gene therapy & molecular biology volume 8 issue b
DESCRIPTION
Gene Therapy & Molecular Biology Volume 8 Issue BTRANSCRIPT
![Page 1: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/1.jpg)
GENE THERAPY &
MOLECULAR BIOLOGY
FROM BASIC MECHANISMS TO
CLINICAL APPLICATIONS
Volume 8
Number 2
December 2004
Published by Gene Therapy Press
![Page 2: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/2.jpg)
![Page 3: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/3.jpg)
GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org
!!!!!!!!!!!!!!!!!!!!!!!!!
Editor Teni Boulikas Ph. D.,
CEO Regulon Inc.
715 North Shoreline Blvd.
Mountain View, California, 94043
USA
Tel: 650-968-1129
Fax: 650-567-9082
E-mail: [email protected]
Teni Boulikas Ph. D.,
CEO, Regulon AE.
Gregoriou Afxentiou 7
Alimos, Athens, 17455
Greece
Tel: +30-210-9853849
Fax: +30-210-9858453
E-mail: [email protected]
!!!!!!!!!!!!!!!!!!!!!!!!!
Assistant to the Editor Maria Vougiouka B.Sc.,
Gregoriou Afxentiou 7
Alimos, Athens, 17455
Greece
Tel: +30-210-9858454
Fax: +30-210-9858453
E-mail: [email protected]
!!!!!!!!!!!!!!!!!!!!!!!!! Associate Editors Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA
Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA
Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA
Crouzet, Joël, Ph.D. Neurotech S.A, France
Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France
Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA
Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of
California at Davis, USA.
Webb, David, Ph.D., Celgene Corporation, USA
Wolff, Jon, Ph.D., University of Wisconsin, USA
!!!!!!!!!!!!!!!!!!!!!!!!!
Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer
Center, USA
Anson, Donald S., Ph.D., Women's and Children's
Hospital, Australia
Ariga, Hiroyoshi, Ph.D., Hokkaido University,
Japan
Baldwin, H. Scott, M.D Vanderbilt University
Medical Center, USA
Barranger, John, MD, Ph.D., University of
Pittsburgh, USA
Black, Keith L. M.D., Maxine Dunitz Neurosurgical
Institute, Cedars-Sinai Medical Center, USA
Bode, Jürgen, Gesellschaft für Biotechnologische
Forschung m.b.H., Germany
Bohn, Martha C., Ph.D., The Feinberg School of
Medicine, Northwestern University, USA
Bresnick, Emery, Ph.D., University of Wisconsin
Medical School, USA
Caiafa, Paola, Ph.D., Università di Roma “La
Sapienza”, Italy
Chao, Lee, Ph.D., Medical University of South
Carolina, USA
![Page 4: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/4.jpg)
Cheng, Seng H. Ph.D., Genzyme Corporation, USA
Clements, Barklie, Ph.D., University of Glasgow,
USA
Cole, David J. M.D., Medical University of South
Carolina, USA
Chishti, Athar H., Ph.D., University of Illinois
College of Medicine, USA
Davie, James R, Ph.D., Manitoba Institute of Cell
Biology;USA
DePamphilis, Melvin L, Ph.D., National Institute of
Child Health and Human, National Institutes of Health,
USA
Donoghue, Daniel J., Ph.D., Center for Molecular
Genetics, University of California, San Diego, USA
Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals
Inc, USA
Fisher, Paul A. Ph.D., State University of New York,
USA
Galanis, Evanthia, M.D., Mayo Clinic, USA
Gardner, Thomas A, M.D., Indiana University
Cancer Center, USA
Georgiev, Georgii, Ph.D., Russian Academy of
Sciences, USA
Getzenberg, Robert, Ph.D., Institute Shadyside
Medical Center, USA
Ghosh, Sankar Ph.D., Yale University School of
Medicine, USA
Gojobori, Takashi, Ph.D., Center for Information
Biology, National Institute of Genetics, Japan
Harris David T., Ph.D., Cord Blood Bank, University
of Arizona, USA
Heldin, Paraskevi Ph.D., Uppsala Universitet,
Sweden
Hesdorffer, Charles S., M.D., Columbia University,
USA
Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc.,
USA
Hung, Mien-Chie, Ph.D., The University of Texas,
USA
Johnston, Brian, Ph.D., Somagenics, Inc, USA
Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA
Joshi, Sadhna, Ph.D., D.Sc., University of Toronto
Canada
Kaltschmidt, Christian, Ph.D., Universität
Witten/Herdecke, Germany
Kiyama, Ryoiti, Ph.D., National Institute of
Bioscience and Human-Technology, Japan
Krawetz, Stephen A., Ph.D., Wayne State
University School of Medicine, USA
Kruse, Carol A., Ph.D., La Jolla Institute for
Molecular Medicine, USA
Kuo, Tien, Ph.D., The University of Texas M. D.
Anderson Cancer USA
Kurachi Kotoku, Ph.D., University of Michigan
Medical School, USA
Kuroki, Masahide, M.D., Ph.D., Fukuoka
University School of Medicine, Japan
Lai, Mei T. Ph.D., Lilly Research Laboratories USA
Latchman, David S., PhD, Dsc, MRCPath
University of London, UK
Lavin, Martin F, Ph.D., The Queensland Cancer
Fund Research Unit, The Queensland Institute of
Medical Research, Australia
Lebkowski, Jane S., Ph.D., GERON Corporation,
USA
Li, Jian Jian, Ph.D., City of Hope National Medical
Center, USA
Li, Liangping Ph.D., Max-Delbrück-Center for
Molecular Medicine, Germany
Lu, Yi, Ph.D., University of Tennessee Health Science
Center, USA
Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc.
Switzerland
Malone, Robert W., M.D., Aeras Global TB Vaccine
Foundation, USA
Mazarakis, Nicholas D. Ph.D., Oxford BioMedica,
UK
Mirkin, Sergei, M. Ph.D., University of Illinois at
Chicago, USA
Moroianu, Junona, Ph.D., Boston College, USA
Müller, Rolf, Ph.D., Institut für Molekularbiologie
und Tumorforschung, Phillips-Universität Marburg,
USA
Noteborn, Mathieu, Ph.D., Leiden University, The
Netherlands
Papamatheakis, Joseph (Sifis), Ph.D., Institute of
Molecular Biology and Biotechnology
Foundation for Research and Technology Hellas, USA
Platsoucas, Chris, D., Ph.D., Temple University
School of Medicine, USA
Rockson, Stanley G., M.D., Stanford University
School of Medicine, USA
Poeschla, Eric, M.D., Mayo Clinic, USA
Pomerantz, Roger, J., M.D., Tibotec, Inc., USA
Raizada, Mohan K., Ph.D., University of Florida,
USA
Razin, Sergey, Ph.D., Institute of Gene Biology
Russian Academy of Sciences, USA
Robbins, Paul, D, Ph.D., University of Pittsburgh,
USA
Rosenblatt, Joseph, D., M.D, University of Miami
School of Medicine, USA
Rosner, Marsha, R., Ph.D., Ben May Institute for
Cancer Research, University of Chicago, USA
Royer, Hans-Dieter, M.D., (CAESAR), Germany
Rubin, Joseph, M.D., Mayo Medical School
Mayo Clinic, USA
Saenko Evgueni L., Ph.D., University of Maryland
School of Medicine Center for Vascular and
Inflammatory Diseases, USA
Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH),
Austria
Santoro, M. Gabriella, Ph.D., University of Rome
Tor Vergata, USA
Sharrocks, Andrew, D., Ph.D., University of
Manchester, USA
![Page 5: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/5.jpg)
Shi, Yang, Ph.D., Harvard Medical School, USA
Smythe Roy W., M.D., Texas A&M University
Health Sciences Center, USA
Srivastava, Arun Ph.D., University of Florida
College of Medicine, USA
Steiner, Mitchell, M.D., University of Tennessee,
USA
Tainsky, Michael A., Ph.D., Karmanos Cancer
Institute, Wayne State University, USA
Sung, Young-Chul, Ph.D., Pohang University of
Science & Technology, Korea
Taira, Kazunari, Ph.D., The University of Tokyo,
Japan
Terzic, Andre, M.D., Ph.D., Mayo Clinic College of
Medicine, USA
Thierry, Alain, Ph.D., National Cancer Institute,
National Institutes of Health, France
Trifonov, Edward, N. Ph.D., University of Haifa,
Israel
Van de Ven, Wim, Ph.D., University of Leuven,
Belgium
Van Dyke, Michael, W., Ph.D., The University of
Texas M. D. Anderson Cancer Center, USA
White, Robert, J., University of Glasgow, UK
White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA
Wiginton, Dan, A., Ph.D., Children's Hospital
Research Foundation, CHRF , USA
Yung, Alfred, M.D., University of Texas, USA
Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer
Centre, Canada
Zorbas, Haralabos, Ph.D., BioM AG Team, Germany
!!!!!!!!!!!!!!!!!!!!!!!!!
Associate Board Members
Aoki, Kazunori, M.D., Ph.D., National Cancer Center
Research Institute, Japan
Cao, Xinmin, Ph.D., Institute of Molecular and Cell
Biology, Singapore
Falasca, Marco, M.D., University College London,
UK
Gao, Shou-Jiang, Ph.D., The University of Texas
Health Science Center at San Antonio, USA
Gibson, Spencer Bruce, Ph.D., University of Manitoba,
USA
Gra•a, Xavier, Ph.D., Temple University School of
Medicine, USA
Gu, Baohua, Ph.D., The Jefferson Center, USA
Hiroki, Maruyama, M.D., Ph.D., Niigata University
Graduate School of Medical and Dental Sciences, Japan
MacDougald, Ormond A, Ph.D., University of
Michigan Medical School, USA
Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research
Center, USA
For submission of manuscripts and inquiries:
Editorial Office
Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.
Gregoriou Afxentiou 7
Alimos, Athens 17455
Greece
Tel: +30-210-985-8454
Fax: +30-210-985-8453
and electronically to
![Page 6: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/6.jpg)
![Page 7: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/7.jpg)
Instructions to authors:
Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org
Scope
Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at
gtmb.org.
The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the
fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research
papers. Articles (both invited and submitted) review or report novel findings of importance to a general
audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to
molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene
delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at
the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use
of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies &
DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting,
therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on
the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology
will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin,
nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal
transduction, development, and on molecular mechanism of human disease. To make the publication
attractive authors are encouraged to include color figures.
Type of articles
Both review articles and original research articles will be considered. In addition, short 1-2 page news &
views will also be considered for publication. Original research articles should contain a generous
introduction in addition to experimental data. The articles contain information important to a general
audience as the volume is also addressed to researches outside the field. There is no limit on the length of
the articles provided that the subject is interesting to a general audience and covers exhaustively a field.
The typical length of each manuscript is a approximately 4-20 printed page including Figures and
Tables. This is 12-60 manuscript pages.
Charges, Complimentary reprints & Subscriptions
There are no charges for color figures or page numbers. Corresponding authors get a one-year free
subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for
additional years by having one paper per year accepted for publication.
The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big
general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page
numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the
embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality
![Page 8: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/8.jpg)
in depth reviews and first rate research articles and most important, the eminent members of the Editorial
Board being assembled are prognostic factors of a big success for GTMB.
Sections of the manuscript
Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-
mail), Summary, key words , running title and Introduction; review articles are subdivided into
headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using
1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I.
Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References.
Please include in your text citations the name of authors and year in parenthesis; for three or more authors
use: (name of first author et al, with year); for two authors please use both names. Please delete hidden
text for references. In the reference list, please, type references with year and Journal in boldface and
provide full title of the article such as:
Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B,
Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free
cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene
Ther Mol Biol 1, 309-321.
To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-
mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the
paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure
legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and
insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than
simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc.
throughout the text. Please provide the highest quality of prints of your Figures; whenever possible,
please provide in addition an electronic version of your figures.
Article contributors are kindly requested to provide a color (or black/white) photo of themselves
(preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the
publication
Submission and reviewing
Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers
providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page
proofs.
Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with
excellent reproduction of color figures.
Reviewing is completed within 5-15 days from receiving the manuscript.
Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in
approximately 1 month following submission.
![Page 9: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/9.jpg)
Please submit an electronic version of full text and figures preferably in jpeg format. The electronic
version of the figures will be used for the rapid reviewing process. High quality prints or photograph of
the figures and the original with one copy should be sent via express mail to the Editorial Office.
Editorial Office
Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc.
Gregoriou Afxentiou 7
Alimos, Athens 17455
Greece
Tel: +30-210-985-8454
Fax: +30-210-985-8453
and electronically to
The free electronic access to articles published in "GTMB" to a big general audience, the attractive
journal title, the speed of the reviewing process, the no-charges for page numbers or color figure
reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many
fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most
important, the eminent members of the Editorial Board being assembled are prognostic factors of a big
success for the newly established journal.
![Page 10: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/10.jpg)
![Page 11: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/11.jpg)
Table of contents
Gene Therapy and Molecular Biology
Vol 8 Number 2, December 2004
Pages Type of
Article Article title Authors (corresponding author is in
boldface)
319-326 Research
Article Phosphorothioated CpG
Oligonucleotide induced hemopoietic
changes in mice
Priya Aggarwal, Ruma Ray and Pradeep
Seth
327-334 Research
Article Development of HIV-1 subtype C Gag
based DNA vaccine construct
Priti Chugh and Pradeep Seth
335-342 Review
Article Targeting retroviral vector entry by
host range extension
Katja Sliva and Barbara S.Schnierle
343-350 Review
Article Role of the Brn-3a and Brn-3b POU
family transcription factors in cancer
David S. Latchman
351-360 Review
Article Angiogenic gene therapy in the
treatment of ischemic cardiovascular
diseases
Tamer A. Malik, Cesario Bianchi, Frank
W. Sellke
361-368 Review
Article Targeting Myc function in cancer
therapy
William L. Walker, Sandra Fernandez
and Peter J. Hurlin
369-384 Review
Article Transfection pathways of nonspecific
and targeted PEI-polyplexes
Vicent M. Guillem and Salvador F.
Ali•o
385-394 Review
Article c-myc: a double-headed Janus that
regulates cell survival and death
Rosanna Supino and A. Ivana Scovassi
395-402 Research
Article DNA-based vaccine for treatment of
intracerebral neoplasms
Terry Lichtor, Roberta P Glick, InSug
O-Sullivan, Edward P Cohen
403-412 Research
Article The involvement of H19 non-coding
RNA in stress: Implications in cancer
development and prognosis
Suhail Ayesh, Iba Farrah, Tamar
Schneider, Nathan de-Groot1 and
Abraham Hochberg
413-422 Research
Article PSA promoter-driven conditional
replicationcompetent adenovirus for
prostate cancer gene therapy
Guimin Chang and Yi Lu
423-430 Research
Article A platform for constructing
infectivity-enhanced fiber-mosaic
adenoviruses genetically modified to
express two fiber types
Marianne G. Rots, Willemijn M.
Gommans, Igor Dmitriev, Dorenda
Oosterhuis, Toshiro Seki, David T.
Curiel, Hidde J. Haisma
431-438 Review
Article Internal ribosome entry sites in cancer
gene therapy
Benedict J Yan and Caroline GL Lee
439-450 Research The pathway of uptake of SV40 Chava Kimchi-Sarfaty, Susan Garfield,
![Page 12: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/12.jpg)
Article pseudovirions packaged in vitro: from
MHC class I receptors to the nucleus
Nathan S. Alexander, Saadia Ali, Carlos
Cruz, Dhanalakshmi Chinnasamy, and
Michael M. Gottesman
451-464 Review
Article The importance of PTHrP for cancer
development
Jürgen Dittmer
465-474 Review
Article Gene-based vaccines for
immunotherapy of prostate cancer -
lessons from the past
Milcho Mincheff and Serguei Zoubak
475-486 Research
Article An erythroid-specific chromatin
opening element increases "-globin
gene expression from integrated
retroviral gene transfer vectors
Michael J. Nemeth and Christopher H.
Lowrey
487-494 Research
Article Decreased tumor growth using an IL-
2 amplifier expression vector
Xianghui He, Farha H Vasanwala, Tom
C Tsang, Phoebe Luo1, Tong Zhang and
David T Harris
495-500 Research
Article Multiple detection of chromosomal
gene correction mediated by a
RNA/DNA oligonucleotide
Alvaro Galli, Grazia Lombardi, Tiziana
Cervelli and Giuseppe Rainaldi
501-508 Review
Article Nitric oxide and endotoxin-mediated
sepsis: the role of osteopontin
Philip Y. Wai and Paul C. Kuo
509-514 Research
Article Feasibility to delineate distribution of
solution injected intraprostatic using
an ex-vivo canine model
Charles J. Rosser, Noriyoshi Tanaka, R.
Jason Stafford, Roger E. Price, John D.
Hazle, Motoyoshi Tanaka, Ashish M.
Kamat, Louis L. Pisters
515-522 Review
Article ER stress and the JNK pathway in
insulin resistance
Hideaki Kaneto, Yoshihisa Nakatani,
and Munehide Matsuhisa
523-538 Review
Article Molecular insight into human
heparanase and tumour progression
Erich Rajkovic, Angelika Rek, Elmar
Krieger and Andreas J Kungl
539-546 Research
Article Two dimensional gel electrophoresis
analyses of human plasma proteins.
Association of retinol binding protein
and transthyretin expression with
breast cancer
Karim Chahed, Bechr Hamrita, Hafedh
Mejdoub, Sami Remadi, Anouar Chaïeb
and Lotfi Chouchane
![Page 13: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/13.jpg)
Gene Therapy and Molecular Biology Vol 8, page 319
319
Gene Ther Mol Biol Vol 8, 319-326, 2004
Phosphorothioated CpG Oligonucleotide induced
hemopoietic changes in miceResearch Article
Priya Aggarwal1, Ruma Ray2 and Pradeep Seth1*
Departments of Microbiology1 and Pathology2, All India Institute of Medical Sciences, New Delhi-110029, India
__________________________________________________________________________________
*Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical
Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email [email protected],
Key words: CpG motifs; 1826-ODN; Splenomegaly; Hemopoiesis
Abbreviations: cytotoxic T lymphocyte, (CTL); extramedullary hemopoiesis, (EMH); human immunodeficiency virus, (HIV);
oligodeoxynucleotides, (ODNs); pathogen-associated microbial patterns, (PAMPs); reactive follicular hyperplasia, (RFH); Toll like
receptors, (TLRs)
Received: 17 May 2004; Accepted: 25 May 2004; electronically published: May 2004
SummaryBacterial DNA and the synthetic CpG-oligodeoxynucleotides (ODNs) derived thereof have attracted attention
because they activate cells of the adaptive immune system (lymphocytes) and the innate immune system
(macrophages). They induce a Th1 biased immune response upon activation of the immune cells. In this paper we
addressed whether unmethylated phosphorothioated CpG ODN (for example 1826 CpG-ODNs) affected
hemopoiesis. We observed an overall Th1 dominant response upon in-vitro stimulation of naïve splenocytes with
1826-ODN. Immunizing mice with immunostimulatory CpG motifs led to transient splenomegaly, with a maximum
increase of spleen weight at 4 weeks post immunization. Thereafter the splenomegaly regressed. The induction of
splenomegaly by CpG-ODNs was dose-dependent with the maximum spleen weights recorded at the 250 µg
immunizing dosage of 1826-ODN. In addition, the splenomegaly was also associated with dose dependent
extramedullary hemopoiesis and reactive follicular hyperplasia in the spleens and lymph nodes, which could be of
therapeutic relevance particularly in patients with life threatening chronic and persistent infectious diseases like
visceral leishmaniasis and HIV infection.
I. IntroductionCpG oligodeoxynucleotides (ODNs) are a novel
pharmacotherapeutic class with profound
immunomodulatory properties. CpG ODN shows Th1
biased immune responses and promise as vaccine adjuvant
and in the treatment of asthma, allergy, infection, and
cancer. Several groups have studied the effect of CpG
ODNs on the various arms of the immune system: B cells,
T cells, NK cells, and dendritic cells (Krieg et al, 1995;
Ballas et al, 1996; Davis et al, 1998). They have also
studied its effect on the release of various cytokines
important from an immunological standpoint. Overall CpG
induces a Th1 like pattern of cytokine production that is
dominated by IL-12 and IFN-! with little secretion of Th2
cytokines. Recent work demonstrates the powerful
adjuvant effect of CpG-ODNs, which can be used to
trigger protective and curative Th1 responses in vivo (Chu
et al, 1997; Lipford et al, 1997a, b; Zimmermann et al,
1998). When combined with specific antigen in-vivo, CpG
ODNs can serve as a strong stimulus for T-cell activation,
as well as for proliferation of antigen specific cytotoxic T
lymphocyte (CTL) effectors.
It is known that bacterial stimuli (Lipopolysaccharide
or Complete Freunds Adjuvant containing heat-killed
mycobacteria) can trigger increased splenic hemopoiesis
(McNeill et al, 1970; Apte et al, 1976; Staber et al, 1980),
possibly via macrophage-derived hemopoietic growth
factors that stimulate the generation and mobilization of
the blood cells necessary to combat bacterial infections
(Morrison et al, 1995). Here, we show that 1826-CpG-
ODNs displayed the capacity to potentiate hemopoiesis. In
addition, we observed that Phosphorothioated-ODNs with
CpG motifs cause splenomegaly in Balb/c mice. We
conclude that CpG ODN likely exerts systemic effects on
spleens and lymph nodes.
II. Materials and methodsA. CpG Motifs (1826-ODN)An unmethylated, phosphorothioated CpG motif, 1826-
ODN, (5’-TCCATGACGTTCCTGACGTT-3') was synthesized
commercially (Biosynthesis, USA). This ODN has 2 CpG motifs
separated by 7 bases in between them. The ODN preparation had
< 0.1 EU of endotoxin per milligram of ODN as assessed by a
Limulus Amebocyte Lysate assay - E-TOXATE (Sigma, USA).
![Page 14: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/14.jpg)
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
320
B. Animals6-8 weeks old, inbred female Balb/c mice were purchased
from National Central for Laboratory Animal Sciences, National
Institute of Nutrition, Hyderabad, India.
C. In vitro stimulatory effect of 1826-ODN on
naïve murine spleen cellsNormal mice were euthanised with an overdose of
pentobarbital and spleens were removed aseptically. The spleen
cells were collected, enumerated and resuspended in RPMI
medium with 10% FCS to the required concentration. One
million naïve spleen cells from unimmunized Balb/c mice, were
plated in each well of a six-well tissue culture plate and
incubated with different doses on 1826-ODN in duplicate wells
(2,10,50 and 250µg/well). The control wells did not contain any
ODN. The culture supernatants were collected at 24,36,48 and 72
hours for quantification of secreted IL-2, IFN-!, IL-4 and IL-10
by murine cytokine ELISA kits (R&D Systems) according to the
manufacturer's instructions.
D. Immunization of miceFive mice per group were injected with different doses of
1826-ODN (2,10,50 and 250µg/mouse) intradermally. The mice
were boosted with the same dose two weeks later. The control
mice received normal saline intradermally. Mice were sacrificed
at 4, 6, 8 and 24 weeks post-immunization respectively and
spleen and lymphnodes were collected for histopathology. For
determination of splenomegaly, fat and contiguous tissue around
the spleens was trimmed off and the spleens were weighed.
E. HistopathologyAfter removal, the spleens and lymphnodes were fixed in
10% neutral-buffered formalin and subsequently fine sections (5-
µ thick) were taken for histopathology. The tissue sections were
then processed in Histokinette machine (Leica TP1020) for
microscopic evaluation. This processing included fixation in 70%
ethanol for 1 hour followed by 80% and absolute ethanol for 1
hour each. Then they were treated with acetone and xylene for 1
hour each, for the clearing of tissues. Finally, they were
impregnated with melted paraffin wax (60°-62°C) for 1 hour.
The tissue sections were mounted on slides, and stained with
hematoxylin and eosin.
III. ResultsA. In vitro stimulatory effect of 1826-
ODN on naïve murine spleen cellsNonspecific stimulatory effect of the 1826-ODN was
evaluated quantitatively on naïve spleen cells, by
evaluating release of Th1 and Th2 cytokines in the culture
supernatants (Figure 1) . Murine IL-2 was detectable only
with 2µg of 1826-ODN. The IL2 level showed a steady
increase with the increasing incubation time and was 265
pg/ml at 72 hours. On the other hand, only 20 pg/ml of IL-
2 was detected at 72 hours with 10 µg dose of the ODN.
Similarly, higher amounts of IFN-! levels were also
detected with 2-µg dose.
Th2 cytokine, IL-10, was secreted in relatively
higher amounts at all doses in comparison to the other
cytokines. The maximum secretion was seen with 2 µg
dose with the values of 115, 490, 405 and 510 pg/ml at 24,
36, 48 and 72 hours time points respectively. The IL-10
cytokine levels were comparatively low with 10 µg dose
of ODN. With the increasing dose of ODN to 50 and 250
µg, the IL-10 cytokine secretion levels further decreased.
The IL-10 cytokine levels at 250-µg dose were barely
detectable. On the other hand, IL-4 cytokine secretion was
not detected in the culture supernatants at all doses at all
time points. Control wells, incubated without ODN did not
show any secretion of either IL-10 or IL-4 cytokines.
B. Mouse splenomegaly assaySplenomegaly was observed to be highly dose
dependent (Figure 2) . There was a significant increase in
the spleen weights with the increasing dose of 1826-ODN
at all time points. Maximum spleen weights were recorded
at 4 weeks time point. Thereafter, the spleen size and
weight decreased significantly over time during next 5
months. Massive splenomegaly was observed with the
250-µg dose of 1826-ODN at 4 weeks time point with an
average spleen weight of 0.65338 +/- 0.075049 grams,
Figure 1 In-vitro stimulatory effect of 1826-ODN on the naïve splenocytes. Culture supernatants were tested for the presence of secreted
murine Th1 (IFN-! and IL-2) and Th2 cytokines (IL-10 and IL-4).
![Page 15: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/15.jpg)
Gene Therapy and Molecular Biology Vol 8, page 321
321
which was 9.6 times more than the average spleen weight
of mice injected with normal saline. At 6 months time
point also, the average spleen weight for 250-µg dosage
was 1.5 folds greater than the average spleen weight of
mice injected with normal saline. On the other hand
splenic weights of mice immunized with 2µg, 10µg and
50µg doses of 1826-ODN at 4 weeks time point were 4.8,
3.2 and 3 folds more than the spleen weight of mice
injected with normal saline, respectively.
C. HistopathologyHistological changes were studied in the spleens at 6
weeks time point and in both spleens and lymph nodes at 6
months time point (Table 1a and b). Spleens showed
increasing degree of extramedullary hemopoiesis (EMH)
and reactive follicular hyperplasia (RFH) with prominent
germinal centers with the increasing doses of 1826-ODN
(Figure 3a). EMH was diagnosed by the presence of
immature hemopoietic precursors including
megakarycytes (Figure 3c). There was a prominent
expansion of white pulp of the spleens and formation of
germinal centers with all the doses of 1826-ODN as
compared to the spleens of mice injected with normal
saline, which were histologically normal (Figure 3e).
Spleens of mice injected with 250-µg-1826-ODN showed
severe degree of reactive follicular hyperplasia with EMH
(Figure 3b). Red pulp showed histiocytes with abundant
eosinophilic cytoplasm. There were prominent germinal
centers. Numerous megakaryocytes were present in the red
pulp. The spleens of mice at 6 months time point also
showed EMH but to a lesser degree than that observed at 6
weeks time point. Here also, the degree of reactive
hyperplasia increased with the increasing dose of 1826-
ODN, with maximum at 250 µg CpG ODN dosage.
Figure 3(c) shows EMH with megakaryocyte formations
in the spleen section of 10-µg dose of ODN. Figure 3(d)
Figure 2 Mouse splenomegaly assay. The mice were immunized with different doses of 1826 ODN (2µg (group 1), 10µg (group 2),
50µg (group 3), 250µg (group 4)) intradermally. The control group (group 5) received normal saline. The spleens were harvested at 4
weeks, 6 weeks 8 weeks and 24 weeks post immunization and weighed. Each group had 5 mice. The average spleen weight is expressed
in grams.
Table 1a. Observation chart showing the histological changes in the respective spleen and lymph node sections of mice
injected with escalating doses of 1826-ODN (a) at 6 weeks time point (b) at 6 months time point post immunization.
2 µg ODN 10 µg ODN 50 µg ODN 250 µg ODN Normal Saline
Spleen *Reactive follicles *Reactive follicles *Expansion of
white
*Severe degree of Histologically
normal
*Prominent
expansion
*Prominent white
pulp
pulp with reactive reactive follicular
of white pulp *Hyperplasia follicular
hyperplasia
hyperplasia
* Extramedullary *Red pulp shows
hemopoiesis histiocytes with
abundant
eosinophilic
cytoplasma
*Prominent
germinal
centers
*Formation of
Megakaryocytes
* Extramedullary
hemopoiesis
![Page 16: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/16.jpg)
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
322
Table 1b.
2 µg ODN 10 µg ODN 50 µg ODN 250 µg ODN Normal Saline
Spleen Histologically normal Extramedullary
hemopoiesis
*Formation of
Megakaryocytes
Extramedullary
hemopoiesis
*Formation of
Megakaryocytes
*Severe degree of
reactive follicular
hyperplasia
* Formation of germinal
centers
* Small epitheloid cells
granuloma with in
center of reactive
white pulp.
Extramedullary
hemopoiesis
*Formation of
Megakaryocytes
*Severe degree of
reactive follicular
hyperplasia
*Formation of
Megakaryocytes in
red
pulp
Histologically
normal
Lymph Node Histologically normal Sinus histiocytosis lymph node not found * Few reactive
secondary follicles
with germinal
center
Histologically
normal
Figure 3 Reactive follicular hyperplasia with the formation of secondary follicle having prominent germinal center in spleen from mice
injected with (a) 50µg and (b) 250 µg of 1826-ODN at 6 weeks time point (40X). The arrows are demarcating an expanding follicle.
![Page 17: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/17.jpg)
Gene Therapy and Molecular Biology Vol 8, page 323
323
Figure 3(c) Extramedullary hemopoiesis with the formation of megakaryocytes (arrows) in the spleen from mice injected with 10ug of
1826-ODN at 6 months time point (40X). (d) Granuloma formation (arrows) with small epitheloid cells in the spleen from mice injected
with 50 ug of 1826-ODN at 6 months time point (e) Spleen from mice injected with normal saline (40X).
![Page 18: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/18.jpg)
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
324
Figure 4(a) Focal sinus histiocytosis in lymph node from mice injected with 10 µg of 1826-ODN at 6 months time point (40X) The
arrow is pointing towards a collection of histiocytes. (b) the lymph node from mice injected with normal saline (40X).
shows the spleen section of mice injected with 50 µg ODN
dose, at 6 months time point, where granuloma can be
seen with small epitheloid cells.
IV. DiscussionIn this study, we describe and characterize the in
vitro cytokine response of spleen cells and in vivo
extramedullary hemopoiesis in spleen and lymph nodes in
mice induced by CpG-ODNs. Specific CpG sequences
appear to be important for elicitation of Th1-type
immunity and enhancement of vaccine efficacy. As our
understanding about the mechanisms of action of various
CpG-ODN improves, it should be possible to predict
effects on immune responses in vivo based on the results
of in vitro assays. At the present time, in vitro assays are
most useful in initially screening CpG-ODN for
immunostimulatory activity and to determine its
optimizing dosage to use in in vivo models. In our study,
CpG-ODN 1826 induced significant Th1 cytokine
responses (IFN-! and IL-2) in vitro, on splenocytes from
normal mice. The induction of cytokines by the naïve
spleen cells can be explained by the presence of Toll like
receptors (TLRs) on the cells. These evolutionary
conserved receptors, homologues of the Drosophila Toll
gene, recognize highly conserved structural motifs only
expressed by microbial pathogens, called pathogen-
associated microbial patterns (PAMPs). Stimulation of
TLRs by PAMPs initiates a signaling cascade that
involves a number of proteins, such as MyD88 and IRAK
(Medzhitov et al, 1997). TLR9, which is localized
![Page 19: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/19.jpg)
Gene Therapy and Molecular Biology Vol 8, page 325
325
intracellularly, is involved in the recognition of specific
unmethylated CpG-ODN sequences. This signaling
cascade leads to the activation of the transcription factor
NF-kB that induces the secretion of pro-inflammatory
cytokines and effector cytokines that direct the adaptive
immune response. There may be physiologic or pathologic
conditions where TLR-9 would be expressed in
nonimmune cells, in which they would be expected to
become CpG responsive. Carlow et al, (1998) has
described CpG-induced stimulation of L cells, which are
of stromal origin, to produce IFN-! upon transfection with
plasmid DNA. Bacterial DNA or a CpG ODN has also
been reported to induce human gingival fibroblasts to
activate NF"B and secrete IL-6 (Takeshita et al, 1999).
The only cells that are directly activated upon exposure to
CpG DNA are the TLR-9 expressing cells like B cells and
pDC (Bauer et al, 2001; Krug et al, 2001). Klinman et al,
(1996) has also shown that a DNA motif consisting of an
unmethylated CpG motif rapidly stimulates B cells in a
polyclonal and antigen-nonspecific fashion, to produce IL-
6 and IL-12, CD4+ T cells to produce IL-6 and IFN-!, and
NK cells to produce IFN-! in-vitro. CpG PTO
(phosphorothioated) was most effective in inducing in-
vitro proliferation of splenocytes. The IL-12 p40 levels
peaked at 500nM concentration ODN with cytokine levels
of 7500pg/ml after 36 hours of incubation. Similarly, the
IL-6 levels peaked to 7000pg/ml at 1000nM concentration
of ODN (Zimmermann et al, 2003). Zelenay et al, (2003)
have also shown that 1826 ODN induced naïve
splenocytes to secrete high levels of IL-6 and IL-12 and
modest levels of IFN-! in-vitro.
Splenomegaly phenomenon was transient and highly
dose dependent. There was a significant increase in the
spleen weights with the increasing dose of CpG motifs
reaching maximum at 4 weeks post-immunization and
thereafter regressing gradually over next 20 weeks.
Massive splenomegaly was observed in the mice injected
with 250-µg dose of 1826-ODN at 4 weeks time point
with a 9.6 fold increase in the splenic weight as compared
to that of mice injected with normal spleen. An antisense
ODN against the rev gene of the human
immunodeficiency virus (HIV) caused a profound degree
of B cell proliferation and massive splenomegaly in-vivo
in mice (Branda et al, 1993). Mice treated with high doses
of immune stimulatory phosphorothioated CpG ODN
developed massive splenomegaly and increased spleen
granulocyte macrophage colony forming units (GM-
CFUs) and early erythroid progenitors (burst-forming
units-erythroid) (Sparwasser et al, 1999). Treatment of
rodents with phosphorothioate oligodeoxynucleotides
induces a form of immune stimulation characterized by
splenomegaly, lymphoid hyperplasia, hyper-!-
globulinemia and mixed mononuclear cellular infiltrates in
numerous tissues. Splenomegaly and B-lymphocyte
proliferation increased with the dose or concentration of
oligodeoxynucleotides (Monteith et al, 1997).
Splenomegaly appeared to occur, at least in part, as a
result of stimulation of B-lymphocyte proliferation.
Bhagat et al, (2003) have also reported splenomegaly in
Balb/c mice to the extent of 153 mg after 48 hours of
subcutaneous injection of a single dose of 5mg/kg
immunomers.
In the spleen sections of mice at 6 weeks time point,
there was increasing degree of extramedullary
hemopoiesis and reactive follicular hyperplasia with
prominent germinal centers, with the increasing doses of
1826-ODN. Thus, the transient splenomegaly observed in
CpG motifs injected mice was dose dependent and
associated with extramedullary hemopoiesis. CpG ODN
has a profound effect on hematopoietic function. CpG-
ODNs activate dendritic cells and macrophages to secrete
large amounts of hemopoietically active cytokines,
including IL-6, GM-CSF, IL-1, IL-12, and TNF-# (Ballas
et al, 1996; Aggarwal and Seth, unpublished data). To
date, it is unclear which of these cytokines, singly or
synergistically, triggers the extramedullary hemopoiesis
described here. It is also conceivable that CpG-ODNs
target bone marrow stroma cells to release hemopoietically
active cytokines. CpG-ODNs, which are operationally
similar to LPS, may trigger extramedullary hemopoiesis
via the induction of cytokines mobilizing BM progenitor
cells to the spleen (Apte et al, 1976; Tokunaga et al,
1992). Even before the identification of the CpG motif,
several investigators using antisense ODN noted the
induction of sequence-specific extramedullary
hematopoiesis and induction of hematopoietic colony
formation (Hatzfeld et al, 1991; McIntyre et al, 1993).
More recently, these effects were shown to be CpG
specific. Histologically, an increased number of large
immature blasts and erythroblasts were detected, reaching
maximum at day 6, suggesting hemopoietic activity
(Sparwasser et al, 1999).
Our findings in this study demonstrate that
phosphorothioate oligonucleotide 1826-ODN exerts
stimulatory effects in mouse model. Recent data from our
laboratory also suggest that CpG-ODNs potentiate the
immune responses induced by HIV-1 Indian Subtype C
vaccine constructs in mice (manuscript under preparation)
perhaps by augmenting the hemopoiesis. Thus, it may be
possible to use CpG-ODN as therapeutic agents in patients
with early or limited HIV disease.
AcknowledgmentsThis study was supported by the research grant from
the Department of Biotechnology, Ministry of Science and
technology, Govt. of India, under Prime minister's, Jai
Vigyan Mission Program.
ReferencesApte R N, Galanos C, Pluznik DH (1976) Lipid A, the active part
of bacterial endotoxins in inducing serum colony-stimulating
activity and proliferation of splenic granulocyte/macrophage
progenitor cells. J Cell Physiol 87, 71-78.
Ballas ZK, Rasmussen WL, Krieg AM (1996) Induction of NK
activity in murine and human cells by CpG motifs in
oligodeoxynucleotides and bacterial DNA. J Immunol 157,
1840–1845.
Bauer S, Kirschning CJ, Hacker H, Redecke V, Hausmann S,
Akira S, Wagner H, Lipford GB (2001) Human TLR9
confers responsiveness to bacterial DNA via species-specific
CpG motif recognition. Proc Natl Acad Sci USA 98,
![Page 20: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/20.jpg)
Aggarwal et al: CpG oligonucleotide, induced hemopoietic changes in mice
326
9237–9242.
Bhagat L, Zhu FG, Yu D, Tang J, Wang H, Ekambar R, Zhang
KR, and Agrawal S (2003) CpG penta- and
hexadeoxyribonucleotides as potent immunomodulatory
agents. Biochem Biophys Res Commun 300, 853-861.
Branda RF, Moore AL, Mathews L, Mc- Cormack JJ, Zon G
(1993) Immune stimulation by an antisense oligomer
complementary to the rev gene of HIV-1. Biochem
Pharmacol 45, 2037–2043.
Carlow DA, Teh SJ, Teh HS (1998) Specific antiviral activity
demonstrated by TGTP, a member of a new family of
interferon-induced GTPases. J Immunol 161, 2348–2355.
Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV
(1997) CpG oligodeoxynucleotides act as adjuvants that
switch on T helper (Th1) immunity. J Exp Med 186, 1623-
1631.
Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J,
Krieg AM, Weeranta R (1998) CpG DNA is a potent
enhancer of specific immunity in mice immunized with
recombinant hepatitis B surface antigen. J Immunol 160,
870-876. Erratum in: J Immunol (1999) 162, 3103.
Weeranta R [corrected to Weeratna R].
Hatzfeld J, Li ML, Brown EL, Sookdeo H, Levesque JP,
O’Toole T, Gurney C, Clark SC, Hatzfeld A (1991) Release
of early human hematopoietic progenitors from quiescence
by antisense transforming growth factor $1 or Rb
oligonucleotides. J Exp Med 174, 925–929.
Klinman D, Yi A K, Beaucage SL, Conover J and Krieg AM
(1996) CpG motifs present in bacterial DNA rapidly induce
lymphocytes to secrete Interleukin 6, interleukin 12, and
interferon !. Proc Nat Acad Sci USA 93, 2879-2883.
Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA,
Teasdale R, Koretzky GA, Klinman DM (1995) CpG motifs
in bacterial DNA trigger direct B-cell activation. Nature
374, 546–549.
Krug A, Towarowski A, Britsch S, Rothenfusser S, Hornung V,
Bals R, Giese T, Engelmann H, Endres S, Krieg AM,
Hartmann G (2001) Toll-like receptor expression reveals
CpG DNA as a unique microbial stimulus for plasmacytoid
dendritic cells which synergizes with CD40 ligand to induce
high amounts of IL-12. Eur J Immunol 31, 3026–3037.
Lipford GB, Bauer M, Blank C, Reiter R, Wagner H, Heeg K
(1997a) CpG-containing synthetic oligonucleotides promote
B and cytotoxic T cell responses to protein antigen: a new
class of vaccine adjuvants. Eur J Immunol 27, 2340-2344.
Lipford GB, Sparwasser T, Bauer M, Zimmermann S, Koch ES,
Heeg K, Wagner H (1997b) Immunostimulatory DNA:
sequence-dependent production of potentially harmful or
useful cytokines. Eur J Immunol 27, 3420-3426.
McIntyre KW, Lombard-Gillooly K, Perez JR, Kunsch C,
Sarmiento UM, Larigan JD, Landreth KT, Narayanan R
(1993) A sense phosphorothioate oligonucleotide directed to
the initiation codon of transcription factor NF-"B p65 causes
sequence-specific immune stimulation. Antisense Res Dev
3, 309–322.
McNeill TA (1970) Antigenic stimulation of bone marrow
colony-forming cells. Immunology 18, 61-72.
Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. (1997) A
human homologue of the Drosophila Toll protein signals
activation of adaptive immunity. Nature 388, 394-397.
Monteith DK, Henry SP, Howard RB, Flournoy S, Levin AA,
Bennett CF, Crooke ST (1997) Immune stimulation--a class
effect of phosphorothioate oligodeoxynucleotides in rodents.
Anticancer Drug Des 12, 421-432.
Morrison SJ, Uchida N, Weissman IL (1995) The biology of
hematopoietic stem cells. Annu Rev Cell Dev Biol 11, 35-
71.
Sparwasser T, ltner LH, Koch ES, Luz A, Lipford GB, and
Wagner H (1999) Immunostimulatory CpG-
Oligodeoxynucleotides Cause Extramedullary Murine
Hemopoiesis. J Immunol 162, 2368–2374.
Staber FG, Metcalf D (1980) Cellular and molecular basis of the
increased splenic hemopoiesis in mice treated with bacterial
cell wall components. Proc Natl Acad Sci USA 77, 4322-
4325.
Takeshita A, Imai K, Hanazawa S (1999) CpG motifs in
Porphyromonas gingivalis DNA stimulate interleukin-6
expression in human gingival fibroblasts. Infect Immun 67,
4340–4345.
Tokunaga T, Yano O, Kuramoto E, Kimura Y, Yamamoto T,
Kataoka T, Yamamoto S (1992) Synthetic oligonucleotides
with particular base sequences from the cDNA-encoding
proteins of Mycobacterium bovis BCG induce interferons
and activate natural killer cells. Microbiol Immunol 36, 55-
66.
Zelenay S, Elias F and Flo J (2003) Immunostimulatory effects
of plasmid DNA and synthetic oligodeoxynucleotides. Eur J
Immunol 33, 1382-1392.
Zimmermann S, Egeter O, Hausmann S, Lipford GB, Röcken M,
Wagner H, Heeg K (1998) CpG oligonucleotides trigger
curative Th1 responses in lethal murine leishmaniasis. J
Immunol 160, 3627-3630.
Zimmermann S, Heeg K, and Dalpke A (2003)
Immunostimulatory DNA as adjuvant: efficacy of
phosphodiester CpG oligonucleotides is enhanced by 3’
sequence modifications. Vaccine 21, 990-995.
Dr. Pradeep Seth
![Page 21: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/21.jpg)
Gene Therapy and Molecular Biology Vol 8, page 327
327
Gene Ther Mol Biol Vol 8, 327-334, 2004
Development of HIV-1 subtype C Gag based DNA
vaccine constructResearch Article
Priti Chugh1 and Pradeep Seth*Department of Microbiology, All India Institute of Medical Sciences, New Delhi-110029
__________________________________________________________________________________*Correspondence: Pradeep Seth MD FAMS FNASc, Professor and Head, Dept of Microbiology, All India Institute of Medical
Sciences, New Delhi-110029; Phone: 91-11-26588714; Fax: 91-11-26588641; Email [email protected],
1. Current address: Priti Chugh, MSc. Ph.D, University of Texas Southwestern Medical Center, Hamon Center for Therapeutic Oncology
Research, 6000 Harry Hines Blvd. NB8.206, Dallas TX 75390-8593
Key words: gag, DNA vaccine, CMV promoter, Virus like particles (VLPs)
Abbreviations: cytomegalovirus, (CMV); immediate early, (IE); kilodalton, (kD); phosphate buffered saline, (PBS); room temperature,
(RT); virus like particles, (VLPs)
Received: 26 April 2004; Accepted: 2 June 2004; electronically published: July 2004
Summary
Recently, the success of genetic immunization as a novel means to induce protective immunity has been
demonstrated. DNA vaccines mimic antigen presentation closely to the natural history of viral infection. This is
particularly relevant in infectious diseases where-in cell mediated immunity plays a larger role in protection, such
as HIV-1 infection. In this paper we present the work done towards development of a gag based DNA immunogen
for local circulating HIV-1 subtype C viruses in India. Gag gene was cloned under the control of CMV promoter in
a mammalian expression plasmid vector. The other main features of the expression cassette in the construct
pJWgagprotease49587 are bovine growth hormone polyadenylation signal and a t-PA leader signal. The construct
was confirmed for expression in vitro by various means, p24 antigen capture assay, immunoblotting and electron
microscopy. The TEM studies on transiently transfected COS-7 cells showed the presence of virus like particles
(VLPs) as a consequence of gene expression from the construct pJWgagprotease49587. This finding is the first
report of VLPs for a subtype C based gag construct. We expect that this construct will be able to prime a good
immune response when used in in-vivo mice studies owing to the formation of virus like particles from the construct
in vitro.
I. IntroductionOf the various infectious diseases that are responsible
for morbidity and mortality, AIDS is deemed to be the
fourth-biggest killer. HIV/AIDS is not a homogenous
pandemic. Human immunodeficiency virus HIV-1, the
causative organism has remained particularly elusive
owing to the sheer diversity of viral evolution. The varied
subtypes and more varied distribution have had profound
impacts on the strategies being devised to control the
spread of HIV infection. Most of the world's HIV infection
is located in the developing world. Of these, most
infections occur within the non-B HIV subtypes. Subtype
C accounts for more than 50% of overall infections
worldwide (Tatt et al, 2001). It is needed to direct
resources towards the research of virus evolution,
pathogenesis, treatment and preventive/therapeutic
vaccines of different HIV-1 clades.
The need for developing a potent immunogen from
the local circulating types is becoming more and more
apparent with the evidence of differences in the rates of
transmission and severity of disease among different
clades. The current rapid spread of subtype C viruses has
raised questions about the role of subtypes on disease
progression and transmission. The presence of three NF-
kB binding sites in subtype C viruses suggests that they
might have a replication advantage. In India, infection rate
at 0.8% of the total adult population is still low, but due to
large population it transforms into large numbers. The use
of existing therapies in the developing world is limited
owing to their high cost (Dayton et al, 2000).
Nucleic acid vaccination offers a simple and
effective means of immunization. DNA plasmids encoding
foreign proteins have been successfully administered
either by direct intramuscular injection or with various
adjuvants and excipients, and by biolistic immunization.
![Page 22: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/22.jpg)
Chugh and Seth: Gag gene construct in mammalian expression vector
328
DNA vaccines have several distinct advantages,
presentation of target protein by MHC-I and MHC-II
pathways, synthesis of immunogen in their native with
appropriate post-translational modifications, ease in
manufacturing process and greater shelf life of DNA as
compared to proteins. This approach is particularly
relevant to tumor antigens and viral immunogens.
Gag gene is one of the most conserved regions of
HIV-1 genome and hence it is a good target for cross clade
immune responses. It encodes for group antigen core
protein. 1.5 Kb gene gives rise to a 55-kilodalton (kD)
Gag precursor protein, also called pr55, which is
expressed from the unspliced viral mRNA and later
processed into the respective p24, p17, p6 proteins by the
viral encoded protease. In studies with HIV infected
individuals, HEPS and LTNPs, helper and cytotoxic
responses to gag epitopes have been defined (Gotch et al,
1990; Jhonson et al, 1991; Kalams et al, 1999).
Plasmids used as DNA vaccines, in general contain a
strong eukaryotic promoter, such as cytomegalovirus
(CMV) immediate early (IE) (Chapman et al, 1991) and
polyadenylation signal from bovine growth hormone,
which increases expression. Immune response elicited by
DNA vaccination depends on route of immunization, it is
largely Th1 type, and this is particularly beneficial since
Th1 type of immune response has been implicated in
control of HIV infection. In this study we present the
construction of a gag based plasmid immunogen in a
mammalian expression vector and verification of its
expression.
II. Materials and methodsA. Plasmid, cells and reagentsThe vector used in the study, pJW4304, was a kind gift
from Dr J. I. Mullins, University of Washington, Seattle, USA.
COS-7 cells for in vitro expression studies were obtained from
NCCS, Pune, India.
B. Cloning of gag gene into pJW4304The integrated HIV-1 proviral DNA from PBMCs of HIV
infected asymptomatic individual (Disease stage: A1, CD4
counts: 534/µl) was taken as a template for PCR and a 4.35 kb
gag-pol (nt139 – nt4495) product was obtained by a set of nested
PCRs using forward primers, MSF12:
5’AAATCTCTAGCAGTGGCGCCCGAACAG3’ [1-27],
GagFP01: 5’TTTGACTAGCGGAGGCTAGCAGGAGAGAG
ATGGGT3’ [139-173] and reverse primers PolRP06:
5’AAAACCATCCATTAGCTCTCCTTGAAACAT3’ [4471-
4500], PolRP01: 5’CATCCATTAGCTCTCCTTGAAACATAC
ATA 3’ [4466-4495]. The amplification profile was as follows:
denaturation [at 92°C for 15sec], annealing (at 52°C for 30 sec]
and extension [at 68°C for 4min] for 25 cycles followed by final
extension for 7 minutes at 68°C. The amplification product was
cloned into TA cloning pGEMT easy vector (Promega, USA) as
per the manufacturer’s instructions (Figure 1A). The construct
was verified in pGEMTeasy by PCR and restriction digestions.
The construct was double digested with Nhe1 and BamH1
enzymes resulting in the release of a 2.3kb Gag-protease
fragment. This fragment was cloned into mammalian expression
vector, pJW4304, by directional cohesive ends ligation (Figure
2A). The presence of insert in the plasmid pJWgagprotease-
49587 was confirmed by PCR for gag and protease genes,
restriction digestions and DNA sequencing.
C. In vitro expression studiesCOS-7 cells were transfected using lipofectin reagent (Life
technologies) according to the manufacturer’s instructions.
Briefly, 5µg plasmid DNA was constituted with lipofectin
reagent at a concentration of 10µg/ml in DMEM (without FCS
and antibiotics) and overlaid on 40-50% confluent COS-7 cells.
The cells were incubated with the transfection mix for 6-8 hrs at
37°C, 5% CO2 and then fresh medium was supplemented
(DMEM 10% FCS, 2mM glutamine and antibiotics). The cells
and supernatants were harvested at different time points 24, 36,
48, 72 and 96 hrs and stored at -20°C for further evaluation.
COS-7 cells transfected with vector pJW4304 alone and the
plasmid containing envelope gp120 gene, pJWSK3, (Arora et al,
2001) comprised the controls in the study.
D. p24 antigen capture ELISAThe supernatants were checked for presence of p24 antigen
by p24 antigen capture ELISA (Innogenetics Belgium)
performed as per the manufacturer’s instructions. Briefly, 100µl
of sample and the standard (provided in the kit) were aliqoted
into the wells coated with anti p24 monoclonal antibody and
incubated at 37°C in a humidified chamber for an hour. The
wells were then washed thoroughly five times and tapped to
remove traces of wash buffer. Thereafter 100µl of HRP
conjugated anti p24 monoclonal antibody was added to the wells
and the plate was incubated for an hour at 37°C followed by 5X
washing again. In the next step 100µl of substrate solution was
added to the wells and incubated in dark at room temperature for
30 minutes. 50µl of stop solution was added to the wells after the
incubation and absorbance was recorded at 450nm. Standard
curve was plotted for the absorbance recorded for standard
provided in the kit and concentration of the samples was
determined from the curve. The negative controls included
untransfected cells and cells transfected with vector alone
(pJW4304) and mock positive (pJWSK3) control.
E. Western blot analysisThe transfected cell lysates were run on a denaturing SDS
PAGE and transferred onto nitrocellulose membrane by semidry
transfer method. The blot was blocked with 2.5% non-fat dry
milk in Tris buffered saline pH 7.4 for two hours at room
temperature (RT) and was washed thrice in TTBS (Tween-Tris
buffered saline). Immunoblotting was carried out by incubating
with HIV-1 positive human serum (at a dilution of 1:50) at RT
for 1hr. After washing thrice the blot was returned for incubation
with alkaline phosphatase conjugated goat anti-human IgG
antibody for an hour at RT. Thereafter, it was washed thrice and
the substrate (BCIP-NBT solution) was added. The reaction was
then stopped by washing in double distilled water.
G. Electron microscopy of transfected COS-7
cellsTransmission electron microscopy was performed with
transfected cells as described earlier (Gheysen et al, 1989) with
minor modifications. Briefly, transfected cells were scraped off,
washed in phosphate buffered saline (PBS pH 7.4) and then fixed
in 1% glutaraldehyde solution for two hours on ice. Thereafter,
the cells were washed with PBS thrice and postfixed with 1 %
osmium tetroxide in PBS for two hours. After washing with PBS
and then with distilled water, the fixed cells were stained with
1% uranyl acetate in 20% acetone for 30 min. The cells were
dehydrated by treatment with acetone and cleared with toluene.
Thereafter, infiltration was done with toluene araldite mixture
first at room temperature and then at 50oC temperature. The
![Page 23: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/23.jpg)
Gene Therapy and Molecular Biology Vol 8, page 329
329
sample was embedded in epoxy resin, sectioned and viewed
under TEM (transmission electron microscope).
*Footnote: The HIV-1 subytpe C strain 49587 used in this
study is from a hemophilic patient who got infected through
blood tranfusion in 1989 in India. (patient id# 49587). The
PBMC sample was collected in the year 1997 from the northern
part of India. The Genbank accession number isAF533140.
III. Results
A. Construction of pJWgagprotease49587In order to clone gag-protease genes of HIV 1
subtype C, a complete gag-pol clone was generated in
pGEM-Teasy by PCR based TA cloning (Figure 1A). A
4.3 Kb PCR product was generated by a nested set of
primers MSF12 and Pol RP06 and GagFP01 and
PolRPO01 (Figure 1B). This product was ligated to
pGEM-Teasy vector and the recombinant was screened on
the basis of blue white colony selection. The 4.3Kb gag-
pol insert was confirmed by EcoR1 digestion of the
plasmid that releases the complete gene fragment (Figure
1C). PCR products from different regions of the construct,
1.5-Kb gag and 3-Kb pol confirmed the presence of insert,
gag-pol, in the clone pGEMTgag-pol. (Figure 1D).
Figure 1A Cloning strategy for TA cloning of gagpol gene fragment. A 4.3Kb fragment generated by nested PCR was cloned into
pGEM-Teasy vector resulting in a recombinant molecule pGEM-Teasy gag-pol (7.3Kb). B Agarose gel picture showing, 4.3 Kb gag-pol
PCR product generated by nested set of PCR with ! Hind III Eco R1 DNA molecular weight marker in the adjacent lane. C Agarose gel
picture showing the release of 4.3 Kb gag-pol fragment from pGEMT-easy gag-pol upon EcoR1 digestion. D Complete gag (1.5 Kb) and
pol (3.1 Kb) PCR amplification products from the pGEMTeasy gag-pol.
![Page 24: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/24.jpg)
Chugh and Seth: Gag gene construct in mammalian expression vector
330
Figure 2A Strategy for cloning gag-protease fragment into eukaryotic expression vector pJW4304. A double digestion of pGEMT-easy
gag-pol with restriction endonucleases Nhe1 and BamH1 releases a 2.3 Kb fragment containing the gag and protease genes. This
fragment was then ligated into pJW4304 by cohesive ends ligation. B Agarose gel picture showing 7.4 kb linearised plasmid
pJWgagprotease-49587 along with ! Hind III molecular weight marker. C Agarose gel picture showing PCR amplification products for
sub-genomic fragments of gag & complete protease genes. The amplification products for gag are 492 bp and 711bp respectively in
lanes 1 and 3. The protease gene fragment represented by 290bp PCR product is depicted in lane2.
From this clone the fragment containing gag-
protease gene was extracted by double digestion with
Nhe1 and BamH1, and ligated into the expression vector
pJW4304 (Figure 2A). The recombinant clone obtained
was confirmed for the presence of required gene fragment
by various digestions and PCR amplification products for
gag and protease genes (Figures 2B, C). The right
orientation of the insert in the clone was confirmed by
Pst1 digestion, which released a 750 bp product as it
should in case of correct orientation of the cloned gene.
Further confirmation of the cloned gag-protease gene that
it belonged to HIV-1 subtype C gag and protease regions,
was obtained with sequencing using primer walking
strategy. (GenBank Accession no: AF533140) (data not
shown).
![Page 25: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/25.jpg)
Gene Therapy and Molecular Biology Vol 8, page 331
331
B. p24 Antigen Capture ELISA
The amount of protein secreted in the medium by the
transfected COS-7 cells was assessed by p24 antigen
capture ELISA. p24 antigen was detectable at 24-hrs post-
transfection and showed a gradual increase in levels until
48 hrs and thereafter a decline was observed. Such an
observation is typical of protein expression in transiently
transfected cells. The negative controls included in the
study were untransfected cells and cells transfected with
vector pJW4304 (without any insert) and mock positive
control pJWSK3 (envelope plasmid). None of the control
supernates showed any reactivity in the assay. Up to 110-
pg/ml protein was detected in the supernates (Figure 3A).
C. Immunoblotting
The transfection cell lysates were run on SDS PAGE
and transferred onto nitro cellulose membrane for
immunoblotting using HIV positive sera as a source of
polyclonal antibodies to HIV proteins. The 24-kilodalton
band representing gag p24 was detected in the 24 and 48
hrs cell lysates indicating that the 55kilodalton-Gag
precursor was being cloven into respective products. The
negative controls and mock positive cell lysates did not
show any such band (Figure 3B).
