Journ

alof

Cell

Scie

nce

Functional expression of the voltage-gated Na+-channel Nav1.7 is necessary for EGF-mediatedinvasion in human non-small cell lung cancer cells

Thomas M. Campbell1, Martin J. Main2 and Elizabeth M. Fitzgerald1,*1Faculty of Life Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, UK2Discovery Sciences, AstraZeneca, Alderley Park, Macclesfield, Cheshire SK10 4TG, UK

*Author for correspondence (elizabeth.m.fitzgerald@manchester.ac.uk)

Accepted 13 July 2013Journal of Cell Science 126, 4939–4949� 2013. Published by The Company of Biologists Ltddoi: 10.1242/jcs.130013

SummaryVarious ion channels are expressed in human cancers where they are intimately involved in proliferation, angiogenesis, invasion andmetastasis. Expression of functional voltage-gated Na+ channels (Nav) is implicated in the metastatic potential of breast, prostate, lung

and colon cancer cells. However, the cellular mechanisms that regulate Nav expression in cancer remain largely unknown. Growthfactors are attractive candidates; they not only play crucial roles in cancer progression but are also key regulators of ion channelexpression and activity in non-cancerous cells. Here, we examine the role of epidermal growth factor receptor (EGFR) signalling and

Nav in non-small cell lung carcinoma (NSCLC) cell lines. We show unequivocally, that functional expression of the a subunit Nav1.7promotes invasion in H460 NSCLC cells. Inhibition of Nav1.7 activity (using tetrodotoxin) or expression (by using small interferingRNA), reduces H460 cell invasion by up to 50%. Crucially, non-invasive wild type A549 cells lack functional Nav, whereas exogenous

overexpression of the Nav1.7 a subunit is sufficient to promote TTX-sensitive invasion of these cells. EGF/EGFR signalling enhancesproliferation, migration and invasion of H460 cells but we find that, specifically, EGFR-mediated upregulation of Nav1.7 is necessaryfor invasive behaviour in these cells. Examination of Nav1.7 expression at mRNA, protein and functional levels further reveals that EGF/EGFR signalling via the ERK1/2 pathway controls transcriptional regulation of channel expression to promote cellular invasion.

Immunohistochemistry of patient biopsies confirms the clinical relevance of Nav1.7 expression in NSCLC. Thus, Nav1.7 has significantpotential as a new target for therapeutic intervention and/or as a diagnostic or prognostic marker in NSCLC.

Key words: Ion channel, Voltage-gated sodium channel, Epidermal growth factor receptor, Invasion, Metastasis, NSCLC

IntroductionLung cancer is the most prevalent cancer world-wide. Small cell

lung carcinoma (SCLC) and non-small cell lung carcinoma

(NSCLC) occur with a frequency of ,20% and ,80%,

respectively. NSCLC has a low, average 5-year, survival rate

(14%) and the development of metastases results in extremely poor

prognosis (Jemal et al., 2011). The epidermal growth factor receptor

(EGFR) plays key roles in the progression of various cancers

(Araujo et al., 2007; Cohen, 2002; Mendelsohn, 2003), and in

NSCLC its overexpression in ,40–80% of patients is also

associated with poor prognosis (Mendelsohn, 2003). Small-

molecule EGFR kinase inhibitors (gefitinib and erlotinib) have

recently shown significant therapeutic benefit in many patients with

advanced NSCLC, particularly those with somatic mutations of the

EGFR (Araujo et al., 2007). However, drug resistance, whether

inherent or acquired, remains a main cause of chemotherapy failure

(Cataldo et al., 2011; Domingo et al., 2010; Lynch et al., 2004; Paez

et al., 2004). Consequently, there is a pressing need for improved

treatments based upon improved understanding of the effector

pathways downstream of EGFR signalling.

Voltage-gated Na+ channels (Nav), normally associated with

cellular excitability, have been found to play crucial roles inmetastatic behaviours of several cancers, including breast

(Brackenbury et al., 2007; Fraser et al., 2005; Gao et al., 2009;

Gillet et al., 2009; Roger et al., 2003), prostate (Abdul andHoosein, 2002; Bennett et al., 2004; Diss et al., 2001; Diss et al.,

2005; Grimes et al., 1995; Laniado et al., 1997; Nakajima et al.,2009; Smith et al., 1998), cervical (Diaz et al., 2007), colon

(House et al., 2010), ovarian (Gao et al., 2010), SCLC (Blandino

et al., 1995; Onganer and Djamgoz, 2005; Onganer et al., 2005;Pancrazio et al., 1989) and NSCLC (Roger et al., 2007). In

prostate cancer, functional expression of Nav enhances cellular

migration, invasion and endocytosis (Ding et al., 2008; Uysal-Onganer and Djamgoz, 2007). In NSCLC, Nav activity reportedly

promotes invasion but not migration (Roger et al., 2007). Theacquisition of functional Nav, thus appears to accelerate

development of cancer metastases in a variety of carcinomas.

However, details of the downstream effects of Nav (Brisson et al.,2011; Gillet et al., 2009) and the cellular mechanism(s) that

regulate their expression and activity in metastatic cells remain

unclear (Ding et al., 2008; Uysal-Onganer and Djamgoz, 2007).

In addition to their roles in cell growth and cancer progression,

growth factors also regulate the expression and activity ofnumerous ion channels (Akopian et al., 1999; Brackenbury and

This is an Open Access article distributed under the terms of the Creative Commons AttributionLicense (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distributionand reproduction in any medium provided that the original work is properly attributed.

Research Article 4939

Journ

alof

Cell

Scie

nce

Djamgoz, 2007; Goetz et al., 2009; Goldfarb et al., 2007; Lei

et al., 2001; Lou et al., 2005; Toledo-Aral et al., 1995). EGF

enhances Nav currents in non-cancerous cells, including cardiac

muscle (Liu et al., 2007). In human and rat prostate cancer,

functional upregulation of Nav is implicated in the pro-invasive

response of cells to EGF, although the cellular mechanism(s)

involved are unknown (Ding et al., 2008; Uysal-Onganer and

Djamgoz, 2007). In the present study, we conducted a detailed

characterisation of Nav in NSCLC and examined the effects of

EGF/EGFR signalling on expression and activity of Nav. Briefly,

we show that functional expression of the Nav1.7 a subunit

isoform specifically promotes invasion of strongly invasive H460

NSCLC cells. Moreover, non-invasive A549 NSCLC cells that

lack Nav, can be induced to invade simply by overexpression of

Nav1.7. In strongly invasive H460 cells, EGF/EGFR signalling

through the ERK1/2 pathway controls transcriptional regulation

of Nav1.7 to promote invasion. Finally, immunohistochemistry of

patient biopsies provides evidence that supports the clinical

relevance of Nav1.7 expression.

ResultsTo assess the role of Nav in NSCLC it was first necessary to

identify suitable model cell lines for comparison of Nav activity

and expression in weakly versus strongly invasive cells. We,

therefore, tested 22 NSCLC cell lines for functional Nav

expression using a high-throughput IonWorksH QuattroTM

Automated Patch Clamp System to record the inward Nav

current (INa) (Fig. 1A). Two cell lines were selected for further

study: A549 cells that lacked INa and H460 cells that exhibited

the most-robust INa both in terms of current amplitude and

proportion of cells with current (,45%, n589). Conventional

patch-clamp recordings confirmed the IonWorksH data

(Fig. 1B,C). H460 cells were more proliferative (Fig. 1D) and

more invasive (Fig. 1F) than A549 cells. However, migration was

greater in A549 cells (Fig. 1E). H460 cells were, thus, chosen as

a strongly invasive model, whereas A549 cells were used as a

model of weak invasive potential. These preliminary findings

agree with those described by Roger et al. (Roger et al., 2007).

Nav promotes H460 cell invasion

To explore the link between functional expression of Nav and

invasion of H460 cells, we used the Nav-specific inhibitor

(tetrodotoxin, TTX) or activator (veratridine) that, respectively,

block or enhance the opening of Nav channels. TTX (0.5 mM)

abolished INa, whereas 50 mM veratridine induced a modest increase

in the persistent inward Na+ current (INa,P) (Fig. 2A). Neither TTX

nor veratridine affected proliferation or migration (Fig. 2B,C).

However, as predicted, blocking Nav channels (using TTX) reduced

invasion of H460 cells by 39.767.2%, whereas enhanced opening

of Nav (using veratridine) promoted invasion (19.764.7%)

(Fig. 2D). Thus, Nav activity is specifically associated with

invasion in these cells. We next generated two H460 dilution

clones on the basis of high versus low Nav activity (Fig. 2E). In

agreement with the pharmacology, invasion was enhanced in the

‘high’ compared with the ‘low’ clone cells (Fig. 2D). The relatively

modest enhancement of invasion seen in WT H460 cells treated with

veratridine, or, in the high versus low clone cells, reflects the

similarly modest increases in current density.

Nav are usually expressed in excitable cells (neurons and

muscle), where they are activated by depolarisation of the cell

membrane in response to action potentials (Catterall, 2000).

However, cancerous cells are most commonly of epithelial origin

(non-excitable), raising the question; how are Nav activated? In

other invasive cancer cells, a small INa window current at the

resting membrane potential (Em) of cells has been postulated to

produce sufficient Na+ influx to promote invasion (Gillet et al.,

Fig. 1. Characterisation of H460 and A549 NSCLC cell lines. (A) Histogram showing average maximum peak current amplitude Imax for inward Na+ current and

uncharacterised outward currents in NSCLC cell lines at 210, 0 and +10 mV. Currents were recorded using the IonWorksH QuattroTM Automated Patch Clamp

System (n$40 for all cell lines). (B) Average current-density–voltage (I–V) curves for H460 (n517) and A549 (n516) cells. Continuous lines indicate Boltzmann curve

fits using the Boltzmann function described in Materials and Methods. Currents were evoked using 30-millisecond depolarising voltage steps in 5-mV intervals

(290 to +70 mV) from a holding potential Vh5 290 mV. (C) Representative current traces from H460 and A549 cells. (D) Proliferation of H460 and A549 cells,

recorded over 144 hours, measured as percent change in confluence from time 0 hours (n516 wells per cell line and at least two separate experiments). (E) H460 and

A549 cell migration, recorded over 58 hours using the scratch-wound assay, measured as percent change in wound confluence (n58 wells per cell line, two separate

experiments). (F) MatrigelTM invasion of H460 and A549 cells, recorded after 48 hours (n59 for both cell lines, ***P,0.001, Student’s t-test).

