -93 -83 0.970381 CREB_Q4 Ddx3y -92 -81 0.883049 CREBP1_Q2 Ddx3y -199 -190 0.86673 NFKAPPAB_01 Ddx3y -200 -189 0.812354 NFKB_C Ddx3y -247 -234 0.838632 NFKB_Q6 Dgka -48 -38 0.874416 ATF1_Q6 Dgka -713 -702 0.965298 CEBP_Q2 Dgka -715 -702 0.934712 CEBPA_01 Dgka -715 -702 0.922211 CEBPB_01 Dgka -48 -41 0.927799 CREB_01 Dgka -45 -40 1.06622 CREB_Q3 Dgka -835 -826 0.902867 NFKAPPAB_01 Dgka -835 -826 0.861363 NFKAPPAB65_01 Dirc2 -249 -236 0.860148 ATF3_Q6 Dirc2 -220 -209 0.93864 CEBP_Q2 Dirc2 -220 -207 0.928313 CEBPB_01 Dirc2 -220 -210 0.944975 CREB_Q4 Dirc2 -246 -236 0.915343 CREB_Q4 Dirc2 -219 -208 0.878324 CREBP1_Q2 Dirc2 -92 -83 0.948708 NFKAPPAB_01 Dirc2 -92 -83 0.91864 NFKAPPAB65_01 Dirc2 -115 -104 0.807389 NFKB_C Dirc2 -105 -90 0.831528 NFKB_Q6_01 Edn1 -702 -689 0.918274 CEBPB_01 Edn1 -483 -472 0.905998 CREB_Q2 Edn1 -483 -472 0.921045 CREB_Q4 Edn1 -333 -324 0.874272 NFKAPPAB_01 Edn1 -884 -875 0.847694 NFKAPPAB65_01 Edn1 -16 -7 0.866112 NFKAPPAB65_01 Edn1 -334 -323 0.826773 NFKB_C Edn1 -335 -324 0.802343 NFKB_C Edn1 -335 -322 0.903081 NFKB_Q6 Edn1 -336 -323 0.842276 NFKB_Q6 Ehd1 -820 -807 0.941372 CEBPB_02 Ehd1 -683 -676 0.923661 CREB_01 Ehd1 -683 -676 0.964556 CREB_01 Ehd1 -690 -679 0.920811 CREB_Q2 Ehd1 -690 -679 0.921379 CREB_Q4 Ehd1 -686 -676 0.928253 CREB_Q4 Ehd1 -685 -674 0.918352 CREBP1_Q2 Ehd1 -690 -679 0.893564 CREBP1_Q2


24

Ehd1 -685 -674 0.902597 CREBP1_Q2 Ehd1 -683 -676 0.926013 CREBP1CJUN_01 Ehd1 -683 -676 0.992758 CREBP1CJUN_01 Ehd1 -787 -778 0.888041 NFKAPPAB_01 Ehd1 -786 -777 0.856649 NFKAPPAB65_01 Ehd1 -162 -153 0.854182 NFKAPPAB65_01 Ehd1 -787 -778 0.895708 NFKAPPAB65_01 Ehd1 -494 -485 0.841902 NFKAPPAB65_01 Ehd1 -788 -777 0.829798 NFKB_C Ehd1 -701 -690 0.830819 NFKB_C Ehd1 -789 -776 0.862849 NFKB_Q6 Ehd1 -788 -773 0.867809 NFKB_Q6_01 Ehd2 -403 -390 0.89549 ATF3_Q6 Ehd2 -607 -594 0.90932 CEBPB_01 Ehd2 -595 -582 0.936453 CEBPB_01 Ehd2 -819 -810 0.838216 NFKAPPAB65_01 Eif2c3 -172 -162 0.894379 ATF1_Q6 Eif2c3 -964 -951 0.917402 CEBPB_01 Eif2c3 -174 -163 0.894091 CREB_Q2 Eif2c3 -94 -83 0.892778 CREB_Q2 Eif2c3 -75 -64 0.892517 CREB_Q2 Eif2c3 -174 -163 0.923664 CREB_Q4 Eif2c3 -344 -333 0.893898 CREB_Q4 Eif2c3 -175 -165 0.92724 CREB_Q4 Eif2c3 -174 -163 0.893619 CREBP1_Q2 Eif2c3 -75 -64 0.897379 CREBP1_Q2 Eif2c3 -590 -581 0.922465 NFKAPPAB_01 Eif2c3 -350 -341 0.854094 NFKAPPAB_01 Eif2c3 -590 -581 0.875362 NFKAPPAB65_01 Eif2c3 -591 -580 0.877867 NFKB_C Eif2c3 -351 -340 0.810812 NFKB_C Eif2c3 -592 -579 0.844671 NFKB_Q6 Eif2c3 -592 -579 0.838303 NFKB_Q6 Eif2c3 -351 -336 0.889293 NFKB_Q6_01 Eif2c3 -595 -580 0.86382 NFKB_Q6_01 Etf1 -40 -30 0.869411 ATF1_Q6 Etf1 -813 -803 0.882491 ATF1_Q6 Etf1 -560 -547 0.933831 CEBP_Q2 Etf1 -423 -410 0.996382 CEBP_Q2 Etf1 -421 -410 0.978698 CEBP_Q2 Etf1 -423 -410 0.936414 CEBPA_01 Etf1 -725 -712 0.94855 CEBPB_01 Etf1 -37 -26 0.920372 CREB_02 Etf1 -65 -56 0.917677 NFKAPPAB_01 Etf1 -65 -56 0.876447 NFKAPPAB_01 Etf1 -640 -631 0.855984 NFKAPPAB_01 Etf1 -641 -632 0.849545 NFKAPPAB_01 Etf1 -65 -56 0.86465 NFKAPPAB65_01


25

Etf1 -640 -631 0.885927 NFKAPPAB65_01 Etf1 -66 -55 0.887405 NFKB_C Etf1 -67 -54 0.857888 NFKB_Q6 Etf1 -532 -519 0.860496 NFKB_Q6 Etf1 -70 -55 0.898581 NFKB_Q6_01 Etf1 -645 -630 0.885921 NFKB_Q6_01 F10 -769 -756 0.897703 ATF3_Q6 F10 -635 -624 0.960141 CEBP_Q2 F10 -637 -624 0.972365 CEBPA_01 F10 -855 -842 0.922077 CEBPB_01 F10 -637 -624 0.941214 CEBPB_01 F10 -768 -757 0.894994 CREB_Q4 F10 -685 -675 0.927657 CREB_Q4 F10 -766 -759 0.908036 CREBP1CJUN_01 F10 -809 -800 0.85634 NFKAPPAB_01 F10 -809 -800 0.850965 NFKAPPAB_01 F10 -62 -53 0.884425 NFKAPPAB65_01 F10 -63 -52 0.804383 NFKB_C F10 -64 -51 0.882394 NFKB_Q6 Fcgr4 -502 -489 0.92127 CEBPB_01 Fcgr4 -943 -936 0.908671 CREBP1CJUN_01 Fcgr4 -976 -967 0.849087 NFKAPPAB65_01 Flvcr2 -164 -154 0.874267 ATF1_Q6 Flvcr2 -161 -151 0.909266 ATF1_Q6 Flvcr2 -521 -508 0.866674 ATF3_Q6 Flvcr2 -164 -151 0.87675 ATF3_Q6 Flvcr2 -257 -244 0.935025 CEBP_Q2 Flvcr2 -605 -594 0.944368 CEBP_Q2 Flvcr2 -257 -244 0.928905 CEBPA_01 Flvcr2 -861 -848 0.94232 CEBPB_01 Flvcr2 -165 -154 0.93451 CREB_02 Flvcr2 -665 -660 1.05621 CREB_Q3 Flvcr2 -163 -152 0.903278 CREB_Q4 Flvcr2 -164 -154 0.938454 CREB_Q4 Flvcr2 -163 -152 0.892756 CREBP1_Q2 Flvcr2 -535 -526 0.899684 NFKAPPAB65_01 Flvcr2 -181 -172 0.845292 NFKAPPAB65_01 Fos -140 -130 0.902196 ATF1_Q6 Fos -909 -898 0.935302 CEBP_Q2 Fos -140 -133 0.948028 CREB_01 Fos -77 -70 1.01179 CREB_01 Fos -81 -70 0.923296 CREB_02 Fos -79 -68 0.924836 CREB_Q2 Fos -308 -297 0.899903 CREB_Q2 Fos -78 -73 1.07404 CREB_Q3 Fos -79 -68 0.938514 CREB_Q4 Fos -80 -70 0.963211 CREB_Q4 Fos -79 -68 0.944108 CREBP1_Q2


26

Fos -308 -297 0.88782 CREBP1_Q2 Fos -140 -133 0.91303 CREBP1CJUN_01 Fos -879 -868 0.839717 NFKB_C Fos -76 -61 0.864316 NFKB_Q6_01 Fpr1 -546 -533 0.846142 NFKB_Q6 Fpr1 -520 -507 0.861213 ATF3_Q6 Fpr1 -898 -885 0.95643 CEBPB_01 Fzd1 -523 -513 0.91425 ATF1_Q6 Fzd1 -158 -147 0.951986 CEBP_Q2 Fzd1 -158 -145 0.911061 CEBPB_02 Fzd1 -533 -524 0.848813 NFKAPPAB65_01 Gadd45b -57 -47 0.869389 ATF1_Q6 Gadd45b -561 -550 0.953909 CEBP_Q2 Gadd45b -563 -550 0.927135 CEBPA_01 Gadd45b -563 -550 0.9357 CEBPB_01 Gadd45b -535 -528 0.94475 CREBP1CJUN_01 Gadd45b -434 -425 0.885579 NFKAPPAB_01 Gadd45b -364 -355 0.935801 NFKAPPAB65_01 Gadd45b -435 -424 0.942507 NFKB_C Gadd45b -436 -423 0.929321 NFKB_Q6 Gadd45b -370 -355 0.84174 NFKB_Q6_01 Gadd45b -369 -354 0.853357 NFKB_Q6_01 Gadd45b -435 -420 0.867652 NFKB_Q6_01 Gas7 -746 -735 0.938722 CEBP_Q2 Gas7 -391 -380 0.893022 CREBP1_Q2 Gas7 -329 -320 0.860486 NFKAPPAB65_01 Ggnbp2 -994 -984 0.9027 ATF1_Q6 Ggnbp2 -176 -163 0.937446 CEBP_Q2 Ggnbp2 -176 -163 0.931046 CEBP_Q2 Ggnbp2 -174 -163 0.937759 CEBP_Q2 Ggnbp2 -176 -165 0.94371 CEBP_Q2 Ggnbp2 -176 -163 0.92591 CEBPA_01 Ggnbp2 -176 -163 1.01369 CEBPB_01 Ggnbp2 -176 -163 0.948434 CEBPB_02 Ggnbp2 -314 -309 1.08082 CREB_Q3 Ggnbp2 -201 -192 0.870175 NFKAPPAB_01 Ggnbp2 -246 -237 0.860908 NFKAPPAB65_01 Ggnbp2 -201 -192 0.891741 NFKAPPAB65_01 Ggnbp2 -357 -348 0.907885 NFKAPPAB65_01 Ggnbp2 -203 -190 0.84719 NFKB_Q6 Ggnbp2 -358 -343 0.835795 NFKB_Q6_01 Ggnbp2 -201 -186 0.830394 NFKB_Q6_01 Ggnbp2 -202 -187 0.863735 NFKB_Q6_01 Gpr109a -784 -771 0.886419 ATF3_Q6 Gpr109a -141 -128 0.929933 CEBP_Q2 Gpr109a -235 -222 0.93107 CEBPA_01 Gpr109a -213 -200 0.928782 CEBPB_01 Gpr109a -783 -772 0.891147 CREBP1_Q2


27

Gpr109a -95 -86 0.875754 NFKAPPAB65_01 Gpr109a -329 -318 0.816858 NFKB_C Gpr109a -330 -317 0.862881 NFKB_Q6 Gpr109a -329 -314 0.847266 NFKB_Q6_01 Gramd1a -612 -601 0.929661 CEBP_Q2 Gramd1a -37 -26 0.988972 CREB_02 Gramd1a -35 -24 0.922225 CREB_Q2 Gramd1a -35 -24 0.916831 CREB_Q4 Gramd1a -566 -555 0.90668 CREB_Q4 Gramd1a -36 -26 0.934181 CREB_Q4 Gramd1a -658 -649 0.859202 NFKAPPAB_01 Gramd1a -735 -726 0.848885 NFKAPPAB_01 Gramd1a -616 -607 0.902058 NFKAPPAB_01 Gramd1a -634 -625 0.852845 NFKAPPAB_01 Gramd1a -658 -649 0.914213 NFKAPPAB_01 Gramd1a -657 -648 0.867662 NFKAPPAB65_01 Gramd1a -616 -607 0.857474 NFKAPPAB65_01 Gramd1a -658 -649 0.882474 NFKAPPAB65_01 Gramd1a -617 -606 0.867936 NFKB_C Gramd1a -659 -648 0.801658 NFKB_C Gramd1a -540 -529 0.829286 NFKB_C Gramd1a -635 -624 0.812442 NFKB_C Gramd1a -618 -605 0.864325 NFKB_Q6 Gramd1a -660 -647 0.846061 NFKB_Q6 Gramd1a -617 -602 0.897891 NFKB_Q6_01 Gramd1a -544 -529 0.839228 NFKB_Q6_01 Gramd1a -663 -648 0.853745 NFKB_Q6_01 H2-Eb1 -40 -29 0.93817 CEBP_Q2 H2-Eb1 -42 -29 0.911386 CEBPB_01 H2-Eb1 -912 -907 1.0917 CREB_Q3 H2-Eb1 -974 -965 0.861097 NFKAPPAB_01 H2-Eb1 -975 -966 0.853123 NFKAPPAB65_01 H2-T22 -62 -52 0.934224 ATF1_Q6 H2-T22 -130 -117 0.92325 CEBPA_01 H2-T22 -130 -117 0.94282 CEBPA_01 H2-T22 -66 -55 0.930708 CREB_02 H2-T22 -63 -58 1.08114 CREB_Q3 H2-T22 -928 -919 0.850288 NFKAPPAB_01 H2-T22 -253 -244 0.885579 NFKAPPAB_01 H2-T22 -588 -579 0.871516 NFKAPPAB65_01 H2-T22 -928 -919 0.841177 NFKAPPAB65_01 H2-T22 -254 -243 0.923102 NFKB_C H2-T22 -255 -242 0.906131 NFKB_Q6 H2-T22 -258 -243 0.875697 NFKB_Q6_01 Hspa1a -483 -473 0.882308 ATF1_Q6 Hspa1a -486 -473 0.976373 ATF3_Q6 Hspa1a -530 -517 0.851219 ATF3_Q6 Hspa1a -486 -473 0.895897 ATF3_Q6