Figure 3A p24 estimation in transfection supernatants during a time course experiment by p24 antigen capture ELISA plotted for the
various dilutions of reference standard p24, provided in the kit (Innogenetics Belgium). Maximum amount of p24 was detected at 48 hrs
post-transfection, thereafter the amount of p24 in the medium declined. B Immunoblotting was done with pJWgagprotease-49587
(denoted as gag in the figure) and pJW4304 (denoted as Mock in the figure) transfected cell lysates. SDS PAGE was run and proteins
were transferred onto nitrocellulose membrane by semi dry transfer method. The blot was probed with HIV positive human sera (ID no:
757) as a source of polyclonal antibodies to various HIV proteins. In the figure, immunoblot shows 24Kd band representing Gag protein
(p24) in the 24 hrs and 48hrs transfected cell lysates. The untransfected cell lysates did not show the presence of any HIV-1 specific
band.
![Page 26: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/26.jpg)
Chugh and Seth: Gag gene construct in mammalian expression vector
332
Figure 4A, B. Transmission electron micrographs of COS-7 cells
transfected with pJWgagprotease-49587. TEM was done with
cells harvested at 24 and 48 hr post-transfection. Budding
protrusions from the cell membrane are seen representing VLPs.
Average particle size was determined to be in the range of 140 to
160 nm. (magnification (a) 23,000 X and (b) 18,000X) C
Transmission electron micrograph of pJW4304 transfected COS-
7 cells as control. No virus like particles are visible either on the
surface or outside the cell membrane. (magnification 14,000 X)
D. Electron microscopy of transfected
cells
In transmission electron micrographs numerous virus
like particles (VLPs) were seen budding out of the cell
membrane and lying outside the membrane in the
intercellular spaces. The morphology of these particles
corresponded to that of a pr55 VLP. These VLPs were
observed in pJWGagprotease-49587 transfected COS-7
cells at 24 and 48 hr post transfection. The average size of
the particle was determined to be 140 nm-160 nm (Fig 4. a
& b). Such particles were not seen in normal untransfected
cells and cells transfected with vector alone (pJW4304)
and untransfected cells (Figure 4C).
IV. DiscussionBoth structural (env, gag, pol) and nonstructural
genes (rev, nef) have been targeted as candidate
immunogens for elicitation of effective immune response
to HIV-1. The surface envelope glycoprotein gp 120 has
been extensively studied as a potential target for HIV-1
vaccine development. The variable nature of envelope,
particularly V3 loop, has proven to be a major hurdle in
elicitation of cross-clade responses. The importance of
targeting envelope gp120 remains, as it is the first HIV-1
protein that is encountered by the immune system in the
natural history of pathogenesis. In our laboratory we have
developed an envelope based DNA vaccine construct and
tested in mice model for immunogenecity (Arora et al,
2001). However in view of the importance of cross-clade
broad immune response we sought to develop a gag based
immunogen. Cross clade CTL responses have been
demonstrated within the gag region in studies with
infected individuals (McAdams et al, 1998). The
importance of gag-based responses is also derived from
the studies showing the co-relation of Th responses to gag
p24 in patients with non-progressive state of HIV-1
infection (Rosenberg et al, 1997). It has also been shown
that an early HAART rescues helper responses to gag p24,
which enables the immune system to keep the virus under
control. The distribution of CTL and Th epitopes in HIV-1
gag reveals presence of 81 CTL and 27 Th epitopes in gag
p24, 35 CTL and 5 Th epitopes in p17 and 2 CTL and 6
Th respectively in the nucleocapsid (p15) regions. These
data from the HIV molecular immunology database clearly
show the relevance of targeting gag gene of HIV-1(Los
Alamos Immunology Database).
In challenge studies with chimeric virus SHIV 83.6
in primates, SIV gag constructs have been used to
immunize the animals. The tetramer binding assays
showed that the presence of large frequency of precursor
CTL against HIV-1 gag gene was coincident with the
clearance of challenge virus. These studies underline the
importance of targeting gag gene in a vaccine construct
Considering all these factors we set out to design an
effective immunogen based on Indian clade C HIV-1
viruses. Our objective was to develop a DNA vaccine
construct from local circulating subtype C virus strain,
which is the most predominant subtype prevalent in the
Indian population. In our strategy for construction of gag-
protease plasmid we have cloned the gene fragment in
conjunction with the t-PA leader signal sequence present
in the vector pJW4304. The use of t-PA leader sequence is
![Page 27: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/27.jpg)
Gene Therapy and Molecular Biology Vol 8, page 333
333
known to have positive effects on expression of Envelope
and Gag proteins as demonstrated in other studies. Use of
t-PA leader signal has shown better immune responses as
compared to cytoplasmic targeting of gag gene (Qui et al,
2000).
The viral protease gene was cloned along with gag
gene in order to provide the native protease for proper
processing of gag gene products from the precursor pr55
protein into p17, p24, p6, p7, and p2. This gene encodes
for an aspartyl protease enzyme that recognizes and
cleaves the gag precursor pr55 into respective gene
products, p17, p24, p15, p6 and p2. Protease gene is
expressed as -1 frameshift from the gag open reading
frame in the HIV-1 genome. This frameshift occurs once
in twenty times during translation of gag-pol open reading
frame. In our cloning strategy the frameshift site was
preserved hence allowing the synthesis of both the
proteins as in their native infection process of mammalian
cells. Another obstacle in over-expression of protease is
that it leads to complete processing of gag particles which
abolishes VLP formation in cells, hence we considered it
beneficial to keep the original frame shift site in the gag
protease construct pJWgagprotease-49587.
In in-vitro expression studies, we detected upto
110pg/ml of secreted antigen in transfected COS-7 cell
supernatants (Figure 3A). In addition, a 24-kilodalton
band representing p24 gag (Figure 3B) was observed on
immunoblotting. This shows that the viral protease
expressed from the construct has been successful in
processing the pr55 precursor gag protein into respective
products. We also observed formation of virus like-
particles (VLPs) at 24 and 48 hrs post transfection in COS
7 cells (Figures 4A, B). These VLPs were in the size
range of 120-160 nm. This is the first report of production
of virus like-particles from an HIV-1 subtype C based
construct. The production of VLPs from the vaccine
construct adds the advantage of particulate antigen to
priming with DNA based immunogen.
The earlier studies with gag gene examined the
particle formation in various expression systems and
evaluated the probable use as particulate antigen. Antigens
in particulate conformation have been shown to be highly
immunogenic in mammals. Expression of gag gene alone
has shown that self-assembly of p55 molecules triggers the
formation of pseudovirions or VLPs (Nermut et al, 1998).
Virus like particles have been described in studies with
baculovirus, vaccinia, yeast and mammalian expression
systems (Gheysen et al, 1989; Haffar et al, 1990; Wagner
et al, 1992). A study by Wagner and coworkers examined
particle formation by gag constructs in various expression
systems (Wagner et al, 1992). Budding of 100-160 nm
pr55 core particles resembling immature virions was
observed in eukaryotic systems. They proposed that empty
immature gag particles would represent a safe non-
infectious and attractive immunogen. Thereafter several
studies have been published demonstrating the
immunogenicity of the virus like particles. Long-lived
cellular immune responses have been elicited upon
administration of VLP formulations in murine and monkey
models (Paliard et al, 2000; Rovinski et al, 1995; Wagner
et al, 1998). The hybrid HIV-1 p17/p24:Ty-VLP vaccine
module that has gone into phase I trials has demonstrated
the ability of inducing both cellular and humoral immune
responses to p17 and p24 proteins. VLPs have also been
designed for inclusion of principal neutralizing domain of
gp120 and other regions of envelope proteins for
successful elicitation of both neutralizing humoral immune
response and cytotoxic T cell response (Brand et al, 1995;
Buonangaro et al, 2002).
In a recent study immunogenicity of virus like
particles consisting of gag, protease and envelope from
clade B HIV-1 in rhesus macaques was assessed. In this
study three different forms of antigens were delivered,
purified VLPs, recombinant DNA and canarypox vectors
engineered to express VLPs. It was found that nucleic acid
vaccination capable of producing VLPs was more efficient
in priming cell-mediated immune responses (Montefiori et
al, 2001). It is understood that in order to induce CD8+ T
cell memory, the antigen needs to be presented via the
MHC class I pathway. It has also been demonstrated that
cross presentation of HIV-1 virus like particles by
dendritic cells can lead to efficient priming of CTL
responses (Bachman et al, 1996). These studies have
implicated that recruiting dendritic cells for antigen
presentation of exogenous virus like particles in a DNA
vaccine module is an added advantage. In view of the
above discussion, it can be expected that the production of
virus like-particles from our DNA vaccine construct,
pJWgagprotease-49587, would have a combined effect of
DNA vaccine and particulate antigen in one module.
Acknowledgments
This work has been supported through a generous
financial grant from the Department of Biotechnology,
Ministry of Science and Technology, Government of India
under the Prime minister’s Jai Vigyan Mission
Programme. Our special thanks are also due to the
University Grants commission for providing fellowship
support to Ms. Priti Chugh. Our thanks are also due to the
Electron Microscopy Department at AIIMS New Delhi for
their help in processing the samples.
ReferencesArora A, Fahey JL, Seth P. (2001) DNA vaccine for the
induction of immune responses against HIV-1 subtype C
envelope gene in mice. Gene Ther Mol Biol. 6, 79-89
Bachmann MF, Lutz MB, Layton GT, Harris SJ, Fehr T,
Rescigno M, Ricciardi-Castagnoli P. (1996) Dendritic cells
process exogenous viral proteins and virus-like particles for
class I presentation to CD8+ cytotoxic T lymphocytes. Eur J
Immunol. 26, 2595-600
Barouch DH, Santra S, Kuroda MJ, Schmitz JE, Plishka R,
BucklerWhite A, Gaitan AE, Zin R, NamJH, Wyatt LS,
Lifton MA, Nickerson CE, Moss B, Montefiori DC, Hirsch
VM, Letvin NL.(2001) Reduction of simian-human
immunodeficiencyvirus 89.6P viremia in rhesus monkeys by
recombinant modified vaccinia virus Ankara vaccination. J.
Virol. 75, 5151– 58
Brand D, Mallet F, Truong C, Roingeard P, Goudeau A, Barin F.
(1995) A simple procedure to generate chimeric Pr55gag
virus-like particles expressing the principal neutralization
![Page 28: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/28.jpg)
Chugh and Seth: Gag gene construct in mammalian expression vector
334
domain of human immunodeficiency virus type 1. J Virol.
Methods. 51, 153-68
Buonaguro L, Racioppi L, Tornesello ML, Arra C, Visciano ML,
Biryahwaho B, Sempala SD, Giraldo G, Buonaguro FM.
(2002) Induction of neutralizing antibodies and cytotoxic T
lymphocytes in Balb/c mice immunized with virus-like
particles presenting a gp120 molecule from a HIV-1 isolate
of clade A. Antiviral Res. 54, 189-201
Chapman BS, Thayer RM, Vincent KA, Haigwood NL. (1991)
Effect of intron A from human cytomegalovirus (Towne)
immediate-early gene on heterologous expression in
mammalian cells. Nucleic Acids Res. 19, 3979-86
Dayton JM, Merson MH. (2000) Global dimensions of the AIDS
epidemic, implications for prevention and care. Infect Dis
Clin North Am. 14, 791-808.
Deml L, Bojak A, Steck S, Graf M, Wild J, Schirmbeck R, Wolf
H, Wagner R. (2001) Multiple effects of codon usage
optimization on expression and immunogenicity of DNA
candidate vaccines encoding the human immunodeficiency
virus type 1 Gag protein. J Virol. 75, 10991-1001
Gheysen D, Jacobs E, de Foresta F, Thiriart C, Francotte M,
Thines D, De Wilde M. (1989) Assembly and release of
HIV-1 precursor Pr55gag virus-like particles from
recombinant baculovirus-infected insect cells. Cell. 59, 103-
12
Gotch FM, Nixon DF, Alp N, McMichael AJ, Borysiewicz LK.
(1990) High frequency of memory and effector gag specific
cytotoxic T lymphocytes in HIV seropositive individuals. Int
Immunol. 2, 707-12
Haffar O, Garrigues J, Travis B, et al. (1990) Human
immunodeficiency virus-like, nonreplicating, gag-env
particles assemble in a recombinant vaccinia virus expression
system. J Virol. 64, 2653-9.
Huang Y, Kong WP, Nabel GJ. (2001) Human
immunodeficiency virus type 1-specific immunity after
genetic immunization is enhanced by modification of Gag
and Pol expression. J Virol. , 75, 4947-51
Johnson RP, Trocha A, Yang L, Mazzara GP, Panicali DL,
Buchanan TM, Walker BD. (1991) HIV-1 gag-specific
cytotoxic T lymphocytes recognize multiple highly
conserved epitopes. Fine specificity of the gag-specific
response defined by using unstimulated peripheral blood
mononuclear cells and cloned effector cells. J Immunol.
147, 3560-7
Kalams SA, Buchbinder SP, Rosenberg ES, Billingsley JM,
Colbert DS, Jones NG, Shea AK, Trocha AK, Walker BD.
(1999) Association between virus-specific cytotoxic T-
lymphocyte and helper responses in human
immunodeficiency virus type 1 infection. Leukemia. 13
Suppl 1, S42-7
Los Alamos HIV Molecular Immunology Database. (2002)
http://hiv-web.lanl.gov/content/immunology/
McAdam S, Kaleebu P, Krausa P, Goulder P, French N, Collin
B, Blanchard T, Whitworth J, McMichael A, Gotch F. (1998)
Cross-clade recognition of p55 by cytotoxic T lymphocytes
in HIV-1 infection. Proc Natl Acad Sci USA. 95, 10112-6
Montefiori DC, Safrit JT, Lydy SL, Barry AP, Bilska M, Vo HT,
Klein M, Tartaglia J, Robinson HL, Rovinski B. (2001)
Induction of neutralizing antibodies and gag-specific cellular
immune responses to an R5 primary isolate of human
immunodeficiency virus type 1 in rhesus macaques. J Virol
75, 5879-90
Nermut MV, Hockley DJ, Bron P, Thomas D, Zhang WH, Jones
IM. (1998) Further evidence for hexagonal organization of
HIV gag protein in prebudding assemblies and immature
virus-like particles. J Struct Biol. 123, 143-9
Paliard X, Liu Y, Wagner R, Wolf H, Baenziger J, Walker CM.
(2000) Priming of strong, broad, and long-lived HIV type 1
p55gag-specific CD8+ cytotoxic T cells after administration
of a virus-like particle vaccine in rhesus macaques. AIDS
Res. Hum Retroviruses 16, 273-82
Qiu JT, Liu B, Tian C, Pavlakis GN, Yu XF. (2000)
Enhancement of primary and secondary cellular immune
responses against human immunodeficiency virus type 1 gag
by using DNA expression vectors that target Gag antigen to
the secretory pathway. J Virol. 74, 5997-6005.
Rosenberg ES, Billingsley JM, Caliendo AM, Boswell SL, Sax
PE, Kalams SA, Walker BD. (1997) Vigorous HIV-
1–specific CD4 T cell responses associated with control of
viremia. Science. 278, 1447–50
Rovinski B, Rodrigues L, Cao SX, Yao FL, McGuinness U, Sia
C, Cates G, ZollaPazner S, Karwowska S, Matthews TJ.
(1995) Induction of HIV type 1 neutralizing and env-CD4
blocking antibodies by immunization with genetically
engineered HIV type 1-like particles containing unprocessed
gp160 glycoproteins. AIDS Res Hum Retroviruses. 11,
1187-95.
Seth A, Ourmanov I, Schmitz JE, Kuroda MJ, Lifton MA,
Nickerson CE, Wyatt L, Carroll M, Moss B, Venzon D,
Letvin NL, Hirsch VM. (2000) Immunization with a
modified vaccinia virus expressing simian immunodeficiency
virus (SIV) Gag-Pol primes for an anamnestic Gag-specific
cy-totoxic T-lymphocyte response and is asso-ciated with
reduction of viremia after SIV challenge. J. Virol. 74,
2502–7
Tatt ID, Barlow KL, Nicoll A, Clewley JP. (2001) The public
health significance of HIV-1 subtypes. AIDS. 15 Suppl 5,
S59-71
Wagner R, Fliessbach H, Wanner G, Motz M, Niedrig M, Deby
G, von Brunn A, Wolf H. (1992) Studies on processing,
particle formation, and immunogenicity of the HIV-1 gag
gene product, a possible component of a HIV vaccine. Arch
Virol. 127(1-4) 117-37
Wagner R, Teeuwsen VJ, Deml L. (1998) Cytotoxic T cells and
neutralizing antibodies induced in rhesus monkeys by virus-
like particle HIV vaccines in the absence of protection from
SHIV infection. Virology. 245, 65-74
![Page 29: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/29.jpg)
Gene Therapy and Molecular Biology Vol 8, page 335
335
Gene Ther Mol Biol Vol 8, 335-342, 2004
Targeting retroviral vector entry by host range
extensionReview Article
Katja Sliva and Barbara S.Schnierle*Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt/Main, Germany
__________________________________________________________________________________
*Correspondence: Barbara S.Schnierle, Institute for Biomedical Research, Georg-Speyer Haus, Paul-Ehrlich-Str. 42-44, 60596
Frankfurt/Main, Germany; Tel. +49-69-63395-218; Fax. +49-69-63395-297; E-mail: [email protected]
Key words: murine leukemia virus, targeting, vector, envelope, virus entry, host range
Abbreviations: endoplasmatic reticulum, (ER); envelope glycoproteins, (Env); epidermal growth factor, (EGF); feline leukemia virus,
(FeLV); fusion peptide, (FP); gastrin-releasing protein, (GRP); green fluorescent protein, (GFP); haemagglutinin, (HA); murine
leukemia virus, (MLV); proline-rich region, (PRR); receptor-binding domain, (RBD); receptor-binding domain, (RBD); signal peptide,
(SP); soluble receptor-binding domains, (sRBD); translocation domain, (TLD)
Received: 12 July 2004; Accepted: 27 July 2004; electronically published: July 2004
Summary
The dream of vectorologists is a vector with magic bullet properties. This conceptual breakthrough in gene therapy
would be a gene transfer vector that could be systemically applied, allowing targeted gene transfer into a
predetermined cell type. The host range of a retroviral vector is determined by the interaction between the viral
envelope glycoprotein and the retrovirus receptor on the surface of the host cell. Here are summarized current
efforts to engineer the envelope glycoprotein of ecotropic murine leukemia virus, which does not infect human cells,
in order to extend its host range and accomplish gene delivery in a highly specific manner.
I. IntroductionTargeting retroviral entry is a central theme in the
development of vectors for gene therapy. The selective
delivery of a therapeutic gene would immensely reduce
unfavorable side effects and ease the clinical application
of gene therapy. Here one aspect of generating targeted
retroviral vectors will be discussed: the extension of the
host range of a non human pathogenic virus. Other
approaches are summarized in other current reviews
(Haynes et al, 2003; Sandrin et al, 2003; Verhoeyen and
Cosset, 2004).
The ability of viruses to introduce foreign DNA
sequences into target cells is being exploited for treating
genetic diseases, including cancer (Cavazzana-Calvo et al,
2000; Aiuti et al, 2002). Retroviral vectors are the best
understood and the most widely used vectors for gene
therapy. They integrate their genomes stably into host cell
DNA allowing long-term expression of inserted
therapeutic genes. Retroviral entry and genome integration
do not require viral protein synthesis, and, therefore, all
viral genes in the vector genome can be replaced with
foreign sequences. There is no production of viral proteins
after transduction, which could lead to immune responses
against the vector particle, and no subsequent spread of the
vector. Vector particles are produced by packaging cell
lines that provided the viral proteins in trans. These cell
lines release vector genomes packaged into infectious
particles that are free from contaminating helper virus and
replication-competent recombinant virus.
Retroviruses and vectors derived thereof acquire cell-
derived lipid bilayer in which the envelope glycoproteins
(Env) are inserted, by budding from the host cell
membrane. The Env protein mediates attachment and
fusion between the host cell membrane and the viral
membrane, which results in the release of the viral capsid
particle containing the genetic material into the cytoplasm.
Viral entry is initiated by the binding of the envelope
protein to an appropriate cellular receptor at the host cell
surface. After binding, the Env protein undergoes
conformational changes allowing induction of membrane
fusion. This is triggered either at the cell surface by the
interaction with the receptor (pH-independent entry), or by
exposure to low pH following receptor-mediated
endocytosis (pH-dependent entry). Induction of fusion
under low pH conditions is believed to occur in the
absence of receptor binding, suggesting that the binding of
pH-dependent envelope proteins serves only as a means of
targeting the virus to endosomes.
![Page 30: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/30.jpg)
Sliva and Schnierle: Host range extension
336
II. The murine leukemia virus (MLV)
envelope glycoproteinThe host range of a retroviral vector is dependent
upon its Env, which binds to a specific cell surface
receptor protein. The MLV Env protein, like all retroviral
Envs, is a type I membrane protein and is synthesized as a
precursor protein, which is directed into the lumen of the
endoplasmatic reticulum (ER) by its N-terminal signal
peptide (SP) (Figure 1A). In the ER, the signal peptide is
cleaved off, the protein is N-linked glycosylated and
correctly folded proteins assemble into trimers. After
transport to the Golgi apparatus, further glycosylation and
trimming of the carbohydrates take place and the precursor
protein is cleaved by furin or related proteases into the
surface SU, and transmembrane TM, subunits. SU and TM
are linked in the case of MLV Env by labile disulfide
bonds. The cleavage is necessary for Env to gain the
active, fusion competent conformation, required for viral
entry. From the Golgi apparatus the mature Env is
transported to the plasma membrane where it is
incorporated into the budding viral particles. Recently, it
has been indicated that recruitment of Env by MLV core
proteins also occurs in intracellular compartments
(Sandrin et al, 2004). The MLV Env is further processed
in the viral particle by another cleavage event. A short
portion of the cytoplasmic tail (R) of TM is removed by
the viral protease. This cleavage is required to activate the
fusion potential of Env (Coffin et al, 1997).
Figure 1. A. Schematic structure of the Moloney-MLV envelope glycoprotein.SU: Env surface domain; TM: Env transmembrane
domain; SP: Signal peptide; VRA: variable region A; VRB: variable region B; RBD: receptor-binding region; PRR: proline-rich region;
FP: fusion peptide; HR: helical region; MS: membrane spanning region; R: R peptide. Arrows indicate protease cleavage sites. B.
Schematic three dimensional structure of Moloney-MLV envelope glycoprotein.
![Page 31: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/31.jpg)
Gene Therapy and Molecular Biology Vol 8, page 337
337
The receptor-binding domain (RBD) is located in the
SU subunit of Env (Figure 1A, B). Two hypervarible
regions (VRA and VRB) are believed to be the main
determinants of the receptor-binding specificity. The
structure of the receptor-binding region has been
determined (Fass et al, 1997) and the VRA and VRB
regions form parallel !-helices that shape the receptor-
binding site. The receptor-binding site is followed by the
proline-rich region (PRR), which is thought to have a
hinge function. The PRR has a role in stabilizing the
overall structure of the protein, affects the SU-TM
interactions and functions as a signal which induces the
envelope conformational changes leading to fusion
(Weimin Wu et al, 1998; Lavillette et al, 1998). The PRR
contains a highly conserved N-terminal sequence and a
hypervariable C-terminal sequence. The hypervariable
region of the PRR has been described to be not absolutely
required for envelope protein function (Weimin Wu et al,
1998). The C-terminal domain of SU is believed to
mediate the SU-TM interaction (Schulz et al, 1992)
(Figure 1B).
A conserved motif (SPHQV) at the N-terminus of
SU containing the histidine residue H8, has also been
shown to be required for membrane fusion. Deletion or
mutation of this histidine residue abrogates Env’s fusion
activity, but not receptor binding. Surprisingly, this fusion
defect can be restored by adding soluble fragments of SU,
containing the receptor-binding site, to viral particles
carrying Envs with a mutated histidine (Zavorotinskaya
and Albritton, 1999; Lavillette et al, 2000; Barnett and
Cunningham, 2001).
TM contains the hydrophobic fusion peptide (FP) at
its N-terminus. It is crucial for membrane fusion and
becomes exposed and inserted into the host cell membrane
after receptor binding and the resulting conformational
changes in Env. The fusion process also involves major
changes in the membrane proximal region of TM. A six-
helix bundle is formed, which pulls the cellular and viral
membrane closer together, driving membrane fusion by
permitting membrane merging and pore formation. This
finally leads to fusion of the viral and cellular membranes,
and eventual delivery of the viral core into the cell (Dutch
et al, 2000).
The mammalian type C retroviruses, like MLV, can
be divided into four different naturally occurring host-
range subtypes according to the distinct cell-surface
receptors they recognize among species as well as to the
viral interference patterns. MLV "s that recognize receptors
found on both rodent cells and cells of other species are
classified as amphotropic and dual- or polytropic viruses,
while the receptor for viruses with xenotropic host range is
present on cells of a variety of species but not on mouse
cells. Receptors for ecotropic MLVs are restricted to cells
of mouse or rat origin, which makes this envelope to a
good candidate for targeting approaches. However, all
receptors belong to the family of membrane transporter
molecules (Coffin et al, 1997). While this allows different
host ranges for the various retrovirus family members, it
also implies that the receptor’s function might have an
important task during viral entry.
The ecotropic MLV envelope protein does not
recognizes receptors on human cells. An obvious
challenge has been to extend the host range of vectors
carrying the ecotropic envelope glycoprotein to a
predetermined human cell type. This change in host range
requires the inclusion of a novel attachment site and the
induction of fusion via a novel receptor interaction.
III. Extension of the ecotropic Env
host rangeA. The search for insertion sites in EnvThe extension of the host range of ecotropic MLV
vectors to specific human cell types was begun with the
insertion of new receptor-binding ligands into Env, to
redirect binding of viral particles to a predetermined cell
type. The insertion of additional sequences into Env very
often interferes with its cleavage into the SU and TM
subunits and/or incorporation into virions (Schnierle and
Groner, 1996; Benedict et al, 1999). Rational
determination of the appropriate insertion site in Env has
been difficult, since its structure is complex and only
limited information is available. Several studies have
investigated locations within the ecotropic Env protein
which can tolerate the insertion of ligands and the
following sites have been mainly determined empirically:
1. The N-terminus of SUInitially ligands were fused to the N-terminus of Env
behind aa 7 of the mature Env protein (Russell et al, 1993;
Cosset et al, 1995; Schnierle et al, 1996; Hall et al, 1997;
Yajima et al, 1998; Benedict et al, 1999). However it was
found that sequences between +1 and +7 also influence the
fusion activity of the chimeric Env, and N-terminal
extension of Env (position +1) is now believed to be
superior over the insertion of additional sequences at
position +7 (Ager et al, 1996; Valsesia-Wittmann et al,
1996).
2. The proline-rich region (PRR)The hypervariable region of the PRR has been
described to be dispensable for Env function and to
tolerate insertion of foreign sequences (Weimin Wu et al,
1998). Even large insertions have been introduced
(Kayman et al, 1999; Erlwein et al, 2003). We recently
generated a fully replication competent Moloney-MLV
that bears the green fluorescent protein (GFP) in its PRR
and still replicates to the same titers as the parental
construct (Erlwein et al, 2003).
3. The receptor-binding domain (RBD)Three studies have reported the stable insertion of
sequences into a small disulfide-bonded loop (between
Cys 73 and Cys 81) near the native receptor-binding site,
which is predicted by the crystal structure exposed to the
surface (Lorimer and Lavictoire, 2000; Wu et al, 2000;
Katane et al, 2002).
4. Replacement of the RBD with a new ligandIn addition to adding new ligands, the insertion of
new ligands into Env by the replacement of the entire
![Page 32: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/32.jpg)
Sliva and Schnierle: Host range extension
338
receptor binding region of Env has been described
(Kasahara et al, 1994; Han et al, 1995; Masood et al, 2001;
Nakamura et al, 2001). These targeting approaches
however do require the co-expression of wt Env in order
to achieve efficient uptake of the chimeric Env and
probably also to enhance the fusion process.
B. Host range expansionInsertion of ligands into Env is possible and insertion
sites are well established, but not all inserted ligands are
tolerated by the ecotropic Env. Unfortunately, it is not yet
possible to predict which ligands will allow proper
incorporation of Env into vector particles. In the last
decade, however, attempts to expand the host range of
MLV vectors by redirecting binding to specific human cell
types through the attachment of additional cell-binding
ligands to the ecotropic MLV Env have met with little
success. While binding of Env to the new receptor could
be demonstrated frequently, this was not sufficient to
catalyze efficient infections (Cosset and Russell, 1996,
1999; Schnierle and Groner, 1996; Benedict et al, 1999;
Lavillette et al, 2001b). Recently, a few exceptions have
been reported. These include targeting via the human
CXCR-4 receptor by incorporation of SDF-1 into the VRA
region of the RBD (Katane et al, 2002, 2004) and two
approaches using N-terminal extensions of Env to target
either the human epidermal growth factor (EGF) receptor
family using their ligand heregulin or gastrin-releasing
protein (GRP) using short peptide ligands (Gollan and
Green, 2002a, 2002b). But the maximum titers reached on
human cells were only 104 IU/ml and these vectors are,
therefore, not yet useful for gene therapy applications.
Why is host range expansion so difficult? The
targeted binding of a new receptor presumably fails to
induce the conformational changes in Env required for the
activation of membrane fusion (Cosset et al, 1995; Zhao et
al, 1999; Karavanas et al, 2002). As mentioned above,
mammalian type C retroviral receptors belong to the
multi-transmembrane domain-containing transporter
family. As retroviruses have evolved to use this type of
proteins as receptors, it is possible that only this type of
surface molecule is able to trigger cellular processes
required for retroviral entry. This would only affect pH-
independent entry processes, because in this case receptor
binding induces the fusion process. Since ecotropic MLV
has been described to use the pH-dependent entry route
(Nussbaum et al, 1993) it was thought that targeting it to
receptors that are internalized after ligand binding should
facilitate infection, because the virus is transported to the
low pH compartment required for fusion activation. This
assumption proved, however, to be too simple. Viral
particles containing a chimeric EGF-Env bind to the EGF-
receptor but are rapidly trafficked to endosomes and
become degraded (sequestration). This effect is dominant
over the normal entry pathway, because a strong decrease
in infectivity of EGF-Env vectors in mouse cells
expressing the EGF-receptor has been observed (Cosset et
al, 1995; Yajima et al, 1998; Benedict et al, 1999;
Chadwick et al, 1999; Zhao et al, 1999) (Figure 2).
Figure 2. Proposed mechanism of cell entry with targeted
vectors using fusion helpers.
IV. Overcoming the fusion defectA. Retroviral librariesThe search for an Env integration site and ligands
that allow both binding and the induction of the fusion
process is continuing. The most promising results come
from evolutionary approaches, such as using retroviral
libraries with random modifications in the receptor-
binding site to select viruses with a desired host range. The
selection process takes attachment and induction of fusion
into account. Successful examples have already been
described for feline leukemia virus (FeLV) subtype A
where Env molecules conferring an altered host range
have been successfully selected from a retroviral library
(Bupp and Roth, 2002, 2003).
B. Adding pH-dependent endosome
escape functionThe post-binding entry process differs among the
MLV Envs. Amphotropic MLV fuses with cells at neutral
pH, whereas ecotropic MLV entry seems to be acid pH
dependent (Coffin et al, 1997). However, following
targeting of the ecotropic MLV to the EGF-receptor, the
subsequent internalization does not support infection
(Cosset et al, 1995), but rather leads to an inactivation of
the viral particles. This observation opened the field to
new targeting strategies that include insertion of an
endosome escape function (fusion helper) into the viral
particles (Figure 2).
We generated chimeric ecotropic Env proteins
containing EGF-receptor ligands and the translocation
domain (TLD) of Exotoxin A of Pseudomonas aeruginosa
which gives the toxin the ability to translocate from
![Page 33: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/33.jpg)
Gene Therapy and Molecular Biology Vol 8, page 339
339
endosomes to the cytoplasm. These chimeric proteins were
successfully produced, chimeric vector particles could
bind to the EGF-receptor, but transduction of human cells
expressing EGF-receptor was not observed (Erlwein et al,
2002). Since the titers of vectors containing Envs with the
TLD were significantly decreased, it is still not clear
whether the endosome escape is inefficient or if infectivity
of the vectors is below a detectable level.
PH-dependent viruses enter cells through receptor-
mediated endocytosis and the subsequent acidification in
the endosome produces the conformational changes in the
viral envelope protein(s) which lead to membrane fusion.
It seems likely that targeting such proteins to a receptor
that undergoes endocytosis could result in efficient fusion.
These proteins are attractive molecules for co-packaging
with ecotropic targeted Envs, and the best studied
envelope protein of this type is the haemagglutinin (HA)
of influenza A (Skehel and Wiley, 2000). Analogous to
retroviral Envs, the mature protein consists of 2 subunits,
HA1 and HA2. The major part of HA1 forms the globular
head region, containing the receptor-binding domain
which binds to the ubiquitously present sialic acid. HA2
contains the fusion peptide and transmembrane domain.
For targeting approaches, however, HA has to be modified
to eliminate its tropism towards human cells. Point
mutations within the receptor-binding pocket have been
reported that greatly reduce binding (Martin et al, 1998;
Lin and Cannon, 2002). The co-expression of these HA
mutants has been reported by Lin et al, (2001). MLV
vectors bearing both, the HA mutant and a chimeric,
ecotropic MLV Env targeted to the murine Flt-3 receptor
show a 10-fold increase in titer on human cells expressing
this receptor compared to the parental cells. Although
there is still a low residual titer of this HA protein, this
study shows that the production of infectious retroviral
vectors bearing a targeted binding protein complemented
with a fusion active HA is possible.
C. Targeting by using soluble RBDsTheoretically targeting might be possible using
soluble receptor-binding domains (sRBD), which are able
to activate fusion-defective Envs. This may allow the local
activation of fusion at the cell type of choice might be
possible (Lavillette et al, 2000; 2001a, 2002; Barnett and
Cunningham, 2001). However, the clinical application of
this strategy is questionable, since two proteinous
components have to be applied systemically to accomplish
their task at a locally restricted area.
V. ConclusionsWe know now that the initial assumption, that
changing the host range of retroviruses is possible by
simply modifying the cell-binding specificity, was too
simple. However, some of the key problems in
engineering Envs to target retroviral vectors have been
answered. It is possible to modify ecotropic Env and
change its binding specificity, but the efficient triggering
of membrane fusion is still missing. As more data about
viral assembly and Env structure are becoming available,
new strategies might arise, which may substantiate the
doubts of some scientists in the field that host range
expansion will not be possible, or which will finally
facilitate the generation of targeted retroviral vectors.
ReferencesAger S, Nilson BH, Morling FJ, Peng KW, Cosset FL and
Russell SJ (1996) Retroviral display of antibody fragments;
interdomain spacing strongly influences vector infectivity.
Hum Gene Ther 7, 2157-2164.
Aiuti A, Slavin S, Aker M, Ficara F, Deola S, Mortellaro A,
Morecki S andolfi G, Tabucchi A, Carlucci F, et al (2002)
Correction of ADA-SCID by stem cell gene therapy
combined with nonmyeloablative conditioning. Science 296,
2410-2413.
Barnett AL and Cunningham JM (2001) Receptor binding
transforms the surface subunit of the mammalian C-type
retrovirus envelope protein from an inhibitor to an activator
of fusion. J Virol 75, 9096-9105.
Benedict CA, Tun RY, Rubinstein DB, Guillaume T, Cannon
PM and Anderson WF (1999) Targeting retroviral vectors to
CD34-expressing cells: binding to CD34 does not catalyze
virus-cell fusion. Hum Gene Ther 10, 545-557.
Bupp K and Roth MJ (2002) Altering retroviral tropism using a
random-display envelope library. Mol Ther 5, 329-335.
Bupp K and Roth MJ (2003) Targeting a retroviral vector in the
absence of a known cell-targeting ligand. Hum Gene Ther
14, 1557-1564.
Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F,
Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova JL,
et al (2000) Gene therapy of human severe combined
immunodeficiency (SCID)-X1 disease. Science 288, 669-
672.
Chadwick MP, Morling FJ, Cosset FL and Russell SJ (1999)
Modification of retroviral tropism by display of IGF-I. J Mol
Biol 285, 485-494.
Coffin JM, Hughes SH and Varmus HE (1997) Retroviruses, Vol
2, Cold Spring Harbor Press.
Cosset FL and Russell SJ (1996) Targeting retrovirus entry.
Gene Ther 3, 946-956.
Cosset FL, Morling FJ, Takeuchi Y, Weiss RA, Collins MK and
Russell SJ (1995) Retroviral retargeting by envelopes
expressing an N-terminal binding domain. J Virol 69, 6314-
6322.
Dutch RE, Jardetzky TS and Lamb RA (2000) Virus membrane
fusion proteins: biological machines that undergo a
metamorphosis. Biosci Rep 20, 597-612.
Erlwein O, Buchholz CJ and Schnierle BS (2003) The proline-
rich region of the ecotropic Moloney murine leukaemia virus
envelope protein tolerates the insertion of the green
fluorescent protein and allows the generation of replication-
competent virus. J Gen Virol 84, 369-373.
Erlwein O, Wels W and Schnierle BS (2002) Chimeric ecotropic
MLV envelope proteins that carry EGF receptor-specific
ligands and the Pseudomonas exotoxin A translocation
domain to target gene transfer to human cancer cells.
Virology 302, 333-341.
Fass D, Davey RA, Hamson CA, Kim PS, Cunningham JM and
Berger JM (1997) Structure of a murine leukemia virus
receptor-binding glycoprotein at 2.0 angstrom resolution.
Science 277, 1662-1666.
Gollan TJ and Green MR (2002a) Redirecting retroviral tropism
by insertion of short, nondisruptive peptide ligands into
envelope. J Virol 76, 3558-3563.
![Page 34: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/34.jpg)
Sliva and Schnierle: Host range extension
340
Gollan TJ and Green MR (2002b) Selective targeting and
inducible destruction of human cancer cells by retroviruses
with envelope proteins bearing short peptide ligands. J Virol
76, 3564-3569.
Hall FL, Gordon EM, Wu L, Zhu NL, Skotzko MJ, Starnes VA
and Anderson WF (1997) Targeting retroviral vectors to
vascular lesions by genetic engineering of the MoMLV gp70
envelope protein. Hum Gene Ther 8, 2183-2192.
Han X, Kasahara N and Kan YW (1995) Ligand-directed
retroviral targeting of human breast cancer cells. Proc Natl
Acad Sci U S A 92, 9747-9751.
Haynes C, Erlwein O and Schnierle BS (2003) Modified
envelope glycoproteins to retarget retroviral vectors. Curr
Gene Ther 3, 405-410.
Karavanas G, Marin M, Bachrach E, Papavassiliou AG and
Piechaczyk M (2002) The insertion of an anti-MHC I ScFv
into the N-terminus of an ecotropic MLV glycoprotein does
not alter its fusiogenic potential on murine cells. Virus Res
83, 57-69.
Kasahara N, Dozy AM and Kan YW (1994) Tissue-specific
targeting of retroviral vectors through ligand-receptor
interactions. Science 266, 1373-1376.
Katane M, Fujita R, Takao E, Kubo Y, Aoki Y and Amanuma H
(2004) An essential role for the His-8 residue of the SDF-
1alpha-chimeric, tropism-redirected Env protein of the
Moloney murine leukemia virus in regulating postbinding
fusion events. J Gene Med 6, 260-267.
Katane M, Takao E, Kubo Y, Fujita R and Amanuma H (2002)
Factors affecting the direct targeting of murine leukemia
virus vectors containing peptide ligands in the envelope
protein. EMBO Rep 3, 899-904.
Kayman SC, Park H, Saxon M and Pinter A (1999) The
hypervariable domain of the murine leukemia virus surface
protein tolerates large insertions and deletions, enabling
development of a retroviral particle display system. J Virol
73, 1802-1808.
Lavillette D, Boson B, Russell SJ and Cosset FL (2001a)
Activation of membrane fusion by murine leukemia viruses
is controlled in cis or in trans by interactions between the
receptor-binding domain and a conserved disulfide loop of
the carboxy terminus of the surface glycoprotein. J Virol 75,
3685-3695.
Lavillette D, Maurice M, Roche C, Russell SJ, Sitbon M and
Cosset FL (1998) A proline-rich motif downstream of the
receptor binding domain modulates conformation and
fusogenicity of murine retroviral envelopes. J Virol 72,
9955-9965.
Lavillette D, Ruggieri A, Boson B, Maurice M and Cosset FL
(2002) Relationship between SU subdomains that regulate
the receptor-mediated transition from the native (fusion-
inhibited) to the fusion-active conformation of the murine
leukemia virus glycoprotein. J Virol 76, 9673-9685.
Lavillette D, Ruggieri A, Russell SJ and Cosset FL (2000)
Activation of a cell entry pathway common to type C
mammalian retroviruses by soluble envelope fragments. J
Virol 74, 295-304.
Lavillette D, Russell SJ and Cosset FL (2001b) Retargeting gene
delivery using surface-engineered retroviral vector particles.
Curr Opin Biotechnol 12, 461-466.
Lin AH and Cannon PM (2002) Use of pseudotyped retroviral
vectors to analyze the receptor-binding pocket of
hemagglutinin from a pathogenic avian influenza A virus
(H7 subtype) Virus Res 83, 43-56.
Lorimer IA and Lavictoire SJ (2000) Targeting retrovirus to
cancer cells expressing a mutant EGF receptor by insertion
of a single chain antibody variable domain in the envelope
glycoprotein receptor binding lobe. J Immunol Methods
237, 147-157.
Martin J, Wharton SA, Lin YP, Takemoto DK, Skehel JJ, Wiley
DC and Steinhauer DA (1998) Studies of the binding
properties of influenza hemagglutinin receptor-site mutants.
Virology 241, 101-111.
Masood R, Gordon EM, Whitley MD, Wu BW, Cannon P, Evans
L anderson WF, Gill P and Hall FL (2001) Retroviral vectors
bearing IgG-binding motifs for antibody-mediated targeting
of vascular endothelial growth factor receptors. Int J Mol
Med 8, 335-343.
Nakamura H, Takeda A and Matano T (2001) Postbinding fusion
function contributed by a chimeric murine leukemia virus
envelope protein. Arch Virol 146, 953-961.
Nussbaum O, Roop A and Anderson WF (1993) Sequences
determining the pH dependence of viral entry are distinct
from the host range-determining region of the murine
ecotropic and amphotropic retrovirus envelope proteins. J
Virol 67, 7402-7405.
Russell SJ and Cosset FL (1999) Modifying the host range
properties of retroviral vectors. J Gene Med 1, 300-311.
Russell SJ, Hawkins RE and Winter G (1993) Retroviral vectors
displaying functional antibody fragments. Nucleic Acids Res
21, 1081-1085.
Sandrin V, Muriaux D, Darlix JL and Cosset FL (2004)
Intracellular trafficking of gag and env proteins and their
interactions modulate pseudotyping of retroviruses. J Virol
78, 7153-7164.
Sandrin V, Russell SJ and Cosset FL (2003) Targeting retroviral
and lentiviral vectors. Curr Top Microbiol Immunol 281,
137-178.
Schnierle BS and Groner B (1996) Retroviral targeted delivery.
Gene Ther 3, 1069-1073.
Schnierle BS, Moritz D, Jeschke M and Groner B (1996)
Expression of chimeric envelope proteins in helper cell lines
and integration into Moloney murine leukemia virus
particles. Gene Ther 3, 334-342.
Schulz TF, Jameson BA, Lopalco L, Siccardi AG, Weiss RA and
Moore JP (1992) Conserved structural features in the
interaction between retroviral surface and transmembrane
glycoproteins? AIDS Res Hum Retroviruses 8, 1571-1580.
Skehel JJ and Wiley DC (2000) Receptor binding and membrane
fusion in virus entry: the influenza hemagglutinin. Annu Rev
Biochem 69, 531-569.
Valsesia-Wittmann S, Morling FJ, Nilson BH, Takeuchi Y,
Russell SJ and Cosset FL (1996) Improvement of retroviral
retargeting by using amino acid spacers between an
additional binding domain and the N terminus of Moloney
murine leukemia virus SU. J Virol 70, 2059-2064.
Verhoeyen E and Cosset FL (2004) Surface-engineering of
lentiviral vectors. J Gene Med 6 Suppl 1, S83-94.
Weimin Wu B, Cannon PM, Gordon EM, Hall FL and Anderson
WF (1998) Characterization of the proline-rich region of
murine leukemia virus envelope protein. J Virol 72, 5383-
5391.
Wu BW, Lu J, Gallaher TK anderson WF and Cannon PM
(2000) Identification of regions in the Moloney murine
leukemia virus SU protein that tolerate the insertion of an
integrin-binding peptide. Virology 269, 7-17.
Yajima T, Kanda T, Yoshiike K and Kitamura Y (1998)
Retroviral vector targeting human cells via c-Kit-stem cell
factor interaction. Hum Gene Ther 9, 779-787.
Zavorotinskaya T and Albritton LM (1999) Suppression of a
fusion defect by second site mutations in the ecotropic
![Page 35: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/35.jpg)
Gene Therapy and Molecular Biology Vol 8, page 341
341
murine leukemia virus surface protein. J Virol 73, 5034-
5042.
Zhao Y, Zhu L, Lee S, Li L, Chang E, Soong NW, Douer D and
Anderson WF (1999) Identification of the block in targeted
retroviral-mediated gene transfer. Proc Natl Acad Sci U S A
96, 4005-4010.
![Page 36: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/36.jpg)
Sliva and Schnierle: Host range extension
342
![Page 37: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/37.jpg)
Gene Therapy and Molecular Biology Vol 8, page 343
343
Gene Ther Mol Biol Vol 8, 343-350, 2004
Role of the Brn-3a and Brn-3b POU family
transcription factors in cancerReview Article
David S. Latchman*Institute of Child Health, 30 Guilford Street, London WC1N 1EH & Birkbeck, University of London Malet Street, London
WC1E 7HX
__________________________________________________________________________________*Correspondence: David S. Latchman, Institute of Child Health, 30 Guilford Street, London WC1N 1EH and Birkbeck, University of
London, Malet Street, London WC1E 7HX, UK; Tel (+44) 20 7905 2611; Fax (+44) 20 7905 2301; E-mail: [email protected]
Key words: Brn-3a, Brn-3b, POU family transcription factors, neuroblastoma, Ewing's sarcoma, breast cancer, cervical cancer
Abbreviations: cervical intra-epithelial neoplasia Type 3, (CIN3)
Received: 03 August 2004; Accepted: 04 August 2004; electronically published: August 2004
Contributed by Prof. David Latchman
Summary
Brn-3a and Brn-3b are closely-related POU family transcription factors both of which play an important role in the
nervous system. However, both these factors were originally isolated from a neuroblastoma cell line and their
expression has been shown to be altered in several different human cancers. Interestingly, functional studies have
shown that Brn-3b has a growth-stimulating effect in neurobastomas, whereas Brn-3a has a growth-inhibiting
effect. Similarly, Brn-3b is over-expressed in human breast cancers and stimulates their growth. However, Brn-3a is
strongly over-expressed in human cervical cancer and stimulates cervical tumour growth by activating expression
of the human papilloma virus E6 and E7 oncogenes which are essential for development of this tumour. Hence,
these closely-related factors play critical but distinct roles in different human cancers.
I. IntroductionThe POU family of transcription factors was
originally defined on the basis of a common DNA binding
domain identified in the mammalian transcription factors
Pit, Oct-1 and Oct-2 and the nematode regulatory protein
Unc-86 (Herr et al, 1988). Subsequently, a large number
of other POU family members have been identified in a
range of different invertebrates and vertebrates and have
been shown to play critical roles in development,
particularly in the nervous system (Verrijzer and van der
Vliet 1993; Ryan and Rosenfeld 1997; Latchman 1999).
For example, He et al, (1989) used degenerate
oligonucleotides corresponding to conserved regions of
the POU domain to isolate several novel POU factors
expressed specifically in the brain. One of these, which
they named Brn-3 was highly expressed in sensory
neurones of the peripheral nervous system and was
particularly closely related to the nematode Unc-86 gene
product, indicating the evolutionary conservation of POU
proteins.
Subsequently however, using a similar approach in a
rodent neuroblastoma cell line we isolated two very
closely-related POU factors (Lillycrop et al, 1992). One of
these was identical to the Brn-3 factor reported by He et
al, (1989), whilst the other showed seven amino acid
differences in the POU domain from the original factor.
Subsequent studies indicated that these two factors which
we named respectively Brn-3a and Brn-3b, were encoded
by different genes and, whilst having highly homologous
POU domains, were much less homologous outside the
POU domain (Lillycrop et al, 1992: Ring and Latchman,
1993). Subsequently, a third closely-related factor Brn-3c
was also isolated from the nervous system (Ninkina et al,
1993).
All these three factors play essential roles in
development of particular aspects of the nervous system.
Thus, inactivation of Brn-3a (also known as Brn-3.0) in
knock out mice results in extensive death of sensory
neurones and is incompatible with survival (McEvilly et
al, 1996; Xiang et al, 1996). Although inactivation of Brn-
3b (also known as Brn-3.2) and Brn-3c (also known as
Brn-3.1) is not incompatible with survival of the animal,
such inactivation leads respectively to defects in the visual
and auditory systems (Erkman et al, 1996; Xiang et al,
1997). Hence, the POU factors Brn-3a, Brn-3b and Brn-3c
constitute a closely-related group of factors which are
classified together in the POU IV subfamily and are the
most closely-related mammalian factors to Unc-86 and
like this factor play an essential role in the proper
development of the nervous system.
However, in terms of cancer it is of particular interest
that both Brn-3a and Brn-3b were isolated from a rodent
![Page 38: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/38.jpg)
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer
344
neuroblastoma cell line and were shown to be regulated
during its differentiation (Lillycrop et al, 1992). Similarly,
Brn-3a was also isolated independently (and named RDC-
1) as a factor which is expressed by Ewing's sarcomas
(Collum et al, 1992) and was subsequently shown to be
expressed in a number of aggressive neuroendocrine
tumours (Leblond-Francillard et al, 1997). Similarly, Brn-
3b was shown to be expressed by teratocarcinoma cell
lines and to be regulated during their differentiation
(Turner et al, 1994). These early expression studies led to
the suggestion that these factors may play a particularly
critical role in specific cancers (Chiarugi et al, 2002). In
this review, I will discuss detailed studies on a few tumour
cell types which indicate that this is indeed the case and
which demonstrate critical but contrasting roles for Brn-3a
and Brn-3b in different types of cancer.
II. Brn-3a and Brn-3b in
neuroblastomaAs indicated above, Brn-3a and Brn-3b were
originally isolated from a rodent neuroblastoma cell line
(Lillycrop et al, 1992). When these cells are induced to
differentiate from a dividing cell type to a non-dividing
cell bearing numerous neurite processes, the level of Brn-
3a was shown to increase dramatically, whilst the level of
Brn-3b decreased (Lillycrop et al, 1992; Budhram-
Mahadeo et al, 1994, 1995). A similar increase in Brn-3a
and decrease in Brn-3b was also noted when several
different human neuroblastoma cell lines were induced to
differentiate in culture (Smith and Latchman, 1996).
These expression studies were of particular interest
since Brn-3a and Brn-3b were shown to have antagonistic
effects on their target promoters. Thus, Brn-3a was able to
activate the promoters of genes encoding neuronal
differentiation markers such as SNAP-25 and the
neurofilaments, whereas Brn-3b repressed these promoters
and antagonised their activation by Brn-3a (Lakin et al,
1995; Smith et al, 1997c). This led to the idea that Brn-3a
may act to promote neuroblastoma differentiation by
inducing the activity of neuronal differentiation genes,
whilst Brn-3b opposes such an effect and promotes the
maintenance of the non-differentiated proliferative
phenotype.
This idea was directly proven by over-expressing
Brn-3a in neuroblastoma cells in the absence of a
differentiation stimulus. This resulted in the cells
activating neuronal specific genes and undergoing
differentiation to a process-bearing cell type (Smith et al,
1997b). Conversely, over-expression of Brn-3b in these
cells prevented neuronal differentiation even in response
to stimuli which would normally induce it (Smith et al,
1997a). Hence, Brn-3a can indeed promote the
differentiation of neuroblastoma cells whereas Brn-3b
opposes this effect and promotes their continued
proliferation.
Interestingly, the ability of full length Brn-3a to
activate neuronal-specific genes and induce differentiation
can be produced by the isolated POU domain, whereas
such effects are not observed with the POU domain of
Brn-3b which differs by only seven amino acids (Smith et
al, 1997b). The critical difference between Brn-3a and
Brn-3b resides at position 22 in the POU-homeodomain
(which is one of the two subdomains of the POU domain).
Thus, altering the valine found at this position in Brn-3a to
the isoleucine found in Brn-3b abolishes its ability to
activate neuronal-specific gene expression and induce
differentiation, whereas the converse change introducing a
valine into Brn-3b allows it to activate neuronal-specific
gene expression and induce differentiation, even though
only a single amino acid has been changed (Dawson et al,
1996; Smith et al, 1997b).
These studies indicate that a small difference
between Brn-3a and Brn-3b allows Brn-3a to act as an
inducer of differentiation in neuroblastoma cells, whereas
Brn-3b opposes this effect.
Although these findings were based on in vitro
studies of a rodent cell line, they have recently been
extended to a human neuroblastoma cell line using both in
vitro and in vivo techniques. Thus, overexpression of Brn-
3b in a human neuroblastoma cell line results in its
enhanced proliferation, whereas inhibition of Brn-3b
expression correspondingly leads to reduced proliferation.
Interestingly, overexpression of Brn-3b also results in the
increased ability of these human neuroblastoma cells to
show anchorage-independent growth in culture, as well as
demonstrating increased invasiveness based on their
ability to migrate through an artificial matrigel basement
membrane (Irshad et al, 2004). Most importantly, these
studies were also extended to the in vivo situation by
showing that the human neuroblastoma cells with
enhanced Brn-3b showed an increased ability to form
tumours when introduced into nude mice compared to
control cells, whereas the cells with reduced Brn-3b
showed a decreased ability to form tumours (Irshad et al,
2004). These results therefore, extend the initial findings
and indicate that Brn-3b appears to be a potent enhancer of
tumour growth and invasiveness
III. Brn-3a and Ewing's sarcomaAs noted above, Collum et al, (1992), observed
expression of Brn-3a (which they referred to as RDC-1) in
Ewing's sarcoma/primitive neuroectodermal tumour cells,
which like neuroblastomas are tumours derived from the
neuroendocrine lineage of neural crest cells (Kovar 1998;
da Alva and Gerald, 2000). These tumours are
characterised by rearrangement of the gene encoding the
EWS regulatory protein to form a fusion protein with a
member of the Ets family of transcription factors with the
resulting fusion protein acting as a strong transcriptional
regulator, which unlike either parental factor can produce
cellular transformation. In 85% of cases, the gene
rearrangement involves the production of a fusion protein
containing the N-terminal part of EWS linked to the C-
terminal portion of the Ets family transcription factor Fli-1
(Arvand and Denny, 2001; Ladanyi, 2002).
In view of the expression of Brn-3a in these tumours,
it is of particular interest that in a yeast two hybrid screen
for proteins which interact with Brn-3a, we isolated the
EWS protein and subsequently showed that Brn-3a can
![Page 39: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/39.jpg)
Gene Therapy and Molecular Biology Vol 8, page 345
345
interact with both EWS and its oncogenic derivative EWS-
Fli1 (Thomas and Latchman, 2002).
Most interestingly however, the interaction between
Brn-3a and EWS or EWS-Fli1 has different functional
effects. Thus, interaction of Brn-3a with EWS-Fli1
prevents Brn-3a from activating markers of neuronal
differentiation and inducing neurite outgrowth and also
inhibits its ability to activate the promoter of the p21 cell
cycle arrest gene and to induce cell cycle arrest (Gascoyne
et al, 2004) (Figure 1).
Figure 1 . Effect of EWS or EWS/Fli1 on the ability of Brn-3a to induce the SNAP-25 promoter (panel a), the endogenous SNAP-25
gene (panel b) and neurite outgrowth (panel c). Note the manner in which EWS/Fli1 but not EWS blocks the effect of Brn-3a. In panels
a and c, Brn-3a was introduced by transfection, in panel b endogenous Brn-3a expression was induced with differentiation medium.
![Page 40: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/40.jpg)
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer
346
In contrast, interaction with EWS does not inhibit these
effects of Brn-3a. Hence, the rearrangement which results
in the production of EWS-Fli1 produces a protein which is
able to inhibit the growth arrest and differentiation-
inducing properties of Brn-3a, thereby promoting tumour
cell growth.
Interestingly, Brn-3a in addition to its effect on
differentiation can also activate genes encoding anti-
apoptotic proteins such as Bcl-2 and Bcl-x and
correspondingly protect neuronal cells from apoptosis
(Smith et al, 1998b; Ensor et al, 2001). These effects,
unlike the effects on neuronal differentiation require an
additional N-terminal domain of Brn-3a (Smith et al,
1998a; 2001). Clearly, this anti-apoptotic effect of Brn-3a
has the potential to promote tumour cell survival and may
therefore be antagonistic to the effect inducing tumour cell
differentiation. Indeed, in an early study, Thiel et al,
(1993), reported that Brn-3a could co-operate with the Ras
oncogene to induce oncogenic transformation and that this
effect was dependent upon the presence of the N-terminal
domain.
In this regard, it is therefore of particular interest that
the interaction of Brn-3a with EWS and EWS-Fli1 appears
to affect the anti-apoptotic activity of Brn-3a differently
compared to its differentiation/growth arrest effect. Thus,
EWS but not EWS-Fli1 can prevent the activation of the
Bcl-2 and Bcl-x promoters by Brn-3a and inhibit its anti-
apoptotic effect (Thomas and Latchman, 2002; Gascoyne
et al, 2004).
Hence, the oncogenic rearrangement of EWS to
produce EWS-Fli1 releases the EWS-mediated block on
the anti-apoptotic effect of Brn-3a, thereby promoting
tumour cell survival, whilst simultaneously inhibiting its
growth arrest/differentiation-inducing effect, thereby
promoting tumour growth.
IV. Brn-3b in breast cancerAlthough Brn-3b can also interact with EWS and
EWS-Fli1, this interaction is much weaker than that with
Brn-3a and its functional significance in Ewing's sarcoma
is at present unclear (Gascoyne et al, 2004). Interestingly
however, a role for Brn-3b in breast cancer has been
defined and appears to be similar to that described above
for neuroblastoma.
Thus, human MCF-7 breast cancer cells which have
been engineered to overexpress Brn-3b, exhibit enhanced
proliferation and anchorage-independent growth, whereas
cells engineered to have reduced Brn-3b levels show
reduced growth and anchorage independence (Dennis et
al, 2001). Moreover, overexpression of Brn-3b in MCF-7
cells enhances their responsiveness to oestrogen which is
correspondingly reduced in the cells showing reduced Brn-
3b levels. This is in agreement with previous molecular
analysis which showed that Brn-3b can interact directly
with the oestrogen receptor via a protein-protein
interaction, which results in enhanced transcriptional
activity of the receptor (Budhram-Mahadeo et al, 1998).