Journal of Cell Science 126 (21)4940

Journ

alof

Cell

Scie

nce

2009; Roger et al., 2007). As shown in Fig. 2F, H460 cells mayalso possess a small INa window current (between 240 and210 mV), where Nav are partially activated but not fully

inactivated. Notably, the Em of these cells (22764 mV) lieswithin this voltage range, thus, allowing Na+ influx (Fig. 2G).However, the more hyperpolarised Em of weakly invasive A549

cells (23663 mV) is consistent with the lack of Nav channelactivity in these cells. TTX-induced Nav block hyperpolarised theEm of H460 cells to 23761 mV (similar to that of A549 cells),

where Na+ influx is predicted to be negligible. By contrast, when thecell membrane was depolarised to 22361 mV by using veratridine,INa,P was enhanced. Consistent with these findings, the intracellularNa+ concentration [Na+]i, was ,2-fold higher in H460 than A549

cells (22.364.3 mM versus 9.763.2 mM; Fig. 2H). Moreover, inTTX-treated H460 cells, [Na+]i was reduced to 10.862.8 mM,although veratridine had no significant effect (28.864.0 mM).

Nav1.7 underlies Nav current and promotes the invasivecapability of H460 cellsNav channels typically comprise one pore-forming a subunit andone or two auxiliary b subunits that modulate channel gating and

cell surface expression (Catterall, 2000; Joho et al., 1990). b

subunits, particularly b1, also function as cell adhesion molecules

(CAMs) (Brackenbury and Isom, 2008; Chioni et al., 2009; Isom,

2001; Isom, 2002; Patino and Isom, 2010). Nine a- and four b-

subunit isoforms have been identified (Catterall et al., 2005). Of

these, Nav1.5, Nav1.8 and Nav1.9 are TTX-resistant (EC5055.7–

60 mM), whereas the remainder are TTX-sensitive (EC5054–

25 nM). Since 0.5 mM TTX abolished INa in H460 cells, we

measured mRNA levels for all TTX-sensitive Nav a subunits, using

quantitative PCR (qPCR) (Fig. 3A). We also assessed mRNA

expression of the four known b subunits (Fig. 3A). In strongly

invasive H460 cells, Nav1.7 mRNA expression was ,4-fold higher

compared with other a subunit isoforms, at levels comparable with

functional expression of Nav in SH-SY5Y neuroblastoma cells. Low

mRNA expression of all Nav a subunits was seen in A549 cells,

consistent with their lack of INa. Western immunoblotting (Fig. 3B)

and immunocytochemistry (Fig. 3C) also confirmed the presence of

Nav1.7 protein in H460 but not in A549 cells. Furthermore, Nav1.7

mRNA expression was ,60% lower in the ‘low’ versus ‘high’ H460

dilution clone, consistent with the difference in INa (Fig. 3D).

Transfection of H460 cells with small interfering RNA (siRNA)

against Nav1.7 (SCN9A) completely abolished INa (Fig. 3E,F) and

reduced the invasive capability of the cells by 50.261.8% (Fig. 3G),

indicating that the functional expression of Nav1.7 is necessary for

Nav-mediated invasion of H460 cells.

H460 cells exhibited very low expression of all Navb subunit

mRNAs (Fig. 3A), whereas A549 cells expressed high levels of

b1 mRNA (,8-fold more than H460 cells; Fig. 3A). Consistent

with a role for the Navb subunit in cell adhesion (Brackenbury

and Isom, 2008; Chioni et al., 2009; Isom, 2001; Isom, 2002;

Patino and Isom, 2010), in A549 cells, adhesion was

Fig. 2. Effects of tetrodotoxin and veratridine on Nav channel activity,

proliferation, migration and on invasion of H460 cells. (A) Representative

traces showing the effects of tetrodotoxin (TTX, 0.5 mM, n55) and

veratridine (Ver, 50 mM, n56) on the Nav current at +10 mV.

(B) Lack of effect of 0.5 mM TTX and 50 mM veratridine on cell proliferation

over 120 hours (n58 wells for each condition, two separate experiments).

(C) Lack of effect of 0.5 mM TTX (closed squares) and 50 mM veratridine

(open circles) on migration, over 58 hours (n58 wells for each condition, two

separate experiments). (D) Effect of 0.5 mM TTX and 50 mM veratridine

(Ver) on MatrigelTM invasion, after 48 hours. Invasion in two H460 dilution

clones with high versus low Nav expression and activity are shown for

comparison. n59 for all conditions; *P,0.05, **P,0.01, one-way ANOVA

and SNK correction. (E) Average current-density–voltage

(I–V) relationships for Nav currents in high (open square, n59) and low

(closed square, n510) H460-cell dilution clones, recorded using conventional

patch clamp technique (*P,0.05, Student’s t-test). Continuous lines indicate

Boltzmann curve fits using as described in Materials and Methods. Inset:

representative current traces from high versus low clone cells. Currents were

evoked using 30-millisecond depolarising voltage steps in 5-mV intervals

(290 to +70 mV), from Vh5 290 mV. (F) Average conductance-voltage

(conductance; squares, n517) and steady-state inactivation-voltage

(availability; circles, n510) curves for INa in H460 cells. Continuous lines

indicate Boltzmann curve fits using the functions described in Materials

and Methods. (G) Average resting membrane potential Em in H460 cells,

A549 cells and H460 cells treated with 0.5 mM TTX or 50 mM veratridine

(Ver) for 2–3 minutes. n510 for all conditions (*P,0.05, **P,0.01,

***P,0.001, one-way ANOVA and SNK correction). (H) Intracellular Na+

concentration [Na+]i, in control versus TTX-treated (0.5 mM) or veratridine-

treated (50 mM, Ver) H460 cells and control A549 cells. [Na+]i was monitored

using the ratiometric fluorescent dye SBFI (n55 for all conditions,

**P,0.01, one-way ANOVA and SNK correction). CTL, untreated control

H460 cells.

Nav1.7 in lung cancer 4941

Journ

alof

Cell

Scie

nce

approximately double than that of H460 cells (Fig. 4B).

Moreover, inhibiting the expression of the b1 subunit by using

siRNA against SCN1B resulted in a modest decrease in adhesion

and a concurrent increase in invasion compared with wild-type

A549 cells (Fig. 4B,C). Notably, the invasive capability of H460

cells was reduced simply by overexpressing b1-GFP (Fig. 4D,F).

Conversely, in A549 cells, TTX-sensitive invasion was enhanced

by overexpression of Nav1.7-DsRed alone (Fig. 4E,F). Thus,

functional expression of Nav1.7 provides a driving force for

NSCLC cell invasion, whereas the b1 subunit promotes cell

adhesion and reduced invasion.

Nav1.7 expression is enhanced in cancerous lung tissue

The clinical relevance of our findings was assessed by comparing

Nav1.7 protein expression in cancerous versus normal-matched

lung tissue from patient biopsies. Nav1.7 immunostaining was

markedly higher in tumour versus normal lung tissue for all

patient samples tested (Fig. 5A–C), consistent with Nav1.7

expression in H460 versus A549 cells (Fig. 5D). Notably,

Fig. 5C clearly shows disorganised tumour tissue bordering

healthy lung tissue, with a marked difference in the levels of

immunostaining for Nav1.7. Increased Nav1.7 protein expression

may thus accompany the transition from low- to high-grade

tumours. Differently staged lung cancer samples could not be

obtained, but comparison of prostate cancer tumour samples

showed negligible immunostaining for Nav1.7 in low-grade

tumours, whereas in high-grade tumours Nav1.7 protein levels

were high (Fig. 5E). Like NSCLC, metastatic prostate cancer is

also associated with functional expression of Nav1.7 (Diss et al.,

2001; Diss et al., 2005; Nakajima et al., 2009; Yildirim et al.,

2012). Together, these data support a role for Nav1.7 in the

development of an invasive cancer phenotype in vivo.

EGF upregulates Nav1.7 expression and H460 cell invasion

EGF/EGFR signalling plays key roles in cancer progression

(Araujo et al., 2007; Cohen, 2002; Mendelsohn, 2003). In

Fig. 3. Nav1.7 is necessary for Navchannel-mediated invasion in H460 cells. (A) Relative mRNA expression for all TTX-sensitive Nav a subunits and all

auxiliary Nav b subunits in A549 and H460 NSCLC cells, and in positive control SH-SY5Y cells. All expression data were normalised to 18S rRNA expression

(n56 for all primer sets, *P,0.05, Student’s t-test). (B) Representative western immunoblots showing expression of Nav1.7 (upper) and b-actin (lower)

proteins in Nav1.7-negative (HEK-293) and Nav1.7-positive (HEK-293 cells stably transfected with Nav1.7, HEK-Nav1.7) control cells, A549 cells, H460 cells

and H460 cells transfected with 5 nM siRNA directed against Nav1.7 (n53 for all blots). (C) Representative fluorescence images showing cellular distribution of

Nav1.7 protein in Nav1.7-positive (HEK-Nav1.7) and Nav1.7-negative (HEK-293) control cells, and in H460 versus A549 cells. Nav1.7 was stained using a

Nav1.7-specific antibody recognising a C-terminal intracellular epitope (green). CTL 1, no primary antibody incubation; CTL 2, no secondary antibody incubation

(n$10 for all cell lines; scale bars: 10 mm; blue, DAPI nuclear staining. (D) Relative Nav1.7 mRNA expression in high and low H460 cell dilution clones

(n56 for both clones, **P ,0.01, Student’s t-test). Inset: representative western immunoblots showing Nav1.7 (upper) and b-actin (lower) protein expression in

high and low dilution clones (n53 for both blots). (E) Relative Nav1.7 mRNA expression for control H460 cells (CTL), H460 cells transfected with 5 nM

scrambled siRNA (Scrambled) and H460 cells transfected with 5 nM siNav1.7 (n56 for all conditions, ***P,0.001, one-way ANOVA and SNK correction).