28

Hspa1a -152 -139 0.930072 CEBPA_01 Hspa1a -483 -476 0.928466 CREB_01 Hspa1a -483 -476 0.95917 CREB_01 Hspa1a -483 -472 1.01175 CREB_02 Hspa1a -485 -474 0.979587 CREB_Q2 Hspa1a -480 -475 1.06637 CREB_Q3 Hspa1a -485 -474 1.0006 CREB_Q4 Hspa1a -483 -473 1.00866 CREB_Q4 Hspa1a -485 -474 0.906632 CREBP1_Q2 Hspa1a -483 -476 0.930695 CREBP1CJUN_01 Hspa1a -483 -476 0.987511 CREBP1CJUN_01 Hspa1a -368 -359 0.863229 NFKAPPAB_01 Hspa1a -134 -123 0.848312 NFKB_C Hspa1a -135 -122 0.878509 NFKB_Q6 Hspa1b -152 -139 0.930072 CEBPA_01 Hspa1b -615 -605 0.972148 CREB_Q4 Hspa1b -286 -275 0.909106 CREBP1_Q2 Hspa1b -134 -123 0.848312 NFKB_C Hspa1b -135 -122 0.878509 NFKB_Q6 Htra1 -295 -282 0.965158 CEBP_Q2 Htra1 -406 -399 0.931298 CREB_01 Htra1 -783 -776 0.924315 CREB_01 Htra1 -99 -88 0.928204 CREB_02 Htra1 -101 -90 0.992918 CREB_Q2 Htra1 -780 -775 1.0786 CREB_Q3 Htra1 -96 -91 1.07692 CREB_Q3 Htra1 -408 -397 0.928266 CREB_Q4 Htra1 -101 -90 0.974919 CREB_Q4 Htra1 -99 -89 0.965527 CREB_Q4 Htra1 -408 -397 0.920835 CREBP1_Q2 Htra1 -101 -90 0.924254 CREBP1_Q2 Htra1 -783 -776 0.950359 CREBP1CJUN_01 Htra1 -308 -299 0.867755 NFKAPPAB_01 Htra1 -309 -298 0.866188 NFKB_C Htra1 -310 -297 0.873966 NFKB_Q6 Htra1 -309 -294 0.884624 NFKB_Q6_01 Ier2 -52 -42 0.932589 ATF1_Q6 Ier2 -52 -39 0.908705 ATF3_Q6 Ier2 -52 -39 0.876482 ATF3_Q6 Ier2 -529 -518 0.937664 CEBP_Q2 Ier2 -529 -516 0.945646 CEBPA_01 Ier2 -49 -42 1.05717 CREB_01 Ier2 -49 -42 1.05717 CREB_01 Ier2 -49 -38 0.943297 CREB_02 Ier2 -53 -42 0.958583 CREB_02 Ier2 -51 -40 0.910124 CREB_Q2 Ier2 -51 -40 0.909221 CREB_Q2 Ier2 -46 -41 1.07712 CREB_Q3


29

Ier2 -50 -45 1.07712 CREB_Q3 Ier2 -51 -40 0.95173 CREB_Q4 Ier2 -51 -40 0.950817 CREB_Q4 Ier2 -52 -42 1.0117 CREB_Q4 Ier2 -49 -39 0.946629 CREB_Q4 Ier2 -51 -40 1.0129 CREBP1_Q2 Ier2 -51 -40 1.01212 CREBP1_Q2 Ier2 -49 -42 1.0557 CREBP1CJUN_01 Ier2 -49 -42 1.0557 CREBP1CJUN_01 Ier2 -313 -304 0.852062 NFKAPPAB_01 Ier2 -727 -718 0.862167 NFKAPPAB_01 Ier2 -294 -285 0.857609 NFKAPPAB_01 Ier2 -92 -83 0.93197 NFKAPPAB65_01 Ier2 -295 -286 0.92362 NFKAPPAB65_01 Ier2 -728 -719 0.853935 NFKAPPAB65_01 Ier2 -314 -303 0.827928 NFKB_C Ier2 -313 -302 0.802952 NFKB_C Ier2 -728 -717 0.830779 NFKB_C Ier2 -315 -302 0.840881 NFKB_Q6 Ier2 -314 -301 0.86515 NFKB_Q6 Ier2 -181 -168 0.884434 NFKB_Q6 Ier2 -729 -716 0.841988 NFKB_Q6 Ier2 -295 -280 0.846917 NFKB_Q6_01 Ier3 -483 -473 0.881265 ATF1_Q6 Ier3 -419 -408 0.936485 CEBP_Q2 Ier3 -419 -406 0.967137 CEBPA_01 Ier3 -419 -406 0.907803 CEBPB_01 Ier3 -682 -675 0.955857 CREB_01 Ier3 -686 -675 0.942791 CREB_02 Ier3 -558 -549 0.853526 NFKAPPAB_01 Ier3 -559 -550 0.856397 NFKAPPAB_01 Ier3 -37 -28 0.876424 NFKAPPAB_01 Ier3 -140 -131 0.864239 NFKAPPAB_01 Ier3 -93 -84 0.914762 NFKAPPAB65_01 Ier3 -713 -704 0.866692 NFKAPPAB65_01 Ier3 -559 -550 0.866362 NFKAPPAB65_01 Ier3 -37 -28 0.858669 NFKAPPAB65_01 Ier3 -803 -794 0.85323 NFKAPPAB65_01 Ier3 -139 -130 0.894012 NFKAPPAB65_01 Ier3 -140 -131 0.963499 NFKAPPAB65_01 Ier3 -559 -548 0.863314 NFKB_C Ier3 -560 -549 0.80235 NFKB_C Ier3 -804 -793 0.822243 NFKB_C Ier3 -141 -130 0.823069 NFKB_C Ier3 -142 -129 0.846025 NFKB_Q6 Ier3 -560 -547 0.889001 NFKB_Q6 Ier3 -94 -79 0.845897 NFKB_Q6_01 Ier3 -560 -545 0.868117 NFKB_Q6_01


30

Ier3 -141 -126 0.873143 NFKB_Q6_01 Ier3 -804 -789 0.83892 NFKB_Q6_01 Ifi47 -229 -216 0.856367 ATF3_Q6 Ifi47 -585 -572 0.903026 CEBPB_01 Ifi47 -292 -283 0.905437 NFKAPPAB_01 Ifi47 -292 -283 0.912439 NFKAPPAB65_01 Ifi47 -293 -282 0.830574 NFKB_C Ifi47 -297 -282 0.866619 NFKB_Q6_01 Ifih1 -125 -115 0.900406 ATF1_Q6 Ifih1 -851 -840 0.950983 CEBP_Q2 Ifih1 -91 -80 0.937995 CEBP_Q2 Ifih1 -851 -838 0.9262 CEBPA_01 Ifih1 -851 -838 0.936778 CEBPB_01 Ifih1 -91 -78 0.932188 CEBPB_01 Ifih1 -93 -86 0.92881 CREB_01 Ifih1 -93 -86 0.979145 CREB_01 Ifih1 -97 -86 0.914736 CREB_02 Ifih1 -95 -84 0.919811 CREB_Q2 Ifih1 -95 -84 0.941271 CREB_Q4 Ifih1 -96 -86 0.919364 CREB_Q4 Ifih1 -95 -84 0.896466 CREBP1_Q2 Ifih1 -93 -86 0.965281 CREBP1CJUN_01 Ifih1 -93 -86 1.06957 CREBP1CJUN_01 Ifih1 -11 -2 0.853391 NFKAPPAB_01 Ifih1 -12 -1 0.813405 NFKB_C Ifit2 -820 -810 0.916156 ATF1_Q6 Ifit2 -569 -558 0.948186 CEBP_Q2 Ifit2 -138 -125 0.905282 CEBPB_01 Ifit2 -569 -556 0.92818 CEBPB_01 Ifit2 -206 -197 0.883063 NFKAPPAB_01 Ifit2 -205 -196 0.864261 NFKAPPAB_01 Ifit2 -206 -197 0.921725 NFKAPPAB_01 Ifit2 -499 -490 0.838741 NFKAPPAB65_01 Ifit2 -206 -197 0.84787 NFKAPPAB65_01 Ifit2 -207 -196 0.922061 NFKB_C Ifit2 -206 -195 0.864865 NFKB_C Ifit2 -208 -195 0.939247 NFKB_Q6 Ifit2 -211 -196 0.839911 NFKB_Q6_01 Ifit2 -206 -191 0.8324 NFKB_Q6_01 Ift57 -162 -152 0.92715 ATF1_Q6 Ift57 -165 -155 0.905629 ATF1_Q6 Ift57 -165 -152 1.00272 ATF3_Q6 Ift57 -165 -152 0.920525 ATF3_Q6 Ift57 -536 -525 0.922467 CEBP_Q2 Ift57 -536 -523 0.953094 CEBPB_01 Ift57 -157 -150 0.919692 CREB_01 Ift57 -162 -155 1.055 CREB_01 Ift57 -162 -155 1.055 CREB_01


31

Ift57 -166 -155 1.00227 CREB_02 Ift57 -162 -151 0.986347 CREB_02 Ift57 -159 -148 0.91854 CREB_Q2 Ift57 -164 -153 1.05048 CREB_Q2 Ift57 -164 -153 1.06213 CREB_Q2 Ift57 -159 -154 1.07712 CREB_Q3 Ift57 -163 -158 1.07712 CREB_Q3 Ift57 -169 -158 0.89768 CREB_Q4 Ift57 -159 -148 0.928575 CREB_Q4 Ift57 -164 -153 1.08601 CREB_Q4 Ift57 -164 -153 1.09779 CREB_Q4 Ift57 -160 -150 0.949432 CREB_Q4 Ift57 -162 -152 1.06923 CREB_Q4 Ift57 -165 -155 1.01417 CREB_Q4 Ift57 -159 -148 0.918444 CREBP1_Q2 Ift57 -164 -153 1.05245 CREBP1_Q2 Ift57 -164 -153 1.06259 CREBP1_Q2 Ift57 -162 -155 1.05358 CREBP1CJUN_01 Ift57 -162 -155 1.05358 CREBP1CJUN_01 Ift57 -268 -257 0.804952 NFKB_C Ift57 -507 -494 0.851116 NFKB_Q6 Ift57 -269 -256 0.86839 NFKB_Q6 Il10 -457 -447 0.934356 ATF1_Q6 Il10 -396 -385 0.925702 CEBP_Q2 Il10 -398 -385 0.928622 CEBPB_01 Il10 -354 -349 1.08114 CREB_Q3 Il10 -860 -851 0.870914 NFKAPPAB_01 Il10 -488 -479 0.872636 NFKAPPAB_01 Il10 -489 -480 0.950333 NFKAPPAB65_01 Il10 -861 -850 0.841256 NFKB_C Il10 -459 -448 0.809654 NFKB_C Il10 -865 -850 0.856859 NFKB_Q6_01 Il10ra -877 -864 0.932745 CEBP_Q2 Il10ra -877 -866 0.923113 CEBP_Q2 Il10ra -272 -259 0.930745 CEBPA_01 Il10ra -35 -28 0.915899 CREBP1CJUN_01 Il10ra -381 -372 0.855194 NFKAPPAB_01 Il10ra -380 -371 0.85885 NFKAPPAB_01 Il10ra -381 -372 0.960199 NFKAPPAB_01 Il10ra -92 -83 0.855169 NFKAPPAB65_01 Il10ra -381 -372 0.897346 NFKAPPAB65_01 Il10ra -382 -371 0.90299 NFKB_C Il10ra -92 -81 0.807512 NFKB_C Il10ra -383 -370 0.898237 NFKB_Q6 Il10ra -383 -370 0.95551 NFKB_Q6 Il10ra -93 -80 0.891988 NFKB_Q6 Il10ra -382 -367 0.880057 NFKB_Q6_01 Il33 -636 -623 0.926783 CEBP_Q2