These effects on a human breast cancer cell line in
culture are of particular interest since Brn-3b has also been
shown to be overexpressed in human mammary tumour
biopsies compared to its level in normal human mammary
gland tissue (Budhram-Mahadeo et al, 1999). In contrast,
no overexpression of Brn-3a was observed. Moreover,
expression of Brn-3b in the human breast cancer biopsies
correlates inversely with the expression of the BRCA-1
anti-oncogene. This suggests that Brn-3b may repress
expression of the BRCA-1 anti-oncogene in sporadic
cancers, producing the same effect as the mutation of this
anti-oncogene which occurs in inherited breast cancer. In
agreement with this idea, Brn-3b can repress the BRCA-1
promoter in co-transfection experiments (Dennis et al,
2001).
To further probe the way in which Brn-3b can alter
breast cancer cell growth, we also carried out a
transcriptomic/gene chip screen to identify novel genes
whose expression was altered in Brn-3b overexpressing
breast cancer cells compared to cells with reduced
expression. This resulted in the identification of a number
of different genes whose expression is either increased or
decreased in breast cancer cells, when Brn-3b expression
is altered (Samady et al, 2004) (Table 1). Most
interestingly, one of these encodes the cyclin-dependent
kinase 4 (CDK4) which plays a critical role in stimulating
cellular growth. Following the initial identification of
CDK4 as a putative target gene for Brn-3b, we were able
to demonstrate that expression of CDK4 correlates
positively with Brn-3b expression in breast cancer biopsy
material and that Brn-3b can activate the CDK4 promoter
(Samady et al, 2004)
As well as demonstrating that Brn-3b is likely to play
a stimulatory role in breast cancer as well as in
neuroblastoma, these experiments demonstrate the variety
of mechanisms by which Brn-3b may act to achieve this
effect. Thus, it appears that Brn-3b can repress the
expression of the anti-oncogenic protein BRCA-1, whilst
stimulating the transcription of the gene encoding the
growth-promoting CDK4 protein and interacting with the
oestrogen receptor to stimulate its transcriptional
activating ability.
V. Brn-3a in cervical cancerThe studies described so far, have indicated a strong
stimulatory role for Brn-3b in both breast cancer and
neuroblastoma. Conversely, Brn-3a expression is
unchanged in breast cancer and appears to have a
predominantly anti-oncogenic role in both neuroblastoma
and Ewing's sarcoma.
At first sight therefore, it is perhaps surprising that human
cervical biopsies demonstrate a 300-fold elevation in Brn-
3a expression in cervical intra-epithelial neoplasia Type 3
(CIN3) compared to normal biopsies from women with a
normal cervix (Ndisang et al, 1998). In contrast, no
difference is observed between Brn-3b levels in CIN3 and
normal cervix. This paradox is explained by the fact that
Brn-3a but not Brn-3b can activate the upstream
regulatory region of human papilloma viruses Types 16
and 18 (HPV-16 and HPV-18), which controls the
production of the oncogenic E6 and E7 proteins (Morris et
al, 1994).
In agreement with the idea that Brn-3a acts in
cervical cells via stimulating HPV oncogene expression,
overexpression of Brn-3a in cervical cell lines containing
![Page 41: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/41.jpg)
Gene Therapy and Molecular Biology Vol 8, page 347
347
HPV enhances their expression of HPV E6 protein,
stimulates their cellular growth and their ability to grow in
an anchorage-independent manner, whereas none of these
effects are observed when Brn-3a is over-expressed in
cervical cell lines which do not contain HPV
genomes(Ndisang et al, 1999). Most importantly, cervical
cells engineered to have reduced levels of Brn-3a not only
exhibit reduced E6 expression and cellular growth in
culture, but also show a decreased ability to form tumours
in nude mice, demonstrating that Brn-3a is important for
tumour growth in vivo (Ndisang et al, 2001).
Table 1. Genes showing altered expression in MCF-7 cells over expressing Brn-3b compared to those with reduced levels
of Brn-3b
Ratio
Up Down Gene
8.3
2.1
1.7
2.3
1.7
2.4
2.0
1.8
3.5
c-jun proto-oncogene; transcription factor AP-1
Interferon-inducible protein 9-27
c-myc oncogene
c-myc binding protein MM-1
cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4);
PSK-J3
cyclin-dependent kinase inhibitor 1 (CDKN1A); melanoma
differentiation-associated protein 6 (MDA6); CDK-interacting protein
1 (CIP1); WAF1
cyclin-dependent kinase regulatory subunit 1 (CKS1)
cdc2-related protein kinase PISSLRE
G1 to S phase transition protein 1 homologue; GTP-binding protein
GST1-HS
1.9
1.7
1.7
1.7
2.1
13.7
4.5
ADP/ATP carrier protein
protein phosphatase 2C gamma
rhoC (H9); small GTPase (rhoC)
B-cell receptor-associated protein (hBAP)
zyxin + zyxin-2
c-jun N-terminal kinase 2 (JNK2); JNK55
junction plakoglobin (JUP); desmoplakin III (DP3)
1.9
2.4
8.0
5.6
8.3
2.0
DNA ligase 1; polydeoxyribonucleotide synthase (ATP) (DNL1)
(LIG1)
tumour necrosis factor type 1 receptor associated protein (TRAP1)
TIS11B protein, EGF response factor (ERF1)
early growth response protein 1 (hEGR1); transcription factor
ETR103; KROX24; zinc finger protein 225; AT225
fuse-binding protein 2 (FBP2)
transcription factor erf-1; AP2 gamma transcription factor
2.0
1.9
2.1
3.4
2.3
integrin beta 4 (ITG84); CD104 antigen
high mobility group protein HMG2
paxillin
alpha 1 catenin (CTNNA1); cadherin-associated protein; alpha E-
catenin
glutathione-S-transferase (GST) homologue
1.8
5.5
2.0
2.0
78-kDa glucose regulated protein precursor (GRP 78);
immunoglobulin heavy chain binding protein (BIP)
cathepsin D precursor (CTSD)
interleukin-1 beta precursor (IL-1; IL1B); catabolin
macrophage migration inhibitory factor (MIF); glycosylation-inhibiting
factor (GIF)
2.6
1.8
2.1
3.9
1.7
1.8
3.5
60S ribosomal protein L5
ornithine decarboxylase
PM5 protein
suppressor for yeast mutant
type 11 cycloskeletal 2 epidermal keratin (KRT2E);cytokeratin 2E
(K2E;CK2E)
glycyl tRNA synthetase
aminoacylase 1 (ACY1)
![Page 42: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/42.jpg)
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer
348
Table 2. Brn-3a and E-6 levels in Pap smears from patients categorised on the basis of the histological diagnosis
Category Count (No =) Percentage Brn-3a
mean value
E-6
mean value
Negative
LGSIL
(HPV-CIN1)
HGSIL
(CIN2-CIN3)
Cancer
74
83
79
2
31%
35%
33%
1%
0.201
0.259
0.438
0.575
0125
0.231
0.358
0.475
Total 238 100% - -
Hence, Brn-3a appears to be of importance as a
cellular factor which is required to stimulate HPV gene
expression and hence produce oncogenic transformation
following initial infection with HPV-16 or HPV-18.
Interestingly, Brn-3a levels are also elevated in biopsies
from women with CIN3 when the biopsy is taken from a
normal region of the cervix (Ndisang et al, 1998; 2000).
This suggests therefore, that Brn-3a is not specifically
elevated in the tumour cells. Rather, it may be elevated in
a subset of women for genetic or environmental reasons
and that such women are at enhanced risk of tumour
formation following initial infection with HPV. This is of
particular importance since the vast majority of women
clear HPV infections and do not progress to tumour
formation.
Although our initial studies on Brn-3a expression
were conducted on cervical biopsies, we have recently
been able to measure Brn-3a in routinely taken cervical
smear samples (Sindos et al, 2003b). As elevated levels of
Brn-3a in the smear correlate with the presence of cervical
abnormality as determined by subsequent histological
analysis (Table 2), its measurement may represent an
additional test which could be used to confirm the results
of cytological examination and determine the need for
further action. Moreover, Brn-3a levels are elevated in
cervical smears from women with persistent minor smear
abnormalities who were subsequently found by
histological examination to have CIN2/3 compared to
those with CIN1 or no abnormality (Sindos et al, 2003a).
This suggests that Brn-3a could be used as a marker for
women who require detailed follow-up in this situation
since they would be predicted to be at enhanced risk of
disease-progression. Hence, as well as playing a critical
role in the development of cervical tumours, Brn-3a may
represent a novel prognostic and diagnostic marker of the
disease.
VI. ConclusionThe studies described above have characterised the
role of Brn-3a and Brn-3b in several different tumours.
They have indicated that Brn-3b plays a stimulatory role in
tumours such as neuroblastoma and breast cancer, whilst
Brn-3a may have an anti-oncogenic role in neuroblastoma
and Ewing's sarcoma but is involved in the development of
cervical cancer, via its ability to activate human papilloma
virus gene expression.
These findings suggest that it would be worthwhile to
investigate the role of Brn-3 factors in other types of
tumour. This is particularly so in view of recent findings
using gene chip analysis which have suggested that Brn-3a
is specifically overexpressed in leukaemias with the
t(8;21) translocation (Schoch et al, 2002; Debernardi et al,
2003). Similarly, it is of interest that the gene encoding
Brn-3b has recently been shown to be activated by the
Wilms' tumour suppressor protein WT-1 (Wagner et al,
2003), whilst Brn-3c has been shown to be overexpressed
in Merkel cell carcinoma (Lennard et al, 2002). The
characterisation of the role of Brn-3a, Brn-3b and Brn-3c
in different types of tumours is likely therefore to require
considerably more effort. It is already clear however, in
the case of Brn-3a and Brn-3b that both these factors play
a critical role in specific types of human cancer where
their expression is altered.
AcknowledgementsI thank the Association for International Cancer
Research, the BBSRC, Cancer Research U.K. and the
Medical Research Council for supporting the work of my
laboratory on Brn-3a and Brn-3b.
ReferencesArvand A, Denny CT (2001) Biology of EWS/ETS fusions in
Ewing's family tumors. Oncogene 20, 5747-54.
Budhram-Mahadeo V, Lillycrop KA, Latchman DS (1995) The
levels of the antagonistic POU family transcription factors
Brn-3a and Brn-3b in neuronal cells are regulated in opposite
directions by serum growth factors. Neurosci Lett 185, 48-
51
Budhram-Mahadeo VS, Ndisang D, Ward T, Weber BL and
Latchman DS (1999) The Brn-3b POU family transcription
factor represses expression of the BRCA-1 anti-oncogene in
breast cancer cells. Oncogene 18, 6684-6691.
![Page 43: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/43.jpg)
Gene Therapy and Molecular Biology Vol 8, page 349
349
Budhram-Mahadeo VS, Parker M and Latchman DS (1998) The
POU Domain factors Brn-3a and Brn-3b interact with the
estrogen receptor and differentially regulate transcriptional
activity via an ERE. Mol Cell Biol 18, 1029-1041.
Budhram-Mahadeo VS, Theil T, Morris PJ, Lillycrop KA,
Möröy T and Latchman DS (1994) The DNA target site for
the Brn-3 POU family transcription factors can confer
responsiveness to cyclic AMP and removal of serum in
neuronal cells. Nucleic Acids Res 22, 3092-3098.
Chiarugi V, Del Rosso M and Magnelli L (2002) Brn-3a, a
neuronal transcription factor of the POU gene family,
indications for its involvement in cancer and angiogenesis.
Mol Biotechnol 22, 123-127.
Collum RG, Fisher PE, Datta M, Mellis S, Thiele C, Huebner K,
Croce CM, Israel MA, Theil T, Möröy, T, DePinho R and
Alt FW (1992) A novel POU homeodomain gene specifically
expressed in cells of the developing nervous system. Nucleic
Acids Res 20, 4919-4925.
Dawson SJ, Morris PJ, Latchman DS (1996) A single amino acid
change converts an inhibitory transcription factor into an
activator. J Biol Chem 271, 11631-11633.
de Alava E, Gerald WL (2000) Molecular biology of the Ewing's
sarcoma/Primitive neuroectodermal tumor family. J Clin
Oncol 18, 204-213.
Debernardi S, Lillington DM, Chaplin T, Tomlinson S, Amess J,
Rohatiner A, Lister TA, Young BD (2003) Genome-wide
analysis of acute myeloid leukemia with normal karyotype
reveals a unique pattern of homeobox gene expression
distinct from those with translocation-mediated fusion
events. Genes Chromosomes Cancer 37, 149-158.
Dennis JH, Budhram-Mahadeo V, Latchman DS (2001) The Brn-
3b POU family transcription factor regulates the cellular
growth, proliferation and anchorage dependence of human
breast cancer cells. Oncogene 20, 4961-4971.
Ensor E, Smith MD, Latchman DS (2001) The Brn-3a
transcription factor protects sensory but not sympathetic
neurones from programmed cell death/apoptosis. J Biol
Chem 276, 5204-5212.
Erkman L, McEvilly RJ, Luo L, Ryan AK, Hooshmand F,
O'Connell SM, Keithley EM, Rapaport DH, Ryan AF,
Rosenfeld MG (1996) Role of transcription factors Brn-3.1
and Brn-3.2 in auditory and visual system development.
Nature 381, 603-606..
Gascoyne DM, Thomas GR, Latchman DS (2004) The effects of
Brn-3a on neuronal differentiation and apoptosis are
differentially modulated by EWS and its oncogenic
derivative EWS/Fli-1. Oncogene 23, 3830-3840.
He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW,
Rosenfeld MG (1989) Expression of a large family of POU-
domain regulatory genes in mammalian brain development.
Nature 340, 35-42.
Herr W, Sturm RA, Clerc RG, Corcoran LM, Baltimore D, Sharp
PA, Ingraham HA, Rosenfeld MG, Finney M, Ruvkun G, et
al (1988) The POU domain, a large conserved region in the
mammalian pit-1 Oct-1 Oct-2 and Caenorhabditis elegans
Unc-86 gene products. Genes Dev 2, 1513-1516.
Irshad S, Pedley RB, Anderson J, Latchman DS, Budhram-
Mahadeo V (2004) The Brn-3b transcription factor regulates
the growth, behaviour and invasiveness of human
neuroblastoma cells in vitro and in vivo . J Biol Chem 279,
21617-21627.
Kovar H (1998) Ewing's sarcoma and peripheral primitive
neuroectodermal tumours after their genetic union. Curr
Opin Oncol 10, 334-342.
Ladanyi M (2002) EWS-FLI1 and Ewing's sarcoma. Cancer
Biol Ther 1, 330-336.
Lakin ND, Morris PJ, Theil T, Sato TN, Moroy T, Wilson MC,
Latchman DS (1995) Regulation of neurite outgrowth and
SNAP-25 gene expression by the Brn-3a transcription factor.
J Biol Chem 270, 15858-15863.
Latchman DS (1999) POU Family transcription factors in the
nervous system. J Cell Physiol 179, 126-133.
Leblond-Francillard M, Picon A, Bertagna X, de Keyzer Y
(1997) High Expression of the POU Factor Brn3a in
Aggressive Neuroendocrine Tumors. J Clin Endocrinol
Metab 82, 89-94.
Leonard JH, Cook AL, Van Gele M, Boyle GM, Inglis KJ,
Speleman F, Sturm RA (2002) Proneural and
proneuroendocrine transcription factor expression in
cutaneous mechanoreceptor (Merkel) cells and Merkel cell
carcinoma. Int J Cancer 101, 103-110.
Lillycrop KA, Budrahan VS, Lakin ND, Terrenghi G, Wood JN,
Polak JM, Latchman DS (1992) A novel POU family
transcription factor is closely related to Brn-3 but has a
distinct expression pattern in neuronal cells. Nucleic Acids
Res 20, 5093-5096.
McEvilly RJ, Erkman L, Luo L, Sawchenko PE, Ryan AF,
Rosenfeld MG (1996) Requirement for Brn-3.0 in
differentiation and survival of sensory and motor neurons.
Nature 384, 574-577.
Morris PJ, Theil T, Ring CJ, Lillycrop KA, Möröy T, Latchman
DS (1994) The opposite and antagonistic effects of the
closely related POU family transcription factors on the
activity of a target promoter are dependent upon differences
in the POU domain. Mol Cell Biol 14, 6907-6914.
Ndisang D, Budhram-Mahadeo V, Latchman DS (1999) The
Brn-3a transcription factor plays a critical role in regulating
HPV gene expression and determining the growth
characteristics of cervical cancer cells. J Biol Chem 274,
28521-28527.
Ndisang D, Budhram-Mahadeo V, Singer A, Latchman DS
(2000) Widespread elevated expression of the HPV-
activating cellular transcription factor Brn-3a in the cervix of
women with CIN3. Clin Sci (Lond) 98, 601-602.
Ndisang D, Budhram-Mahadeo V, Pedley B, Latchman DS
(2001) The Brn-3a transcription factor plays a key role in
regulating the growth of cervical cancer cells in vivo.
Oncogene 20, 4899-4903.
Ndisdang D, Morris PJ, Chapman C, Ho L, Singer A, Latchman
DS (1998) The HPV-activating cellular transcription factor
Brn-3a is overexpressed in CIN3 cervical lesions. J Clin
Invest 101, 1687-1692.
Ninkina NN, Stevens GE, Wood JN, Richardson WD (1993) A
novel Brn3-like POU transcription factor expressed in
subsets of rat sensory and spinal cord neurons. Nucleic Acids
Res 21, 3175-3182.
Ring CJ, Latchman DS (1993) The human Brn-3b POU
transcription factor shows only limited homology to the Brn-
3a/RDC-1 factor outside the conserved POU domain.
Nucleic Acids Res 21, 2946.
Ryan AK and Rosenfeld MG (1997) POU domain family
values,- flexibility, partnerships and developmental codes.
Genes and Development 11, 1207-1225.
Samady L, Dennis J, Budhram-Mahadeo V, Latchman DS (2004)
Activation of CDK4 gene expression in human breast cancer
cells by the Brn-3b POU family transcription factor. Cancer
Biol Ther 3, 317-323.
Schoch C, Kohlmann A, Schnittger S, Brors B, Dugas M,
Mergenthaler S, Kern W, Hiddemann W, Eils R, Haferlach T
(2002) Acute myeloid leukemias with reciprocal
rearrangements can be distinguished by specific gene
expression profiles. Proc Natl Acad Sci U S A. 99, 10008-
10013.
Sindos M, Ndisang D, Pisal N, Chow C, Deery A, Singer A,
Latchman D (2003a) Detection of cervical neoplasia using
![Page 44: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/44.jpg)
Latchman: Role of the Brn-3a and Brn-3b POU family transcription factors in cancer
350
measurement of Brn-3a in cervical smears with persistent
minor abnormalities. Int J Gynecol Cancer.13, 515-517.
Sindos M, Ndisang D, Pisal N, Chow C, Singer A, Latchman DS
(2003b) Measurement of Brn-3a levels in Pap smears
provides a novel diagnostic marker for the detection of
cervical neoplasia. Gynecol Oncol 90, 366-371.
Smith MD, Latchman DS (1996) The functionally antagonistic
POU family transcription factors Brn-3a and Brn-3b show
opposite changes in expression during the growth arrest and
differentiation of human neuroblastoma cells. Int J Cancer
67, 653-660.
Smith MD, Dawson SJ, Latchman DS (1997a) Inhibition of
neuronal process outgrowth and neuronal specific gene
activation by the Brn-3b transcription factor. J Biol Chem
272, 1382-1388.
Smith MD, Dawson SJ, Latchman DS (1997b) The Brn-3a
transcription factor induces neuronal process outgrowth and
the co-ordinate expression of genes encoding synaptic
proteins. Mol Cell Biol 17, 345-354.
Smith MD, Dawson SJ, Boxer LM, Latchman DS (1998a) The
N-terminal domain unique to the long form of the Brn-3a
transcription factor is essential to protect neuronal cells from
apoptosis and for the activation of Bcl-2 gene expression.
Nucleic Acids Res 26, 4100-4107.
Smith MD, Ensor EA, Coffin RS, Boxer LM, Latchman DS
(1998b) Bcl-2 transcription from the proximal P2 promoter is
activated in neuronal cells by the Brn-3a POU transcription
factor. J Biol Chem 273, 16715-16722.
Smith MD, Melton LA, Ensor EA, Packham G, Anderson P,
Kinloch RA, Latchman DS (2001) Brn-3a activates the
expression of Bcl-X L and promotes neuronal survival in vivo
as well as in vitro. Mol Cell Neurosci. 17, 460-470.
Smith MD, Morris PJ, Dawson SJ, Schwartz ML, Schlaepfer
WW, Latchman DS (1997c) Co-ordinate induction of the
three neurofilament genes by the Brn-3a transcription factor.
J Biol Chem 272, 21325-21333.
Theil T, McLean-Hunter S, Zornig M and Möröy, T (1993)
Mouse Brn-3 family of POU transcription factors, a new
amino terminal domain is crucial for the oncogenic activity
of Brn-3A. Nucleic Acids Res 21, 5921-5929.
Thomas GR, Latchman DS (2002) The pro-oncoprotein EWS
(Ewing's sarcoma protein) interacts with the Brn-3a
transcription factor and inhibits its ability to activate
transcription. Cancer Biol Ther. 1, 428-432.
Verrijzer CP and Van der Vliet PC (1993) POU domain
transcription factors. Biochimica et Biophysica Acta 1173, 1-
21.
Wagner KD, Wagner N, Schley G, Theres H, Scholz H (2003)
The Wilms' tumour suppressor Wt1 encodes a transcriptional
activator of the class IV POU-domain factor Pou4f2 (Brn-
3b). Gene 305, 217-223.
Xiang M, Gan L, Li D, Chen ZY, Zhou L, O'Malley BW Jr,
Klein W, Nathans J (1997) Essential role of POU domain
factor Brn-3c in auditory and vestibular hair cell
development. Proc Natl Acad Sci U S A 94, 9445-9450.
Xiang M, Gan L, Zhou L, Klein WH, Nathans J (1996) Targeted
deletion of the mouse POU domain gene Brn-3a causes a
selective loss of neurons in the brainstem and trigeminal
ganglion, uncoordinated limb movement and impaired
suckling. Proc Natl Acad Sci U S A 93, 11950-11955.
Prof. David S. Latchman
![Page 45: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/45.jpg)
Gene Therapy and Molecular Biology Vol 8, page 351
351
Gene Ther Mol Biol Vol 8, 351-360, 2004
Angiogenic gene therapy in the treatment of
ischemic cardiovascular diseasesReview Article
Tamer A. Malik, Cesario Bianchi, Frank W. SellkeBeth Israel Deaconess Medical Center, Boston, MA 02215, USA
__________________________________________________________________________________
*Correspondence: Tamer A. Malik, Beth Israel Deaconess Medical Center, Boston, MA 02215, 330 Brookline Ave, East Campus,
Dana Building, Room 881; Tel: 617-667-1853/617-632-8385; Fax 617-975-5562; Email: [email protected],
Key words: VEGF, FGF, HGF, Retrovirus, Adenovirus, Adeno-associated virus, Plasmids, Liposomes, MRI, AGENT trials, VEGF
trials
Abbreviations: basic fibroblast growth factor, (!-FGF); complementary DNA, (cDNA); coronary artery bypass grafting, (CABG);
coronary artery disease, (CAD); cytomegalovirus, (CMV); electromechanical mapping, (EMM); extracellular matrix, (ECM); fibroblast
growth factor-4, (FGF-4); hepatocyte growth factor, (HGF), herpes simplex virus, (HSV); interventional MRI, (iMRI); kilobases, (kb);
left ventricular, (LV); magnetic resonance imaging, (MRI); percutaneous transmural coronary angioplasty, (PTCA); peripheral vascular
disease, (PAD); human immunodeficiency virus, (HIV); tumor necrosis factor alpha, (TNF-").
Received: 11 June 2004; Accepted: 30 July 2004; electronically published: July 2004
Summary
Encouraging preliminary data suggest that gene therapy may soon be an option for the treatment of patients with
advanced coronary artery disease that is not amenable to conventional treatment. A critical consideration in
developing cardiovascular gene transfer as a therapy is the ability to deliver the vector, viral or plasmid, to the
desired tissue in a safe fashion. Attempts at developing non-viral direct DNA therapy delivered through the
intravenous route are currently underway and with the use of advanced technology the possibility of making gene
therapy a simple outpatient procedure does not seem out of the realm of possibility. Several clinical trials are
currently underway that should help characterize the risk–benefit profile of various products, the optimal dose that
should be administered, and the patient population likely to derive greatest benefit.
I. IntroductionGene therapy is most often defined as the transfer of
nucleic materials to the somatic cells of an individual to
elicit a beneficial therapeutic effect. A transferred gene
can be targeted to specific tissues, organs or to the entire
body. The potential advantage of gene therapy over drug
administration is the single administration with long
lasting beneficial results and minimal systemic toxicity.
There are a couple of techniques that need to be developed
for the success of gene therapy namely; the isolation and
cloning of the desired therapeutic genes, the vectors which
are the vehicle for these genes and finally delivery of gene
to target tissues. The proposed mechanisms of action of
gene therapy are replacement of non-functional genes with
functional counterparts, correction of a defective gene,
enhancement of normal gene expression and restriction of
the expression of certain genes (Clowes et al, 1997).
The two types of gene delivery for therapy are the ex
vivo where the cells to be transfected by the gene are
cultured outside the body under a controlled environment
and then re-introduced back into the body and the in vivo
where the genetic material is directly delivered into the
body affecting the desired the cells. Gene therapy is
evolving as a new therapeutic alternative for the treatment
of patients with advanced coronary artery disease (CAD)
not amenable to bypass surgery or catheter based
interventions.
II. Development of vectorsThe transfer of plain DNA known as “naked” DNA
directly into the body has yielded less than satisfactory
results owing to the fact that only a small fraction of
transferred DNA enters the cell and once inside is
subjected to destruction by the cytoplasmic enzymes.
Therefore, mechanisms of facilitating DNA entry into
cells were developed, namely through the use of vectors,
which are vehicles carrying the genetic material to the
target tissues or cells. The ideal vector would be the one
that delivers genetic material efficiently to target tissue
producing the desired level of gene expression with
minimal systemic and local adverse effects and for the
specified duration of time. To fit all these characteristics in
one vector is challenging and has not been completely
successful. The vectors used in cardiovascular gene
![Page 46: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/46.jpg)
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
352
therapy, as well as gene therapies directed at other
diseases, include viral vectors, such as retroviruses,
adenoviruses and adeno-associated viruses, and nonviral
vectors, such as polymers, cationic liposomes, and
liposome-viral conjugates. In order to develop clinical
gene therapy strategies, a clear understanding of the
advantages and shortcomings of current vector systems is
mandatory (Zuckerbraun et al, 2002) (Figure 1).
A. Viral vectors
For delivery of the genetic load into cells, viral
vectors first must attach to the cell membrane through
binding proteins, then fuse with the cell membrane
injecting their genetic material into the cytoplasm. The
viruses’ capability to replicate in the host cell is annulled
by removing certain genes and replacing them with the
desired genes to be incorporated into the host’s genome.
1. Retrovirus
This is a class of viruses that have a lipid envelope
containing a single stranded RNA genome. Once the virus
transfects a cell and enters the cytoplasm, the viral genome
is reverse transcribed into double stranded DNA, which
integrates into the host genome [called complementary
DNA (cDNA)] and is further expressed as proteins
(Figure 2, 3).
Figure 1. The vector gets internalized into the cell and releases its nucleic acids (containing transgene). The nucleic acids are
translocated into the nucleus, where they may remain distinct or become incorporated into the host DNA. Vector (transgene) messenger
RNA (mRNA) is transcribed in the nucleus then translated by ribosomal complexes in the cytoplasm to yield the final transgene protein
product. It is the over expression of this protein that is intended to be of therapeutic value. Reproduced from Zuckerbraun and Tzeng,
2002 with kind permission from Archives of Surgery.
Figure 2. From The Online Biology
Book hosted by Estrella Mountain
Community College Website, in
Sunny Avondale, Arizona: Biological
Diversity: Viruses (revised 6/18/01).
![Page 47: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/47.jpg)
Gene Therapy and Molecular Biology Vol 8, page 353
353
The viral genome is approximately 10 kilobases (kb),
containing mainly these three genes: gag (coding for core
proteins), pol (coding for reverse transcriptase) and env
(coding for the viral envelope protein), which are replaced
with the transgene of interest (Figure 3) (Nabel, 1989,
1990). Retroviruses have the advantage of longer periods
of gene expression with relatively minimal stimulation of
the immune system and no local inflammatory reactions.
But they attack only proliferating cells with a large
variety of cells as a target, which explains why they can’t
be used in in-vivo gene therapy. If the viruses are
delivered directly into the body they will be neutralized
immediately by the complement system and also the
desired target cells are not necessarily in the proliferation
phase. The cells desired to undergo the genetic
modification are removed from the body and are cultured
under controlled conditions then re-transplanted into the
body after being transfected by the virus. The retrovirus
genome is easily manipulated and replication-deficient
retroviruses can hold large transgenes, measuring up to 8
kb (Figure 3). Retroviruses theoretically can cause genetic
mutations due to the incorporation of an unfamiliar genetic
material in the cell’s genome. Major limitations to the use
of retroviruses are their low titers (number of virus
particles proportional to the gene transfer efficiency) but
the development of new retroviruses increased the virus
titers with more efficient gene transfer (Weiss et al, 1984;
Flugelman et al, 1992). Transfecting endothelial cells with
retroviruses to be implanted into vascular stents, grafts or
injured arteries for a desired therapeutic effect have been
studied.
Lentiviruses are a class of retrovirus but unlike
retroviruses they can infect non-proliferating, terminally
differentiated cells. These advantages of stable gene
expression in non-dividing cells with minimal
immunogenicity could be promising for gene therapy in
the cardiovascular system. The human immunodeficiency
virus (HIV) is a member of this family and, as may be
expected, there are some concerns about the possible
mutation of these recombinant viruses back to a
pathogenic phenotype. The use of lentiviruses for gene
therapy is on the horizon, and they may be the preferred
vectors of the future.
2. AdenovirusesAdenoviruses are non-enveloped viruses with
double-stranded DNA genomes that cause respiratory,
intestinal, and eye infections in humans. The virus that
causes the common cold is an adenovirus. The virion is
spherical and about 70 to 90 nm in size. The genome
encodes about thirty proteins and both strands of the DNA
encode genes. Some regions of the DNA have to be
removed in order to render the virus non-proliferative
(Figure 4).
Adenoviruses do not incorporate in the host’s
genome thereby do not cause mutations. This also explains
its short duration of action which is usually for 1 or 2
weeks added to the fact that most people in their lifetime
have had a natural adenovirus infection thereby evoking
an immune response, both at the cellular and humoral
levels, against future encounters with the virus. This short
duration of action could be seen as a shortcoming in the
treatment of chronic diseases and an advantage in the
treatment of diseases where a temporary action is required.
Figure 3. From the Department of Microbiology & Immunology, University of Leicester, UK. MBChB Special Study Module Project
Report about Virus Vectors & Gene Therapy Problems, Promises & Prospects by David Peel 1998
![Page 48: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/48.jpg)
Gene Therapy and Molecular Biology Vol 8, page 359
359
Mack CA, Patel SR, Schwarz EA, et al. (1998) Biologic bypass
with the use of adenovirus-mediated gene transfer of the
complementary deoxyribonucleic acid for vascular
endothelial growth factor 121 improves myocardial perfusion
and function in the ischemic porcine heart. J Thorac
Cardiovasc Surg 115, 168-176.
Morishita R, Gibbons GH, Ellison KE, et al. (1994) Intimal
hyperplasia after vascular injury is inhibited by antisense
CDK 2 kinase oligonucleotides. J Clin Invest. 93, 1458-
1464.
Nabel EG, Nabel GJ. (1999) Genetic therapies for cardiovascular
disease. In, Topol EJ, ed. Textbook of Interventional
Cardiology. 3rd ed. Philadelphia, Pa, WB Saunders Co.
Nabel EG, Plautz G, Boyce FM, Stanley JC, Nabel GJ. (1989)
Recombinant gene expression in vivo within endothelial cells
of the arterial wall. Science 244, 1342-1344.
Nabel EG, Plautz G, Nabel GJ. (1990) Site-specific gene
expression in vivo by direct gene transfer into the arterial
wall. Science. 249, 1285-1288.
Rosengart TK, Lee LY, Patel SR, et al. (1999a) Angiogenesis
gene therapy, phase I assessment of direct intramyocardial
administration of an adenovirus vector expressing VEGF121
cDNA to individuals with clinically significant severe
coronary artery disease. Circulation 100, 468-474.
Rosengart TK, Lee LY, Patel SR, et al. (1999b) Six-month
assessment of a phase I trial of angiogenic gene therapy for
the treatment of coronary artery disease using direct
intramyocardial administration of an adenovirus vector
expressing the VEGF121 cDNA. Ann Surg 230, 466-470.
Ruel M, Sellke FW. (2003) Angiogenic protein therapy. Semin
Thorac Cardiovasc Surg Jul 15, 222-35.
Schiedner G, Morral N, Parks RJ, et al. (1998) Genomic DNA
transfer with a high-capacity adenovirus vector results in
improved in vivo gene expression and decreased toxicity.
Nat Genet 18, 180-183.
Sellke FW, Ruel M, (2003) Vascular growth factors and
angiogenesis in cardiac surgery. Ann Thorac Surg 75,
S685-90.
Sleight P (2003) Current options in the management of coronary
artery disease. Am J Cardiol 92, 4N-8N.
Summerford C, Samulski RJ. (1998) Membrane-associated
heparan sulfate proteoglycan is a receptor for adeno-
associated virus type 2 virions. J Virol 72, 1438-1445.
Taniyama Y, Morishita R, Aoki M et al. (2002) Angiogenic and
antifibrotic action of hepatocyte growth factor in
cardiomyopathy. Hypertension 40, 47-53.
Ueda H, Sawa Y, Matsumoto K, et al. (1999) Gene transfection
of hepatocyte growth factor attenuates reperfusion injury in
the heart. Ann Thorac Surg 67, 1726-1731.
Vale PR, Losordo DW, Milliken CE, et al. (2000) Left
ventricular electromechanical mapping to assess efficacy of
phVEGF165 gene transfer for therapeutic angiogenesis in
chronic myocardial ischemia. Circulation 102, 965-974.
Von der Leyen HE, Gibbons GH, Morishita R, et al. (1995) Gene
therapy inhibiting neointimal vascular lesion, in vivo transfer
of endothelial cell nitric oxide synthase gene. Proc Natl
Acad Sci U S A. 92, 1137-1141.
Weiss RA, Teich NM, Varmus HE, Coffin JM, eds. RNA Tumor
Viruses. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory Press 1984. Cold Spring Harbor Monograph
Series 10C, pt 1.
Wolf C, Cai WJ, Vosschulte R, Koltai S, Mousavipour D, Scholz
D, Afsah-Hedjri A, Schaper W, Schaper J. (1998) Vascular
remodeling and altered protein expression during growth of
coronary collateral arteries. J Mol Cell Cardiol 30, 2291-
2305
![Page 49: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/49.jpg)
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
360
![Page 50: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/50.jpg)
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
354
Figure 4. Adenoviruses are non-enveloped icosahedral particles.
The capsid is built up from 252 capsomers of which 240 are
hexavalent and 12 (situated at the apices) are pentavalent. From
the Department of Medical Microbiology Website, University of
Cape Town, written by Linda M Stannard, 1995. Virus Ultra
Structure
Unlike retroviruses, adenoviruses can be used in in
vivo, infecting replicating and non-replicating cells
equally. They also have high transduction efficiencies with
high levels of gene expression (Horwitz, 1990; Clemens et
al, 1996). Adenoviruses induce a local inflammatory
response and have a large complex genome making it
difficult to manipulate (Kochanek et al, 1996; Schiedner et
al, 1998).
So several strategies have been developed to improve
the use of adenoviruses, and researchers are creating what
is called a “gutless” adenovirus that is devoid of all its
native genetic material. It has been shown that this new
virus causes less stimulation of the immune system with a
longer duration of action and the ability to use larger
transgenes (Kibbe et al, 2000; Fisher et al, 2001).
3. Adeno-associated viruses (AAVs)These are small DNA viruses that integrate
successfully in one spot of the host’s genome (on
chromosome 19 in humans). They can’t replicate by
themselves and therefore require a helper virus, either
adenovirus or herpes virus. Also they are non-pathogenic
in humans, do not cause mutations and once integrated are
stable leading to long term genetic expression which
makes AAV an attractive tool for the management of
chronic diseases from single gene mutation as well as
acquired disorders, such as atherosclerosis (Summerford
and Samulski, 1998). Other advantages of AAVs are that
proliferating cells are not a requirement for transfection, it
is relatively non-immunogenic, and the genome is small
and easy to manipulate. A disadvantage of the small AAV
genome is that the transferred genetic material is limited in
size to a maximum of 4.9kb. It is challenging to produce
this vector in large amounts without delivering an equally
large amount of the contaminating helper virus. These
problems with AAV production will soon be overcome,
and it is becoming a very attractive vector for human gene
therapy (Cheung et al, 1980; Jolly, 1994) (Figure 5).
4. OthersSeveral others viruses have been used experimentally
for gene transfer namely; Herpes Simplex Virus (HSV),
Pertussis Virus, Cytomegalovirus (CMV).
B. Non viral vectorsA plasmid is an autonomous, circular, self-replicating
and an extra-chromosomal DNA molecule that carries
only a few genes and has a single origin of replication.
Some plasmids can be inserted into a bacterial
chromosome, where they become a permanent part of the
bacterial genome. The number of plasmids in a cell
generally remains constant from generation to generation.
It is here that they provide great functionality in molecular
science.
Plasmids are easy to manipulate and isolate using
bacteria. They can be integrated into mammalian genomes,
thereby conferring to mammalian cells whatever genetic
functionality they carry. Thus, we can have the ability to
introduce genes into a given organism by using bacteria to
amplify the hybrid genes that are created in vitro. This tiny
but mighty plasmid molecule is the basis of recombinant
DNA technology.
They were originally discovered by their ability to
transfer antibiotic-resistance genes between bacteria, so to
make plasmids useful these regions of antibiotic resistance
had to be removed and replaced with recombinant genes
(Feldman and Steg, 1997). Methods to deliver gene-
carrying plasmids to mammalian cells for gene therapy
include direct microinjection, liposomes, calcium
phosphate, electroporation, or DNA-coated particle
bombardment.
Liposomes are microscopic artificial vesicles,
spherical in shape that can be produced from natural
nontoxic phospholipids and cholesterol. When mixed in
water under low shear conditions, the phospholipids
arrange themselves in sheets, the molecules aligning side
by side in like orientation, "heads" up and "tails" down
(Figure 6). These sheets then join tails-to-tails to form a
bilayer membrane enclosing some of the water in that
phospholipid sphere. The vesicles can be loaded with a
great variety of molecules, such as small drug molecules,
proteins, nucleotides and even plasmids.
The simplicity of the liposome preparation and lack
of disease transmission associated with viral vectors
combined with the ease of plasmid construction make
liposomes the most common form of non-viral gene
transfer. The genetic material transferred by the liposome
will enter the nucleus but will not incorporate into the
cell’s genome except for a very small amount. However
some of its shortcomings are its use only in in vitro due to
the instability of this complex (liposome-plasmid DNA) in
the circulation, gene expression is for a short duration and
the efficiency of gene transfer is low (Morishita et al,
1994). Transfection efficiencies vary with DNA/liposome
ratio, cell type, and the proliferation status of cells. (Dzau
et al, 1996; Armeanu et al, 2000). The non-selectivity of
these liposomes has been partially overcome by the
insertion of surface markers that attach to specific cell
surface receptors (Von der Leyen et al, 1995).
![Page 51: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/51.jpg)
Gene Therapy and Molecular Biology Vol 8, page 355
355
Figure 5. From the Avigen Company Website. 2001. DNA should be single stranded.
Figure 6 . A liposome with showing the lipid bilayer with water
inside. From the Collaborative Laboratories Website. Liposomes,
controlled delivery systems. Updated April 22nd 2004.
III. New techniques for administering
gene-based therapy and assessment of
heart functionOne of the important considerations in developing
cardiovascular gene transfer as a therapy is the ability to
deliver the vector, viral or plasmid, to the desired tissue in
a safe fashion. This is not a problem in peripheral vessels
but proves to be quite a challenge in the coronary arteries
(Nabel EG and Nabel GJ, 1999). In the peripheral vessels,
adequate exposure at the time of surgery makes gene
transfer feasible and also these vessels tolerate long
periods of ischemia without serious consequences. In
contrast, in the coronary bed, we must be able to access
the lesion and occlude the vessel for an adequate amount
of time to allow vector attachment and uptake without
significantly compromising myocardial perfusion (Bailey,
1996) (Figure 7).
In angiogenesis direct intramuscular injection of the
desired vector into ischemic tissues, such as skeletal
muscle or myocardium, allows local angiogenic factor
expression to stimulate collateral blood vessel
development (Baumgartner et al, 1998; Mack et al, 1998;
Rosengart et al, 1999a). Researchers have modified this by
injecting microspheres coupled to plasmids or growth
factors that in turn can allow for slow release of the
recombinant material into the surrounding tissue. (Arras et
al, 1998).
Figure 7. From the Arizona Heart Institute Research Website.
2000-2001
![Page 52: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/52.jpg)
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
356
A. Magnetic resonance imaging (MRI)MRI has evolved as a new non-invasive tool of
accurately measuring and quantifying myocardial function
and perfusion. The distinct advantages of MRI over
current conventional nuclear-based cardiac imaging
techniques, such as PET or myocardial scintigraphy,
include its spatial resolution and lack of exposure of the
patient to ionizing radiation. Also, quantification of
cardiac morphology and function by MRI is more accurate
and image quality is more reproducible than
echocardiography, independent of the operator’s skills and
experience or each patient’s individual anatomy
(Lederman et al, 2002).
The new interventional MRI (iMRI) provides a real-
time guidance for gene and cell delivery into the heart in
addition to being a reliable tool in assessing the ventricular
remodeling after myocardial infarction (Barbash et al,
2004).
B. Electro-mechanical mappingLeft ventricular (LV) electromechanical mapping
(EMM) can be used to distinguish among infarcted,
ischemic, and normal myocardium. This system uses
electromagnetic field sensors to combine and integrate
real-time information from percutaneous intracardiac
electrograms acquired at multiple endocardial locations.
The resulting interrogations can be used to distinguish
between infarcted and normal myocardium (Gepstein et al,
1998) and thus permit online assessment of myocardial
function and viability (Kornowski et al, 1998). This could
be used as a tool for assessing the effects of gene delivery
in restoring the myocardial function after an infarct.
IV. Angiogenesis and gene therapyFor gene therapy to be successful in angiogenesis, the
gene selected should code for a protein with a proven
angiogenic activity, the vector used should provide high
gene-transfer efficiency, the delivery technique should
target the desired ischemic tissues and the procedure
should be safe both in the long term and short term.
A. Process of new blood vessel formationA couple of trials have been done using gene therapy
in angiogenesis with some promising results. Three
different processes (vasculogenesis, arteriogenesis and
angiogenesis) contribute to the growth of blood vessels.
Vasculogenesis is the primary process responsible for
growth of new vasculature during embryonic development
and it is characterized by the differentiation of pluripotent
endothelial cell precursors into endothelial cells that
subsequently form primitive blood vessels (Bussolino et
al, 1997). Arteriogenesis is the growth of collateral arteries
that possess a fully developed tunica media or the
enlargement of existing blood vessels that is seen in adult
vessels. Recruited monocytes transform into macrophages,
which produce numerous cytokines and growth factors
(including tumor necrosis factor alpha (TNF-"), and basic
fibroblast growth factor (b-FGF) involved in
arteriogenesis (Wolf et al, 1998). These proteins stimulate
remodeling and dilatation of arterioles leading to the
development of functional collaterals. Angiogenesis is a
process that also occurs in adult tissues whereby new
capillaries develop from preexisting vasculature. It is a
dynamic, multi-step process and requires interaction of a
variety of cells which involves retraction of pericytes from
the surface of the capillary, release of proteases from the
activated endothelial cells by VEGF family proteins,
degradation of the extracellular matrix (ECM) surrounding
the pre-existing vessels, endothelial migration towards an
angiogenic stimulus and their proliferation, formation of
tube-like structures, fusion of the formed vessels and
initiation of blood flow. Matrix degradation and
endothelial and smooth muscle cell/pericyte migration are
modulated by interplay of numerous factors, including
plasminogen activators, matrix metalloproteinases and
their inhibitors. There are multiple additional regulators of
endothelial and smooth muscle cell proliferation that are
also important components of the angiogenic process
(Ruel and Sellke, 2003). Initial trials with gene therapy
using adenovirus have used a replication-deficient virus,
serotype 5 (Ad5) in which the E1A and E1B genes have
been removed and replaced with fibroblast growth factor-4
(FGF-4) may be promising.
B. Regulation of angiogenesisAngiogenesis is held delicately in a balance, well
orchestrated by the interplay of many cells and controlled
by both positive and negative regulators. In the body,
angiogenesis is controlled through a series of "on" and
"off" switches. The "on" switches are angiogenesis-
stimulating factors, and the "off" switches are
angiogenesis-inhibiting factors. There are more than 20
known angiogenic growth factors, and 30 known
angiogenic inhibitors. Under normal physiological
conditions, angiogenesis is "turned off" because there is
more production of inhibitors than stimulators. But, this
balance is a double-edged sword. Improper regulation of
stimulators and inhibitors contributes to more than 70
pathological conditions such as tumor growth, rheumatoid
arthritis, psoriasis, and diabetes mellitus (Sellke and Ruel,
2003). VEGF is the most widely studied and used factor
for therapeutic angiogenesis. Several studies have been
done where VEGF was directly delivered to a patient’s leg
with known peripheral vascular disease (PAD) in the area
surrounding a diseased artery. Within a few days,
stimulation of the growth of new blood vessels around the
blockage in the ailing blood vessel was found and this
obviated the need for an amputation. Improved myocardial
perfusion and function after the administration of
angiogenic growth factors has been demonstrated in
animal models of chronic myocardial ischemia. A recent
clinical study reported beneficial long-term effects of
therapeutic angiogenesis using FGF-2 protein in terms of
freedom from angina and improved myocardial perfusion
on nuclear imaging (Ruel and Sellke, 2003). For
successful angiogenesis in ischemic heart disease and
PAD, a sustained but transient expression of growth
factors is required, which makes gene therapy a particular
attractive therapeutic option.
![Page 53: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/53.jpg)
Gene Therapy and Molecular Biology Vol 8, page 357
357
V. Gene therapy trialsA. FGF trialsInitial pre-clinical trials using animal models of
chronic myocardial ischemia have shown that adenovirus-
5 with a gene coding for fibroblast growth factor-4
(Ad5FGF-4) delivery into coronary vessel reverses
myocardial dysfunction and increases blood flow with a
sustained response of approximately 2-3 months. This
ultimately led to the initiation of the multi-center clinical
trials known as the AGENT trials.
1. AGENT and AGENT 2 trialsThis was the first multi-center US clinical,
randomized, double-blinded, placebo-controlled trial using
Ad5-FGF4 for the treatment through the stimulation of
angiogenesis of myocardial ischemia.
The main focus of this trial was safety of intra-
coronary route for gene delivery. Patients with chronic
stable angina were given incremental doses of ad5fgf-4 to
know the optimum dose for use in future trials. It was not
powered to evaluate the dose response or the efficacy.
Both the treatment and placebo groups were well matched
in terms of disease characteristics. Results showed that
administration of ad5fgf-4 by intra-coronary route is safe
and well tolerated and patients had a significant increase in
their exercise tolerance when compared to placebo
suggesting an improvement in myocardial dysfunction
(Grines et al, 2002).
AGENT 2 was designed to evaluate the potential of
Ad5FGF-4 in promoting new blood formation thus
reversing the ischemic insult and to reassess its safety
(Grines et al, 2003).
Seventy-nine were included in the first and 52
patients in the second trial. Patients who received
Ad5FGF-4 experienced complete resolution of symptoms
(30% vs. 13%) and less usage of medications to relieve
their angina (43% vs. 17%) when compared to patients
who received placebo. In addition, the incidence of
worsening/unstable angina and revascularization by
coronary artery bypass grafting or angioplasty was
considerably lower in the Ad5FGF-4 group (6% and 6%,
respectively) compared with those in the placebo group
(24% and 16%, respectively). But some of these results
did not reach a statistical significance (Data on file, Berlex
Laboratories, 1998 Report No. A02854, 2000 Report No.
A02856).
2. AGENT 3 and AGENT 4 trialsThe results from the first two AGENT trials have
provided preliminary encouraging data about the safety
and anti-ischemic effects of Ad5FGF-4. Larger, long-term
trials that could evaluate better the potential risks, benefits
and complications looking into the short- and long-term
safety and efficacy parameters were needed.
AGENT 3 and AGENT 4 are 2 ongoing double-blind,
placebo-controlled trials with AGENT 3 is being
conducted exclusively in the United States, whereas
AGENT 4 is a multinational study (Europe, Canada,
United States, and Latin America). Each trial will recruit
450 patients (150 patients each on low-dose Ad5FGF-4,
high-dose Ad5FGF-4, and placebo) from centers with
expertise in multiple vessel percutaneous revascularization
procedures (Data on file, Berlex Laboratories, 2000 Report
No. A02858) and patients will be followed clinically for
up to 5 years and tracked for a further 10 years (Grines et
al, 2003).
Other potential areas for investigation include the use
of Ad5FGF-4 as an adjunct to angioplasty, as well as the
value of repeated administration of Ad5FGF-4 (Grines et
al, 2003).
B. VEGF trialsIn one of the first human clinical trials, patients with
ischemic heart disease were injected with naked plasmid
encoding for VEGF directly into diseased myocardium
and results showed marked improvement in blood flow
and with reduction of symptoms related to ischemia
(Losordo et al, 1998; Vale et al, 2000).
In a more recent trial, patients (n=13) with
symptomatic disease in spite of being treated with
conventional modalities of therapy [medications,
percutaneous transmural coronary angioplasty (PTCA) and
/or coronary artery bypass grafting (CABG)] demonstrated
significant reduction in infarct size after direct myocardial
injection of phVEGF165 measured by serial single-photon
emission CT-sestamibi imaging (Lathi et al, 2001).
Also patients with advanced CAD (class 3 or 4
angina) receiving naked DNA-encoding VEGF165
through direct myocardial injection reported to experience
reduced angina and sublingual nitroglycerin consumption
and this improvement was maintained throughout a whole
year of follow-up measured at different time points (Lathi
et al, 2001; Fortuin et al, 2003). Following this success, a
phase I study using intramuscular injection of adenoviral
vector of VEGF121 gene demonstrated clinical safety with
no evidence of systemic or cardiac related adverse effects
related to the vector (Rosengart et al, 1999a; Hedman et al,
2003).
Using the intra-coronary route for gene delivery
encoding for VEGF165 produced promising results with
significant increase in myocardial perfusion although no
differences in clinical restenosis rate or minimal lumen
diameter were present after the 6-month follow-up (Aoki
et al, 2000).
C. HGF trialsAnother angiogenic factor that looks promising is
hepatocyte growth factor (HGF), which was reported to
promote angiogenesis in animal models of myocardial
infarction (Ueda et al, 1999).
HGF has been found to inhibit collagen synthesis and
through different mechanisms stimulate its degradation
and this interesting function can be used as a tool in the
treatment of post myocardial infarction fibrotic
cardiomyopathy (Taniyama et al, 2002).
VI. ConclusionEncouraging preliminary data suggest the possible
use of gene therapy in the treatment of advanced coronary
![Page 54: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/54.jpg)
Malik et al: Angiogenic gene therapy for ischemic cardiovascular diseases
358
artery disease that is not amenable to conventional
treatment options (Dzau et al, 2003; Sleight, 2003).
Indeed, larger-scale, clinical trials are currently
underway at centers throughout the world. These trials will
characterize further the risk–benefit profile of various
products, the optimal dose that should be administered,
and the patient population likely to derive greatest benefit
(Dzau, 2003).
Attempts at developing non-viral direct DNA therapy
delivered through the intravenous route are currently
underway and with the use of advanced technology the
possibility of making gene therapy a simple outpatient
procedure does not seem remote.
ReferencesAoki M, Morishita R, Taniyama Y, et al. (2000) Angiogenesis
induced by hepatocyte growth factor in non-infarcted
myocardium and infarcted myocardium, up-regulation of
essential transcription factor for angiogenesis, ets. Gene
Ther 7, 417-427.
Armeanu S, Pelisek J, Krausz E, et al. (2000) Optimization of
nonviral gene transfer of vascular smooth muscle cells in
vitro and in vivo. Mol Ther 1, 366-375.
Arras M, Mollnau H, Strasser R, et al. (1998) The delivery of
angiogenic factors to the heart by microsphere therapy. Nat
Biotechnol 16, 159-162.
Bailey SR. (1996) Mechanisms of delivery and local drug
delivery technologies. Semin Interv Cardiol 1, 17-23.
Barbash IM, Leor J, Feinberg MS, et al. (2004) Interventional
magnetic resonance imaging for guiding gene and cell
transfer in the heart. Heart 90, 87-91.
Baumgartner I, Pieczek A, Manor O, et al. (1998) Constitutive
expression of phVEGF165 after intramuscular gene transfer
promotes collateral vessel development in patients with
critical limb ischemia. Circulation 97, 1114-1123.
Bussolino F, Mantovani A, Persico G. (1997) Molecular
mechanisms of blood vessel formation. trends Biochem Sci
22, 251-256
Cheung AK, Hoggan MD, Hauswirth WW, Berns KI. (1980)
Integration of the adeno-associated virus genome into
cellular DNA in latently infected human Detroit 6 cells. J
Virol 33, 739-748.
Clemens PR, Kochanek S, Sunada Y, et al. (1996) In vivo muscle
gene transfer of full-length dystrophin with an adenoviral
vector that lacks all viral genes. Gene Ther 3, 965-972.
Clowes WA (1997) Vascular Gene Therapy in the 21st Century.
Thromb Haemost 78, 605-610
Data on file, Berlex Laboratories, (1998) Report No. A02854
(Ad5FGF-4 dose-response study in ameroid pig)
Data on file, Berlex Laboratories, (2000) Report No. A02856
(Chronic efficacy study following single administration of
Ad5FGF-4.)
Data on file, Berlex Laboratories, (2000) Report No. A02858
(Effect of high anti-Ad5 antibody titer on the efficacy
ofAd5FGF-4 in an ameroid model of myocardial ischemia)
Data on file, Berlex Laboratories, (2003) Report No. A02950
(Systemic toxicology, distribution and expression following
intracoronary or left ventricular administration of Ad5FGF-4
in swine)
Dzau VJ, Beatt K, Pompilio G, Smith K. (2003) Current
perceptions of cardiovascular gene therapy. Am J Cardiol
92, 18N-23N
Dzau VJ, Mann MJ, Morishita R, Kaneda Y. (1996) Fusigenic
viral liposome for gene therapy in cardiovascular diseases.
Proc Natl Acad Sci U S A. 93, 11421-11425.
Dzau VJ. (2003) Predicting the future of human gene therapy for
cardiovascular diseases, what will the management of
coronary artery disease be like in 2005 and 2010? Am J
Cardiol 92, 32n-35n.
Feldman LJ, Steg G. (1997) Optimal techniques for arterial gene
transfer. Cardiovasc Res. 35, 391-404.
Fisher KD, Stallwood Y, Green NK, Ulbrich K, Mautner V,
Seymour LW. (2001) Polymer-coated adenovirus permits
efficient retargeting and evades neutralising antibodies. Gene
Ther. 8, 341-348.
Flugelman MY, Jaklitsch MT, Newman KD, Casscells W,
Bratthauer GL, Dichek DA. (1992) Low level in vivo gene
transfer into the arterial wall through a perforated balloon
catheter. Circulation. 85, 1110-1117.
Fortuin FD, Vale P, Losordo DW, et al. (2003) One-year follow-
up of direct myocardial gene transfer of vascular endothelial
growth factor-2 using naked plasmid deoxyribonucleic acid
by way of thoracotomy in no-option patients. Am J Cardiol
92, 436-439.
Gepstein L, Goldin A, Lessick J, et al. (1998) Electromechanical
characterization of chronic myocardial infarction in the
canine coronary occlusion model. Circulation 98, 2055-
2064.
Grines C, Watkins M, Mahmarian J, Iskandrian A, Rade J,
Marrott P, Pratt C, Kleiman N. (2003) A randomized double
blind placebo-controlled trial of Ad5FGF-4 gene therapy and
its effect on myocardial perfusion in patients with stable
angina. J Am Coll Cardiol 42, 1339-1347.
Grines CL, Watkins MW, Helmer G, Penny W, Brinker J,
Marmur JD, West A, Rade JJ, Marrott P, Hammond HK,
Engler RL. (2002) Angiogenic Gene Therapy (AGENT) trial
in patients with stable angina pectoris. Circulation 105,
1291-1297.
Hedman M, Hartikainen J, Syvanne M, et al. (2003) Safety and
feasibility of catheter-based local intracoronary vascular
endothelial growth factor gene transfer in the prevention of
postangioplasty and in-stent restenosis and in the treatment
of chronic myocardial ischemia, phase II results of the
Kuopio Angiogenesis Trial (KAT). Circulation 107, 2677-
2683.
Horwitz M. (1990) The adenoviruses. In, Fields BN, Knipe DM,
eds. Virology. New York, NY, Raven Press, 1723.
Jolly D. (1994) Viral vector systems for gene therapy. Cancer
Gene Ther. 1, 51-64.
Kibbe MR, Murdock A, Wickham T, et al. (2000) Optimizing
cardiovascular gene therapy, increased vascular gene transfer
with modified adenoviral vectors. Arch Surg 135, 191-197.
Kochanek S, Clemens PR, Mitani K, Chen HH, Chan S, Caskey
CT (1996) A new adenoviral vector, replacement of all viral
coding sequences with 28 kb of DNA independently
expressing both full-length dystrophin and beta-
galactosidase. Proc Natl Acad Sci U S A 93, 5731-5736.
Kornowski R, Hong MK, Leon MB. (1998) Comparison between
left ventricular electromechanical mapping and radionuclide
perfusion imaging for detection of myocardial viability.
Circulation 98, 1837-1841.
Lathi KG, Vale PR, Losordo DW, et al. (2001) Gene therapy
with vascular endothelial growth factor for inoperable
coronary artery disease, anesthetic management and results.
Anesth Analg 92, 19-25.
Lederman RJ, Guttman MA, Peters DC, et al. (2002) Catheter-
based endomyocardial injection with real-time magnetic
resonance imaging. Circulation 105, 1282-4.
Losordo DW, Vale PR, Symes JF, et al. (1998) Gene therapy for
myocardial angiogenesis, initial clinical results with direct
myocardial injection of phVEGF165 as sole therapy for
myocardial ischemia. Circulation 98, 2800-2804.
