gabaculine selection using bacterial and plant marker genes (gsa-at) in durum wheat transformation

ORIGINAL PAPER

Gabaculine selection using bacterial and plant marker genes(GSA-AT) in durum wheat transformation

Angelica Giancaspro • Daniele Rosellini •

Antonio Blanco • Agata Gadaleta

Received: 18 October 2011 / Accepted: 23 December 2011 / Published online: 11 January 2012

� Springer Science+Business Media B.V. 2012

Abstract Selectable marker genes are widely used for the

efficient transformation of crop plants. In most cases,

selection is based on antibiotic or herbicide resistance

genes because they tend to be most efficient. The Syn-

echococcus hemL gene has been successfully employed as

a selectable marker for tobacco and alfalfa genetic trans-

formation, by using gabaculine as the selective agent. The

gene conferring gabaculine resistance is a mutant form of

the hemL gene from Synechococcus PCC6301, strain GR6,

encoding a gabaculine insensitive form of the glutamate1-

semialdehyde aminotransferase (GSA) enzyme. In the

present study we compared the transformation and selec-

tion efficiency of the common selection method based on

the Streptomyces hygroscopicus bar gene conferring

resistance to Bialaphos�, with both the Synechococcus

hemL gene and a Medicago sativa mutated GSA gene

(MsGSAgr) conferring resistance to phytotoxin gabaculine.

Callus derived from immature embryos of the durum wheat

cultivar Varano were simultaneously co-bombarded with

bar/hemL and bar/MsGSAgr genes. After gene delivery,

the marker genes were individually evaluated through all

the selection phases from callus regeneration to adult plant

formation, and compared for their transformation and

selection efficiency. The integration of the three genes in

the T0 generation was confirmed by PCR analysis with

specific primers for each gene and southern blot analysis.

Both Synechococcus hemL and MsGSA were more efficient

than bar for biolistic transformation (2.8% vs. 1.8% and

1.1% vs. 0.5%) and selection (79% vs. 43% and 87% vs.

50%). Thus, an efficient selection method for durum wheat

transformation was established that obviates the use of

herbicide resistance genes.

Keywords Wheat transformation � Selectable marker �Gabaculine � GSA-AT � hem-L

Introduction

Selectable marker genes (SMGs) are widely used for the

efficient transformation of crop plants. In most cases,

selection is based on antibiotic or herbicide resistance.

These genes are preferred because they tend to be most

efficient. Due mainly to consumer concerns, considerable

effort is being put into developing a suite of strategies (site-

specific recombination, homologous recombination, trans-

position and co-transformation) to eliminate the SMG from

the nuclear or chloroplast genome after selection. Current

efforts concentrate on systems where the SMGs are elim-

inated efficiently soon after transformation. However, these

methods are laborious and not completely reliable. For the

commercialization of transgenic plants, the use of a com-

pletely marker-free technology would be preferable, since

there would be no involvement of SMGs, whose presence

is undesirable in crop plants. Several risk-assessment

reports (Kuiper et al. 2001; Ramessar et al. 2007; European

Union as of January 1, 2009) have shown that neither the

SMGs nor their products are harmful to human and envi-

ronmental health. Nevertheless, removal of these genes

from a transgenic plant is considered as ‘‘good laboratory

practice’’ by many regulatory committees. Approximately

A. Giancaspro � A. Blanco � A. Gadaleta (&)

Department of Environmental and Agro-Forestry Biology and

Chemistry, Section of Genetics and Plant Breeding, University

of Bari Aldo Moro, Via Amendola, 165/A, 70126 Bari, Italy

e-mail: [email protected]

D. Rosellini

Department of Applied Biology, University of Perugia, Borgo

XX giugno 74, 06121 Perugia, Italy

123

Plant Cell Tiss Organ Cult (2012) 109:447–455

DOI 10.1007/s11240-011-0109-2

fifty marker genes used for transgenic and transplastomic

plant research and crop development have been assessed

for efficiency, scientific applications and commercializa-

tion (Miki and McHugh 2004). SMGs can be divided into

several categories depending on whether they allow posi-

tive or negative selection and whether selection is condi-

tional or non-conditional on the presence of external

substrates. Positive SMGs are defined as those that promote

the growth of transformed tissue whereas negative SMGs

result in the death of the transformed tissue. The positive

SMGs that are conditional on the use of toxic agents, such

as antibiotics, herbicides or drugs were the first to be

developed and exploited. More recent developments

include positive SMGs that are conditional on non-toxic

agents that may be substrates for growth or that induce

growth and differentiation of the transformed tissues

(Stoykova and Stoeva-Popova 2010; Thiruvengadam et al.

2011; Qiao et al. 2010). Newer strategies include positive

selectable markers which are not conditional on external

substrates but which alter the physiological processes that

govern plant development (Khan et al. 2010, 2011).

Despite the large number of SMGs that exist for plants,

only a few are used for research and crop development for

this reason additional marker genes are needed that are not

antibiotic or herbicide based due to concerns over potential

increases in antibiotic resistance or effect on natural eco-

systems (Miki and McHugh 2004) Recently, new solutions

have been proposed represented by alternative selection

systems based on genes conferring resistance to chemical

agents different from toxic antibiotics or herbicides. In par-

ticular, the Synechococcus hemL gene has been successfully

employed as a selectable marker in Nicotiana tabacum

(Gough et al. 2001) and M. sativa (Rosellini et al. 2007)

genetic transformation by A. tumefaciens, using gabaculine

as the selective agent. The gene conferring gabaculine

resistance is a mutant form of the hemL gene from

Synechococcus PCC6301, strain GR6, encoding a mutant,

gabaculine insensitive form of the enzyme glutamate1-

semialdehyde aminotransferase (GSA-AT, Hill et al. 1985).