32

Il33 -634 -623 0.943787 CEBP_Q2 Il33 -636 -623 0.930166 CEBPA_01 Il33 -924 -911 0.927132 CEBPB_01 Il33 -636 -623 0.919859 CEBPB_02 Il33 -499 -494 1.09754 CREB_Q3 Il33 -928 -917 0.817207 NFKB_C Il6 -185 -175 0.845146 ATF3_Q6 Il6 -178 -165 0.946118 CEBP_Q2 Il6 -178 -167 0.979058 CEBP_Q2 Il6 -178 -165 0.945206 CEBPA_01 Il6 -178 -165 0.962882 CEBPB_01 Il6 -178 -165 0.929221 CEBPB_02 Il6 -185 -178 0.967598 CREB_01 Il6 -185 -178 1.05032 CREB_01 Il6 -187 -176 0.96471 CREB_Q2 Il6 -182 -177 1.07712 CREB_Q3 Il6 -187 -176 0.997939 CREB_Q4 Il6 -188 -178 0.91586 CREB_Q4 Il6 -185 -175 1.00765 CREB_Q4 Il6 -187 -176 0.90484 CREBP1_Q2 Il6 -185 -178 0.994398 CREBP1CJUN_01 Il6 -185 -178 0.987995 CREBP1CJUN_01 Il6 -91 -82 0.928149 NFKAPPAB_01 Il6 -91 -82 0.927 NFKAPPAB65_01 Il6 -92 -81 0.897469 NFKB_C Il6 -93 -80 0.883128 NFKB_Q6 Il6 -92 -77 0.919187 NFKB_Q6_01 Irak3 -525 -512 0.863121 ATF3_Q6 Irak3 -32 -21 0.925787 CEBP_Q2 Irak3 -588 -577 0.932443 CEBP_Q2 Irak3 -32 -19 0.946199 CEBPB_01 Irak3 -622 -609 0.933545 CEBPB_01 Irak3 -32 -19 0.912999 CEBPB_02 Irak3 -61 -54 1.00962 CREB_01 Irak3 -61 -50 0.941107 CREB_02 Irak3 -63 -52 1.03511 CREB_Q2 Irak3 -58 -53 1.07404 CREB_Q3 Irak3 -63 -52 1.03149 CREB_Q4 Irak3 -61 -51 1.01227 CREB_Q4 Irak3 -63 -52 0.982801 CREBP1_Q2 Irak3 -258 -249 0.841161 NFKAPPAB65_01 Irak3 -259 -244 0.864078 NFKB_Q6_01 Isg20 -76 -66 0.933364 ATF1_Q6 Isg20 -67 -54 0.866522 ATF3_Q6 Isg20 -76 -63 0.861644 ATF3_Q6 Isg20 -94 -83 0.954729 CEBP_Q2 Isg20 -94 -81 0.945166 CEBPB_01 Isg20 -64 -57 0.933378 CREB_01


33

Isg20 -64 -53 1.00933 CREB_02 Isg20 -61 -56 1.08114 CREB_Q3 Isg20 -64 -54 0.937668 CREB_Q4 Isg20 -162 -153 0.875071 NFKAPPAB_01 Isg20 -162 -153 0.844064 NFKAPPAB65_01 Isg20 -163 -152 0.833171 NFKB_C Isg20 -164 -151 0.896617 NFKB_Q6 Jarid2 -12 -2 0.917561 ATF1_Q6 Jarid2 -15 -2 0.86943 ATF3_Q6 Jarid2 -678 -665 0.946998 CEBPB_01 Jarid2 -345 -336 0.893336 NFKAPPAB_01 Jarid2 -934 -925 0.904573 NFKAPPAB_01 Jarid2 -345 -336 0.85912 NFKAPPAB65_01 Jarid2 -346 -335 0.819282 NFKB_C Jarid2 -346 -333 0.852305 NFKB_Q6 Jarid2 -935 -920 0.855546 NFKB_Q6_01 Jarid2 -315 -300 0.849099 NFKB_Q6_01 Jarid2 -345 -330 0.84221 NFKB_Q6_01 Jarid2 -517 -502 0.83119 NFKB_Q6_01 Jarid2 -350 -335 0.858572 NFKB_Q6_01 Junb -656 -643 0.866594 ATF3_Q6 Junb -656 -643 0.918983 ATF3_Q6 Junb -656 -643 0.951115 CEBPA_01 Junb -656 -643 0.917907 CEBPB_01 Junb -110 -99 0.912708 CREB_02 Junb -655 -644 0.888402 CREB_Q2 Junb -108 -97 0.908844 CREB_Q4 Junb -655 -644 0.893684 CREB_Q4 Junb -109 -99 0.941322 CREB_Q4 Junb -653 -643 0.929571 CREB_Q4 Junb -108 -97 0.880866 CREBP1_Q2 Junb -311 -302 0.908224 NFKAPPAB_01 Junb -931 -922 0.858483 NFKAPPAB_01 Junb -311 -302 0.893702 NFKAPPAB65_01 Junb -311 -300 0.83113 NFKB_C Junb -936 -921 0.878026 NFKB_Q6_01 Klf7 -364 -354 0.900843 ATF1_Q6 Klf7 -367 -354 0.850079 ATF3_Q6 Klf7 -49 -36 0.929244 CEBP_Q2 Klf7 -809 -798 0.917198 CREB_Q2 Klf7 -808 -803 1.05621 CREB_Q3 Klf7 -809 -798 0.952045 CREB_Q4 Klf7 -810 -800 0.925914 CREB_Q4 Klf7 -814 -803 0.875341 CREBP1_Q2 Klf7 -849 -840 0.858087 NFKAPPAB_01 Klf7 -848 -839 0.844377 NFKAPPAB65_01 Klf7 -849 -840 0.839074 NFKAPPAB65_01 Kmo -875 -865 0.86867 ATF1_Q6


34

Kmo -940 -927 0.925195 CEBPB_01 Kmo -244 -235 0.875667 NFKAPPAB_01 Kmo -244 -235 0.84489 NFKAPPAB65_01 Lck -898 -885 0.918779 CEBP_Q2 Lck -900 -887 0.925257 CEBPB_01 Lck -898 -885 0.940695 CEBPB_02 Lck -852 -845 0.915899 CREBP1CJUN_01 Lck -581 -572 0.902324 NFKAPPAB_01 Lck -582 -573 0.932233 NFKAPPAB65_01 Lck -581 -572 0.856901 NFKAPPAB65_01 Lck -581 -572 0.907038 NFKAPPAB65_01 Lck -582 -571 0.821837 NFKB_C Lck -583 -570 0.846167 NFKB_Q6 Lck -586 -571 0.854182 NFKB_Q6_01 Lck -582 -567 0.834894 NFKB_Q6_01 Lipg -883 -873 0.901502 ATF1_Q6 Lipg -672 -659 0.857733 ATF3_Q6 Lipg -883 -870 0.865127 ATF3_Q6 Lipg -233 -220 0.924913 CEBP_Q2 Lipg -233 -222 0.970808 CEBP_Q2 Lipg -233 -220 0.903586 CEBPB_01 Lipg -880 -873 0.942534 CREB_01 Lipg -911 -904 0.923824 CREB_01 Lipg -881 -876 1.08082 CREB_Q3 Lipg -912 -907 1.06637 CREB_Q3 Lipg -883 -873 0.935445 CREB_Q4 Lipg -880 -873 0.907677 CREBP1CJUN_01 Lipg -146 -137 0.854853 NFKAPPAB_01 Lipg -146 -137 0.898956 NFKAPPAB_01 Lipg -147 -136 0.90662 NFKB_C Lipg -148 -135 0.907637 NFKB_Q6 Lipg -296 -283 0.887522 NFKB_Q6 Lipg -151 -136 0.86045 NFKB_Q6_01 Ltf -51 -38 0.922214 ATF3_Q6 Ltf -51 -38 0.865643 ATF3_Q6 Ltf -78 -67 0.949371 CEBP_Q2 Ltf -78 -65 0.935873 CEBPA_01 Ltf -78 -65 0.907053 CEBPB_01 Ltf -51 -41 0.928447 CREB_Q4 Ltf -50 -39 0.894018 CREBP1_Q2 Ltf -375 -366 0.880962 NFKAPPAB_01 Ltf -375 -366 0.862999 NFKAPPAB65_01 Lztfl1 -119 -109 0.887331 ATF1_Q6 Lztfl1 -951 -938 0.949005 CEBP_Q2 Lztfl1 -136 -123 0.989827 CEBP_Q2 Lztfl1 -134 -123 0.942904 CEBP_Q2 Lztfl1 -136 -123 0.952281 CEBPA_01 Lztfl1 -136 -123 1.03816 CEBPB_02


35

Lztfl1 -123 -112 0.907384 CREB_Q2 Lztfl1 -123 -112 0.884582 CREBP1_Q2 Lztfl1 -592 -585 0.918087 CREBP1CJUN_01 Lztfl1 -179 -170 0.886566 NFKAPPAB_01 Lztfl1 -179 -170 0.845755 NFKAPPAB65_01 Lztfl1 -180 -171 0.84965 NFKAPPAB65_01 Lztfl1 -180 -169 0.835605 NFKB_C Lztfl1 -181 -168 0.845731 NFKB_Q6 Med21 -134 -124 0.928159 ATF1_Q6 Med21 -131 -121 0.872682 ATF1_Q6 Med21 -134 -121 0.92098 ATF3_Q6 Med21 -134 -121 0.930849 ATF3_Q6 Med21 -39 -26 0.847873 ATF3_Q6 Med21 -27 -14 0.961708 CEBPA_01 Med21 -27 -14 0.93624 CEBPA_01 Med21 -781 -768 0.916557 CEBPB_01 Med21 -131 -124 1.04243 CREB_01 Med21 -131 -124 1.0424 CREB_01 Med21 -135 -124 0.939353 CREB_02 Med21 -131 -120 0.955917 CREB_02 Med21 -133 -122 0.958192 CREB_Q2 Med21 -133 -122 0.976994 CREB_Q2 Med21 -263 -258 1.05755 CREB_Q3 Med21 -128 -123 1.06252 CREB_Q3 Med21 -132 -127 1.06252 CREB_Q3 Med21 -33 -28 1.06831 CREB_Q3 Med21 -133 -122 0.99802 CREB_Q4 Med21 -133 -122 0.990414 CREB_Q4 Med21 -134 -124 0.997623 CREB_Q4 Med21 -131 -121 0.987253 CREB_Q4 Med21 -133 -122 0.9618 CREBP1_Q2 Med21 -133 -122 0.954419 CREBP1_Q2 Med21 -131 -124 1.04134 CREBP1CJUN_01 Med21 -131 -124 1.04131 CREBP1CJUN_01 Med21 -817 -808 0.85131 NFKAPPAB_01 Mex3c -222 -212 0.89634 ATF1_Q6 Mex3c -874 -864 0.881189 ATF1_Q6 Mex3c -869 -856 0.947743 CEBP_Q2 Mex3c -994 -987 1.00007 CREB_01 Mex3c -871 -860 0.930299 CREB_02 Mex3c -996 -985 0.973694 CREB_Q2 Mex3c -991 -986 1.07404 CREB_Q3 Mex3c -868 -863 1.08692 CREB_Q3 Mex3c -996 -985 0.993931 CREB_Q4 Mex3c -994 -984 0.928398 CREB_Q4 Mex3c -996 -985 0.926065 CREBP1_Q2 Mex3c -700 -691 0.868011 NFKAPPAB_01 Mex3c -701 -690 0.823898 NFKB_C


36

Mex3c -705 -690 0.830115 NFKB_Q6_01 Mitd1 -574 -564 0.876755 ATF1_Q6 Mitd1 -84 -74 0.904942 ATF1_Q6 Mitd1 -81 -71 0.882123 ATF1_Q6 Mitd1 -84 -71 0.844614 ATF3_Q6 Mitd1 -84 -71 0.907748 ATF3_Q6 Mitd1 -222 -209 0.925897 CEBP_Q2 Mitd1 -420 -409 0.961676 CEBP_Q2 Mitd1 -222 -211 0.929019 CEBP_Q2 Mitd1 -222 -209 0.929819 CEBPA_01 Mitd1 -420 -407 0.929259 CEBPB_01 Mitd1 -222 -209 0.924295 CEBPB_02 Mitd1 -81 -74 0.923505 CREB_01 Mitd1 -549 -544 1.06455 CREB_Q3 Mitd1 -83 -72 0.884729 CREBP1_Q2 Mitd1 -637 -628 0.870461 NFKAPPAB_01 Mitd1 -152 -143 0.888887 NFKAPPAB_01 Mitd1 -638 -629 0.842432 NFKAPPAB65_01 Mitd1 -637 -628 0.84377 NFKAPPAB65_01 Mitd1 -582 -573 0.858329 NFKAPPAB65_01 Mitd1 -153 -142 0.853825 NFKB_C Mitd1 -154 -141 0.904522 NFKB_Q6 Mitd1 -583 -568 0.878295 NFKB_Q6_01 Mpa2l -390 -379 0.938724 CEBP_Q2 Mpa2l -390 -377 0.959992 CEBPB_01 Mpa2l -607 -594 0.911409 CEBPB_02 Mpa2l -838 -831 0.920646 CREB_01 Mpa2l -835 -830 1.09337 CREB_Q3 Mpa2l -838 -831 0.946784 CREBP1CJUN_01 Mpa2l -429 -420 0.874135 NFKAPPAB_01 Mpa2l -428 -419 0.941605 NFKAPPAB_01 Mpa2l -429 -420 0.971826 NFKAPPAB_01 Mpa2l -428 -419 0.923215 NFKAPPAB65_01 Mpa2l -429 -420 0.973118 NFKAPPAB65_01 Mpa2l -384 -375 0.849349 NFKAPPAB65_01 Mpa2l -430 -419 0.8222 NFKB_C Mpa2l -429 -418 0.804457 NFKB_C Mpa2l -429 -418 0.858057 NFKB_C Mpa2l -430 -419 0.895751 NFKB_C Mpa2l -430 -417 0.90085 NFKB_Q6 Mpa2l -431 -418 0.908829 NFKB_Q6 Mpa2l -431 -418 0.847243 NFKB_Q6 Mpa2l -433 -418 0.837315 NFKB_Q6_01 Mpa2l -434 -419 0.843109 NFKB_Q6_01 Mpa2l -430 -415 0.915591 NFKB_Q6_01 Mt2 -557 -546 0.923879 CEBP_Q2 Mt2 -940 -929 0.936078 CEBP_Q2 Mt2 -15 -2 0.91486 CEBPB_01