![Page 55: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/55.jpg)
Gene Therapy and Molecular Biology Vol 8, page 361
361
Gene Ther Mol Biol Vol 8, 361-368, 2004
Targeting Myc function in cancer therapyReview Article
William L. Walker, Sandra Fernandez and Peter J. Hurlin*Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health Sciences University,
3101 Sam Jackson Park Road, Portland, Oregon 97201 USA
__________________________________________________________________________________*Correspondence: Peter J. Hurlin, Shriners Hospitals for Children and Department of Cell and Developmental Biology, Oregon Health
Sciences University, 3101 Sam Jackson Park Road, Portland, Oregon 97201 USA; Tel: +1 503 221 3438; Fax: +1 503 221 3451; e-mail:
Key words: Myc, Max, Mnt, apoptosis
Received: 23 July 2004; Accepted: 23 August 2004; electronically published: August 2004
Summary
The development of novel therapeutic strategies to improve the survival rate of patients with cancer requires a
better understanding of the critical events that underlie the origins and progression of tumors. The Myc family of
transcription factors play important normal roles in regulating cell proliferation and their deregulated or elevated
expression is one of the most common features of cancer cells. Here, we review mechanisms thought to underlie
Myc-dependent tumor formation and discuss possible strategies for disrupting the oncogenic activity of Myc family
proteins.
I. IntroductionDeregulated expression of members of the Myc
family of genes is a common feature of diverse
malignancies. Myc gene amplification and gene
translocation are often responsible, but abnormally high
Myc levels are also observed in numerous tumors that
show no such defects. Although it is not possible to
discriminate between cause and effect when evaluating the
role of Myc in human tumors, a large collection of
experimental results from cell culture and animal models
clearly demonstrate that deregulated Myc expression can
function as a root cause of cancer.
How do Myc proteins contribute to the tumor
phenotype? The use of transgenic mice containing
inducible Myc genes or activatable forms of Myc, together
with more traditional types of transgenic models, have led
to, or confirmed, the identification of several Myc
activities that can be a factor in tumor formation. These
activities include stimulating cell proliferation, promoting
vasculogenesis and, paradoxically, promoting or
sensitizing cells to apoptosis. Although Myc driven
apoptosis can be regarded as a safeguard or tumor
suppressor mechanism (Huebner and Evan, 1998;
Pelengaris et al, 2002a), when combined with its affects on
cell proliferation and vasculogenesis, this activity has the
potential to ultimately have the reverse effect. Because
Myc deregulation/overexpression can stimulate both
proliferation and apoptosis, it has the capability of
applying strong selection pressure for the development of
cells that escape cell death. This type of scenario was
shown to play out in cultured primary cells exposed to
high c-Myc levels (Zindy et al, 1998). Typically, cells that
escaped Myc-driven apoptosis in culture, harbored defects
in the p53 tumor suppressor pathway (Zindy et al, 1998),
which serves as an important mediator apoptosis in
general and of Myc-driven apoptosis specifically (Sherr,
2001). Mutations in the p53 pathway, in theory, help clear
the path for Myc-driven tumorigenesis by not only
preventing apoptosis (Figure 1), but by also disabling
important checkpoints governed by p53 that prevent
excessive cell proliferation (Sherr, 2001). Proof of this
principal has been obtained in the results of crosses
between transgenic mice that overexpress c-Myc and ones
that have abrogated p53 pathway function. In this
environment, tumorigenesis is typically accelerated, often
dramatically (Nilsson and Cleveland, 2003). Taken
together, these results demonstrate that Myc deregulation
has the potential to function as an early, initiating event in
the evolution of tumor cells and, at least theoretically, may
be partially responsible for the high proportion of human
tumors that exhibit mutations in genes encoding p53 or its
positive regulator p19ARF.
In addition to mutations that disrupt the p53 pathway,
Myc-dependent apoptosis can be disarmed through a
variety of other mechanisms (Nilsson and Cleveland,
2003). Most notably, this can be accomplished by
overexpression of anti-apoptotic proteins such as Bcl2 and
BclXL (Strasser et al, 1990; Pelengaris et al, 2002b) and
![Page 56: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/56.jpg)
Walker et al: Targeting Myc function in cancer therapy
362
loss of proapoptotic proteins such as Bax (Eischen et al,
1991). Thus, events that cripple Myc-dependent apoptosis,
but leave its other proliferation-promoting activities intact,
cooperate to drive tumor formation (Figure 1).
Based on the model presented above, tumors that
exhibit excessively high and/or deregulated Myc
expression, must either have lost their apoptotic response
to Myc or are not programmed to respond in this manner.
The latter situation appears to exist in certain cell types,
such as skin keratinocytes (Gandarillas and Watt, 1997;
Pelengaris et al, 1999;Waikel et al; 1999, 2001). When c-
Myc expression was induced in suprabasal mouse
keratinocytes, cells committed to terminal differentiation,
they reinitiated cell proliferation and formed highly
Figure 1. Model outlining activities and events associated with Myc-dependent tumor formation. When normal cells (gray) are subjected
to Myc deregulation (blue), they become hyperproliferative. In the absence of sufficient growth/survival factors and nutrients to support
hyperproliferation, cells are stressed to the point that they undergo apoptosis (purple). Myc overexpressing cells that sustain secondary
events allowing escape from an apoptotic fate, such as mutational disruption of p53 pathway function or upregulation of anti-apoptotic
proteins such as Bcl2 and BclXL, continue to proliferate (green), In addition to promoting cell proliferation, Myc stimulates
vasculogenesis and angiogenesis, activities that ultimately drive tumor formation.
![Page 57: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/57.jpg)
Gene Therapy and Molecular Biology Vol 8, page 363
363
vascularized papillomas (Pelengaris et al, 1999). Although
apoptosis appears to be minimal in this setting, the
formation of tumors was limited due to the retention and
advance of the keratinocyte terminal differentiation
program. In other words, Myc seemed to cause suprabasal
keratinocytes to revert to a basal-like phenotype that
ultimately produced differentiated “squames” that slough
off the skin surface (Pelengaris et al, 1999; Waikel et al,
2001). This is a surprising result since Myc has the
demonstrated activity of suppressing the differentiation
programs of many other cell types while promoting their
proliferation (Grandori et al, 2000). Moreover, in terms of
the response to deregulated/elevated Myc expression, the
lack of increased apoptosis in keratinocytes appears to be
the exception rather than the rule.
A potential explanation for these results is that skin
keratinocytes have a higher threshold for induction of
apoptosis. Because of their location at the body surface
and therefore frequent exposure to stresses capable of
inducing apoptosis (e.g. UV light), a higher apoptosis
threshold may have evolved specifically in keratinocytes
to help insure the integrity of our skin. For example,
keratinocytes may have naturally high levels of certain
anti-apoptotic proteins or low levels of proapoptotic
proteins compared to other cell types. Clearly, there is still
much to be learned about the conditions that determine the
response primary cells in vivo have to deregulated and/or
overexpressed Myc and mechanisms that ultimately lead
to tumorigenesis. Moreover, understanding the detailed
molecular mechanisms that underlie Myc-dependent
tumorigenesis in different cancers will ultimately provide
specific, efficatious targets for the development of
therapeutic drugs.
II. Potential therapeutic strategies that
target Myc expression and activityA. Turning Myc offThe most obvious way to prevent Myc-dependent
tumorigenesis is to target its downregulation or
inactivation in tumors. Transgenic mice expressing Myc
under the control of an inducible promoter or expressing
an activatible form of Myc (Myc-estrogen receptor
fusions), have clearly demonstrated that tumors induced
by ectopic Myc expression typically remain dependent on
the artificially deregulated and typically elevated Myc
levels (Felsher and Bishop, 1999; Pelengaris et al, 1999,
2002b; D’Cruz et al, 2001). Thus, “turning off” Myc
subsequent to tumor formation has been found to lead to
rapid tumor regression. Although in some settings a
subpopulation of cells ultimately become resistant to Myc
downregulation, these results clearly indicate that
therapies targeting inactivation of Myc in tumors would at
least temporarily slow tumor growth. Indeed, this would
most likely be true whether or not a tumor exhibited Myc
deregulation/overexpression, as targeted deletion of c-Myc
in both primary and “immortal” cells has been
demonstrated to cause a dramatic reduction in their ability
to proliferate (Mateyak et al, 1997; Trumpp et al, 2001; de
Alboran et al, 2001).
These latter results and the finding that homozygous
deletion of c-Myc and N-myc cause mid-gestation
lethality, also illustrate the seemingly obvious point that,
even if Myc genes could be targeted for downregulation in
vivo, this would probably have to be largely confined to
the tumor cell population. However, the great majority of
tumors occur in adults, which of course contain a much
smaller pool of proliferating cells than a fetus or
prepubescent individual. Thus, assuming that the only
effect of targeting Myc downregulation is decreased
proliferation, this strategy may actually be less destructive
to normal proliferating cell populations than many
standard chemotherapeutic agents that may also negatively
impact non-proliferating cells. Moreover, because of the
overlapping tissue expression patterns of the three well-
characterized Myc family genes, c-Myc, L-Myc and N-
Myc, systemic downregulation of any one of the Myc
genes – in an attempt to target its overexpression (or
normal expression) in a specific tumor – may have a quite
limited deleterious effect overall. This would probably be
most true for L-Myc and N-Myc, which exhibit a more
limited expression range than c-Myc (Mugrauer et al,
1988; Downs et al, 1989; Hatton et al, 1995). Thus, for
example, targeting L-Myc downregulation to treat small
cell lung carcinoma, which frequently exhibit L-Myc
amplification, by systemic application of L-Myc anti-sense
oligos, morpholinos, or siRNA, may have a minimal
organism-wide deleterious effect. Further, unlike the
lethality caused by N-Myc and c-Myc deletion in mice,
mice lacking L-Myc appear normal, supporting the
hypothesis that there would be minimal impact outside of
a L-Myc-dependent tumor.
It has been demonstrated that antisense
oligonucleotides targeting c-Myc, L-Myc and N-Myc can
be effective at slowing the proliferation of particular tumor
cell types in culture and in partially ameliorating tumor-
associated phenotypes (Wickstrom et al, 1988; Schmidt et
al, 1994; Dosaka-Akita et al, 1995; Smith et al, 1998;
Waelti and Gluck, 1998; Iversen et al, 2003; Pastorino et
al, 2003). Further, it has been observed that systemic
introduction of Myc antisense agents can lead to
significant tumor regression in mouse tumor xenografts
(Schmidt et al, 1994; Iversen et al, 2003; Pastorino et al,
2003). However, these studies have been largely
preliminary in nature and, to date, there has been no
follow-up evidence supporting the notion that this type of
approach works on human tumors. It seems that the
greatest limitation to this approach is instability of
antisense agents and consequently an inability for them to
effectively reach and enter enough tumor cells to have a
significant impact. Perhaps the development of next
generation antisense Myc agents that may have a longer
half-life in vivo (Iversen et al, 2003) or adjuvant vehicles
to better deliver the agents to tumors will aid their
effectiveness.
B. Restoring Myc-dependent apoptosis in
tumorsAs discussed above, transgenic models of Myc-
driven tumor formation using inducible and/or activatible
systems have demonstrated that most tumors regress
![Page 58: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/58.jpg)
Walker et al: Targeting Myc function in cancer therapy
364
following “inactivation” of Myc. In this setting, a basic
assumption had been that reactivating or turning Myc back
on would reinitiate tumorigenesis. Surprisingly, this was
found not to be the case in osteosarcomas produced in
transgenic mice using an inducible c-Myc expression
system (Jain et al, 2002). Termination of ectopic c-Myc
expression caused restoration of osteocyte differentation
and tumor regression and subsequent restoration of ectopic
c-Myc expression led to apoptosis and a failure to promote
tumor formation (Jain et al, 2002). Mechanisms
underlying this unexpected phenomenon have yet to be
defined and it is not known whether this is a general
response of cells to temporary downregulation of
oncogenic levels of Myc. Although many questions
remain, reactivation of Myc-driven apoptosis has obvious
implications for tumor therapy (Felsher and Bradon,
2003). For example, some tumors might be especially
vulnerable to transient downregulation of Myc protein
levels using existing antisense and siRNA technologies as
discussed above. Such a protocol would ameliorate the
potential side effects of sustained systemic delivery of
such agents. Further, there transient use, combined with
chemotherapeutic drugs known to exacerbate Myc-driven
apoptosis, might offer even more promise.
Because defective apoptosis appears to be a common
mechanism underlying Myc-dependent progression to
tumor formation, as well as tumor progression in general,
restoring apoptosis in tumors offers great promise as a
cancer therapy. The prevalence of p53 pathway defects in
tumor cells, has made restoring p53 pathway function the
primary focus in this area. Indeed, considerable progress
has been made in this effort and drugs with the potential of
restoring wildtype p53 function to mutated and defective
p53 proteins have been identified and are currently being
tested in clinical trials (Wang and El-Diery, 2004).
The anti-apoptotic BCL-2 family proteins are also
attractive targets for drug design, as they are known to
cooperate with ectopic Myc expression in tumorigenesis
and are expressed at elevated levels in a wide variety of
tumor types (Nilsson and Cleveland, 2003). BCL2-specific
antisense oligonucleotides have been developed that show
broad anti-cancer activities in pre-clinical models and are
currently being tested in several late-stage clinical trials
(Hu and Kavanagh, 2003; Manion and Hokenbery, 2004).
While drugs that target restoration of apoptotic pathways
appear to have general anti-tumor activity, tumors that
exhibit deregulation and/or overexpressed of Myc family
proteins may be particularly vulnerable to this type of
therapy.
C. Targeting disruption of functional
Myc complexesThe biological function of Myc family proteins is
highly dependent on the integrity of its basic-helix-loop-
helix leucine zipper motif (bHLHZip – Grandori et al,
2000). The HLHZip motif mediates interaction with
another bHLHZip protein, Max, which facilitates binding
of the basic regions of the Myc:Max heterodimer to the
DNA sequence CACGTG and related “E-box” sites . The
Myc:Max heterodimer can activate transcription in
reporter assays, an activity mediated primarily through a
conserved tripartite activation domain in the N-terminal
half of Myc family proteins (Grandori et al, 2000). Many
different proteins have been found that interact within this
region and mediate or modulate Myc-dependent
transcription. As if this were not complicated enough, Myc
proteins can also repress transcription, an activity that
involves protein-protein interactions in regions that
sometimes overlap with their activation domains
(Grandori et al, 2000).
Because of the obligate role Max plays in Myc
function, interaction between Myc and Max and between
Myc:Max heterodimers and DNA offer attractive targets
for drug design. The same is true for protein – protein
interactions that mediate the transcriptional properties of
Myc. Drugs that interfere with either the Myc:Max
interaction or with Myc:Max DNA binding would be
expected to abolish Myc activity, whereas drugs that
interfere with interactions between Myc and coactivator or
corepressor proteins may have a more limited or selective
affect on Myc function. Because Max interacts with a
number of other proteins that contain Myc-like HLHZip
regions (Grandori et al, 2000), there is the real problem of
specificity in targeting the Myc:Max interaction, as drugs
that interfere with Myc:Max interactions may also
interfere with other Max - HLHZip interactions, with
unknown consequences for the cell. Nonetheless, small
molecules have been identified that disrupt Myc:Max
heterodimerization using a yeast two-hybrid approach, and
they seem to have specific effects in suppressing Myc
activities (Yin et al, 2003). Potential problems of
specificity may also arise in drugs that target Myc:Max
DNA binding, as they may affect DNA binding by
members of a large number of additional proteins that
contain a “basic” region DNA binding motif.
Finally, because the molecular mechanisms that
mediate the transcriptional activities of Myc family
proteins are still confusing, it is not clear whether targeting
any of the many interactions thought to control Myc
transcription would cripple its functions in tumorigenesis.
However, one potential target is the interaction between
Myc and the coactivator TRRAP (McMahon et al, 1998
–Figure 2). Interaction with TRRAP was found to be
required for Myc-dependent transformation (McMahon et
al, 1998; Park et al, 2001) and regions within these
proteins that mediate the interaction have been mapped.
Thus small molecules that disrupt this interaction might be
effective in blocking tumor-promoting activities of Myc.
A second potential target is the interaction between
Myc and Miz1 (Wanzel et al, 2003). Miz1 is a
transcriptional activator whose activities are repressed by
interaction with Myc which causes displacement of the
Miz1 coactivator protein CBP (Staller et al, 2001, Herold
et al, 2002). Through this mechanism, Myc was found to
disrupt Miz1-dependent transcriptional activation of the
genes encoding cyclin-dependent kinase inhibitors
p15INK4D and p21CIP1 (Herold et al, 2002; Seoane et al,
2002). The p21CIP1 gene is a key transcriptional target of
p53, and by suppressing its transcription, Myc appears to
suppress the cell cycle arrest functions of p53, but not its
pro-apoptotic function. Therefore, in cells that have an
intact p53 pathway, the development of drugs that disrupt.
![Page 59: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/59.jpg)
Gene Therapy and Molecular Biology Vol 8, page 365
365
Figure 2. Speculative Myc-Mnt antagonism model. Myc (c-Myc, N-Myc and L-Myc) and Mnt compete for interaction with their
obligate heterodimerization partner Max and for binding and regulation of shared transcriptional target genes. Myc:Max complexes
activate transcription through recruitment of coactivator proteins such as TRRAP and TRRAP-associated GCN5, a histone
acetyltransferase. Of note, TRRAP is one of many proteins found to interact with Myc and affect its ability to activate transcription. In
contrast to Myc, Mnt represses transcription through its interaction with Sin3 corepressor proteins, which tethers histone deacetylating
(HDAC) enzymes. Ubiquitous Mnt:Max complexes are postulated to create a threshold of transcriptional repression at shared Myc/Mnt
target genes that is overcome, and proliferation promoted, when Myc levels are expressed at sufficiently high levels.
intact p53 pathway, the development of drugs that disrupt
interaction between Myc and Miz1 would theoretically
cause increased susceptibility to Myc-dependent
apoptosis.
D. Interfering with downstream
pathways regulated by MycBecause Myc family proteins are transcriptional
regulators, it would seem that disrupting the function of
proteins encoded by its transcriptional target genes would
offer an effective way at disarming Myc function.
However, the identification of bona fide Myc target genes
has been at best difficult and at worse, misleading
(Eisenman, 2001). Moreover, recent findings support the
view that Myc functions are not mediated by it’s
regulation of a small number of key transcriptional targets,
but instead through it’s binding and regulation of perhaps
thousands of different genes (see http//www.myc-cancer-
gene.org for an updated list). Although it is not clear how
many different genes Myc actually regulates, it is clear
that it broadly affects the gene expression profile of cells.
This is also reflected at the protein level, where changes,
up and down, of broad categories of proteins have been
observed following ectopic Myc expression (Ishii, et al,
2002). Therefore, instead of - or in addition to - trying to
zero in on specific Myc transcriptional targets as candidate
drug targets, it may be fruitful to focus on disrupting more
downstream events that ultimately contribute to the
oncogenic activity of Myc. In many, and perhaps most
cases, such events are probably not unique to Myc-driven
oncogenesis, but represent general attributes of tumor cells
that Myc can provoke or enhance.
One example of this is vasculogenesis - the
production of new blood vessel networks, and
angiogenesis - the remodeling and expansion of this blood
vessel networks. Vasculogenesis and angiogenesis
provides for the increased blood supply required to
support the ever-growing nutritional needs of neoplastic
tissues during tumorigenesis. Ectopic
expression/activation of Myc in transgenic mice has been
found to stimulate angiogenesis and vasculogenesis
(Pelengaris et al, 1999, 2002b). Further, the vasculature
network formed in neoplastic tissues was dependent on
continued ectopic Myc expression. In addition, it was
recently revealed that angiogenesis and vasculogenesis is
defective in c-Myc null embryos and this deficiency was
linked to the inability of c-Myc null embryonic stem cells
to form tumors in Skid mice (Baudino et al, 2003). These
studies, together with data indicating that Myc can
regulate, either directly or indirectly, the expression of a
number of important factors involved in angiogenesis and
![Page 60: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/60.jpg)
Walker et al: Targeting Myc function in cancer therapy
366
vasculogenesis (Baudino et al, 2003 and references
therein), support the idea that drugs that disrupt
neovascularization will be effective in disrupting Myc-
dependent tumorigenesis. Because neovascularization is a
common and necessary feature of tumor growth in general,
the development and testing of such drugs has been the
focus of intense study for several years. However, the
drugs that have been developed have, so far, yet to prove
effective against human tumors (Siemann et al, 2004).
Thus, perhaps models of Myc-driven tumorigenesis may
provide a useful setting to more precisely define the
critical mechanisms responsible for neo-vasculogenesis
and a useful system to test novel drugs designed to disrupt
new blood vessel formation.
Another pathway modulated by Myc family proteins
that is likely generally important in tumorigenesis is cell
growth. Cell growth refers to the increased cell size
associated with progression through specific phases of the
cell cycle. Before cells divide, they increase their cell mass
and volume in order to maintain a consistent size of
daughter cells (Saucedo et al, 2002). It is hypothesized
that Myc regulates cell size by stimulating the expression,
directly or indirectly, of genes encoding proteins required
for protein synthesis (Jones et al, 1996; Greasly et al,
2000) and by assisting RNA polymerase III in the
transcription activation of transfer and ribosomal (5S)
RNAs (Gomez-Roman et al, 2003). Although these Myc
activities might be considered potential targets for
therapeutic intervention in tumors, disrupting fundamental
components of the protein synthesis machinery, that are
not necessarily coupled to cell proliferation, might be
expected to have strong adverse effects on non-tumor
tissues as well. However, the activity of mTOR, a central
regulator of cell growth, survival and protein translational
control is a key target of the drug rapamycin and related
compounds that show promise as anticancer agents
(Bjornsti and Houghton, 2004). Indeed, rapamycin has
been shown to be effective at reversing chemotherapeutic
resistance of Myc-dependent mouse lymphomas that
express Akt, an important regulator of mTOR activity and
cell survival (Wendel et al. 2004). In addition, inhibition
of mTOR activity by rapamycin can lead to c-Myc
downregulation in some cell types, (Gera et al, 2004), and
has been shown to inhibit transcription of the telomerase
catalytic subunit hTERT gene (Zhou et al, 2003), a direct
target of c-Myc transcriptional activation (Grandori et al,
2000) and putative oncogene. Thus, inhibitors of mTOR
activity may ultimately prove efficacious on human tumor
subsets that can be defined as exhibiting Myc
deregulation, particularly ones showing activation of
Akt/mTOR signalling.
III. Stimulating endogenous Myc
antagonistsBesides Myc family proteins, Max interacts with
another set of bHLHZip proteins that include the four Mad
family proteins (Mad1, Mxi1-Mad2, Mad3 and Mad4),
Mnt and Mga (Grandori et al, 2000). Like Myc:Max, these
alternative Max complexes bind to E-box sequences, but
appear to function as dedicated repressors. Furthermore,
each of these proteins can suppress the ability of Myc
family proteins to transform normal cells in culture to
tumor-like cells (Grandori et al, 2000). From these results
it has been speculated that this group of proteins normally
function as Myc antagonists in cells and would therefore
act as tumor suppressors in vivo. Although there is no
definitive evidence for a role as tumor suppressors in
human cancers for any of these proteins, disruption of
mouse Mxi1 (a.k.a. Mad2) and Mnt genes was shown to
predispose certain cell types to tumorigenesis (Schreiber-
Agus et al, 1998; Hurlin et al, 2003). In the case of Mnt,
conditional deletion in mammary epithelium led to the
formation of breast tumors. A conditional deletion
approach was required in these experiments because
homozygous germline deletion of Mnt is early postnatal
lethal (Hurlin et al, 2003; Toyo-oka et al, 2004) and
studies are underway by our group to test whether loss of
Mnt leads to tumors in other tissues.
Further support for the idea that Mnt functions as a
Myc antagonist comes from cell culture experiments.
MEFs lacking Mnt were found to exhibit several of the
hallmark attributes of cells caused by ectopic Myc
expression, including being sensitized to apoptosis, having
cell cycle entry defects and showing an enhanced rate of
senescence escape (Hurlin et al, 2003). Suppression of
Mnt by siRNA also caused increased apoptosis, even in an
immortal cell line lacking c-Myc (Nilsson et al, 2004).
Although these data generally support the notion that Mnt
is a Myc antagonist, because of the complicated
transcriptional activities of Myc family proteins, this is
somewhat difficult to unequivocally prove and requires
much more work. Nonetheless, these data, particularly the
finding of increasing sensitivity to apoptosis by Mnt
deficiency, raise the possibility that Mnt and possibly
other Max-interacting repressor proteins may serve as
future cancer therapeutic targets.
IV. ConclusionMyc family proteins serve as essential regulators of
cell proliferation and events that uncouple Myc
transcriptional gene expression from growth factor
signaling, push cells into a proliferative mode and makes
them prone to malignant conversion. If the local
growth/survival factor and nutrient environment is
sufficient, cell proliferation will occur, but when the
environment is, or becomes unfavorable to cell
proliferation, apoptotic cell death typically ensues. Thus,
sustained Myc-driven proliferation, and ultimately tumor
formation, is thought to require cooperation with
secondary events that either provide a favorable growth
factor/nutritional environment or that suppress apoptosis
(or both). This understanding of Myc-dependent
tumorigenesis has led to efforts to directly suppress Myc
expression in tumors and initiatives to restore defective
pro-apoptotic pathways in tumors. While these approaches
may ultimately be successful, the identification and
development of new therapeutic strategies and eventually
drugs targeting Myc functions in tumorigenesis will
require a more precise understanding of the complicated
molecular mechanisms underlying the normal and
oncogenic activities of Myc family proteins.
![Page 61: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/61.jpg)
Gene Therapy and Molecular Biology Vol 8, page 367
367
AcknowledgementsPJH is funded by grants from the NIH and Shriners
Hospitals for Children.
ReferencesBaudino TA, Maclean KH, Brennan J, Parganas E, Yang C,
Aslanian A, Lees JA, Sherr CJ, Roussel MF and Cleveland
JL (2003) Myc-mediated proliferation and lymphomagenesis,
but not apoptosis, are compromised by E2f1 loss. Mol Cell
11, 905-914.
Bjornsti MA and Houghton PJ (2004) The TOR pathway: a
target for cancer therapy. Nat Rev Cancer 4, 335-348.
D'Cruz CM, Gunther EJ, Boxer RB, Hartman JL, Sintasath L,
Moody SE, Cox JD, Ha SI, Belka GK, Golant A, Cardiff RD
and Chodosh LA (2001) c-MYC induces mammary
tumorigenesis by means of a preferred pathway involving
spontaneous Kras2 mutations. Nat Med 7,235-239.
de Alboran IM, O'Hagan RC, Gartner F, Malynn B, Davidson L,
Rickert R, Rajewsky K, DePinho RA and Alt FW (2001)
Analysis of C-MYC function in normal cells via conditional
gene-targeted mutation. Immunity 14, 45-55.
Dosaka-Akita H, Akie K, Hiroumi H, Kinoshita I, Kawakami Y
and Murakami A (1995) Inhibition of proliferation by L-myc
antisense DNA for the translational initiation site in human
small cell lung cancer. Cancer Res 55, 1559-1564.
Downs KM, Martin GR and Bishop JM (1989) Contrasting
patterns of myc and N-myc expression during gastrulation of
the mouse embryo. Genes Dev 3, 860-869.
Eischen CM, Roussel MF, Korsmeyer SJ and Cleveland JL
(2001) Bax loss impairs Myc-induced apoptosis and
circumvents the selection of p53 mutations during Myc-
mediated lymphomagenesis. Mol Cell Biol 21, 7653-7662.
Eisenman, RN (2001) Deconstructing myc. Genes Dev 15, 2023-
2030.
Felsher DW and Bradon N (2003) Pharmacological inactivation
of MYC for the treatment of cancer. Drug News Perspect
16,370-374.
Felsher DW, Bishop JM (1999) Reversible tumorigenesis by
MYC in hematopoietic lineages. Mol Cell 4, 199-207
Gandarillas A and Watt FM (1997) c-Myc promotes
differentiation of human epidermal stem cells. Genes Dev
11,2869-2882.
Gera JF, Mellinghoff IK, Shi Y, Rettig MB, Tran C, Hsu JH,
Sawyers CL and Lichtenstein AK (2004) AKT activity
determines sensitivity to mammalian target of rapamycin
(mTOR) inhibitors by regulating cyclin D1 and c-myc
expression. J Biol Chem 279, 2737-46.
Gomez-Roman N, Grandori C, Eisenman RN and White RJ
(2003) Direct activation of RNA polymerase III transcription
by c-Myc. Nature 421, 290-294.
Grandori C, Cowley SM, James LP and Eisenman RN (2000)
The Myc/Max/Mad network and the transcriptional control
of cell behavior. Annu Rev Cell Dev Biol 16, 653-699.
Greasley PJ, Bonnard C and Amati B (2000) Myc induces the
nucleolin and BN51 genes: possible implications in ribosome
biogenesis. Nucleic Acids Res 28, 446-453.
Hatton KS, Mahon K, Chin L, Chiu FC, Lee H W, Peng D,
Morgenbesser SD, Horner J and DePinho RA (1996)
Expression and activity of L-Myc in normal mouse
development. Mol Cell Biol 16, 1794-1804.
Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala
T, Syvaoja J, Saluz HP, Haenel F and Eilers M (2002)
Negative regulation of the mammalian UV response by Myc
through association with Miz-1. Mol Cell 10, 509-521.
Hu W and Kavanagh JJ (2003) Anticancer therapy targeting the
apoptotic pathway. Lancet Oncol 4, 721-729.
Hueber AO and Evan GI (1998) Traps to catch unwary
oncogenes. Trends Genet 14, 364-367.
Hurlin PJ, Zhou ZQ, Toyo-oka K, Ota S, Walker WL, Hirotsune
S, Wynshaw-Boris A (2003) Deletion of Mnt leads to
disrupted cell cycle control and tumorigenesis. Embo J 22,
4584-4596.
Iversen PL, Arora V, Acker AJ, Mason DH and Devi GR (2003)
Efficacy of antisense morpholino oligomer targeted to c-myc
in prostate cancer xenograft murine model and a Phase I
safety study in humans. Clin Cancer Res 9, 2510-2519.
Jain M, Arvanitis C, Chu K, Dewey W, Leonhardt E, Trinh M,
Sundberg CD, Bishop JM and Felsher DW (2002) Sustained
loss of a neoplastic phenotype by brief inactivation of MYC.
Science 297, 102-104.
Jones RM, Branda J, Johnston KA, Polymenis M, Gadd M,
Rustgi A, Callanan L, Schmidt EV (1996) An essential E box
in the promoter of the gene encoding the mRNA cap-binding
protein (eukaryotic initiation factor 4E) is a target for
activation by c-myc. Mol Cell Biol 16, 4754-4764.
Manion MK and Hockenbery DM (2003) Targeting BCL-2-
related proteins in cancer therapy. Cancer Biol Ther 2,
S105-114.
Mateyak MK, Obaya AJ, Adachi S and Sedivy JM (1997)
Phenotypes of c-Myc-deficient rat fibroblasts isolated by
targeted homologous recombination. Cell Growth Differ 8,
1039-1048.
McMahon SB, Van Buskirk HA, Dugan KA, Copeland TD and
Cole MD (1998) The novel ATM-related protein TRRAP is
an essential cofactor for the c-Myc and E2F oncoproteins.
Cell 94, 363-374.
Mugrauer G, Alt FW and Ekblom P (1988) N-myc proto-
oncogene expression during organogenesis in the developing
mouse as revealed by in situ hybridization. J Cell Biol 107,
1325-1335.
Nilsson, JA and Cleveland, JL (2003) Myc pathways provoking
cell suicide and cancer. Oncogene 22, 9007-9021.
Nilsson, JA, Maclean, KH, Keller, UB, Pendeville, H, Baudino,
TA and Cleveland, JL (2004) Mnt loss triggers Myc
transcription targets, proliferation, apoptosis, and
transformation. Mol Cell Biol 24, 1560-1569.
Park J, Kunjibettu S, McMahon SB, Cole MD (2001) The ATM-
related domain of TRRAP is required for histone
acetyltransferase recruitment and Myc-dependent
oncogenesis. Genes Dev 15, 1619-1624.
Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A,
Ribatti D, Semple SC, Gambini C, Allen TM and Ponzoni M
(2003) Targeted liposomal c-myc antisense
oligodeoxynucleotides induce apoptosis and inhibit tumor
growth and metastases in human melanoma models. Clin
Cancer Res 9, 4595-4605.
Pelengaris S, Khan M and Evan G (2002a) c-MYC: more than
just a matter of life and death. Nat Rev Cancer 2, 764-776.
Pelengaris S, Khan M and Evan G (2002b) Suppression of Myc-
induced apoptosis in beta cells exposes multiple oncogenic
properties of Myc and triggers carcinogenic progression. Cell
109, 321-334.
Pelengaris, S, Littlewood, T, Khan, M, Elia, G and Evan, G
(1999) Reversible activation of c-Myc in skin: induction of a
complex neoplastic phenotype by a single oncogenic lesion.
Mol Cell 3, 565-577.
Saucedo LJ and Edgar BA (2002) Why size matters: altering cell
size. Curr Opin Genet Dev 12, 565-571
Schmidt ML, Salwen HR, Manohar CF, Ikegaki N and Cohn SL
1994 The biological effects of antisense N-myc expression in
human neuroblastoma. Cell Growth Differ 5, 171-178.
Schreiber-Agus, N, Meng, Y, Hoang, T, Hou, H, Jr, Chen, K,
Greenberg, R, Cordon-Cardo, C, Lee, HW and DePinho, RA
(1998) Role of Mxi1 in ageing organ systems and the
![Page 62: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/62.jpg)
Walker et al: Targeting Myc function in cancer therapy
368
regulation of normal and neoplastic growth. Nature 393,
483-487.
Seoane J, Le HV and Massague J (2002) Myc suppression of the
p21(Cip1) Cdk inhibitor influences the outcome of the p53
response to DNA damage. Nature 419, 729-734.
Sherr, CJ (2001) The INK4a/ARF network in tumour
suppression. Nat Rev Mol Cell Biol 2, 731-737.
Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R,
Eisenman RN (2002) Quantitative proteomic analysis of Myc
oncoprotein function. EMBO J 21, 5088-5096
Siemann DW, Chaplin DJ and Horsman MR (2004) Vascular-
targeting therapies for treatment of malignant disease.
Cancer 100, 2491-2499
Smith JB and Wickstrom E. (1998) Antisense c-myc and
immunostimulatory oligonucleotide inhibition of
tumorigenesis in a murine B-cell lymphoma transplant
model. J Natl Cancer Inst 90, 1146-1154.
Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky
H, Moroy T, Bartek J, Massague J, Hanel F, Eilers M. (2001)
Repression of p15INK4b expression by Myc through
association with Miz-1. Nat Cell Biol 3, 392-9.
Toyo-oka K, Hirotsune S, Gambello MJ, Zhou ZQ, Olson L,
Rosenfeld MG, Eisenman R, Hurlin P and Wynshaw-Boris A
(2004) Loss of the Max-interacting protein Mnt in mice
results in decreased viability, defective embryonic growth
and craniofacial defects: relevance to Miller-Dieker
syndrome. Hum Mol Genet 13, 1057-1067.
Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Martin
GR and Bishop JM (2001) c-Myc regulates mammalian body
size by controlling cell number but not cell size. Nature 414,
768-773.
Waelti ER and Gluck R (1998) Delivery to cancer cells of
antisense L-myc oligonucleotides incorporated in fusogenic,
cationic-lipid-reconstituted influenza-virus envelopes
(cationic virosomes). Int J Cancer 77, 728-733.
Waikel RL, Kawachi Y, Waikel PA, Wang XJ and Roop DR
(2001) Deregulated expression of c-Myc depletes epidermal
stem cells. Nat Genet 28, 165-168.
Waikel RL, Wang XJ, and Roop DR (1999) Targeted expression
of c-Myc in the epidermis alters normal proliferation,
differentiation and UV-B induced apoptosis. Oncogene 18,
4870-4878.
Wang S and El-Deiry WS (2004) The p53 pathway: targets for
the development of novel cancer therapeutics. Cancer Treat
Res 119, 175-187.
Wanzel, M, Herold, S and Eilers, M (2003) Transcriptional
repression by Myc. Trends Cell Biol 13, 146-150.
Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S,
Kogan S, Cordon-Cardo C, Pelletier J, Lowe SW (2004)
Survival signalling by Akt and eIF4E in oncogenesis and
cancer therapy. Nature 428, 332-337.
Wickstrom E L, Bacon T A, Gonzalez A, Freeman D L, Lyman
G H and Wickstrom E 1988 Human promyelocytic leukemia
HL-60 cell proliferation and c-myc protein expression are
inhibited by an antisense pentadecadeoxynucleotide targeted
against c-myc mRNA. Proc Natl Acad Sci USA 85, 1028-
1032.
Yin X, Giap C, Lazo JS and Prochownik EV (2003) Low
molecular weight inhibitors of Myc-Max interaction and
function. Oncogene 22, 6151-6159.
Zhou C, Gehrig PA, Whang YE and Boggess JF (2003)
Rapamycin inhibits telomerase activity by decreasing the
hTERT mRNA level in endometrial cancer cells. Mol
Cancer Ther 2, 789-795.
Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL,
Sherr CJ, Roussel MF (1998) Myc signaling via the ARF
tumor suppressor regulates p53-dependent apoptosis and
immortalization. Genes Dev 12. 2424-2433.
Dr. Peter J. Hurlin
![Page 63: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/63.jpg)
Gene Therapy and Molecular Biology Vol 8, page 369
369
Gene Ther Mol Biol Vol 8, 369-384, 2004
Transfection pathways of nonspecific and targetedPEI-polyplexesReview Article
Vicent M. Guillem1 and Salvador F. Aliño2
1Servei d’ Hematologia i Oncologia. Hospital Clínic Universitari. Facultat de Medicina. Universitat de València. Avda.
Blasco Ibañez 17, 46010 – València (Spain)2Grup de Teràpia Gènica. Departament de Farmacologia. Facultat de Medicina. Universitat de València. Avda. Blasco
Ibañez 15, 46010 – València (Spain)
__________________________________________________________________________________*Correspondence: Salvador F. Aliño, Departament de Farmacologia. Facultat de Medicina, Universitat de València, Blasco Ibañez 15,
46010 – Valencia (Spain); Phone: (+34) 96 386 46 21; Fax: (+34) 96 386 49 72; E-mail: [email protected]
Key words: PEI-polyplexes, transfection, DNase degradation, Interactions, cell surface, cell culture medium, specificity, efficacy, cell
internalization, Endosome trafficking, proton-sponge effect, Cytoplasm transport, nuclear accession, dissociation
Abbreviations: Polyethyleneimine, (PEI); polylysine, (PLL); polyamidoamine dendrimers, (PAMAM dendrimers); epithelial growth
factor, (EGF); basic fibroblast growth factor, (bFGF); 2-(dimethylamino)ethylmethacrylate, (pDMAEMA); transferrin-polylysine
polyplexes, (Tf-pLL); poly-[N-(2-hydroxypropyl)methacrylamide], (pHPMA)
Received: 30 April 2004; Accepted: 24 June 2004; electronically published: September 2004
Summary
Polyethyleneimine (PEI) based vectors have become in an important vehicle for nonviral gene transfer. However,despite their extensive use and efficacy in the transfection of several cellular models both in vitro and in vivo , themechanism by which they transfect cells has not been fully elucidated, and controversy remains over theinterpretation of some apparently contradictory findings. A review is made of the studies on PEI polyplexes,
focusing on PEI polyplex transfection properties (as physico-chemical characteristics important for transfection)and the mechanistic findings of PEI polyplex transfection comprising cell membrane binding with nonspecific andtargeted–PEI polyplexes, the putative internalization pathways (such as the proton sponge hypothesis), the nuclearbioavailability of the transported nucleic acid, and other relevant issues such as the influence of polyplex size in vitro
upon transfection activity.
I. IntroductionSpecific and efficient delivery of nucleic acid into
targeted cells is a priority objective of gene therapy. To
achieve successful modification of the gene expression
pattern, the exogenous nucleic acid must overcome a
series of obstacles to gain access first to the cell and
posteriorly to the intracellular compartments, where the
nucleic acid exerts its function. Since nucleic acid uptake
by cells is an inefficient process, it has been necessary to
develop several strategies to increase nucleic acid
delivery. One of the approaches is based on the use of
nonviral vehicles such as liposomes (Wong et al, 1980;
Alino et al, 1993), lipoplexes or nucleic acid-cationic lipid
complexes (Felgner et al, 1997), and polyplexes (Gebhart
and Kabanov 2001) - complexes of nucleic acids and
cationic polymers such as polyethyleneimine (PEI)
(Boussif et al, 1995). Due to its intrinsic transfection
properties, PEI has been used to conform the backbone of
a great number of vector formulations. Despite their
widespread use and demonstrated efficacy in the
transfection of several cellular models both in vitro and in
vivo, the mechanism by which they transfect cells has not
been fully elucidated, and controversy remains over the
interpretation of some apparently contradictory findings.
The present review discusses the hypothetical transfection
pathways of PEI-polyplexes - from vector binding to the
cell membrane to nucleic acid arrival in the nucleus, the
influence of physico-chemical properties of PEI in
transfection activity and other relevant issues such as the
influence of polyplex size and cell type upon transfection
activity, and the most relevant differences or similarities
between PEI and other polymers used in transfection
(fundamentally polylysine polyplexes).
II. Characteristics of PEI-polyplexes
A. PEI physico-chemical properties ofimportance for transfection
PEI is a synthetic polymer with a nitrogen-carbon
base (32.5% nitrogen). Ethanolamine, the monomeric unit
of PEI (CH2-CH2-NH-), confers great PEI solubility in
![Page 64: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/64.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
370
water and most polar solvents. The most prominent
characteristic of PEI is its high positive charge density
(20-25 mEq/g), which facilitates ionic interaction with
negatively charged molecules such as nucleic acids, via
the protonation of amine groups taken from the
surrounding medium. This implies the existence of a
correlation between PEI positive charge density and the
pH of the medium, which (as we will see) largely accounts
for the transfection properties of PEI. Two types of
polyethyleneimine are used in transfection: branched PEI
(mainly of molecular weights 25 and 800 KDa) (Boussif et
al, 1995) and linear PEI (22 kDa) (Ferrari et al, 1997).
Branched PEI has three kinds of amine groups – primary,
secondary and tertiary - with an amine ratio of 1:2:1,
respectively, while linear PEI amines are exclusively
secondary. Thus, while linear PEI acquires its positive
charge density through the protonation of secondary
groups, branched PEI possesses additional primary amine
groups for protonation. Based on the existing protonation
profile, only every 5 or 6 amino groups are protonated a
physiological pH (Suh et al, 1994). In addition to being
most basic and also most reactive, the primary amine
groups are amenable to chemical modification and have
been used to covalently attach different types of molecules
with the aim of conferring additional properties to the
vector. Nucleic acid-PEI binding slightly changes the PEI
protonation profile, one-half to one-third of the amine
groups being protonated at physiological pH. Therefore, in
contrast to other polymers such as polylysine (PLL), PEI
possesses a great buffering capacity over a very wide pH
range (Tang and Szoka 1997).
B. PEI-polyplex physico-chemical
properties of importance for transfectionAs has been commented, polyplex formation occurs
as a result of ionic interaction between negative DNA
charges provided by phosphate groups, and the positive
charge of the cationic polymer (Kabanov and Kabanov
1995) - provided in the case of PEI by protonated amine
groups. The size and shape of the resulting polyplex
particles depends on the conditions under which they are
prepared.
An important part of polyplex transfection activity
depends on the polyplex physico-chemical characteristics.
Therefore, characterization of the physico-chemical
properties and knowledge of the parameters that can
modify them could be very useful for predicting and
defining the conditions of preparation capable of ensuring
optimal transfection performance. The physico-chemical
characteristics of polyplexes (structure, size, charge,
capability of interaction with biomolecules) are largely
dependent on factors inherent to the nature of the
polycation (structure, molecular weight, charge density,
etc.), but also on properties common to all polymers, such
as the charge or mass ratio between polymer and DNA,
and also on the characteristics of the solvent used for the
electrostatic reaction – such as the ionic force (De Smedt
et al, 2000). Of all physico-chemical parameters, the size
of the complexes seems to be directly associated to
transfection activity (Ogris et al, 1998), while the rest of
parameters are relevant to transfection in the degree in
which they affect polyplex size. The latter can vary from a
few nanometers to several micrometers (Tang and Szoka
1997) - complexes of larger size being aggregates of
particles of smaller size. Polyplex size depends on several
parameters, such as the cation/anion ratio, DNA and
polycation concentration, solution volume, and mixing
speed. Moreover, size is greatly influenced by the
presence of other electrolytes in the dissolution. Each of
these factors will be analyzed separately below.
1. Influence of charge ratioOn examining the variation of size with respect to
charge ratio, it is seen that under conditions of non-
aggregation (preparation in water), low +/- charge ratios
yield small particles. Size progressively increases until the
neutralization charge is reached, and decreases again as
the net positive charge increases – this being thought to
favor solubility of the polyplex particles (Kabanov and
Kabanov 1995; Tang and Szoka 1997; Pouton et al, 1998).
In the case of PEI-polyplexes, complete condensation
takes place from a N/P ratio of 2 or 3 (where N is the
number of polymer nitrogen atoms and P the number of
DNA phosphorus atoms), with the formation of neutral
charge particles (Erbacher et al, 1999a). At these ratios, a
tendency towards particle aggregation is observed. The
compact particles of smaller size are generally obtained at
higher N/P ratios, yielding polyplexes of positive net
charge (Erbacher et al, 1999a). At N/P ratios generally
used to obtain complete condensation (N/P >4), PEI/DNA
complexes present a zeta potential of around + 30-35 mV
(Kircheis et al, 1999; Ogris et al, 1999). With respect to
shape, small polyplexes have revealed toroidal structures
measuring between 40-80 nm, according to electron
microscopic estimations (Tang and Szoka 1997) and
dynamic light scattering studies (Ogris et al, 1998), as well
as globular structures of up to 20-40 nm according to
estimations of atomic force microscopy (Dunlap et al,
1997). In comparison, large-size polyplexes are generally
spherical or aggregates of micrometric size.
2. Influence of preparation conditionsThe preparation conditions greatly influence
polyplex size and structure, mostly at aggregation level.
The most relevant factors are salt concentration and the
concentration of DNA and PEI before and after
preparation. In general, polyplexes formed in saline
solutions are larger than those formed in water (low ionic
force) (Tang and Szoka 1997; Ogris et al, 1998; Kwoh et
al, 1999), and size can moreover change over time (Ogris
et al, 1998). In addition, even when polyplexes are formed
under conditions of low ionic force, and despite the
presence of the strong positive polyplex charge, many
polyplexes (such as those composed of PLL) effectively
aggregate when added to saline solutions of physiological
concentration (Pouton et al, 1998). This aggregation
tendency is probably related to a decrease in the real zeta
potential due to the presence of saline electrolytes (Tang
and Szoka 1997). According to these authors, this
behavior is partially dependent on the type of cationic
![Page 65: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/65.jpg)
Gene Therapy and Molecular Biology Vol 8, page 371
371
polymer involved. For example, PLL polyplexes and
polyamidoamine dendrimers (PAMAM dendrimers) tend
to form aggregates, whereas PEI polyplexes and fractured
dendrimers (starburst dendrimers) are more resistant to
aggregation (Tang and Szoka 1997).
Other authors have demonstrated the importance of
DNA and polymer concentration. For example, PLL
polyplexes aggregate when the DNA solution is highly
concentrated (400 µg/ml), and do not aggregate when the
DNA concentration is lower (Duguid et al, 1998). This
tendency to aggregate at certain concentrations is frequent
in almost all polymers. When equal volumes of prediluted
polymer and DNA are used, differences in transfection
effectiveness associated to the sequence of the addition of
the reagents are scantly relevant (Kircheis et al, 2001c;
Wightman et al, 2001), though when the concentrations
are high, the mixing order becomes relevant. Thus,
transfection activity in vitro was found to be 10-fold
greater when the polymer (PEI) was added to the plasmid
DNA (drop by drop) than when the inverse approach was
adopted, i.e., adding the DNA to the polymer (Boussif et
al, 1995, 1996). Such differences were in fact associated to
differences in the size of the polyplexes prepared in one or
other way (larger polyplexes being the most efficacious)
(Ogris et al, 1998).
3. Influence of PEI typeWhile there do not seem to be important differences
in zeta potential between polyplexes formed with the
different types from PEI (i.e., linear versus branched and
high versus low molecular weight)(Kircheis et al, 2001b),
the influence of PEI type upon particle size is remarkable
under certain preparation conditions. For example, while
at low ionic force the sizes of polyplexes prepared with
different types of PEI (linear and branched, with different
molecular weights) seem to be quite invariable, the
behavior of branched and linear PEI polyplexes clearly
diverges when the complexes are formed at physiological
ionic force. While complexes formed with branched PEI
(25 or 800 kDa, indistinctly) are small (50-80 nm) or
medium-sized (100 to some hundreds of nm), depending
on the DNA concentration, complexes formed with linear
PEI of molecular weight 22 kDa conform large aggregates
– the size increasing with incubation time (Kircheis et al,
2001b). The same behavior is observed when linear 22-
kDa polyplexes initially prepared in a medium without
salts are later added to a saline medium (Goula et al,
1998b; Kircheis et al, 2001b; Wightman et al, 2001). As
can be expected, these differences in size between linear
and branched PEI polyplexes exert a great influence upon
transfection activity. In some cell types, the transfection
activity of linear PEI of molecular weight 22 kDa is
similar to that of branched PEI (Demeneix et al, 1998)
(Poulain et al, 2000), whereas in others it is remarkably
greater (Poulain et al, 2000; Wightman et al, 2001) – this
phenomenon being attributed to the greater size of linear
PEI polyplexes when prepared in saline medium. This
advantage disappears when the complexes are prepared in
nonsaline medium that avoids aggregation (HBG, 5,
glucose). In this medium, both linear and branched PEI-
polyplexes are small and of similar size (Poulain et al,
2000; Wightman et al, 2001).
4. Influence of PEI molecular weight
The first studies of the influence of molecular weight
in transfection, involving both linear and branched
polyplexes, pointed to the existence of an optimum
molecular weight (around 20-25 kDa) at which PEI
polyplexes show improved transfection performance
(Demeneix et al, 1998; Fischer et al, 1999; Godbey et al,
1999b; Jeong et al, 2001). At higher and lower molecular
weights transfection efficacy decreases. Some authors
have tried to explain this molecular weight dependency. It
has been postulated that low molecular weight constructs
show poorer transfection either because they are more
unstable and more easily dissociable in saline medium
(Papisov and Litmanovich 1988) than high weight
constructs, or because their endosomal release capacity is
less (Boussif et al, 1996; Kircheis et al, 2001c). The slight
decreasing tendency in transfection efficacy for molecular
weights larger than 20 kDa is attributed to increased
polyplex toxicity (Bieber and Elsasser 2001).
Nevertheless, the optimum molecular weight range seems
to differ from one cell line to another. Such differences are
attributed to an increase in toxicity with growing
molecular weight, and to variable cell sensitivity to PEI.
C. Protection against DNase degradation
One of the consequences derived from polyplex
formation is nucleic acid protection from degradation by
nucleases. Practically all cationic polymers are able to
afford variable DNA protection against DNase
degradation once the polyplex has been formed (De Smedt
et al, 2000) - PEI being one of the most protective
polymers (Kircheis et al, 2001c; Moret et al, 2001;
Guillem et al, 2002b). This property is of vital importance
for transfection activity in vitro and in vivo, since it allows
protection of the nucleic acid from intracellular
(endolysosomal digestion) as well as extracellular
degradation (through serum nuclease action).
D. In vitro transfection properties of PEI-polyplexes
The in vitro transfection activity of polyplexes is
influenced not only by the intrinsic properties of the latter
(as described above), but also by other inherent factors
associated to the transfection process, such as polyplex
concentration, incubation time, polyplex interaction with
the culture medium, and the type of cells used (Boussif et
al, 1996). It is difficult to establish systematic comparisons
between the transfection activities of different polyplexes,
since there is a great variety of cationic polymers, and the
optimum transfection conditions vary from one polyplex
system to another, as well as from one cell line to another.
Perhaps two of the most exhaustive studies comparing the
transfection activity of nonspecific polyplexes are those
carried out in the 3T3 (Demeneix et al, 1998) and Cos-7
cell lines (Gebhart and Kabanov 2001), employing several
![Page 66: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/66.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
372
polyplexes - including PEI. According to these studies,
PEI and PAMAM polyplexes present the best transfection
activities, compared with other polymers, at least in these
cell lines. In reference to PEI, the transfection activity in
vitro has been established in a broad variety of cells. The
first form of PEI used for gene transfer was the branched
form with a molecular weight of 800 kDa, applied to
different cell lines and tissues, as well as in local
administration to the brain (Boussif et al, 1995).
Posteriorly, these authors described PEI (branched 800
kDa type) mediated transfection in 25 different cell types,
including 18 human cell lines as well as primary rat and
pig cells (Boussif et al, 1996; Demeneix et al, 1998).
Branched PEI of low molecular weight (25 kDa) was
introduced soon afterwards (Abdallah et al, 1996),
affording superior transfection efficacy and toxicity versus
the high molecular weight form. In fact, this form of
branched PEI has allowed the transfer and expression of
genes incorporated to large gene constructs, as is the case
of the artificial 2300-kb chromosomes (Marschall et al,
1999). Such results had not been obtained up until that
time with any other type of vector. These two branched
forms of PEI have been used with significant efficacy in
terms of cell transfection, and have been the standard
forms of PEI employed for nucleic acid transference
(Godbey et al, 1999a). The linear PEI form was developed
soon afterwards (Ferrari et al, 1997). As has been
mentioned above, it displays some significant differences
in transfection profile (not only in vitro but also in vivo)
that can be interesting for certain applications. However,
despite the well demonstrated transfection activity of PEI
polyplexes and their widespread use as a regular tool for
transfection in different laboratories, our understanding of
the PEI transfection process remains incomplete. In the
following section we review the mechanistic findings of
transfection with PEI polyplexes.
III. Mechanisms of the in vitro
transfection process with PEI polyplexes
This section describes the pathway of PEI polyplexes
in the transfection process, from polyplex addition to the
cell culture to arrival of the nucleic acid in the nucleus. To
make understanding easier, the section has been divided
into different sections referring to the most relevant stages
of the polyplex pathway, including interaction with the
cell culture medium and the subsequent cellular barriers
(cell membrane, endosome-lysosome, cytoplasm and
nuclear envelope), and other important issues (influence of
particle size, targeting, etc.) in the context of each phase.
A. Interaction with cell culture medium
Once the polyplex has been prepared, the next step
consists of polyplex incubation with cells. Polyplex
interaction with elements of the cell culture medium (ions,
anionic proteins from serum) can originate structural
changes in size and surface charge that in turn can affect
transfection activity. Although polyplexes generally seem
to be less sensitive to serum than lipoplexes (Gebhart and
Kabanov, 2001), the presence of serum can reduce or even
increase the transfection activity of some polyplexes-
concretely when serum absence or presence produces
changes in polyplex size. Some authors (Guo and Lee,
2001) have suggested that the inhibiting role of serum on
transfection is associated to the stabilization of small PEI
polyplexes (of smaller transfection efficacy), in a way
similar to what happens with lipoplexes (Turek et al,
2000). According to this hypothesis, initially large
complexes or initially small complexes that increase in
size on coming into contact with the culture medium,
would be resistant to serum inhibition. The influence of
polyplex size upon transfection activity is discussed in
greater detail in the following sections.
B. Interactions between polyplexes and
the cell surface
It can be considered that in vitro transfection begins
with polyplex interaction with the cell membrane.
Different forms of membrane interaction can be defined:
nonspecific interactions with receptors or other
components of the cell membrane (such as proteoglycans),
and specific interactions with membrane receptors
(Godbey and Mikos, 2001). The type of interaction
depends on whether the polyplex is targeted or not, and on
the cell type involved in transfection.
1. Nonspecific cell interaction of untargeted
polyplexesIt is generally accepted that the interaction of an
untargeted polyplex with the cell essentially consists of an
ionic interaction between the positive polyplex charges
and the negative charges of the cell membrane (Kabanov
and Kabanov, 1995). Specifically, it is thought that
polyplex interaction with the cell surface takes place
fundamentally with sulfated proteoglycans, which are
negatively charged proteins present in the membrane
(Kjellen and Lindahl 1991). Evidence to this effect is
provided by the fact that cell treatment with heparinase
and chondroitinase (enzymes that degrade proteoglycans)
or the use of mutant cell lines deficient in proteoglycan
production dramatically inhibits transfection with PLL
polyplexes (Mislick and Baldeschwieler). A similar
mechanism is postulated for other polymers including as
PEI polyplexes. Recent studies indicate that such
interactions with the membrane proteoglycans are decisive
not only in the interaction process, but also in subsequent
polyplex internalization (Kircheis et al, 2001a). These
studies suggest that the transfection differences observed
between different cell types are associated to the levels of
proteoglycan expression (Mislick and Baldeschwieler
1996; Labat-Moleur et al, 1996; Godbey and Mikos 2001;
Wiethoff et al, 2001). If this were the case, and since
several cell types are characterized by low or nil
proteoglycan expression (e.g., hematopoietic cells), the
latter can be considered difficult to transfect with
nonspecific polyplexes (Ogris et al, 2000), and
transfection in these cell types would thus require the
incorporation of additional elements to the polyplex
construct in order to promote cell interaction.
![Page 67: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/67.jpg)
Gene Therapy and Molecular Biology Vol 8, page 373
373
2. Specific cell interaction of targeted
polyplexes. Influence of targeting upon vector
properties: specificity, efficacy, cell internalizationConsidering the need to improve polyplex specificity
and efficacy, effort has centered on combining and even
exchanging nonspecific interaction between polyplexes
and the cell surface via a specific cellular internalization
mechanism, by incorporating ligands attached to the
vectors. The development of targeted polyplexes has as
main aim their application to in vivo therapy, where
selectivity in gene delivery is particularly important.
Nevertheless, in vitro targeting, in addition to testing the
selectivity of a possible ligand for subsequent in vivo use,
is especially interesting when transference through
nonspecific interaction is very low. This is the case of cells
that grow in suspension, such as lymphocyte derived cell
lines, whose proteoglycan expression is very low and
nonspecific polyplex transfection fails (Ogris et al, 2000).
In the case of PEI-polyplexes, it has been demonstrated
that the incorporation of targeting elements not only
contributes to improve the specificity of delivery but also
increases the activity of transfection in different cell lines
(Erbacher et al, 1999b).
In general, targeted polyplexes have been based on
the covalent attachment of a targeting element to the
polymer, PLL and PEI being the most commonly used
elements. This strategy began with the experiments of Wu
et al, (1987), which targeted complexes of
asialoorosomucoid-PLL/DNA to the asialoglycoprotein
receptors of hepatic cells. Other ligands frequently used
for selective nucleic acid delivery are: a) transferrin
(Wagner and al.), whose receptor is abundant in tumor
cells (Wagner et al, 1990; Cotten et al, 1993); b)
galactosylated ligands (Plank et al, 1992) or asialofetuin
(Dasi et al,) for hepatocyte targeting; c) epithelial growth
factor (EGF) (Chen et al, 1994, Cristiano and Roth 1996)
and basic fibroblast growth factor (bFGF) (Sosnowski et
al, 1996) for targeting lung cancer cells; and d) antibodies
that recognize specific membrane elements, such as anti-
PECAM (platelet endothelial cell adhesion molecule), for
selective transference to endothelial cells (Li et al, 2000).