The lower sensibility to gabaculine of the mutant form of

GSA-AT enzyme respect to the wild type, is due to two

changes in its primary structure: a deletion of the aminoacids

serine-proline-phenylalanine from positions 5, 6 and 7, and a

methionine to isoleucine substitution at position 248, both

necessary to confer the gabaculine resistance. The GSA-AT

enzyme is naturally found in a wide range of organisms,

including algae, cyanobacteria and higher plants. In plants,

GSA-AT is encoded by the nuclear genome and then trans-

ported to chloroplast, where it catalyses the conversion

of glutamate1-semialdehyde into d-aminolaevulinic acid

(ALA), the universal precursor of tetrapyrrolic compounds

including chlorophyll and phycobilins (Reinbothe and

Reinbothe 1996). The enzyme encoded by the hemL gene is

sensitive to gabaculine, an irreversible inhibitor of a wide

range of pyridoxal-5-phosphate-linked aminotransferases

(Rando 1977). The complete sequence of the gene has been

determined in a little range of organisms including barley

(Grimm 1990), Synechococcus PCC6301 and Escherichia

coli (Grimm et al. 1991). Being a potent inhibitor of GSA-

AT, gabaculine is toxic to a wide range of plants (Hill et al.

1985). Several gabaculine-resistant mutants have been iso-

lated (Kahn and Kannangara 1987; Houghton et al. 1988),

one of which is the GR6 strain of Synechococcus PCC6301

(Grimm et al. 1991). Recently, the GSA gene has been iso-

lated from alfalfa and point-mutated to induce gabaculine

resistance (Ferradini et al. 2011). The use of Synechococcus

hemL gene has never been reported for the genetic trans-

formation of cereals, and only one plant gene, rice aceto-

lactate synthase, has been used as SMG (Ogawa et al. 2008).

The objective of the present work was to test a selection

method based on gabaculine in durum wheat (Triticum tur-

gidum var. durum) biolistic transformation, using both the

cyanobacterial hemL gene and a mutated form of the gene for

the glutamate 1-semialdehyde aminotransferase enzyme

(GSA) of alfalfa. The vector delivered in the transformation

contained a point-mutated form of M. sativa GSA gene

carrying a M to I substitution at position 286. Within the

enzyme binding domain, the M at position 286 in the

M. sativa sequence is completely conserved; on the contrary,

the N terminus differs profoundly, so the SPF deletion

present in hemL cannot be reproduced in plant enzymes.

Therefore it has been decided to test the hypothesis that the M

to I substitution alone was sufficient for gabaculine resis-

tance in alfalfa (Ferradini et al. 2011). In order to test the

gabaculine selection method, both the hemL/gabaculine and

the MsGSAgr/gabaculine selection systems were compared

with the conventional system based on the bar gene from

S. hygroscopicus as the SMG and Bialaphos� as the selective

agent. After gene delivery, the three systems were evaluated

through all the selection phases from callus regeneration to

adult plant formation, and compared for their transformation

and selection efficiencies.

Materials and methods

DNA constructs

The three vectors used in the genetic transformation

experiments were plasmids pAPCK-hemL, pAPCK-35S-

MsGSAgr and pAHC20-bar (Fig. 1). The plasmid pAPCK-

hemL (7,718 bp) carried the coding sequence of the hemL

gene of Synechococcus PC6301 strain GR6, encoding the

mutant gabaculine-resistant GSA-AT enzyme, under the

control of the Dual CaMV 35S promoter and nos termi-

nator (Fig. 1a). The plasmid also includes a 171 bp

448 Plant Cell Tiss Organ Cult (2012) 109:447–455

123

chloroplast transit peptide from the Pisum sativum Rubisco

small unit (Rubisco TP). The plasmid pAPCK-MsGSAgr

(5,700 bp) carried the point mutated GSA gene of M. sativa

conferring resistance to the gabaculine, under the control of

the Dual CaMV 35S promoter and the nos terminator

(Fig. 1b) (Ferradini et al. 2011; Rosellini 2011). The

plasmid pAHC20-bar (UbiBar, 5,505 bp) harboured the

selectable bar gene from S. hygroscopicus encoding

the phosphinotricin-acetyl-transferase (PAT) enzyme,

under the control of maize Ubi1 promoter and first intron

(Christensen and Quail 1996) and nos terminator (Gadaleta

et al. 2006).

The three vectors were cloned into E. coli competent

cells by heat shock, then selected on 19 LB solid medium

containing 50 mg/l ampicillin. Plasmid DNA was extracted

from E. coli by using the QIAGEN Plasmid MAXI Kit

following the manufacturer’s instructions. Each plasmid

was checked for the inserted marker gene by means of

restriction endonuclease digestion and PCR amplification

with specific primer pairs, followed by electrophoretic

separation on 1.8% agarose gel and UV visualization of

DNA bands stained with Gel-Red�.