37

Mt2 -839 -828 0.95723 CREB_02 Mt2 -829 -820 0.929211 NFKAPPAB_01 Mt2 -829 -820 0.921103 NFKAPPAB65_01 Mt2 -830 -819 0.837683 NFKB_C Mt2 -831 -818 0.846442 NFKB_Q6 Mt2 -830 -815 0.905091 NFKB_Q6_01 Mxd1 -470 -460 1.01742 ATF1_Q6 Mxd1 -473 -460 1.01585 ATF3_Q6 Mxd1 -473 -460 0.949262 ATF3_Q6 Mxd1 -394 -383 0.96581 CEBP_Q2 Mxd1 -841 -828 0.937285 CEBPB_01 Mxd1 -396 -383 0.928477 CEBPB_01 Mxd1 -470 -463 1.05565 CREB_01 Mxd1 -470 -463 1.0652 CREB_01 Mxd1 -470 -459 1.05407 CREB_02 Mxd1 -474 -463 0.954949 CREB_02 Mxd1 -472 -461 0.991268 CREB_Q2 Mxd1 -472 -461 0.996855 CREB_Q2 Mxd1 -471 -466 1.07712 CREB_Q3 Mxd1 -467 -462 1.0919 CREB_Q3 Mxd1 -472 -461 1.02247 CREB_Q4 Mxd1 -472 -461 1.03665 CREB_Q4 Mxd1 -473 -463 1.01006 CREB_Q4 Mxd1 -470 -460 1.11331 CREB_Q4 Mxd1 -472 -461 0.998258 CREBP1_Q2 Mxd1 -472 -461 0.955165 CREBP1_Q2 Mxd1 -872 -865 0.921132 CREBP1CJUN_01 Mxd1 -470 -463 1.05422 CREBP1CJUN_01 Mxd1 -470 -463 1.06353 CREBP1CJUN_01 Mxd1 -213 -204 0.851145 NFKAPPAB_01 Mxd1 -413 -404 0.858482 NFKAPPAB65_01 Mxd1 -214 -203 0.8542 NFKB_C Mxd1 -215 -202 0.890351 NFKB_Q6 Mxd1 -214 -199 0.881537 NFKB_Q6_01 Mycl1 -801 -791 0.89176 ATF1_Q6 Mycl1 -111 -98 0.852259 ATF3_Q6 Mycl1 -777 -766 0.942403 CEBP_Q2 Mycl1 -550 -537 0.856488 NFKB_Q6 Nck1 -22 -9 0.846785 ATF3_Q6 Nck1 -22 -9 0.877686 ATF3_Q6 Nck1 -806 -795 0.947372 CEBP_Q2 Nck1 -750 -739 0.947789 CEBP_Q2 Nck1 -27 -16 0.959816 CEBP_Q2 Nck1 -808 -795 0.945059 CEBPA_01 Nck1 -870 -857 0.941151 CEBPA_01 Nck1 -808 -795 0.962981 CEBPB_01 Nck1 -750 -737 0.929701 CEBPB_01 Nck1 -19 -12 0.913761 CREBP1CJUN_01


38

Nck1 -180 -171 0.865175 NFKAPPAB_01 Nck1 -113 -104 0.844678 NFKAPPAB65_01 Ndufa12 -454 -441 0.918219 CEBPB_01 Ndufa12 -685 -672 0.920761 CEBPB_02 Ndufa12 -291 -280 1.00339 CREB_02 Ndufa12 -67 -56 0.957578 CREB_02 Ndufa12 -288 -283 1.07456 CREB_Q3 Ndufa12 -291 -281 1.00617 CREB_Q4 Ndufa12 -695 -686 0.862974 NFKAPPAB_01 Ndufa12 -572 -563 0.855878 NFKAPPAB_01 Ndufa12 -135 -126 0.856951 NFKAPPAB_01 Nfkb2 -556 -546 0.875077 ATF1_Q6 Nfkb2 -170 -160 0.907145 ATF1_Q6 Nfkb2 -679 -666 0.920425 CEBPB_01 Nfkb2 -943 -932 0.919692 CREB_02 Nfkb2 -941 -930 0.917915 CREB_Q2 Nfkb2 -926 -921 1.08277 CREB_Q3 Nfkb2 -940 -935 1.05978 CREB_Q3 Nfkb2 -941 -930 0.909905 CREB_Q4 Nfkb2 -929 -919 0.91598 CREB_Q4 Nfkb2 -941 -930 0.882624 CREBP1_Q2 Nfkb2 -282 -273 0.86141 NFKAPPAB_01 Nfkb2 -891 -882 0.885764 NFKAPPAB_01 Nfkb2 -920 -911 1.01382 NFKAPPAB_01 Nfkb2 -920 -911 0.977183 NFKAPPAB_01 Nfkb2 -159 -150 0.935145 NFKAPPAB_01 Nfkb2 -919 -910 0.927065 NFKAPPAB_01 Nfkb2 -892 -883 0.935999 NFKAPPAB_01 Nfkb2 -281 -272 0.866782 NFKAPPAB65_01 Nfkb2 -921 -912 0.932233 NFKAPPAB65_01 Nfkb2 -920 -911 0.974847 NFKAPPAB65_01 Nfkb2 -920 -911 0.93989 NFKAPPAB65_01 Nfkb2 -159 -150 0.898588 NFKAPPAB65_01 Nfkb2 -919 -910 0.916451 NFKAPPAB65_01 Nfkb2 -892 -883 0.927579 NFKAPPAB65_01 Nfkb2 -893 -882 0.823 NFKB_C Nfkb2 -328 -317 0.802617 NFKB_C Nfkb2 -921 -910 0.915355 NFKB_C Nfkb2 -370 -359 0.820436 NFKB_C Nfkb2 -920 -909 0.819173 NFKB_C Nfkb2 -283 -272 0.81303 NFKB_C Nfkb2 -921 -910 0.923347 NFKB_C Nfkb2 -160 -149 0.866261 NFKB_C Nfkb2 -892 -881 0.816691 NFKB_C Nfkb2 -107 -96 0.819712 NFKB_C Nfkb2 -922 -909 0.908505 NFKB_Q6 Nfkb2 -371 -358 0.84675 NFKB_Q6 Nfkb2 -284 -271 0.875546 NFKB_Q6


39

Nfkb2 -922 -909 0.965579 NFKB_Q6 Nfkb2 -161 -148 0.901362 NFKB_Q6 Nfkb2 -370 -355 0.834653 NFKB_Q6_01 Nfkb2 -893 -878 0.898205 NFKB_Q6_01 Nfkb2 -921 -906 0.942793 NFKB_Q6_01 Nfkb2 -164 -149 0.836699 NFKB_Q6_01 Nfkb2 -286 -271 0.836176 NFKB_Q6_01 Nfkb2 -925 -910 0.994481 NFKB_Q6_01 Nfkb2 -924 -909 0.863314 NFKB_Q6_01 Nfkbib -282 -272 0.910657 ATF1_Q6 Nfkbib -279 -269 0.889278 ATF1_Q6 Nfkbib -282 -269 0.929984 ATF3_Q6 Nfkbib -282 -269 0.957086 ATF3_Q6 Nfkbib -536 -525 0.936672 CEBP_Q2 Nfkbib -538 -525 0.972454 CEBPB_01 Nfkbib -279 -272 0.933052 CREB_01 Nfkbib -939 -932 0.948971 CREB_01 Nfkbib -281 -270 0.91558 CREB_Q2 Nfkbib -281 -270 0.91235 CREB_Q2 Nfkbib -940 -935 1.06637 CREB_Q3 Nfkbib -281 -270 0.95801 CREB_Q4 Nfkbib -281 -270 0.931001 CREB_Q4 Nfkbib -282 -272 0.950753 CREB_Q4 Nfkbib -804 -793 0.90566 CREBP1_Q2 Nfkbib -281 -270 0.912339 CREBP1_Q2 Nfkbib -281 -270 0.91928 CREBP1_Q2 Nfkbib -939 -932 0.977574 CREBP1CJUN_01 Nfkbib -307 -296 0.80399 NFKB_C Nfkbib -307 -292 0.866165 NFKB_Q6_01 Nfkbiz -216 -206 0.874959 ATF1_Q6 Nfkbiz -405 -394 0.956845 CEBP_Q2 Nfkbiz -405 -392 0.96489 CEBPB_01 Nfkbiz -547 -540 0.919718 CREB_01 Nfkbiz -547 -536 0.931826 CREB_02 Nfkbiz -15 -6 0.871106 NFKAPPAB_01 Nfkbiz -53 -44 0.903115 NFKAPPAB_01 Nfkbiz -15 -6 0.971826 NFKAPPAB_01 Nfkbiz -52 -43 0.90577 NFKAPPAB65_01 Nfkbiz -53 -44 0.864094 NFKAPPAB65_01 Nfkbiz -15 -6 0.973118 NFKAPPAB65_01 Nfkbiz -556 -547 0.872952 NFKAPPAB65_01 Nfkbiz -14 -5 0.894012 NFKAPPAB65_01 Nfkbiz -54 -43 0.879989 NFKB_C Nfkbiz -16 -5 0.913894 NFKB_C Nfkbiz -55 -42 0.888881 NFKB_Q6 Nfkbiz -17 -4 0.873175 NFKB_Q6 Nfkbiz -16 -1 0.927312 NFKB_Q6_01 Nfkbiz -557 -542 0.888771 NFKB_Q6_01


40

Nfkbiz -20 -5 0.840363 NFKB_Q6_01 Nfkbiz -54 -39 0.873617 NFKB_Q6_01 Nod1 -462 -452 0.868798 ATF1_Q6 Nod1 -462 -449 0.922556 CEBP_Q2 Nod1 -460 -449 0.97003 CEBP_Q2 Nod1 -462 -449 0.917922 CEBPB_01 Nod1 -570 -557 0.915602 CEBPB_01 Nod1 -459 -452 0.942877 CREB_01 Nod1 -459 -452 0.960006 CREB_01 Nod1 -86 -75 0.821426 NFKB_C Nod1 -87 -74 0.855415 NFKB_Q6 Nt5c3 -209 -199 0.868232 ATF1_Q6 Nt5c3 -905 -894 0.948285 CEBP_Q2 Nt5c3 -439 -428 0.889965 CREB_Q2 Nt5c3 -439 -428 0.895537 CREB_Q4 Nt5c3 -194 -185 0.913256 NFKAPPAB_01 Nt5c3 -219 -210 0.894963 NFKAPPAB65_01 Nt5c3 -193 -184 0.876831 NFKAPPAB65_01 Nt5c3 -168 -159 0.854537 NFKAPPAB65_01 Nt5c3 -195 -184 0.842575 NFKB_C Nt5c3 -714 -703 0.83242 NFKB_C Nt5c3 -715 -702 0.849391 NFKB_Q6 Nt5c3 -199 -184 0.886004 NFKB_Q6_01 Nupr1 -113 -100 0.921012 CEBP_Q2 Nupr1 -111 -100 0.923555 CEBP_Q2 Nupr1 -113 -100 0.927744 CEBPB_01 Nupr1 -830 -823 0.925344 CREB_01 Nupr1 -831 -826 1.06637 CREB_Q3 Nupr1 -832 -821 0.880813 CREBP1_Q2 Nupr1 -577 -568 0.864012 NFKAPPAB_01 Nupr1 -578 -567 0.879215 NFKB_C Nupr1 -579 -566 0.856217 NFKB_Q6 Parp11 -551 -541 0.875908 ATF1_Q6 Parp11 -76 -63 0.893732 ATF3_Q6 Parp11 -626 -615 0.94236 CEBP_Q2 Parp11 -492 -479 0.925574 CEBPA_01 Parp11 -259 -248 0.91392 CREB_02 Parp11 -176 -167 0.885638 NFKAPPAB65_01 Parp11 -175 -166 0.868332 NFKAPPAB65_01 Parp11 -177 -166 0.805591 NFKB_C Parp11 -178 -165 0.843832 NFKB_Q6 Parp11 -177 -164 0.854376 NFKB_Q6 Parp11 -180 -165 0.865938 NFKB_Q6_01 Plod2 -192 -179 0.87024 ATF3_Q6 Plod2 -706 -695 0.926614 CEBP_Q2 Plod2 -289 -280 0.871975 NFKAPPAB_01 Plod2 -288 -279 0.839461 NFKAPPAB65_01 Pols -18 -8 0.986747 ATF1_Q6