(F) Average current-density–voltage (I–V) plots for control untransfected (open squares, n510), and H460 cells transfected with 5 nM scrambled siRNA (closed

squares, n510) or 5 nM siNav1.7 (open circles, n58). Continuous lines indicate Boltzmann curve fits as described in Materials and Methods. Inset: representative

current traces from untransfected and 5 nM siNav1.7-transfected H460 cells. Currents were evoked using 30-millisecond depolarising steps in 5-mV intervals

(290 to +70 mV), from Vh5 290 mV. (G) Relative MatrigelTM invasion in H460 cells; untransfected (CTL), transfected with 5 nM scrambled siRNA

(Scrambled) or 5 nM siNav1.7. n59 for all conditions, ***P,0.001, one-way ANOVA and SNK correction.

Journal of Cell Science 126 (21)4942

Journ

alof

Cell

Scie

nce

NSCLC, EGFR overexpression is associated with particularlyaggressive malignancies (Mendelsohn, 2003). To assess the role

of EGFR signalling in the upregulation of Nav1.7 and the

subsequent invasion in NSCLC, we initially compared Nav1.7

mRNA expression in H460 cells following treatments with EGFor EGFR signalling modulators (Fig. 6A). Serum starvation

(48 hours) reduced Nav1.7 mRNA levels by 81.261.1%

compared with control cells maintained in complete medium.

In contrast, addition of EGF (100 ng.ml21, 24 hours) following24 hour serum starvation, fully restored Nav1.7 mRNA

expression. Conversely, the EGFR inhibitor gefitinib (1 mM,

24 hours), in complete medium reduced Nav1.7 mRNAexpression to serum-starved levels. Moreover, gefitinib blocked

EGF-mediated enhancement of Nav1.7 mRNA expression in

these cells. The Nav1.7 protein levels mirrored these changes in

mRNA expression (inset Fig. 6A).

To avoid adverse effects of serum starvation on the integrity of

cell membranes, electrophysiology was performed on H460 cells

maintained in the presence of serum. Under these conditions,

EGF (24 hours) had a negligible effect on INa (Fig. 6B),

presumably because EGF-mediated signalling is already close

to its maximum under control conditions. However, in the

presence of either gefitinib or anti-EGF function-blocking

antibody (10 mg.ml21), INa was almost completely abolished.

The concurrent changes in Nav1.7 mRNA, protein and INa

(current density, pA.pF21) suggest that EGF/EGFR signalling

controls transcriptional regulation of Nav1.7 and, hence, numbers

of functional channels at the cell surface. Growth factor

signalling can, however, induce rapid post-translational

regulation of ion channels within minutes, e.g. phosphorylation

of channels at the cell surface (Martin et al., 2006; Woodall et al.,

2008) and/or rapid trafficking of channels to the cell surface

(Kanzaki et al., 1999). However, because acute (10-minute)

application of gefitinib had no effect on INa (Fig. 6C), we

conclude that endogenous EGF/EGFR signalling controls

transcriptional rather than post-translational regulation of Nav1.7.

Fig. 4. Reciprocal expression of Nav1.7 and b1 subunits

regulates invasion and adhesion. (A) Relative expression of Nav

b1 subunit mRNA in control A549 cells versus A549 cells

transfected with 5 nM siRNA against Nav b1 (siSCN1B), or

scrambled siRNA (n56 for all conditions, ***P,0.001, one-way

ANOVA and SNK correction). (B) Effect of b1-siRNA on A549 cell

adhesion, analysed by Crystal Violet staining (n58 for all

conditions, **P,0.01, ***P,0.001, one-way ANOVA and SNK

correction). Adhesion in H460 cells is shown for comparison.

(C) Effect of siSCN1B on A549 cell MatrigelTM invasion after

48 hours (n59 for both conditions, *P,0.05, Student’s t-test).

(D) Relative invasion into MatrigelTM of H460 cells transfected with

either control GFP (CTL) or b1-GFP (H460 + b1-GFP) (n54 for all

conditions, **P ,0.01, Student’s t-test). (E) Relative invasion into

MatrigelTM of A549 cells transfected with GFP control (CTL) or

Nav1.7-DsRed in the absence (A549 + Nav1.7-DsRed) or presence

of 0.5 mM TTX (A549 + Nav1.7-DsRed + TTX). n54 for all

conditions, **P ,0.01, one-way ANOVA and SNK correction).

(F) Fluorescence images for H460 cells (left) and A549 cells (right)

transfected with b1-GFP and Nav1.7-DsRed, respectively (scale

bars: 50 mm).

Fig. 5. Nav1.7 protein expression is higher in

cancerous compared with normal-matched human

lung tissue. Representative images showing Nav1.7-

immunostaining (DAB+-stained areas, brown) from

sections of the following formalin-fixed, paraffin-

embedded specimens: (A–C) normal versus cancerous

lung tissue from three patients (P1–P3), (D) weakly

invasive A549 cells compared with strongly invasive

H460 cells, (E) low- versus high-grade prostate tumour

tissue microarray preparations. (F) Control

untransfected HEK-293 cells (negative control) and

HEK-293 cells stably transfected with Nav1.7 (positive

control) (n53 for all preparations, scale bars: 200 mm).

Nav1.7 in lung cancer 4943

Journ

alof

Cell

Scie

nce

H460 cell proliferation, migration and invasion were all

upregulated by EGF/EGFR signalling, whereas Nav contributed

only to invasion (Fig. 6D–F). Since inhibition of Nav (TTX), EGFR

(gefitinib), or combined EGF/TTX treatments all result in ,40%

inhibition of invasion compared with control untreated cells, we

infer that the pro-invasive response to EGF is mediated exclusively

via Nav activity. Notably, however, neither gefitinib nor TTX

completely suppressed invasion. Thus, although EGF/EGFR/Nav

signalling accounts for ,40–50% of invasion, other cellular factors

must also contribute to the pro-invasive capabilities of these cells.

Finally, we examined the involvement of the signalling

pathways downstream of EGFR. Four main pathways are

associated with EGFR signalling: Jak/Stat, PLCc, PI3-K/Akt

and ERK1/2 (Oda et al., 2005). Of these, we focused on the PI3-

K/Akt and ERK1/2 signalling cascades, which modulate ion

channels in excitable cells (Adams et al., 2000; Black et al., 2008;

Persson et al., 2011; Qiu et al., 2003; Smani et al., 2010;

Stamboulian et al., 2010; Woodall et al., 2008) and are intimately

involved in cancer progression (Fremin and Meloche, 2010;

Keshet and Seger, 2010; Li et al., 2005; Stahl et al., 2004).

Western immunoblotting confirmed basal activity of both

phospho-ERK1/2 and phospho-Akt in H460 cells (Fig. 7A).

U0126 inhibited Nav1.7 mRNA expression but wortmannin had

no effect, implying that ERK1/2 (not PI3-K) controls Nav1.7

expression (Fig. 7B). Effects on INa were initially screened using

IonWorksH Automated Patch Clamp (Fig. 7C). As with Nav1.7

mRNA expression, U0126 inhibited mean INa by 44% from

0.3960.05 nA (control) to 0.2260.02 nA, whereas wortmannin

application had no effect. These data were further supported by

conventional patch clamp recordings (Fig. 7D). Consistent with

these effects on Nav1.7 expression and activity, H460 cell

invasion was unaffected by wortmannin but inhibited by U0126

(Fig. 7E). No additive effect of combining U0126 with TTX was

observed, suggesting that regulation via ERK1/2 is crucial for

Nav1.7-mediated invasion of H460 cells.

DiscussionWe have shown that EGF/EGFR signalling via a U0126-sensitive

ERK1/2 pathway controls transcriptional upregulation of Nav1.7

to promote cellular invasion in NSCLC cell lines. Moreover,

immunohistochemistry of patient biopsies provides evidence

supporting the clinical relevance of Nav1.7 protein expression in

NSCLC. Thus, we identify Nav1.7 as a new downstream effector

of the EGF/EGFR pathway with potential as a target for

therapeutic intervention and/or as a diagnostic or prognostic

marker in NSCLC.

