THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Bioloey, Inc.

Vol 267, No. 28, Issue of October 5, pp. 20392-20399,1992 Printed in U. S. A.

Gene Expression of Mouse Choline Acetyltransferase ALTERNATIVE SPLICING AND IDENTIFICATION OF A HIGHLY ACTIVE PROMOTER REGION*

(Received for publication, December 16, 1991)

Hidemi MisawaS, Kayoko Ishiig, and Takeo Deguchi From the Department of Molecular Neurobiology, Tokyo Metropolitan Institute for Neuroscience, 2-6 Musashidai, Fuchu-city, Tokyo 183, Japan

Seven types of mRNA for choline acetyltransferase that differ in the 5'-noncoding region were identified in the mouse spinal cord by cDNA cloning and polym- erase chain reaction. Among these transcripts, the M- type mRNA corresponding to the previously cloned mouse cDNA was most abundant in the spinal cord of mouse. A mouse genomic DNA clone containing the 5'- region of choline acetyltransferase mRNA was isolated and sequenced. Comparison of the sequences between the cDNAs and the genomic DNA revealed that the different mRNA species were transcribed from differ- ent promoter regions and produced by differential splicing. Two murine cholinergic cell lines, NSBOY and NGlOS-15, were shown to express the M-type mRNA almost exclusively, and were therefore used to study transcription of "type mRNA. Fragments of the 5'- region of choline acetyltransferase gene were ligated with chloramphenicol acetyltransferase reporter gene and introduced into cultured cells. The fragment from -2752 to +46, which contained the "type exon, a TATA-box like element upstream of the "type exon, and the downstream intron, induced a significant expression of CAT activity in neuronal but not in non- neuronal cell lines. This result indicates that this re- gion of choline acetyltransferase gene contains ele- ments that regulate neuron-specific expression of cho- line acetyltransferase activity. However, there was no parallel correlation between reporter gene expression in the transfected cells and intrinsic choline acetyl- transferase activity in these neuronal cell lines. Pos- sible mechanisms that would explain this observation are discussed.

Although choline acetyltransferase (acetyl-CoA:choline 0- acetyltransferase, EC 2.3.1.6), the enzyme responsible for the synthesis of acetylcholine, was discovered nearly five decades ago ( l ) , little is known how the enzyme activity is regulated

* This work was supported in part by grants-in-aid for Encourage- ment of Young Scientists (to H. M. and I. K.) and for Scientific Research on Priority Areas (Molecular Basis of Neural Connections) (to T. D.) from the Ministry of Education, Science and Culture, and by special coordination funds from the Science and Technology Agency of the Japanese government. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accord- ance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankTM/EMBL Data Bank with accession numbeds) The nucleotide sequence(s) reported in this paper has been submitted

$ To whom correspondence should be addressed. Fax: 011-81-423-

Present address: Dept. of Physiology, School of Medicine, Keio

012486-012493,

21-8678.

University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160, Japan.

under physiological or pathological conditions. In contrast, the regulation mechanism of catecholamine-synthesizing en- zymes has been much better elucidated. It has been demon- strated that choline acetyltransferase activity in neuronal cell lines and primary cultures of nervous tissue can be regulated by several substances and culture conditions (2). Cultured sympathetic ganglion cells were shown to switch phenotype from adrenergic to cholinergic in response to diffusible factors (3). Choline acetyltransferase activity in cultured motoneu- rons from the mouse spinal cord was markedly enhanced by co-culture with skeletal myotubes (4). However, it is not known how transcription of choline acetyltransferase gene is regulated under these conditions.

Recently, we and another laboratory have isolated and analyzed choline acetyltransferase cDNAs from pig (5), rat (6, 7 ) , and mouse ( 7 ) . Although there is a high level of homology between these cDNAs in the coding region and in the 38 bp' of the 5'-noncoding region, the sequence in the 5'- noncoding region upstream of -38 bp differs markedly be- tween rat and mouse. Recently we have found that there are five types of choline acetyltransferase mRNA that differ in the 5"noncoding region, and that "type mRNA correspond- ing to the previously cloned mouse cDNA is the most abun- dant type in the spinal cord of rat.'

In this study, we identified seven types of choline acetyl- transferase mRNA from mouse spinal cord. We have also cloned and sequenced genomic DNA for mouse choline ace- tyltransferase. Fragments of the genomic DNA were ligated to bacterial chloramphenicol acetyltransferase (CAT) gene and introduced into several cell lines. Assay of expressed CAT activity indicated that the 5"region of the choline acetyltrans- ferase gene contains elements that regulate high expression of the reporter gene in neuronal, but not in non-neuronal cell lines. Promoter and enhancer elements must be located in this region of the choline acetyltransferase gene.

MATERIALS AND METHODS

Construction and Screening of the cDNA Library-Total RNA was extracted from the spinal cord of ddy mouse (6-week-old male), and poly(A)+ RNA was selected by oligo(dT)-cellulose column chroma- tography (9). A cDNA library was constructed in hgtl0 as described* with 10 Kg of poly(A)+ RNA and a specific 17-mer oligonucleotide (Fig. 1, Reu-1), which is complementary to positions 642-658 of the mouse choline acetyltransferase cDNA (7). A cDNA library contain- ing 1.6 X lo6 independent phages was screened by plaque hybridiza- tion with the HindIII-ScaI fragment of mouse choline acetyltransfer- ase cDNA 32P-labeled by a Multiprime labeling system (Amersham

The abbreviations used are: bp, base pair(s); kb, kilobase(s); PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; SDS, sodium dodecyl sulfate; EtBr, ethidium bromide; CAT, chlor- amphenicol acetyltransferase.

M. Kengaku, H. Misawa, and T. Deguchi, submitted for publica- tion.

20392

Mouse Choline Acetyltransferase Gene 20393

Corp.). Prehybridization and hybridization were carried out as de- scribed (7). Oligonucleotides were synthesized using a Gene Assem- bler Plus (Pharmacia).

Screening of Mouse Genomic Library-A mouse genomic DNA library constructed in Charon 28 was obtained from the Japanese Cancer Research Resources Gene Bank (depositor: Dr. N. Takahashi) and screened with the "P-labeled cDNA for mouse choline acetyl- transferase (7).

Nucleotide Sequence Analysis-cDNA clones, genomic DNA clones, and PCR products were digested with restriction enzymes, subcloned into pUC18 and sequenced by the dideoxy method (10).

PCR Amplification-Five micrograms of poly(A)+ RNA prepared from the spinal cord and cholinergic cell lines and 50 pmol of P ( N ) ~ (Pharmacia) were used to synthesize cDNA as described.' The am- plification reaction was carried out for 25 cycles with 25 pmol of forward and reverse primers using a step program (94 "C, 40 s; 63 or 65 "C, 2 min, 72 "C, 3 min), followed by a 15-min final extension at 72 "C. For the analysis of CAT transcripts, 10 pg of total RNA was reverse-transcribed and amplified using a step program (94 "C, 40 s; 58 "C, 2 min, 72 "C, 3 min). The oligonucleotides used are shown in Fig. 1 and Fig. 9.