41

Pols -15 -5 0.930628 ATF1_Q6 Pols -15 -5 0.867301 ATF1_Q6 Pols -21 -8 0.884484 ATF3_Q6 Pols -21 -8 0.949568 ATF3_Q6 Pols -40 -27 0.920331 CEBP_Q2 Pols -38 -27 0.950372 CEBP_Q2 Pols -40 -27 0.951617 CEBPB_01 Pols -40 -27 0.955658 CEBPB_02 Pols -15 -4 0.916347 CREB_02 Pols -377 -366 0.917665 CREB_02 Pols -20 -9 0.913375 CREB_Q2 Pols -20 -9 0.943663 CREB_Q4 Pols -18 -8 0.957415 CREB_Q4 Pols -15 -5 0.974314 CREB_Q4 Pols -21 -11 0.949133 CREB_Q4 Pols -836 -827 0.877252 NFKAPPAB_01 Pols -836 -827 0.878426 NFKAPPAB65_01 Pols -838 -827 0.82262 NFKB_C Pols -694 -679 0.831192 NFKB_Q6_01 Pols -841 -826 0.852901 NFKB_Q6_01 Prox1 -964 -953 0.945317 CEBP_Q2 Prox1 -86 -79 0.962411 CREB_01 Prox1 -88 -77 0.911063 CREB_Q2 Prox1 -70 -65 1.06637 CREB_Q3 Prox1 -83 -78 1.05944 CREB_Q3 Prox1 -88 -77 0.923345 CREB_Q4 Prox1 -86 -76 0.948434 CREB_Q4 Prox1 -88 -77 0.928833 CREBP1_Q2 Prox1 -783 -774 0.860192 NFKAPPAB_01 Prox1 -783 -774 0.841744 NFKAPPAB65_01 Prox1 -787 -772 0.842985 NFKB_Q6_01 Ptgir -808 -798 0.958949 ATF1_Q6 Ptgir -559 -548 0.921251 CEBP_Q2 Ptgir -561 -548 0.934455 CEBPB_01 Ptgir -574 -565 0.87043 NFKAPPAB_01 Ptgir -574 -565 0.974855 NFKAPPAB_01 Ptgir -573 -564 0.844248 NFKAPPAB65_01 Ptgir -574 -565 0.976008 NFKAPPAB65_01 Ptgir -613 -602 0.80942 NFKB_C Ptgir -575 -564 0.900189 NFKB_C Ptgir -576 -563 0.951059 NFKB_Q6 Ptgir -579 -564 0.83341 NFKB_Q6_01 Ptgir -575 -560 0.904956 NFKB_Q6_01 Ptgs2 -465 -455 0.909648 ATF1_Q6 Ptgs2 -465 -452 0.893608 ATF3_Q6 Ptgs2 -163 -152 0.951448 CEBP_Q2 Ptgs2 -165 -152 0.905262 CEBPB_01 Ptgs2 -165 -152 1.01967 CEBPB_02


42

Ptgs2 -83 -76 1.00962 CREB_01 Ptgs2 -83 -72 0.940393 CREB_02 Ptgs2 -85 -74 1.03497 CREB_Q2 Ptgs2 -80 -75 1.07404 CREB_Q3 Ptgs2 -85 -74 1.03734 CREB_Q4 Ptgs2 -83 -73 1.01227 CREB_Q4 Ptgs2 -85 -74 0.936593 CREBP1_Q2 Ptgs2 -428 -419 0.904432 NFKAPPAB_01 Ptgs2 -428 -419 0.954826 NFKAPPAB_01 Ptgs2 -428 -419 0.925668 NFKAPPAB65_01 Ptgs2 -429 -418 0.854535 NFKB_C Ptgs2 -706 -695 0.821501 NFKB_C Ptgs2 -430 -417 0.89875 NFKB_Q6 Ptgs2 -429 -414 0.851169 NFKB_Q6_01 Ptgs2 -433 -418 0.835545 NFKB_Q6_01 Rab11fip1 -273 -260 0.922904 CEBP_Q2 Rab11fip1 -273 -260 0.943725 CEBPA_01 Rab11fip1 -595 -582 0.927289 CEBPB_02 Rab11fip1 -273 -260 0.916776 CEBPB_02 Rab11fip1 -714 -703 0.922322 CREB_02 Rab11fip1 -715 -706 0.85647 NFKAPPAB_01 Rab11fip1 -715 -706 0.854028 NFKAPPAB_01 Rab11fip1 -589 -580 0.867921 NFKAPPAB65_01 Rab11fip1 -716 -705 0.824327 NFKB_C Rab11fip1 -717 -704 0.840485 NFKB_Q6 Rel -346 -336 0.881136 ATF1_Q6 Rel -343 -333 0.920763 ATF1_Q6 Rel -346 -333 0.885682 ATF3_Q6 Rel -346 -333 0.986343 ATF3_Q6 Rel -107 -94 0.895471 ATF3_Q6 Rel -903 -892 0.980677 CEBP_Q2 Rel -903 -890 0.914623 CEBPB_01 Rel -107 -94 0.929462 CEBPB_01 Rel -107 -94 0.924637 CEBPB_02 Rel -104 -97 1.05385 CREB_01 Rel -343 -336 1.06213 CREB_01 Rel -343 -336 1.055 CREB_01 Rel -104 -97 0.949041 CREB_01 Rel -606 -599 0.923342 CREB_01 Rel -347 -336 0.941834 CREB_02 Rel -108 -97 1.0004 CREB_02 Rel -343 -332 1.0267 CREB_02 Rel -106 -95 0.993029 CREB_Q2 Rel -345 -334 0.973045 CREB_Q2 Rel -345 -334 1.03132 CREB_Q2 Rel -340 -335 1.07712 CREB_Q3 Rel -105 -100 1.07404 CREB_Q3 Rel -344 -339 1.0919 CREB_Q3


43

Rel -106 -95 1.01652 CREB_Q4 Rel -345 -334 0.999148 CREB_Q4 Rel -345 -334 1.06663 CREB_Q4 Rel -107 -97 0.994437 CREB_Q4 Rel -346 -336 0.985675 CREB_Q4 Rel -343 -333 1.04558 CREB_Q4 Rel -106 -95 1.01011 CREBP1_Q2 Rel -345 -334 0.965756 CREBP1_Q2 Rel -345 -334 0.968532 CREBP1_Q2 Rel -106 -95 0.907736 CREBP1_Q2 Rel -104 -97 0.976894 CREBP1CJUN_01 Rel -343 -336 1.06054 CREBP1CJUN_01 Rel -343 -336 1.05358 CREBP1CJUN_01 Rel -104 -97 0.925811 CREBP1CJUN_01 Rel -91 -82 0.968023 NFKAPPAB_01 Rel -91 -82 0.93465 NFKAPPAB_01 Rel -90 -81 0.956333 NFKAPPAB_01 Rel -286 -277 0.871777 NFKAPPAB_01 Rel -424 -415 0.876892 NFKAPPAB_01 Rel -91 -82 0.910083 NFKAPPAB65_01 Rel -91 -82 0.894865 NFKAPPAB65_01 Rel -90 -81 0.965444 NFKAPPAB65_01 Rel -286 -277 0.843398 NFKAPPAB65_01 Rel -424 -415 0.87364 NFKAPPAB65_01 Rel -92 -81 0.845985 NFKB_C Rel -91 -80 0.802546 NFKB_C Rel -92 -81 0.926021 NFKB_C Rel -286 -275 0.838905 NFKB_C Rel -91 -80 0.820079 NFKB_C Rel -92 -79 0.849465 NFKB_Q6 Rel -93 -80 0.84344 NFKB_Q6 Rel -439 -426 0.849857 NFKB_Q6 Rel -93 -80 0.919543 NFKB_Q6 Rel -92 -79 0.879697 NFKB_Q6 Rel -95 -80 0.907916 NFKB_Q6_01 Rel -571 -556 0.847252 NFKB_Q6_01 Rel -429 -414 0.896105 NFKB_Q6_01 Rel -96 -81 0.915015 NFKB_Q6_01 Rel -92 -77 0.864488 NFKB_Q6_01 Rnf125 -772 -762 0.896466 ATF1_Q6 Rnf125 -775 -762 0.879166 ATF3_Q6 Rnf125 -775 -762 0.954288 CEBP_Q2 Rnf125 -775 -762 0.951871 CEBP_Q2 Rnf125 -775 -764 0.944828 CEBP_Q2 Rnf125 -873 -862 0.922675 CEBP_Q2 Rnf125 -775 -762 1.01075 CEBPA_01 Rnf125 -775 -762 1.00888 CEBPA_01 Rnf125 -775 -762 0.946375 CEBPB_01


44

Rnf125 -775 -762 0.946778 CEBPB_02 Rnf125 -775 -762 0.984055 CEBPB_02 Rnf125 -772 -765 0.949741 CREB_01 Rnf125 -772 -765 0.942473 CREB_01 Rnf125 -772 -761 0.963468 CREB_02 Rnf125 -774 -763 0.914589 CREBP1_Q2 Rnf125 -755 -746 0.87043 NFKAPPAB_01 Rnf125 -755 -746 0.971826 NFKAPPAB_01 Rnf125 -756 -747 0.83825 NFKAPPAB65_01 Rnf125 -755 -746 0.973118 NFKAPPAB65_01 Rnf125 -756 -745 0.873428 NFKB_C Rnf125 -757 -744 0.902169 NFKB_Q6 Rnf125 -756 -741 0.839286 NFKB_Q6_01 Rnf125 -760 -745 0.903013 NFKB_Q6_01 Saa3 -857 -847 0.868089 ATF1_Q6 Saa3 -223 -210 0.885695 ATF3_Q6 Saa3 -102 -89 0.937988 CEBP_Q2 Saa3 -177 -166 0.946683 CEBP_Q2 Saa3 -79 -68 0.951357 CEBP_Q2 Saa3 -102 -91 0.976895 CEBP_Q2 Saa3 -177 -164 0.935453 CEBPA_01 Saa3 -102 -89 0.946747 CEBPA_01 Saa3 -177 -164 0.977606 CEBPB_01 Saa3 -102 -89 0.979276 CEBPB_01 Saa3 -177 -164 0.932744 CEBPB_02 Saa3 -102 -89 0.972973 CEBPB_02 Saa3 -81 -68 0.917314 CEBPB_02 Saa3 -676 -669 0.91625 CREBP1CJUN_01 Saa3 -972 -963 0.852643 NFKAPPAB_01 Saa3 -978 -963 0.834194 NFKB_Q6_01 Samsn1 -75 -65 0.868901 ATF1_Q6 Samsn1 -447 -436 0.922816 CEBP_Q2 Samsn1 -549 -536 0.932648 CEBPB_01 Samsn1 -573 -568 1.09754 CREB_Q3 Samsn1 -874 -863 0.803893 NFKB_C Schip1 -682 -672 0.905507 ATF1_Q6 Schip1 -614 -603 0.966266 CEBP_Q2 Schip1 -614 -601 0.955169 CEBPA_01 Schip1 -614 -601 0.93904 CEBPB_01 Schip1 -215 -206 0.874873 NFKAPPAB65_01 Schip1 -609 -598 0.809022 NFKB_C Sco1 -1000 -987 0.935162 CEBPA_01 Sco1 -88 -77 0.94805 CREB_02 Sco1 -85 -80 1.05621 CREB_Q3 Sco1 -563 -558 1.07456 CREB_Q3 Sco1 -116 -105 0.812625 NFKB_C Sema4a -665 -655 0.911645 ATF1_Q6 Sema4a -787 -774 0.858562 ATF3_Q6


45

Sema4a -70 -57 0.90712 CEBPB_01 Sema4a -662 -655 1.01345 CREB_01 Sema4a -662 -655 0.913998 CREBP1CJUN_01 Sema4a -662 -655 0.947319 CREBP1CJUN_01 Sema4a -686 -677 0.890388 NFKAPPAB_01 Sema4a -686 -677 0.854046 NFKAPPAB65_01 Sema4a -356 -347 0.868754 NFKAPPAB65_01 Sema4a -687 -676 0.826299 NFKB_C Sema4a -688 -675 0.910092 NFKB_Q6 Sema4a -687 -672 0.840579 NFKB_Q6_01 Sh2b2 -665 -652 0.85259 ATF3_Q6 Sh2b2 -483 -472 0.925097 CEBP_Q2 Sh2b2 -485 -472 0.926055 CEBPA_01 Sh2b2 -485 -472 0.935381 CEBPB_02 Sh2b2 -572 -563 0.847469 NFKAPPAB65_01 Sh2b2 -302 -289 0.848509 NFKB_Q6 Sh2b2 -573 -558 0.855104 NFKB_Q6_01 Siglec1 -598 -588 0.871007 ATF1_Q6 Siglec1 -75 -62 0.945153 CEBPB_01 Siglec1 -599 -594 1.05755 CREB_Q3 Siglec1 -105 -96 0.874937 NFKAPPAB_01 Siglec1 -107 -94 0.854487 NFKB_Q6 Slc13a3 -823 -810 0.942385 CEBP_Q2 Slc13a3 -823 -812 0.92952 CEBP_Q2 Slc13a3 -823 -810 0.912646 CEBPB_01 Slc13a3 -823 -810 0.9061 CEBPB_01 Slc13a3 -202 -197 1.07095 CREB_Q3 Slc13a3 -356 -343 0.841138 NFKB_Q6 Slfn1 -495 -482 0.945635 CEBPA_01 Slfn1 -207 -202 1.05621 CREB_Q3 Slfn1 -88 -81 0.910152 CREBP1CJUN_01 Slfn1 -908 -899 0.89555 NFKAPPAB_01 Slfn1 -68 -59 0.870661 NFKAPPAB_01 Slfn1 -423 -414 0.843841 NFKAPPAB65_01 Slfn1 -907 -898 0.914213 NFKAPPAB65_01 Slfn1 -69 -58 0.823862 NFKB_C Slfn1 -908 -897 0.814493 NFKB_C Slfn1 -425 -412 0.8421 NFKB_Q6 Slfn1 -909 -896 0.876225 NFKB_Q6 Slfn1 -69 -54 0.860177 NFKB_Q6_01 Slfn1 -912 -897 0.906518 NFKB_Q6_01 Slfn3 -829 -819 0.927887 ATF1_Q6 Slfn3 -846 -833 0.851701 ATF3_Q6 Slfn3 -195 -184 0.970866 CEBP_Q2 Slfn3 -197 -184 0.948278 CEBPB_01 Slfn3 -197 -184 0.921319 CEBPB_02 Slfn3 -843 -836 0.908671 CREBP1CJUN_01 Slfn3 -163 -154 0.851894 NFKAPPAB_01