The necessity of Nav1.7 functional expression for invasion of

NSCLC cells agrees with other work showing the crucial role of

Fig. 6. Modulation of EGF/EGFR signalling regulates functional expression of Nav1.7 and invasion in H460 cells. (A) Relative Nav1.7 mRNA expression

showing the effect of 48-hour serum starvation, stimulation with 100 ng.ml21 EGF for 24 hours post serum starvation, treatment with 1 mM gefitinib for 24 hours

in the presence of serum, and co-application of 100 ng.ml21 EGF and 1 mM gefitinib for 24 hours post serum starvation (n56 for all conditions, ***P,0.001,

one-way ANOVA and SNK correction). Inset: representative western immunoblots showing expression of Nav1.7 (upper) and b-actin (lower) in H460 cells

subjected to the following treatments: serum starved for 48 hours (SS); 100 ng.ml21 EGF for 24 hours post serum starvation (EGF); 1 mM gefitinib (Gef) for

24 hours in the presence of serum (n53 for both blots). (B) Average current-density–voltage (I–V) plots for control untreated H460 cells (open squares, n510) and

H460 cells treated with 100 ng.ml21 EGF (closed squares, n511), 1 mM gefitinib (open circles, n512) or 10 mg.ml21 anti-EGF function blocking antibody

(closed circles, n510) for 24 hours in the presence of serum (***P,0.001, one-way ANOVA and SNK correction). Inset: representative current traces from

untreated and gefitinib-treated H460 cells. (C) Average current-density–voltage (I–V) plots for control untreated (open squares, n511), and acutely treated

(10-minute pre-incubation) with 1 mM gefitinib (closed squares, n512) H460 cells. Inset: representative current traces from untreated and acute gefitinib-treated

H460 cells. Continuous lines indicate Boltzmann curve fits as described in Materials and Methods. Currents were evoked using 30-millisecond depolarising steps

in 5-mV intervals (290 to +70 mV) from Vh5290 mV. (D) Cell proliferation over 120 hours in control untreated (CTL), TTX-treated (0.5 mM), EGF-treated

(100 ng.ml21), EGF/TTX co-treated, and gefitinib-treated (1 mM) H460 cells (n$8 wells for each condition, at least two separate experiments). (E) Migration

over 58 hours in control untreated (CTL), TTX-treated (0.5 mM), EGF-treated (100 ng.ml21), EGF/TTX co-treated, and gefitinib-treated (1 mM) H460 cells (n58

wells for each condition, two separate experiments). (F) H460 cell MatrigelTM invasion after 48 hours in control untreated (CTL), 0.5 mM TTX-treated,

100 ng.ml21 EGF-treated, 1 mM gefitinib-treated (Gef) and EGF/TTX co-treated cells (n59 for all conditions, *P,0.05, **P,0.01, ***P ,0.001, one-way

ANOVA and SNK correction).

Journal of Cell Science 126 (21)4944

Journ

alof

Cell

Scie

nce

Nav – particularly Nav1.5 and Nav1.7 – in metastatic behaviours

of several cancers, including NSCLC. Nav1.7 mRNA expression

in H460 cells has been reported (Roger et al., 2007) but its

predominant role in Nav-dependent invasion of these cells has not

been shown before. In breast cancer, the Nav b1 subunit is

reported to act as a CAM, being highly expressed in non-invasive

cells but not in strongly invasive cells that exhibit reduced cell

adhesion (Brackenbury and Isom, 2008; Chioni et al., 2009). We

see similar trends in the reciprocal expression of the Nav b1 and

Nav1.7 subunits in non-invasive A549 versus highly invasive

H460 NSCLC cells. Moreover, regulation of Nav b1 and Nav1.7

expression alone is sufficient to alter significantly the invasive

properties of H460 and A549 cells. Thus, the balance of Nav b1

versus a subunit expression also appears to regulate the invasive

potential of NSCLC cells.

To date, there has been little detailed characterisation of the

mechanisms that drive functional expression of Nav in cancerous

cells (Ding et al., 2008; Fraser et al., 2010; Uysal-Onganer and

Fig. 7. EGF upregulates Nav1.7 expression and the subsequent H460 cell invasion through ERK1/2 signalling. (A) Representative western immunoblots

showing the levels of active phospho-ERK1/2 (pERK1/2) versus total ERK (top), and active phospho-Akt (pAkt) versus total Akt (bottom) proteins in

control untreated (CTL), U0126- (10 mM) and wortmannin-treated (100 nM, Wort) H460 cells after 24 hours (n53 for all blots). (B) Relative Nav1.7 mRNA

expression in H460 cells showing the effect of treatment with U0126 (10 mM) or wortmannin (100 nM, Wort) for 24 hours compared with control untreated

(CTL) H460 cells (n56 for all conditions, *P,0.05, one-way ANOVA and SNK correction). (C) Maximum current amplitudes (Imax) from individual H460 cells

that had been left untreated (CTL), or had been treated with U0126 (10 mM) or wortmannin (100 nM, Wort), were recorded using the IonWorksH QuattroTM

Automated Patch Clamp System (n5number of cells with TTX-inhibitable INa/total number of cells tested). (D) Average current-density–voltage (I–V) plots for

control untreated (open squares, n59) and 10 mM U0126-treated (closed squares, n511) H460 cells (**P,0.01, Student’s t-test). Continuous lines indicate

Boltzmann curve fits as described in Materials and Methods. Inset: representative current traces from untreated (CTL) and U0126-treated H460 cells. Currents

were evoked using 30-millisecond depolarising steps in 5-mV intervals (290 to +70 mV), from Vh5290 mV. (E) Relative MatrigelTM invasion of H460 cells

after 48 hours in control untreated conditions (CTL) and following treatment with 10 mM U0126, 10 mM U0126/1 mM TTX, 100 nM wortmannin (Wort)

and 100 nM wortmannin/1 mM TTX (Wort + TTX) (n59 for all conditions, *P,0.05, **P,0.01, one-way ANOVA and SNK correction).

Table 1. Primers used in qPCR to determine mRNA expression of TTX-sensitive Nav channel a and b subunits in human

NSCLC cell lines

Sense primer (59-39) Anti-sense primer (59-39)

Nav1 a subunits

Gene symbol Subunit

SCN1A Nav1.1 ATGATCTGCCTATTCCAAATTACAA GGTTCCCACAGTCTCCCTTASCN2A Nav1.2 CGTGATGGTGATGTGTTTGTG TCTCTGTCTTGTTATAGGCACTGSCN3A Nav1.3 GAATAGTTGTTCCACTTTCTGCTG ACATGCACCACAGGATAAAATAACSCN4A Nav1.4 TGTCTGCTTGTATGCTTTTATAGG CTCCAGTACACAGTGGTTCACSCN8A Nav1.6 GCGTTGAGGCACTACTACTTC TCCCACAATGGAGAGGATGACSCN9A Nav1.7 AGACCTCTCTTTCCATGTAGATTAC TGTAACTGCCTTTCTGTATTGTTG

Nav1 b subunits

Gene symbol Subunit

SCN1B b1 GTATGTGCTCATTGTGGTGTTG CCAGGTATTCCGAGGCATTCSCN2B b2 AGGTTCCAACTGACAGAAACTG ATCATAGACCAGGACACAGAGGSCN3B b3 CACCAGCCTACTTCCAATCTC TCTAAGCCCTTTAATAAGCAACATCSCN4B b4 CCAAGTCTGTCCTGTCTTCATC GGTGGGATGGAAAGAAAGAGAG

Nav1.7 in lung cancer 4945

Journ

alof

Cell

Scie

nce

Djamgoz, 2007). To address this crucial issue, we focused on the

role of EGF/EGFR signalling, which not only plays key roles in

NSCLC (Fujimoto et al., 2005; Mendelsohn, 2003; Volante et al.,

2007) but also regulates transcription and activity of various ion

channels, including Nav (Adams et al., 2000; Black et al., 2008;

Ding et al., 2008; Liu et al., 2007; Persson et al., 2011; Qiu et al.,

2003; Smani et al., 2010; Stamboulian et al., 2010; Uysal-Onganer

and Djamgoz, 2007; Woodall et al., 2008). In H460 cells, our data

suggest that EGF/EGFR signalling via ERK1/2 tonically

upregulates the functional expression of Nav1.7 to enhance Na+

influx and, hence, invasion. Whereas proliferation, migration and

invasion of H460 cells are all promoted via the EGF/EGFR

pathway, only invasion is sensitive to Nav1.7 inhibition. Since

blocking of EGFR, ERK1/2 or Nav1.7 inhibits invasion by ,40–

50% – with no additive effects of combined treatments – we infer

that EGF/EGFR–ERK-mediated invasion in these cells is most

likely to occur via upregulation of Nav1.7. However, since this

pathway promotes only 40–50% of H460 cell invasion, other

cellular factors must also be involved. Vascular endothelial,

fibroblast and platelet-derived growth factors all play roles in

NSCLC (Ballas and Chachoua, 2011) and are linked with Nav

function (Andrikopoulos et al., 2011; Goldfarb et al., 2007;

Hilborn et al., 1998). Although further work is required to establish

the relevance of such growth factors, it is conceivable that Nav1.7

is a convergence point in several cancer signalling pathways.

Whereas transcriptional upregulation is necessary to promote

sufficient functional expression of Nav protein at the cell surface,

our data suggest it is the influx of Na+ through Nav1.7 and the

consequent depolarisation of the cell membrane, which appears

to be essential for invasion. Although inhibition of EGF/EGFR,

ERK1/2 and Nav1.7 consistently reduced invasion by ,40–50%,

the effects on INa varied from complete loss of current (TTX) to

47% inhibition (U0126). This implies that not all available

channels need to be functional to enable sufficient Na+ influx for

invasion. Indeed, in agreement with others (Gillet et al., 2009;

Roger et al., 2007), we also found evidence of continuous Na+

influx in H460 cells, when Nav channels are partially activated

at resting membrane potential. Furthermore, block of Nav activity

hyperpolarises the plasma membrane and reduces [Na+]i, whereas

enhanced channel opening depolarises the membrane potential

and raises [Na+]i. Thus, a positive-feedback mechanism appears

to operate, where the partial opening of Nav at resting potential

allows Na+ influx, which – in turn – keeps the plasma membrane

sufficiently depolarised to maintain a continuous influx of Na+.

Under physiological conditions, this influx of Na+ is sufficient to

maintain the invasive capability of cells. Endogenous modulators

of Nav1.7, e.g. ERK1/2, can thus provide an exquisite mechanism

for fine-tuning of EGF/EGFR-mediated invasion in NSCLC.

Similarly, other transport proteins that allow Na+ influx are also

expected to promote invasive behaviour in NSCLC. For example,

in prostate cancer cells, overexpression of exogenous Nav1.4

enhances their invasion (Bennett et al., 2004). In MDA-MB-231

breast cancer cells, Nav1.5 is postulated to be functionally

coupled with the Na+/H+ exchanger NHE1. This exchanger

extrudes H+ to cause extracellular acidification, thereby

providing an optimal environment for pH-dependent activity of

cysteine cathepsins and proteolysis of the ECM, leading to

enhanced cell invasion (Brisson et al., 2011; Gillet et al., 2009).