Rapid Amplification of cDNA 5'-Ends (5'-RACE)-cDNA synthesis was performed with 10 pg of poly(A)+ RNA from the spinal cord and a primer specific to M-type exon (Fig. 6B, RACE-I). After tailing with dCTP, one-tenth of the cDNA was amplified in 100 pl of standard reaction mixture containing 10 pmol of d(G)17-adaptor (5'- CTGAGAATTCGTCGACGTACGGGGGGGGGGGGGGGGG), 25 pmol of adaptor (5'-CTGAGAATTCGTCGACGTAC), and 25 pmol of a second primer specific to the M-type exon (Fig. 6B, RACE-2) as described (11). The d(G),,-adaptor and adaptor included the restric- tion sites for Sal1 and EcoRI. The 5'-RACE product was digested with proteinase K in 200 pl containing 0.5% SDS, 5 mM EDTA, and 200 pg of proteinase K at 56 "C for 30 min, extracted with phenol/ chloroform, followed with chloroform, and precipitated with ethanol. The precipitate was dissolved in 100 p1 of HzO, and a portion of the sample was analyzed by agarose gel electrophoresis.

Northern and Southern Blot Analyses-Total RNA was prepared from cultured cells (NS2OY and NG108-15), and Northern blot hybridization was performed as described (7) with the mouse choline acetyltransferase cDNA "'P-labeled using the Multiprime labeling system. PCR products (5 p l ) or 5'-RACE products (2 pl) were sepa- rated on a 2.5 or 3% NuSieve GTG agarose (FMC Bioproducts) gel containing ethidium bromide (EtBr, 0.5 pg/ml) and transferred to a GeneScreen Plus (Du Pont-New England Nuclear). Southern blot hybridization was performed as described.'

Construction of Expression Plasmids-Plasmids were constructed and amplified using standard protocols (12). A 1651-bp HindIIIl BamHI fragment from pSV2CAT (13) was inserted into the HindIIIl RamHI sites of Bluescript SK- (Stratagene) to construct pBlueCAT. A 135-bp HpaI/BamHI fragment, which contained a polyadenylation sequence, was isolated from pSV2CAT and blunted with T4 DNA polymerase. pBlueCAT was digested with KpnI, blunted, and ligated with the HpaI/BamHI fragment to construct pBlueOCAT. Orienta- tion of the insert was confirmed by sequencing. The 4054-bp EcoRI(b1unt-ended)/HindIII fragment from genomic DNA clone (MG35) was inserted into the HincII/HindIII sites of pBlueOCAT. The Hind111 site was digested, blunt-ended, and XbaI linker (5'- CTCTAGAG) was inserted. This construct (pBlueOEHCAT) con- tained a translation termination codon (TAG) in-frame to the initi- ation ATG codon of choline acetyltransferase gene. Thus CAT protein should be translated from the own ATG codon. The XhoI/TthlllI and XhoIIPstI fragments were excised from pBlueOEHCAT, and the ends of the deleted pBlueOEHCAT were blunted and religated to produce pBlueOTHCAT and pBlueOPHCAT, respectively. To pre- pare pBlueOTTCAT, the TthlllI/TthHB8I fragment of the genomic DNA clone was blunt-ended and inserted into the ClaI (blunt-ended) site of pBlueOCAT. The restriction sites used to construct CAT expression plasmids are shown in the sequence of MG35 clone (Fig. 4B).

Cell Culture, DNA Transfection, and Assay of Chloramphenicol Acetyltransferase (CAT) Activity-All cell lines were grown a t 37 "C in a 7% CO,, 93% air atmosphere in Dulbecco's modified Eagle's medium containing penicillin (lo5 units/liter), streptomycin sulfate (100 mg/liter) and 10% fetal calf serum. NIH/3T3 cells obtained from the Japanese Cancer Research Resources Gene Bank were cultured in medium containing 10% bovine calf serum instead of fetal calf serum. For NG108-15 cells, 1 X HAT solution (100 p~ hypoxan- thine, 0.4 p M aminopterine, 16 p~ thymidine) was supplemented.

Transient transfection of cultured cells was performed by the calcium phosphate precipitation method as described (14) using 5 pg of each CAT expression plasmid, 4 pg of carrier DNA (Bluescript), and 1 pg of internal control plasmid pact-p-gal (which contains p-galactosidase gene under the control of the chicken cytoplasmic @-actin promoter; Ref. 15) per 5 X lo5 cells in a 60-mm dish. Four hours after the addition of co-precipitated DNA, the cells were treated with 15% glycerol and cultured for 63-66 h. The cells were washed twice with phosphphate-buffered saline(-), collected by a rubber policeman, and then centrifuged. The pellet was sonicated in 150 p1 of 250 mM Tris- HCl, pH 8.0, and the content of protein was determined using Coomassie protein assay reagent (Pierce) with bovine serum albumin as a standard. The @-galactosidase activity was determined as de- scribed (12) using o-nitrophenyl-b-D-galactopyranoside as a sub- strate. The CAT activity of the extracts was measured as described (14) using 10 p~ [l-14C]chloramphenicol (57 mCi/mmol, Amersham) and 5-20 pg of protein for a 30-min incubation at 37 "C. The amounts of cell extract used for the CAT assay were normalized with p- galactosidase activity determined in each dish. Acetylated chloram- phenicol was separated from the substrate by thin layer chromatog- raphy on a silica gel 60A plate (Whatman). Autoradiography was carried out at -80 "C with an intensifying screen. The radioactivity of each spot was determined using an AMBIS radioanalytic imaging system (AMBIS System Inc.). Each transfection was carried out in duplicate.

Determination of Choline Acetyltransferase Actiuity-Choline ace- tyltransferase activity was measured by the method of Fonnum (16) with slight modifications (17). Cells grown to confluence in a 60-mm dish were lysed in 500 p1 of 0.4 M NaCl and 1.0% Triton X-100. The reaction was carried out at 37 "C for 60 min in a 100-pl reaction volume containing 60 p~ [l-14C]acetyl-CoA (10 mCi/mmol, ICN Radiochemicals), 8 mM choline, and 50-100 pg of protein. The radiolabeled acetylcholine was extracted and measured.

Primer Extension Analysis-Primer extension was carried out by a standard method (12). Total RNA (40 pg) extracted from NG108- 15 cells transfected with pBlueOEHCAT, pBlueOTHCAT, or pBlueOPHCAT was hybridized with a 32P-labeled oligonucleotide primer (lo5 cpm) complementary to the coding sequence (+15 to +31) of the CAT gene. Primer-extended products were analyzed on a 5% acrylamide sequencing gel containing 8 M urea.