In this last group, one of the best developed models is
based on specific gene transfer to T cells using antibodies
against membrane antigens that are expressed
fundamentally in these cells, such as JL1 (Suh et al, 2001),
CD3 (Erbacher et al, 1999a; O'Neill et al, 2001) and CD4
(Puls and Minchin, 1999).
Although in some models these targeted polyplexes
have produced interesting results, the need for specific
synthesis of the vector for each target cell greatly limits
their use and increases the economic cost - especially
when a monoclonal antibody is used as targeting element.
A more versatile targeting method is based on the use of
the streptavidin-biotin system, which had been previously
used to prepare targeted immunoliposomes (Alino et al,
1999). In this case, targeted gene delivery was based on
the attachment of biotinylated antibodies (against
membrane antigens) on the cell surface, with the
subsequent addition of polyethylenimine-avidin-DNA
complexes to interact with cell-attached antibodies (Wojda
and Miller, 2000) through the specific avidin-biotin
interaction. The in vitro transfection results in terms of
effectiveness obtained with this procedure are limited,
though the main disadvantage is that for further in vivo
development, complete vector assembly must be made
before administration.
Taking these previous studies as reference, we
attempted to construct a targeted polyplex (which we have
called immunopolyplex), the salient characteristic of
which is the possibility of easily replacing the targeting
element, leaving the polyplex backbone intact.
Streptavidin protein was thought to be attached covalently
to PEI, acting as a bridge molecule for direct binding of
biotinylated proteins (targeting elements) to the vector.
The streptavidin-biotin system is considered to allow
targeting element replacement without complicated
protocol modifications, avoiding the need for specific
synthesis of the vector for each case, and moreover
allowing considerable savings in time and money. Since a
great amount of biotin-labeled antibodies against
membrane antigens are commercially available, they can
easily be used to determine the most suitable targeting
element for many targeted nucleic acid strategies. Due to
the therapeutic interest and difficulty of hematopoietic cell
gene transfer, our work with immunopolyplexes has
focused on the transference of genes and oligonucleotides
to cell lines of hematological origin, which proved hard to
transfect through nonspecific pathways. Thus, we selected
as targeting elements several biotinylated antibodies that
specifically recognize some membrane antigens of
hematopoietic cells. Initially we started with a set of
commercial biotin labeled antibodies against the following
antigens: CD4 and CD3 for T lymphocyte targeting,
CD19, CD20, CD21, CD22 for B lymphocyte targeting
and CD45 and CD71 for panlymphocytic targeting. The
best results were obtained with immunopolyplexes
carrying CD3 antibody for T cell transfection (Guillem et
al, 2002a, 2002b) and CD19 antibody for B cell
transfection (Guillem et al, 2002b) (Figure 1). We found
that immunopolyplex activity was fundamentally specific
and mediated mainly through specific antigen-antibody
interaction, and that anti-CD3 immunopolyplex is more
efficacious in T cells than anti-CD19 in B cells (4- or 5-
fold in terms of the percentage of positive cells, and 6- to
12-fold in terms of fluorescence intensity per cell). In this
case, abundance of antigen could be a parameter for partly
explaining observed differences in transfection activities:
we found CD3 in T cell line (Jurkat) to be about 3-fold
more abundant than CD19 in B cell line (Granta 519).
However, this is not the only parameter to be taken into
account for explaining or predicting transfection activities
in general. As some authors have suggested (O'Neill et al,
2001), the efficiency of transgene expression could be
affected by signaling events following antibody-antigen
interaction. For example, we observed that although CD45
is 4-fold more abundant than CD3 in Jurkat cells,
transfection with anti-CD45 immunopolyplexes displayed
poor results (data not shown). The lack of transfection is
probably related to the notion that CD45 does not
internalize upon antibody binding, as previously reported
(van der Jagt et al, 1992). In this case, although anti-CD45
immunopolyplex does bind to CD45 membrane antigen,
![Page 68: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/68.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
374
Figure 1: Fluorescence imaging of EGFP transfection with immunopolyplexes. Granta 519 B cell line (CD3-/CD19+, up) and
Jurkat T cell line (CD3+/CD19-, down) were transfected with p3CEGFP (5 mg/ml), employing anti-CD3(left,up and down) and anti-
CD19 (right, up and down) immunopolyplexes as vehicles . The imaging shows cells seen under fluorescence microscopy 24 h after
transfection.
its internalization might not be promoted. In the case of
CD3, the fact that CD3 antibody binding stimulates cell
proliferation can be taken to constitute a collateral effect
favoring transfection efficacy, since it eliminates the
nuclear membrane in the transfection period. Conversely,
antibodies that after antigen binding stimulate cell
apoptosis, such as CD20 (Cardarelli et al, 2002), would
dramatically impair the transfection process by eliminating
targeted cells. All these facts should be taken into account
when designing a targeting model, though when the
antigen-antibody profile is not known, antibody screening
could easily be performed with immunopolyplex until the
most suitable targeting option is identified.
C. Polyplex internalization: size doesmatter
Although endocytosis is accepted to be the general
mechanism responsible for cellular internalization of
polyplexes (Kircheis et al, 1997; Godbey et al, 1999c), the
term comprises very different forms of internalization,
including fluid phase endocytosis (Remy-Kristensen et al,
2001), nonspecific absorptive endocytosis (Labat-Moleur
et al, 1996; Mislick and Baldeschwieler 1996),
phagocytosis, macropinocytosis (Remy-Kristensen et al,
2001), and receptor mediated endocytosis (Boussif et al,
1996; Ogris et al, 1998). The first studies of polyplex
internalization mechanisms were performed with
transferrin-polylysine polyplexes (Tf-pLL)(Cotten et al,
1990; Zenke et al, 1990; Wagner et al, 1991). These
authors reported important in vitro transfection with small
particles (diameter !100 nm), and suggested that clathrin-
coated pits were implicated in receptor mediated
endocytosis (Wagner et al, 1990). Without further
evidence, it was quickly assumed that this mechanism
could be the preferential internalization route for other
polyplexes and, at the same time, that it should restrict the
internalization of complexes greater than 100 nm. This
correspondence seemed to be satisfied by PLL (Wagner et
al, 1991) and pDMAEMA (2-(dimethylamino)ethyl
methacrylate) polyplexes (van de Wetering et al, 1998),
since complexes of a few hundreds of nanometers
transfected better than those of micrometric size.
Subsequent research with PEI-polyplexes (Ogris et al,
1998) demonstrated that polyplexes of great size can also
benefit from specific internalization mediated by receptor,
resulting in even greater transfection levels than with
small constructs (Ogris et al, 1998; Wightman et al, 2001).
In an attempt to account for these apparently
contradictory findings, some authors have suggested
hypotheses to explain the relation between transfection
efficacy and construct size. One hypothesis suggests that
larger (and therefore heavier) polyplexes settle upon the
cells, creating a greater local polyplex concentration which
would force interaction with the cells. In contrast, small
![Page 69: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/69.jpg)
Gene Therapy and Molecular Biology Vol 8, page 375
375
polyplexes remain in suspension and their contact with the
cells would be more limited (Boussif et al, 1996; Ogris et
al, 1998). This hypothesis is sustained by the fact that on
promoting sedimentation of small polyplexes over cells by
centrifugation, transfection efficacy increases (Boussif et
al, 1996). This hypothesis assumes that there are no
significant internalization differences between large and
small PEI-polyplexes, since if the internalization of large
polyplexes were greatly impaired, the effect of the higher
local concentration could be neutralized. This explanation
by itself, which could help account for the differences with
PEI-polyplexes, fails to explain the behaviour of
polyplexes in general - since it does not account for PLL
polyplexes behaving in exactly the opposite way, i.e.,
large polyplexes transfect worse than small constructs. It
could be argued that the assumption that PEI and PLL
polyplexes follow the same internalization pathway has
not been demonstrated, since some authors have proposed
different internalization pathways for PEI and PLL
polyplexes (Godbey et al, 2000), and these could be
influenced differently by polyplex size. Moreover, the
influence of size upon transfection seems to be strongly
dependent on the type of cell involved, though the PEI and
PLL polyplex experiments mentioned above were
performed in the same cell line model (K562 cells).
Another proposed explanation suggests that the
reduced transfection efficacy of small PEI-polyplexes is
due to their lesser capacity to destabilize the endosomes
compared with larger PEI-polyplexes. Since PEI is though
to behave as a proton sponge that destabilizes the
endosome (Behr 1996)(see the following section), these
authors assume that a critical minimum amount of PEI
must reach the endosome to cause its rupture, and suggest
that small PEI-polyplexes do not contain sufficient
polymer to promote endosome disruption as effectively as
the larger constructs. This hypothesis is supported by the
observation that the transfection efficacy of small particles
increases in the presence of lysosomotropic agents
(chloroquine or endosomolytic peptides), whereas the
efficacy of large particles is not substantially modified
(Ogris et al, 1998).
In the case of polylysine, and since the latter does not
exert an intrinsic destabilizing effect upon the endosome,
large particles would not have an advantage over small
ones in relation to endosomal release, and transfection
efficacy would fundamentally depend on internalization
effectiveness - where small polyplexes supposedly would
be favored by the possibility of using the clathrin coated
pit internalization route. In support of this explanation,
some studies of the kinetics of internalization of
fluorescent labeled transferrin PEI-polyplexes show that
while small polyplexes are rapidly and fully internalized,
those of great size remain attached to the membrane and
are internalized more slowly (Ogris et al, 2001b). Still,
total fluorescence and membrane binding fluorescence are
greater in the case of the large polyplexes that for the
small particles–thus supporting the hypothesis postulating
a greater local concentration of large polyplexes. On the
other hand, although relative internalization is less
efficient in the case of large polyplexes, the associated
transgene expression is eleven times greater than in the
case of the smaller constructs. This supports the
hypothesis of an increased endosomal release for large PEI
polyplexes.
In our studies of PEI polyplex characterization, we
have observed that when PEI-polyplexes of different sizes
are treated with DNase I, the large complexes (N/P ratios
close to charge neutrality) totally protect plasmid DNA
from degradation, while the smaller ones (high N/P ratios)
experience discrete cuts in the DNA sequence (Guillem et
al, 2002b). This would occur because a small particle
would have more DNA exposed at the polyplex surface
per unit mass than a larger particle – thereby increasing
the probability of exposure of some DNA regions at the
polyplex surface, with increased accessibility to nucleases.
We hypothesize that this same process may occur at
intralysosomal level, and can partly explain the
transfection advantage of large polyplexes versus small
constructs.
Probably the influence upon transfection efficacy of
all these processes would be the sum of the contribution of
each individual effect, favoring transfection in one of the
stages (internalization, endosomal release, access to the
nucleus), while impairing it in others.
Regarding the upper polyplex size limit for
penetrating the cell, there are at least two alternative
possibilities. One option is to accept that penetration
occurs via the internalization of polyplex particles in large
vesicles. This hypothesis receives growing support from
many studies that show that polyplexes (targeted or not)
with a size of hundreds of nanometers and of micrometric
size (Pouton et al, 1998), or even aggregates or
precipitates (such as DNA complexes with calcium
phosphate or DEAE-dextran), are able to transfect cultured
cells (De Smedt et al, 2000). Some authors have even
detected the endocytosis of large polyplex particles using
electron microscopy (Bieber et al, 2002). Retaining the
hypothesis of small particle endocytosis as preferential
internalization mechanism, the other possibility would be
to admit that large polyplexes might not be internalized
entirely, but could remain attached to the external cell
membrane surface - as suggested for transfection with
large fluorescent labeled transferring PEI polyplexes
(Ogris et al, 2001b) - and would then be internalized as
smaller fragments detached from the large ones. Both
processes could coexist, and the variable predominance of
either could depend not only on particle size, but also on
polyplex type, and the cell type involved (Kircheis et al,
2001c). In fact, some authors (Remy-Kristensen et al,
2001) have observed that in certain cells (EAhy 926 cells),
small PEI-polyplexes, initially homogeneously attached to
cell membrane, migrate to particular areas of the cell
surface, yielding large aggregates that are further taken up
in vesicles several micrometers in size (macropinocytosis).
In contrast, in other cells (L929 fibroblasts), the same
polyplexes are quickly and homogeneously internalized by
submicrometric endosomes (fluid phase endocytosis).
D. Endosome trafficking. The proton-sponge effect: influence on the transfectionefficacy of PEI-polyplexes
It is believed that after internalization, the particles
![Page 70: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/70.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
376
are directed towards the lysosomal route to be degraded
(Klemm et al, 1998; Lecocq et al, 2000). For most
polycations such as polylysine, accumulation and
degradation in the endosomal compartment is an important
obstacle in the transfection process (Mislick et al, 1995),
and explains the relatively low levels of transfection
obtained. Different strategies have been developed to
overcome this obstacle, such as the addition of
lysosomotropic agents (e.g., chloroquine) (Erbacher et al,
1996) to the culture medium, or the use of membrane
destabilizing peptides (Plank et al, 1994) or inactivated
viral particles possessing endosomolytic activity (Curiel et
al, 1991) and which can be added to the medium or bound
to the vector.
Nevertheless, some polycations such as PEI and
PAMAM fractured dendrimers (starburst dendrimers) do
not require lysosomotropic agents to exhibit substantial
transfection in vitro (Haensler and Szoka 1993;
Kukowska-Latallo et al, 1996; Tang et al, 1996; Tang and
Szoka 1997). In these cases, the addition of chloroquine
has little or no effect. Attempts have been made to explain
this behavior through the proton sponge hypothesis, which
assumes that PEI and fractured dendrimers are able to
buffer the endolysosomal pH and cause endosome
disruption via osmotic swelling (Berh 1996). The key to
the proton sponge effect would be the degree of
protonation of the polycation amine groups. Whereas at
physiological pH the amine groups of PLL are fully
protonated (pKa between 9 and 10), the amine groups of
PEI and the starburst dendrimers are only partially
protonated. Consequently, after endocytosis of such
polyplexes (PEI or PAMAM), the amine groups are able
to uptake protons from the acidic endosomal interior,
which is thought to buffer endosomal pH and induce
proton accumulation within the endosome–this in turn
being coupled to a simultaneous flow of chloride anions
towards the interior. The above authors on one hand
hypothesize that the net increase in ion concentration
would lead to a massive water input, with swelling and
ultimately rupture of the endosome, while on the other
hand it is postulated that increasing PEI protonation could
contribute to its separation from DNA via the repulsion of
internal positive charges - thereby contributing to polyplex
dissociation (Berh). However, the authors did not take into
consideration that the presence of negative DNA charges
can compensate the increase in the PEI protonation, and
therefore the internal cationic repulsion effect. Besides,
other investigators report that the differences in
transfection efficacy between PEI and PLL cannot be
sustained on the buffering effect of PEI upon lysosomal
pH, because according to their measurements the
intralysosomal pH of cells transfected with PEI-polyplexes
remains unaltered (Godbey et al, 2000; Forrest and Pack
2002). In any case, the different authors interpret their
respective findings in different ways. Thus, according to
Godbey el al., the increased effectiveness of PEI with
respect to PLL is explained by the capacity of PEI to avoid
the lysosomal degradation route followed by PLL
polyplexes. These authors accordingly proposed different
intracellular processing mechanisms for each type of
polyplex (Godbey et al, 1999a; Godbey et al, 2000). On
the other hand, Forest et al, maintain that it is necessary
for PEI-polyplexes to be exposed to an acidic environment
(endosome-lysosome fusion) in order to achieve endosome
DNA release. Moreover, they observe no trafficking of
PLL-polyplexes towards lysosomes in some cell lines.
Again, different routes for PEI and PLL polyplexes are
postulated, though in this case the situation is opposite that
proposed above. Uncertainty therefore remains about the
intracellular fate of polyplexes and their endolysosomal
processing.
Apart from such discrepancies regarding the particle
processing mechanisms, there seems to be general
agreement that knowledge of the relation between PEI-
polyplexes and intralysosomal pH is critical for
understanding PEI polyplex transfection activity. We
therefore decided to further investigate the influence of pH
upon the interaction between DNA and PEI. To this effect,
we added PEI polyplexes to solutions at different pH
(from 3.5 to 12) and studied the intensity of the resulting
interaction between DNA and PEI based on a fluorescence
decay assay (Guillem et al, 2002b). Our results indicate
that the intensity of interaction between DNA and PEI
decreases at basic pH and is enforced at acid pH values.
Considering the physico-chemical properties of PEI, this
seems logical, since at acid pH values PEI positive charge
increases and its capacity to interact with negatively
charged DNA should also increase. In contrast, as pH
becomes less acidic, the PEI positive charge decreases,
and DNA-PEI ionic interaction can be expected to
decrease gradually, releasing DNA. These data suggest
that, at intracellular level, an acidic environment, far from
stimulating the dissociation of PEI-DNA complexes
(which, if lysosomal pH is not modified by PEI
polyplexes, would threaten DNA integrity in the
lysosome), seems to actually strength PEI-DNA
interaction - and this could contribute to protect DNA
from lysosomal degradation.
Another point still far from being clarified is how
polyplexes leave the endosomes. While some authors have
used electron microscopy to detect endolysosomal
microrupture (Bieber et al, 2002), other investigators have
failed to detect any endolysosome vesicle alterations
(Remy-Kristensen et al, 2001) - even when transgene
expression is subsequently achieved. Again, the results
obtained seem to depend on the cell type involved. In any
case, if endosome disruption effectively occurs, it appears
to be on a non-massive scale, since the phenomenon has
been only scarcely detected. Nevertheless, the fact that
peptides such as melittin, which has endosomolytic
properties (thus contributing to nucleic acid release into
the cytoplasm), increase the transfection efficacy of PEI
polyplexes (Ogris et al, 2001a) speaks in favor of the
convenience of promoting endosomal release.
E. Cytoplasm transport and nuclearaccession
In reference to cytoplasmic transport, some authors
who have studied the dependence of inert particle
cytoplasmic diffusion upon size, concluded that particle
mobility is effectively dependent upon particle size – those
measuring more than 54 nm presenting impaired diffusion
![Page 71: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/71.jpg)
Gene Therapy and Molecular Biology Vol 8, page 377
377
(Luby-Phelps et al, 1987). Nevertheless, it has been found
that large particles can migrate through the cytoplasm not
only by diffusion, but also via other mechanisms in which
cytoskeletal components such as the microtubuli or actin
filaments are involved, thereby facilitating polyplex
transport (Meyer et al, 1997). Accordingly, if finally PEI
polyplexes are released into the cytoplasm following
endosomal disruption, they theoretically could be
transported to the nucleus – especially those particles
measuring less than 54 nm in size. With respect to the
nuclear envelope, one aspect that suggests the latter to be
an important barrier for nucleic acid transference to the
nucleus is the fact that when cells are allowed to undergo
mitosis after adding polylysine (Brunner et al, 2000) or
PEI polyplexes (Brunner et al, 2000; Remy-Kristensen et
al, 2001), these are transfected much more efficiently than
when the cell cycle has been arrested. Thus, it can be
concluded that mitosis (and consequently nuclear
dismantling) facilitates transfection – this being the reason
why superior transfection efficacy is generally obtained
with rapidly proliferating cells than in cells that either do
not divide or do so only slowly. Nevertheless, since some
cells that do not divide can be transfected, there must be
mechanisms for penetrating the nucleus in the presence of
the nuclear envelope.
Some authors have proposed that polyplex entry to
the nucleus could involve polyplex fusion with the nuclear
membranes, mediated by polyplex interaction with the
negatively charged membrane phospholipids (Godbey et
al, 1999c). According to these authors, at a certain
moment during polyplex trafficking, the particles could
establish contact with phospholipids - those synthesized
continuously for membrane regeneration or those from the
endosomal membrane. In any case, polyplexes could
become coated with a lipid envelope and perhaps on
interacting with the phospholipids of the nuclear envelope,
the coated polyplexes could finally fuse with the nuclear
membranes and thus access the interior of the nucleus.
Another potential route for polyplex access to the
nucleus that would not imply nuclear envelope
modification or rupture is based on the existence of the
nuclear pores. In this context, while pore diameter is 80
nm, pore structure leaves free only a central water channel
of 9 nm - though particles up to 28 nm in diameter can be
transported to the nucleus via the activation of transport
mechanisms that imply energy consumption (Nigg, 1997).
It is therefore theoretically possible for small polyplex
particles (less than 28 nm in size) to access the nucleus
through the nuclear pores. The nuclear importation of
molecules larger than 40,000 Da (generally proteins) is
known to be highly selective and depends on the presence
of a short amino acid sequence called a nuclear location
signal (NLS)(Newmeyer 1993). For this reason, with the
aim of facilitating nuclear delivery, and this improving
transfection efficacy, many polyplex formulations also
incorporate nuclear location sequences (Branden et al,
1999; Zanta et al, 1999) or peptides such as melittin (Ogris
et al, 2001a) which in addition to possessing
endosomolytic activity also has nuclear targeting
properties. Improvements in transfection efficacy
associated to the use of NLS suggest that polyplexes can at
least partially benefit from transport mechanisms through
nuclear pores.
F. PEI polyplex dissociation within the
nucleus: nuclear availabilityIn order for vehiculized nucleic acid to modify gene
expression (by means of a transgene or oligonucleotides),
it is assumed that the non-nucleic component in general, or
the cationic polymer in the case of polyplexes, must
separate from the nucleic acid at some point. In the case of
lipoplexes, the use of fluorescent labeled DNA and lipids
has shown that whereas labeled DNA appears in the
nucleus, the cationic lipids do not. This suggests that
lipoplex disassembly takes place before the DNA reaches
the nucleus (Marcusson et al, 1998). However, in the case
of polyplexes, the evidence suggests that the polymer
(fundamentally PEI) not only accompanies the nucleic
acid to the nucleus but moreover targets it to the latter
(Boussif et al, 1995; Pollard et al, 1998; Godbey et al,
1999c; Wightman et al, 2001). Thus, in experiments
involving cytoplasmic injection, the DNA vehiculized in
polyplexes produced an increase in the portion of DNA
released into the nucleus (up to 10-fold in the case of PEI-
polyplexes) with respect to naked DNA (Pollard et al,
1998).
Internalization experiments in certain cell models
involving fluorescent PEI administered either alone or
forming part of polyplexes have revealed preferential
fluorescence location in the nucleus (Godbey et al, 1999c).
With respect to disassembly, the destination seems to
depend on the nucleic acid size. Thus, in the case of
oligonucleotides, some evidence indicates that the latter
separate from the polymer (PEI) once within the nucleus
(Dheur et al, 1999; Guillem et al, 2002a). In our
transfection experiments with immunopolyplexes or
untargeted PEI-polyplexes carrying FITC labeled
oligonucleotides in Jurkat (non-adherent cells) and B16
(adherent) cells, respectively, we observed that the initially
quenched fluorescence of oligo-FITC in the polyplexes (at
95% to N/P 10) is progressively recovered once polyplex
or immunopolyplex has been incorporated into the cell and
disassembled - a process which can be seen with
fluorescence microscopy (Figure 2). Fluorescence is
located mainly in the nucleus in both models (Figure 3),
thus indicating that targeting does not alter the
intracellular processing of polyplexes - though the kinetics
are different (immunopolyplex trafficking being faster).
In the case of PEI polyplexes carrying plasmid DNA,
it seems that although the former reach the nucleus, most
polyplexes remain undissociated. This at least is the
interpretation of the experiment conducted by Godbey and
coworkers (Godbey et al, 1999c). In effect, when PEI and
nucleic acid are labeled with green and red fluorescent
probes, respectively, and polyplex is subsequently formed,
the fluorescence observed is yellow–thus indicating that
the green and red probes are located sufficiently close to
allow fluorescence overlapping. When the intracellular
route of these labeled PEI-polyplexes is followed,
fluorescence labeling in the nucleus is seen to be mainly of
a yellow color (undissociated polyplexes) - though some
green and red dots (corresponding to dissociated
![Page 72: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/72.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
378
Figure 2. Imaging of B16 cells treated with PEI-polyplexes bearing FITC labeled oligonucleotides. Cells were visualized under
fluorescence microscopy at 0 (a) 6(b) and 24 hours(d) after PEI polyplex addition (c ,cells seen under transmitted light).
complexes) appear extranuclearly. However, as mentioned
in previous sections, there is evidence to suggest that
polyplex destination is strongly dependent upon the cell
type involved (Remy-Kristensen et al, 2001; Bieber et al,
2002). In many studies it has not been possible to detect
the presence of exogenous DNA in the nucleus (either
along or accompanied by PEI), though transgene
expression has been detected (Remy-Kristensen et al,
2001; Bieber et al, 2002). This on one hand indicates that
it is not possible to know whether in these cases the
expressed DNA has reached the nucleus in free form or
accompanied by the polymer. On the other hand, it
suggests that the presence of many DNA copies is not
needed to ensure transgene expression (this being the
reason why transgene expression observed in the Godbey
nuclear location experiment could be due to the small
proportion of DNA dissociated from the polymer). This
hypothesis is reinforced by the observations of direct DNA
injection experiments: only 10 copies per nucleus sufficed
to achieve transgene expression (Pollard et al, 1998).
Nevertheless, the fact that direct polyplex injection (PEI or
PLL polyplexes with a small number of transgene copies
in different cell types) into the nucleus affords transgene
expression, and that this does not happen with lipoplexes
(Pollard et al, 1998), indicates that polyplex can be
disassembled, at least partially, within the nucleus. This in
turn generates new questions, however: Is it possible for
exogenous gene expression to occur without polyplex
disassembly? Without discarding that exogenous gene
expression could originate from a small part of plasmid
molecules that can be released, the possibility exists that
the transcription machinery (as if PEI were the cationic
nuclear proteins associated to genomic DNA), could
temporarily separate DNA from polymer – this in turn
being sufficient to allow transgene transcription. To date,
the limited experimental evidence in this direction is
provided by the work of Bieber and coworkers (Bieber et
al, 2002). In order to verify whether PEI-DNA interaction
could be a critical stage for transfection, these
investigators conducted tests of in vitro transcription with
PEI polyplexes, observing that transcription is not altered
by the presence of the PEI. This speaks in favor of the
hypothesis of transcriptional disassembly.
IV. In vivo transfection of polyplexesAlthough it was not our aim to conduct an in-depth
review of the mechanisms of polyplex in vivo transfection,
a summarized account will be provided of some critical
aspects of PEI that could be important for understanding
the transfection profile of PEI-polyplexes in vivo,
compared with other polymers also used in vivo.
In vivo gene expression mediated by polyplexes was
first reported by Wu and coworkers (Wu et al, 1991) in a
murine model of gene transfer to the liver using
polyplexes based on galactosylated PLL. Despite the time
elapsed since these first results were published, only few
subsequent reports have appeared involving the use of
![Page 73: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/73.jpg)
Gene Therapy and Molecular Biology Vol 8, page 379
379
Figure 3: Nuclear localization of oligo-F transferred with PEI based vectors. Imaging of B16 cells (Up) transfected with PEI-oligo
polyplexes (24 after trnasfection) and Jurkat cells (down) transfected with anti CD3 immunopolyplexes (6 h after transfection)
(left,transmitted light; right , fluorescent light)
polyplexes in vivo, and with limited success (De Smedt et
al, 2000). Regarding PEI polyplexes, the more successful
systemic administration models refer to lung gene transfer
(Goula et al, 1998a), though in this case transfection
depends on the formation of aggregates that cause
pulmonary capillary obstruction secondary to
microthrombus formation (Chollet et al, 2002). One of the
important and specific obstacles of in vivo gene transfer is
systemic clearance, i.e., polyplex elimination from blood
before the particles are able to cross the vascular
endothelial fenestrations and interact with the target
tissues. The two main characteristics controlling the
systemic stability of nonviral vectors in general, and of
polyplexes in particular, are particle size and surface
charge. In order to overcome this important problem,
several works have been conducted with the aim of
obtaining small-size polyplexes. By varying the type of
polymer, the preparation conditions, the zeta potential, the
nucleic acid-cationic polymer ratio, and via the addition of
other molecules, it has been possible to reach sizes of
under 200 nm for almost all kinds of polyplexes (Erbacher
et al, 1998). Even with such small-size polyplexes,
interaction of the latter with serum proteins (Dash et al,
1999) and/or later activation of the complement system
(Plank et al, 1996), induces the formation of large particles
that are recognized by the macrophage elimination system.
In order to avoid charge mediated aggregation, covering of
the positively charged surface of the polyplexes has been
performed. Some of the more widely used covering
molecules are hydrophilic polymers, mainly
polyethyleneglycol (Lee et al, 2002; Lim et al, 2000; Ogris
et al, 2001b), and to a lesser extent poly-[N-(2-
hydroxypropyl)methacrylamide] (pHPMA) (Toncheva et
al, 1998), anionic lipids (Mastrobattista et al, 2001), and
even the targeting elements themselves - as is the case of
galactose, (Hashida et al, 1998), the asialoorosomucoids
(Kwoh et al, 1999) or transferrin (Ogris et al, 2001b). In
general, the coated polyplexes exhibit a neutral or negative
zeta potential (surface charge), in addition to much lesser
binding to anionic proteins and scant induction of serum
aggregation compared with uncovered polyplexes
(Kircheis et al, 1999; Ogris et al, 1999).
On the other hand, with the purpose of increasing in
vivo transfection efficacy and specificity, several targeting
elements have been incorporated to the polyplexes. One of
the best worked models is the targeting to the liver of PLL
polyplexes, with the use mainly of ligands that are
recognized and internalized by the hepatic receptors of
asialoglycoproteins, such as the asialoorosomucoids (Wu
et al, 1991; Chowdhury et al, 1993), natural glycosidic
residues like galactose (Perales et al, 1994; Nishikawa et
al, 1998; Wu and Wu 1988) or mannose (Nishikawa et al,
2000), and glycopeptides (Merwin et al, 1994).
Another of the in vivo systemic administration
![Page 74: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/74.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
380
models affording improved results involves gene transfer
to tumors with PLL or PEI polyplexes targeted with
transferrin and EGF (Frederiksen et al, 2000; Kircheis et
al, 2001b). Polyplex targeting with antibodies has been
applied for in vivo transfer to respiratory epithelium.
Different targeting elements, such as anti-PECAM, an
antibody against PECAM1 (platelet endothelial cell
adhesion molecule 1) (Li et al, 2000) attached to a PEI
backbone, or the Fab fragment of polyclonal antibodies
with specificity for the polymeric Ig receptor abundantly
expressed in cells of the pulmonary epithelium, attached to
PLL backbone (Ferkol et al, 1995) have been used.
Another approach has been the search of alternative routes
to systemic administration, including local administration
by direct addition of polyplexes over the targeted tissues
or organs. One type of polymer used in vivo via local
administration is represented by the fractured dendrimers.
The latter have been used for the transfer of a gene with
immunosuppressor activity, with the purpose of
prolonging graft survival in a murine model of heart
transplantation (Qin et al, 1998), obtaining good results.
Also chitosan has been used in pulmonary local
administration with a good toxicity profiles and good
transfection efficacy (Koping-Hoggard et al, 2001).
However, PEI is the polymer offering the greatest success
and efficacy in vivo via local administration. PEI-
polyplexes have been used for nucleic acid transfer to
different organs including the kidneys (Boletta et al,
1997), brain (Boussif et al, 1995; Lemkine et al, 1999),
lungs (Ferrari et al, 1997; Ferrari et al, 1999), and tumors
in diverse locations (Coll et al, 1999; Aoki et al, 2001).
However, few clinical tests have been conducted based on
nucleic acid transfer with polyplexes. This shows that the
field is still in its beginnings, and development will
depend on the improvement of polyplex formulations for
in vivo use.
V. ConclusionsAs we have seen, PEI based vectors have become
important nonviral gene transfer vehicles, mostly because
of the intrinsic properties of PEI. In effect, the latter is
positively charged, thus allowing it to interact
spontaneously with polyanionic nucleic acids and form
stable polyplex particles that can interact with cell
membrane; PEI protects DNA from degradation; and it
allows linker molecule binding (through its primary amine
groups), which in turn facilitates further covalent coupling
of several elements that can improve the transfection
profile of the vector in terms of efficacy and specificity,
such as targeting proteins, nuclear localization sequences,
etc. The transfection pathway of PEI polyplexes has not
been fully elucidated, but they seem to follow an
endocytic route in which PEI protects DNA from
lysosomal degradation and promotes accession of DNA to
the nucleus.
Further efforts are needed to achieve better results
with in vivo use, including improvements in the toxicity
profile and stability in blood circulation, as well as other
aspects involving in vivo nucleic acid transfer efficacy and
specificity.
ReferencesAbdallah B, Hassan A, Benoist C, Goula D, Behr JP and
Demeneix BA (1996). A powerful nonviral vector for in vivo
gene transfer into the adult mammalian brain:
polyethylenimine. Hum Gene Ther 7, 1947-54
Alino SF, Bobadilla M, Garcia-Sanz M, Lejarreta M, Unda F and
Hilario E (1993). In vivo delivery of human alpha 1-
antitrypsin gene to mouse hepatocytes by liposomes.
Biochem Biophys Res Commun 192, 174-81.
Alino SF, Crespo J, Blaya C, Tarrason G, Adán J, Escrig E,
Benet M, Crespo A and Piulats J (1999). Oligonucleotide-
entrapped immunoliposome delivered by mini-osmotic pump
improves the survival of SCID mice bearing human
leukemia. Tumor Targeting 4, 1-9.
Aoki K, Furuhata S, Hatanaka K, Maeda M, Remy JS, Behr JP,
Terada M and Yoshida T (2001). Polyethylenimine-mediated
gene transfer into pancreatic tumor dissemination in the
murine peritoneal cavity. Gene Ther 8, 508-14.
Behr JP (1996). [Gene transfer with amino lipids and amino
polymers]. C R Seances Soc Biol Fil 190, 33-8.
Berh J (1996). Lëponge à protons: un moyen d'entrer dans une
cellule auquel les virus n'ont pas pensé. Méd Sci 12, 56-59.
Bieber T and Elsasser HP (2001). Preparation of a low molecular
weight polyethylenimine for efficient cell transfection.
Biotechniques 30, 74-7, 80-1.
Bieber T, Meissner W, Kostin S, Niemann A and Elsasser H
(2002). Intracellular route and transcriptional competence of
polyethylenimine-DNA complexes. J Control Release 82,
441.
Boletta A, Benigni A, Lutz J, Remuzzi G, Soria MR and Monaco
L (1997). Nonviral gene delivery to the rat kidney with
polyethylenimine. Hum Gene Ther 8, 1243-51.
Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D,
Demeneix B and Behr JP (1995). A versatile vector for gene
and oligonucleotide transfer into cells in culture and in vivo:
polyethylenimine. Proc Natl Acad Sci U S A 92, 7297-301.
Boussif O, Zanta MA and Behr JP (1996). Optimized galenics
improve in vitro gene transfer with cationic molecules up to
1000-fold. Gene Ther 3, 1074-80.
Branden LJ, Mohamed AJ and Smith CI (1999). A peptide
nucleic acid-nuclear localization signal fusion that mediates
nuclear transport of DNA. Nat Biotechnol 17, 784-7.
Brunner S, Sauer T, Carotta S, Cotten M, Saltik M and Wagner E
(2000). Cell cycle dependence of gene transfer by lipoplex,
polyplex and recombinant adenovirus. Gene Ther 7, 401-7.
Cardarelli PM, Quinn M, Buckman D, Fang Y, Colcher D, King
DJ, Bebbington C and Yarranton G (2002). Binding to CD20
by anti-B1 antibody or F(ab')(2) is sufficient for induction of
apoptosis in B-cell lines. Cancer Immunol Immunother 51,
15-24.
Chollet P, Favrot MC, Hurbin A and Coll JL (2002). Side-effects
of a systemic injection of linear polyethylenimine-DNA
complexes. J Gene Med 4, 84-91.
Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR
and Chowdhury JR (1993). Fate of DNA targeted to the liver
by asialoglycoprotein receptor-mediated endocytosis in vivo.
Prolonged persistence in cytoplasmic vesicles after partial
hepatectomy. J Biol Chem 268, 11265-71.
Coll JL, Chollet P, Brambilla E, Desplanques D, Behr JP and
Favrot M (1999). In vivo delivery to tumors of DNA
complexed with linear polyethylenimine. Hum Gene Ther10, 1659-66.
Cotten M, Langle-Rouault F, Kirlappos H, Wagner E, Mechtler
K, Zenke M, Beug H and Birnstiel ML (1990). Transferrin-
polycation-mediated introduction of DNA into human
leukemic cells: stimulation by agents that affect the survival
of transfected DNA or modulate transferrin receptor levels.
Proc Natl Acad Sci U S A 87, 4033-7.
![Page 75: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/75.jpg)
Gene Therapy and Molecular Biology Vol 8, page 381
381
Cotten M, Wagner E and Birnstiel ML (1993). Receptor-
mediated transport of DNA into eukaryotic cells. Methods
Enzymol 217, 618-44.
Curiel DT, Agarwal S, Wagner E and Cotten M (1991).
Adenovirus enhancement of transferrin-polylysine-mediated
gene delivery. Proc Natl Acad Sci U S A 88, 8850-4.
Dash PR, Read ML, Barrett LB, Wolfert MA and Seymour LW
(1999). Factors affecting blood clearance and in vivo
distribution of polyelectrolyte complexes for gene delivery.
Gene Ther 6, 643-50.
Dasi F, Benet M, Crespo J, Crespo A and Alino SF (2001).
Asialofetuin liposome-mediated human alpha1-antitrypsin
gene transfer in vivo results in stationary long-term gene
expression. J Mol Med 79, 205-12.
De Smedt SC, Demeester J and Hennink WE (2000). Cationic
polymer based gene delivery systems. Pharm Res 17, 113-
26.
Demeneix B, Behr J, Boussif O, Zanta MA, Abdallah B and
Remy J (1998). Gene transfer with lipospermines and
polyethylenimines. Adv Drug Deliv Rev 30, 85-95.
Dheur S, Dias N, van Aerschot A, Herdewijn P, Bettinger T,
Remy JS, Helene C and Saison-Behmoaras ET (1999).
Polyethylenimine but not cationic lipid improves antisense
activity of 3'-capped phosphodiester oligonucleotides.
Antisense Nucleic Acid Drug Dev 9, 515-25.
Duguid JG, Li C, Shi M, Logan MJ, Alila H, Rolland A,
Tomlinson E, Sparrow JT and Smith LC (1998). A
physicochemical approach for predicting the effectiveness of
peptide-based gene delivery systems for use in plasmid-
based gene therapy. Biophys J 74, 2802-14.
Dunlap DD, Maggi A, Soria MR and Monaco L (1997).
Nanoscopic structure of DNA condensed for gene delivery.
Nucleic Acids Res 25, 3095-101.
Erbacher P, Roche AC, Monsigny M and Midoux P (1996).
Putative role of chloroquine in gene transfer into a human
hepatoma cell line by DNA/lactosylated polylysine
complexes. Exp Cell Res 225, 186-94.
Erbacher P, Zou S, Bettinger T, Steffan AM and Remy JS
(1998). Chitosan-based vector/DNA complexes for gene
delivery: biophysical characteristics and transfection ability.
Pharm Res 15, 1332-9.
Erbacher P, Bettinger T, Belguise-Valladier P, Zou S, Coll JL,
Behr JP and Remy JS (1999a). Transfection and physical
properties of various saccharide, poly(ethylene glycol), and
antibody-derivatized polyethylenimines (PEI). J Gene Med
1, 210-22.
Erbacher P, Remy JS and Behr JP (1999b). Gene transfer with
synthetic virus-like particles via the integrin-mediated
endocytosis pathway. Gene Ther 6, 138-45.
Felgner PL, Barenholz Y, Behr JP, Cheng SH, Cullis P, Huang
L, Jessee JA, Seymour L, Szoka F, Thierry AR, Wagner E
and Wu G (1997). Nomenclature for synthetic gene delivery
systems. Hum Gene Ther 8, 511-2.
Ferkol T, Perales JC, Eckman E, Kaetzel CS, Hanson RW and
Davis PB (1995). Gene transfer into the airway epithelium of
animals by targeting the polymeric immunoglobulin receptor.
J Clin Invest 95, 493-502.
Ferrari S, Moro E, Pettenazzo A, Behr JP, Zacchello F and
Scarpa M (1997). ExGen 500 is an efficient vector for gene
delivery to lung epithelial cells in vitro and in vivo. GeneTher 4, 1100-6.
Ferrari S, Pettenazzo A, Garbati N, Zacchello F, Behr JP and
Scarpa M (1999). Polyethylenimine shows properties of
interest for cystic fibrosis gene therapy. Biochim BiophysActa 1447, 219-25.
Fischer D, Bieber T, Li Y, Elsasser HP and Kissel T (1999). A
novel non-viral vector for DNA delivery based on low
molecular weight, branched polyethylenimine: effect of
molecular weight on transfection efficiency and cytotoxicity.
Pharm Res 16, 1273-9.
Forrest ML and Pack DW (2002). On the kinetics of polyplex
endocytic trafficking: implications for gene delivery vector
design. Mol Ther 6, 57-66.
Frederiksen KS, Abrahamsen N, Cristiano RJ, Damstrup L and
Poulsen HS (2000). Gene delivery by an epidermal growth
factor/DNA polyplex to small cell lung cancer cell lines
expressing low levels of epidermal growth factor receptor.
Cancer Gene Ther 7, 262-8.
Gebhart CL and Kabanov AV (2001). Evaluation of polyplexes
as gene transfer agents. J Control Release 73, 401-16.
Godbey WT, Barry MA, Saggau P, Wu KK and Mikos AG
(2000). Poly(ethylenimine)-mediated transfection: a new
paradigm for gene delivery. J Biomed Mater Res 51, 321-8.
Godbey WT and Mikos AG (2001). Recent progress in gene
delivery using non-viral transfer complexes. J Control
Release 72, 115-25.
Godbey WT, Wu KK and Mikos AG (1999a).
Poly(ethylenimine) and its role in gene delivery. J ControlRelease 60, 149-60.
Godbey WT, Wu KK and Mikos AG (1999b). Size matters:
molecular weight affects the efficiency of poly(ethylenimine)
as a gene delivery vehicle. J Biomed Mater Res 45, 268-75.
Godbey WT, Wu KK and Mikos AG (1999c). Tracking the
intracellular path of poly(ethylenimine)/DNA complexes for
gene delivery. Proc Natl Acad Sci U S A 96, 5177-81.
Goula D, Benoist C, Mantero S, Merlo G, Levi G and Demeneix
BA (1998a). Polyethylenimine-based intravenous delivery of
transgenes to mouse lung. Gene Ther 5, 1291-5.
Goula D, Remy JS, Erbacher P, Wasowicz M, Levi G, Abdallah
B and Demeneix BA (1998b). Size, diffusibility and
transfection performance of linear PEI/DNA complexes in
the mouse central nervous system. Gene Ther 5, 712-7.
Guillem VM, Tormo M, Moret I, Benet I, Garcia-Conde J,
Crespo A and Alino SF (2002a). Targeted oligonucleotide
delivery in human lymphoma cell lines using a
polyethyleneimine based immunopolyplex. J Control
Release 83, 133-46.
Guillem VM, Tormo M, Revert F, Benet I, Garcia-Conde J,
Crespo A and Alino SF (2002b). Polyethyleneimine-based
immunopolyplex for targeted gene transfer in human
lymphoma cell lines. J Gene Med 4, 170-82.
Guo W and Lee RJ (2001). Efficient gene delivery via non-
covalent complexes of folic acid and polyethylenimine. J
Control Release 77, 131-8.
Haensler J and Szoka FC, Jr. (1993). Polyamidoamine cascade
polymers mediate efficient transfection of cells in culture.
Bioconjug Chem 4, 372-9.
Hashida M, Takemura S, Nishikawa M and Takakura Y (1998).
Targeted delivery of plasmid DNA complexed with
galactosylated poly(L-lysine). J Control Release 53, 301-10.
Jeong JH, Song SH, Lim DW, Lee H and Park TG (2001). DNA
transfection using linear poly(ethylenimine) prepared by
controlled acid hydrolysis of poly(2-ethyl-2-oxazoline). JControl Release 73, 391-9.
Kabanov AV and Kabanov VA (1995). DNA complexes with
polycations for the delivery of genetic material into cells.
Bioconjug Chem 6, 7-20.
Kircheis R, Kichler A, Wallner G, Kursa M, Ogris M, Felzmann
T, Buchberger M and Wagner E (1997). Coupling of cell-
binding ligands to polyethylenimine for targeted gene
delivery. Gene Ther 4, 409-18.
Kircheis R, Schuller S, Brunner S, Ogris M, Heider KH, Zauner
W and Wagner E (1999). Polycation-based DNA complexes
for tumor-targeted gene delivery in vivo. J Gene Med 1,
111-20.
![Page 76: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/76.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
382
Kircheis R, Blessing T, Brunner S, Wightman L and Wagner E
(2001a). Tumor targeting with surface-shielded ligand--
polycation DNA complexes. J Control Release 72, 165-70.
Kircheis R, Wightman L, Schreiber A, Robitza B, Rossler V,
Kursa M and Wagner E (2001b). Polyethylenimine/DNA
complexes shielded by transferrin target gene expression to
tumors after systemic application. Gene Ther 8, 28-40.
Kircheis R, Wightman L and Wagner E (2001c). Design and
gene delivery activity of modified polyethylenimines. Adv
Drug Deliv Rev 53, 341-58.
Kjellen L and Lindahl U (1991). Proteoglycans: structures and
interactions. Annu Rev Biochem 60, 443-75.
Klemm AR, Young D and Lloyd JB (1998). Effects of
polyethyleneimine on endocytosis and lysosome stability.
Biochem Pharmacol 56, 41-6.
Koping-Hoggard M, Tubulekas I, Guan H, Edwards K, Nilsson
M, Varum KM and Artursson P (2001). Chitosan as a
nonviral gene delivery system. Structure-property
relationships and characteristics compared with
polyethylenimine in vitro and after lung administration in
vivo. Gene Ther 8, 1108-21.
Kukowska-Latallo JF, Bielinska AU, Johnson J, Spindler R,
Tomalia DA and Baker JR, Jr. (1996). Efficient transfer of
genetic material into mammalian cells using Starburst
polyamidoamine dendrimers. Proc Natl Acad Sci U S A 93,
4897-902.
Kwoh DY, Coffin CC, Lollo CP, Jovenal J, Banaszczyk MG,
Mullen P, Phillips A, Amini A, Fabrycki J, Bartholomew
RM, Brostoff SW and Carlo DJ (1999). Stabilization of poly-
L-lysine/DNA polyplexes for in vivo gene delivery to the
liver. Biochim Biophys Acta 1444, 171-90.
Labat-Moleur F, Steffan AM, Brisson C, Perron H, Feugeas O,
Furstenberger P, Oberling F, Brambilla E and Behr JP
(1996). An electron microscopy study into the mechanism of
gene transfer with lipopolyamines. Gene Ther 3, 1010-7.
Lecocq M, Wattiaux-De Coninck S, Laurent N, Wattiaux R and
Jadot M (2000). Uptake and intracellular fate of
polyethylenimine in vivo. Biochem Biophys Res Commun
278, 414-8.
Lee H, Jeong JH and Park TG (2002). PEG grafted polylysine
with fusogenic peptide for gene delivery: high transfection
efficiency with low cytotoxicity.. J Control Release 79,
283-91.
Lemkine GF, Goula D, Becker N, Paleari L, Levi G and
Demeneix BA (1999). Optimisation of polyethylenimine-
based gene delivery to mouse brain. J Drug Target 7, 305-
12.
Li S, Tan Y, Viroonchatapan E, Pitt BR and Huang L (2000).
Targeted gene delivery to pulmonary endothelium by anti-
PECAM antibody. Am J Physiol Lung Cell Mol Physiol278, L504-11.
Lim DW, Yeom YI and Park TG (2000). Poly(DMAEMA-
NVP)-b-PEG-galactose as gene delivery vector for
hepatocytes. Bioconjug Chem 11, 688-95.
Luby-Phelps K, Castle PE, Taylor DL and Lanni F (1987).
Hindered diffusion of inert tracer particles in the cytoplasm
of mouse 3T3 cells. Proc Natl Acad Sci U S A 84. 4910-3
Marcusson EG, Bhat B, Manoharan M, Bennett CF and Dean
NM (1998). Phosphorothioate oligodeoxyribonucleotides
dissociate from cationic lipids before entering the nucleus.
Nucleic Acids Res 26, 2016-23.
Marschall P, Malik N and Larin Z (1999). Transfer of YACs up
to 2.3 Mb intact into human cells with polyethylenimine.
Gene Ther 6, 1634-7.
Mastrobattista E, Kapel RH, Eggenhuisen MH, Roholl PJ,
Crommelin DJ, Hennink WE and Storm G (2001). Lipid-
coated polyplexes for targeted gene delivery to ovarian
carcinoma cells. Cancer Gene Ther 8, 405-13.
Merwin JR, Noell GS, Thomas WL, Chiou HC, DeRome ME,
McKee TD, Spitalny GL and Findeis MA (1994). Targeted
delivery of DNA using YEE(GalNAcAH)3, a synthetic
glycopeptide ligand for the asialoglycoprotein receptor.
Bioconjug Chem 5, 612-20.
Meyer B, Uyech L and Szoka F (1997). Manipulating the
intracellular trafficking of nucleic acids. Gene Therapy for
diseases of the Lung. Brigham. New York, Marcel Dekker:135-180.
Mislick KA, Baldeschwieler JD, Kayyem JF and Meade TJ
(1995). Transfection of folate-polylysine DNA complexes:
evidence for lysosomal delivery. Bioconjug Chem 6, 512-5.
Mislick KA and Baldeschwieler JD (1996). Evidence for the role
of proteoglycans in cation-mediated gene transfer. Proc Natl
Acad Sci U S A 93, 12349-54.
Moret I, Esteban Peris J, Guillem VM, Benet M, Revert F, Dasi
F, Crespo A and Alino SF (2001). Stability of PEI-DNA and
DOTAP-DNA complexes: effect of alkaline pH, heparin and
serum. J Control Release 76, 169-81.
Newmeyer DD (1993). The nuclear pore complex and
nucleocytoplasmic transport. Curr Opin Cell Biol 5, 395-
407.
Nigg EA (1997). Nucleocytoplasmic transport: signals,
mechanisms and regulation. Nature 386, 779-87.
Nishikawa M, Takemura S, Takakura Y and Hashida M (1998).
Targeted delivery of plasmid DNA to hepatocytes in vivo:
optimization of the pharmacokinetics of plasmid
DNA/galactosylated poly(L-lysine) complexes by controlling
their physicochemical properties. J Pharmacol Exp Ther287, 408-15
Nishikawa M, Takemura S, Yamashita F, Takakura Y, Meijer
DK, Hashida M and Swart PJ (2000). Pharmacokinetics and
in vivo gene transfer of plasmid DNA complexed with
mannosylated poly(L-lysine) in mice. J Drug Target 8, 29-
38.
Ogris M, Steinlein P, Kursa M, Mechtler K, Kircheis R and
Wagner E (1998). The size of DNA/transferrin-PEI
complexes is an important factor for gene expression in
cultured cells. Gene Ther 5, 1425-33.
Ogris M, Brunner S, Schuller S, Kircheis R and Wagner E
(1999). PEGylated DNA/transferrin-PEI complexes: reduced
interaction with blood components, extended circulation in
blood and potential for systemic gene delivery. Gene Ther 6,
595-605.
Ogris M, Wagner E and Steinlein P (2000). A versatile assay to
study cellular uptake of gene transfer complexes by flow
cytometry. Biochim Biophys Acta 1474, 237-43.
Ogris M, Carlisle RC, Bettinger T and Seymour LW (2001a).
Melittin enables efficient vesicular escape and enhanced
nuclear access of nonviral gene delivery vectors. J BiolChem 276, 47550-5.
Ogris M, Steinlein P, Carotta S, Brunner S and Wagner E
(2001b). DNA/polyethylenimine transfection particles:
influence of ligands, polymer size, and PEGylation on
internalization and gene expression. AAPS PharmSci 3,
E21.
O'Neill MM, Kennedy CA, Barton RW and Tatake RJ (2001).
Receptor-mediated gene delivery to human peripheral blood
mononuclear cells using anti-CD3 antibody coupled to
polyethylenimine. Gene Ther 8, 362-8.
Papisov IM and Litmanovich A (1988). Molecular "recognition"
in interpolymer interactions and matrix polymerization. Adv.Polym. Sci. 90, 139-179.
Perales JC, Ferkol T, Beegen H, Ratnoff OD and Hanson RW
(1994). Gene transfer in vivo: sustained expression and
regulation of genes introduced into the liver by receptor-
targeted uptake. Proc Natl Acad Sci U S A 91, 4086-90.
![Page 77: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/77.jpg)
Gene Therapy and Molecular Biology Vol 8, page 383
383
Plank C, Zatloukal K, Cotten M, Mechtler K and Wagner E
(1992). Gene transfer into hepatocytes using
asialoglycoprotein receptor mediated endocytosis of DNA
complexed with an artificial tetra-antennary galactose ligand.
Bioconjug Chem 3, 533-9.
Plank C, Oberhauser B, Mechtler K, Koch C and Wagner E
(1994). The influence of endosome-disruptive peptides on
gene transfer using synthetic virus-like gene transfer systems.
J Biol Chem 269, 12918-24.
Plank C, Mechtler K, Szoka FC, Jr. and Wagner E (1996).
Activation of the complement system by synthetic DNA
complexes: a potential barrier for intravenous gene delivery.
Hum Gene Ther 7, 1437-46.
Pollard H, Remy JS, Loussouarn G, Demolombe S, Behr JP and
Escande D (1998). Polyethylenimine but not cationic lipids
promotes transgene delivery to the nucleus in mammalian
cells.. J Biol Chem 273, 7507-11.
Poulain L, Ziller C, Muller CD, Erbacher P, Bettinger T, Rodier
JF and Behr JP (2000). Ovarian carcinoma cells are
effectively transfected by polyethylenimine (PEI)
derivatives. Cancer Gene Ther 7, 644-52.
Pouton CW, Lucas P, Thomas BJ, Uduehi AN, Milroy DA and
Moss SH (1998). Polycation-DNA complexes for gene
delivery: a comparison of the biopharmaceutical properties
of cationic polypeptides and cationic lipids. J ControlRelease 53, 289-99.
Puls R and Minchin R (1999). Gene transfer and expression of a
non-viral polycation-based vector in CD4+ cells. Gene Ther
6, 1774-8.
Qin L, Pahud DR, Ding Y, Bielinska AU, Kukowska-Latallo JF,
Baker JR, Jr. and Bromberg JS (1998). Efficient transfer of
genes into murine cardiac grafts by Starburst
polyamidoamine dendrimers. Hum Gene Ther 9, 553-60.
Remy-Kristensen A, Clamme JP, Vuilleumier C, Kuhry JG and
Mely Y (2001). Role of endocytosis in the transfection of
L929 fibroblasts by polyethylenimine/DNA complexes.
Biochim Biophys Acta 1514, 21-32.
Sosnowski BA, Gonzalez AM, Chandler LA, Buechler YJ,
Pierce GF and Baird A (1996). Targeting DNA to cells with
basic fibroblast growth factor (FGF2). J Biol Chem 271,
33647-53.
Suh J, Paik H and Hwang B (1994). Ionization of
polyethylenimine and polyallylamine at various pHs. Bioorg.Chem 22, 318-327.
Suh W, Chung JK, Park SH and Kim SW (2001). Anti-JL1
antibody-conjugated poly (L-lysine) for targeted gene
delivery to leukemia T cells. J Control Release 72, 171-8.
Tang MX, Redemann CT and Szoka FC, Jr. (1996). In vitro gene
delivery by degraded polyamidoamine dendrimers.
Bioconjug Chem 7, 703-14.
Tang MX and Szoka FC (1997). The influence of polymer
structure on the interactions of cationic polymers with DNA
and morphology of the resulting complexes. Gene Ther 4,
823-32.
Toncheva V, Wolfert MA, Dash PR, Oupicky D, Ulbrich K,
Seymour LW and Schacht EH (1998). Novel vectors for gene
delivery formed by self-assembly of DNA with poly(L-
lysine) grafted with hydrophilic polymers. Biochim Biophys
Acta 1380, 354-68.
Turek J, Dubertret C, Jaslin G, Antonakis K, Scherman D and
Pitard B (2000). Formulations which increase the size of
lipoplexes prevent serum-associated inhibition of
transfection. J Gene Med 2, 32-40.
van de Wetering P, Cherng JY, Talsma H, Crommelin DJ and
Hennink WE (1998). 2-(Dimethylamino)ethyl methacrylate
based (co)polymers as gene transfer agents. J Control
Release 53, 145-53.
van der Jagt RH, Badger CC, Appelbaum FR, Press OW,
Matthews DC, Eary JF, Krohn KA and Bernstein ID (1992).
Localization of radiolabeled antimyeloid antibodies in a
human acute leukemia xenograft tumor model. Cancer Res
52, 89-94.
Wagner E, Zenke M, Cotten M, Beug H and Birnstiel ML
(1990). Transferrin-polycation conjugates as carriers for
DNA uptake into cells. Proc Natl Acad Sci U S A 87, 3410-
4.
Wagner E, Cotten M, Foisner R and Birnstiel ML (1991).
Transferrin-polycation-DNA complexes: the effect of
polycations on the structure of the complex and DNA
delivery to cells. Proc Natl Acad Sci U S A 88, 4255-9.
Wagner E et al, (1994). Delivery of drugs, proteins and genes
into cells using transferrin as a ligand for receptor-mediated
endocytosis. Adv. Drug. Deliv. Rev 14, 113-136.
Wiethoff CM, Smith JG, Koe GS and Middaugh CR (2001). The
potential role of proteoglycans in cationic lipid-mediated
gene delivery. Studies of the interaction of cationic lipid-
DNA complexes with model glycosaminoglycans. J BiolChem 276, 32806-13.
Wightman L, Kircheis R, Rossler V, Carotta S, Ruzicka R, Kursa
M and Wagner E (2001). Different behavior of branched and
linear polyethylenimine for gene delivery in vitro and in
vivo. J Gene Med 3, 362-72.
Wojda U and Miller JL (2000). Targeted transfer of
polyethylenimine-avidin-DNA bioconjugates to
hematopoietic cells using biotinylated monoclonal
antibodies. J Pharm Sci 89, 674-81.
Wong TK, Nicolau C and Hofschneider PH (1980). Appearance
of beta-lactamase activity in animal cells upon liposome-
mediated gene transfer. Gene 10, 87-94.
Wu GY, Wilson JM, Shalaby F, Grossman M, Shafritz DA and
Wu CH (1991). Receptor-mediated gene delivery in vivo.
Partial correction of genetic analbuminemia in Nagase
rats.PG - 14338-42. J Biol Chem 266.
Wu GY and Wu CH (1987). Receptor-mediated in vitro gene
transformation by a soluble DNA carrier system. J Biol
Chem 262, 4429-32.