Na+ influx has also been suggested to impact on intracellular

Ca2+ homeostasis, primarily through reversal of Na+/Ca2+

exchanger NCX activity (Blaustein and Lederer, 1999). Thiscould have numerous effects, including altered gene expression.

Regardless of how increased [Na+]i promotes invasion, wehave demonstrated unequivocally that functional expression ofNav1.7 is associated with increased invasive potential of NSCLC

cell lines. Whereas the use of small-molecule EGFR inhibitors,such as gefitinib and erlotinib, has substantial therapeutic benefitsfor many patients with advanced NSCLC, drug resistance

remains a significant problem (Cataldo et al., 2011; Domingoet al., 2010; Lynch et al., 2004; Paez et al., 2004). Drugs thattarget Nav1.7 activity could, thus, prove useful in conjunction

with existing therapies. Nav-specific blockers are already inclinical use as local anaesthetics and, more recently, Nav1.7-specific inhibitors are being developed for the treatment of pain

(Bregman et al., 2011; Chowdhury et al., 2011; Clare, 2010;Ghelardini et al., 2010). Given its functional significance andmarked upregulation in tumour tissue, we suggest that Nav1.7

represents an important new target for therapeutic interventionand/or as a diagnostic and/or prognostic marker in NSCLC.

Materials and MethodsMaterials

Primary antibodies were obtained as follows: anti-Nav1.7 (westernimmunoblotting; NeuroMab, CA, USA), anti-Nav1.7 (immunocyto-/histochemistry; AstraZeneca, UK), anti-phospho-ERK1/2 (Sigma-Aldrich orPromega, UK), anti-total ERK1/2 (Promega, UK), anti-phospho-Akt and anti-total Akt (Cell Signalling Technology, UK), anti-b-actin (Sigma-Aldrich, UK).Anti-EGF function-blocking antibody and EGF were from Millipore, UK.Secondary antibodies were obtained as follows: FITC-conjugated anti-rabbit IgG(Jackson Immunoresearch, UK), horseradish peroxidise (HRP)-conjugated anti-rabbit and anti-mouse IgGs (Dako, UK). All oligonucleotide primers for qPCRwere designed and manufactured by PrimerDesign, UK. Tetrodotoxin (TTX),veratridine and wortmannin were from Sigma-Aldrich, UK. U0126 was fromPromega, UK and gefitinib was from AstraZeneca, UK.

Cell culture

A549 and H460 cells were obtained from AstraZeneca, UK, were geneticallytested and authenticated using the PowerPlexH 16 System (Promega, UK) and werenot cultured for more than 6 months. A549 cells were cultured in Dulbecco’smodified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum(FBS; Gibco/Invitrogen, UK) and 50 U.ml21 penicillin/50 mg.ml21 streptomycin(Sigma-Aldrich, UK). H460 cells were cultured in RPMI-1640 medium (Gibco/Invitrogen, UK) supplemented with FBS and penicillin/streptomycin. Cells weremaintained at 37 C, 5% CO2. Cells were seeded and maintained in completemedium at least overnight, prior to any treatment. All pharmacological agents weredissolved in appropriate solvents and diluted in cell culture medium.

Electrophysiology

Recordings of inward Nav channel current, INa, from A549 and H460 cells weremade using the whole-cell patch clamp technique. The extracellular solutioncontained (in mM): NaCl 140, CsCl 3, MgCl2 1, CaCl2 2, glucose 11, HEPES 10adjusted to pH 7.4 with NaOH and 320 mOsm.litre21 with sucrose. The internalsolution contained (in mM): CsCl 135, NaCl 5, CaCl2 0.37, MgCl2 1, HEPES 10,EGTA 5, adjusted to pH 7.2 with CsOH and 310 mOsm.litre21 with sucrose.Before recording, cells were replated onto 0.01% poly-L-lysine-coated coverslips(Sigma-Aldrich, UK) and incubated at 37 C, 5% CO2 for at least 1 hour. Patchpipettes of resistance 2–5 MV were pulled from thin-walled borosilicate glasstubing (Intracel, UK), fire-polished and coated with Sigmacote (Sigma-Aldrich,UK). An Axopatch 200B amplifier (Molecular Devices, CA, USA) was used forrecordings which were filtered at 2 kHz and digitised at 5–10 kHz using a Digidata1322A A/D converter (Molecular Devices, CA, USA). Cells were held at apotential Vh, of 290 mV, with holding current less than 250 pA and seriesresistance less than 10 MV. Currents were recorded with cell capacitancecompensated and leak currents subtracted using a P/4 subtraction protocol.Series resistance was compensated up to 80%. Standard current-voltage (I–V)protocols used 30-millisecond sweeps from 290 to +70 mV in 5 mV steps, fromVh 290 mV. I–V curves were fitted with a Boltzmann function: I5G(V-Vrev)/1+exp(-(V-V50,act)/k), where Vrev is reversal potential, V50,act is voltage for halfmaximal current activation; G is conductance and k is slope factor. Conductance–voltage relationships were derived from individual I–V plots and fitted with aBoltzmann function: G/Gmax51/1+exp((V50,act-V)/k), where Gmax is maximalconductance. Peak conductance G, at each test potential was calculated from the

Journal of Cell Science 126 (21)4946

Journ

alof

Cell

Scie

nce

corresponding peak current I, as follows: G5I/(V-Vrev). Steady-state inactivationprotocols comprised a test pulse of +10 mV following 500-millisecond pre-pulsepotentials between 2120 and +40 mV, from Vh 290 mV. Peak current valueswere normalised to Imax and curves fitted with the following Boltzmann function:I/Imax51/1+exp((Vt-V50,inact)/k), where Imax is maximum peak current and V50,inact,the midpoint of voltage-dependent inactivation. Resting membrane potential (Em)was estimated by current clamp in physiological saline solutions (PSS), using high-resistance patch pipettes (.10 MV). Extracellular PSS contained (in mM): NaCl140, KCl 4, MgCl2 1, CaCl2 2, glucose 11, HEPES 10 adjusted to pH 7.4 withNaOH and 320 mOsm.litre21 with sucrose. Internal PSS contained (in mM): K-glutamate 125, KCl 20, CaCl2 0.37, MgCl2 1, K-ATP 1, EGTA 1, HEPES 10adjusted to pH 7.2 with KOH and 310 mOsm.litre21 with sucrose. Dataacquisition and analysis were performed using pCLAMP (v9.0, MolecularDevices) and Origin (v8.0, Microcal Software).

IonWorksH electrophysiology

High-throughput electrophysiology used the IonWorksH QuattroTM AutomatedPatch Clamp System (Molecular Devices, CA, USA). The extracellular solutionwas phosphate-buffered saline (pH 7.4). Internal solution contained (in mM): K-gluconate 100, KCl 40, MgCl2 3.2, HEPES 10, EGTA 3, adjusted to pH 7.2 withKOH and 310 mOsm/litre with sucrose. Cells were resuspended in PBS at 16106

cells.ml21. Seal resistances ranged from a user-defined lower limit of 50 MV to,250 MV. Data were rejected if the pre-compound amplitude of the Na+ currentwas less than 50 pA or if the total resistance (parallel seal plus membraneresistance) decreased by more than 50% from pre- to post-compoundmeasurement. Electrical access to the interior of cells was achieved using thepore-forming antibiotic amphotericin B (10 mg/100 ml internal solution). INa

sensitivity to TTX was determined by comparing peak INa before and after a 2-minute incubation with 1 mM TTX. All IonWorksH data are presented asmaximum current amplitude (Imax). The IonWorksH platform does not provide cellcapacitance measurements. Thus, current densities (pA.pF21) cannot be calculated.

Quantitative PCR

Total RNA extraction was performed using the RNeasy kit (Qiagen, UK). RNAyield and purity were determined by spectrophotometry and only samples with anA260:A280 ratio above 1.8 were used for experiments. Total RNA (1 mg) wasreverse transcribed using the PrecisionTM Reverse Transcription Kit(PrimerDesign, UK) and qPCR performed using cDNA obtained from 25 ng oftotal RNA. qPCR was performed using an ABI 7500 Sequence Detection Systemwith software version 1.2.3 (Applied-Biosystems, UK). All primers were specificfor each gene of interest (Table 1). Amplification and detection were carried out in96-well Optical Reaction Plates (Applied-Biosystems, UK) with SYBRH greenPrecisionTM 26qPCR Mastermix (PrimerDesign, UK). All expression data werenormalised to 18S rRNA expression, as determined by an initial reference genescreen using the geNormTM Housekeeping Gene Selection Kit (PrimerDesign,UK). Primer-specificity was confirmed at the end of each qPCR run through thegeneration of single peaks in melt-curve analyses. Data analysis was performedusing the 22DDCT method.

Western immunoblotting

Cells grown in 10-cm diameter Petri dishes were washed in PBS and lysed on icein RIPA buffer with cOmplete Mini EDTA-free protease inhibitor cocktail (Roche,UK). Cell lysates were passed through a fine-gauge syringe needle 106to sheargenomic DNA and centrifuged at 1000 g for 30 seconds. Protein samples wereseparated by 7–10% SDS-PAGE for 90 minutes at 160 V and transferred byelectrophoresis (110 V for 90 minutes) onto a nitrocellulose membrane (Whatman,UK). Membranes were ‘blocked’ at room temperature (RT) for 1 hour in 5% (w/v)BSA in Tris-buffered saline (TBS) with 0.1% Tween-20 (TTBS), washed 36withTTBS and probed with primary antibody (1:1000–5000) in 5% BSA/TTBS at 4 Covernight. Membranes were then re-washed with TTBS 36and incubated withappropriate HRP-conjugated secondary antibody (1:2000) in 5% BSA/TTBS at RTfor 90 minutes. After further washing with TTBS, blots were treated with WesternLightningH ECL reagent (PerkinElmer, UK) and immunoreactive proteins detectedby exposure to film (GE Life Sciences, UK). In all cases, loading controls of b-actin or total-protein (for phosphorylated proteins) were used in parallel.