RESULTS

Cloning of 5"Regions of Choline Acetyltransferase cDNAs- A cDNA library was constructed from the poly(A)+ RNA of mouse spinal cord using a 17-mer oligonucleotide primer (Fig. 1, Rev-1 ) that was complementary to positions 642-658 of the coding region of mouse choline acetyltransferase cDNA (7). Screening of 1.6 X lo6 recombinant phages detected about 300 positive signals with the 32P-labeled mouse cDNA frag- ment (HindIII-ScaI, 455 bp) containing the N-terminal cod- ing region as a probe. Twenty-one clones were randomly isolated, sequenced, and classified into two types. Fig. 1 shows the nucleotide sequences of the clones having the longest 5'- ends and the numbers of clones isolated in each type. There was no homology in the 5'-noncoding region upstream of -38, although the sequence in the coding and noncoding regions downstream of -39 was identical in both clones. Nineteen clones (named "type) had the same sequences as the mouse choline acetyltransferase cDNA previously cloned in this lab- oratory (7) and contained an additional 47 nucleotides at the 5'-end. The 5"noncoding region of the other two clones (named R1-type) showed high level of homology with the rat cDNA (7). The number of cDNA clones isolated should reflect the population of each type of mRNA species in the spinal cord. "type cDNA contained an in-frame termination codon upstream of the initiation ATG codon. R1-type contained neither an in-frame termination codon nor an ATG codon in the proper reading frame upstream of the putative initiation site.

PCR Analysis of 5'-Noncoding and Coding Regions of Cho- line Acetyltransferase mRNA-To confirm the presence of multiple types of choline acetyltransferase mRNA in the

20394 Mouse Choline Acetyltransferase Gene

A. "Type ( 1 9/2 1 clones) B. R1-Type (2D1 clones)

A B C 1 2 3 4 1 2 3 4 1 2 3

FIG. 2. PCR amplification of the 5'-region ( A and B ) and coding region (C) of choline acetyltransferase mHNA ex- pressed in mouse spinal cord. A and R, each type of transcript was amplified for 25 cycles using a specific forward primer and a common reverse primer (Rev-2) as described under "Materials and Methods." The products were separated on a 3% agarose gel contain- ing EtBr ( A ) and then transferred to a filter membrane and hybrid- ized with a '"P-labeled oligonucleotide corresponding to the common coding region ( R ) . Primers used were; R (lane I ) , N (lane 2 ) , M-1 (lane 3 ) , and M-2 (lane 4). C, the whole coding region was divided into three subregions (1-666, lane I; 618-1326, lane 2; 1279-1923, lane 3 ) and amplified for 25 cycles as described under "Materials and Methods." The products were separated on a 3% agarose gel contain- ing EtBr. +X174 DNA digested with HincII was used as a size marker and is shown on the left in base pairs.

mouse spinal cord, a cDNA mixture was prepared using ran- dom primers and analyzed by PCR amplification. A common reverse primer was selected from the coding region (Fig. 1, Rev-2) and forward primers were selected from the 5'-non- coding regions specific to each cDNA ("1, "2, and R oligonucleotides in Fig. 1). Recently, we found another type of mRNA (Nl- and N2-type) in the rat spinal cord.' The sequence corresponding to the rat N-type exon was identified on a cloned mouse genomic DNA (see below), and PCR analysis was performed using a specific oligonucleotide primer (5"GGATCCAGGCTCTATCATCTGAGG). After 25 cycles of PCR amplification, EtBr-stained bands were visible only in lanes 3 and 4 (Fig. 2 A ) . DNAs were blotted on a nylon

membrane and hybridized with a ''lP-labeled oligonucleotide corresponding to the common coding region (Fig. 2B). Four bands were detected with R-specific primer (lane 1). The band a t 300 bp corresponded to the length of R1-type mRNA. The other three bands at 220 bp (R2), 488 bp (R3) , and 409 bp ( R 4 ) were excised from the gel, subcloned into pUC18, and sequenced. The results indicated that these four cDNAs are produced by differential splicing with the same 5'-exon (Fig. 3). PCR products amplified with the primer specific to N- type mRNA detected two hybridization bands (lane 2). Se- quencing of both fragments revealed that they are produced by differential splicing of mRNA with the same 5'-region (Fig. 3). The sequences of R2-, N1-, and N2-type mRNAs were homologous to those of rat R2-, N1-, and N2-type mRNAs recently identified in our laboratory.' We cannot so far identify R3 and R4-type mRNAs from the rat spinal cord. In lane 3, a single hybridization band that corresponded to M-type mRNA was detected. In lane 4, a single band at 303 bp should contain a mixture of four types of mRNA (R3, R4, N1, and M), which was reflected in its high intensity. All the seven choline acetyltransferase mRNAs except R1-type con- tained an in-frame termination codon upstream to the as- signed ATG initiation codon.

To study whether there is differential splicing of mRNA in the coding region, the whole coding region was divided into three overlapping subregions, and each region was analyzed by PCR amplification (Fig. 2C). A single band was detected in each lane (666 bp in lane 1,708 bp in lane 2,645 bp in lane 3 ) , which coincided with the length of the coding region of the cloned mouse choline acetyltransferase cDNA (7). No other band was detected with Southern blot hybridization analysis (data not shown), thus excluding the possibility of differential splicing in the coding region of choline acetyl- transferase mRNA.

Cloning and Characterization of Genomic DNA for Mouse Choline Acetyltransferase-By screening a mouse genomic DNA library constructed in Charon 28 with the "'P-labeled mouse whole cDNA, two positive clones (MG1 and MG35) were isolated. The MG35 clone, which contained the 5'-region of mRNA, was analyzed (Fig. 4, A and B). Thirty-eight bp of the 5"noncoding region and the N-ternimal coding region constituted an exon. Two other exons were assigned according to the sequences detected in R3-, R4-, N1-, N2-, and "type mRNAs. R-type-specific 5'-exon was not found in this ge-

Mouse Choline Acetyltransferase Gene 20395

FIG. 3. Nucleotide sequences and alignment of choline acetyltransfer- ase cDNAs from PCR products. Nu- cleotide residues are numbered as shown in Fig. 1. Sequences are aligned with inserted gaps represented by dashes. Identical sequences in each mRNA type are boxed.