Detection of gabaculine effect on durum wheat callus

In order to study gabaculine toxic effects and establish the

best concentration suitable for the selection of callus, a

preliminary toxicity test was conducted on the two durum

wheat varieties Svevo and Varano. These varieties were

chosen for their high shoot regeneration potential (Gadaleta

et al. 2002). One hundred two-week-old callus for each

cultivar were grown on a regeneration medium supple-

mented with five gabaculine (Sigma Aldrich) concentra-

tions: 0, 5, 20, 50, 100 lM. The effects of gabaculine on

callus embryogenesis were evaluated by detecting the

number of the regenerated shoots after 4 weeks of in vitro

culture, following growth at 25�C with 16 h of light

(250 lE s-1 m-2 from cool white fluorescent tubes) and

8 h of darkness daily for 3 weeks. Shoots developed from

all the treatments were grown to plants, in order to detect

any effect of gabaculine on the phenotype.

Transformation experiments

The explants used for transformation experiments were

embryogenic callus derived from immature embryos.

Immature seeds were harvested 15–18 days post-anthesis

from durum wheat cv. Varano, surface-sterilized with 70%

ethanol for 5 min and 20% sodium hypochlorite for 15 min,

then rinsed in sterile water. Immature embryos that varied in

size between 0.8 and 1.5 mm in diameter, were aseptically

excised under a stereo dissecting microscope and placed with

the scutellar portion of the embryo exposed on a solid MS

medium. The isolated embryos were cultured for ten days on

a solid initiation medium (MS) to induce the formation of

callus. The protocol for medium composition, callus induc-

tion and maintenance were described by Gadaleta et al.

(2006). Only good quality callus, showing a regular round

shape and a bright yellow colour, were subjected to trans-

formation. A total of four independent co-transformation

experiments were performed using the biolistic device: in the

first two experiments, wheat callus (respectively 616 and 700

pieces) were simultaneously co-bombarded with equimolar

amounts of the two plasmids carrying the hemL and the bar

genes. Two experiments (with 550 and 600 callus) were

conducted bombarding simultaneously embryogenic callus

with the two plasmids carrying the MsGSAgr and the bar

genes, respectively.

The exact quantity of each plasmid to employ for gene

delivery was calculated depending on the molecular weight

according to He et al. (1999). In particular, we used

12.5 lg of pAHC20-bar, 17.5 lg of pAPCK-hemL and

12.9 lg of pAPCK-MsGSAgr. Plasmid delivery was car-

ried out by means of the biolistic device PDS 1000-He

particle gun (BioRad, Richmond, CA) following the pro-

cedure described by Weeks et al. (1993). After

Dual CAMV 35S hemL Nos TerminatorEcoRI

BamHIPstI

EcoRIRubisco TP

II

Dual CAMV 35S MsGSAgr Nos TerminatorEcoRI BamHI AscIII I

A

B

Fig. 1 Schematic representation of the plasmid vectors delivered in

the genetic transformation of durum wheat callus by biolistic device.

a pAPCK-hemL carrying the mutant hemL gene of SynechococcusPCC6301 strain GR6 under the control of CaMV 35S double

promoter and nos terminator from nopaline synthase gene of

Agrobacterium tumefaciens. Rubisco TP is a 171 bp chloroplast

transit peptide from the Pisum sativum Rubisco small unit. b pAPCK-

35S-MsGSAgr carrying the point mutated GSA-AT gene of Medicagosativa under the control of CaMV 35S double promoter and nosterminator

Plant Cell Tiss Organ Cult (2012) 109:447–455 449

123

transformation, the bombarded explants were maintained

for 3 weeks in the dark at 25�C on a ‘‘recovery’’ medium

without any selective pressure.

Callus selection and regeneration

Following the recovery period, selection was performed

separately with gabaculine (Sigma Aldrich) on half of the

callus and bialaphos on the other half, for each of the four

experiments. Callus selected with bar/bialaphos were

plate-cultured on a selection-regeneration solid medium,

consisting of a MS basic substrate supplemented with

0.2 mg/l of 2,4-D and 1 mg/l of bialaphos (Meiji Seika

Kasha, Tokyo, Japan). Conditions of growth were 16 h of

light and 8 h of darkness at 25�C. For the selection with

gabaculine, the callus were transferred to a selection-

regeneration medium containing 0.2 mg/l of 2,4-D and

15 lM gabaculine, and maintained under the same growth

conditions of bialaphos-selection. The regeneration period

varied from 5 to 7 weeks, depending on the selection

system, and allowed some callus to form green spots

developing into little green shoots. Sub-cultures were

performed every 10 days. Both for bialaphos and gabacu-

line selection, two control treatments were performed, by

culturing 50 non transformed Varano callus on the same

selection condition of the bombarded explants (negative

controls) and 50 callus on a non-selective medium (positive

controls).

Following regeneration, callus which developed green

shoots completed the selection in Pyrex culture tubes

containing a rooting medium consisting of a hormone-free

half-strength basic MS medium, supplemented with 3 mg/l

bialaphos for bar selection, and 15 lM gabaculine for

hemL and MsGSAgr selection. Roots developed in a period

comprised between 2 and 4 weeks, then plantlets that

showed healthy growth under selection were transferred

from rooting tubes to pots of soil mixture, maintained in

the growth chamber for about 2 weeks with decreasing

humidity, and finally transferred to the greenhouse. In the

greenhouse, the regenerated wheat lines received supple-

mentary lighting provided by sodium lamps, with a day

temperature of 17–20�C and a night temperature of

14–16�C. Young leaf samples were taken from plants in

vases to be used for the following molecular analyses.