Wu GY and Wu CH (1988). Receptor-mediated gene delivery
and expression in vivo. J Biol Chem 263, 14621-4.
Zanta MA, Belguise-Valladier P and Behr JP (1999). Gene
delivery: a single nuclear localization signal peptide is
sufficient to carry DNA to the cell nucleus. Proc Natl Acad
Sci U S A 96, 91-6.
Zenke M, Steinlein P, Wagner E, Cotten M, Beug H and
Birnstiel ML (1990). Receptor-mediated endocytosis of
transferrin-polycation conjugates: an efficient way to
introduce DNA into hematopoietic cells. Proc Natl Acad Sci
U S A 87, 3655-9.
Dr. Salvador F. Aliño and Dr.Vicent M. Guillem
![Page 78: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/78.jpg)
Guillem and Aliño: Transfection pathways of nonspecific and targeted PEI-polyplexes
384
![Page 79: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/79.jpg)
Gene Therapy and Molecular Biology Vol 8, page 385
385
Gene Ther Mol Biol Vol 8, 385-394, 2004
c-myc: a double-headed Janus that regulates cell
survival and deathReview Article
Rosanna Supino1 and A. Ivana Scovassi2*1Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1, 20133 Milano, and 2Istituto di Genetica Molecolare
CNR, Via Abbiategrasso 207, 27100 Pavia, Italy
__________________________________________________________________________________
*Correspondence: A. Ivana Scovassi, Istituto di Genetica Molecolare CNR, Via Abbiategrasso 207, 27100 Pavia, Italy; Tel +39-0382-
546334; Fax +39-0382-422286; E-mail: [email protected]
Key words: Antisense, apoptosis, cancer, c-myc, phosphorylation, TFO
Abbreviations: antisense oligonucleotides, (AS-ODN); disialoganglioside, (GD2); Oligonucleotides, (ODNs); Ribonucleoprotein,
(RNP); triple helix-forming oligonucleotides, (TFOs)
Received: 05 August 2004; Accepted: 07 September 2004; electronically published: September 2004
Summary
A paradox for cancer biology is represented by the fact that some oncogenes, including c-myc, provide an advantage
to cancer cells by stimulating uncontrolled proliferation while, at the same time, they exert a pro-apoptotic activity.
The prominent roles of c-myc and the relevance of phosphorylation and subcellular compartmentalization of c-Myc
protein are described in this review, which focuses also the possible strategies to modulate (i.e. up- and down-
regulate) the c-myc level. The gene expression targeted approach of c-myc modulation as anticancer therapeutic
treatment is discussed.
I. IntroductionA. c-myc: a proto-oncogene with many
functionsIt is generally assumed that the efficacy of anticancer
drugs may be related to cell proliferation control and/or to
the activation of the apoptotic pathway(s). Among the
mediators of such processes, the c-myc proto-oncogene
controls the balance between proliferation and death, thus
playing a crucial role in different cell pathways leading to
opposite effects (Prendergast, 1999; Amati et al, 2001;
Eisenman, 2001; Nasi et al, 2001; Pelengaris et al, 2002;
Pelengaris and Khan, 2003). In this respect, c-myc could
be represented as Janus, the old Roman deity with two
faces who presides over everything by regulating cell
proliferation and cell death (Figure 1).
A simplified view of the activities of c-myc is shown
in Figure 2. In normal cells, c-myc expression is tightly
controlled by mitogenic stimuli and appears to be
necessary, and in some instances sufficient, to induce cells
to enter the S phase of cell cycle and to proliferate, and to
respond to differentiative stimuli (Hoffman and
Liebermann, 1994). Translocation and amplification of the
c-myc gene as well as increased half-life and
overexpression of the oncoprotein, which have been
observed in many tumors, promote tumorigenesis (Spencer
and Groudine, 1991; Marcu et al, 1992).
Deregulation of c-myc occurring in a broad range of
human cancers is often associated with poor prognosis
(Pelengaris et al, 2002). The molecular mechanisms for
the frequently observed deregulation of c-myc in human
cancers could depend on the fact that c-myc
overexpression may antagonize the pro-apoptotic function
of p53 (Ceballos et al, 2000). c-myc controls or affects
other processes relevant to tumorigenesis, e.g. it can
promote transformation by its ability to induce the
expression of telomerase, thus bypassing telomere erosion
and facilitating immortalization (Drissi et al, 2001).
Different factors may regulate in distinct ways c-
myc-promoted cell transformation (O’Hagan et al, 2000).
Among them, Bim acts as a suppressor of Myc-induced
lymphomagenesis (Egle et al, 2004); non-peptide
antagonists of Myc/Max dimerization inhibit c-myc-
induced transformation (Berg et al, 2002); the ATM-
related domain of TRRAP protein, which is involved in
transcriptional regulation and chromatin structure,
modulates c-myc-dependent oncogenesis (Park et al,
2001).
B. c-Myc-interacting proteinsc-Myc protein is a member of the helix-loop-helix
leucine zipper family of transcription factors that bind to a
DNA motif called “E-box”, which consists of the
consensus sequence CACGTG. Efficient binding of c-Myc
![Page 80: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/80.jpg)
Supino and Scovassi: Strategies to modulate the different functions of c-myc
386
to an E-box requires the heterodimerization with its
partner Max, another member of this family. Myc function
is antagonized by the Mad protein, which can also
dimerize with Max and bind to E-boxes (Amati et al,
2001; Baudino and Cleveland, 2001; Zhou and Hurlin,
2001). Since the main activities of Myc strictly depend on
its dimerization with Max, the inhibition of such
interaction may affect different processes. Indeed, small
molecules acting as inhibitors of Myc/Max dimerization
were effective in counteracting the oncogenic activity of
Myc (Berg et al, 2002).
c-myc initiates a transcriptional program that controls
hundred of genes belonging to different functional
categories of myc targets. Some of them can be considered
as direct targets, others are indirectly regulated. The
investigation of the nature of the interaction among c-Myc
network members revealed that it could be modulated
through the formation of distinct sub-nuclear structures
localized in specific compartments (Yin et al, 2001).
Figure 1. Representation of the oncogene c-myc as the double-headed Janus deity. Looking in the direction of both cell proliferation and
death, c-myc controls the basic life processes.
Figure 2. Regulation of different processes by c-myc in normal cells. Effect of c-myc deregulation in promoting cancer.
![Page 81: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/81.jpg)
Gene Therapy and Molecular Biology Vol 8, page 387
387
To date, the search for c-myc targets did not provide
conclusive data. A still growing list of proteins regulated
by c-Myc is reported and discussed in many reviews
(Dang, 1999; Sakamuro and Prendergast, 1999; O’Hagan
et al, 2000; Eisenman 2001; Levens, 2002, 2003;
Fernandez et al, 2003; Nilsson and Cleveland, 2003, 2004;
Patel et al, 2004). A variety of molecular, biological and
genetic approaches were devised to identify the mRNAs
induced or repressed by c-myc. Recent advances in
proteomics and microarray technology allowed genome-
wide studies of mRNA transcripts responsive to c-Myc
(Schuhmacher et al, 2001; Shiio et al, 2002; Watson et al,
2002; Fernandez et al, 2003; Orian et al, 2003).
C. Regulation of apoptosis by c-mycThe observation that c-myc null fibroblasts are
resistant to apoptosis highlighted the essential pro-
apoptotic role of this oncogene (Chang et al, 2000). It is
generally assumed that c-myc promotes apoptosis by
sensitizing cells to a variety of insults rather than by acting
as a direct death effector. Yu et al (2002) carried out a
genome-wide survey for myc-mediated gene expression
under apoptotic conditions. Isogenic Rat-1 cell lines that
either overexpress or lack c-myc, were treated with
etoposide, which induced apoptosis at an extent that
depend upon the level of c-myc. The analysis provided the
identification of a cluster of genes that respond to
etoposide and are highly dependent on the cellular myc
status. Moreover, the results revealed also that the
existence of c-myc-independent genes involved in the
apoptotic pathway.
Although a detailed understanding of the signalling
pathways by which c-myc elicits apoptosis is still lacking,
different factors have been shown to modulate c-myc-
induced apoptosis. As first shown by Fanidi et al (1992)
and Bissonnette et al (1992), the ability of c-myc to
promote apoptosis can be suppressed by the
overexpression of bcl-2; the same effect was obtained by
the suppression of the pro-apoptotic factor Bax (Mitchell
et al, 2000). Ionizing radiation-induced apoptosis can be
increased by the activity of c-Myc in suppressing BclXL,
thus suggesting a strategy in desensitizing tumor cells to
DNA damage-induced apoptosis (Maclean et al, 2003).
The transcriptional repressor Mad1, which regulates
negatively cell proliferation, has an inhibitory effect on c-
myc-mediated apoptosis and proliferation (Gehring et al,
2000). Using RNA stable interference (siRNA), Nilsson
and Cleveland (2004) showed that Mnt, a myc antagonist
(Hurlin et al, 2004), triggers apoptosis via the myc target
ODC. A similar indirect effect was described for the
complex formed by the c-myc-negative regulator MBP-1
(c-myc promoter-binding protein 1), and MIP-2A (MBP-1-
interacting protein), which in turn regulates negatively the
MBP-1 activity and the induction of apoptosis (Ghosh et
al, 2001).
A synergy between c-myc and different death
receptors, leading to the release of cytochrome c from
mitochondria, was shown (Klefstrom et al, 2002).
Remarkably, it has been reported that the gene for
cytochrome c, which is required for apoptosis, is a direct
target of c-myc and that c-Myc binds to it (Morrish et al,
2003). The analysis of the apoptosis induced in melanoma
cells after c-myc down-regulation revealed that this
process occurs through the specific depletion of the levels
of glutathione (Biroccio et al, 2002).
In contrast to the pro-apoptotic function usually
ascribed to c-myc, it has been shown that c-myc could
contribute to block apoptosis under some conditions. In
lymphoid CEM cells, treatment with oxysterols reduces c-
Myc protein expression level before promoting apoptosis
(Ayala-Torres et al, 1999), thus suggesting that the
negative regulation of c-Myc does not inhibit the
activation of apoptosis by steroid compounds.
D. c-Myc proteinc-Myc is a highly unstable phosphoprotein with a
half-life of about 15-30 minutes. The phosphorylation sites
Thr58 and Ser62 exert opposite effects on the control of c-
Myc degradation through the ubiquitin-proteasome
pathway (Flinn et al, 1998; Sears et al, 2000; Amati, 2004;
Herbst et al, 2004; Welcker et al, 2004; Yeh et al, 2004).
Recent data indicate that the stability of c-Myc is regulated
by different sequence elements, i.e. the N-terminal
“degron” that signals Myc ubiquitination and degradation,
and the C-terminal “stabilon” that promotes its
sequestration and stabilization into a subnuclear
compartment (Herbst et al, 2004).
The N-terminal domain of c-Myc, which is essential
for transcriptional and transforming activity, binds to !-
tubulin (Alexandrova et al, 1995) and is released from it
during mitosis to facilitate microtubule disassembly. The
release of c-Myc from !-tubulin is regulated by c-Myc
phosphorylation state (Noguchi et al, 1999; Gregory and
Hann, 2000; Niklinski et al, 2000). c-Myc protein shows a
predominant localization in the cytoplasm of interphase
cells, while in proliferating cells its nuclear distribution is
similar to that of some ribonucleoprotein (RNP)-
containing structures (Spector et al, 1987), or is confined
to large amorphous nuclear globules (Henriksson et al,
1988; Koskinen et al, 1991). The existence of a dynamic
modification of c-Myc is suggested by the competition of
phosphorylation and glycosylation for the same site, i.e.
Thr58 (Kamemura et al, 2002).
The search for the precise intracellular localization of
c-Myc in tumor cells, where its degradation is deregulated
with a resulting abnormal stability of the protein in the
nucleus (Flinn et al, 1998; Salghetti et al, 1999; Gregory
and Hann, 2000; Niklinski et al, 2000; Herbst et al, 2004),
revealed that phosphorylated c-Myc accumulates in the
nucleus of tumor cells. Phosphorylated c-Myc is
distributed in the form of spots of different sizes
throughout the nucleus and in the nucleolus (Soldani et al,
2002), where c-myc transcripts were described (Bond and
Wold, 1993). As clearly demonstrated in HeLa cells
(Soldani et al, 2002), phosphorylated c-Myc does
accumulate in large amorphous globules (Henriksson et al,
1998) and its distribution pattern is not reminiscent of the
distribution of non-nucleolar RNP-containing structures,
as reported by Spector et al (1987). Remarkably, in tumor
cells treated with the antimitotic drug paclitaxel, the
immunolabeling for phosphorylated c-Myc changed, and
became more diffused throughout the nucleoplasm
![Page 82: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/82.jpg)
Supino and Scovassi: Strategies to modulate the different functions of c-myc
388
(Bottone et al, 2003; Supino et al, unpublished
observations). A typical example of the nuclear
distribution of phosphorylated c-Myc in tumor cells is
shown in Figure 3.
II. Strategies to modulate the c-myc
levelA. OverexpressionThe most common alteration affecting c-myc in
human tumors is gene amplification (Nesbit et al, 1999),
which can range from a single gene duplication to
hundreds of copies. Many experiments based on the
enforced expression of an exogenously introduced c-myc
gene provided the evidence that c-myc amplification could
sensitize tumor cells to apoptosis. The pro-apoptotic role
for c-myc has been first shown in serum-starved primary
or immortalized fibroblasts (Evan et al, 1992; Fanidi et al,
1992) and in IL-3-dependent myeloid cells upon
withdrawal of the cytokine (Askew et al, 1991) and this
role was further confirmed (Alarcon et al, 1996; Dong et
al, 1977; Rupnow et al, 1998). Promising results have
been obtained by Peltenburg et al (2004), who
demonstrated that the stable transfection of IGR39D
melanoma cells with c-myc causes a sensitization of tumor
cells toward apoptosis.
Although it is well established that apoptosis can be
induced by the enforced expression of exogenously
introduced c-myc genes in several experimental systems, it
is interesting to investigate whether constitutive
overexpression of the resident c-myc gene in tumor cells is
sufficient to induce apoptosis. A positive correlation
between endogenous high level of c-myc and apoptosis
propensity was found in lymphoblastic leukemic CEM
cells, which harbor constitutive activation of c-myc and
undergo serum starvation-induced apoptosis (Tiberio et al,
2001).
We addressed this question by examining the effect
of different apoptogenic stimuli on tumorigenic and non-
tumorigenic clones isolated from the SW613-S human
Figure 3. Nuclear localization of phosphorylated c-Myc in HeLa
cells. Immunofluorescence experiments were carried out
according to Bottone et al (2003). Red fluorescence: !-tubulin;
green fluorescence: phosphorylated c-Myc.
colon carcinoma cell line. 12A1 cells (tumorigenic clone)
harbor an endogenous high level of amplification of the c-
myc gene, whereas B3 cells (non-tumorigenic clone) have
a small number of copies of this gene (Lavialle et al,
1988). We found that only cells with endogenous c-myc
overexpression activate the apoptotic machinery in
response to serum deprivation (Donzelli et al, 1999) and
after the treatment with etoposide, doxorubicin and
vitamin D3, which induce Fas-mediated apoptosis (Gorrini
et al, 2003). The low levels of c-myc expression present in
SW613-B3 cells were unable to activate Fas-mediated
apoptosis, thus suggesting that only a high c-myc
expression can bypass the lack of Fas receptor. Apoptosis
driven by DNA damage and long term-culture was
independent of c-myc expression (Gorrini et al, 2003). The
same experimental system was used to define the effect of
c-myc amplification on the response to the antimitotic drug
paclitaxel. A high c-myc amplification level potentiates
paclitaxel cytotoxicity, confers a multinucleated
phenotype and promotes apoptosis to a high extent, thus
suggesting that c-myc expression level is relevant in
modulating the cellular responses to paclitaxel (Bottone et
al, 2003).
In conclusion, the overexpression of c-myc could be a
strategy for therapeutic applications, possibly by
modulating myc levels, thus sensitising tumor cells to
therapy. As an example of the clinical potential of the
analysis of the c-myc expression level in tumors, recent
data obtained on patients with ovarian cancer suggest that
a high c-myc expression level could improve the
chemotherapy response (Iba et al, 2004).
B. Inhibition1. The gene expression targeted therapyThe identification of genes that are important for the
development and maintenance of malignant phenotype
opened new perspectives for eventually inducing a
reversion to normal phenotype. In this view, disease-
associated proteins can be targets of a selective therapy
that would lead to less toxic side effects than the
conventional, often cytotoxic, therapeutic treatment. In
fact, the main limitation to conventional cancer
chemotherapy derives from the lack of specificity of the
drugs, and from pharmacokinetic and manufacturing
problems, which can lead to systemic, and organ toxicity.
This impairs the use of high-dose intensity therapy, giving
rise to a high rate of tumor relapse. The identification of
fundamental genetic differences between malignant and
normal cells resulting, for example, from activated
oncogenes and inactivated tumor suppressor genes, has
made it possible to consider such genes as specific targets
for antitumor therapy. In this respect, many genes have
been selected for antisense therapy, including HER-2/neu,
PKA, TGF-!, EGFR, TGF-ß, IGFIR, P12, MDM2,
BRCA, Bcl-2, ER, VEGF, MDR, ferritin, transferrin
receptor, IRE, c-fos, HSP27, c-myc, c-raf and
metallothioneins. Similar effects can be obtained with
triple helix-forming oligonucleotides (TFOs) that are
synthesized as to bind with a high affinity and specificity
to double stranded DNA.
![Page 83: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/83.jpg)
Gene Therapy and Molecular Biology Vol 8, page 389
389
2. Rational for the use of a therapy targeted
against c-mycSeveral genes known to be of importance in the
regulation of apoptosis, cell growth, metastatization and
angiogenesis provide a tantalizing prospect for the
development of anticancer agents. Impaired apoptosis is a
crucial step in tumorigenesis but is also a significant
impediment to cytotoxic therapy (Hu and Kavanagh,
2003). Thus, agents targeted to interfere with appropriate
molecules which regulate the apoptotic response to cell
damage (spontaneous or induced by antitumor drugs)
appear as a more rational therapeutic approach. As above
reported, c-myc and bcl-2 are important regulators of
tumor progression and of apoptotic response to
chemotherapy. Conflicting results have been reported on
the role of c-myc expression in drug resistance (Leonetti et
al, 1999; Knapp et al, 2003; Grassilli et al, 2004).
Implication of c-myc in sensitizing cells to apoptosis in
p53-mutant small cell lung carcinoma (Supino et al, 2001)
and in prostate carcinoma cells (Cassinelli et al, 2004) has
been reported. Thus, in tumors where overexpression of c-
myc is related to drug resistance, a combined treatment
with antitumor drugs and antisense oligonucleotides (AS-
ODN) against c-myc could improve the therapeutic effects.
Additional approaches to modify c-myc expression
consist of peptides, PNA (peptide nucleic acids) and
siRNA (Cutrona et al, 2000; Hosono et al, 2004).
Remarkably, it has been shown that c-Myc expression can
be lowered by affecting the stabilization of a G-
quadruplex structure present in the c-myc promoter (Grand
et al, 2004).
3. Mechanism of action of antisense
oligonucleotides and triple helix forming
oligonucleotidesAS-ODN are able to inhibit specifically the synthesis
of a particular protein by binding to protein-encoding
RNA, thereby preventing RNA function and thus
inhibiting the action of the gene. Antisense therapy should
correct the mutations and abnormal expression of genes of
tumor cells by decreasing their expression, inducing RNA
degradation, and causing a premature termination of RNA
transcription (Head et al, 2002). Oligonucleotides (ODNs)
are short pieces of DNA; their size ranges generally from
18 to 21 nucleotides. They hybridize to a specific target
mRNA and their action can be mediated by the cleavage
of the target DNA or by blocking the translation of RNA.
In the first case, once the AS-ODN is bound to the specific
RNA target, cellular RNase H cleaves the RNA/ODN
complex, cleaving the RNA strand and releasing the ODN
which can bind another specific RNA strand.
Alternatively, ODNs ribozymes can be designed to
hybridize and cleave the target RNA, thus to sterically
bind RNA, with a resulting arrest of translation process.
TFOs are synthesized as to bind with a high affinity
and specificity to the purine strand in the major groove of
homopurine-homopyrimidine sequences in double
stranded DNA. They can bind to DNA by parallel or anti-
parallel orientation. TFOs directed against the purine-rich
tracts of gene promoter regions are able to selectively
reduce the transcription and the expression of target genes,
by blocking binding of transcriptional activators and/or
formation of initiation complexes. TFOs can be used to
mediate site-specific genome modification. Indeed, TFOs
are effective by binding as third strands with sequence
specificity and the resulting triple helices, or TFO-
mutagen complexes, are able to provoke repair and
recombination (Faruqi et al, 2000), leading to directed
mutagenesis, recombination, and, potentially, gene
correction. TFO against p53, c-myc, bcl-2, HER/neu
EGFR, etc have been successfully synthesized (Thomas et
al, 1995; Basye et al, 2001; Shen et al, 2003; Re et al,
2004).
4. Effectiveness of antisense approachi. Experimental validation
The effectiveness of AS-ODN in the reduction of
target gene expression has been differently reported in
preclinical and clinical studies. In vitro studies show that
ODNs are effective in the selective inhibition of gene
expression (Monia et al, 1996; Eberle et al, 2002; Heere-
Ress et al, 2002) and their application in clinical trials is
attractive (Crooke, 1993; Hu and Kavanagh, 2003;
Stephens and Rivers, 2003). Many experimental studies
have been performed with AS-ODNs against several genes
and successful chemosensitization and radiosensitization
was found in combination treatments both in vitro and in
vivo (Bcl-2/Bcl-xL and TRAIL, MDM2, HER-2, adhesion
molecules; Del Bufalo et al, 2003; Rait et al, 2003;
Zangemeister-Wittke, 2003; Wang et al, 2003; Tang et al,
2004). Recently, inhibition of c-myc and cyclin D1,
resulting in a decrease in cell growth, increase of apoptotic
index, inhibition of colony formation mediated by a
decrease of E2F1 mRNA and protein production has been
reported in hepatoma (Simile et al, 2004) and melanoma
cells (Eberle et al, 2002). In an androgen-independent
human prostate cancer xenograft murine model, an AS-
ODN showed inhibition of c-myc translation and tumor
growth and induction of apoptosis. In vivo studies on
distribution of c-myc AS-ODN locally delivered by
gelatin-coated platinum-iridium stents in rabbits indicated
an induction of apoptosis in vascular smooth muscle cells,
suggesting the efficacy of a local treatment (Zhang et al,
2004).
TFOs directed to regulatory sequences in the c-myc
gene have been shown to inhibit transcription factor
binding and transcription in vitro as well as promoter
activity and gene expression in HeLa and MCF-7 cells
(Postel et al, 1991; Thomas et al, 1995; Kim et al, 1998).
Moreover, GT-rich TFOs directed to a sequence near the
P2 promoter were particularly effective in inhibiting c-myc
expression in leukemic and cancer cells (Catapano et al,
2000; McGuffie et al, 2000); daunomycin-conjugated GT-
TFOs showed an increased stability of triple-helix and
thus a higher activity of the TFO in human prostate
(DU145) and breast cancer (MCF-7 and MDA-MB-231)
cells (Carbone et al, 2004).
ii. Clinical results
Although ODNs are under clinical investigation in
different diseases, the majority of them are exploited
![Page 84: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/84.jpg)
Supino and Scovassi: Strategies to modulate the different functions of c-myc
390
against cancer for which this form of molecular
therapeutics seems particularly suitable (Biroccio et al,
2003). ODNs are systemically administered and their
toxicities, similar for all compounds, include
thrombocytopenia, hypotension, fever and fatigue. AS-
ODNs against c-myc are currently in phase I study in
humans. The lack of toxicity together with the results
obtained in a large amount of preclinical results (Iversen et
al, 2003; Bayes et al, 2004) support their temptative
therapeutic use.
It should be remembered that many other antisense
approaches, including for example antisenses against
BCL2, XIAP, PKA type I, EGFR, COX-2 inhibitors, gave,
alone or in combination with antitumor agents, preclinical
encouraging results in patients with advanced solid
malignancies (Mani et al, 2003). Indeed this treatment is
well tolerated and it is now in Phase III trials on chronic
lymphocytic leukaemia, non-small-cell lung cancer,
advanced malignant melanoma, multiple myeloma and
prostate carcinoma (Hu and Kavanagh, 2003; Kim et al,
2004). Moreover, the effectiveness also of the oral
administration of this kind of treatment makes this strategy
very promising in cancer therapy (Tortora and Ciardiello,
2003).
iii. Limits of the ODNs approach and attempts to
their overcoming
Low physiological stability, intracellular degradation,
in vivo instability, unfavorable pharmacokinetics (the lack
of transfer across cell membranes), low cellular uptake,
insufficient nuclear accumulation and accessibility to the
target, and the need to deliver AS-ODNs selectively to
diseased tissues to maximize their action and to minimize
their side effect, together with dissociation of DNA
binding, due to changes in DNA or chromatin dynamics,
limit therapeutic applications of AS-ODNs and TFOs
(Wagner, 1995) (Figure 4). For this reason, many delivery
systems such as viral vectors and liposomes to carry the
AS-ODN through the cell membrane and the cytoplasm
into the nucleus have been developed (Head et al, 2002).
The use of lipid-based delivery systems represents a
technological tool for increasing the stability of AS-ODNs
in vivo (Gutierrez-Puente et al, 1999; Leonetti et al, 2001).
The main advantage of liposomes entrapment of AS-ODN
is their large carrying capacity, allowing the delivery of a
large number of asODN molecules for each binding event.
A second advantage is the long circulation longevity of
liposome-entrapped drugs in different animal models
(Webb et al, 1995; Leonetti et al, 2001) mainly due to a
delay of antisense loss by extracellular nucleases.
c-myc-AS-ODN efficiency was increased by
delivering the ODN in sterically stabilized liposomes
targeted against the disialoganglioside (GD2) epitope
(highly expressed in melanoma cells). Encapsulation of
AS-ODNs in GD2-targeted liposomes can protect non-
targeted cells from potential deleterious effects of the AS-
ODNs, and simultaneously enhance the toxicity of the
molecule toward the target cell population. In these
conditions, the down-modulation of c-myc determined a
reduction of cell proliferation and tumorigenicity and an
increased apoptotic rate of human melanoma (Pastorino et
al, 2003). To increase the specificity, a selective delivery
of immunoliposomes has been obtained with cell surface-
directed antibodies grafted on their exteriors (Allen and
Moase, 1996) which, however, lose their advantage in the
treatment of advanced solid tumors (Allen and Moase,
1996; Lopez De Menezes et al, 1998), likely because the
"binding site barrier" restricts the penetration into the
tumor (Yuan et al, 1994). Another strategy to increase the
Figure 4. Factors that can limit the use of antisense oligonucleotides (AS-ODN) or triple helix forming oligonucleotides (TFO). Sites 1-
3 define where the factors reported in the respective boxes can interfere.
![Page 85: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/85.jpg)
Gene Therapy and Molecular Biology Vol 8, page 391
391
residence time of the oligonucleotides on the target and to
increase their stability was to modify ODNs and TFOs as
phosphorothioate oligonucleotides, which show a binding
affinity similar to that of the phosphodiester
oligonucleotide. A marked inhibition of c-myc
transcription in HeLa cells has been demonstrated (Kim et
al, 1998). Advantages in the affinity and the half-life of
the binding of TFO to DNA were taken by the
daunomycin-conjugated TFO; with this approach c-myc-
targeted TFO showed a high stability and biological
activity in mammary and prostate carcinoma cells
(Carbone et al, 2004).
III. DiscussionThe oncogene c-myc plays essential roles in
controlling cell cycle and proliferation, differentiation,
tumorigenesis and apoptosis. For its crucial involvement
in the development of cancer as well as in driving tumor
cells to apoptosis, c-myc is a good candidate for the
development of strategies aimed at modulating its activity
in tumor cells.
In this respect, it is generally assumed that an
increased level of c-myc could confer a propensity to
apoptosis to a tumor cell, which is effective in potentiating
the effects of clinical treatments. Even if this pro-apoptotic
effect could be cell- and drug-dependent, promising results
have been obtained in c-myc-overexpressing tumor cells
derived from therapy-resistant tumors, such as melanomas
and colon carcinomas.
An opposite strategy to face tumor development is
the inhibition of the activity of factors that control cell
proliferation and transformation, including c-myc. This
goal is mainly achievable by the use of AS-ODN or TFO.
The increasing amount of preclinical data on the effect of
AS-ODN to c-myc encourages their temptative therapeutic
use. However, potential limitation to gene-targeted
therapies may exist, e.g. the development of resistant
tumor cell populations that lose their sensitivity toward c-
myc inhibition over time. In addition, since c-myc is a
factor involved in determining the fate of normal cells and
tissues, the side effects of its inactivation have to be
considered.
In parallel with the antisense approach, the use of
PNA and siRNA could provide an alternative way of
down-regulating c-myc. The modulation of the functional
interaction of c-Myc with its partners as well as the
development of molecular tools to block the c-myc
promoter could contribute to improve the anticancer
therapy. Further in vitro experiments on different cancer
cell lines will help in developing clinical trials aimed at
obtaining a beneficial up- and down-regulation of c-myc in
human tumors.
AcknowledgmentsThe research at the laboratory of RS and AIS is
supported respectively by AIRC (Associazione Italiana
Ricerca sul Cancro) and MIUR (FIRB Project
RBNE0132MY).
ReferencesAlarcon RM, Rupnow BA, Graeber TG, Knox SJ, and Giaccia
AJ (1996) Modulation of c-Myc activity and apoptosis in
vivo. Cancer Res 56, 4315-4319.
Alexandrova N, Niklinski J, Bliskovsky V, Otterson GA, Blake
M, Kaye FJ, and Zajac-Kaye M (1995) The N-terminal
domain of c-Myc associates with "-tubulin and microtubules
in vivo and in vitro. Mol Cell Biol 15, 5188-5195.
Allen TM, and Moase EH (1996) Therapeutic opportunities for
targeted liposomal drug delivery. Adv Drug Del Rev 21,
117-133.
Amati B (2004) Myc degradation: dancing with ubiquitin ligases.
Proc Natl Acad Sci USA 101, 8843-8844.
Amati B, Frank SR, Donjerkovic D, and Taubert S (2001)
Function of the c-Myc oncoprotein in chromatin remodeling
and transcription. Biochim Biophys Acta 1471, M135-
M145.
Askew DS, Ashmun RA, Simmons BC, and Cleveland JL (1991)
Constitutive c-myc expression in an IL-3-dependent myeloid
cell line suppresses cell cycle arrest and accelerates
apoptosis. Oncogene 6, 1915-1922.
Ayala-Torres S, Zhou F, and Thompson EB (1999) Apoptosis
induced by oxysterol in CEM cells is associated with
negative regulation of c-Myc. Exp Cell Res 246, 193-202.
Basye J, Trent JO, Gao D, and Ebbinghaus SW (2001) Triplex
formation by morpholino oligodeoxyribonucleotides in the
HER-2/neu promoter requires the pyrimidine motif. Nucl
Acids Res 29, 4873-4880.
Baudino TA, and Cleveland JL (2001) The Max network gone
Mad. Mol Cell Biol 21, 691-702.
Bayes M, Rabasseda X, and Prous JR (2004) Gateways to
clinical trials. Methods Find Exp Clin Pharmacol 26, 211-
244.
Berg T, Cohen SB, Desharnais J, Sonderegger C, Maslyar DJ,
Goldberg J, Boger DL, and Vogt PK (2002) Small-molecule
antagonists of Myc/Max dimerization inhibit Myc-induced
transformation of chicken embryo fibroblasts. Proc Natl
Acad Sci USA 99, 3830-3835.
Biroccio A, Benassi B, Filomeni G, Amodei S, Marchini S,
Chiorino G, Rotilio G, Zupi G, and Ciriolo MR (2002)
Glutathione influences c-Myc-induced apoptosis in M14
human melanoma cells. J Biol Chem 277, 43763-43770.
Biroccio A, Leonetti C, and Zupi G (2003) The future of
antisense therapy: combination with anticancer treatments.
Oncogene 22, 6579-6588.
Bissonnette RP, Echeverri F, Mahboubi A, and Green DR (1992)
Apoptotic cell death induced by c-myc is inhibited by bcl-2.
Nature 359, 552-554.
Bond VC, and Wold B (1993). Nucleolar localization of myc
transcripts. Mol Cell Biol 13, 3221-3230.
Bottone MG, Soldani C, Tognon GL, Gorrini C, Lazzè MC,
Brison O, Ciomei M, Pellicciari C, and Scovassi AI (2003)
Multiple effects of paclitaxel are modulated by a high c-myc
amplification level. Exp Cell Res 290, 49-59.
Carbone GM, McGuffie E, Napoli S, Flanagan CE, Dembech C,
Negri U, Arcamone F, Capobianco ML, and Catapano CV
(2004) DNA binding and antigene activity of a daunomycin-
conjugated triplex-forming oligonucleotide targeting the P2
promoter of the human c-myc gene. Nucl Acids Res 32,
2396-2410.
Cassinelli G, Zuco V, Supino R, Lanzi C, Scovassi AI, Semple
SC, and Zunino F (2004) Role of c-myc protein in hormone
refractory prostate carcinoma: cellular response to paclitaxel.
Biochem Pharmacol 68, 923-931.
Catapano CV, McGuffie EM, Pacheco D, and Carbone GM
(2000) Inhibition of gene expression and cell proliferation by
triple helix-forming oligonucleotides directed to the c-myc
gene. Biochemistry 39, 5126-5138.
![Page 86: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/86.jpg)
Supino and Scovassi: Strategies to modulate the different functions of c-myc
392
Ceballos E, Delgado MD, Gutierrez P, Richard C, Muller D,
Eilers M, Ehinger M, Gullberg U, and Leon J (2000) c-Myc
antagonizes the effect of p53 on apoptosis and p21WAF1
transactivation in K562 leukemia cells. Oncogene 19, 2194-
2204.
Chang DW, Claassen GF, Hann SR, and Cole MD (2000) The c-
Myc transactivation domain is a direct modulator of
apoptotic versus proliferative signals. Mol Cell Biol 20,
4309-4319.
Crooke ST (1993) Therapeutic applications of oligonucleotides.
Annu Rev Pharmacol Toxicol 32, 329-376.
Cutrona G, Carpaneto EM, Ulivi M, Roncella S, Landt O,
Ferrarini M, and Boffa LC (2000) Effects in live cells of a c-
myc anti-gene PNA linker to a nuclear localization signal.
Nat Biotechnol 18, 300-303.
Dang CV (1999) c-Myc target genes involved in cell growth,
apoptosis, and metabolism. Mol Cell Biol 19, 1-11.
Del Bufalo D, Trisciuoglio D, Scarsella M, Zangemeister-Wittke
U, and Zupi G (2003) Treatment of melanoma cells with a
bcl-2/bcl-xL antisense oligonucleotide induces
antiangiogenic activity. Oncogene 22, 8441-8447.
Dong J, Naito M, and Tsuruo T (1997) c-Myc plays a role in
cellular susceptibility to death receptor-mediated and
chemotherapy-induced apoptosis in human monocytic
leukemia U937 cells. Oncogene 15, 639-647.
Donzelli M, Bernardi R, Negri C, Prosperi E, Padovan L,
Lavialle C, Brison O, and Scovassi AI (1999) Apoptosis-
prone phenotype of human colon carcinoma cells with a high
level amplification of the c-myc gene. Oncogene 18, 439-
448.
Drissi R, Zindy F, Roussel MF, and Cleveland JL (2001) c-Myc-
mediated regulation of telomerase activity is disabled in
immortalized cells. J Biol Chem 276, 29994-30001.
Eberle J, Fecker LF, Brittner JU, Orfanos CE, and Geilen CC
(2002) Decreased proliferation of human melanoma cell lines
caused by antisense RNA against translation factor ELF-
4A1. Br J Cancer 86, 1957-1962.
Egle A, Harris AW, Bouillet P, and Cory S (2004) Bim is a
suppressor of Myc-induced mouse B cell leukemia. Proc
Natl Acad Sci USA 101, 6164-6169.
Eisenman RN (2001) Deconstructing Myc. Genes Dev 15, 2023-
2030.
Evan GI, Wyllie AH, Gilbert CS, Littlewood TD, Land H,
Brooks M, Waters CM, Penn LZ, and Hancock DC (1992)
Induction of apoptosis in fibroblasts by c-myc protein. Cell
69, 119-128.
Fanidi A, Harrington EA, and Evan GI (1992) Cooperative
interaction between c-myc and bcl-2 proto-oncogenes.
Nature 359, 554-556.
Faruqi AF, Datta HJ, Carroll D, Seidman MM, Glazer PM
(2000). Triple-helix formation induces recombination in
mammalian cells via a nucleotide excision repair-dependent
pathway. Mol Cell Biol 20, 990-1000.
Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene
J, Cocito A, and Amati B (2003) Genomic targets of the
human c-Myc protein. Genes Dev 17, 1115-1129.
Flinn EM, Busch CMC, and Wright APH (1998) myc boxes,
which are conserved in myc family proteins, are signals for
protein degradation via the proteasome. Mol Cell Biol 18,
5961-5969.
Gehring S, Rottmann S, Menkel AR, Mertsching J, Krippner-
Heidenreich A, and Luscher B (2000) Inhibition of
proliferation and apoptosis by the transcriptional repressor
Mad1. Repression of Fas-induced caspase-8 activation. J
Biol Chem 275, 10413-10420.
Ghosh AK, Majumder M, Steele R, White RA, and Ray RB
(2001) A novel 16-kilodalton cellular protein physically
interacts with and antagonizes the functional activity of c-
myc promoter-binding protein 1. Mol Cell Biol 21, 655-662.
Gorrini G, Donzelli M, Torriglia A, Supino R, Brison O,
Bernardi R, Negri C, Denegri M, Counis M-F, Ranzani GN,
and Scovassi AI (2003). Effect of apoptogenic stimuli on
colon carcinoma cell lines with a different c-myc expression
level. Int J Mol Med 11, 737-742.
Grand CL, Powell TJ, Nagle RB, Bearss DJ, Tye D, Gleason-
Guzman M, and Hurley LH (2004) Mutations in the G-
quadruplex silencer element and their relationshipo to c-
MYC overexpression, NM23 repression, and therapeutic
rescue. Proc Natl Acad Sci USA 101, 6140-6145.
Grassilli E, Ballabeni A, Maellaro E, Del Bello B, and Helin K
(2004) Loss of Myc confers resistance to doxorubicin-
induced apoptosis by preventing the activation of multiple
serine protease- and caspase-mediated pathways. J Biol
Chem 279, 21318-21326.
Gregory MA, and Hann SR (2000) c-Myc proteolysis by the
ubiquitin-proteasome pathway, stabilization of c-Myc in
Burkitt's lymphoma cells. Mol Cell Biol 20, 2423-2435.
Gutierrez-Puente Y, Tari AM, Stephens C, Rosenblum M,
Guerra RT, and Lopez-Berestein G (1999) Safety,
pharmacokinetics, and tissue distribution of liposomal P-
ethoxy antisense oligonucletotides targeted to Bcl-2.
Pharmacol Exp Ther 291, 865-869.
Head JF, Elliott RL, and Yang DC (2002) Gene targets of
antisense therapies in breast cancer. Exp Opin Ther Targets
6, 375-385.
Heere-Ress E, Thallinger C, Lucas T, Schlagbauer-Wadl H,
Wacheck V, Monia BP, Wolff K, Pehamberger H, and
Jansen B (2002) Bcl-X(L) is a chemoresistance factor in
human melanoma cells that can be inhibited by antisense
therapy. Int J Cancer 99, 29-34.
Henriksson M, Classon M, Ingvarsson S, Koskinen P, Sumegi J,
Klein G, and Thyberg J (1988) Elevated expression of c-myc
and N-myc produces distinct changes in nuclear fine
structure and chromatin organization. Oncogene 3, 587-593.
Herbst A, Salghetti SE, Kim SY, and Tansey WP (2004)
Multiple cell-type-specific elements regulate Myc protein
stability. Oncogene 23, 3863-3871.
Hoffman B, and Liebermann DA (1994) Molecular controls of
apoptosis: differentiation/growth arrest primary response
genes, proto-oncogenes, and tumor suppressor genes as
positive and negative modulators. Oncogene 9, 1807-1812.
Hosono T, Mizuguchi H, Katayama K, Xu ZL, Sakurai F, Ishii-
Watabe A, Kawabata K, Yamaguchi T, Nakagawa S,
Mayumi T, and Hayakawa T (2004) Adenovirus vector-
mediated doxycycline-inducible RNA interference. Hum
Gene Ther 15, 813-819.
Hu W, and Kavanagh JJ (2003) Anticancer therapy targeting the
apoptotic pathway. Lancet Oncol 4, 721-729.
Hurlin PJ, Zhou ZQ, Toyo-Oka K, Ota S, Walker WL, Hirotsune
S, and Wynshaw-Boris A (2004) Evidence of mnt-myc
antagonism revealed by mnt gene deletion. Cell Cycle 3, 97-
99.
Iba T, Kigawa J, Kanamori Y, Itamochi H, Oishi T, Simada M,
Uegaki K, Naniwa J, and Terakawa N (2004) Expression of
the c-myc gene as a predictor of chemotherapy response and a
prognostic factor in patients with ovarian cancer. Cancer Sci
95, 418-423.
Iversen PL, Arora V, Acker AJ, Mason DH, and Devi GR (2003)
Efficacy of antisense morpholino oligomer targeted to c-myc
in prostate cancer xenograft murine model and a Phase I
safety study in humans. Clin Cancer Res 9, 2510-2519.
Kamemura K, Hayes BK, Comer FI, and Hart GW (2002)
Dynamic interplay between O-glycosylation and O-
phosphorylation of nucleocytoplasmic proteins: alternative
glycosylation/phosphorylation of THR-58, a known
![Page 87: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/87.jpg)
Gene Therapy and Molecular Biology Vol 8, page 393
393
mutational hot spot of c-Myc in lymphomas, is regulated by
mitogens. J Biol Chem 277, 19229-19235.
Kim HG, Reddoch JF, Mayfield C, Ebbinghaus S, Vigneswaran
N, Thomas S, Jones DE, and Miller DM (1998) Inhibition of
transcription of the human c-myc protooncogene by
intermolecular triplex. Biochemistry 37, 2299-2304.
Kim R, Tanabe K, Emi M, Uchida Y, and Toge T (2004)
Potential roles of antisense therapy in the molecular targeting
of genes involved in cancer. Int J Oncol 24, 5-17.
Klefstrom J, Verschuren EW, and Evan G (2002) c-Myc
augments the apoptotic activity of cytosolic death receptor
signaling proteins by engaging the mitochondrial apoptotic
pathway. J Biol Chem 277, 43224-43232.
Knapp DC, Mata JE, Reddy MT, Devi DR, and Iversen PL
(2003) Resistance to chemotherapeutic drugs overcome by c-
Myc inhibition in a Lewis lung carcinoma murine model.
Anticancer Drugs 14, 39-47.
Koskinen PJ, Sistonen L, Evan G, Morimoto R, and Alitalo K
(1991) Nuclear colocalization of cellular and viral myc
proteins with HSP70 in myc-overexpressing cells. J Virol
65, 842-851.
Lavialle C, Modjtahedi N, Cassingena R, and Brison O (1988)
High c-myc amplification level contributes to the
tumorigenic phenotype of the human breast carcinoma cell
line SW613-S. Oncogene 3, 335-339.
Leonetti C, Biroccio A, Benassi B, Stringaro A, Stoppacciaro A,
Semple SC and Zupi G (2001) Encapsulation of c-myc
antisense oligodeoxynucleotides in lipid particles improves
antitumoral efficacy in vivo in a human melanoma line.
Cancer Gene Ther 8, 459-468.
Leonetti C, Biroccio A, Candiloro A, Citro G, Fornari C,
Mottolese M, Del Bufalo D, and Zupi G (1999) Increase of
cisplatin sensitivity by c-myc antisense
oligodeoxynucleotides in a human metastatic melanoma
inherently resistant to cisplatin. Clin Cancer Res 5, 2588-
2595.
Levens D (2002) Disentangling the MYC web. Proc Natl Acad
Sci USA 99, 5757-5759.
Levens DL (2003) Reconstructing MYC. Genes Dev 17, 1071-
1077.
Lopez De Menezes DE, Pilarski LM, and Allen TM (1998) In
vitro and in vivo targeting of immunoliposomal doxorubicin
to human B-cell lymphoma. Cancer Res 58, 3320-3330.
Maclean KH, Keller UB, Rodriguez-Galindo C, Nilsson JA, and
Cleveland JL. (2003) c-Myc augments gamma irradiation-
induced apoptosis by suppressing Bcl-XL. Mol Cell Biol 23,
7256-7270.
Mani S, Goel S, Nesterova M, Martin RM, Grindel JM,
Rothenberg ML, Zhang R, Tortora G, and Cho-Chung YS
(2003) Clinical studies in patients with solid tumors using a
second-generation antisense oligonucleotide (GEM 231)
targeted against protein kinase A type I. Ann N Y Acad Sci
1002, 252-262.
Marcu KB, Bossone SA, and Patel AJ (1992) Myc function and
regulation. Annu Rev Biochem 61, 809-860.
McGuffie EM, Pacheco D, Carbone GM, and Catapano CV
(2000) Antigene and antiproliferative effects of a c-myc-
targeting phosphorothioate triple helix-forming
oligonucleotide in human leukemia cells. Cancer Res 60,
3790-3799.
Mitchell KO, Ricci MS, Miyashita T, Dicker DT, Jin Z, Reed JC,
and El-Deiry WS (2000) Bax is a transcriptional target and
mediator of c-myc-induced apoptosis. Cancer Res 60, 6318-
6325.
Monia BP, Johnston FJ, Geiger T, Muller M, and Fabbro D
(1996) Antitumor activity of a phosphorotioate antisense
oligodeoxynucleotide targeted against C-raf kinase. Nat Med
2, 668-675.
Morrish F, Giedt C, and Hockenbery D (2003) c-MYC apoptotic
function is mediated by NRF-1 target genes. Genes Dev 17,
240-255.
Nasi S, Ciarapica R, Jucker R, Rosati J, and Soucek L (2001)
Making decision through Myc. FEBS Lett 490, 153-162.
Nesbit CE, Tersak JM, and Prochownik EV (1999) MYC
oncogenes and human neoplastic disease. Oncogene 18,
3004-3016.
Niklinski J, Claassen G, Meyers C, Gregory MA, Allegra CJ,
Kaye FJ, Hann SR, and Zajac-Kaye M (2000) Disruption of
Myc-tubulin interaction by hyperphosphorylation of c-Myc
during mitosis or by constitutive hyperphosphorylation of
mutant c-Myc in Burkitt's lymphoma. Mol Cell Biol 20,
5276-5284.
Nilsson JA, and Cleveland JL (2003) Myc pathways provoking
cell suicide and cancer. Oncogene 22, 9007-9021.
Nilsson JA, and Cleveland JL (2004) Mnt: master regulator of
the max network. Cell Cycle 3, 588-590.
Noguchi K, Kitanaka C, Yamana H, Kokubu A, Mochizuki T,
and Kuchino Y (1999) Regulation of c-Myc through
phosphorylation at Ser-62 and Ser-71 by c-Jun N-terminal
kinase. J Biol Chem 274, 32580-32587.
O'Hagan RC, Schreiber-Agus N, Chen K, David G, Engelman
JA, Schwab R, Alland L, Thomson C, Ronning DR,
Sacchettini JC, Meltzer P, and DePinho RA (2000) Gene-
target recognition among members of the myc superfamily
and implications for oncogenesis. Nat Genet 24, 113-119.
Orian A, van Steensel B, Delrow J, Bussemaker HJ, Li L,
Sawado T, Williams E, Loo LW, Cowley SM, Yost C, Pierce
S, Edgar BA, Parkhurst SM, and Eisenman RN (2003)
Genomic binding by the Drosophila Myc, Max, Mad/Mnt
transcription factor network. Genes Dev 17, 1101-1114.
Park J, Kunjibettu S, McMahon SB, and Cole MD (2001) The
ATM-related domain of TRRAP is required for histone
acetyltransferase recruitment and Myc-dependent
oncogenesis. Genes Dev 15, 1619-1624.
Pastorino F, Brignole C, Marimpietri D, Pagnan G, Morando A,
Ribatti D, Sample SC, Gambini C, Allen TM, and Ponzoni M
(2003) Targeted liposomal c-myc antisense
oligodeoxynucleotides induce apoptosis and inhibit tumor
growth and metastases in human melanoma models. Clin
Cancer Res 9, 4595-4605.
Patel JH, Loboda AP, Showe MK, Showe LC, and McMahon
SB. (2004) Analysis of genomic targets reveals complex
functions of MYC. Nat Rev Cancer 4, 562-568.
Pelengaris S, Khan M, and Evan G (2002) c-Myc, more than just
a matter of life and death. Nat Rev Cancer 2, 764-776.
Pelengaris S, and Khan M (2003) The many faces of c-Myc.
Arch Biochem Biophys 416, 129-136.
Peltenburg LTC, de Bruin EC, Meersma D, Wilting S,
Jurgensmeier JM and Schrier PI (2004) c-Myc is able to
sensitize human melanoma cells to diverse apoptotic triggers.
Melanoma Res 14, 3-12.
Postel EH, Flint SJ, Kessler DJ, and Hogan ME (1991) Evidence
that a triplex-forming oligodeoxyribonucleotide binds to the
c-myc promoter in HeLa cells, thereby reducing cmyc
mRNA levels. Proc Natl Acad Sci USA 88, 8227-8231.
Prendergast G (1999) Mechanisms of apoptosis by c-Myc.
Oncogene 18, 2967-2987.
Rait AS, Pirollo KF, Ulick D, Cullen K, and Chang EH (2003)
Her-2-targeted antisense oligonucleotide results in
sensitization of head and neck cancer cells to
chemotherapeutic agents. Ann N Y Acad Sci 1002, 79-89.
Re RN, Cook JL, and Giardina JF (2004) The inhibition of tumor
growth by triplex-forming oligonucleotides. Cancer Lett
209, 51-53.
Rupnow BA, Alarcon RM, Giaccia AJ, and Knox SJ (1998) p53
mediates apoptosis induced by c-Myc activation in hypoxic
![Page 88: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/88.jpg)
Supino and Scovassi: Strategies to modulate the different functions of c-myc
394
or gamma irradiated fibroblasts. Cell Death Differ 5, 141-
147.
Sakamuro D, and Prendergast GC (1999) New Myc-interacting
proteins: a second Myc network emerges. Oncogene 18,
2942-2954.
Salghetti SE, Kim SY, and Tansey WP (1999). Destruction of
Myc by ubiquitin-mediated proteolysis, cancer-associated
and transforming mutations stabilize Myc. EMBO J 18, 717-
726.
Schuhmacher M, Kohlhuber F, Holzel M, Kaiser C, Burtscher H,
Jarsch M, Bornkamm GW, Laux G, Polack A, Hudle UH,
and Eick D (2001) The transcriptional program of a human B
cell line in response to Myc. Nucl Acids Res 29, 397-406.
Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, and Nevins JR
(2000) Multiple Ras-dependent phosphorylation pathways
regulate Myc protein stability. Genes Dev 14, 2501-2514.
Shen C, Rattat D, Buck A, Mehrke G, Polat B, Ribbert H,
Schirrmeister H, Mahren B, Matuschek C, and Reske SN
(2003) Targeting bcl-2 by triplex-forming oligonucleotide-a
promising carrier for gene-radiotherapy. Cancer Biother
Radiopharm18, 17-26.
Shiio Y, Donohoe S, Yi EC, Goodlett DR, Aebersold R, and
Eisenman RN (2002) Quantitative proteomic analysis of Myc
oncoprotein function. EMBO J 21, 5088-5096.
Simile MM, De Miglio MR, Muroni MR, Frau M, Asara G, Serra
S, Muntoni MD, Seddaiu MA, Daino L, Feo F, and Pascale
RM (2004) Down-regulation of c-myc and Cyclin D1 genes
by antisense oligodeoxy nucleotides inhibits the expression
of E2F1 and in vitro growth of HepG2 and Morris 5123 liver
cancer cells. Carcinogenesis 25, 333-341.
Soldani C, Bottone MG, Biggiogera M, Alpini C, Scovassi AI,
Martin T, and Pellicciari C (2002) Nuclear localization of
phosphorylated c-Myc protein in human tumor cells. Eur J
Histochem 46, 377-380.
Spector DL, Watt RA, and Sullivan NF (1987) The v- and c-myc
oncogene proteins colocalize in situ with small nuclear
ribonucleoprotein particles. Oncogene 1, 5-12.
Spencer CA, and Groudine M (1991) Control of c-myc
regulation in normal and neoplastic cells. Adv Cancer Res
56, 1-48.
Stephens AC, and Rivers RP (2003) Antisense oligonucleotide
therapy in cancer. Curr Opin Mol Ther 5, 118-122.
Supino R, Perego P, Gatti L, Caserini C, Leonetti C, Colantuono
M, Zuco V, Carenini N, Zupi G, and Zunino F (2001) A role
for c-myc in DNA damage-induced apoptosis in a human
TP53-mutant small-cell lung cancer cell line. Eur J Cancer
37, 2247-2256.
Tang NH, Chen YL, Wang XQ, Li XJ, Yin FZ, and Wang XZ
(2004) Cooperative inhibitory effects of antisense
oligonucleotide of cell adhesion molecules and cimetidine on
cancer cell adhesion. World J Gastroenterol 10, 62-66.
Thomas TJ, Faaland CA, Gallo MA, and Thomas T (1995)
Suppression of c-myc oncogene expression by a polyamine-
complexed triplex forming oligonucleotide in MCF-7 breast
cancer cells. Nucl Acids Res 23, 3594-3599.
Tiberio L, Maier JAM, and Schiaffonati L (2001) Down-
modulation of c-myc expression by phorbol ester protects
CEM T leukaemia cells from starvation-induced apoptosis:
role of ornithine decarboxylase and polyamines. Cell Death
Differ 8, 967-976.
Tortora G, and Ciardiello F (2003) Antisense targeting protein
kinase A type I as a drug for integrated strategies of cancer
therapy. Ann N Y Acad Sci 1002, 236-243.
Wagner RW (1995) The state of the art in antisense research. Nat
Med 1, 1116-1118.
Wang H, Oliver P, Zhang Z, Agrawal S, and Zhang R (2003)
Chemosensitization and radiosensitization of human cancer
by antisense anti-MDM2 oligonucleotides: in vitro and in
vivo activities and mechanisms. Ann NY Acad Sci 1002,
217-235.
Watson JD, Oster SK, Shago M, Khosravi F, and Penn LZ
(2002) Identifying genes regulated in a Myc-dependent
manner. J Biol Chem 277, 36921-36930.
Webb MS, Harasym TO, Masin D, Bally MB, and Mayer LD
(1995) Sphingomyelin-cholesterol liposomes significantly
enhance the pharmacokinetic and therapeutic properties of
vincristine in murine and human tumor models. Br J Cancer
72, 896-904.
Welcker M, Orian A, Jin J, Grim JA, Harper JW, Eisenman RN,
and Clurman BE (2004) The Fbw7 tumor suppressor
regulates glycogen synthase kinase 3 phosphorylation-
dependent c-Myc protein degradation. Proc Natl Acad Sci
USA 101, 9085-9090.
Yeh E, Cunningham M, Arnold H, Chasse D, Monteith T, Ivaldi
G, Hahn WC, Stukenberg PT, Shenolikar S, Uchida T,
Counter CM, Nevins JR, Means AR, and Sears R (2004) A
signalling pathway controlling c-Myc degradation that
impacts oncogenic transformation of human cells. Nat Cell
Biol 6, 308-318.
Yin X, Landay MF, Han W, Levitan ES, Watkins SC, Levenson
RM, Farkas DL, and Prochownik EV (2001) Dynamic in
vivo interactions among Myc network members. Oncogene
20, 4650-4664.
Yu Q, He M, Lee NH, and Liu ET (2002) Identification of Myc-
mediated death response pathways by microarray analysis. J
Biol Chem 277, 13059-13066.
Yuan F, Leunig M, Huang SK, Berk DA, Papahadjopoulos D,
and Jain RK (1994) Microvascular permeability and
interstitial penetration of sterically stabilized (stealth)
liposomes in a human tumor xenograft. Cancer Res 54,
3352-3356.
Zangemeister-Wittke U (2003) Antisense to apoptosis inhibitors
facilitates chemotherapy and TRAIL-induced death
signalling. Ann NY Acad Sci 1002, 90-94.
Zhang XX, Cui CC, Xu XG, Hu XS, Fang WH, and Kuang BJ
(2004) In vivo distribution of c-myc antisense
oligodeoxynucleotides local delivered by gelatine-coated
platinum-iridium stents in rabbits and its effect on apoptosis.
Chin Med J 117, 258-263.
Zhou ZQ, and Hurlin PJ (2001) The interplay between Mad and
Myc in proliferation and differentiation. Trends Cell Biol
11, S10-14.
From left to right: Rosanna Supino and A. Ivana Scovassi
![Page 89: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/89.jpg)
Gene Therapy and Molecular Biology Vol 8, page 395
395
Gene Ther Mol Biol Vol 8, 395-402, 2004
DNA-based vaccine for treatment of intracerebral
neoplasmsResearch Article
Terry Lichtor1,3*, Roberta P Glick1,3, InSug O-Sullivan2, Edward P Cohen2,4
1Department of Neurological Surgery, Rush University Medical Center and John H Stroger Hospital of Cook County2Department of Microbiology and Immunology, University of Illinois at Chicago; Chicago, Illinois
__________________________________________________________________________________
*Correspondence: Terry Lichtor, MD, PhD, Department of Neurosurgery, 1900 West Polk Street, Chicago, Illinois 60612; Telelphone:
312-864-5120; Fax: 312-864-9606; E-Mail: [email protected]
Key words: Gene Therapy, Breast Cancer, Brain Tumors, Tumor Vaccine
Abbreviations: cytotoxic T-lymphocyte, (CTL); intracerebrally, (i.c.); Mean survival time, (MST); phenazine methosulfate, (PMS);
spontaneous breast neoplasm, (SB-5b); tumor associated antigens, (TAA)
3Supported in part by a grant from CINN Foundation awarded to Drs. Lichtor and Glick4Supported in part by NIDCR grant number RO1DE013970-01A2 awarded to Dr. Cohen
Received: 8 July 2004; revised: 14 September 2004
Accepted: 20 September 2004; electronically published: September 2004
Summary
Antigenic differences between normal and malignant cells of the cancer patient form the rationale for clinical
immunotherapeutic strategies. Because the antigenic phenotype of neoplastic cells varies widely among different
cells within the same malignant cell-population, immunization with a vaccine that stimulates immunity to the broad
array of tumor antigens expressed by the cancer cells is likely to be more efficacious than immunization with a
vaccine for a single antigen. A vaccine prepared by transfer of DNA from the tumor into a highly immunogenic cell
line can encompass the array of tumor antigens that characterize the patient’s neoplasm. Poorly immunogenic
tumor antigens, characteristic of malignant cells, can become strongly antigenic if they are expressed by highly
immunogenic cells. A DNA-based vaccine was prepared by transfer of genomic DNA from a breast cancer that
arose spontaneously in a C3H/He mouse into a highly immunogenic mouse fibroblast cell line, where genes
specifying tumor-antigens were expressed. The fibroblasts were modified in advance of DNA-transfer to secrete an
immune augmenting cytokine and to express allogeneic MHC class I-determinants. In an animal model of breast
cancer metastatic to the brain, introduction of the vaccine directly into the tumor bed stimulated a systemic cellular
anti-tumor immune response and prolonged the lives of the tumor-bearing mice.