RZ -110 R 3 -378 R4 -299 Nl - 3 2 8 NZ -139

n3 - 2 8 8 n4 - 2 2 7 N! -288 N2 -99

R Z - 3 8

R2 -38 R 3 -198 R4 -198 N1 -198 NZ -38

RZ -38 R3 -108

N1 -108 R4 -108

N2 -38

RZ -18 R 3 -18 R4 -18 N1 -18 NZ -18

R 3 1 3 RZ 7 3

Nl 73 R4 73

NZ 73

CATAGGCTGATCTGTTCAGCCTGTCGCCTGCAAATCAGGACGCTCAGCGTGTGCAGCCCTCCCGGAAGGAA CATAGGCTGATCTGTTCAGCCTGTCGCCTGCAAATCAGGACGCTCAGCGTGTGCAGCCCTCCCGGAAGGAA CATAGGCTGATCTGTTCAGCCTGTCGCCTGCAAATCAGGACGCTCAGCGTGTGCAGCCCTCCCGGAAGGAA -----------------

GATCCAGGCTCTATCATCTGAGGAATGAGAAAACAGTTA GGATCCAGGCTCTATCATCTGAGGAATGAGAAAACAGTTA

CAGTCAGTCGGGGCGGCTGCTGGGATCT TCAGTCAGTCGGGGCGGCTGCTGGGATCT

--"--"---"-"----"------

"""""""""""""""""""""""""""""""""""""""""""""

GGCAACTTCGTCGGAGGCTCTGCTACAGAACCTAGGTGGCGGGCCCAACCTCTGGTACTGCTGCCACCCCCTCCCTGGCCCTTCTGGCTC GGCAACTTCGTCGGAGGCTCTGCTACAGAACCTAGGTGGCGGGCCCAACCTCTGGTACTGCTGCCACCCCCTCCCTGGCCCTTCTGGCTC GGCAACTTCGTCGGAGGCTCTGCTACAGAACCTAGGTGGCGGGCCCAACCTCTGGTACTGCTGCCACCCCCTCCCTGGCCCTTCTGGCTC

ACGCAGCCGCCTCCAGCCCTGCTTGGTGTGGAACAGTGCCGGTTCGGTGCGTAACAGCCCAGGAGAGCA ACGCAGCCGCCTCCAGCCCTGCTTGGTGTGGAACAGTGCCGGTTCGGTGCGTAACAGCCCAGGAGAGCA ACGCAGCCGCCTCCAGCCCTGCTTGGTGTGGAACAGTGCCGGTTCGGTGCGTAACAGCCCAGGAGAGCA

"_""""""""""""""""""""""""""""""""" TCGGCAGCTCTGCTACTCT

""""_"_""""""""""""""""""""""""""""- TCGGCAGCTCTGCTACTCT

GGATTAAGAATCGCTAGGATGCCTATCCTGGAAAAGGTCCCCCCAAAGATGCCTGTACAAGCTTCTAGCTGTGAGGAGGTGCTGGACTTA +l

GGATTAAGAATCGCTAGGATGCCTATCCTGGAAAAGGTCCCCCCAAAGATGCCTGTACAAGCTTCTAGCTGTGAGGAGGTGCTGGACTTA GGATTAAGAATCGCTAGGATGCCTATCCTGGAAAAGGTCCCCCCAAAGATGCCTGTACAAGCTTCTAGCTGTGAGGAGGTGCTGGACTTA GGATTAAGAATCGCTAGGATGCCTATCCTGGAAAAGGTCCCCCCAAAGATGCCTGTACAAGCTTCTAGCTGTGAGGAGGTGCTGGACTTA GGATTAAGAATCGCTAGGATGCCTATCCTGGAAAAGGTCCCCCC~GATGCCTGTACAAGCTTCTAGCTGTGAGGAGGTGCTGGACTTA

CCTAAGTTGCCAGTGCCCCCACTGCAGCAAACCCTGGC CCTAAGTTGCCAGTGCCCCCACTGCAGCAAACCCTGGC CCTAAGTTGCCAGTGCCCCCACTGCAGCAAACCCTGGC

nomic DNA. In fact, R-type-specific exon is located 3.7 kb upstream of the N-type exon in rat genomic DNA.' A sche- matic diagram showing the structure of the seven types of choline acetyltransferase mRNA is shown in Fig. 5. The sequences of exon-intron boundaries followed the GT/AG rule (18).

A homology search of the genomic DNA revealed the pres- ence of a number of possible cis-acting DNA elements. A TATA box-like A+T-rich region is present upstream of the "type exon at position -2651 to -2632, and upstream of the N-type exon at -3777 to -3768. Occurrences of the CCAAT box sequence, a core homologous sequence of certain pro- moters and enhancers, are present at -3613, -2702 (inverted orientation), -1734, -1513, -305, and -223. A sequence identical to the AP1-binding site (TGACTCA) (19, 20) was found at -2584. A sequence homologous to the CAMP respon- sive element (CRE, TGACGTCA) (21) is present at -1249. At position -1785, there is a sequence homologous to KB (NFKB-binding site, GGGACTTTCC) (22), which was found in an immunoglogulin K-chain enhancer. Recently this motif has been shown to be recognized by a brain specific transcrip- tion activator and involved in nerve-specific expression of the proenkephalin gene (23). The physiological role of these cis- elements is currently under investigation.

5'-RACE Analysis of Mouse Choline Acetyltransferase mRNA-To find out whether the "type mRNA is most abundant among the four types of mRNA that contained the "type exon (R3, R4, N1, and M), poly(A)+ RNA was reverse- transcribed with a primer (RACE-1) specific to "type exon (Fig. 6B). After the cDNA was added with poly(dC) tail (15 to -20 bp), a second strand was synthesized with the (dG)16- adaptor as a primer. The product was PCR-amplified with adaptor and another specific primer (RACE-2) located up- stream to the extension primer (RACE-1). PCR products were electrophoresed on a 3% agarose gel, blotted on a nylon membrane, and hybridized with 32P-labeled oligonucleotide

(RACE-3). Two hybridization signals (130 bp for band-1, 90 bp for band-2) were detected (Fig. 6A). These bands were excised from the gel and subcloned in pUC18. By colony hybridization, three clones from band-1 and 5 clones from band-2 were obtained and sequenced. All clones isolated from band-2 stopped before the splicing site, while the clones isolated from band-1 extended beyond the splicing site and corresponded to "type mRNA. The observations in Figs. 1, 2B, and 6 indicated that "type mRNA is the most abundant species in the mouse spinal cord.

Northern Blot and PCR Analysis of Choline Acetyltransfer- ase mRNA Expressed in Cholinergic Cell Lines"NS2OY neuroblastoma and NG108-15 neuroblastoma/glioma hybrid cells were shown to express high choline acetyltransferase activity. Northern blot analysis with the mouse cDNA re- vealed a single mRNA of 4.0 kb in both cell lines (Fig. 7A), which is comparable with the size of the choline acetyltrans- ferase mRNA in mouse spinal cord and brain (6, 7). The hybridization signal was much more intense in NS2OY than NGlO8-15 cells. PCR and Southern blot analysis detected only "type mRNA in both cell lines (Fig. 7B), indicating that M-type mRNA is the major species expressed in these cell lines. Thus these cholinergic cell lines offer a good model to study the gene expression of "type mRNA.

Promoter Activity in the ,Upstream Region of the M-type Exon-Promoter activity in the cloned choline acetyltrans- ferase gene was investigated by transient CAT expression assay using the two cholinergic cell lines, NS2OY and NG108- 15. Polyadenylation signal was introduced upstream of the CAT transcriptional unit. This manipulation (pBlueOCAT) markedly reduced the background activity to less than 1% of the parental plasmid (pBlueCAT). The EcoRI/HindIII frag- ment of genomic clone for choline acetyltransferase was in- serted between the poly(A) signal and the CAT transcriptional unit of pBlueOCAT. The genomic DNA was partially deleted using restriction enzymes and inserted into the same plasmid.