Characterization of regenerated T0 plants

Genomic DNA was extracted from leaf samples of T0

plants regenerated from bialaphos and gabaculine selection

(from both hemL and MsGSAgr genes), and from non-

transgenic controls according to the protocol described by

Dellaporta et al. (1983). DNA concentration was deter-

mined using a UV–Visible spectrophotometer detecting

adsorbance at a 260 nm wavelength. Purity of genomic

DNA was assessed reading the 260/280 nm absorption

ratio, with a value of approximately 1.8 indicating a good

quality. DNA integrity was also checked on 0.8% agarose

gel stained with Gel-Red� (Sigma Aldrich).

In order to assess the presence of bar, hemL and MsGSAgr

and identify the transformed T0 plants, the genomic DNA of

all the regenerated plants were amplified with primer pairs

specific for each gene. Primers employed for pAHC20-bar

(bar-F: 50GTCTGCACCATCGTCAACC 30; bar-R: 50GA-

AGTCCAGCTGCCAGAAAC 30; He et al. 1999), produced a

420 bp amplicon from the bar gene coding sequence at an

annealing temperature of 59�C. The primers used to screen the

hemL gene (hemL-F: 50GCAGTTTGAGGCGGGCTTTA 30;hemL-R: 50ATCGCAAGACCGGCAACAG 30; Rosellini

et al. 2007) gave a 208 bp PCR product at an annealing

temperature of 67�C. The primer pairs for MsGSAgr gene

(GSA-F: 50CCAGCTTTGGTGCACCTTGTC 30; GSA-R:

50ATCGCAAGACCGGCAACAG 30; Ferradini et al. 2011)

gave a 1,130 bp PCR product at an annealing temperature of

62�C. In order to avoid improper amplification of GSA-AT

endogenous wheat gene, forward and reverse primers for the

pAPCK-hemL and pAPCK-MsGSAgr plasmids were

designed on hemL and MsGSAgr coding sequence and nos

terminator, respectively.

Non transgenic control plants were PCR amplified.

Further negative controls were represented by a PCR

reaction-mix free of DNA and by the genomic DNA of the

wild-type durum wheat cultivar Varano; positive controls

consisted in plasmids pAPCK-hemL, pAPCK-MsGSAgr

and pAHC20-bar, respectively for the hemL, MsGSAgr and

bar genes.

All the PCR analyses were carried out in a 25 ll total

reaction volume containing 100 ng template DNA, 250 nM

of each primer pair, 200 lM of each dNTP, 1.5 mM

MgCl2, 19 Buffer (10 mM Tris–HCl, pH 8.3; 10 mM

KCl), and 1 unit of Taq DNA polymerase (Euroclone Eu-

roTaq). Amplifications were conducted in a Perkin Elmer

DNA Thermal Cycler with the following protocol: 1 cycle

of denaturation at 94�C for 3 min, followed by 35 cycles of

(94�C for 1 min, annealing at the appropriate temperature

for 1 min, extension at 72�C for 2 min), and final extension

at 72�C for 10 min. Amplification products were analyzed

by electrophoresis in 1.5% (w/v) agarose gels stained with

Gel Red� dying solution. Transformed T0 plants carrying

the bar, MsGSAgr and hemL genes were identified by the

presence of amplicons at the expected molecular sizes.

Southern blot analysis

DNA from bombarded and control plants was isolated, as

described above, and were digested with restriction

enzymes that cut only ones. The digestion products were


123

separated by electrophoresis in a 0.8% agarose gel (1 V/

cm, 4�C), transferred to a nylon membrane by capillarity

and fixed to the membrane by UV cross-linking. Prehy-

bridization was carried out at 42�C for 4 h in a solution

containing: 59 SSC (NaCl 0.75 M, sodium citrate PCR

assays) and labelled with dig-dNTPs during the PCR

reaction. The washing conditions after hybridization were

markedly stringent (0.3 mM sodium citrate, 3 mM NaCl,

0.1% SDS and 65�C). Two probes were synthesized, one

from the hemL coding sequence to part of the Nos terminator

(amplified using the primers GCAGTTTGAGGCGGGC

TTTA and ATCGCAAGACCGGCAACAG) and the second

one from MsGSAgr coding region using the primers: CCA

GCTTTGGTGCACCTTGTC and ATCGCAAGACCGGC

AACAG) probe after stripping. Hybridization signals were

visualized with antidigoxigenine alkaline phosphatase con-

jugate (Boehringer).

Results and discussion

Effect of gabaculine on durum wheat callus

regeneration

In order to establish the best gabaculine concentration to

use for callus selection after transformation with the hemL

or MsGSAgr marker genes, different concentrations of the

toxin were tested on callus regeneration efficiency. The

toxicity assay was performed on two durum wheat culti-

vars, Svevo and Varano, in order to identify a possible

genotype-dependent response to gabaculine resistance.

These two varieties were selected because they are char-

acterized by a high percentage of plant regeneration from

tissue culture (Gadaleta et al. 2002).

Gabaculine inhibited regeneration of both cv. Svevo and

Varano by decreasing green spot formation, shoot devel-

opment and adult plant formation at all the four tested

concentrations (Table 1). 5 lM gabaculine allowed the

formation of many shoots, from 45% of callus for Svevo

and 70% of callus for Varano. At this low toxin concen-

tration, the shoots were green like the controls, and they

were able to form roots and develop into adult plants; these

were phenotypically indistinguishable from the controls,

with bright green and fully expanded leaves.