Immunocytochemistry

Cells were seeded at 36104 onto sterile 0.01% poly-L-lysine-coated 22-mm squarecoverslips and incubated for 48 hours. After washing with PBS, cells were fixedwith 4% (w/v) paraformaldehyde at RT for 20 minutes. Paraformaldehyde wasquenched with 0.1 M glycine for 10 minutes; cells were permeabilised with 0.5%saponin (10 minutes; Sigma-Aldrich, UK) and blocked with 5% BSA/PBS for1 hour. Cells were incubated at RT for 1 hour with primary antibody (1:200 in 5%BSA/PBS), washed 36 with PBS, incubated at RT for 1 hour with a FITC-conjugated anti-rabbit secondary antibody (1:1000) in 5% BSA/PBS before finalwashing in PBS. Nuclei were stained with DAPI (100 ng.ml21), prior to mountingcoverslips onto glass slides with ProLongH Gold Antifade Reagent (Invitrogen,

UK). Images were taken on a DeltaVision RT restoration microscope (AppliedPrecision, UK) using a 606oil immersion objective lens. Appropriate wavelengthfilters were used for FITC and DAPI fluorophores. Images were collected using aCoolsnap HQ camera (Photometrics, UK) with a Z optical spacing of 0.1 mm in 12sections. Raw images were deconvolved using SoftWoRxH software and displayedas maximum projections using NIH Image J (W.S. Rasband, National Institutes ofHealth, USA). To confirm primary antibody specificity, wild-type and HEK-293cells stably transfected to express Nav1.7 were used as negative and positivecontrols, respectively. Non-specific binding of primary and secondary antibodieswas assessed using the above protocol without either the primary antibody orsecondary antibody incubation steps.

Immunohistochemistry

Cell lines (H460 and A549) and cancerous versus normal tissue (prostate and lung;Tristar Technologies LLC, MD, USA) were paraffin-embedded and cut into 4-mmsections. Sections were processed on a LabVision Autostainer 360 (Thermo FisherScientific, UK) using the ChemMate EnvisionTM+ System-HRP (DAB+) kit(Dako, UK), according to manufacturer’s instructions. Sections were incubatedwith anti-Nav1.7 antibody (1:200) for 1 hour, followed by 30 minutes with HRP-labelled polymer-conjugated anti-rabbit IgG secondary antibody. Sections werecounterstained with dilute Mayer’s haematoxylin (Dako, UK). All processing wasperformed at RT. Images were taken with a light microscope and visualcomparisons were made. Negative controls (without incubation of primaryantibody) were performed for all experiments.

Functional assays

ProliferationCells were plated at 4000 cells per well into 96-well plates and cell numbersmonitored in real time by in vitro micro-imaging using an IncuCyteTM incubator(Essen BioScience, UK), allowing for hourly monitoring of cell proliferation bydetermining cell confluence.

MigrationFor scratch-wound assay, cells were seeded into 24-well culture plates at 2.56105

cells.ml21 and then grown to 100% confluence. A linear wound was introduced inthe centre of the cell monolayer. Culture medium supplemented with 1% FBS (tominimise cell proliferation) was then replaced and cell migration (wound closure)monitored using an IncuCyteTM incubator.

InvasionInvasion was analysed in 24-well plates containing BD MatrigelTM InvasionChambers (8-mm pore size polyethylene terephthalate membrane cell cultureinserts covered with a film of MatrigelTM Basement Membrane Matrix; BDBiosciences, UK). The upper compartment was seeded with 46104 viable cells inbasal culture medium. The lower compartment contained culture medium plus20% FBS as a chemoattractant. After 48 hours at 37 C, 5% CO2, inserts werewashed in PBS for 2 minutes and cells fixed with ice-cold methanol for10 minutes. Cells were then stained with haematoxylin (Sigma-Aldrich, UK) for3 minutes and invaded cells (those attached to the lower side of the membrane)were counted in the whole insert using a light microscope at 2006magnification.

Adhesion96-well plates were coated with 20 mg.ml21 fibronectin at 37 C for 1 hour, withsome wells left uncoated as negative controls. After two washes with washingbuffer (0.1% BSA in cell culture medium without serum), wells were ‘blocked’with blocking buffer (0.5% BSA in cell culture medium without serum) at 37 C,5% CO2 for 1 hour. After two washes, cells were plated at 20,000 cells per well inserum-free medium and incubated at 37 C, 5% CO2 for 30 minutes. Plates wereleft to shake at 2000 rpm for 30 seconds before being washed 36. Remaining cellswere fixed with 4% paraformaldehyde at RT for 15 minutes, washed 36 andstained with Crystal Violet for 10 minutes. Wells were washed thoroughly withwater and left to dry completely before addition of 2% SDS (30 minutes at RT).Absorbance of the resulting SDS/Crystal Violet solution was measured at 550 nmto quantify numbers of adherent cells.

For each functional assay, cells were seeded at the same densities for control(un-treated) and treated samples. Cell proliferation, migration and invasion datawere then normalised as follows: cell proliferation to 0% confluence at 0 hours,migration to 0% wound confluence at 0 hours, and invasion to the controlcondition.

Generation of dilution clones

H460 cell dilution clones were generated using a serial dilution protocol providedby Corning, UK (http://www.level.com.tw/html/ezcatfiles/vipweb20/img/img/34963/3-2Single_cell_cloning_protocol.pdf). To increase the likelihood that cellsof a particular colony originated from a single cell, selected cells were re-clonedfor a second time. For all experiments, parental control H460 cells were also

Nav1.7 in lung cancer 4947

Journ

alof

Cell

Scie

nce

included to provide a direct comparison with the standard population of H460cells. To confirm that dilution clones did not revert to their original state(maintenance of the Nav phenotype), INa was routinely recorded by patch-clampelectrophysiology prior to any experiments.

Transient transfection

siRNAH460 cells were transfected with small interfering RNAs (siRNAs) directedagainst SCN9A (Nav1.7; 59-TCGGATAGTGAATACAGCAAA-39), SCN1B

(Navb1; 59-CACATTGAGGTAGTGGACAAA-39) or control scrambled siRNAs(AllStars negative control siRNA; Qiagen, UK). Cells were seeded into 24-wellplates (16105) in 0.5 ml basal culture medium. For each well, 37.5 ng of siRNAwas diluted into 100 ml of medium without serum. HiPerFect transfection reagent(3 ml per well; Qiagen, UK) was added to diluted siRNA and mixed by briefvortexing. After 10-minute incubation at RT, transfection complexes were addeddrop-wise to cells giving a final siRNA concentration of 5 nM per well. Cells wereincubated at 37 C, 5% CO2 for 24 hours before experiments were performed.

cDNATransient transfection of H460 and A549 cells was performed at 60–70% cellconfluence using jetPEITM transfection reagent (Polyplus-transfection, France),according to manufacturer’s instructions. H460 and A549 cells were transfectedwith pEGFP-N1-Navb1 (b1-GFP; L. Isom, University of Michigan/W.Brackenbury, University of York) and pcDNA3-DsRed2-Nav1.7 [Nav1.7-DsRed;J.N. Wood, UCL; (Farmer et al., 2012)], respectively. Empty pEGFP-1 was used asa negative control. After transfection, cells were maintained for 24–48 hours incomplete medium prior to conducting experiments.

Fluorescence measurement of intracellular Na+

Intracellular Na+ concentration [Na+]i, was measured using the ratiometricfluorescent dye SBFI as described by (Roger et al., 2007). Calibration of [Na+]i

was performed in each cell by comparing fluorescence in high (20 mM) and low(10 mM) Na+ calibration solutions containing (in mM): NaCl 10 or 20, KCl 150,HEPES 5, EGTA 10, monensin 0.01, adjusted to pH 7.4 with NaOH and320 mOsm/litre with sucrose.

Data analysis

All quantitative data are presented as the means 6 standard error of the mean(s.e.m.). Statistical analysis was carried out using Student’s t-test or ANOVA(One-way with Student–Newman–Keuls post hoc correction), as appropriate(GraphPad Prism v5.0), with 95% confidence limits.

AcknowledgementsWe thank Sebastien Roger (Universite Francois Rabelais, Tours,France) for initial help with in vitro invasion assays, and HelenWombwell, Roy Milner and Michael Morton (AstraZeneca, AlderleyPark, UK) for help with IHC, antibody procurement and IonWorksHelectrophysiology, respectively.

Author contributionsExperiments were conceived, designed and interpreted by E.F., T.C.and M.M. Data acquisition and analysis were performed by T.C.Overall supervision of work was by E.F. and M.M. The paper waswritten by E.F., T.C. and M.M.

FundingBiotechnology and Biological Sciences Research Council UK, CASEStudentship to T.M.C. and AstraZeneca, UK to T.M.C. Deposited inPMC for immediate release.

Conflicts of interestThe authors disclose no potential conflicts of interest.

ReferencesAbdul, M. and Hoosein, N. (2002). Voltage-gated sodium ion channels in prostate

cancer: expression and activity. Anticancer Res. 22, 1727-1730.

Adams, J. P., Anderson, A. E., Varga, A. W., Dineley, K. T., Cook, R. G., Pfaffinger,

P. J. and Sweatt, J. D. (2000). The A-type potassium channel Kv4.2 is a substrate for

the mitogen-activated protein kinase ERK. J. Neurochem. 75, 2277-2287.

Akopian, A. N., Okuse, K., Souslova, V., England, S., Ogata, N. and Wood, J. N.

(1999). Trans-splicing of a voltage-gated sodium channel is regulated by nerve

growth factor. FEBS Lett. 445, 177-182.

Andrikopoulos, P., Fraser, S. P., Patterson, L., Ahmad, Z., Burcu, H., Ottaviani, D.,

Diss, J. K., Box, C., Eccles, S. A. and Djamgoz, M. B. (2011). Angiogenic functionsof voltage-gated Na+ Channels in human endothelial cells: modulation of vascularendothelial growth factor (VEGF) signaling. J. Biol. Chem. 286, 16846-16860.