20396 Mouse Choline Acetyltransferase Gene

A

1 I I u I L L e, 300bps

B

EcoRI-Hind111 (4060 bp) fragment FIG. 4. Nucleotide sequences of

of mouse choline acetyltransferase gene. A, restriction maps of the EcoRI- HindIII region of genomic clone MG35. Open and filled boxes indicate the 5'- noncoding and coding regions of mRNA, respectively. This DNA clone contained N- and M-type exons, but not R-type exon. B, nucleotide sequence of the EcoRI-Hind111 region. Nucleotide resi- dues are numbered in the 5' to 3' direc- tion starting with the initiation codon (ATG, double underlined) as number 1. Exons are boxed. Restriction enzyme sites used to construct expression plas- mid DNA are underlined.

-4014 ~C~CCTGCMTCCC'CTCCGTGACCCCTCCCAGTCTMCCCCCTCTCCAMCACACTCGTATTCATTGAGGGMTGGATCAGGGAGGCATTG

-3914 GGCTCTTCGCAGAGCTGTACCGGTGATCACCMCCACCTACTGAGAGCCCCCMGTACAGTCATGCATCTG~GTCCTTCCTGCGGATC~CCAGTGC

-3814 CAMCTTGGTCTACTACACCCTGGTGCCTCCGGCCTGMTTMTAMCCATATCTGTCTGAGGAGGCCMGTCTC~ACTGATGAG~~~GTG~~~CAGTGT

-3714 GACACAAMCCTMGCACACTGGGGTTCACATGTTCMTGCAGCACTGAGGAGGGGTGGMGCTCTGMGATCC~AC~CCT~~~GAAMGGAMCMC

-3814 CCCMTCCCCCCCCCCCCCCCACACACACACACACACGATAGTCTCTCC~CCMGCCCAGTGTAGCACCT~~~AGGTTCCACCCGA~~~GMCCT~GGA

-3514 TCTGCCTGGCCTCCGAGGACAGCTGGCACCMGGGC~CACACAGTGGGACCTCGCCTCATCTTGTCMGAGA~~~AGCACMG~~~ACCTGG~CTGCA

EcoRl

-3414 C A G M G A G G A G G T A G T C C C C A ~ A T A G G G T C T C G G C C T G G T G A C A G T G T T C A ~ CATCCACGCTCTATCATCTGAGGM~AGAAMCAG~ACC

-3314

-3214 ATAGTGGCCCCTCAGGGTTATCCGGGGTGG~~~GTGAGGGTGGGGGCTCCCGCCTTGA~CCTACCATGGAGGCCCAGGCTGM~~~CAGTACACTCATTC

C A T G G A T C T G C C ~ C T C A G T C A T G ~ G T T f f i M T G G A A M C G G M G G M G A ' G A TAGGMCTGATGCTMTCCCTAGTCCACCACCCTG~CTGMT

-3114 CTGMTCCTGATCCCTGCACATGGGACTC~GA~CAGGGTGMGAGGCAG'GGGGTAGGGTMCCTGTGTATGCA~~~GGGMGGTCTGCAG~GGT

-2814 AGGACTGTCTCTGGGCCTCTGGTTGAGGCTPT~CMCTCCCACTTACCATCAGAGTG~CMGTCTGTGGTCTCTTGTCTGCTCCTCCC~CCC~

-2314 CTCTCCTCCTAGGGGGACTAC'GTCTGTCTGCCTGCCTGTCTGCCTGTCTATCCTTGACTGAGTCTG~GTGTMGATGGGAGAGTACTITGCCTGGG

-3014 CTGTCTGTCTGTCCTTGTCTGAGTCTTCTTGTGTMGAGGGGC'GTGTCTGTCTCTCTGTGTGTCTGTCTGTCCTTG~GAGTC~GTGTGAGAG

-2714 C A A C C T G C A C C A A T T G G A T C G T M A A G A A M C M G G G A G G T C T T A C T G T G G C C M C C M C T C C T T M ~ M T A ~ A M G ~ ~ ~ G T G C A G T M G A T P T

-2614 CACCCTTGTCAGGAGGGCCMM~CTTCTGACTCMGCACTCCCCAGGG~CTGCATAAGCAGCTGCCCAGGAGCCGGTGCGATGGGGGAGTATGGGG

TLIIII

-2514 ACTGGGGTCCCGGGCAGGCTGGGGTGGGGCGGTGGGGAGGCAATGTTCTGTGCCCC~CCMGGCCTMGTCTGATGCCAGTGCAGGMCTCATCCGGG

-2414 MCCTGTCCTAGACACGTGAGGGCAG~CAGGGMACGCAGGGCAGAGTGTGGGGTAGGGGGAGCAGTGGACTGTGAGGMGAGAGGCAGGCMG

-2314 C A A M G C G G G A G C G ~ G A G M G A G G G G G A ACAGCTGTGCCTGGT7TGCTTGCA CAGTCAGTCGCGCCG

-2214

-2014 CCCCTCMGACCCCCCCGACCCAGGCGTTGTCCCTGGGGGCTGGGGGGGGGGGGAGGGTGGCGGGGGGAGGTGTCCTTCTCCGGAGGAGTGTCCACCGAG

CTCACCCAGCCGCCTCCAGCCCTGCTTGGTGTGGMCAGTGCCGGTTCGGTGCGTMCAGCCCA~AGAGCA TGAGMGGGCTGGCCACCACTGCGCT -2114

CCTGCTGCGAMTGGCMCTTCGTCGGAGGCTCTGCTACAGMCCTAGGTGGCGGGCCCMCCTCTGGTACTGCTGCCACCCCCTCCCTGGCCCTTCTGG

-1814 C C G C T C G C A G G C C T T G A T T A T C A G G G C T T G G G A C T T C C C T T A T C ~ C C C A T C ~ A C ~ A C ~ G C C T G A C A T C T G C C M T C C C M G G T C T G T G G T