46

Slfn3 -766 -757 0.861815 NFKAPPAB_01 Slfn3 -163 -154 0.877671 NFKAPPAB_01 Slfn3 -164 -153 0.833447 NFKB_C Slfn3 -771 -756 0.853533 NFKB_Q6_01 Slfn3 -168 -153 0.834799 NFKB_Q6_01 Slfn4 -65 -52 0.923749 CEBPB_01 Slfn4 -62 -55 0.924508 CREB_01 Slfn4 -64 -53 0.908292 CREB_Q2 Slfn4 -63 -58 1.07692 CREB_Q3 Slfn4 -64 -53 0.912015 CREB_Q4 Slfn4 -464 -455 0.873452 NFKAPPAB65_01 Slfn5 -794 -781 0.908863 CEBPB_01 Slfn5 -461 -454 0.923757 CREB_01 Slfn5 -311 -302 0.852525 NFKAPPAB_01 Slfn5 -644 -635 0.853372 NFKAPPAB65_01 Slfn5 -94 -85 0.905953 NFKAPPAB65_01 Slfn5 -312 -301 0.849657 NFKB_C Slfn8 -798 -787 0.941884 CEBP_Q2 Slfn8 -288 -277 0.929667 CEBP_Q2 Slfn8 -800 -787 0.967884 CEBPA_01 Slfn8 -800 -787 0.949042 CEBPB_01 Slfn8 -290 -277 0.905668 CEBPB_01 Slfn8 -28 -17 0.886084 CREBP1_Q2 Slfn8 -513 -502 0.817623 NFKB_C Spata1 -841 -831 0.920766 ATF1_Q6 Spata1 -441 -431 0.921416 ATF1_Q6 Spata1 -841 -828 0.852453 ATF3_Q6 Spata1 -841 -828 0.926097 CEBPA_01 Spata1 -838 -831 1.03417 CREB_01 Spata1 -838 -831 0.953395 CREB_01 Spata1 -840 -829 0.968692 CREB_Q2 Spata1 -835 -830 1.05944 CREB_Q3 Spata1 -161 -156 1.05755 CREB_Q3 Spata1 -840 -829 0.98371 CREB_Q4 Spata1 -838 -828 0.947829 CREB_Q4 Spata1 -838 -831 0.957724 CREBP1CJUN_01 Spata1 -838 -831 0.930053 CREBP1CJUN_01 Spata1 -544 -535 0.906427 NFKAPPAB_01 Spata1 -100 -91 0.865554 NFKAPPAB65_01 Spata1 -554 -545 0.855563 NFKAPPAB65_01 Spata1 -545 -534 0.839625 NFKB_C Spata1 -555 -544 0.870184 NFKB_C Spata1 -546 -533 0.843406 NFKB_Q6 Spata1 -102 -89 0.841084 NFKB_Q6 Spata1 -559 -544 0.873433 NFKB_Q6_01 Spata1 -423 -408 0.833562 NFKB_Q6_01 Spsb1 -655 -644 0.933221 CEBP_Q2 Spsb1 -655 -642 0.991771 CEBPB_01


47

Spsb1 -655 -642 0.962309 CEBPB_02 Spsb1 -924 -919 1.06602 CREB_Q3 Spsb1 -985 -976 0.87702 NFKAPPAB_01 Spsb1 -963 -954 0.870893 NFKAPPAB_01 Spsb1 -868 -859 0.902924 NFKAPPAB_01 Spsb1 -985 -976 0.871627 NFKAPPAB_01 Spsb1 -913 -904 0.934937 NFKAPPAB_01 Spsb1 -376 -367 0.862863 NFKAPPAB_01 Spsb1 -963 -954 0.851687 NFKAPPAB65_01 Spsb1 -913 -904 0.933477 NFKAPPAB65_01 Spsb1 -964 -953 0.840251 NFKB_C Spsb1 -869 -858 0.871219 NFKB_C Spsb1 -914 -903 0.888403 NFKB_C Spsb1 -986 -975 0.805946 NFKB_C Spsb1 -986 -975 0.822041 NFKB_C Spsb1 -915 -902 0.876671 NFKB_Q6 Spsb1 -918 -903 0.870357 NFKB_Q6_01 Spsb1 -968 -953 0.852205 NFKB_Q6_01 Stard5 -777 -764 0.907135 CEBPB_01 Stard5 -623 -616 0.932401 CREB_01 Stard5 -152 -147 1.07099 CREB_Q3 Stard5 -625 -614 0.888506 CREBP1_Q2 Stard5 -311 -300 0.821056 NFKB_C Stard5 -441 -428 0.848926 NFKB_Q6 Stk40 -713 -700 0.930697 CEBP_Q2 Stk40 -713 -702 0.953575 CEBP_Q2 Stk40 -345 -334 0.929939 CEBP_Q2 Stk40 -713 -700 0.908642 CEBPB_01 Stk40 -713 -700 0.911415 CEBPB_02 Stk40 -345 -332 0.935415 CEBPB_02 Stk40 -52 -41 0.895591 CREB_Q2 Stk40 -47 -42 1.05978 CREB_Q3 Stk40 -52 -41 0.88761 CREBP1_Q2 Stk40 -327 -318 0.851887 NFKAPPAB_01 Stk40 -223 -214 0.8636 NFKAPPAB_01 Stk40 -539 -530 0.845736 NFKAPPAB65_01 Stk40 -224 -213 0.81352 NFKB_C Stk40 -225 -212 0.838436 NFKB_Q6 Stk40 -329 -316 0.859545 NFKB_Q6 Stk40 -228 -213 0.86837 NFKB_Q6_01 Sult1a1 -417 -407 1.01179 ATF1_Q6 Sult1a1 -414 -404 1.01867 ATF1_Q6 Sult1a1 -417 -404 0.920907 ATF3_Q6 Sult1a1 -417 -404 0.960688 ATF3_Q6 Sult1a1 -261 -248 0.924253 CEBPA_01 Sult1a1 -414 -407 1.04243 CREB_01 Sult1a1 -414 -407 1.03749 CREB_01 Sult1a1 -416 -405 0.926201 CREB_Q2


48

Sult1a1 -416 -405 0.944213 CREB_Q2 Sult1a1 -411 -406 1.06252 CREB_Q3 Sult1a1 -415 -410 1.06252 CREB_Q3 Sult1a1 -416 -405 0.96077 CREB_Q4 Sult1a1 -416 -405 0.970946 CREB_Q4 Sult1a1 -417 -407 1.0122 CREB_Q4 Sult1a1 -414 -404 0.986674 CREB_Q4 Sult1a1 -416 -405 0.939097 CREBP1_Q2 Sult1a1 -416 -405 0.884833 CREBP1_Q2 Sult1a1 -414 -407 1.04134 CREBP1CJUN_01 Sult1a1 -414 -407 1.03653 CREBP1CJUN_01 Sult1a1 -424 -415 0.863414 NFKAPPAB_01 Sult1a1 -285 -276 0.864642 NFKAPPAB_01 Sult1a1 -425 -416 0.914213 NFKAPPAB65_01 Sult1a1 -426 -415 0.814493 NFKB_C Sult1a1 -286 -275 0.812424 NFKB_C Sult1a1 -287 -274 0.860772 NFKB_Q6 Sult1a1 -427 -414 0.84217 NFKB_Q6 Sult1a1 -426 -411 0.933043 NFKB_Q6_01 T2bp -653 -640 0.876765 ATF3_Q6 T2bp -913 -900 0.956753 CEBP_Q2 T2bp -913 -900 0.938787 CEBPA_01 T2bp -841 -832 0.854323 NFKAPPAB_01 T2bp -330 -317 0.85482 NFKB_Q6 Tcfec -264 -253 0.922662 CEBP_Q2 Tcfec -181 -170 0.933555 CEBP_Q2 Tcfec -264 -251 0.925676 CEBPA_01 Tcfec -264 -251 0.930234 CEBPB_01 Tcfec -170 -163 0.913761 CREBP1CJUN_01 Tcfec -22 -13 0.849032 NFKAPPAB65_01 Tmem142b -52 -42 0.880494 ATF1_Q6 Tmem142b -47 -37 0.875682 ATF1_Q6 Tmem142b -50 -37 0.856463 ATF3_Q6 Tmem142b -55 -42 0.878692 ATF3_Q6 Tmem142b -976 -963 0.950577 CEBPA_01 Tmem142b -47 -40 0.922699 CREB_01 Tmem142b -49 -38 0.925342 CREB_Q2 Tmem142b -49 -38 0.963753 CREB_Q4 Tmem142b -50 -40 0.940145 CREB_Q4 Tmem142b -49 -38 0.909055 CREBP1_Q2 Tmem142b -230 -221 0.879287 NFKAPPAB_01 Tmtc2 -844 -831 0.929966 CEBPB_01 Tmtc2 -202 -189 0.939968 CEBPB_01 Tmtc2 -543 -538 1.05617 CREB_Q3 Tmtc2 -572 -557 0.846065 NFKB_Q6_01 Tnfaip3 -211 -201 0.93202 ATF1_Q6 Tnfaip3 -379 -369 0.877228 ATF1_Q6 Tnfaip3 -667 -654 0.910491 CEBPB_01


49

Tnfaip3 -212 -207 1.06637 CREB_Q3 Tnfaip3 -56 -47 0.86801 NFKAPPAB_01 Tnfaip3 -441 -432 0.862361 NFKAPPAB_01 Tnfaip3 -56 -47 0.859192 NFKAPPAB_01 Tnfaip3 -55 -46 0.956601 NFKAPPAB_01 Tnfaip3 -168 -159 0.884556 NFKAPPAB_01 Tnfaip3 -68 -59 0.850685 NFKAPPAB_01 Tnfaip3 -230 -221 0.898424 NFKAPPAB65_01 Tnfaip3 -56 -47 0.907693 NFKAPPAB65_01 Tnfaip3 -55 -46 0.9657 NFKAPPAB65_01 Tnfaip3 -67 -58 0.912149 NFKAPPAB65_01 Tnfaip3 -68 -59 0.950567 NFKAPPAB65_01 Tnfaip3 -69 -58 0.820063 NFKB_C Tnfaip3 -169 -158 0.882362 NFKB_C Tnfaip3 -57 -46 0.878165 NFKB_C Tnfaip3 -56 -45 0.83213 NFKB_C Tnfaip3 -70 -57 0.8497 NFKB_Q6 Tnfaip3 -57 -44 0.871615 NFKB_Q6 Tnfaip3 -170 -157 0.862795 NFKB_Q6 Tnfaip3 -69 -56 0.861103 NFKB_Q6 Tnfaip3 -173 -158 0.852235 NFKB_Q6_01 Tnfaip3 -60 -45 0.912618 NFKB_Q6_01 Tnfaip3 -69 -54 0.906029 NFKB_Q6_01 Tnfaip3 -61 -46 0.857398 NFKB_Q6_01 Tor3a -89 -79 0.869943 ATF1_Q6 Tor3a -385 -372 0.908012 CEBPB_01 Tor3a -89 -79 0.927001 CREB_Q4 Tor3a -88 -77 0.901657 CREBP1_Q2 Tor3a -595 -586 0.877949 NFKAPPAB_01 Tor3a -596 -587 0.941695 NFKAPPAB_01 Tor3a -596 -587 0.947035 NFKAPPAB65_01 Tor3a -597 -586 0.818809 NFKB_C Tor3a -596 -585 0.843045 NFKB_C Tor3a -596 -581 0.837347 NFKB_Q6_01 Tor3a -597 -582 0.960526 NFKB_Q6_01 Trim12 -949 -936 0.871976 ATF3_Q6 Trim12 -30 -19 0.926897 CEBP_Q2 Trim12 -62 -49 0.842144 NFKB_Q6 Tyki -43 -33 0.871314 ATF1_Q6 Tyki -601 -590 0.953268 CEBP_Q2 Tyki -603 -590 0.930058 CEBPA_01 Tyki -603 -590 0.918495 CEBPB_01 Tyki -536 -525 0.803168 NFKB_C Ube2f -27 -14 0.851073 ATF3_Q6 Ube2f -694 -683 0.959925 CEBP_Q2 Ube2f -488 -479 0.849526 NFKAPPAB_01 Ube2f -488 -479 0.840143 NFKAPPAB65_01 Ube2f -487 -478 0.869823 NFKAPPAB65_01