Araujo, A., Ribeiro, R., Azevedo, I., Coelho, A., Soares, M., Sousa, B., Pinto, D.,

Lopes, C., Medeiros, R. and Scagliotti, G. V. (2007). Genetic polymorphisms of theepidermal growth factor and related receptor in non-small cell lung cancer—a reviewof the literature. Oncologist 12, 201-210.

Ballas, M. S. and Chachoua, A. (2011). Rationale for targeting VEGF, FGF, and PDGFfor the treatment of NSCLC. Onco Targets Ther. 4, 43-58.

Bennett, E. S., Smith, B. A. and Harper, J. M. (2004). Voltage-gated Na+ channelsconfer invasive properties on human prostate cancer cells. Pflugers Arch. 447, 908-914.

Black, J. A., Nikolajsen, L., Kroner, K., Jensen, T. S. and Waxman, S. G. (2008).Multiple sodium channel isoforms and mitogen-activated protein kinases are presentin painful human neuromas. Ann. Neurol. 64, 644-653.

Blandino, J. K., Viglione, M. P., Bradley, W. A., Oie, H. K. and Kim, Y. I. (1995).Voltage-dependent sodium channels in human small-cell lung cancer cells: role inaction potentials and inhibition by Lambert-Eaton syndrome IgG. J. Membr. Biol.

143, 153-163.

Blaustein, M. P. and Lederer, W. J. (1999). Sodium/calcium exchange: itsphysiological implications. Physiol. Rev. 79, 763-854.

Brackenbury, W. J. and Djamgoz, M. B. (2007). Nerve growth factor enhancesvoltage-gated Na+ channel activity and Transwell migration in Mat-LyLu rat prostatecancer cell line. J. Cell. Physiol. 210, 602-608.

Brackenbury, W. J. and Isom, L. L. (2008). Voltage-gated Na+ channels: potential forbeta subunits as therapeutic targets. Expert Opin. Ther. Targets 12, 1191-1203.

Brackenbury, W. J., Chioni, A. M., Diss, J. K. and Djamgoz, M. B. (2007). Theneonatal splice variant of Nav1.5 potentiates in vitro invasive behaviour of MDA-MB-231 human breast cancer cells. Breast Cancer Res. Treat. 101, 149-160.

Bregman, H., Berry, L., Buchanan, J. L., Chen, A., Du, B., Feric, E., Hierl, M.,Huang, L., Immke, D., Janosky, B. et al. (2011). Identification of a potent, state-dependent inhibitor of Nav1.7 with oral efficacy in the formalin model of persistentpain. J. Med. Chem. 54, 4427-4445.

Brisson, L., Gillet, L., Calaghan, S., Besson, P., Le Guennec, J. Y., Roger, S. andGore, J. (2011). Na(V)1.5 enhances breast cancer cell invasiveness by increasingNHE1-dependent H(+) efflux in caveolae. Oncogene 30, 2070-2076.

Cataldo, V. D., Gibbons, D. L., Perez-Soler, R. and Quintas-Cardama, A. (2011).Treatment of non-small-cell lung cancer with erlotinib or gefitinib. N. Engl. J. Med.

364, 947-955.

Catterall, W. A. (2000). From ionic currents to molecular mechanisms: the structureand function of voltage-gated sodium channels. Neuron 26, 13-25.

Catterall, W. A., Goldin, A. L. and Waxman, S. G. (2005). International Union ofPharmacology. XLVII. Nomenclature and structure-function relationships of voltage-gated sodium channels. Pharmacol. Rev. 57, 397-409.

Chioni, A. M., Brackenbury, W. J., Calhoun, J. D., Isom, L. L. and Djamgoz, M. B.

(2009). A novel adhesion molecule in human breast cancer cells: voltage-gated Na+

channel beta1 subunit. Int. J. Biochem. Cell Biol. 41, 1216-1227.

Chowdhury, S., Chafeev, M., Liu, S., Sun, J., Raina, V., Chui, R., Young, W., Kwan,

R., Fu, J. and Cadieux, J. A. (2011). Discovery of XEN907, a spirooxindole blockerof NaV1.7 for the treatment of pain. Bioorg. Med. Chem. Lett. 21, 3676-3681.

Clare, J. J. (2010). Targeting voltage-gated sodium channels for pain therapy. Expert

Opin. Investig. Drugs 19, 45-62.

Cohen, P. (2002). Protein kinases—the major drug targets of the twenty-first century?Nat. Rev. Drug Discov. 1, 309-315.

Diaz, D., Delgadillo, D. M., Hernandez-Gallegos, E., Ramırez-Domınguez, M. E.,

Hinojosa, L. M., Ortiz, C. S., Berumen, J., Camacho, J. and Gomora, J. C.(2007). Functional expression of voltage-gated sodium channels in primary culturesof human cervical cancer. J. Cell. Physiol. 210, 469-478.

Ding, Y., Brackenbury, W. J., Onganer, P. U., Montano, X., Porter, L. M., Bates,L. F. and Djamgoz, M. B. (2008). Epidermal growth factor upregulates motility ofMat-LyLu rat prostate cancer cells partially via voltage-gated Na+ channel activity.J. Cell. Physiol. 215, 77-81.

Diss, J. K., Archer, S. N., Hirano, J., Fraser, S. P. and Djamgoz, M. B. (2001).Expression profiles of voltage-gated Na(+) channel alpha-subunit genes in rat andhuman prostate cancer cell lines. Prostate 48, 165-178.

Diss, J. K., Stewart, D., Pani, F., Foster, C. S., Walker, M. M., Patel, A. andDjamgoz, M. B. (2005). A potential novel marker for human prostate cancer: voltage-gated sodium channel expression in vivo. Prostate Cancer Prostatic Dis. 8, 266-273.

Domingo, G., Perez, C. A., Velez, M., Cudris, J., Raez, L. E. and Santos, E. S.(2010). EGF receptor in lung cancer: a successful story of targeted therapy. Expert

Rev. Anticancer Ther. 10, 1577-1587.

Farmer, C., Cox, J. J., Fletcher, E. V., Woods, C. G., Wood, J. N. and Schorge,S. (2012). Splice variants of Na(V)1.7 sodium channels have distinct b subunit-dependent biophysical properties. PLoS ONE 7, e41750.

Fraser, S. P., Diss, J. K., Chioni, A. M., Mycielska, M. E., Pan, H., Yamaci, R. F.,Pani, F., Siwy, Z., Krasowska, M., Grzywna, Z. et al. (2005). Voltage-gatedsodium channel expression and potentiation of human breast cancer metastasis. Clin.

Cancer Res. 11, 5381-5389.

Fraser, S. P., Ozerlat-Gunduz, I., Onkal, R., Diss, J. K., Latchman, D. S. and

Djamgoz, M. B. (2010). Estrogen and non-genomic upregulation of voltage-gatedNa(+) channel activity in MDA-MB-231 human breast cancer cells: role in adhesion.J. Cell. Physiol. 224, 527-539.

Journal of Cell Science 126 (21)4948

Journ

alof

Cell

Scie

nce

Fremin, C. and Meloche, S. (2010). From basic research to clinical development ofMEK1/2 inhibitors for cancer therapy. J. Hematol Oncol 3, 8.

Fujimoto, N., Wislez, M., Zhang, J., Iwanaga, K., Dackor, J., Hanna, A. E.,Kalyankrishna, S., Cody, D. D., Price, R. E., Sato, M. et al. (2005). Highexpression of ErbB family members and their ligands in lung adenocarcinomas thatare sensitive to inhibition of epidermal growth factor receptor. Cancer Res. 65,11478-11485.

Gao, R., Wang, J., Shen, Y., Lei, M. and Wang, Z. (2009). Functional expression ofvoltage-gated sodium channels Nav1.5 in human breast cancer cell line MDA-MB-231. J. Huazhong Univ. Sci. Technolog. Med. Sci. 29, 64-67.

Gao, R., Shen, Y., Cai, J., Lei, M. and Wang, Z. (2010). Expression of voltage-gatedsodium channel alpha subunit in human ovarian cancer. Oncol. Rep. 23, 1293-1299.

Ghelardini, C., Desaphy, J. F., Muraglia, M., Corbo, F., Matucci, R., Dipalma, A.,Bertucci, C., Pistolozzi, M., Nesi, M., Norcini, M. et al. (2010). Effects of a newpotent analog of tocainide on hNav1.7 sodium channels and in vivo neuropathic painmodels. Neuroscience 169, 863-873.

Gillet, L., Roger, S., Besson, P., Lecaille, F., Gore, J., Bougnoux, P., Lalmanach,

G. and Le Guennec, J. Y. (2009). Voltage-gated sodium channel activity promotescysteine cathepsin-dependent invasiveness and colony growth of human cancer cells.J. Biol. Chem. 284, 8680-8691.

Goetz, R., Dover, K., Laezza, F., Shtraizent, N., Huang, X., Tchetchik, D.,

Eliseenkova, A. V., Xu, C. F., Neubert, T. A., Ornitz, D. M. et al. (2009). Crystalstructure of a fibroblast growth factor homologous factor (FHF) defines a conservedsurface on FHFs for binding and modulation of voltage-gated sodium channels.J. Biol. Chem. 284, 17883-17896.

Goldfarb, M., Schoorlemmer, J., Williams, A., Diwakar, S., Wang, Q., Huang, X.,

Giza, J., Tchetchik, D., Kelley, K., Vega, A. et al. (2007). Fibroblast growth factorhomologous factors control neuronal excitability through modulation of voltage-gatedsodium channels. Neuron 55, 449-463.

Grimes, J. A., Fraser, S. P., Stephens, G. J., Downing, J. E., Laniado, M. E., Foster,C. S., Abel, P. D. and Djamgoz, M. B. (1995). Differential expression of voltage-activated Na+ currents in two prostatic tumour cell lines: contribution to invasivenessin vitro. FEBS Lett. 369, 290-294.