-1814 GCACAGCTTCCCAGGCCCAGAGA~CCGGGACGCTCAGAGTCTACAGCGTTCCAGGCACCAGTAGTCGTCGGGGTACATCTAffiAGA~GGA~T

-1514 CCCMTAGMGCAGAMTCGGACAGTACCAMCCGCAGAMGACAMTACATTCAMTTCTCTMGCCTGGATCMGAGGCTTAGGAGGMGGAGCTGGG

-1614 TGCGAGAMGTGACACCACTGAGAGCCTGGGAMCCAGMCAGACTGGTG~GGACC~CAGGGCAGAGCAGAGGACCCCC~GTGCCCCCACMGCCAG

-1714 mGTCGTGTTGTACCCGCGGCG~AGTMTATCGCTGGGCCTCAGTPTCCTCCAGCCATTCTTGAGMGGTGGGGAGTGCTGGCG~MGTGCCACATC

plll

-1414 GTGTCTCGGACAGTGGMTACCGATCAGGATGCTGAG

-1314 A T C G C C C I U M C G A G M T T A C G T G C A T M T C G G T A C A G C C 7 C

-1214 TCATCCTGCCATITCTAGCTACAGTGGTCTCTAGGACTATTGTGCTGGGAGTGCACTGTACACGGCCmCTATCCTCTCTG~CAGTGffiACCAGGCAT

-1114 GCACCMCTCTTCTACTCTTAGGTCTGC~CTTCCTCC'CTGGATGGTCTCTCCCCCGMCCMGTGAGCCTTATGCCAGCACCT~~~CTGCTGCTGCTG

-1014 CTGCTCCTCCTGCTGCTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGCCCMCAGGTTCMTGTAGCTPTAGGCTC~AGGG

-814 CTMTAMCGCAGCTTGGTTGAMTCTTGACTGTACATGTATGCAGG~GG~AGTGGGGCAGAGGGTGTATCCTACIUMCTGGCCTGTGTCCTTA

-814 GCTTACCTTATPTCTAGTCCACC~CCAMTTMTCTGCC~CCTMGGCTGTCAGGAGACTCTAGAGGCCCTGACTACCTGCTCCCCAGMGGTATCA

-714 TGCCCTTCCGTAGTTCCCTCATACCCAACCTTGGAGCCTGCTGCCCATAGACTACCCMG~MCACTCTGCTMCAGACCCAGAGTCCTCMGMGCCC

-614 CGAATATCACCCAGAGTACAGGCC~AGMT~CTTGTGGGCA'CAAGCACACTCTCATTATAC~TACRCATACACACACAGGG~GGGGAGCTITCTGA

-514 ACTCACGTCCCCTCTACTCTATACCTGACCCAAGCCAGGCATCTGAGAGGGAAATCTGMCCCAGCAGATATAG~GCACTTGAGAGCTACAGACTTG

-414 CGCGAAMGTTCATCTTGGCCAGAGA~ATA'GAGTTCCAGGCAMCCMGGTGCTCTAGTGCTCTGATCCCAGAMTCTGGGAGTGTGCMCCAGCC

-314 CACCTCCTCCCAATGCATCCTGGAATGCTCAGCTAGCCTTGGGTCATAGCAGC'CATGAAGCAGGTCTPTGCTGGTGGCTCMGGCAGACCCMTCTCT

-214 CCCTCTCCATTCWACAGTACACTGTGGGCAGGAACACAGGGCTGAGGTCTGAGATGGCAGTCATAGAGGCGCAGAGTTCCCTACACACTACTGTCAGTG

-114 GTCTCCTTGTGCACTCCGACTAAGGCTATGGGA~CATTCAGGCTCTGTGTGATGCTGAGTCTCCTCTG~CCCA TCGGCACCTCTGCTACTCTGGAT

- 1 4 T A A G A A T C C C T A C G ~ C C T A T C C T G G A A A A G G T C C C C C C A A A G A T G C C T G T A C ~ - Hind111

As a positive control, plasmid DNA containing the SV40 promoter and enhancer (pSV2CAT) was used. The plasmid DNAs were introduced into the cells by the calcium phosphate precipitation method, and CAT activity was determined 63- 66 h later (Fig. 8). pSV2CAT expressed high levels of CAT activity; there was 3.20 and 1.06% substrate acetylation/pg protein/30 min in NS2OY and NG108-15 cells, respectively. A high amount of expression of CAT activity was observed in pBlueOEHCAT that contained the whole region of genomic DNA from EcoRI to HindIII. Deletion of choline acetyltrans-

ferase gene from -4060 to -2752 (pBlueOTHCAT) caused 1.7- and 1.9-fold increase of CAT expression in NS2OY and NG108-15, respectively, indicating that a negative element or structural hindrance for CAT expression is present within this deleted sequence. Further deletion to -1823 (pBlue- OPHCAT) reduced CAT expression to a level comparable with that of the negative control, pBlueOCAT. Insertion of the 493 bp (from -2751 to -2259) containing a TATA-box like sequence (pBlueOTTCAT) induced a significant level of CAT activity. These observations indicated that a promoter

Mouse Choline Acetyltransferase Gene 20397

K-Tylr Exon

h-T!p \I.T>pr lirull I:,,,!,

('mixllng I < X O , ,

FIG. 5. Schematic diagram showing the splicing patterns of multiple choline acetyltransferase mRNA species. Open and /illrd hoxes indicate the 5"noncoding and coding regions, respectively. Since R-type exon was not found in MG35 clone, it is positioned based on analogy to the rat choline acetyltransferase gene.

.A B

FIG. 6. 5'-RACE analysis of choline acetyltransferase mRNA species containing "type exon. A, poly(A)' RNA from the mouse spinal cord was reverse-transcribed with a primer (RACE- I ) , and PCR amplification was performed with the second primer (HACK-2) as described under "Materials and Methods." The product was separated on a 3% agarose gel, blotted on a filter membrane, and hybridized with the '"P-labeled third primer (RACE-3). I?, identifi- cation of sequences of the 5'-end of 5'-RACE products. The filled circles indicate the position of the 5'-ends of RACE clones, and the open circle shows the 5'-end of cloned M-type cDNA (Fig. 1). The filled triangle indicates the splicing site within M-type exon (Fig. 4). Horizontal arrows indicate the position of primers used. Nucleotide residues are numbered as shown in Fig. 4.

activity is present in the -2751 and -2259 region, and an enhancer-like activity in the -2258 to 46 region.

Primer extension of CAT mRNAs from NG108-15 cells transfected with pBlueOEHCAT or pBlueOTHCAT yielded a product approximately 370 bp long (Fig. 9A, lunes I and 2), corresponding to the length of the transcript initiated at the promoter for "type mRNA and spliced as indicated in Fig. 5 . No product was observed with the RNA from NG108-15 cells transfected with pBlueOPHCAT (Fig. 9A, lune 3 ) . To further confirm that CAT mRNAs were initiated and spliced correctly in the transfection experiment, a cDNA mixture was prepared and analyzed by PCR amplification followed by Southern hybridization analysis (Fig. 9B). The common re- verse primer was complementary to the coding sequence (+20 t o +41) of the CAT gene. Forward primers were positioned at the 5'-end of the cloned "type mRNA (Fig. 1, M- I ) or immediately upstream of the TATA box-like sequence of the "type promoter (Fig. 9C). A single band (384 bp) was detected in the cDNA mixture prepared from cells transfected with pBlueOEHCAT (lune I ) and pBlueOTHCAT (lune 3 ) only when the forward primer was selected from the "type exon (lunes 1 and 3 ) . The size of this product coincided with

A B

1 2 Origin-.