A stronger inhibition of regeneration was observed at 20

and 50 lM gabaculine: the two treatments showed the

same inhibitory effect, allowing the development of shoots

for only 20 and 40% of total callus for cv. Svevo and

Varano, respectively. The increased toxicity of gabaculine

also resulted in an change of shoot colour, which were pale

green or, in some cases, chlorotic. In particular, at 20 lM

the percentage of pale green shoots was higher than that of

the chlorotic ones (75% for cv. Svevo and 62% for cv.

Varano), whereas at 50 lM this percentage dropped to

25% for both varieties (Fig. 2). In the following stages of

regeneration, only pale green shoots were able to develop

into plantlets, but they were clearly distinguishable from

the controls, showing a ‘‘weak’’ aspect with little, coiled, or

chlorotic leaves.

As expected, 100 lM gabaculine was toxic for both

durum wheat varieties: the toxin completely inhibited shoot

formation on callus of cv. Svevo, whereas allowed regen-

eration for the only 23% of Varano callus. In this case, the

developed shoots were completely chlorotic and none of

them could develop roots and form adult plants. In genetic

transformation experiments, the quantity of selective agent

added in the culture medium is chosen to allow an efficient

discrimination between transgenic and not transgenic tis-

sues, by inhibiting the growth of the not transformed cells,

while stimulating the proliferation of the transformed ones.

The concentration of the selective substance must not be

too high, as it could lead to the death of the not transformed

cells and the subsequent release of toxic metabolites in the

surrounding medium which could reduce the regeneration

efficiency of the transgenic explants. Based on the results

of preliminary toxicity assay, we established that the best

gabaculine concentration to select wheat callus trans-

formed with hemL and MsGSAgr marker genes was

15 lM. The choice of such concentration in the regenera-

tion medium was due to the fact that 5 lM revealed no

toxic for callus, while 20 lM had a too drastic selective

effect, by allowing the formation of only pale green or

chlorotic plants. Our choice is similar with what reported

by Gough et al. (2001) for the genetic transformation of

Table 1 Effect of different

gabaculine concentrations on

durum wheat callus

regeneration (cv. Svevo and

Varano)

a Regenerating callus = callus

forming green spotsb Developed

plantlets = plantlets developed

from regenerated calli

Gabaculine

concentration

(lM)

Tested

callus

(N�)

Regenerating

callusa (%)

Developed

plantletsb

(%)

Regenerating

callusa

(%)

Developed

plantletsb

(%)

cv. Svevo cv. Varano

0 100 55 100 85 100

5 100 45 100 70 100

20 100 20 75 40 62

50 100 20 25 40 25

100 100 0 0 23 0


123

tobacco. In their work they established that a gabaculine

concentration between 5 and 25 lM was suitable for the

detection of not transformed N. tabacum plants susceptible

to the toxin. On the other hand, in the agro-transformation

of alfalfa, Rosellini et al. (2007) employed a 25 lM con-

centration, which was slightly higher than the minimum for

complete inhibition of regeneration. This suggest a differ-

ent susceptibility of plant species to gabaculine intrinsic

genomic resistance.

Comparison of bar/Bialaphos and hemL/gabaculine

selection systems for wheat transformation

In the present work the innovative hemL/gabaculine

selection system was compared with the traditional pro-

cedure based on S. hygroscopicus bar gene as the select-

able marker and Bialaphos herbicide as the selective agent.

A total of two co-transformation experiments were carried

out by simultaneously delivering into wheat callus plas-

mids pAHC20-bar and pAPCK-hemL carrying the bar and

the hemL marker genes, respectively. In each experiment

one thousand embryos were dissected from wheat imma-

ture seeds and induced to callus formation, but only good

quality explants showing round shape and bright yellow

colour were used for transformation experiments. Callus

were cultured for 3 weeks on a ‘‘recovery’’ medium

without any selective pressure after transformation, in

order to repair the mechanical damages of bombardment

and increase the survival of transformants. Then, selection

was separately performed with bialaphos on half callus and

gabaculine on the other half. Regenerated explants from

both selection systems were grown to maturity. A total of

16 plants were obtained in the first experiment, 6 from

gabaculine and 10 from bialaphos selection. In the second

experiment, 33 plants were developed of which 19 selected

with hemL and 14 with bar. The presence of hemL and/or

bar marker genes was confirmed in each T0 plant by PCR

analysis of genomic DNA (Fig. 3a, b). Based on PCR

results, the two selectable makers were compared for their

transformation efficiency, which was calculated as the

number of T0 transgenic plants on the total number of

bombarded callus (Table 2). Our results demonstrated that

biolistic transformation and selection with hemL gene

worked as the traditional bar selection systems using bi-

alaphos in this particular regime. Analysis of southern blot

conducted on one plant of T2 progeny of the 19 plants

resulted positive with PCR reaction showed an hybridiza-

tion signal with the hemL probe. Eight plants showed two

insertion points (Fig. 4), one plants had the 3 insertion

point while for 10 of them a single transgene copy.

In addition to transformation efficiency, the two marker

genes were compared also for their selection ability during

all the different stages of plant regeneration, by estimating

the regeneration, shoot formation, and rooting frequency.