50

Ube2f -488 -479 0.853367 NFKAPPAB65_01 Ube2f -20 -9 0.803243 NFKB_C Ube2f -493 -478 0.881063 NFKB_Q6_01 Ugcg -352 -339 0.84518 ATF3_Q6 Ugcg -270 -257 0.864568 ATF3_Q6 Ugcg -849 -836 0.920359 CEBP_Q2 Ugcg -654 -641 0.925816 CEBP_Q2 Ugcg -854 -843 0.945543 CEBP_Q2 Ugcg -889 -876 1.00405 CEBPA_01 Ugcg -654 -641 0.940072 CEBPB_02 Ugcg -846 -839 0.93616 CREB_01 Ugcg -846 -839 0.948242 CREBP1CJUN_01 Ugcg -608 -599 0.88475 NFKAPPAB_01 Ugcg -609 -600 0.865521 NFKAPPAB65_01 Ugcg -609 -598 0.805419 NFKB_C Uty -662 -652 0.972262 ATF1_Q6 Uty -662 -649 0.865787 ATF3_Q6 Uty -114 -101 0.909664 ATF3_Q6 Uty -69 -56 0.937474 CEBP_Q2 Uty -69 -58 0.953607 CEBP_Q2 Uty -69 -56 0.924048 CEBPB_02 Uty -66 -59 0.940086 CREB_01 Uty -659 -652 0.96069 CREB_01 Uty -659 -648 0.934745 CREB_02 Uty -70 -59 0.981552 CREB_02 Uty -68 -57 0.934096 CREB_Q2 Uty -113 -102 0.903327 CREB_Q2 Uty -656 -651 1.06637 CREB_Q3 Uty -67 -62 1.07456 CREB_Q3 Uty -661 -650 0.898609 CREB_Q4 Uty -113 -102 0.900469 CREB_Q4 Uty -68 -57 0.911013 CREB_Q4 Uty -113 -102 0.913698 CREB_Q4 Uty -111 -101 0.933223 CREB_Q4 Uty -69 -59 0.971003 CREB_Q4 Uty -661 -650 0.883004 CREBP1_Q2 Uty -661 -650 0.878945 CREBP1_Q2 Uty -113 -102 0.883412 CREBP1_Q2 Uty -68 -57 0.914302 CREBP1_Q2 Uty -659 -652 0.988992 CREBP1CJUN_01 Uty -693 -684 0.859523 NFKAPPAB_01 Uty -693 -684 0.923396 NFKAPPAB_01 Uty -694 -685 0.858419 NFKAPPAB65_01 Uty -693 -684 0.874612 NFKAPPAB65_01 Uty -694 -683 0.882495 NFKB_C Uty -695 -682 0.865665 NFKB_Q6 Uty -696 -683 0.881852 NFKB_Q6 Uty -695 -680 0.881367 NFKB_Q6_01


51

Uty -694 -679 0.907638 NFKB_Q6_01 Vcan -965 -955 0.891467 ATF1_Q6 Vcan -782 -769 0.918255 CEBP_Q2 Vcan -782 -769 0.924447 CEBPA_01 Vcan -576 -567 0.853277 NFKAPPAB_01 Vcan -126 -117 0.849862 NFKAPPAB_01 Vcan -577 -568 0.956333 NFKAPPAB_01 Vcan -577 -568 0.965444 NFKAPPAB65_01 Vcan -127 -116 0.812076 NFKB_C Vcan -328 -317 0.819091 NFKB_C Vcan -579 -566 0.850756 NFKB_Q6 Vcan -578 -563 0.871547 NFKB_Q6_01 Vcan -955 -940 0.869526 NFKB_Q6_01 Vcpip1 -178 -165 0.929987 CEBP_Q2 Vcpip1 -653 -640 0.929788 CEBPB_01 Vcpip1 -175 -165 0.938489 CREB_Q4 Vcpip1 -602 -591 0.92468 CREBP1_Q2 Vcpip1 -371 -360 0.820616 NFKB_C Vcpip1 -372 -359 0.842676 NFKB_Q6 Vti1a -783 -770 0.849587 ATF3_Q6 Vti1a -783 -770 0.893372 ATF3_Q6 Vti1a -777 -764 0.931179 CEBPA_01 Vti1a -304 -297 0.929265 CREB_01 Vti1a -780 -773 1.02386 CREB_01 Vti1a -304 -293 0.923942 CREB_02 Vti1a -782 -771 0.942073 CREB_Q2 Vti1a -781 -776 1.08882 CREB_Q3 Vti1a -306 -295 0.917201 CREB_Q4 Vti1a -782 -771 0.921167 CREB_Q4 Vti1a -426 -416 0.911991 CREB_Q4 Vti1a -783 -773 0.937752 CREB_Q4 Vti1a -306 -295 0.930016 CREBP1_Q2 Vti1a -511 -502 0.894837 NFKAPPAB_01 Vti1a -511 -502 0.870685 NFKAPPAB_01 Vti1a -286 -277 0.929493 NFKAPPAB65_01 Wdr59 -242 -231 0.934214 CEBP_Q2 Wdr59 -242 -229 0.919893 CEBPB_01 Wdr59 -239 -232 0.932542 CREB_01 Wdr59 -243 -232 0.939525 CREB_02 Wdr59 -241 -230 0.916702 CREB_Q2 Wdr59 -240 -235 1.0917 CREB_Q3 Wdr59 -241 -230 0.893424 CREB_Q4 Wdr59 -242 -232 0.933882 CREB_Q4 Wdr59 -692 -683 0.921729 NFKAPPAB_01 Wdr59 -227 -218 0.92321 NFKAPPAB_01 Wdr59 -692 -683 0.872251 NFKAPPAB65_01 Wdr59 -227 -218 0.869162 NFKAPPAB65_01 Wdr59 -693 -682 0.837847 NFKB_C


52

Wdr59 -69 -58 0.822713 NFKB_C Wdr59 -68 -57 0.808617 NFKB_C Wdr59 -694 -681 0.881944 NFKB_Q6 Wdr59 -73 -58 0.832153 NFKB_Q6_01 Zc3h12a -335 -324 0.971297 CEBP_Q2 Zc3h12a -335 -322 0.911298 CEBPB_02 Zc3h12a -36 -31 1.06031 CREB_Q3 Zc3h12a -39 -29 0.916232 CREB_Q4 Zc3h12a -554 -545 0.840308 NFKAPPAB65_01 Zc3h12a -511 -502 0.855442 NFKAPPAB65_01 Zc3h12a -555 -544 0.841934 NFKB_C Zeb1 -107 -94 0.916164 CEBPB_01 Zeb1 -127 -117 0.929117 CREB_Q4 Zeb1 -106 -95 0.883044 CREBP1_Q2 Zeb1 -602 -593 0.863941 NFKAPPAB65_01 Zeb1 -528 -519 0.884387 NFKAPPAB65_01 Zeb1 -527 -518 0.871728 NFKAPPAB65_01 Zeb1 -725 -714 0.807239 NFKB_C Zeb1 -604 -591 0.841202 NFKB_Q6 Zeb1 -532 -517 0.844224 NFKB_Q6_01 Zhx2 -16 -6 0.90295 ATF1_Q6 Zhx2 -704 -693 0.934504 CEBP_Q2 Zhx2 -121 -110 0.921783 CEBP_Q2 Zhx2 -16 -9 0.927758 CREB_01 Zhx2 -16 -9 0.958884 CREB_01 Zhx2 -20 -9 0.92069 CREB_02 Zhx2 -528 -517 0.986813 CREB_02 Zhx2 -526 -515 0.8852 CREB_Q2 Zhx2 -18 -7 0.928471 CREB_Q2 Zhx2 -525 -520 1.08082 CREB_Q3 Zhx2 -17 -12 1.064 CREB_Q3 Zhx2 -526 -515 0.913725 CREB_Q4 Zhx2 -18 -7 0.950456 CREB_Q4 Zhx2 -527 -517 0.938315 CREB_Q4 Zhx2 -19 -9 0.966747 CREB_Q4 Zhx2 -18 -7 0.907471 CREBP1_Q2 Zhx2 -16 -9 0.964257 CREBP1CJUN_01 Zhx2 -16 -9 1.04983 CREBP1CJUN_01 Zhx2 -738 -729 0.852813 NFKAPPAB_01 Zhx2 -738 -729 0.859549 NFKAPPAB_01 Zhx2 -737 -728 0.953304 NFKAPPAB_01 Zhx2 -738 -729 0.893192 NFKAPPAB65_01 Zhx2 -737 -728 0.962554 NFKAPPAB65_01 Zhx2 -738 -727 0.802047 NFKB_C Zhx2 -739 -728 0.844837 NFKB_C Zhx2 -738 -727 0.805697 NFKB_C Zhx2 -742 -727 0.882999 NFKB_Q6_01 Zhx2 -458 -443 0.832108 NFKB_Q6_01


53

Zhx2 -743 -728 0.887958 NFKB_Q6_01

Table 4 NF-κB, C/EBPδ and ATF3 binding site location in LPS-induced target gene

promoters

NF-κB, C/EBPδ and ATF3 binding sites were identified by scanning of 1kbp 5’ promoter

regions of 580 LPS-induced genes, using MotifLocator and the TRANSFAC matrices.

Individual matrix thresholds were set to only report predictions above the percentile of

0.05%. Each binding site predicted location is shown, relative to the TSS


Gene Function/Process

1 Ccrl2 Receptor 2 Clec4b1 Receptor 3 Clec4e Receptor 4 Clec4n Receptor 5 Fcgr4 Receptor 6 Fpr1 Receptor 7 Gpr109a Receptor 8 Ms4a6b Receptor 9 Tlr6 Receptor

10 P2ry14 Receptor 11 Klra2 Receptor 12 Olr1 Receptor 13 Sdc4 Receptor 14 Il6 Cytokine 15 Saa3 Cytokine 16 Angpt1 Cytokine 17 Tnfsf4 Cytokine 18 Ccl12 Chemokine 19 Ccl3 Chemokine 20 Cxcl10 Chemokine 21 Cxcl2 Chemokine 22 Aoah Secreted lipase 23 Serpinb2 Protease inhibitor 24 Slpi Protease inhibitor 25 Tnfaip6 Matrix cross-linking protein 26 C3 Antimicrobial


54

27 Camp Antimicrobial 28 F10 Coagulation factor 29 Hp Hemoglobin binding protein 30 Cp Iron/copper transporter 31 Ifit2 Interferon induced 32 Ifit3 Interferon induced 33 Ifi203 Interferon induced 34 Gbp2 Interferon induced 35 Gvin1 Interferon induced 36 Pla2g4a Intracellular lipid signaling 37 AB112350 Intracellular lipid signaling 38 Ccdc50 Regulator of intracellular signaling 39 Homer1 Regulator of intracellular signaling 40 Ehd1 Regulator of intracellular signaling 41 Ptpn2 Regulator of intracellular signaling 42 Rffl Regulator of intracellular signaling 43 Arhgap26 Regulator of intracellular signaling 44 Ift57 Regulator of intracellular signaling 45 Slc7a11 Pro-survival factor 46 Dclre1c Pro-survival factor 47 Bcl2a1b Pro-survival factor 48 Arid5b Transcriptional regulator 49 Batf2 Transcriptional regulator 50 Cited2 Transcriptional regulator 51 Nfkbiz Transcriptional regulator 52 Tcfec Transcriptional regulator 53 D16Ertd472e Unknown 54 Fndc3a Unknown 55 Ier2 Unknown 56 Lyrm1 Unknown 57 Rnf31 Unknown 58 Slfn1 Unknown 59 Slfn2 Unknown 60 Slfn4 Unknown 61 Trim12 Unknown 62 Trim13 Unknown 63 Trim30 Unknown

Table 5 Whole genome location analysis identifies direct C/EBPδ-targets in LPS

stimulated macrophages

Macrophages from wild-type mice were stimulated for with 10 ng/ml LPS for 6 hours.

Cells were harvested and processed for ChIP-to-Chip assay as described in Methods.

Following comprehensive analysis we identified 63 LPS-induced direct C/EBPδ-targets.


55

Supplementary Methods

Mice

C57BL/6 mice were obtained from Jackson Laboratories. Atf3-/-

mice in the C57BL/6

background were generated by backcrossing Atf3-/-

mice in the 129SVJ background to

C57BL/6 mice for 10 times to generate the congenic mice1. Cebpd

+/- mice

2 were

backcrossed for at least 11 generations into C57BL/6. Cebpd

+/- heterozygotes were

intercrossed to generate Cebpd-/-

mice. Mice were maintained at the animal facility of

Institute for Systems Biology and used at 8–12 weeks of age

All animals were housed and handled according to the University of Washington

and

Institute for Systems Biology's Institutional Animal Care and Use Committees approved

protocols.

Gene expression profiling

Probe intensities were processed into CEL files using the Affymetrix GeneChip

Operating Software. Probe intensities were background- adjusted, normalized, and

probeset-summarized using the Robust Multi-chip Average (RMA) method3 using the

software Bioconductor4, then exported to MATLAB (MathWorks, Natick, MA) for

further analysis. For each microarray expression experiment (combination of strain,

stimulus, and time point), log2 intensities3 for each probeset were averaged across all

biological replicates for that experiment to obtain the replicate-combined probeset

intensity. From among the 45,037 probesets on the Affymetrix Mouse GeneChip 430.2

(excluding on-chip control probesets), a representative probeset was selected for each

NCBI Entrez gene represented on the microarary, eliminating probesets that are

annotated as cross-hybridizing to transcripts from different genes. In this process, a


56

probesets from among the 45,037 probesets (excluding on-chip control probesets) on the

Affymetrix Mouse GeneChip 430.2 were selected based on four criteria. A probeset was

selected if and only if: (i) it possessed an Entrez GeneID in the Affymetrix probeset

annotation database5; (ii) it had a log2 intensity exceeding a fixed cutoff (see below), in at

least one replicate-combined experiment; (iii) its probeset name did not contain “_x_at”

or “_s_at”, and was not associated (by GeneID annotation) with transcripts of two distinct

genes. Criterion (iii) was imposed in order to eliminate probesets containing probes that

cross-hybridize to transcripts from different genes6. Whenever multiple probesets mapped

to the same GeneID (or the same collection of GeneIDs) according to the above criteria,

the probeset with the largest absolute probeset intensity across all non-reference

experiments was selected as the “representative probeset” for the GeneID.