9.5 . 1.5 - 4.4 -

2.4 -

1.4 -

NSZOY NG108-15 1 2 3 4 1 2 3 4

365 - 303 -

FIG. 7. Northern blot and PCR analysis of choline acetyl- transferase mRNA expressed in cholinergic cell lines. A, total RNAs (20 pg) prepared from NS20Y (lane I ) and NG108-15 (lane 2 ) cells were separated on a 1% formaldehyde-agarose gel, blotted on a nylon membrane, and hybridized with the :'2P-labeled mouse choline acetyltransferase cDNA. RNA ladder (BRL) was used as a size marker and is shown on the left in kilobases. R, poly(A)+ RNAs from the cells were analyzed by PCR with the specific forward primers and the common reverse primer under the same conditions as in Fig. 2R. The lengths of hybridization bands are shown on the left in base pairs. For autoradiography of NG108-15, a 3-fold longer exposure was required compared with that for NS2OY cells.

NSZOY N C I O R - I ~

pRlueOEtICA1 I I 9 SIX

pRlueOTHCAT - IS 062

pRlueOPHCA1 - I ??

pRlueOTTCAT 0 4 I Rh

pBlueOCAT No - Inseri 2 27

pSV2CAT SV40 Promoter & Enhancer IO I 0 0

FIG. 8. Transient CAT assay in cholinergic cell lines. The structure and restriction enzyme sites of the 5"noncoding and coding regions are the same as those shown in Fig. 4. The open boxes indicate the regions of choline acetyltransferase gene inserted into the CAT expression plasmid. CAT activity is given as a percentage of that in the cells transfected with pSV2CAT. Duplicate transfections were performed in each experiment, and the values are the means of two independent experiments.

the length of the correctly spliced CAT mRNA (Fig. 9C), and the product was not detected when the forward primer was selected from the region upstream of "type exon (lunes 2 and 4 ) .

Preferential Expression of Mouse Choline Acetyltransferase Gene in Neuron-derived Cell Lines-To determine whether the genomic DNA (EcoRI-Hind111 fragment) contained ele- ments necessary for neuron-specific expression of choline acetyltransferase gene, pBlueOEHCAT and pBlueOTTCAT were introduced into various murine cell lines (Fig. 10). As negative and positive controls, pBlueOCAT and pSV2CAT plasmids were also introduced. Transient expression of CAT activity was calculated as a percentage of that of pSV2CAT (Table I). Intrinsic choline acetyltransferase activity in these cells was also determined (Table I). A high level of expression of CAT activity from pSV2CAT was observed in all cell lines. In contrast, pBlueOEHCAT expressed high CAT activity in NG108-15, and moderate activity in NS20Y and Nl8TGl

20398 Mouse Choline Acetyltransferase Gene

A

1 2 3

B

1 2 3 4 5 6

384" 0

C

- = = - 1 -E! 2 ~ , * g = &

N tyv I/.0" w y y Em" N.m;i..>,! codq I 1,,1 - ",YV* -.,- - lhmr

r.,on,,<m * - v m - - r('n

FIG. 9. Primer extension ( A ) and PCR ( B ) analyses of CAT transcripts in NGlOS-15 cells. A, RNAs prepared from NG108- 15 cells transfected with pBlueOEHCAT (lane I ) , pBlueOTHCAT (lane 2) , and pBlueOPHCAT (lane 3 ) were used as templates for primer extension experiments. The products were analyzed on an 5% acrylamide gel containing 8 M urea. 4x174 DNA digested with Hinff was used as a size marker and is shown on the left in base pairs. The arrow indicates an approximately 370-bp primer extension product. R, RNAs from NG108-15 cells transfected with pBlueOEHCAT (lanes I and 21, pBlueOTHCAT (lanes 3 and 4 ) , and pBIueOPHCAT (lanes 5 and 6) were analyzed by PCR. The reverse primer was complementary to the coding region of the CAT gene. The forward primers were selected from the most 5'-end of M-type exon (M- I in Fig. 1, lanes I , 3, and 5), as well as the 22-mer oligonucleotide (5'- CTTACTGTGGCCAACCAACTCC) located immediately upstream of the TATA box-like sequence (lanes 2,4, and 6). The products were separated on a 2.5% agarose gel and analyzed by Southern hybridi- zation as in Fig. 2B. The size of the hybridization band is shown on the left in base pairs. C, schematic diagram showing the positions of primers used in the primer extension and PCR analyses.

cells. No activity was detected in fibroblast cell lines, L, NIH/ 3T3, and Balb/3T3 cells. pBlueOTTCAT was also expressed in NG108-15, N18TG1, and NS20Y cell lines, although the levels of activity were considerably less than for pBlue- OEHCAT. Intrinsic choline acetyltransferase activity was high in NS20Y and NG108-15 cells, whereas a low but sig- nificant activity was detected in Nl8TGl cells. Choline ace- tyltransferase activity was not detected in fibroblast cell lines. Expression of CAT activity was not exactly in parallel with intrinsic choline acetyltransferase activity in the three neu- ronal cell lines, although expression of CAT activity was observed only in the neuronal cell lines so far tested.

DISCUSSION

Analysis of choline acetyltransferase mRNA by cDNA clon- ing and PCR amplification identified seven types of mRNA in the mouse spinal cord that differed in the 5"noncoding region. R3- and R4-type mRNAs were detected in the mouse spinal cord, in addition to the five types of mRNAs found in the rat spinal cord.2 Sequencing of the mouse genomic DNA for choline acetyltransferase revealed that the exon-intron organization and splicing pattern are the same as for the rat choline acetyltransferase gene. The R-type exon, however, was not found in the genomic DNA clone isolated in this

ET" A. NS2OY

ACCM I

CM -

AC.CM -

FIG. 10. Autoradiography of transient CAT assay in various cell lines. Four expression plasmids, pBlueOCAT (lane I ) , pBlue- OEHCAT (lane 2), pBlueOTTCAT (lane 3 ) , and pSV2CAT (lane 41, were transfected in these cell lines, and CAT activity was measured as described under "Materials and Methods." pSV2CAT and pBlueOCAT were used as positive and negative controls, respectively. This experiment was repeated again with similar results.

study. All the transcripts except the R1-type contained an in- frame termination codon upstream of the putative initiation ATG codon, suggesting that the transcripts are different only in the 5"noncoding regions and possibly produce choline acetyltransferase protein of the same structure. A subject for further research is whether the R1-type has an open reading frame upstream of the putative ATG codon.

The conclusion that the "type mRNA is also the most abundant in the mouse spinal cord is based on the following observations. (i) Nineteen out of 21 cDNA clones isolated contained the "type exon. Out of these, four clones were M- type and 15 clones were terminated in the region common to M, N1, R3 and R4-type mRNAs. (ii) 5'-RACE analysis of the "type exon of mRNA detected two major bands. The upper band corresponded to "type mRNA, while the lower band comprised cDNAs terminated in the region downstream of the splicing site. Premature termination at this site was also observed in 6 clones isolated from the cDNA library. (iii) The PCR product corresponding to "type mRNA gave the most intense signal among other types of mRNA.