The average values of these parameters for the two

experiments are reported in Table 3. In the initial steps of

regeneration, gabaculine revealed a stronger selective

agent than bialaphos, in fact both callus regeneration and

shoot formation frequencies were lower with the gabacu-

line than the herbicide. Only 9.5% of the bombarded callus

were able to form green spots in presence of gabaculine,

and only 40.8% of them developed into a shoot. On the

contrary, regeneration and shoot formation percentages on

bialaphos selection system were respectively 14.2 and

69.4%.

The effectiveness of the two selective agents was

inverted in the subsequent stages of regeneration, in fact

bialaphos showed a stronger selective pressure than gaba-

culine during the rooting phase, when the rooting formation

percentage was 68% on gabaculine and 30% on bialaphos

medium. Final selection efficiency, calculated as the

number of T0 plants integrating the marker gene divided by

Fig. 2 Regeneration of durum wheat callus (cv. Svevo) on gabaculine-free culture media showing a green colour (a) and on a 50 lM gabaculine

culture media looking pale green (b)


123

the total number of regenerated explants, was higher for

gabaculine (78.9%) than for bialaphos (42.8%), thus sug-

gesting a valid use of the hemL gene as an efficient alter-

native to the traditional bar gene in wheat genetic

transformation.

Comparison of bar/Bialaphos and MsGSAgr/gabaculine

selection systems for wheat transformation

Two co-transformation experiments were carried out by

simultaneously delivering into wheat callus plasmids

pAHC20-bar and pAPCK-MsGSAgr carrying the bar and

the M. sativa mutated GSA marker genes, respectively.

Seven hundred embryos were excised in each experiment

but only embryogenic callus were bombarded, namely 500

in the first bombardment and 600 in the second one. Gene

delivery experiments and selection for MsGSAgr and bar

evaluation were conducted in the same way as for the

hemL-bar comparison. Selection with gabaculine or bi-

alaphos was conducted on 250 callus in the first experi-

ment, while on 300 in the second one. The integration of

the transgenes was confirmed by PCR analysis on the

genomic DNA of the regenerated plants (Fig. 3c). A total

of 7 gabaculine-resistant plantlets were obtained in the two

experiments, 6 of which contained the MsGSAgr gene;

besides, 6 bialaphos-resistant plantlets were regenerated, of

which only 3 integrated the bar gene. The average biolistic

transformation frequencies obtained using the two select-

able markers were 1.1% for the MsGSAgr gene and 0.5%

for bar (Table 2). In whole experiments, transformation

was confirmed by inheritance of the transgene as deter-

mined by PCR analysis of progeny DNA and southern

hybridization. Southern hybridization was conducted on

one plant of T2 progeny of each transgenic line for MsG-

SAgr gene resulted first positive to PCR reaction. Analysis

1 2 3 4 5 6 7 8 9 10 11 12 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

A

208 bp

B 1 2 3 4 5 6 7 8 9 10 11 12 13

420 bp

1 2 3 4 5 6 7 8 9 10 11 12

C

1130 bp

Fig. 3 PCR analysis for the detection of the hemL, bar and MsGSAgrgene integration. a 12 T0 plants regenerated from gabaculine selection

showed the expected amplicon from the hemL gene (208 bp, arrow).

Lane 1 100 bp molecular weight Ladder; lane 2 no DNA; lane 3plasmid pAPCK-hemL-nptII; lane 4 cv. Varano genomic DNA; lanes5–8, 10–16: transgenic plants; lane 9 control PCR reaction with no

primer. b PCR analysis for the detection of gene integration in 9 T0

plants regenerated from bialaphos selection. The expected amplicon

from the bar gene (420 bp, arrow) is shown. Lane 1 100 bp molecular

weight Ladder; lane 2 no DNA; lane 3 cv. Varano genomic DNA;

lanes 4–8, 10 transgenic plants; lanes 9, 11, 12 escapes; lane 13plasmid pAHC20. c PCR analysis for the detection of the MsGSAgrgene integration in 7 T0 plants regenerated from gabaculine selection.

The expected amplicon (1130 bp, arrow) is shown. Lane 1 kDNA/

EcoRI, HindIII molecular weight Ladder; lanes 2–5, 7, 8 transgenic

plants; lane 6 escape; lanes 9, 10 plasmid pAPCK-35S-MsGSAgr;

lane 11 no DNA; lane 12 cv. Varano genomic DNA

Table 2 Efficiency of durum wheat (cv. Varano) biolistic transfor-

mation with hemL or MsGSAgr marker genes, ach compared with barselectable gene

Experiment Selection

system

Selected

callus

(N�)

Transgenic

plants

(N�)

Transformation

efficiencya

(%)