I. IntroductionAn emerging strategy in the treatment of cancer
involves stimulation of an immune response against the
unique antigens expressed by the neoplastic cells. The
expectation is that effectively stimulated, the immune
system can be called upon to destroy the malignant cells.
In most instances, proliferating tumors do not provoke
anti-tumor immune responses, which are capable of
controlling tumor growth. The neoplastic cells escape
recognition by the immune system in spite of the fact that
they form weakly immunogenic tumor associated antigens
(TAA). The successful induction of immunity to TAA
could result in tumor cell destruction and prolongation of
the survival of cancer patients. A number of different
techniques have been designed to increase the antigenic
properties of tumor cells. The immunogenic properties of
tumor cells were increased by modifying neoplastic cells
to secrete immune-augmenting cytokines, or by “feeding”
antigen presenting (dendritic) apoptotic bodies from tumor
cells or tumor cell lysates. Anti-tumor immune responses
followed immunization with such vaccines as well as
vaccine prepared by introducing tumor cell-derived RNA
into dendritic cells. Immunization with dendritic cells
“fed” derivates of tumor cells or transfected with tumor-
RNA can result in the induction of immune responses
against the broad array of tumor antigens expressed by the
population of malignant cells including tumors of
neuroectodermal origin. In one pre-clinical study,
intraperitoneal injection of bone marrow-derived dendritic
![Page 90: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/90.jpg)
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
396
cells pulsed with the RNA derived from the GL261 glioma
cells induced a T cell response against intracerebrally
implanted GL261 cells (O et al, 2002). The efficacy of the
vaccine was improved further by administration of
recombinant interleukin-12 into the vaccine regimen. In
patients, immunization with autologous dendritic cells
transfected with mRNA from malignant glioma elicited a
tumor specific CD8+ cytotoxic T-lymphocyte (CTL)
response against the patient’s malignant cells (Kobayashi
et al, 2003).
Immunotherapy can result in the selective destruction
of the neoplasm with minimal or non-existent toxic
effects. Selective tumor regression was observed in
experimental animals and patients receiving
immunotherapy alone, suggesting the potential
effectiveness of this type of treatment for patients with
malignant disease (Valmori et al, 2000).
Antigenic differences between normal and malignant
cells form the rationale for clinical immunotherapy
protocols. Because the antigenic phenotype varies widely
among different cells within the same tumor-cell
population, immunization with a vaccine that stimulates
immunity to multiple TAA expressed by the entire
population of malignant cells is likely to be more effective
than immunization with a vaccine for a single antigen.
Variants that fail to express the antigen chosen for therapy
can avoid destruction. Here, in a mouse model, we
describe the application of a novel immunotherapeutic
strategy to intracerebral breast cancer. The vaccine was
prepared by transfer of genomic DNA from breast cancer
cells into a highly immunogenic fibroblast cell line, where
genes specifying breast cancer antigens are expressed
(Cohen, 2001). The vaccine encompasses the array of
TAA that defines the patient’s neoplasm. Poorly
immunogenic TAA, characteristic of malignant cells,
become strongly antigenic if they are expressed by highly
immunogenic cells. In animal models of melanoma and
breast cancer, immunization with DNA-based vaccine was
sufficient to deter tumor growth and to prolong the lives of
tumor-bearing mice (Cohen, 2001; Whiteside et al, 2002).
Previous studies indicated that transfection of genomic
DNA from the malignant cells into the cell line resulted in
stable integration and expression of the transferred DNA
altering both the genotype and the phenotype of the cells
that took up the exogenous DNA. The genetically
engineered cells were effective stimulators of the anti-
tumor immune response. Immunization of tumor-bearing
mice with the DNA-based vaccine resulted in the
induction of cell mediated immunity directed toward the
type of cell from which the DNA was obtained, and
prolongation of survival. This was the case for mice with
melanoma, squamous cell carcinoma and in mice with
breast cancer (de Zoeten et al, 1999). Multiple undefined
genes specifying TAA that characterize the malignant cell
population were expressed by cells that took up DNA from
the tumor. Among other advantages, only microgram
quantities of DNA from small amounts of tumor tissue
were required to prepare the vaccine. As the transferred
DNA is integrated into the genome of the recipient cells,
and is replicated as the cells divide, the number of vaccine
cells can be expanded as required for multiple
immunizations. The recipient cells can also be modified
before DNA transfer to increase their immunogenic
properties, as for example, to secrete immune-augmenting
cytokines or to express allogeneic MHC-determinants. In
animal models, injection of cytokine-secreting allogeneic
fibroblasts into the tumor bed of intracerebral neoplasms
was also effective in the treatment of mice with
established brain tumors (Lichtor et al, 2002).
Although immunotherapy with a vaccine prepared by
transfer of tumor-DNA into a highly immunogenic cell
line has its advantages, there are potential concerns. Genes
that specify normal cellular constituents are also expressed
by the transfected cells. They may be recognized as
‘foreign’ by the immune system, provoking an
autoimmune disease. Autoimmune disease has not been
observed, however, following extensive immunization
with the tumor-DNA-transfected fibroblasts. The immune
system is normally tolerant to “self” antigens. Mice
immunized with DNA-based vaccines have not exhibited
adverse effects; they lived their anticipated life spans
without evidence of disease. Cellular infiltrates into
normal organs or tissues have not been detected. It is also
conceivable that the vaccine itself may grow in the
recipient, forming a tumor or provoking a neoplasm.
However in multiple studies, tumor growth at the
vaccination site or elsewhere in the body has not been
observed.
II. Materials and methods
A. Preparation of a vaccine for use in the
treatment of intracerebral breast cancer by
transfection of cytokine-secreting syngeneic
/allogeneic fibroblasts with DNA from a breast
carcinoma that arose spontaneously in a C3H/He
mouse (SB-5b cells)Cytokine-secreting syngeneic/allogeneic fibroblasts were
prepared as described previously (Lichtor et al, 2002). The cells
were further modified by transferring DNA from mouse SB-5b
breast cancer cells into the fibroblasts (Figure 1). Sheared,
unfractionated DNA isolated (Qiagen, Chatsworth, CA) from a
spontaneous mammary adenocarcinoma (SB-5b) that arose in a
C3H/He mouse taken directly from in vitro cultured cells, was
used to transfect mouse fibroblasts modified to express
allogeneic H-2Kb-determinants and to secrete IL-2 (LM-IL-2Kb
cells), IL-18 (LM-IL-18Kb cells) or GM-CSF (LM-GMCSFKb
cells) or to express H-2Kb-determinants alone (LMKb cells) using
the methods described in (Wigler et al, 1979) as modified.
Briefly, high molecular weight DNA from each cell type was
sheared by passage through the DNA isolation column. The
approximate size of the DNA at the time it was used in the
experiments was 25 kb. Afterward, 100 µg of sheared DNA was
mixed with 10 µg pCDNA6/V5-HisA, a plasmid which gives
resistance to the antibiotic Blasticidin, for use in selection. The
sheared DNA and plasmid (DNA : plasmid ratio = 10 : 1) were
then mixed with Lipofectamine 2000, according to the
manufacturer’s instructions (Life Technologies, Carlsbad, CA).
The DNA/Lipofectamine mixture was added to a population of 1
X 107 actively proliferating LM-IL-2Kb, LM-IL18Kb,
LMGMCSFKb cells, or non-cytokine secreting LMKb cells
divided into ten dishes containing an original inoculum of 1 X
106 cells. Eighteen hours afterward, the medium was replaced
with fresh growth medium. The fibroblasts were maintained for
14 days in growth medium containing 2-5 µg/ml Blasticidin HCl
![Page 91: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/91.jpg)
Gene Therapy and Molecular Biology Vol 8, page 397
397
Figure 1. Preparation of the DNA-based vaccine. DNA-based vaccines were prepared by transfection of the fibroblast cell line LM with
DNA from mouse breast carcinoma. Briefly, high-molecular weight DNA from SB-5b cells was sheared by passage through the DNA
isolation column. Next, 100 µg of the sheared DNA was mixed with 10 µg pCDNA6/V5-HisA, a plasmid that confers resistance to
Basticidin. The sheared DNA and the plasmid were then mixed with lipofectamine to facilitate DNA uptake. The DNA-lipofectamine
mixture was added to a population of 1 X 107 LM fibroblasts modified previously by retroviral transduction to secrete IL-2 and to
express H-2Kb-determinants (LM-IL-2Kb cells). The transfected fibroblasts were grown on a tissue culture plate, and Blasticidin was
added to the medium to select for cells that had taken up the foreign plasmid DNA.
(Invitrogen, Carlsbad, CA). One hundred percent of the cells
transfected with tumor-DNA alone maintained in the Basticidin
growth medium died within this period. The surviving colonies
in each of the plates (a total of at least 2.5 X 104) were pooled
and maintained as a cell line for use in the experiments.
B. Intracerebral injection of C3H/He mice
with SB-5b breast cancer cellsAs a model of intracerebral metastatic breast cancer in
patients, C3H/He mice were injected intracerebrally with a
mixture of SB-5b breast cancer cells and the DNA-transfected
modified fibroblasts. Anesthetized mice were placed into a
stereotactic frame. A 1 mm burr hole was introduced into the
right frontal lobe in the region of the coronal suture using a D#60
drill bit (Plastics One, Roanoke, VA). A Hamilton syringe
containing a 26 gauge needle with a small 2-3 mm piece of
solder placed 3-4 mm from the tip of the needle to maintain a
uniform depth of injection was used to introduce the breast
cancer cells and vaccine into the brain. The total injection
volume was 5-10 µl. After injection, the incision over the burr
hole was closed with a single 5-O Dexon absorbable suture.
C. T cell mediated cytotoxicity toward breast
cancer cellsA CellTiter 96 aqueous non-radioactive cell proliferation
assay kit (Promega, Madison WI) was used to measure T cell
mediated cytotoxicity toward the breast cancer cells in mice
injected intracerebrally with the transfected fibroblasts. T cells
from the spleens of mice injected with the transfected cells were
co-incubated for 18 hr with SB-5b cells. Afterward, the number
of remaining viable cells was measured by MTS, which is
bioreduced by cells into a formazan product that can be detected
at 490 nm. Effector T cells recovered from the spleens by
Histopaque (Sigma) density gradient (Kim and Cohen, 1994)
were co-cultured at 370 C for 18 hrs with mitomycin C-treated
(50 µg/ml for 45 min at 370 C) SB-5b target cells. The ratio of
spleen cells to SB-5b cells was 30:1. Afterward, the non-adherent
cells were removed, washed and viable SB-5b cells were added
at various E:T ratios for 4 hrs at 370C. Negative control wells
were treated with 2% Triton-100 to cause total lysis of the cells.
Positive control wells contained SB-5b cells alone. Next 20 µl of
MTS and 1 µl of phenazine methosulfate (PMS), an electron
coupling reagent, were mixed and added to each well, followed
by incubation at 37°C for 1-4 hrs in a 7% CO2/air atmosphere
after which the absorbance was read. The percent specific lysis
was calculated from the absorbance using the formula as follows:
100 X Control Negative– Control Positive
Control Negative– Group alExperiment
D. ELISPOT IFN-! Assay
Spleen cells from C3H/He mice injected i.c. with the
various cell constructs were analyzed in ELISPOT IFN-! assays.
This determines the proportion of T cells reactive with SB-5b
cells. T cells from the spleens were recovered by Histopaque
density gradient and co-incubated with SB-5b tumor cells (the
spleen cell: SB-5b cell ratio = 10:1) for 16 hours at 37°C in wells
precoated with a high-affinity monoclonal antibody for INF-!
according to the manufacturer’s instructions (BD Pharmingen,
San Diego, CA). The cells were washed before the addition of
biotinylated anti-IFN-! detection antibody and horse radish
peroxidase labeled streptavidin (Streptavidin-HRP). The spots
were counted using computer-assisted image analysis
(ImmunoSpot Series 2 analyzer: Cellular Technology Limited,
Cleveland, OH).
![Page 92: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/92.jpg)
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
398
E. Statistical analysisStudent’s t test was used to determine the statistical
differences between the survival of mice in various experimental
and control groups. A P value less than 0.05 was considered
significant.
III. ResultsA. Treatment of mice bearing an
intracerebral breast cancer with DNA-
transfected syngeneic/allogeneic fibroblasts
modified to secrete immune augmenting
cytokinesThe immunotherapeutic properties of the modified
fibroblasts transfected with DNA from a breast cancer that
arose spontaneously in a C3H/He mouse were determined
in mice with intracerebral breast cancer. C3H/He mice
were injected intracerebrally (i.c.) with a mixture of 1.0 X
104 SB-5b breast carcinoma cells and 1.0 X 106 cytokine-
secreting syngeneic/allogeneic fibroblasts transfected with
DNA from the breast cancer cells. The results (Figure 2)
indicated that mice injected i.c. with a mixture of breast
cancer cells and transfected syngeneic/allogeneic
fibroblasts modified to secrete IL-2 survived significantly
longer than mice injected i.c. with a mixture of breast
cancer cells and non cytokine-secreting, transfected
fibroblasts (P < 0.005). Analogous results were obtained
for mice injected i.c. with a mixture of breast cancer cells
and transfected fibroblasts modified to secrete GM-CSF (P
< 0.05). The survival of mice injected i.c. with SB-5b cells
and transfected fibroblasts modified to secrete IL-18 was
not significantly different than that of mice injected with
SB-5b cells and non-secreting transfected cells. The
experiment was repeated twice with equivalent results.
Thus syngenic/allogeneic fibroblasts modified to
secrete IL-2 or GM-CSF that were transfected with DNA
from breast cancer cells were effective in prolonging the
survival of mice with intracerebral breast cancer.
Transfected fibroblasts modified to secrete IL-18 were not
effective.
B. T cell mediated toxicity toward breast
cancer in mice injected intracerebrally with
syngeneic/allogeneic transfected fibroblasts
modified to secrete IL-2, GM-CSF or IL-18An MTS cytotoxicity assay was used to detect the
presence of cytotoxic T lymphocytes towards breast
cancer in mice injected i.c. with the mixture of SB-5b
breast cancer cells and the modified DNA-transfected
fibroblasts. The T cells, obtained from the spleens of the
injected mice, were analyzed two weeks after the i.c.
injection of the cell mixture. The results (Figure 3)
indicated that, like the survival of mice with i.c. breast
cancer treated with the cytokine-secreting fibroblasts, the
cytotoxic response of greatest magnitude was in mice
injected i.c. with the mixture of SB-5b cells and
transfected fibroblasts modified to secrete IL-2 or GM-
CSF. Lesser cytotoxic effects were present in mice
injected i.c. with SB-5b cells and transfected fibroblasts
modified to secrete IL-18.
An Elispot-IFN-! assay was used to determine the
proportion of T cells in the spleen that were reactive with
Figure 2. Treatment of C3H/He mice with intracerebral SB-5b breast carcinoma with cytokine-secreting allogeneic fibroblasts
transfected with DNA from a spontaneous breast neoplasm (SB-5b). C3H/He mice (nine animals/group) were injected with a mixture of
1.0 X 104 SB-5b cells and 1.0 X 106 cytokine secreting fibroblasts transfected with tumor DNA or with an equivalent number of non-
secreting cells transfected with tumor DNA (LMKb/SB5b). Mean survival time (MST) in days: Media control, 23.0 ± 1.9; LMKb/SB5b,
27.3 ± 6.3; LMKbGMCSF/SB5b, 30.0 ± 9.5; LMKbIL-2/SB5b, 36.6 ± 7.0; LMKbIL-18/SB5b, 28.4 ± 4.8. Probability values were as
follows: LMKbIL-2/SB5b vs LMKb/SB5b or media control, P < 0.005; LMKbIL-2/SB5b vs LMKbIL-18/SB5b, P < 0.025; LMKbIL-
2/SB5b vs LMKbGMCSF/SB5b, P < 0.05; LMKbGMCSF/SB5b vs media control, P < 0.05.
![Page 93: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/93.jpg)
Gene Therapy and Molecular Biology Vol 8, page 399
399
Figure 3 . MTS proliferation assay from spleen cells taken from the animals two weeks following a single intracerebral injection of a
mixture of tumor and treatment cells. The target cells used in this study were SB-5b breast cancer cells, and the effector (spleen cell) to
target cell ratios (E/T) were 50:1 and 100:1. Mononuclear cells from the spleens of the immunized mice obtained through Histopaque
centrifugation were used for this assay. The error bars represent one standard deviation.
Figure 4. ELISPOT assay detecting INF-! secretion by spleen cells in the animals that have survived for six weeks following the initial
injection of SB-5b tumor cells and allogeneic fibroblasts transfected with tumor DNA. Mononuclear cells from the spleens of the
immunized mice obtained through Histopaque centrifugation were used in this assay. The assay was done in the presence (SB-5b
stimulated) and absence (unstimulated) of SB-5b tumor cells. The error bars represent one standard deviation.
![Page 94: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/94.jpg)
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
400
SB-5b cells in mice immunized with transfected
fibroblasts modified to secrete IL-2 or GM-CSF. The
assay was performed six weeks after the i.c. injection of
the mixture of SB-5b cells and the transfected fibroblasts.
The results indicated that the highest proportion of T cells
reactive with SB-5b cells was in surviving mice injected
with fibroblasts modified to secrete IL-2 (Figure 4).
Lesser numbers of spots were found in T cells from mice
injected with SB-5b cells and non-secreting transfected
fibroblasts or SB-5b cells and transfected fibroblasts
modified to secrete GM-CSF. The analysis of cells from
mice injected i.c. with SB-5b cells and transfected
fibroblasts modified to secrete IL-18 was not performed
because there were no surviving mice.
IV. DiscussionThe prognosis for patients with breast cancer
metastatic to the brain is poor, with the survival ranging
from eight to thirteen months (Bendell et al, 2003; Ogura
et al, 2003). Breast cancer is the second leading cause of
cancer-related death in American women, and
conventional treatments such as surgery, radiation therapy
and chemotherapy have provided little benefit to affect
long-term survival. Given the poor prognosis associated
with metastatic tumors to the brain, there is urgent need
for the development of therapies that can impact on
clinical survival rates.
Here, we report the generation of cell mediated
immune responses toward breast cancer in mice
immunized i.c. with cytokine-secreting syngeneic
/allogeneic mouse fibroblasts transfected with DNA from
a breast neoplasm that arose spontaneously in a C3H/He
mouse (SB-5b cells). Mice injected i.c. with breast cancer
cells and the transfected fibroblasts survived significantly
longer than mice injected with the breast cancer cells
alone, pointing toward the potential of this form of therapy
in breast cancer patients whose neoplasm has metastasized
to the brain.
Further evidence for the efficacy of the transfected
fibroblasts to stimulate an anti-tumor immune response
was provided by the results of the in vitro studies. Spleen
cells from mice injected i.c. with the DNA-based vaccine
were responsive to SB-5b breast cancer cells both in
ELISPOT IFN-! and cytolytic T lymphocyte assays. Co-
incubation of breast cancer cells and T cells from the
spleens of the i.c. injected mice stimulated both CTL-
mediated lysis of the breast cancer cells as well as the
number of activated T cells as determined by ELISPOT
IFN-! assays. Prior studies by this laboratory have
indicated that the introduction of high m.w. genomic DNA
from one cell type, using the techniques described in this
manuscript, altered both the genotype and the phenotypic
characteristics of the cells that took up the exogenous
DNA (de Zoeten et al, 1999). No attempt has been made
to identify the tumor associated antigens expressed by the
transfected cells. The identification of tumor antigens is
technically challenging and may not be required in the
treatment of breast cancer patients.
Mouse fibroblasts were chosen as recipients of the
DNA from the breast cancer cells for several compelling
reasons. The cells, maintained as a cell line under
conventional laboratory conditions were readily
transfected with sheared, genomic DNA from the breast
cancer cells. Since the transferred DNA was integrated,
and replicated as the recipient cells divided (the
transfected fibroblasts were maintained through multiple
rounds of cell division before they were used in the
experiments), the number of transfected cells could be
expanded as necessary. In addition, the fibroblasts could
be modified in advance of DNA-transfer to augment their
immunogenic properties. In the experiments reported here,
the cells were modified to express allogeneic MHC class I-
determinants and to secrete IL-2, IL-18 or GM-CSF.
Allogeneic class I-determinants are strong immune
adjuvants. IL-2 and GM-CSF are growth and activation
factors for CTLs. IL-18 stimulates CTLs and augments
NK cell mediated cytotoxicity. The immune-augmenting
properties of IL-2 and GM-CSF exceeded that of IL-18 in
this unique model system. In addition, like dendritic cells,
fibroblasts are efficient antigen presenting cells. In
particular they express class I-determinants and co-
stimulatory molecules required for T cell activation
constitutively. The cells used as DNA-recipients expressed
H-2k-determinants and B7.1. Systemic class I restricted
cellular breast cancer immune responses were generated in
mice injected i.c. with the transfected cells.
Transfection of DNA from the breast cancer cells
into a highly immunogenic cell line has additional
important advantages. A tumor cell line derived from a
primary breast neoplasm does not have to be established if
the patient’s own tumor is genetically modified to prepare
a vaccine for immunization. Preparation of a cell line from
a primary neoplasm is technically challenging and,
especially in the case of breast cancer, cannot always be
accomplished.
Surprisingly, the proportion of the transfected cell
population that expressed the products of genes specifying
TAA was sufficient to induce the anti-breast cancer
immune response. Our observation that the anti-tumor
immune response that were sufficient to deter the growth
of intracerebral breast cancer, resulting in prolongation of
survival may be an indication that multiple and possible
large numbers of immunologically distinct TAA, the
products of multiple mutant/dysregulated genes were
present within the population of breast cancer cells.
The results presented in this study raise the
possibility that a human fibroblast cell line that shares
identity with the patient at one or more MHC class I
alleles may be readily modified to provide immunologic
specificity for TAA expressed by the patient’s neoplastic
cells. Transfection of a highly characteristic fibroblast cell
line with DNA prepared from the tumor may capture the
array of genes that characterize the neoplasm. It is
conceivable that the prolongation of survival noted in the
treated animals in this study may be largely due to the
expression of potent immunostimulatory cytokines in
close proximity to tumor cells and independent of the
expression of genomic breast cancer DNA. However in
the clinical situation where the treatment cells will be
injected into the tumor cavity following surgical resection,
![Page 95: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/95.jpg)
Gene Therapy and Molecular Biology Vol 8, page 401
401
the expression of tumor antigens by the vaccine cells will
be more critical.
One concern related to therapy with fibroblasts
transfected with DNA from the tumor is that multiple
genes specifying normal “self” antigens are likely to be
expressed by the transfected cells. There is a theoretical
danger that autoimmune disease might develop in breast
cancer patients. Vaccines derived from tumor cell-extracts,
peptide elutes of tumor cells, or mRNA fed to APCs
including dendritic cells are subject to the same concern.
However, toxic effects have not been observed. Tumor-
free mice injected i.c. with cell-based vaccines including
those prepared by transfection of fibroblasts with DNA
from the breast cancer cells failed to exhibit adverse
effects. They lived their anticipated life spans without
evidence of disease.
The ultimate goal of cancer therapy is the elimination
of every remaining tumor cell from the patient. It is
unlikely that a single form of therapy is capable of
achieving this goal. However immunotherapy in
combination with surgery, radiation therapy and
chemotherapy will likely find a place as a new and
important means of treatment for patients with brain
tumors.
AcknowledgmentsThis work was supported in part by a grant from the
CINN foundation awarded to Drs. Lichtor and Glick, and
by NIDCR grant number RO1DE013970-01A2 awarded
to Dr. Cohen.
ReferencesBendell JC, Domchek SM, Burstein HJ, Harris L, Younger J,
Kuter I, Bunnell C, Rue M, Gelman R, Winer E (2003)
Central nervous system metastases in women who receive
trastuzumab-based therapy for metastatic breast carcinoma.
Cancer 97, 2972-2977.
Cohen EP (2001) DNA-based vaccines for the treatment of
cancer_an experimental model. Trends Mol Med 7, 175-
179.
de Zoeten E, Carr-Brendel V, Markovic D, Taylor-Papadimitriou
J, Cohen EP (1999) Treatment of breast cancer with
fibroblasts transfected with DNA from breast cancer cells. J
Immunol 162, 6934-6941.
Kim TS and Cohen EP (1994) Interleukin-2-secreting mouse
fibroblasts transfected with genomic DNA from murine
melanoma cells prolong the survival of mice with melanoma.
Cancer Res 54(10), 2531-2535.
Kobayashi T, Yamanaka R, Homma J, Tsuchiya N, Yajima N,
Yoshida S, Tanaka R (2003) Tumor mRNA-loaded dendritic
cells elicit tumor-specific CD8+ cytotoxic T cells in patients
with malignant glioma. Cancer Immunol Immunother 52,
632-637.
Lichtor T, Glick RP, Tarlock K, Moffett S, Mouw E, Cohen EP
(2002) Application of interleukin-2-secreting
syngeneic/allogeneic fibroblasts in the treatment of primary
and metastatic brain tumors. Cancer Gene Ther 9, 464-469.
O I, Ku G, Ertl HCJ, Blaszczyk-Thurin M (2002) A dendritic cell
vaccine induces protective immunity to intracranial growth
of glioma Anticancer Res 22, 613-622.
Ogura M, Mitsumori M, Okumura S, Yamauchi C, Kawamura S,
Oya N, Nagata Y, Hiraoka M (2003) Radiation therapy for
brain metastases from breast cancer. Breast Cancer 10, 349-
355.
Valmori D, Levy F, Miconnet I, Zajac P, Spagnoli GC, Rimoldi
D, Lienard D, Cerundolo V, Cerottini JC, Romero P (2000)
Induction of potent antitumor CTL responses by recombinant
vaccinia encoding a melan-A peptide analogue. J Immunol
164, 1125-1131.
Whiteside TL, Gambotto A, Albers A, Stanson J, Cohen EP
(2002) Human tumor derived genomic DNA transduced into
a recipient cell induces tumor-specific immune responses ex
vivo. Proc Natl Acad Sci USA 99, 9415-9420.
Wigler M, Pellicer A, Silverstein S, Axel R, Urlaub G, Chasin L
(1979) DNA-mediated transfer of the adenine
phosphoribosyltransferase locus into mammalian cells. Proc
Natl Acad Sci USA 76, 1373-1376.
Terry Lichtor, MD, PhD.
![Page 96: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/96.jpg)
Lichtor et al: DNA-Based Vaccine for intracerebral neoplasms
402
![Page 97: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/97.jpg)
Gene Therapy and Molecular Biology Vol 8, page 403
403
Gene Ther Mol Biol Vol 8, 403-412, 2004
The involvement of H19 non-coding RNA in stress:
Implications in cancer development and prognosisResearch Article
Suhail Ayesh1,2*, Iba Farrah1, Tamar Schneider1, Nathan de-Groot1 and Abraham
Hochberg1
1The Department of Biological Chemistry, the Silberman Institute of Life Sciences. The Hebrew University of Jerusalem,
Jerusalem, Israel2Molecular Genetics Lab, Makassed Islamic Charitable Hospital, Jerusalem, Israel
__________________________________________________________________________________
*Correspondence: Suhail Ayesh, Tel: +972-2-6585455; Fax:+ 972-2-6510250; E-mail: [email protected]
Key words: Human cDNA expression assay, Bladder carcinoma cell lines, serum deprivation, hypoxia, Angiogenesis
Abbreviations: active cyclin dependent kinase 2, (CDK2); angiopoietin 1 receptor precursor, (TIE-2); c-jun N-terminal kinase, (JNK);
dimethyl sulphoxide, (DMSO); extracellular signal-regulated protein kinase, (ERK); fas-activated serine, (FAS); fetal calf serum, (FCS);
fibroblast growth factor receptor 1 precursor, (FGFR1); Focal adhesion kinase, (FAK); Hanks' Balanced Salt Solution, (HBSS); lipid-
activated protein kinase 2, (PRK2); mitogen-activated protein kinase and extracellular signal-regulated protein kinase, (MEK2);
mitogen-activated protein, (MAP); NF-kB-inducing kinase, (NIK); nuclear factor !-B, (NF-!B); phytohemagglutinin M, (PHA);
placenta growth factor, (PIGF); placental plasminogen activator inhibitor 2, (PAI-2); polymerase chain reaction, (PCR); Protein kinase C
", (PKCA); protein kinase C-#, (PKC-#); receptor-associated kinase, (IRAK IL1); reverse transcriptase-polymerase chain reaction, (RT-
PCR); Tumor necrosis factor-", (TNF-"); Urokinase plasminogen activator receptor, (uPAR); vascular endothelial growth factor
receptor 1, (VEGFR1); vascular permeability factor/vascular endothelial growth factor, (VPF/VEGF)
Received: 18 September 2004; Accepted: 27 September 2004; electronically published: October 2004
Summary
The H19 gene is an imprinted gene expressed from the maternal allele. It is known to function as an RNA molecule,
cDNA microarray hybridization was used in an attempt to identify novel kinases participating in cellular response
to hypoxia and serum deprivation. The expression of H19 RNA was examined in embryonic cells (Human
amniocytes) that normally express H19 RNA basal level. At low serum (0.1% FCS) medium or hypoxia: 100µM
CoCl2; or both: without serum (0.1% FCS) and 100µM CoCl2 for 16hr the fold increase of H19 RNA expression
was: 1.9 ±0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively. Significant increase in expression and induced (up)
expression of certain genes were observed in TA31 cell line that highly expresses H19 RNA. Using the human cDNA
atlas microarray, we detected differentially expressed genes modulated by the presence of H19 RNA in certain
conditions: serum deprivation, hypoxia and both serum deprivation and hypoxia which may resemble the stress
conditions in cancer. Some of the key genes that had increased or induced (up) expression mainly in serum
deprivation are: CDK2, FGFR1, IRAK, JNK1, uPAR and PRK2. In hypoxia the key genes are PKC-#, cot-proto
oncogene, PKC-", FAK and MEK2. In serum deprivation and hypoxia these genes are: Tie2, JNK2, ERK2 and
VEGFR1. Using Atlas Array and observing the genes that had increased or induced (up) expression, a good
indication for certain genes and pathways was found to be involved in tumor progression and angiogenesis. The
major angiogenesis genes include FGFR1, VEGF, TIE2, uPA, and PKC-#. Other signal molecules associated with
the invasive and migratory potential include JNK2, uPAR and FAK.
I. IntroductionH19 is the first imprinted gene with no protein
product described to have oncofetal properties (Ariel et al,
1997). Little is known about the function of this imprinted
gene, though it is expressed abundantly in the human
placenta and in several embryonic tissues. A gene lying in
exons with a very low mutation rate and having significant
expression levels in certain human cells and tissues, must
have a function, if not having several vital functions
(Hurst and Smith, 1999).
H19 expression increases in certain conditions and
tissues (Tycko and Morison, 2002). It increases in the
![Page 98: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/98.jpg)
Ayesh et al: The role of H19 gene during cancer development
404
carotid artery after injury, suggesting its role during
wound healing. During embryogenesis H19 RNA level is
highly elevated. Previous studies showed that H19 fulfills
an important role in the process of tumorigenesis
(Looijenga and Verkerk, 1997).
H19 is expressed abundantly in many cancer types,
but is only marginally expressed in nearly all normal adult
tissues. In some cases of breast adenocarcinoma with poor
prognosis, H19 is over expressed in epithelial cells (Lottin
et al, 2002). Our observations that ectopic expression of
H19 RNA alters expression profiles of (certain) genes
involved in metastasis and blood vessel development,
support the notion of a role for this gene in tumor invasion
and angiogenesis. This role seems to be triggered by stress
conditions that accompany tumor growth (better to be in
Discussion not here. It is especially noteworthy that many
of the genes modulated by H19 RNA are also hypoxia
responsive (Ayesh et al, 2002) The realization that a lot of
us carry in situ tumors (microscopic tumors), but do not
develop the disease, suggests that these microscopic
tumors are mostly dormant and need additional signals to
grow and become lethal tumors (Folkman and Kalluri,
2004). H19 is considered a tumor marker that combines
prognostic and predictive value in patients with refractory
superficial cancer (Ariel et al, 2000). The search for key
genes which convert the non-lethal tumors into the
expanding mass of tumor cells that is potentially lethal to
an individual became a very important issue.
To investigate more about the function of H19, we
transfected cells from the bladder carcinoma cell line
T24P, which does not express H19, with an episomal
construct in which H19 expression is under the control of
the cytomegalovirus promoter in either a sense full-length
cDNA construct (TA31 cells), or an anti-sense construct
covering 800 bp that extended from the 3' end direction
(TA11 cells). We aimed to identify kinases and genes that
showed altered expression between the TA31 (H19+) and
TA11 (H19-) cell lines with the Atlas human cDNA
expression array, containing cDNA from 350 all kinases.
We also compared the effect of the presence of H19 RNA
on the proliferation capacity of cells, and plotted out key
genes that were noticeably up regulated or over expressed
both in normal and poor serum conditions.
Some of the differentially expressed kinases are
among those promoting invasion, migration, angiogenesis
and notably apoptosis. These findings and results support
the suggestion of H19 functioning in cancer progression
by overcoming stress conditions thereby enabling cells to
survive and proliferate.
II. Materials and methodsA. Cell cultureThe human bladder carcinoma cell line T24P was obtained
from the American Type Culture Collection (Manassas, VA).
Cells from the T24P cell line were stably transfected with an
episomal vector that has an H19 full-length cDNA placed in
either the sense direction, creating TA31, or the antisense
direction (800 bp from 3’ end), creating TA11. The cells were
grown as previously described (Kopf et al, 1998). For serum
deprivation and hypoxia, these cells were grown in low serum
conditions (0.1% fetal calf serum (FCS)) medium or hypoxia:
100µM CoCl2 (Wang et al, 2000); or both: in low serum
conditions (0.1% FCS) and 100µM CoCl 2 for 16hr before RNA
extraction.
1. Human amniocytesHuman amniocytes were cultured in sterile flasks grown to
confluence in RPMI medium supplement. It contained 10% FCS,
1% Penicillin/ Streptomycin, 1% L-glutamate, and 1.3%
phytohemagglutinin M(PHA). They were grown at 370C in a
humidified incubator (95% air, 5% CO2), according to
cytogenetics laboratory procedure manual (Genetics Division
LAC/USA medical center,1990). When the cells reached
confluence, they were washed with Hanks' Balanced Salt
Solution (HBSS). Then trypsinized with EDTA-trypsin, and
neutralized with Bio-amf media (biological industries, Israel).
The media with the cultured cells were collected and sub-
cultured in 4 different flasks according to the previous culture
conditions for 48h. Later on, the flasks were washed with HBSS
and incubated for 16h with four different types of media. These
media are: medium A: the same medium mentioned above;
medium B: low serum conditions (0.1% FCS); medium C:
100µM CoCl2; medium D: low serum conditions (0.1% FCS) and
100µM CoCl2.
B. RNA Extraction and RT-PCRConditional media were collected; the cells were lysed, and
neutralized. Then total RNA was extracted by RNA STAT-60$
(TEL-TEST INC, Friends wood, TX) according to manufacturer
instructions. For RT-PCR reaction, the synthesis of cDNA was
performed using p(dT)15 primer (Boehringer, Mannheim,
Germany) to initiate reverse transcription of 2 µg total RNA with
400U of M-MLV reverse transcriptase (GibcoBRL®
Gaithersburg, MD).
The cDNA was used as a template for PCR to amplify the
tested genes, H19 and Histone H3.3. The amplification was
performed in a final volume of 25 µl reaction mixture. It
contained 2µl of cDNA, 0.625 units of Taq DNA polymerase
(Takara, Otsu, Japan), its 1X buffer (50 mM KCI, 2 mM MgCl2,
10 mM Tris-HCl), 0.2 mM dNTP mix, and 0.15µg of each
primer. DMSO (4.5%) was also used in the amplification of H19
transcript. Thermal cycling parameters for H19 were:
denaturation at 98°C for 15sec, annealing at 58°C for 30sec, and
extension at 72°C. In all the PCR assays, the number of cycles
was calibrated to ensure that PCR amplification was in the linear
phase. Each PCR was repeated 3 times. The integrity of the
cDNA was assayed by PCR analysis with the ubiquitous cell
cycle independent histone variant H3.3, as described by Futscher
et al, (1993). Photographs of the PCR products were scanned
with a PowerLook II scanner and quantified with ImageGague
version 3.41 software (Fuji Photo Film Co., Tokyo, Japan).
C. The custom Atlas arrayThe custom Atlas kinase array (Clontech Labs Inc)
includes 359 human complementary DNAs of known kinases and
phosphotase genes, divided into categories. In addition, the array
includes 9 housekeeping genes for internal control of gene
expression; genomic DNA spots as orientation markers and
controls of labeling efficiency; and negative controls
immobilized in duplicate dots on a nylon membrane.
D. RNA labeling and hybridizationThe Atlas array kit contains all necessary ingredients for RNA
labeling, probe purification, and hybridization. Total DNA-free
RNA (5 µg) from each tissue sample were labeled by "32-P-
dATP. The complementary DNA probe was purified on a special
column provided in the kit. Equal amounts of labeled probe
(about 10 7 cpm) for each cell line were hybridized to the array.
![Page 99: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/99.jpg)
Gene Therapy and Molecular Biology Vol 8, page 405
405
After several washings the arrays were exposed to radiographs at
-80°C for 7, 10, and 16 hours.
The whole analysis was carried out twice. The difference
between pattern and degree of gene expression was calibrated
using household genes in the two independent experiments.
E. RNA identification and comparisonSignals of exposure were scanned and quantified with
software for digital image analysis (Atlas-image, v. 2; Clontech
Labs Inc). This program is designed to compare gene expression
profiles and generate a detailed report. Briefly, after alignment of
the 2 arrays to the grid template, the background calculation was
performed. The program generates intensity values (the average
of the total signal from the left and right spots in double-spotted
arrays) and the normalization coefficient is calculated first for
array 1 and then applied to the adjusted intensity of each of the
genes on array 2. The adjusted intensity for a gene is the intensity
value minus background value multiplied by the normalization
coefficient. The ratio and difference values were calculated.
Comprehensive information on the genes included in the
array is found at Clontech Labs Inc's Atlas info bioinformatics
database (atlasinfo.clontech.com).
III. ResultsA. H19 expression at different stress
conditionsH19 expression in human amniocytes: the level of
H19 RNA was examined in embryonic cells (Human
amniocytes) that normally express H19 at basal level. The
change in H19 RNA expression was measured by RT-PCR
after different stress conditions and the results are as
shown below. Figure 1 shows that there is an increase in
H19 RNA level in low serum (0.1% FCS) medium or
hypoxia: 100µM CoCl2; or both: low serum conditions
(0.1% FCS) and 100µM CoCl2 for 16h. The increase of
H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ±
0.18 folds respectively.
H19 expression in T24P, TA 11 and TA 31 cell lines
was examined at low serum (0.1% FCS) medium, or
hypoxia: 100µM CoCl2; or both: low serum conditions
(0.1% FCS) and 100µM CoCl2for 16h by northern blot. As
shown in Figure 2, the H19 level was slightly increased in
T24p cell line at hypoxia (100µM CoCl2), while no H19
induction in TA 11 cell line, which contains the plasmid
that expresses the anti-sense for H19.
Figure 1. H19 expression in human ammniocytes. H19 RNA expression in usual medium (10% FCS) lane 1, low serum (0.1% FCS)
medium lane 2, hypoxia: 100µM CoCl2 lane 3; or both: low serum conditions(0.1% FCS) and 100µM CoCl2 lane 4 for 16hand blank
lane 5. The increase of H19 RNA expression was: 1.9 ± 0.11, 1.73 ± 0.2 and 2.0 ± 0.18 folds respectively.
Figure 2. Northern blot analysis of H19 expression in T24P, TA11 and TA31 cell lines at normal and different stress conditions. The
H19 RNA expression in normal conditions lane1, in low serum (0.1% FCS) medium lane2, or hypoxia: 100µM CoCl2 lane3; or both:
low serum conditions (0.1% FCS) and 100µM CoCl2 for 16hr lane 4, examined by northern blot in the three cell line: T24p cell line, TA
11 cell line, TA 31 cell line.
![Page 100: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/100.jpg)
Ayesh et al: The role of H19 gene during cancer development
406
1. Gene expression analysisThe results of microarray gene analysis after
different stress conditions were as follows: The genes
listed in these Tables (1, 2, 3) are those increased
significantly (more than 1.5 fold) or induced (up) in TA31
cell line compared to TA 11 and T24p cell lines. Table 1
contains the genes with increased and induced (up)
expression at low serum (0.1% FCS) medium. Table 2
contains the genes that increased or induced expression
(up) in hypoxia (100µM CoCl2); 3 contains the genes that
increased or induced (up) at double stress conditions (low
serum conditions (0.1% FCS) and 100µM CoCl2 for 16h.
Table 1. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS)
medium in TA 31 cell line compared to TA11 and T24p cell lines
B6e 2.31673 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362
B5a 2.346823 Ribose phosphophate pyrophosphokinase M57423
A7a 2.531401 fibroblast growth factor receptor1 precursor (FGFR1) X66945
C2d 2.64694 checkpoint kinase 1 (CHK1) AF016582
C1a 2.702954 hint protein; protein kinase C inhibitor 1 (PKCI1) U51004
B1a 3.088425 Diacylglycerol kinase " AF064771
B3k 3.276213 protein kinase A anchoring protein AF037439
D3e 3.287641 CDC28 protein kinase 2 AA010065
A2m 3.387337 DRAK2 AB011421
A6e 3.873097 neurotrophic tyrosine kinase receptor type 1 (NTRK1) X03541
A1f 5.618388 cyclin-dependent protein kinase 2 (CDK2) M68520
A7d 5.633224 protein kinase C " polypeptide (PKC-") M22199
A3f Up c-jun N-terminal kinase 1 (JNK1) L26318
A3n Up Protein-tyrosine kinase transmembrane M97639
A4d Up cyclin-dependent kinase 10 (CDK10) L33264
A4k Up mitogen-activated protein kinase kinase 6 (MAP kinase kinase 6) U39657
A5d Up urokinase-type plasminogen activator precursor (uPAR) M15476
A5m Up SHK1 kinase binding protein 1 AF015913
A6a Up angiopoietin 1 receptor precursor L06139
A7n Up Muscle specific tyrosine kinase receptor AF006464
B1b Up Selenide water dikinase 1 U34044
B1n Up Lipid-activated protein kinase 2 (PRK2) U33052
B3d Up cell division protein kinase 4 M14505
B4m Up ribosomal protein S6 kinase II "3 (S6KII-"3) U08316
B5l Up cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) M34182
B5m Up serine/threonine-protein kinase (NEK2) U11050
B6h Up Bruton's tyrosine kinase (BTK) U10087
B7a Up A kinase anchor protein U17195
C2c Up serine/threonine-protein kinase (NEK3) Z29067
C3f Up adenylate kinase 3 (AK3) X60673
C5c Up phosphatidylinositol 3-kinase catalytic subunit delta isoform U86453
C5e Up protein tyrosine kinase U02680
C5j Up activin receptor type I precursor (ACTRI) L02911
C7b Up serine/threonine protein kinase (SAK) Y13115
D6f Up serine/threonine-specific protein kinase minibrain U58496
Table 2. Genes that that had increased or induced (up) expression with a ratio of more than 1.5 fold at hypoxia in TA 31
cell line compared to TA11 and T24p cell lines
Gene code Ratio Protein/gene
Gene bank
accession
B1i 1.505267 ephrin type-B receptor 1 precursor L40636
A7d 1.510266 Protein kinase C " polypeptide (PKC-") M22199
A1m 1.512111 ntak protein (neural and thymus derived activator for erbb kinases AB005060
B6k 1.52491 ribosomal protein S6 kinase II "1 (S6KII-"1) L07597
A6d 1.528496 Placental plasminogen activator inhibitor 2 (PAI-2) M18082
D3h 1.544107 mitogen-activated protein kinase 9 L31951
B6e 1.555473 serine/threonine-protein kinase PCTAIRE 3 (PCTK3) X66362
![Page 101: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/101.jpg)
Gene Therapy and Molecular Biology Vol 8, page 407
407
C2d 1.568302 checkpoint kinase 1 (CHK1) AF016582
D1d 1.596408 protein kinase C # (PKC-#) Z15108
C3k 1.600221 6-phosphofructokinase D25328
A4c 1.604381 focal adhesion kinase (FAK) L13616
B7f 1.623765 NIK serine/threonine protein kinase Y10256
A7c 1.635135 protein serine/threonine kinase (STK1) L20320
A2m 1.641395 DRAK2 AB011421
B2j 1.671949 nucleoside diphosphate kinase A (NDKA) X17620
D4a 1.689245 calmodulin (CALM) J04046
B2e 1.805216 cell division control protein 2 homolog (CDC2) X05360
C5k 1.833114 putative diacylglycerol kinase eta (DAG kinase eta) D73409
B3l 1.882828 cAMP-dependent protein kinase I " regulatory subunit (PRKAR1) M33336
D3e 1.933686 CDC28 protein kinase 2 AA010065
C4l 1.940017
guanine nucleotide-binding protein & subunit 2-like protein 1
(GNB2L1) M24194
B3k 2.143857 protein kinase A anchoring protein AF037439
B1c 2.209804 tyrosine-protein kinase ctk L18974
A6e 2.553698 neurotrophic tyrosine kinase receptor type 1 (NTRK1) X03541
D1b 2.59454 Creatin kinase B chain L47647
B2k 2.730018 STE20-like kinase 3 (MST3) AF024636
B4k 2.73525 cot proto-oncogene D14497
C4i 2.925536 mevalonate kinase M88468
C7d 3.366751 serine/threonine protein kinase minibrain homolog (DYRK) D86550
A6a Up angiopoietin 1 receptor precursor (TIE-2) L06139
B1g Up mitogen-activated protein kinase kinase 2 (MAP kinase kinase 2) L11285
B3d Up cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) M14505
B5c Up tyrosine-protein kinase itk/tsk D13720
B5l Up cAMP-dependent protein kinase gamma-catalytic subunit M34182
B5m Up serine/threonine-protein kinase (NEK2) U11050
B6i Up serine/threonine-protein kinase PLK1 (STPK13) U01038
B6l Up c-ros-1 tyrosine-protein kinase proto-oncogene M34353
B6m Up STE20-like kinase (MST2) U26424
B7a Up A-kinase anchor protein U17195
C2n Up mitochondrial thymidine kinase 2 U77088
C3f Up adenylate kinase 3 (AK3) X60673
C3i Up phosphomevalonate kinase (PMKase) L77213
C5h Up dual-specificity protein phosphatase 9 Y08302
C5j Up activin receptor type I precursor (ACTRI) L02911
C5n Up 1D-myo-inositol-trisphosphate 3-kinase B X57206
C6e Up MAP kinase-activating death domain protein U77352
C6h Up myotonic dystrophy protein kinase-like protein Y12337
C7e Up serine kinase 9 (SRPK2) U88666
D1c Up calcium/calmodulin-dependent protein kinase type II U50359
Table 3. Genes that had increased or induced (up) expression with a ratio of more than 1.5 fold at low serum (0.1% FCS)
medium and hypoxia in TA 31 cell line compared to TA11 and T24p cell lines
Gene code Ratio Protein/gene
C4l 1.576539 guanine nucleotide-binding protein & subunit 2-like protein 1 (GNB2L1) M24194
C6j 1.590471 myotonin-protein kinase; myotonic distrophy protein kinase (MDPK) L19268
A1h 1.680315 DNA-dependent protein kinase (DNA-PK) U35835
B7c 1.715803 cell division protein kinase 8 (CDK8) X85753
D4a 1.73196 calmodulin (CALM) J04046
A7a 1.762276 fibroblast growth factor receptor1 precursor (FGFR1) X66945
B4k 1.7795 cot proto-oncogene D14497
![Page 102: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/102.jpg)
Ayesh et al: The role of H19 gene during cancer development
408
C5k 1.864683 putative diacylglycerol kinase eta (DAG kinase eta) D73409
A2m 2.046678 DRAK2 AB011421
B5h 2.072661 ephrin type-A receptor 5 precursor (EHK1) X95425
D3h 2.303345 mitogen-activated protein kinase 9 L31951
A1j 2.307026 vascular endothelial growth factor receptor 3 precursor (VEGFR3); flt-4 X68203
C5i 2.396003 phosphatidylinositol 3 kinase catalytic subunit % isoform X83368
A1m 2.504037 ntak protein (neural and thymus derived activator for erbb kinases) AB005060
D3e 2.706103 CDC28 protein kinase 2 AA010065
B2e 2.782374 cell division control protein 2 homolog (CDC2) X05360
A7d 2.892207 protein kinase C " polypeptide (PKC-") M22199
A1f 2.971199 cyclin-dependent protein kinase 2 (CDK2) M68520
C4i 4.024127 mevalonate kinase M88468
A1d Up serine/threonine-protein kinase (STK2) L20321
A2b Up related to receptor tyrosine kinase (RYK) S59184
A2f Up protein kinase C ' (PKC-') L07032
A2i Up fas-activated serine/threonine kinase (FAST) X86779
A3b Up vascular endothelial growth factor receptor 1 (VEGFR1); Flt-1 X51602
B3d Up cell division protein kinase 4; cyclin-dependent kinase 4 (CDK4) M14505
B5c Up tyrosine-protein kinase itk/tsk D13720
B5l Up cAMP-dependent protein kinase %-catalytic subunit (PKA C-%) M34182
B5m Up serine/threonine-protein kinase NEK2 U11050
B6b Up B-lymphocyte kinase (BLK) Z33998
B7l Up deoxycytidine kinase M60527
B7m Up 58-kDa inhibitor of the RNA-activated protein kinase U28424
C2c Up serine/threonine-protein kinase NEK3 Z29067
C4f Up phosphorylase B kinase % catalytic subunit skeletal muscle isoform X80590
D1h Up c-jun N-terminal kinase 1 (JNK1) L26318
D2e Up hematopoietic progenitor kinase (HPK1) U66464
D2f Up Adenylate kinase isoenzyme 2 U39945
IV. DiscussionH19 was described to have oncofetal properties; it is
expressed abundantly in the human placenta and in several
embryonic tissues (Ariel et al, 1997). We cultured human
amniocytes, which express H19 under normal conditions,
at different stress condition i.e. hypoxia and serum stress
(Figure 1). The increase in H19 expression (about 2 folds)
in both serum deprivation and hypoxia was a strong
indication that H19 is involved in the physiological
response to different stress conditions.
The H19 level was slightly increased in T24p cell
line at hypoxia (100µM CoCl2) as shown in Figure 2.
While no H19 induction was found in TA 11 cell line,
which contains the plasmid that expresses the anti-sense
for H19, was found. It seems very likely that H19 RNA is
involved in the induction of the expression of the kinases
which increased significantly (more than 1.5 fold) or
induced (up) in TA31 cell line compared to TA 11 and
T24p cell lines.
Significant increase in expression and induced (up)
expression of certain genes was observed in TA31 cell line
which is H19+ and after growing these cells with stress
conditions: which are serum deprivation, hypoxia and both
serum deprivation and hypoxia together.
While taking a closer look at all the genes that had an
increase or induced (up) expression in the hypoxia and
serum stress conditions, which may resemble the stress
conditions in cancer, certain important genes may be
playing important roles in cell survival and the mitogenic
activities of the tumor.
A. Serum deprivationElevated expression of active cyclin dependent
kinase 2 (CDK2) is critical for promoting cell cycle
progression and unrestrained proliferation of tumor cells.
CDK2 is retained in the cytoplasm of cells by serum
deprivation (Bresnahan et al, 1997).
Apoptosis of human endothelial cells after growth
factor deprivation and stress accompanied by cancer is
associated with rapid and dramatic induced (up)
expression of CDK2 activity. CDK2 activation, through
caspase-mediated cleavage of cdk inhibitors, may be
instrumental in the execution of apoptosis following
caspase activation (Levkau et al, 1998). One of the stress
kinases which we found to have induced (up) expression
in serum deprivation is fibroblast growth factor receptor 1
precursor (FGFR1). FGFR1 may be a specific target for
MMP2 on the cell surface, yielding a soluble FGF receptor
that may modulate the mitogenic and angiogenic activities
![Page 103: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/103.jpg)
Gene Therapy and Molecular Biology Vol 8, page 409
409
of FGF. MMP2 is a key gene in angiogenesis (Levi et al,
1996).
Binding of interleukin-1 (IL1) to its receptor and by
the association of IRAK (IL1 receptor-associated kinase),
triggers activation of nuclear factor !-B (NF-!B), a family
of related transcription factors that regulates the
expression of genes bearing cognate DNA binding sites
such as PCNA which we also found to have induced (up)
expression in pervious study (Ayesh et al, 2002). Another
gene that had induced (up) expression was JNK1 (c-jun N-
terminal kinase 1) which is involved in the initiation of the
apoptosis process (Ch et al, 1996; Yu et al, 1996). JNK1 is
activated by various stimuli, including UV light, Ha-Ras,
TNF-" (Tumor necrosis factor-"), IL-1 and CD28
costimulation (Derijard et al, 1994; Ch et al 1996). JNK1
phosphorylates Elk-1 on the same major sites recognized
by ERK1/2 (extracellular-regulated kinase), thus
potentiating its transcriptional activity (Cavigelli et al,
1995).
A critical gene involved in the mitogenic and
invasive pathways and up regulated under stress
conditions is uPA (Urokinase plasminogen activator). uPA
is secreted as an enzymatically inactive proenzyme (pro-
uPA). Urokinase plasminogen activator receptor (uPAR)
mediates the binding of the zymogen, pro-uPA, to the
plasma membrane where trace amounts of plasmin will
initiate a series of events referred to as reciprocal zymogen
activation where plasmin converts pro-uPA to the active
enzyme, uPA, which in turn converts plasma membrane-
associated plasminogen to plasmin (Dear et al, 1998,
Plesner et al, 1997). Urokinase-type plasminogen activator
receptor (uPAR) is known to play important roles in tumor
cell migration, invasion, and metastasis (Ayesh et al,
2002). High levels of u-PA, PAI-1 (placental plasminogen
activator inhibitor 2) and u-PAR in many tumor types
predict poor patient prognosis (Fazioli and Blasi, 1994;
Andreasen et al, 1997). PRK2 (lipid-activated protein
kinase 2) is necessary for apoptosis, during FAS-induced
apoptosis (Cryns et al, 1997) which can form a complex
with adaptor proteins made up of src domains (Braverman
and Quilliam, 1999).
B. Hypoxia stressMany key genes in the main pathway of
tumorgenesis were found to have increased or induced
(up) expression. The proliferation of new tumor cells
instead could take place. PKC-# (protein kinase C-#) is
important in NF-!B activation (Folgueira et al, 1996) and
takes a central position in TNF signal pathways acting as a
molecular switch between mitogenic and growth
inhibitory signals of TNF-". (Muller et al, 1995). The role
of TNF-" in angiogenesis is thought to be indirect through
its ability to induce angiogenic factors. TNF-· mediates its
action through NF-!B transcription factor (Ayesh et al,
2002). In serum-free media, NF-!B is activated promoting
survival of cells while inhibiting PKC-# results in cell
death (Wang et al, 1999). PKC-# was implicated in tumor
angiogenesis (Pal et al, 1998). It is highly over expressed
in tumors and is involved in apoptosis, angiogenesis, and
several signal transduction pathways regulating
differentiation, proliferation or apoptosis of mammalian
cells. Sp1 promotes the transcription of vascular
permeability factor/vascular endothelial growth factor
(VPF/VEGF), a potent angiogenic factor, by interacting
directly and specifically with protein kinase C # (PKC #)
isoform in renal cell carcinoma. PKC # binds and
phosphorylates the zinc finger region of Sp1 (Pal et al,
1998).
One of the genes that had increased expression was
cot-proto oncogene (c-cot/TPL-2) which encodes a
MAP3K related serine threonine kinase and plays a critical
role in TNF-" production. An increase in cot kinase
expression promotes TNF-" promoter-driven
transcription. Cot kinase is partially mediated by
MEK/ERK kinase pathway which includes many up
regulated genes in the stress conditions in order to survive.
Cot kinase increases at least the AP-1 and AP-2 response
elements (Ballester et al, 1998). It also plays a role in IL-2
production which is an important angiogenesis-associated
secreted protein (Ballester et al, 1997). TPL-2 is a
component of a signaling pathway that controls proteolysis
of NF-!B1 p105 generating, at the end, active nuclear NF-
!B. Furthermore, kinase-inactive TPL-2 blocks the
degradation of p105 induced by (TNF-") (Belich et al,
1999). Cot assembles physically with NF-!B-inducing
kinase (NIK) and phosphorylate it in vivo (Lin et al,
1999).
Protein kinase C- " is the major protein kinase C
isoenzyme of a signal transduction cascade regulating IL-2
receptor expression and which is over expressed in the
experiment (Szamel et al, 1997). Focal adhesion kinase
(FAK) is centrally implicated in the regulation of cell
motility and adhesion (Zachary, 1997) and is induced by
adhesion of cell surface integrins to extracellular matrix
and other factors (Guan 1997; Zachary 1997). Activated
FAK leads to its binding to a number of intracellular
signaling molecules including SCr, Grb2 and PI 3-kinse.
Integrin signaling through FAK causes increased cell
migration and potentially regulates cell prolifration and
survival (Guan 1997). FAK is involved in the progression
of cancer to invasion and metastasis and overexpression of
FAK in tumor cells leads to a high propensity toward
invasion and metastasis and increased cell survival under
anchorage-independent conditions (Kornberg 1998). Other
genes as MEK2 (MAPK and ERK kinase) contribute to
the activation of the oxidative burst and phagocytosis, and
participate in cytokine regulation of apoptosis in cells
under stress (Downey et al, 1998).
C. Serum deprivation and hypoxia
stressesTie2 had an increased expression in all stresses and is
known to play a role in tumor angiogenesis (Lin et al,
1998). Tie2 and its ligand angiopiotin-1 represent key
signal transduction systems involved in the regulation of
embryonic vascular development. The expression of these
molecules correlates with phases of blood vessel formation
needed in angiogenesis (Breier et al, 1997).
Three distinct groups of MAP kinases have been
identified in mammalian cells (ERK, JNK, and p38).