Sequencing of the mouse genomic clone containing the 5 ' - noncoding region suggested that promoter-like sequences ex- ist upstream of N- and "type exons. A transfection assay using CAT reporter gene should prove the functional role of these elements. To begin with, choline acetyltransferase mRNA species expressed in two cholinergic cell lines, NS2OY and NG108-15, were analyzed by Northern blot hybridization and PCR amplification. Northern blot analysis revealed a single 4.0-kb mRNA in both cell lines. PCR analysis showed that "type mRNA was expressed predominantly, whereas the other mRNA species were hardly detectable in these cell lines, indicating that these cell lines are suitable to study the expression of "type mRNA.

When the CAT transcriptional unit was ligated to the multiple cloning site of Bluescript (pBlueCAT), a high CAT

Mouse Choline Acetyltransferase Gene 20399

TABLE I Transient expression of CAT activity and intrinsic choline acetyltransferase activity in variow cell lines

CAT activities are calculated from the data shown in Fig. 10. Choline acetyltransferase activities were determined as described under “Materials and Methods.” The values are the means of dudicate determinations.

Cell Lines

NS20Y NG108-15

N18TG1 L cells Balb/3T3 NIHl3T3

Origin

Neuroblastoma Neuroblastoma

and glioma Neuroblastoma Connective tissue Embryo Embrvo

CAT activity (% of pSV2CAT) Choline acetyltransferase

pBlueOCAT pBlueOEHCAT pBlueOTTCAT activity

pmollmg proteinlmin 2 10 5 262

24 499 220 188

5 19 15 3 4 3

<1 2 1 2 2 1

12 <1 <1 <1

activity was expressed, which made assessment of the pro- moter activity of inserted DNA fragments difficult. When the poly(A) addition signal of SV40 early region was inserted in front of the CAT transcriptional unit, the resultant plasmid (pBlueOCAT) showed a very low expression of CAT activity, less than 1% of the activity expressed from pBlueCAT in the transfected various cell lines. A similar improvement of back- ground CAT activity was reported with pBR322 (8).

The transient expression study indicated that the promo- tor-like element upstream of the “type exon (T th l l l I - TthHB8I fragment) of choline acetyltransferase gene induces expression of CAT activity in several neural cell lines. Dele- tion of the N-type exon and its upstream region increased CAT expression about 2-fold, suggesting that this region exerts a suppressive effect. I t is, however, undetermined whether this region contains a suppressor element or whether the effect is simply due to structural hindrance for transcrip- tional activity. Deletion of the A+T-rich region upstream of the M-type exon abolished CAT expression. When the M- type exon and the downstream intron were deleted, expression of CAT activity was markedly reduced. Two possible expla- nations for this are conceivable. i) There is an enhancer-like element in the intron region. ii) The native exon-intron organization is necessary for high transcriptional activity of choline acetyltransferase gene. Detailed study to elucidate the mechanism is currently in progress.

The present study demonstrates that the 5”region of cho- line acetyltransferase gene cloned in this laboratory contains sufficient information to cause specific expression in several neuronal, but not in non-neuronal, cell lines. There was no correlation between intrinsic choline acetyltransferase activ- ity and transient expression of CAT activity in neuronal cell lines. This observation indicates either that elements needed for neuron-specific expression, but not for cholinergic-specific expression, are located in this region of the choline acetyl- transferase gene, or that the differences in choline acetyl- transferase activity in these cell lines are determined by mechanisms other than transcription factors.

The molecular and genetic mechanisms of phenotype selec- tion of cholinergic versus adrenergic neurotransmitter syn- thesis and the maintenance of cholinergic function remain to

be elucidated. Analysis of the expression mechanism of cho- line acetyltransferase gene, both of the regulatory elements on the gene and of its transcription factors, will give clues to the answers of the questions raised above. I t may also yield information on the pathogenesis and potential therapies for devastating neurodegenerative diseases such as Alzheimer’s disease and amyotrophic lateral sclerosis.

Acknowledgments-We thank Dr. Takehiko Amano (Mitsubishi Kasei Institute for Life Sciences) for the gift of NS2OY and N18TG1 cells, Dr. Shunsuke Ishii (Institute of Physical and Chemical Research (RIKEN)) for the gift of pact-8-gal, Dr. Ryosuke Takahashi (Depart- ment of Neurology in this institute) for advice and discussion, and Michiko Tsuchikura for secretarial assistance.

REFERENCES

2. Salvaterra, P. M., and Vaughn, J. E. (1989) Int. Reu. Neurobiol. 31 , 81- 1. Nachmansohn, D., and Machado, A. L. (1943) J. Neurophysiol. 6,397-403

3. Patterson, P . H. (1978) Annu. Reu. Neurosci. 1 , 1-17 4. Giller, E. L., Jr., Schrier, B. K., Shainberg, A., Fisk, H. R., and Nelson, P.

5. Berrard, S., Brice, A., Lottspelch, F., Braun, A.. Barde, Y. A,, and Mallet,

6. Brice, A,, Berrard, S., Raynaud, B., Ansieau, S., Coppola, T., Weber, M. J.,

7. Ishii, K., Oda, Y., Ichikawa, T., and Deguchl, T. (1990) Mol. Brain Res. 7 ,

8. Araki, E., Shimada, F., Shichiri, M., Mori, M., and Ebina, Y. (1988) Nucleic

9. Aviv. H.. and Leder. P. (1972) Proc. Natl. Acad. Sci. U. S. A. 69. 1408-

143

G. (1973) Science 182,588-589

J. (1987) P m . Natl. Acad. Sci. U. S. A. 84,9280-9284

and Mallet, J. (1989) J. Neurosci. Res. 23, 266-273

151-159

Acids Res. 16,1627 . .

14’12 ’

10. Saneer. F.. Nicklen. S.. and Coulson. A. R. (1977) Proc. Natl. Acad. Sci.

11.

12.

13.

15. 14.

16. 17. 18.

CS,A. ?4, 5463-5467 Frohman, M. A., Dush, M, K., and Martin, G. R. (1988) Proc. NatL Acad.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Sci. U. S. A. 86,8998-9002

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Bid. 2, 1044-1051

Rosenthal, N. (1987) Methods Enzymol. 162,704-720 Inagaki N. Maekawa, T., Sudo, T., Ishii, S., Seino, Y., and Imura, H.

Fonnum, F. (1975) J. Neurochem. 24,407-409 (199;) Pioc. Natl. Acad. Sci. U. S. A. 8 9 , 1045-1049

Ishida, I., and Deguchi, T. (1983) Deu. Brain Res. 7,13-23 Breathnach, R., and Chambon, P. (1981) Annu. Reu. Biochem. 60, 349-

3x3 19. An-ei, P I Irnagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J.,

20. Lee, W., Mitchell, P., and Tjian, R. (1987) Cell 4 9 , 741-752 21. Montminy, M. R., Sevarino, K. A,, Wagner, J. A., Mandel, G., and Good-

22. Sen, R., and Baltimore, D. (1986) Cell 47, 921-928 23. Korner, M., Rattner, A., Mauxion, F., Sen, R., and Citri, Y. (1989) Neuron

fonat;C., Herrlich, P., and Karin, M. (1987) Cell 49,729-739

man, R. H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,6682-6686

3, 563-572