hemL vs. bar

I hemL/gabaculine

308 4 1.3

II hemL/gabaculine

350 15 4.3

Mean 2.8

I bar/Bialaphos

308 2 0.6

II bar/Bialaphos

350 11 3.1

Mean 1.8

MsGSAgr vs. bar

I MsGSAgr/gabaculine

250 3 1.2

II MsGSAgr/gabaculine

300 3 1.0

Mean 1.1

I bar/Bialaphos

250 1 0.4

II bar/Bialaphos

300 2 0.6

Mean 0.5

a Transformation efficiency was calculated as the number of trans-

genic plants (PCR-positive plants) divided by the total number of

selected explants


123

of southern blot with the MsGSAgr probe showed the

expected fragment. All the six plants resulted positive with

PCR reaction showed an hybridization signal. Four of them

had a single-copy insertions while the other 2 showed two

insertion points. As observed for the hemL gene, also with

M. sativa-derived GSA gene the selection with gabaculine

was an efficient system at least as bar marker and bialaphos

selection in the present concentration. A better selection of

gabaculine was observed in the early stages of regeneration

(Table 3), in fact, both callus regeneration and shoot for-

mation frequencies were lower on gabaculine-containing

media than on the herbicide. After 4 weeks of culture,

gabaculine selection showed 13% of callus with green

spots, and 28.6% of them developed into a shoot. Besides,

bialaphos allowed 20.5% of total bombarded callus to

regenerate, and 36.4% of these latter produced green

shoots. Selection efficiency, calculated for both methods as

the number of T0 plants containing the selectable marker

gene divided by the total number of regenerated plantlets,

was for gabaculine selection (87.5%), and for bialaphos

selection (50%). The Synechococcus hemL gene has

already been showed to be an efficient selectable marker in

agro-transformation of tobacco (Gough et al. 2001) and

alfalfa (Rosellini et al. 2007). In the present work we

suggest for the first time a valid use of hemL and above all

MsGSAgr genes as selectable markers also in durum wheat

biolistic transformation. Our results are in accord with a

number of published papers on biolistic transformation of

wheat with several marker genes, which reported trans-

formation efficiencies ranging from 1 to 3% (Barro et al.

1998; Blechl and Anderson 1996; Bliffeld et al. 1999; Ortiz

et al. 1996; Witrzens et al. 1998).

Conclusion

In the present work a new selection system for transgenic

plant was established for the first time in durum wheat,

using a plant-derived marker gene. The use of new alter-

native markers in transformation experiments allow

researchers to stack successively transgenes. Our system

used the phytotoxin gabaculine as the selective agent and

the M. sativa GSA gene, mutated for gabaculine resistance

(MsGSAgr), as the selectable marker. The efficiency of the

system based on gabaculine was evaluated by using as the

selectable marker both the bacterial gabaculine-resistant

hemL gene from Synechococcus strain GR6, and the plant-

derived point mutated GSA gene from alfalfa, the present

experiments showed that the GSA gene is as a good can-

didate as selection system in plant genetic transformation.

Acknowledgments This work was supported by Ministero

dell’Universita e della Ricerca, project PRIN 2007 and Universita

degli Studi di Bari Aldo Moro, Italy, projects Ateneo 2007, 2008.

1

1600 bp

2200 bp

2 3 4 5 6 7 8

Fig. 4 Southern blot analysis of transgenic wheat. DNA extracted

from leaves of the 8 T2 plants and digested with NcoI (NewEngland

Biolabs) that cuts once in the plasmid pAPCK-hemL. Digestion

products were separated by electrophoresis in a 0.8% agarose gel

(1 V/cm, 4�C). The 8 transgenic lines showed two copy of the

transgene

Table 3 Average selection efficiency, regeneration, shoot formation

and rooting frequencies in durum wheat transformation experiments

employing hemL/gabaculine or MsGSAgr/gabaculine systems, com-

pared to bar/Bialaphos selection

Selection

system

Regeneration

frequencya %

Shoot

formation

frequencyb %

Rooting

frequencyc %

Selection

efficiencyd %

hemL vs. bar

hemL/

gabaculine

9.5 40.8 68.0 78.9

bar/

Bialaphos

14.2 69.4 29.8 42.8

MsGSAgr vs. bar

MsGSAgr/

gabaculine

13.0 28.6 61.5 87.5

bar/

Bialaphos

20.5 36.4 20.0 50.0

a Regeneration frequency = percentage of callus forming green spotsb Shoot formation frequency = percentage of regenerated explants which

developed shootsc Rooting frequency = percentage of shoots which developed rootsd Selection efficiency = percentage of transgenic plants (PCR-positive plants)

on the total number of regenerated plants


123

References

Barro F, Cannel ME, Lazzeri PA, Barcelo P (1998) The influence of

auxins on transformation of wheat and analysis of transgene

integration patterns of transformants. Theor Appl Genet 97:

684–695

Blechl AE, Anderson OD (1996) Expression of a novel high-

molecular-weight glutenin subunit gene in transgenic wheat. Nat

Biotechnol 14:875–879

Bliffeld M, Mundy J, Potrykus I, Futterer J (1999) Genetic

engineering of wheat for increased resistance to powdery

mildew disease. Theor Appl Genet 98:1079–1086

Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors

for high-level expression of selectable and/or screenable marker

genes in monocotyledonous plants. Transgenic Res 5:213–218

Dellaporta SL, Wood J, Hicks JB (1983) Isolation of DNA from

higher plants. PMB Rep 4:19–21

Ferradini N, Nicolia A, Capomaccio S, Veronesi F, Rosellini D

(2011) A point mutation in the Medicago sativa GSA gene

provides a novel, efficient, selectable marker for plant genetic

engineering. J Biotechnol 156:147–152

Gadaleta A, Blechl A, Nguyen S, Blanco A (2002) Embriogenic

callus induction and plant regeneration variability among Italian

durum wheat cultivars. In: Proceedings of EUCARPIA Cereal

Section Meeting Salsomaggiore, Italy, pp 440–442

Gadaleta A, Giancaspro A, Blechl AE, Blanco A (2006) Phospho-

mannose isomerase, pmi, as a selectable marker gene for durum

wheat transformation. J Cereal Sci 43:31–37

Gough KC, Haves WS, Kilpatrick J, Whitelam GC (2001) Cyano-

bacterial GR6 glutamate-1-semialdehyde aminotransferase: a

novel enzyme-based selectable marker for plant transformation.