Hilborn, M. D., Vaillancourt, R. R. and Rane, S. G. (1998). Growth factor receptortyrosine kinases acutely regulate neuronal sodium channels through the src signalingpathway. J. Neurosci. 18, 590-600.

House, C. D., Vaske, C. J., Schwartz, A. M., Obias, V., Frank, B., Luu, T.,Sarvazyan, N., Irby, R., Strausberg, R. L., Hales, T. G. et al. (2010). Voltage-gatedNa+ channel SCN5A is a key regulator of a gene transcriptional network that controlscolon cancer invasion. Cancer Res. 70, 6957-6967.

Isom, L. L. (2001). Sodium channel beta subunits: anything but auxiliary. Neuroscientist

7, 42-54.Isom, L. L. (2002). The role of sodium channels in cell adhesion. Front. Biosci. 7, 12-

23.Jemal, A., Bray, F., Center, M. M., Ferlay, J., Ward, E. and Forman, D. (2011).

Global cancer statistics. CA Cancer J. Clin. 61, 69-90.Joho, R. H., Moorman, J. R., VanDongen, A. M., Kirsch, G. E., Silberberg, H.,

Schuster, G. and Brown, A. M. (1990). Toxin and kinetic profile of rat brain type IIIsodium channels expressed in Xenopus oocytes. Brain Res. Mol. Brain Res. 7, 105-113.

Kanzaki, M., Zhang, Y. Q., Mashima, H., Li, L., Shibata, H. and Kojima, I. (1999).Translocation of a calcium-permeable cation channel induced by insulin-like growthfactor-I. Nat. Cell Biol. 1, 165-170.

Keshet, Y. and Seger, R. (2010). The MAP kinase signaling cascades: a system ofhundreds of components regulates a diverse array of physiological functions. Methods

Mol. Biol. 661, 3-38.Laniado, M. E., Lalani, E. N., Fraser, S. P., Grimes, J. A., Bhangal, G., Djamgoz,

M. B. and Abel, P. D. (1997). Expression and functional analysis of voltage-activatedNa+ channels in human prostate cancer cell lines and their contribution to invasion invitro. Am. J. Pathol. 150, 1213-1221.

Lei, S., Dryden, W. F. and Smith, P. A. (2001). Nerve growth factor regulates sodiumbut not potassium channel currents in sympathetic B neurons of adult bullfrogs.J. Neurophysiol. 86, 641-650.

Li, L., Ittmann, M. M., Ayala, G., Tsai, M. J., Amato, R. J., Wheeler, T. M., Miles,B. J., Kadmon, D. and Thompson, T. C. (2005). The emerging role of the PI3-K-Akt pathway in prostate cancer progression. Prostate Cancer Prostatic Dis. 8, 108-118.

Liu, H., Sun, H. Y., Lau, C. P. and Li, G. R. (2007). Regulation of voltage-gatedcardiac sodium current by epidermal growth factor receptor kinase in guinea pigventricular myocytes. J. Mol. Cell. Cardiol. 42, 760-768.

Lou, J. Y., Laezza, F., Gerber, B. R., Xiao, M., Yamada, K. A., Hartmann, H.,Craig, A. M., Nerbonne, J. M. and Ornitz, D. M. (2005). Fibroblast growth factor14 is an intracellular modulator of voltage-gated sodium channels. J. Physiol. 569,179-193.

Lynch, T. J., Bell, D. W., Sordella, R., Gurubhagavatula, S., Okimoto, R. A.,Brannigan, B. W., Harris, P. L., Haserlat, S. M., Supko, J. G., Haluska, F. G. et al.

(2004). Activating mutations in the epidermal growth factor receptor underlyingresponsiveness of non-small-cell lung cancer to gefitinib. N. Engl. J. Med. 350, 2129-2139.

Martin, S. W., Butcher, A. J., Berrow, N. S., Richards, M. W., Paddon, R. E.,Turner, D. J., Dolphin, A. C., Sihra, T. S. and Fitzgerald, E. M. (2006).Phosphorylation sites on calcium channel alpha1 and beta subunits regulate ERK-dependent modulation of neuronal N-type calcium channels. Cell Calcium 39, 275-292.

Mendelsohn, J. (2003). Antibody-mediated EGF receptor blockade as an anticancertherapy: from the laboratory to the clinic. Cancer Immunol. Immunother. 52, 342-346.

Nakajima, T., Kubota, N., Tsutsumi, T., Oguri, A., Imuta, H., Jo, T., Oonuma, H.,Soma, M., Meguro, K., Takano, H. et al. (2009). Eicosapentaenoic acid inhibitsvoltage-gated sodium channels and invasiveness in prostate cancer cells. Br. J.

Pharmacol. 156, 420-431.Oda, K., Matsuoka, Y., Funahashi, A. and Kitano, H. (2005). A comprehensive

pathway map of epidermal growth factor receptor signaling. Mol. Syst. Biol. 1, 0010.Onganer, P. U. and Djamgoz, M. B. (2005). Small-cell lung cancer (human):

potentiation of endocytic membrane activity by voltage-gated Na(+) channelexpression in vitro. J. Membr. Biol. 204, 67-75.

Onganer, P. U., Seckl, M. J. and Djamgoz, M. B. (2005). Neuronal characteristics ofsmall-cell lung cancer. Br. J. Cancer 93, 1197-1201.

Paez, J. G., Janne, P. A., Lee, J. C., Tracy, S., Greulich, H., Gabriel, S., Herman, P.,

Kaye, F. J., Lindeman, N., Boggon, T. J. et al. (2004). EGFR mutations in lungcancer: correlation with clinical response to gefitinib therapy. Science 304, 1497-1500.

Pancrazio, J. J., Viglione, M. P., Tabbara, I. A. and Kim, Y. I. (1989). Voltage-dependent ion channels in small-cell lung cancer cells. Cancer Res. 49, 5901-5906.

Patino, G. A. and Isom, L. L. (2010). Electrophysiology and beyond: multiple roles ofNa+ channel b subunits in development and disease. Neurosci. Lett. 486, 53-59.

Persson, A. K., Gasser, A., Black, J. A. and Waxman, S. G. (2011). Nav1.7accumulates and co-localizes with phosphorylated ERK1/2 within transected axons inearly experimental neuromas. Exp. Neurol. 230, 273-279.

Qiu, M. H., Zhang, R. and Sun, F. Y. (2003). Enhancement of ischemia-inducedtyrosine phosphorylation of Kv1.2 by vascular endothelial growth factor via activationof phosphatidylinositol 3-kinase. J. Neurochem. 87, 1509-1517.

Roger, S., Besson, P. and Le Guennec, J. Y. (2003). Involvement of a novel fastinward sodium current in the invasion capacity of a breast cancer cell line. Biochim.

Biophys. Acta 1616, 107-111.Roger, S., Rollin, J., Barascu, A., Besson, P., Raynal, P. I., Iochmann, S., Lei, M.,

Bougnoux, P., Gruel, Y. and Le Guennec, J. Y. (2007). Voltage-gated sodiumchannels potentiate the invasive capacities of human non-small-cell lung cancer celllines. Int. J. Biochem. Cell Biol. 39, 774-786.

Smani, T., Calderon-Sanchez, E., Gomez-Hurtado, N., Fernandez-Velasco, M.,

Cachofeiro, V., Lahera, V., Ordonez, A. and Delgado, C. (2010). Mechanismsunderlying the activation of L-type calcium channels by urocortin in rat ventricularmyocytes. Cardiovasc. Res. 87, 459-466.

Smith, P., Rhodes, N. P., Shortland, A. P., Fraser, S. P., Djamgoz, M. B., Ke, Y. andFoster, C. S. (1998). Sodium channel protein expression enhances the invasiveness ofrat and human prostate cancer cells. FEBS Lett. 423, 19-24.

Stahl, U., Wenk, J., Wagener, F., Woenckhaus, J., Gamerdinger, U., Battmann,A. and Dreyer, T. (2004). [Phosphoinositide 3-kinase (PI3-K) expression.Tumorigenesis of epithelial carcinoma of the mouth]. Pathologe 25, 31-37.

Stamboulian, S., Choi, J. S., Ahn, H. S., Chang, Y. W., Tyrrell, L., Black, J. A.,

Waxman, S. G. and Dib-Hajj, S. D. (2010). ERK1/2 mitogen-activated proteinkinase phosphorylates sodium channel Na(v)1.7 and alters its gating properties.J. Neurosci. 30, 1637-1647.

Toledo-Aral, J. J., Brehm, P., Halegoua, S. and Mandel, G. (1995). A single pulse ofnerve growth factor triggers long-term neuronal excitability through sodium channelgene induction. Neuron 14, 607-611.

Uysal-Onganer, P. and Djamgoz, M. B. (2007). Epidermal growth factor potentiates invitro metastatic behaviour of human prostate cancer PC-3M cells: involvement ofvoltage-gated sodium channel. Mol. Cancer 6, 76.

Volante, M., Saviozzi, S., Rapa, I., Ceppi, P., Cappia, S., Calogero, R., Novello, S.,

Borasio, P., Papotti, M. and Scagliotti, G. V. (2007). Epidermal growth factorligand/receptor loop and downstream signaling activation pattern in completelyresected nonsmall cell lung cancer. Cancer 110, 1321-1328.

Woodall, A. J., Richards, M. A., Turner, D. J. and Fitzgerald, E. M. (2008). Growthfactors differentially regulate neuronal Cav channels via ERK-dependent signalling.Cell Calcium 43, 562-575.

Yildirim, S., Altun, S., Gumushan, H., Patel, A. and Djamgoz, M. B. (2012). Voltage-gated sodium channel activity promotes prostate cancer metastasis in vivo. Cancer

Lett. 323, 58-61.

Nav1.7 in lung cancer 4949