The LPS transcription factor cluster analysis was performed using the K-means algorithm

with squared Euclidean distance7, with 1000 iterations. The number of clusters was

selected so as to minimize the Bayesian Information Criterion (BIC)8, with the variance

estimate obtained from the sum-squared intra-cluster distances using K = 3. Genes were

selected for inclusion based on filtering for minimum log2 expression intensity (> 7) in at

least one time point, differential expression (3-fold up-regulated or down-regulated

respect to wild-type unstimulated macrophages, in at least one time point), and based on

the gene appearing on a list of putative mouse transcription factors (TF). The TF list was

constructed by taking the union of all mouse TFs listed in the TRANSFAC database9, all

successfully mapped mouse orthologs of members of a curated list of human TF genes10

,

and all genes possessing a Gene Ontology 11

annotation of “transcription factor activity”


57

(Gene Ontology ID number GO: 0003700, excluding “IEA” evidence codes) in the

Mouse Genome Informatics database12

.

Motif Scanning

Promoter sequences were scanned using the software tool MotifLocator13

. A total of 360

murine transcription factor matrices were obtained from the TRANSFAC database

Professional version 9.3. During initial, exploratory analyses using MotifLocator,

occasionally a known binding site would be missed, even though there was a labeled

matrix that should have been identified. Examining these individual cases it appeared that

the specific matrix did not report the hit as it was too stringent in a single position i.e., the

matrix expected an A at 100%, whereas a C was observed. In order to reduce this

particular stringency, a low-level of noise was added to the matrices used by

MotifLocator. Specifically, if the expectation of a nucleotide was 0 then 0.01 was added

to that position and the other expectations are adjusted accordingly. To assess the

statistical significance of MotifLocator scores, we evaluated scores on randomized

sequence. We obtained the random distributions for each binding site matrix model

individually, as the distributions and thresholds were sensitive to the choice of matrix

(see below). The random sequences were constructed as follows. 200kbp of sequence was

sampled from upstream regions of ~100 immune related genes. This sequence underwent

a random shuffling and was then split into four equal segments of 50kbp each, to be

accommodated by the scanning algorithm. Scanning was then performed, on both + and -

strands. The randomization procedure was repeated twice for a total of 4 (2 50) (1+2)

=1200 random scores per matrix. An example distribution is given below. This

distribution allowed us to convert a given MotifLocator score on true sequence to a P-


58

value reflecting the probability of obtaining (by chance) a match with a score at least as

good as the given score, in a random-sequence background model. These distributions

can also be used to set thresholds for filtering scanning results, for example

corresponding to defined quantiles of the random distribution. Quantile values vary

considerably between matrices. For example, the 0.1% topmost quantile ranges from

0.711 for matrix PAX1_B, to 1.087 for matrix GATA_01. For each promoter, 1kbp

regions were extracted from the multiple FASTA file downloaded from the [UCSC

Genome Browser website] http://genome.ucsc.edu/ This sequence file is derived from the

NCBI mouse genome annotation Build 36 (mm8 / Feb. 2006 assembly). The promoters

were scanned using MotifLocator and the TRANSFAC matrices with the individual

matrix thresholds set to report predictions above the percentile of 0.067%, i.e. an

expectation of observing a prediction for a matrix every 1500bp.

Kinetic Modeling

Kinetic modeling was carried out in MATLAB (MathWorks, Natick, MA). The kinetic

model of Il6, Atf3, and Cebpd gene expression consists of time-inhomogeneous delay

differential equations (DDEs) involving five species: Cebpd mRNA, total C/EBP

protein, Atf3 mRNA, total ATF3 protein, and Il6 mRNA. Data from a time-course

chromatin immunoprecipitation experiment indicating the temporal binding of NF-

B/Rel to the Il6 promoter were used as the time-inhomogeneous term in the equations,

indicating TLR4 signaling. Apart from the time-dependent fractional TLR4 signaling

term, the model equations are self-contained, with the relative protein levels of ATF3 and

C/EBPδ being used (in conjunction with the time-dependent NF- B binding data) in the


http://genome.ucsc.edu/

59

appropriate combinations, to compute the fractional transcriptional activity of Il6, Cebpd,

and Atf3. The expression level rx of each gene x (where the index x 1,2,3 represents

the genes Atf3, Cebpd, and Il6, respectively), was modeled by a DDE of the form:

drx

dt(t) kir,x fx py(t r ) y {13}

kdr,xrx ,

where r is the transcriptional time delay (in min); py is the level of protein y (in

molec/cell; the index y = 0,1,2 represents the concentration of nuclear NF B, ATF3,

and C/EBP , respectively); kir,x is the maximum rate of initiation of transcription of gene

x (in molec cell-1

min-1

); kdr,x is the rate of turnover of mRNA for gene x; and fx is the

fractional rate of production of completed mRNA transcripts of gene x, which depends on

the levels of various TF protein levels with a time lag of r. The expression level of the

two proteins ATF3 and C/EBP (in molec/cell) are modeled by the set of DDEs:

dpy

dt(t) kip,yry (t p ) kdp,y py ,

for all y 1,2 ; p is the delay for protein translation, folding, and nuclear translocation

(min); kip,y is the rate of initiation of translation, per mRNA copy, for protein y (min-1

);

kdp,y is the rate of turnover of protein y (min-1

). The time-dependence of the nuclear

NF B abundance, p0, is given by the NF B/Rel ChIP data, and scaled so that the

maximum number of molec/cell over the time-course is 1,500 (ref. 14). The fractional

activity functions fx for the genes Atf3, Cebpd, and Il6 are defined by:

f1w01p0

K w01p0,

f2w02p0 w22p0p2

K w02p0 w22p0p2 w12p1,


60

f3w03p0 w23p0p2

K w03p0 w23p0p2 w13p1,

respectively, where w01 = 11.6; w02 = 0.0280; w12 = 8,689; w22 = 23.5 molec-1

cell; w03 =

0.0907; w13 = 0.0276; w23 = 0.0126 molec-1

cell; and K = 1,500 molec/cell. The values of

the other kinetic parameters defined above, are given by r = 10 min15

; p = 20 min16

; kdr,1

= 0.012 min-1

(ref. 17) ; kdr,2 = 0.017 min-1

(ref. 18) ; kdr,3 = 0.012 min-1

(ref. 19); kir,x =

100 kdr,x (for all x 1,2,3 ); kdp,1 = 0.0058 min-1

(from time-course western blot data);

kdp,2 = kdp,3 = 0.0043 min-1

(ref. 18) ; kip,y = 20 kdp,y (for all y 1,2 ). These fractional

transcriptional activity functions were chosen to have the simplest possible form that is

consistent with a probabilistic model of transcriptional activation based on fractional

promoter occupancy20,21

. The cases of Il6 induction in Atf3-/-

and Cebpd-/-

macrophages

were modeled by setting p1 = 0 and p2 = 0, respectively, in the above-described set of

DDEs.

The model DDEs were solved to obtain the time-course Il6 transcriptional induction

using the MATLAB function dde23. The initial conditions for the model were the

steady-state solution with p0 = 0 (i.e., with no TLR4 signal). The wyx constants were

obtained by multi-parameter regression to obtain the best fit (minimum least squares) to

experimental data for rx (for all x 1,2,3 , as measured by time-course quantitative real-

time RT-PCR) and for p1 (measured by the time-course western blot of ATF3

expression). Optimization was performed using the SNOBFIT stochastic branch and fit

algorithm22

.


61

For LPS pulsing NFκB-signals of same amplitude and different durations were

computationally varied using a previously described method 23

.

Sequences of promoter-specific primers:

Batf: Sense; CTAACTTGTTGA CGTTTCCGCCCA

Anti-sense; AGCACACCACCTTCCACAGGTA

Cebpd: Sense; TGATCCCTGTTCCGCCTTTGCTAT

Anti-sense; AGTGGGTCGGAGACCGGA

Il6: Sense; AGAGTGCTCATGCTTCTTAGGGCT

Anti-sense; GCACAATGTGACGTCGTTTAGCATCG

Lztfl1: Sense ; CGACCGGAAATT TCTCTGTTGCCA

Anti-sense; AGGAACGGAGGTTGTTTAGAAGCC

Ncoa7: Sense; TTGCCTGACTCCCAATCCATTTGC

Anti-sense; GGAAACGTCCTCTTTAATCAGTGAGTC

Nfkb1: Sense; ACAAAGTAGAAGTGGCCACAGGGT

Anti-sense; TCTACGGGACCACA AATGTCTGC

Nfkb2: Sense; TTCGGGACTTTCCTAAGCAGCACT

Anti-sense; TTCAGCTTTCCAGAGTTTCGGACG

Tcf4: Sense; CCCTTCTTTCCTGGATTTGGTTT

Anti-sense; GGGCGGATGGGATTAAGGTAGAAA

Zhx2: Sense; AAGTTTCTAACCCACTGCCAGCCT

Anti-sense; TCAAATGCCTTTGGCTTCCCTTGG


62

Comprehensive listing of TaqMan® Gene Expression Assays (Applied Biosystems)

used for real-time PCR gene expression analysis

Cebpd: Mm00786711_s1

Il6: Mm00446190_m1

Tnfaip6: Mm00493736_m1

Cxcl2: Mm00436450_m1

Saa3: Mm00441203_s1

Hp: Mm00516884_s1

Cp: Mm00432654_m1

C3: Mm01232779_m1

Serpinb2 Mm00440905_m1

F10: Mm00484178_m1

Camp: Mm00438285_m1

Ccl3: Mm00441258_m1


63

References

1. Hartman, M. G. et al. Role for activating transcription factor 3 in stress-induced

beta-cell apoptosis. Mol. Cell. Biol. 24, 5721–-5732 (2004).

2. Sterneck. E. et al. Selectively enhanced contextual fear conditioning in mice

lacking the transcriptional regulator CCAAT/enhancer binding protein delta.

Proc. Natl. Acad. Sci. USA 95,10908-10913 (1998).

3. Irizarry, R.A. et al. Exploration, normalization, and summaries of high density

oligonucleotide array probe level data. Biostatistics 4, 249-264 (2003).

4. Gentleman, R.C. et al. Bioconductor: open software development for

computational biology and bioinformatics. Genome Biol 5, research80 (2004).

5. Affymetrix. Affymetrix Mouse GeneChip 430.2 annotation database, 2007/03/09.

Available at: http://www.affymetrix.com (2007).

6. Affymetrix . Data Analysis Fundamentals. Affymetrix (2006).

7. Dollar, P. Piotr Dollar's Image and Video Toolbox for Matlab. San Diego, CA:

University of California, San Diego (2006).

8. Hastie, T., Tibshirani, R. & Friedman, J.H. The Elements of Statistical Learning.

New York: Springer (2003).

9. Biobase. TRANSFAC Professional v10.3. Available at: http://www.biobase.de

(2006).

10. Roach, J.C. et al. Transcription factor expression in lipopolysaccharide-activated

peripheral-blood-derived mononuclear cells. Proc. Natl. Acad. Sci. USA 104,

16245-16250 (2007).


http://www.affymetrix.com/

http://www.biobase.de/

64

11. Gene Ontology. Project Gene Ontology (downloaded in OBO 1.0 format), vers.

2007/03/23. Available at: http://www.geneontology.org (2006).

12. Jackson Laboratory. Mouse Genome Informatics annotations, vers. 2007/03/23.

Available at: http://www.geneontology.org/GO.current.annotations.shtml (2006).

13. Thijs, G. et al. INCLUSive: integrated clustering, upstream sequence retrieval and

motif sampling. Bioinformatics. 18, 331-332 (2002)

14. Lenardo, M.J., Kuang, A., Gifford, A. & Baltimore, D. NF-kappa B protein

purification from bovine spleen: nucleotide stimulation and binding site

specificity. Proc Natl Acad Sci U S A 85, 8825-8829 (1988).

15. Monk NAM. Oscillatory expression of Hes1, p53, and NK-κB driven by

transcriptional time delays. Current Biology 13, 1409-1413 (2003).

16. Barrio, M., Burrage, K., Leier, A. & Tian, T. Oscillatory regulation of Hes1:

discrete stochastic delay modelling and simulation. PLoS Comp Biol 2, 1017-1030

(2006).

17. Pan, Y.X., Chen, H. & Kilberg, M.S. Interaction of RNA-binding proteins HuR

and AUF1 with the human ATF3 mRNA 3'-untranslated region regulates its

amino acid limitation-induced stabilization. J Biol Chem 280, 34609-34616

(2005).

18. Sivko, G.S. & DeWille, J.W. CCAAT/Enhancer binding protein delta

(c/EBPdelta) regulation and expression in human mammary epithelial cells: I.

"Loss of function" alterations in the c/EBPdelta growth inhibitory pathway in

breast cancer cell lines. J Cell Biochem 93, 830-843 (2004).


http://www.geneontology.org/

http://www.geneontology.org/GO.current.annotations.shtml

65

19. Rola-Pleszczynski, M. & Stankova, J. Leukotriene B4 enhances interleukin-6 (IL-

6) production and IL-6 messenger RNA accumulation in human monocytes in

vitro: transcriptional and posttranscriptional mechanisms. Blood 80, 1004-1011

(1992).

20. Ackers, G.K., Johnson, A.D. & Shea, M.A. Quantitative model for gene

regulation by lambda phage repressor. Proc Natl Acad Sci U S A 79, 1129-1133

(1982).

21. Bolouri, H. & Davidson, E.H. Transcriptional regulatory cascades in

development: initial rates, not steady state, determine network kinetics. Proc Natl

Acad Sci U S A 100, 9371-9376 (2003).

22. Huyer, W. & Neumaier, A. SNOBFIT - Stable Noisy Optimization by Branch and

Fit. ACM Trans Math Softw In Press (2008).

23. Werner, S.L., Barken, D. & Hoffmann, A. Stimulus specificity of gene expression

programs determined by temporal control of IKK activity. Science 309, 1857-

1861 (2005).


function of c/ebpδ in a regulatory circuit that ... · 8 supplementary table 2 . gene name tfbs...

Documents