Plant Cell Rep 20:296–300

Grimm B (1990) Primary structure of a key enzyme in plant

tetrapyrrole synthesis: Glutamate 1-semialdehyde aminotrans-

ferase. PNAS 87:4169–4173

Grimm B, Kannangara CG, Smith AJ, Smith M (1991) Gabacline-

resistant glutamate 1-semialdehyde aminotransferase of Syn-echococcus. J Biol Chem 19:12495–12501

He GY, Rooke L, Steele S, Bekes F, Gras P, Tatham AS, Fido R,

Barcelo P, Shewry PR, Lazzeri PA (1999) Transformation of

pasta wheat (Triticum turgidum L var durum) with high-

molecular weight glutenin subunit genes and modification of

dough functionality. Mol Breed 5:377–386

Hill CM, Pearson SA, Smith AJ, Rogers LJ (1985) Inhibition of

chlorophyll synthesis in Hordeum vulgare by 3-amino-2,3-

dihydrobenzoic acid (gabaculine). Biosci Rep 5:775–781

Houghton JD, Turner L, Brown SB (1988) Biosynthesis of ALA in

Cyanidium caldarium: characterisation of tRNAglu, ligase,

dehydrogenase and GSA. Carlsberg Res Commun 54:131–143

Kahn A, Kannangara CG (1987) Gabaculine-resistant mutants of

chlamydomonas rheinhardtii with elevated glutamate 1-semial-

dehyde aminotransferase activity. Carlsberg Res Commun

52:73–81

Khan RS, Thirukkumaran G, Nakamura I, Mii M (2010) Rol (root

loci) gene as a positive selection marker to produce marker-free

Petunia hybrida. Plant Cell Tissue Organ Cult 101:279–285

Khan RS, Alam SS, Munir I, Azadi P, Nakamura I, Mii M (2011)

Botrytis cinerea-resistant marker-free Petunia hybrida produced

using the MAT vector system. Plant Cell Tissue Organ Cult

106:11–20

Kuiper HA, Kleter GA, Noteborn HP, Kok EJ (2001) Assessment of

the food safety issues related to genetically modified foods. Plant

J 27:503–528

Miki B, McHugh S (2004) Selectable marker genes in transgenic

plants: applications, alternatives and biosafety. J Biotechnol

107:193–232

Ogawa T, Kawahigashi H, Toki S, Handa H (2008) Efficient

transformation of wheat by using a mutated rice acetolactate

synthase gene as a selectable marker. Plant Cell Rep 27:

1325–1331

Ortiz JPA, Reggiardo MI, Ravizzini RA, Altabe SG, Cervigni GDL,

Spitteler MA, Morata MM, Elias FE, Vallejos RH (1996)

Hygromycin resistance as an efficient selectable marker for

wheat stable transformation. Plant Cell Rep 15:877–881

Qiao G, Zhou J, Jiang J, Sun Y, Pan L, Song H, Jiang J, Zhuo R,

Wang X, Sun Z (2010) Transformation of Liquidambar formo-sana L. via Agrobacterium tumefaciens using a mannose

selection system and recovery of salt tolerant lines. Plant Cell

Tissue Organ Cult 102:163–170

Ramessar K, Peremarti A, Gomez-Galera S, Naqvi S, Moralejo M,

Munoz P, Capell T, Christou P (2007) Biosafety and risk

assessment framework for selectable marker genes in transgenic

crop plants: a case of the science not supporting the politics.

Transgenic Res 16:261–280

Rando RR (1977) Mechanism of the irreversible inhibition of

c-aminobutyric acid-a-ketoglutaric acid transaminase by the

neurotoxin gabaculine. Biochemistry 16:4604–4610

Reinbothe S, Reinbothe C (1996) Regulation of chlorophyll biosyn-

thesis in angiosperms. Plant Physiol 111:1–7

Rosellini D (2011) Selectable marker genes from plants: reliability

and potential. In Vitro Cell Dev Biol-Pant 47:222–223

Rosellini D, Capomaccio S, Ferradini N, Savo Sardaro ML, Nicolia

A, Veronesi F (2007) Non-antibiotic, efficient selection for

alfalfa genetic engineering. Plant Cell Rep 26:1035–1044

Stoykova P, Stoeva-Popova P (2010) PMI (manA) as a nonantibiotic

selectable marker gene in plant biotechnology. Plant Cell Tissue

Organ Cult 105:141–148

Thiruvengadam M, Hsu WH, Yang CH (2011) Phosphomannose-

isomerase as a selectable marker to recover transgenic orchid

plants (Oncidium Gower Ramsey). Plant Cell Tissue Organ Cult

104:239–246

Weeks JT, Anderson OD, Blechl AE (1993) Rapid production of

multiple independent lines of fertile transgenic wheat (Triticumaestivum). Plant Physiol 102:1077–1108

Witrzens B, Brettell RIS, Murray FR, McElroy D, Li Z, Dennis ES

(1998) Comparison of three selectable marker genes for

transformation of wheat by microprojectile bombardment. Aust

J Plant Physiol 25:39–44


123

gabaculine selection using bacterial and plant marker genes (gsa-at) in durum wheat transformation

Documents