![Page 104: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/104.jpg)
Ayesh et al: The role of H19 gene during cancer development
410
These MAP kinases are mediators of signal transduction
from the cell surface to the nucleus (Whitmarsh and Davis,
1996). Jun kinase (JNK1 and JNK2) is selectively
mediating signal transduction of the pro-inflammatory
cytokines IL-1 and TNF as well as of cellular stress
(Uciechowski et al, 1996). JNK2 was found to be over
expressed in both serum deprivations and hypoxia. IL-1,
TNF, UV light and osmotic stress, are able to stimulate jun
kinase activity (including JNK2) in humans (Uciechowski
et al, 1996). JNK2 (also called Elk-1 activation domain
kinase) phosphorylates the NH2-terminal activation
domain of the transcription factor c-Jun, and the activity of
JNK2 was approximately 10-fold greater than that of
JNK1 (Sluss et al, 1994). JNK2 phosphorylates Elk-1 in
extracts of UV-irradiated cells on the same major sites
recognized by ERK1/2 that potentiate its transcriptional
activity (Cavigelli et al, 1995).
The mitogen-activated protein (MAP) kinase also
known as (ERK2) is proline-directed serine/threonine
kinases that are activated in response to a variety of
extracellular signals, including growth factors, hormones
and, neurotransmitters. MAPK/ERK is a key molecule in
intracellular signal transducing pathways that transport
extracellular stimuli from cell surface to nuclei.
MAPK/ERK has been revealed to be involved in the
physiological proliferation of mammalian cells and also to
potentiate them to transform and thus increase in amounts
in tumor cells (Davis 1995). ERK2 is activated by many
oncogenes, such as RAS and RAF, and they induce cell
proliferation (Mishima et al, 1998).
Vascular endothelial growth factor receptor 1
(VEGFR1) also called FLT-1 gene encodes a
transmembrane tyrosine kinase that is involved in
angiogenesis and migration which is a high-affinity
receptor for VEGF and placenta growth factor (PIGF). Flt-
1 plays important roles in the angiogenesis required for
embryogenesis and in monocyte/macrophage migration
(Gerber et al, 1997). VEGF/PIGF functions via flt-1 in an
autocrine manner to perform a role in invasion and
differentiation (Shore et al, 1997). The Flt-1 receptor gene
had direct induced (up) expression by hypoxia via
hypoxia-inducible enhancer on the Flt-1 promoter (Gerber
et al, 1997), and has been implicated in the regulation of
blood vessel growth during angiogenesis (Breier et al,
1997; Cheung 1997). The VEGF signal transduction
system has been implicated in the regulation of
pathological blood vessel growth during certain
angiogenesis-dependent diseases that are often associated
with tissue ischemia, such as tumorgenesis (Shibuya et al,
1994; Breier 1997).
ReferencesAndreasen PA, Kjoller L, Christensen L, Duffy MJ (1997) The
urokinase-type plasminogen activator system in cancer
metastasis, a review. Int J Cancer 72, 1-22
Ariel I, Ayesh S, Perlman EJ et al (1997) The product of the
imprinted H19 gene is an oncofetal RNA. Mol Pathol 50,
34-44.
Ariel I, Sughayer M, Fellig Y, et al (2000) The imprinted H19
gene is a marker of early recurrence in human bladder
carcinoma. Mol Pathol 53, 320-323.
Ayesh S, Matouk I, Schneider T et al (2002) A. Possible
physiological role of H19 RNA. Mol Carcinog 35, 63-74.
Ballester A, Tobena R, Lisbona C, Calvo V, Alemany S (1997)
Cot kinase regulation of IL-2 production in Jurkat T cells. J
Immunol 159, 1613-8.
Ballester A, Velasco A, Tobena R, Alemany S (1998) Cot kinase
activates tumor necrosis factor-" gene expression in a
cyclosporin A-resistant manner. J Biol Chem 273, 14099-
106.
Belich MP, Salmeron A, Johnston LH, Ley SC (1999) TPL-2
kinase regulates the proteolysis of the NF-!B-inhibitory
protein NF-!B1 p105. Nature 397, 363-8.
Braverman LE, Quilliam LA (1999) Identification of Grb4/Nck&,
a src homology 2 and 3 domain-containing adapter protein
having similar binding and biological properties to Nck. J
Biol Chem 274, 5542-9.
Breier G, Damert A, Plate KH, Risau W (1997) Angiogenesis in
embryos and ischemic diseases. Thromb Haemost 78, 678-
83.
Bresnahan WA, Thompson EA, Albrecht T (1997) Human
cytomegalovirus infection results in altered Cdk2 subcellular
localization. J Gen Virol 78, 8.
Cavigelli M, Dolfi F, Claret FX, Karin M (1995) Induction of c-
fos expression through JNK-mediated TCF/Elk-1
phosphorylation. EMBO J 14, 5957-64.
Chen YR, Meyer CF, Tan TH (1996) Persistent activation of c-
Jun N-terminal kinase 1 (JNK1) in % radiation-induced
apoptosis. J Biol Chem 271, 631-4.
Cheung CY (1997) Vascular endothelial growth factor, possible
role in fetal development and placental function. J Soc
Gynecol Investig 4, 169-77
Cryns VL, Byun Y, Rana A et al (1997) Specific proteolysis of
the kinase protein kinase C-related kinase 2 by caspase-3
during apoptosis. Identification by a novel, small pool
expression cloning strategy. J Biol Chem 272, 29449-53.
Davis RJ (1995) Transcriptional regulation by MAP kinases.
Mol Reprod Dev 42, 459-67
Dear AE, Medcalf RL (1998) The urokinase-type-plasminogen-
activator receptor (CD87) is a pleiotropic molecule. Eur J
Biochem 252, 185-93.
Derijard B, Hibi M, Wu IH et al (1994) a protein kinase
stimulated by UV light and Ha-Ras that binds and
phosphorylates the c-Jun activation domain. Cell 76, 1025-
37.
Downey GP, Butler JR, Tapper H, Fialkow L, Saltiel AR, Rubin
BB, Grinstein S (1998) Importance of MEK in neutrophil
microbicidal responsiveness. J Immunol 160, 434-43.
Fazioli F, Blasi F (1994) Urokinase-type plasminogen activator
and its receptor, new, targets for anti-metastatic therapy.
Trends Pharmacol Sci 15, 25-9.
Folgueira L, McElhinny JA, Bren GD et al (1996) Protein kinase
C-# mediates NF-!B activation in human immunodeficiency
virus-infected monocytes. J Virol 70, 223-31.
Folkman J, Kalluri R (2004) Cancer without disease. Nature
427, 787
Futscher BW, Blake LL, Gerlach JH, Grogan TM, Dalton WS
(1993) Quantitative polymerase chain reaction analysis of
mdr1 mRNA in multiple myeloma cell lines and clinical
specimens. Anal Biochem 213, 414-421.
Gerber HP, Condorelli F, Park J, Ferrara N (1997) Differential
transcriptional regulation of the two vascular endothelial
growth factor receptor genes. Flt-1, but not Flk-1/KDR, is
up-regulated by hypoxia. J Biol Chem 272, 23659-67.
Guan JL (1997) Focal adhesion kinase in integrin signaling.
Matrix Biol 16, 195- 200.
Hurst LD, Smith NG (1999) Molecular evolutionary evidence
that H19 RNA is functional. Trends Genet 15, 134-135.
![Page 105: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/105.jpg)
Gene Therapy and Molecular Biology Vol 8, page 411
411
Kopf E, Bibi O, Ayesh S et al (1998) The effect of retinoic acid
on the activation of the human H19 promoter by a 3’
downstream region. FEBS Lett 432, 123-127. Kornberg LJ
(1998) Focal adhesion kinase and its potential involvement in
tumor invasion and metastasis. Head Neck 20, 745-52.
Levi E, Fridman R, Miao HQ et al (1996) Matrix
metalloproteinase 2 releases active soluble ectodomain of
fibroblast growth factor receptor 1. Proc Natl Acad Sci 93,
7069-74.
Levkau B, Koyama H, Raines EW et al (1998) Cleavage of
p21Cip1/Waf1 and p27Kip1 mediates apoptosis in
endothelial cells through activation of Cdk2, role of a
caspase cascade. Mol Cell 1, 553-63.
Lin P, Buxton JA, Acheson A et al (1998) Antiangiogenic gene
therapy targeting the endothelium-specific receptor tyrosine
kinase Tie2. Proc Natl Acad Sci 95, 8829-34.
Lin X, Cunningham ET Jr, Mu Y, Geleziunas R, Greene WC
(1999) The proto-oncogene Cot kinase participates in
CD3/CD28 induction of NF-!B acting through the NF-!B-
inducing kinase and I!B kinases. Immunity 10, 271-80.
Looijenga LH, Verkerk AJ, de-Groot N, Hochberg A, Oosterhuis
JW (1997) H19 in normal development and neoplasia. Mol
Reprod Dev 46, 419-439.
Lottin S, Adriaenssens E, Dupressoir T, Berteaux N, Montpellier
C, Coll J, Dugimont T, Curgy JJ (2002) Overexpression of
an ectopic H19 gene enhances the tumorigenic properties of
breast cancer cells. Carcinogenesis 23, 1885-95.
Mishima K, Yamada E, Masui K et al. Shimokawara T,
Takayama K, Sugimura M, Ichijima K (1998)
Overexpression of the ERK/MAP kinases in oral squamous
cell carcinoma. Mod Pathol 11, 886-91.
Muller G, Ayoub M, Storz P, Rennecke J, Fabbro D, Pfizenmaier
K (1995) PKC-# is a molecular switch in signal transduction
of TNF-", bifunctionally regulated by ceramide and
arachidonic acid. EMBO J 14, 1961-9.
Pal S, Claffey KP, Cohen HT, Mukhopadhyay D (1998)
Activation of Sp1-mediatedvascular permeability
factor/vascular endothelial growth factor transcription
requires specific interaction with protein kinase C-#. J Biol
Chem 273, 26277-80.
Plesner T, Behrendt N, Ploug M (1998) Structure, function and
expression on blood and bone marrow cells of the urokinase-
type plasminogen activator receptor, uPAR. Stem Cells 15(6,
398-408.
Shibuya M, Seetharam L, Ishii Y et al (1994) Possible
involvement of VEGF- FLT tyrosine kinase receptor system
in normal and tumor angiogenesis. Princess Takamatsu
Symp. 24, 162-70.
Shore VH, Wang TH, Wang CL, Torry RJ, Caudle MR, Torry
DS (1997) Vascular endothelial growth factor, placenta
growth factor and their receptors in isolated human
trophoblast. Placenta 18, 657-65.
Sluss HK, Barrett T, Derijard B, Davis RJ (1994) Signal
transduction by tumor necrosis factor mediated by JNK
protein kinases. Mol Cell Biol 14, 8376-84.
Szamel M, Ebel U, Uciechowski P, Kaever V, Resch K (1997) T
cell antigen receptor dependent signalling in human
lymphocytes, cholera toxin inhibits interleukin-2 receptor
expression but not interleukin-2 synthesis by preventing
activation of a protein kinase C isotype, PKC-". Biochim
Biophys Acta 1356, 237-48.
Tycko B, Morison IM (2002) Physiological functions of
imprinted genes. J Cell Physiol 192, 245-258.
Uciechowski P, Saklatvala J, von der Ohe J, Resch K, Szamel M,
Kracht M (1996) Interleukin 1 activates jun N-terminal
kinases JNK1 and JNK2 but not extracellular regulated MAP
kinase (ERK) in human glomerular mesangial cells. FEBS
Lett 394, 273-8.
Wang G, Hazra TK, Mitra S, Lee HM, Englander EW (2000)
Mitochondrial DNA damage and a hypoxic response are
induced by CoCl2 in rat neuronal PC12 cells. Nucleic Acids
Res 28, 2135-40.
Wang YM, Seibenhener ML, Vandenplas ML, Wooten MW
(1999) Atypical PKC-# is activated by ceramide, resulting in
coactivation of NF-!B/JNK kinase and cell survival. J
Neurosci Res 55, 293-302.
Whitmarsh AJ, Davis RJ (1996) Transcription factor AP-1
regulation by mitogen-activated protein kinase signal
transduction pathways. J Mol Med 74, 589-607.
Yu R, Shtil AA, Tan TH, Roninson IB, Kong AN (1996)
Adriamycin activates c-jun N-terminal kinase in human
leukemia cells, a relevance to apoptosis. Cancer Lett 107,
73-81
Zachary I (1997) Focal adhesion kinase. Int J Biochem Cell
Biol 29, 929-34.
Suhail Ayesh, Iba Farrah, Tamar Schneider, Nathan de-Groot Abraham Hochberg
![Page 106: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/106.jpg)
Ayesh et al: The role of H19 gene during cancer development
412
![Page 107: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/107.jpg)
Gene Therapy and Molecular Biology Vol 8, page 413
413
Gene Ther Mol Biol Vol 8, 413-422, 2004
PSA promoter-driven conditional replication-
competent adenovirus for prostate cancer gene
therapyResearch Article
Guimin Chang2 and Yi Lu1,2*Department of 1Medicine and 2Urology, University of Tennessee Health Science Center, Memphis, Tennessee, USA
__________________________________________________________________________________
*Correspondence: Yi Lu, Ph.D., Department of Medicine, University of Tennessee Health Science Center, 956 Court Avenue, H300,
Memphis, TN 38163, USA; Tel: (901) 448-5436; Fax: (901) 448-5496; E-mail: [email protected]
Key words: adenovirus, PSA, E1, replication-competent, prostate cancer
Abbreviations: !-galactosidase, (lacZ); adenovirus type 5, (Ad5); Dulbecco’s modified Eagle medium, (D-MEM); early region 1, (E1);
Fetal bovine serum, (FBS); prostate specific antigen, (PSA); Rous sarcoma virus, (RSV)
Received: 24 August 2004; revised: 22 September 2004
Accepted: 6 October 2004; electronically published: October 2004
Summary
A conditional, replication-competent adenovirus (AdPSAE1) carrying the adenoviral E1 region under the control of
a prostate specific antigen (PSA) promoter was generated in an effect to target the prostate for cancer gene therapy.
The anti-prostate tumor efficacy and specificity of AdPSAE1 were examined in vitro and in vivo in prostate and
nonprostate cancer models. In vitro at multiplicity of infection (moi) of 1, AdPSAE1 effectively killed the human
prostate cancer cell lines PPC-1 and LNCaP, but had no effect on nonprostate cancer cells including the human
bladder cancer cell line RT4, human breast cancer cell line MCF-7, and rat gliosarcoma cell line 9L. As a control,
an adenovirus expressing the ß-galactosidase transgene under the control of the same PSA promoter (AdPSAlacZ)
was used in parallel in all experiments. The in vivo tissue-specific expression driven by this PSA promoter was
examined in a xenograft tumor model. Intratumoral injection of AdPSAlacZ resulted in PSA promoter-driven
expression of lacZ in xenograft tumors in nude mice derived from human prostate cancer PPC-1 cells, but not in
tumors derived from human bladder cancer RT4 cells. Intratumoral injection of AdPSAE1 effectively inhibited in
vivo growth (61.8% reduction in tumor size) of xenograft PPC-1 prostate tumors compared to untreated or
AdPSAlacZ treated tumors. Conversely, intratumoral injection of AdPSAE1 had no effect on the growth of
xenograft RT4 bladder tumors when compared to untreated control group. These results indicate that prostate-
targeted conditional replication-competent adenoviruses may be useful in gene therapy of prostate cancer.
I. IntroductionProstate cancer is the most frequently diagnosed
cancer and the second leading cause of cancer deaths in
men today. It is estimated that there will be approximately
230,110 new cases and 29,900 deaths of prostate cancer in
American men in 2004 (Jemal et al, 2004). Unfortunately
for those patients diagnosed with advanced prostate
cancer, there is no effective current treatment modality and
their prognosis is poor. Although viral based gene therapy
is a promising new strategy to combat advanced prostate
cancer, its current effectiveness is limited by inefficient
cellular transduction in vivo.
The adenovirus early region 1 (E1) gene, which
comprises E1a and E1b, encodes the viral early proteins
that are necessary for adenoviral replication and the
consequent oncolysis of permissive host cells. E1-deleted
(including E1a-deleted) adenoviruses are replication-
defective and are commonly used as viral vectors to carry
therapeutic genes for gene therapy. The conventional way
of producing an E1-deleted adenovirus is to use cells that
are able to supply replication-enabling proteins. One such
example is HEK 293 cells which were transformed by
human adenovirus type 5 (Ad5) and express E1 protein
(Graham et al, 1977). E1-deleted viruses infect host cells
and express the transgene but they cannot replicate and
undergo lysis due to the lack of the E1 protein. Thus, E1-
deleted recombinant adenoviruses are a safe viral vehicle
for gene transfer. However, E1-deleted, replication-
defective adenoviruses have several common problems
with respect to in vivo transduction: a low transduction
rate, time-limited expression of the transgene, and host
immune responses to repeated viral administration.
![Page 108: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/108.jpg)
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
414
An alternative means of producing E1-deleted
adenoviruses is to provide the E1 protein in the targeted
cells. Codelivery of an E1-deleted adenovirus along with
an E1-expressing plasmid allows one round of viral
replication. This limited replication significantly increases
in vivo delivery efficiency of adenovirus to cancer cells
(Goldsmith et al, 1994; Han et al, 1998). This trans
complementation of a replication-defective adenovirus
with E1 protein in targeted cells may provide a means of
amplifying gene transduction in vivo. However, the
resultant adenovirus itself is not replication-competent and
only one round of viral replication is possible. Therefore,
transduction of tumor cells by this approach is still limited.
Replication-competent viruses, also known as
oncolytic viruses, replicate within transduced cells and
force these cells into a lytic cycle. Released virus is then
able to infect neighboring cells until all susceptible cells
are eliminated. Theoretically a large tumor burden could
be effectively eradicated using a small dose of an
oncolytic virus. Therefore, strategies to use conditional
oncolytic virus, or so-called attenuated replication-
competent viruses, to specifically target prostate tissue
have been developed (Rodriguez et al, 1997; Yu et al,
1999a, 1999b).
The idea behind this study is to place the Ad5 E1
region in cis complementation (i.e., use E1 as a transgene)
back into an E1-deleted, replication-defective adenovirus
under the control of a prostate-specific promoter. Thus, E1
protein expression will be confined strictly to prostate
tissues and render this a conditional oncolytic virus within
the prostate. Our previous study showed that a prostate-
specific adenovirus, AdPSAlacZ, which contains a ß-
galactosidase (lacZ) reporter gene under the control of the
PSA promoter, transduced a high level of lacZ transgene
expression in the prostate after intraprostatic injection in
an animal model. The virus did disseminate to tissues
beyond the prostate after injection, however, AdPSAlacZ
did not express the transgene in these nonprostate tissues
(Steiner et al, 1999). This result suggests that the PSA
promoter effectively and specifically drives lacZ transgene
expression in prostate cells transduced by AdPSAlacZ. In
this study we replaced the lacZ transgene in AdPSAlacZ
with the Ad5 E1 region to generate a prostate-specific
replication-competent adenovirus AdPSAE1, in which E1
expression is under the control of the PSA promoter. The
efficacy and specificity of AdPSAE1 as a potential
therapeutic vector for prostate cancer gene therapy were
analyzed.
II. Materials and methodsA. Cell culture and mediumDulbecco’s modified Eagle medium (D-MEM) was
purchased from Gibco BRL (Gaithersburg, MD). RPMI 1640
medium and McCoy’s 5" medium were purchased from Cellgro
(Herndon, VA). Fetal bovine serum (FBS) was from Hyclone
Laboratories (Logan, UT). All cell lines were purchased from
ATCC (Rockville, MD) and were grown in D-MEM with 10%
heat inactivated FBS. The human prostate cancer cell lines PPC-
1 and LNCaP, both secret PSA (Dr. J. Norris of MUSC, personal
communication), were grown in RPMI 1640 medium with 10%
FBS. The human breast carcinoma MCF-7 cells and human
bladder cancer RT4 cells were grown in McCoy’s 5" medium
with 10% FBS. Rat gliosarcoma 9L cells were grown in D-MEM
medium with 10% FBS. All cells were grown in medium
containing 100 units/ml penicillin, 100 µg/ml streptomycin at
37°C in a 5% CO2 atmosphere.
B. Construction of adenoviral vector
AdPSAlacZ and AdPSAE1The generation of AdPSAlacZ, an E1-deleted recombinant
adenovirus expressing the lacZ reporter gene under the control of
a 680-bp PSA promoter, has been described previously (Steiner
et al, 1999). AdPSAE1 was generated by replacing the lacZ
transgene in AdPSAlacZ with the wild-type Ad5 E1 gene.
Briefly, an approximately 3-kb E1 fragment was generated by
PCR using DNA extracted from the E1-containing adenovirus
Ad-dl327 (Genetic Therapy Inc., Gaithersburg, MD) as a
template, and primers specific to both the 5’ and 3’ region of the
Ad5 E1 gene. In addition, a restriction site was introduced in
each of the 5’ and 3’ primers to facilitate subsequent subcloning.
The resultant PCR product included 4 bp upstream of the E1a
gene start codon, the entire E1a and E1b regions, and 7 bp
downstream of E1b stop codon, as well as the introduced BamH I
and EcoR I site at 5’- and 3’- end, respectively. This PCR
product was digested with BamH I and EcoR I, and subcloned
into the corresponding sites in pBluescript (Stratagene, La Jolla,
CA) and the E1 fragment was re-released with Spe I and EcoR V
digestions. The prostate-specific adenoviral shuttle vector
pPSAlacZ (used to generate AdPSAlacZ, Steiner et al, 1999) was
digested with Xba I and Cel II to remove the lacZ gene, and was
then ligated with the above-mentioned modified E1 fragment to
generate the shuttle vector pPSAE1. This pPSAE1 shuttle vector
was cotransfected with pJM17, an adenoviral genome plasmid, in
293 cells as described previously (Steiner et al, 2000a) to
generate AdPSAE1. The resultant AdPSAE1 was genomically
similar to Ad-dl327 except that the E1 gene in AdPSAE1 is
under the control of a 680-bp PSA promoter rather the
endogenous E1 promoter in Ad-dl327. Positive recombinant
plaques were isolated by a direct plaque-screening PCR method
(Lu et al, 1998) using primers specific to the recombinant
construct, i.e., using one primer specific for the PSA promoter
and the other primer specific for the E1 gene. Amplification and
titration of adenoviruses were performed as described previously
(Graham and Prevec, 1991).
C. Analysis of potential oncolytic effects of
AdPSAE1 on various cell lines by crystal violet
stainingCells (5#104 per well) were plated in six-well plates, the
next day the cells were either untreated or transduced with
AdPSAlacZ or AdPSAE1 at moi of 1. After 6 days of
transduction, the media was removed and the plates were washed
twice with PBS. The wells were then completely covered with 2
ml of 1% crystal violet (Sigma, St. Louis, MO) and the plate was
allowed to sit 5 min with gentle rocking. After washing with
water, the plate was allowed to dry at room temperature
overnight before they were photographed.
D. In vitro growth inhibition assay by
AdPSAE1Cells (5#104 per well) were plated in six-well plates, the
next day the cells were divided into three groups: (a) control
uninfected, (b) control virus AdPSAlacZ infected, and (c)
AdPSAE1 infected. After viral infection at moi of 1, cell
numbers were counted daily through day 6 post viral infection.
![Page 109: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/109.jpg)
Gene Therapy and Molecular Biology Vol 8, page 415
415
E. X-gal staining of AdPSAlacZ transduced
xenograft tumorsThe recombinant adenovirus, AdRSVlacZ, which contains
a !-galactosidase reporter gene under the control of a Rous
sarcoma virus (RSV) promoter, was used as a positive control to
demonstrate in vivo transduction efficiency within tumors.
Xenograft tumors were established by injecting 5 x 106 various
cancer cells subcutaneously into the flank of male Balb/c nu/nu
athymic nude mice (Harlan Sprague Dawley, Inc., Indianapolis,
IN). When tumors reached about 50 mm3 volume, 5 x 109 pfu
AdRSVlacZ, or 1x1010 pfu AdPSAlacZ were injected directly
into the tumor site. The mice were sacrificed 3 days post
injection and the tumors were harvested and processed to
cryosections as described previously (Lu et al, 1999). For tumor
section staining, samples were fixed in 4% paraformaldehyde for
30 min, then in 30% sucrose in PBS at 4°C until the samples
sank to the bottom of the vial. The samples were then snap-
frozen in liquid nitrogen in O.C.T. medium (Tissue-Tek/Sakura,
Torrance, CA) and processed to cryosections using a Cryostat.
The cryosections were fixed in formalin for 30 sec then
processed for X-gal staining as a measure of lacZ expression as
described (Eastham et al, 1996).
F. In vivo tumor growth inhibition by
AdPSAE1PPC-1 cells (1#107 cells in 0.2 ml of PBS) or RT4 cells
(5.7#106 cells in 0.2 ml of PBS) were injected subcutaneously
into the flank of male Balb/c nu/nu athymic nude mice (Harlan
Sprague Dawley, Indianapolis, IN). For each tumor cell model,
three groups of mice were formed with 8 mice in each group.
Group I was used as an untreated control. Group II and group III
were for intratumoral viral injection of AdPSAE1 and control
virus AdPSAlacZ, respectively. When tumors reached about 200
mm3 volume, a single dose of 5#106 pfu AdPSAE1 or
AdPSAlacZ were injected directly into each tumor mass. Tumor
volume was measured every 3 days until the animals were
sacrificed. All of the animals were sacrificed at day 35 after viral
injection, when several mice of group III showed distress or had
tumor burdens > 15% of their total body weight.
III. ResultsA prostate-specific, conditional oncolytic adenovirus,
AdPSAE1, was generated by replacing the lacZ transgene
of AdPSAlacZ (Steiner et al, 1999) with the wild-type
Ad5 E1 region (Figure 1). This strategy allows the
expression of E1 protein under the control of a prostate
specific promoter (PSA), enabling the adenovirus to
replicate and enter the oncolytic cycle only in prostate
cells. To analyze the oncolytic cell-killing effects and
tissue specificity of AdPSAE1, various cancer cell lines
including prostate and nonprostate cells were used in both
in vitro and in vivo models.
A. AdPSAE1 effectively and specifically
inhibited prostate cancer cell growth in vitro
The potential oncolytic cell-killing effects of
AdPSAE1 were analyzed in various cancer cells. The
human prostate cancer lines PPC-1 and LNCaP and
nonprostate cancer cell lines RT4 (human bladder cancer),
MCF-7 (human breast cancer), and 9L (human glioma)
were infected with AdPSAE1 or control virus AdPSAlacZ
at moi of 1. Viable cells were stained with crystal violet 6
days after infection and were compared to untreated
control cells (Figure 2). As dead cells typically detach,
crystal violet stains only those viable cells that remain
attached to the culture dish. As shown in Figure 2A and
2B, AdPSAE1 (right well) almost completely wiped out
all PPC-1 and LNCaP cells, whereas AdPSAlacZ (middle
well) had no cell-killing effects as compared to the
untreated control (left well), respectively. On the other
hand, AdPSAE1 had no cell-killing effects on RT4
(Figure 2C), MCF-7 (Figure 2D) and 9 L (Figure 2E)
cells. These results clearly demonstrate that AdPSAE1
selectively replicates (thus goes through the oncolytic
cycle and kills the host cells) in cancer cells derived from
the prostate (PPC-1 and LNCaP), but not in nonprostate
cancer cells (RT4, MCF-7 and 9L).
To analyze the time-course of the growth inhibition
effects of AdPSAE1 on prostate cancer cells, PPC-1 and
LNCaP cells were either untreated or transduced with
AdPSAE1 or control virus AdPSAlacZ at moi of 1 in
vitro, and the cell numbers were monitored. As shown in
Figure 3, significant growth inhibition was observed
starting at day 4 post AdPSAE1 infection, with complete
growth inhibition at day 6 for both prostate cancer cell
Figure 1. Design of a prostate-specific conditional replication-competent adenovirus. The native Ad5 early region 1 (E1) gene that
is required for adenoviral replication, is replaced by an expression cassette which contains an Ad5 E1 gene under the control of a 860-bp
PSA promoter.
![Page 110: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/110.jpg)
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
416
Figure 2. Conditional oncolytic effects of AdPSAE1 in prostate cancer cells. The human prostate cancer cell lines PPC-1 (A) and
LNCaP (B), human bladder cancer cell line RT4 (C), human breast cancer cell line MCF-7 (D), and human glioma cell line 9L (E) were
transduced with AdPSAE1 or AdPSAlacZ at moi of 1. Attached viable cells were stained with crystal violet 6 days after viral infection
and were compared to the untreated controls.
![Page 111: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/111.jpg)
Gene Therapy and Molecular Biology Vol 8, page 417
417
Figure 3. Time-course of the growth inhibition effects of AdPSAE1 on prostate cancer cells. Prostate cancer cells PPC-1 (A) and
LNCaP (B) were transduced with AdPSAE1 at moi of 1. Cell numbers were determined daily from day 1 to 6 after viral transduction.
Untreated and AdPSAlacZ transduced cells were used as controls. The data represent the results from two independent experiments each
performed in duplicate. Some error bars are too small to show.
lines PPC-1 and LNCaP. AdPSAlacZ transduction did not
cause significant growth inhibition in either of these cell
lines (Figure 3A and 3B).
The differential sensitivity of various cancer cells to
AdPSAE1-mediated oncolytic killing and growth
inhibition is presented in Figure 4. On day 6 after in vitro
viral transduction at moi of 1, AdPSAE1 transduction
significantly reduced numbers of PPC-1 and LNCaP cells
to 81.6% and 96.9% of untreated control values, whereas
the control virus AdPSAlacZ transduction resulted in
minor and insignificant growth inhibition (Figure 4). In
contrast, AdPSAE1 had no significant cell-killing or
growth inhibition effects towards the nonprostate cancer
cells RT4, MCF-7 and 9L when compared to the untreated
control and control virus AdPSAlacZ transduced groups
(Figure 4). These results suggest that, in vitro , AdPSAE1
effectively leads to prostate-specific oncolytic killing.
To ensure that selective viral replication accounted
for the cell-killing in AdPSAE1 transduced cells, RT-PCR
was performed using primers specific to Ad5 E1a gene
and followed by Southern blot hybridization (Steiner et al,
1999) to examine the E1a mRNA expression in
AdPSAE1-transduced cells. We found that only LNCaP
and PPC-1 cells had positive E1a RT-PCR product
whereas RT4, MCF-7 and 9L cells did not (not shown),
indicating that E1a was selectively expressed in prostate
cancer cells. We also performed RCA (replication
complement adenovirus) assay by sequential infection of
target cells (prostate and nonprostate cells) with AdPSAE1
and consequently collected supernatant of target cells to
infect 293 cells. We only found plaques in 293 cells
infected by supernatant from LNCaP and DU145 cells that
Figure 4. Differential growth inhibition of AdPSAE1 with
respect to prostate and nonprostate cancer cells. Prostate
cancer cells (PPC-1 and LNCaP) and nonprostate cancer cells
(RT4, MCF-7 and 9L) were transduced with AdPSAE1 or
AdPSAlacZ at moi of 1. Cell numbers were determined six days
later and compared to that of untreated control. The data
represent the results from two independent experiments each
performed in duplicate. Some error bars are too small to show.
![Page 112: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/112.jpg)
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
418
had been initially infected by AdPSAE1, not by
supernatant from nonprostate cancer cells infected by
AdPSAE1 (not shown). These results indicate that only
AdPSAE1-transduced prostate cancer cells generate
progeny viruses.
Figure 5. Specific transgene expression driven by a PSA promoter in prostate cancer cells. Xenograft tumors were established by
subcutaneous injection of cancer cells into the flank of nude mice. When tumors reached about 50 mm3, each of the adenoviral
constructs (1x1010 pfu AdPSAlacZ or 5x109 pfu AdRSVlacZ) was injected directly into the tumor. The tumors were harvested 72 hr later
and processed to cryosections. Shown are X-gal staining of tumor sections derived from prostate cancer PPC-1 cells (A, C, E) and
bladder cancer RT4 cells (B, D, F). A and B are tumors transduced by AdPSAlacZ (1x1010 pfu). C and D are untreated control tumors to
serve as negative controls. E and F are tumors transduced by AdRSVlacZ (5x109 pfu) to serve as positive controls.
![Page 113: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/113.jpg)
Gene Therapy and Molecular Biology Vol 8, page 419
419
B. Specific expression of transgene driven
by the PSA promoter in the xenograft
prostate tumors in animal modelTo determine the in vivo specificity of a 680-bp PSA
promoter that was used tin the AdPSAE1 construct, a
parallel adenovirus, AdPSAlacZ, containing a lacZ
reporter gene under the control of the same 680-bp PSA
promoter was used to analyze specificity in xenograft
tumors grown in nude mice. A dose of 1x1010 pfu
AdPSAlacZ was injected into subcutaneous xenograft
tumors derived from human prostate cancer PPC-1 cells or
human bladder cancer RT4 cells. As a positive control,
AdRSVlacZ (Lu et al, 1999), an adenovirus containing the
lacZ gene under the control of a constitutively active RSV
promoter, was injected into xenograft tumors at a dose of
5x109 pfu. LacZ expression was determined through X-gal
staining of cryosections of the tumors 72 h following viral
injection. Untransduced control PPC-1 (Figure 5C) and
RT4 (Figure 5D) tumors did not express detectable
endogenous lacZ. AdPSAlacZ transduced PPC-1 tumors
contained X-gal positive (blue stained) cells (Figure 5A),
whereas AdPSAlacZ transduced RT4 tumors did not
(Figure 5B). In contrast, both PPC-1 (Figure 5E) and
RT4 (Figure 5F) tumors transduced by AdRSVlacZ
showed X-gal positive cells. These results demonstrate
that expression of the lacZ transgene driven by this PSA
promoter occurred only in xenograft prostate tumors, but
not in xenograft bladder tumors. However, the activity of
the PSA promoter is much lower than that of the
constitutively active RSV promoter (Compare Figure 5A
and 5E with the blue stained cells and the viral dose
injected, respectively).
C. dPSAE1 specifically inhibited prostate
tumor growth in vivo
To determine whether AdPSAE1 causes similar
tumor growth inhibition in vivo as was shown in vitro
(Figure 2, 3 and 4), human prostate cancer PPC-1 cells
and human bladder cancer RT4 cells were injected
subcutaneously into the flank of nude mice to establish the
xenograft tumors. When tumors developed to about 200
mm3, a single dose of AdPSAE1 was injected directly into
the tumor in both cancer cell models. As shown in Figure
6A for the PPC-1 tumor model, both untreated tumors and
tumors treated with control virus AdPSAlacZ grew rapidly
and at a similar rate. In contrast, the AdPSAE1-treated
group showed an effective suppression of this rapid
growth. By day 35 post viral injection, the group treated
with AdPSAE1 had a remarkable 61.8% reduction of
tumor size as compared to the untreated group (Figure
6A). On the other hand, the same single dose of AdPSAE1
injected into the RT4 xenograft tumors failed to result in
significant growth inhibition, as compared to the untreated
RT4 tumor group (Figure 6B). These results suggest that
AdPSAE1 is able to specifically inhibit prostate tumor
growth in vivo.
IV. DiscussionMost currently used gene therapy vectors are
engineered to prevent viral self-replication. These
replication deficient viruses represent a safer gene transfer
vehicle. They deliver therapeutic transgenes without
exposing host cells to the viral lytic cycle. The
transduction of replication-defective viral vectors in vivo
confines transgene expression to those cells along the
Figure 6. AdPSAE1 specifically inhibits prostate tumor growth in vivo. (A) The human prostate cancer line PPC-1 and (B) human
bladder cancer line RT4 were injected subcutaneously into the flank of nude mice. When tumors reached an average volume of 200
mm3, tumors were either untreated (control) or treated with intratumoral injection (day 0) with 5x106 pfu of AdPSAlacZ (control virus)
or 5x106 pfu AdPSAE1. The tumor sizes were periodically measured after viral injection. Each point represents the average tumor
volume from 8 mice. Some error bars are too small to show.
![Page 114: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/114.jpg)
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
420
injection track due an inability to pass the transgene
to neighboring cells. Consequently, the effectiveness of a
viral vector is directly correlated to its transduction
efficiency. Although bystander effect of certain
therapeutic transgenes in the suicide gene therapy strategy
helps to increase some therapeutic index, its effect is
limited. Tumor cells cannot be 100% transduced with a
single treatment. Untransduced tumor cells survive, divide
and eventually offset the therapeutic effects posed by the
initial viral transduction. Therefore, repeated viral
injections aimed at infecting those tumor cells not infected
in the first round of viral transduction is required to
maximize the therapeutic effect in vivo. However,
adenoviral vectors cause strong immunogenic responses.
Consequently, second and subsequent rounds of
adenoviral administration possess significantly reduced
therapeutic effects in vivo (Berkner, 1988; Russell, 2000).
To overcome this obstacle, an alternative approach is
to employ conditional oncolytic viruses, also called
attenuated replication-competent viruses, for cancer gene
therapy. Conditional oncolytic viruses are altered such that
they specifically target a desired cell type or modified such
that the desired target cells are several orders of magnitude
more sensitive to oncolytic cell lysis than are nontargeted
cells. By taking advantage of prostate-specific promoter,
an Ad5 E1a gene, was reintroduced to E1a/E3-deleted
adenovirus under the control of PSA enhancer/promoter (-
5322 to –3729/-580 to +12) (PSE). The resultant
adenovirus, CN706, specifically replicates in, and thus
kills, PSA-producing cells such as LNCaP but not in non-
PSA-producing cells such as DU145 (Rodriguez et al,
1997). Likewise, CN764, an adenoviral vector containing
the Ad5 E1a gene driven by PSE and the Ad5 E1b gene
driven by a hK2 enhancer/promoter (-5155 to –3387/-324
to +33), has a high therapeutic index with a cell specificity
of 10,000:1 for prostate cancer LNCaP cells, compared to
ovarian cancer OVCAR-3, SK-OV-3 and PA-1 cells (Yu
et al, 1999a). A similar approach was used to generate
another prostate-specific replication-competent
adenovirus, CV787. CV787 contains the E1a transgene
driven by a prostate-specific probasin promoter, an E1b
gene driven by the PSE promoter and a wild-type E3
region that suppresses the host immune system. CV787
destroys PSA-producing cells 10,000 times more
efficiently than non-PSA-producing cells. A single tail
vein injection of CV787 has been shown to eliminate
distant LNCaP xenograft tumors (Yu et al, 1999b). This
indicates that CV787 could be a powerful therapeutic
vector to treat metastatic prostate cancer.
Unlike other groups as mentioned above in which
they used much longer PSA promoter region (above 1.6
kb), our current study shows that a 680-bp PSA promoter
is sufficient enough to drive a prostate-specific transgene
expression. This 680-bp PSA promoter drives expression
of the lacZ transgene specifically in xenograft tumors
derived from prostate but not in those derived from
nonprostate cancer cells (Figure 5A and 5B). This
demonstrates specific expression of transgene by the PSA
promoter only in prostate derived cells. Our previous
publication demonstrated that the same PSA promoter
drives expression of the reporter transgene in a prostate-
specific manner when AdPSAlacZ was directly injected
into the prostate (Steiner et al, 1999). The majority of
injected virus was retained within the prostate gland,
whereas a minor portion spread to distant tissues. Despite
nonprostate infection by the adenovirus as detected by
Southern blot of PCR using primers specific to the Ad5
adenovirus, the lacZ transgene was not expressed as
detected by Southern blot of RT-PCR using primers
specific to bacterial lacZ gene. Together, these data
strongly demonstrate that the 680-bp PSA promoter drives
transgene expression exclusively in the prostate in vivo.
In this study we used xenograft prostate tumors
derived from a primary prostate cancer cell line PPC-1
(Brothman et al, 1989), rather from a metastatic prostate
cancer line (such as LNCaP or DU145 as other groups
did), for analyzing the efficacy of AdPSAE1. We believe
that the intratumoral injection of viral vector into a
primary prostate tumor setting reflects much closer to the
real clinical situation for prostate cancer gene therapy.
Moreover, to our knowledge, we are the first group to use
a bladder xenograft tumor model (RT4) for analyzing the
specificity of PSA promoter-driven E1 expression (Figure
6B), it seems to make more sense to us to pay attention
whether AdPSAE1 would cause damage to the bladder,
which is anatomically close to the prostate during the
prostate cancer gene therapy application, rather than to the
ovarian and breast as used by other group (Yu et al,
1999a).
While the PSA promoter maintains faithful tissue-
specific expression, its promoter activity is relatively weak
compared to the constitutive active RSV promoter
(compare Figure 5A and 5E). This implies that as a trade-
off for the tissue specificity, the expression of a
therapeutic transgene driven by the PSA promoter will be
lower than that of a constitutively active promoter. This
may not seem to be a major issue because we are using a
conditional oncolytic strategy in which the therapeutic
transgene itself is the Ad5 E1 gene. Theoretically, only
low levels of E1 expression are required to initiate and
maintain the viral oncolytic cycle to eradicate all the
prostate cells. In this study, we have demonstrated that at
an moi of 1, AdPSAE1 was able to completely eradicate
all cancerous prostate cells in vitro (Figure 2, 3 and 4).
Similarly, in our in vivo study, at viral doses (i.e.,
intratumoral injection of 5x106 pfu AdPSAE1 per tumor of
200 mm3 size, Figure 6) much lower than that of the
typical E1-deleted adenoviral vectors we have routinely
used (i.e., intratumoral injection of 5x109 pfu E1-deleted
adenovirus containing a therapeutic gene per tumor of 100
mm3 size, Steiner et al, 2000b, 2000c), AdPSAE1
exhibited an equivalent inhibition ability for xenograft
prostate tumor growth as those by E1-deleted adenovirus
at a much higher dose. However, we were still unable to
completely eradicate tumors using AdPSAE1 treatment in
vivo (Figure 6A). This failure may be due to insufficient
production of the E1 protein in vivo by the relatively weak
prostate-specific promoter.
The limitation of this strategy by a PSA promoter
driven, prostate-specific gene expression is that it only
works effectively in PSA-producing prostate cells (such as
LNCaP and PPC-1 as shown in this report), but not in
![Page 115: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/115.jpg)
Gene Therapy and Molecular Biology Vol 8, page 421
421
PSA-negative prostate cells such as DU145 and PC3
(Rodriguez et al, 1997; Yu et al, 1999b). Therefore, other
prostate-specific promoters (such as probasin) should be
explored for their abilities to drive transgene expression in
PSA-negative prostate cancer cells. Our ongoing research
showed that a 456-bp probasin promoter is able to drive
transgene specifically expressed in both PSA-positive and
PSA-negative prostate cancer cells. It implies that this
456-bp 5’ region of the probasin gene might be a good
candidate to function as a prostate-specific promoter to
drive the E1 transgene expression in prostate cancer.
The idea of using conditional oncolytic viruses is an
attractive strategy that may hold the promise of 100%
eradication of primary tumor cells and of targeting tumor
metastases. However, significant effort should be
undertaken to evaluate the tissue specificity and ensure the
safety of each new viral construct. A study to evaluate the
biodistribution and toxicity of a replication-competent
adenovirus following intraprostatic injection showed that
although the virus persisted in the urogenital tract and
liver, most toxicity was minimal and self-limiting. Most
importantly, there was no germ-line transmission of viral
genes (Paielli et al, 2000). One way to control viral spread
is to design a conditional oncolytic virus containing a
prodrug enzyme gene, so the prodrug can be used as
desired to suppress viral replication effectively. A
replication-competent, E1b-attenuated adenovirus
containing a cytosine deaminase/herpes simplex virus type
1-thymidine kinase (CD/HSV-TK) fusion gene was
constructed (Freytag et al, 1998). Not only the suicide
gene system allows for the utilization of double-suicide
gene therapy, but also it provides a means to eliminate the
virus itself by destroying the host cells in situ and controls
viral spread whenever needed (Freytag et al, 1998).
Recent development in this field has brought the
hope closer to generate the ideal conditional replication-
competent adenovirus for prostate cancer gene therapy. It
appears that PSA prompter/enhancer has more activity and
specificity in helper-dependent adenoviral vector (almost
devoid of all adenoviral sequences) than in traditional E1-
deleted adenoviral vector (Shi et al, 2002). Moreover, this
promoter specificity can also be influenced by other
constitutively active promoter/enhancer in the vector
backbone (Shi et al, 2002). To overcome the obstacle that
PSA promoter is active only in PSA-producing prostate
cancer cells, a strategy of cotransduction of another
adenovirus expressing androgen receptor (AR) and
combination with dihydrotestosterone (DHT) treatment
should be worth exploration. Because PSA promoter-
driven transgene can be induced by DHT in PC-3 cells (a
non-PSA-producing prostate cancer cell line) transfected
with AR expression vector (Kizu et al, 2004). Moreover, a
novel TARP (T cell receptor gamma-chain alternate
reading frame protein) promoter with PSA enhancer has
shown a high prostate-specific activity in both hormone-
dependent and hormone-refractory prostate cancer cells
(Cheng et al, 2004). With significant ongoing efforts of
better understanding and improvement in these aspects, we
expect that ideal conditional replication-competent
adenoviruses will be generated and become an effective
means for the treatment of prostate cancer in the near
future.
AcknowledgmentsThis research was supported in part by NIH grant
DK65962 (Y.L.), in part by Elsa U. Pardee Foundation
(Y.L.), and in part by Cancer Research and Prevention
Foundation (Y.L.).
We thank Dr. Dan Baker of the Department of
Medicine, University of Tennessee Health Science Center
for his critical review of this manuscript.
ReferencesBerkner KL (1988) Development of adenovirus vectors for the
expression of heterologous genes. Biotechniques 6, 616-629.
Brothman AR, Lesho LJ, Somers KD, Wright GL Jr, and
Merchant DJ (1989) Phenotypic and cytogenetic
characterization of a cell line derived from primary prostatic
carcinoma. Int J Cancer 44, 898-903.
Cheng WS, Kraaij R, Nilsson B, van der Weel L, de Ridder CM,
Totterman TH, and Essand M (2004) A novel TARP-
promoter-based adenovirus against hormone-dependent and
hormone-refractory prostate cancer. Mol Ther 10, 355-364.
Eastham JA, Chen S-H, Sehgal I, Yang G, Timme TL, Hall SJ,
Woo SLC, and Thompson TC (1996) Prostate cancer gene
therapy, herpes simplex virus thymidine kinase gene
transduction followed by ganciclovir in mouse and human
prostate cancer models. Hum Gene Ther 7, 515-525.
Freytag SO, Rogulski KR, Paielli DL, Gilbert JD, and Kim JH
(1998) A novel three-pronged approach to kill cancer cells
selectively, concomitant viral, double suicide gene, and
radiotherapy. Hum Gene Ther 9, 1323-1333.
Goldsmith KT, Curiel DT, Engler JA, and Garver Jr, RI (1994)
Trans complementation of an E1a-deleted adenovirus with
codelivered E1A sequences to make recombinant adenoviral
producer cells. Hum Gene Ther 5, 1341-1348.
Graham FL, Smiley J, Russell WC, and Nairn R (1977)
Characteristics of a human cell line transformed by DNA
from human adenovirus type 5. J Gen Virol 36, 59-72.
Graham FL. and Prevec L (1991) Manipulation of adenovirus
vectors. In Methods in Molecular Biology. E.J. Murray, ed,
Vol. 7, Gene transfer and expression protocols. (The
Human Press Inc, Clifton) pp. 109-128.
Han JS, Qian D, Wicha MS, and Clarke MF (1998) A method of
limited replication for the efficient in vivo delivery of
adenovirus to cancer cells. Hum Gene Ther 9, 1209-1216.
Jemal A, Timari RC, Murray T, Ghafoor A, Samuels A, Ward E,
Feuer EJ, and Thun MJ, A (2004) Cancer Statistics, 2004.
CA Cancer J Clin 54, 8-29.
Kizu R, Otsuki N, Kishida Y, Toriba A, Mizokami A, Burnstein
KL, Klinge CM, and Hayakawai K (2004) A new luciferase
reporter gene assay for the detection of androgenic and
antiandrogenic effects based on a human prostate specific
antigen promoter and PC3/AR human prostate cancer cells.
Anal Sci 20, 55-59.
Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Roger W, and
Steiner MS (1999) Delivery of adenoviral vectors to the
prostate for gene therapy. Cancer Gene Ther 6, 64-72.
Lu Y, Zhang Y, and Steiner MS (1998) Efficient identification of
recombinant adenoviruses by direct plaque-screening. DNA
Cell Biol 17, 643-645.
Paielli DL, Wing MS, Rogulski KR, Gilbert JD, Kolozsvary A,
Kim JH, Hughes J, Schnell M, Thompson T, and Freytag SO
(2000) Evaluation of the biodistribution, persistence,
toxicity, and potential of germ-line transmission of a
![Page 116: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/116.jpg)
Chang and Lu: Prostate-specific conditional oncolytic adenovirus
422
replication-competent human adenovirus following
intraprostatic administration in the mouse. Mol Ther 1, 263-
274.
Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW,
and Henderson DR (1997) Prostate attenuated replication
competent adenovirus (ARCA) CN706, a selective cytotoxic
for prostate-specific antigen-positive prostate cancer cells.
Cancer Res 57, 2559-2563.
Russell WC (2000) Update on adenovirus and its vectors. J Gen
Virol 81, 2573-2604.
Shi CX, Hitt M, Ng P,and Graham FL (2002) Superior tissue-
specific expression from tyrosinase and prostate-specific
antigen promoters/enhancers in helper-dependent compared
with first-generation adenoviral vectors. Hum Gene Ther
13, 211-224.
Steiner MS, Zhang X, Wang Y, and Lu Y (2000b) Growth
inhibition of prostate cancer by adenovirus expressing a
novel tumor suppressor gene pHyde. Cancer Res 60, 4419-
4425.
Steiner MS, Zhang Y, and Lu Y (2000a) A fast way to generate
recombinant adenovirus, a high-frequency-recombination
system. J Industr Microbiol Biotechnol 24, 198-202.
Steiner MS, Zhang Y, Carraher J, and Lu Y (1999) In vivo
expression of prostate specific adenoviral vectors in a canine
model. Cancer Gene Ther 6, 456-464.
Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, and Lu Y
(2000c) Adenoviral vector containing wild type p16
suppresses prostate cancer growth and prolongs survival by
inducing cell senescence. Cancer Gene Ther 7, 360-372.
Yu DC, Chen Y, Seng M, Dilley J, and Henderson DR (1999b)
The addition of adenovirus type 5 region E3 enables calydon
virus 787 to eliminate distant prostate tumor xenografts.
Cancer Res 59, 4200-4203.
Yu DC, Sakamoto GT, and Henderson DR (1999a) Identification
of the transcriptional regulatory sequences of human
kallikrein 2 and their use in the construction of calydon virus
764, an attenuated replication competent adenovirus for
prostate cancer therapy. Cancer Res 59, 1498-1504.
Dr. Yi Lu
![Page 117: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/117.jpg)
Gene Therapy and Molecular Biology Vol 8, page 423
423
Gene Ther Mol Biol Vol 8, 423-430, 2004
A platform for constructing infectivity-enhanced
fiber-mosaic adenoviruses genetically modified to
express two fiber typesResearch Article
Marianne G. Rots1*, Willemijn M. Gommans1, Igor Dmitriev2, Dorenda
Oosterhuis1, Toshiro Seki2, David T. Curiel2, Hidde J. Haisma1
1Therapeutic Gene Modulation, Groningen University Institute for Drug Exploration, University of Groningen, A.
Deusinglaan 1, 9713 AV Groningen, the Netherlands2Division of Human Gene Therapy, Departments of Medicine, Pathology and Surgery, University of Alabama at
Birmingham, Birmingham, AL 35291, USA
__________________________________________________________________________________
*Correspondence: Marianne G. Rots, Department of Therapeutic Gene Modulation; Groningen University Institute for Drug
Exploration; A. Deusinglaan 1; 9713 AV Groningen; The Netherlands; Tel: +31-50-363 8514 7866; Fax: +31-50-363 3247; e-mail:
Key words: gene therapy, adenovirus, fiber, infectivity enhancement
Abbreviations: adenovirus type 3, (Ad3); coxsackie adenovirus receptor, (CAR); fetal bovine serum, (FBS); Green Fluorescent Protein,
(GFP); Head and neck squamous cell carcinoma, (HNSCC); plaque forming units, (pfu); relative light units, (RLU); viral particle, (vp)
Received: 27 September 2004; Accepted: 6 October 2004; electronically published: October 2004
Summary
Adenoviruses type 5 have been successfully exploited as gene transfer vectors and numerous vectorological
improvements have contributed to increasing efficiency and specificity of adenoviral gene therapy. Despite these
improvements, inefficient gene transfer still is an important limitation and is, at least in part, due to the low
expression of the primary receptor (CAR) on target cells. Combining two different fiber types (the fiber of Ad5 for
CAR-dependent uptake and the fiber of Ad3 for CAR-independent uptake) on an Ad5-based capsid would increase
the options for improvement of specificity and efficiency. In this study, we present an approach to engineer fiber-
mosaic adenoviruses by cloning the fiber of Ad3 into the Ad5 genome under the control of the Major Late Promoter
using native splicing signals. Such fiber-mosaic viruses were efficiently rescued using conventional 293 cells and
demonstrated good infection profiles. Pre-incubation with recombinant fiber knob (either derived from Ad5 or
Ad3) indicated different mechanisms of entry for the fiber-mosaic viruses. The introduction of an additional entry
pathway can be further exploited to overcome low infection efficiency due to low CAR expression. In addition, the
technology will be of value in increasing the specificity of adenoviral gene therapy since this approach allows the
incorporation of two different retargeting ligands per capsid. Such infectivity enhancement will also prove powerful
in the context of replicative agents.
I. IntroductionAdenoviruses are widely used as gene transfer
vehicles in gene therapy for several reasons including the
easy production to high titers and their efficient infection
of both dividing and non-dividing cells. Even though
adenoviruses are among the most efficient vectors in vivo
to date, accounting for 40% of all clinical gene therapy
trials (Marshall, 2001), adenoviral cancer gene therapy is
limited by the low efficiency of gene transfer. This low
gene transfer might at least partially be explained by
no/low expression or accessibility of the primary receptor
for adenoviruses (coxsackie adenovirus receptor (CAR))
(Douglas et al, 2001).
Redirecting viruses to specific receptors on target
cells will improve specificity and possibly also efficiency
(Glasgow and Curiel, 2004). Such transductional
retargeting has been exploited through complexing the
virus to targeting moieties (eg bispecific antibodies) (Rots
et al, 2003) or through genetic modification of the knob or
penton base (Nicklin and Baker, 2002). Alternatively,
several genetic strategies have been developed to stably
incorporate retargeting moieties directly into the viral
capsid. For fiber modifications, the HI-loop or C-terminal
![Page 118: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/118.jpg)
Rots et al: Constructing fiber-mosaic adenoviruses
424
end have been exploited, and several polypeptides have
been successfully incorporated (Belousova et al, 2002).
Although successful in improving the characteristics of the
vector in vitro, the retargeting moiety generally is only
expressed by specific tumor types in vivo . In this respect,
we reasoned that both efficiency and specificity of
adenoviral gene transfer would be improved by allowing a
virus to infect cells via two ways of entry.
Adenoviruses belonging to subgroup C mainly bind
to the CAR receptor and will be internalized after binding
of the penton base to integrins. However, subgroup B
adenoviruses do not bind to CAR but to other receptor(s),
like CD46 (Gaggar et al, 2003), before internalization via
integrin-mediated endocytosis takes place (Cuzange et al,
1994). These subgroup B viruses display a different
infection profile as has been described in detail for
adenovirus type 3 (Ad3) (Stevenson et al, 1997; Kanerva
et al, 2002), Ad7 (Gall et al, 1996), Ad17 (Chillon et al,
1997) and Ad35 (Shayakhmetov et al, 2000). Based on the
improved infection of primary cancer cells described for
Ad3 versus Ad5 (Kanerva et al, 2002; Volk et al, 2003),
we choose to exploit the infection mechanism of Ad3. To
this end, the Ad3 fiber was cloned into the Ad5 genome
using the native fiber splicing signals thus creating a virus
expressing both fibers onto the capsid of Ad5 (fiber-
mosaic virus). We demonstrate that such fiber-mosaic
viruses (AdF3F5) can be rescued and that this virus infects
cells through two different mechanisms; one CAR
mediated entry which can be blocked by recombinant
knob 5 protein and one entry pathway which can be
blocked by preincubation with recombinant knob 3
protein.
This technology of introducing an additional fiber
type in adenoviral gene therapy vectors will contribute to
optimizing adenoviral gene therapy efficiency (Figure 1).
Specificity can subsequently be achieved by introducing
targeting ligands into the knob of Ad5 (Dmitriev et al,
1998) and/or the knob of Ad3 (Uil et al, 2003).
Alternatively, the use of tumor specific promoters will
restrict transgene expression or viral replication
specifically to target cells (Rots et al, 2003). Especially in
the context of replication competent adenoviruses, the
fiber-mosaic approach will be beneficial since secondary
infection efficiency is thought to be a major problem
hampering therapeutic outcome of replicative agents.
II. Materials and methodsA. CellsHuman cervical cancer cells (HeLa) and embryonic kidney
cells (293), both expressing high levels of CAR and integrins,
were purchased from the American Type Culture Collection
(ATCC, Rockville, MD). Head and neck squamous cell
carcinoma (HNSCC) cell lines (FaDu and SCC25), glioma lines
(U373 and U118) and ovarian cancer cell lines (SKOV) were
included for their differential expression of the receptor for Ad3
and Ad5. Cells were cultured at linear phase in recommended
media.
B. Construction of recombinant adenoviral
plasmid encoding the fiber-mosaic adenovirus
AdF3F5Since incorporation of the fiber monotrimer into the viral
capsid is dependent on the tail domain of the fiber, we
constructed a chimeric fiber by fusing the tail of Ad5 to the shaft
of Ad3. Oligos encoding the first 15 amino acids of the tail of the
fiber of Ad5 (based on Ad sequence nts 31042 to 31087
containing the KRAR nuclear localization signal) (Hong and
Engler, 1991) were constructed to contain a NdeI- 3’end. The
shaft and the knob region of Ad3 were obtained by PCR using
Pfu-polymerase (Stratagene) resulting in a NdeI-5’end
(underlined) using the following primers: 5’-
GTACCCATATGAAGATGAAAGCAGCTC-3’ (forward) and
5’-GGGAAGGGGGAGGCAAAATAACTAC-3’ (reverse). The
tail of Ad5 was then genetically fused to the gene coding for the
shaft and the knob of Ad3 and introduced upstream of the wild
type Ad5 fiber by cloning into the PacI site of pAd70-100dlE3
(kindly provided by Dr. Falck-Pederson, Cornell, New York)
(Gall et al, 1996). Digestion with NdeI results in a NdeI-NdeI
fragment containing the shaft and knob of Ad3 followed by
Figure 1. Schematic representation of
infectivity-enhancement by fiber
mosaic adenoviruses. Adenoviruses
expressing two different fiber types on
one capsid can make use of two different
mechanisms of entry. This approach will
circumvent the low expression of the
primary receptor, CAR, as described for
numerous primary cancer cell types. The
technology allows for introduction of
two targeting moieties in the same
virion.
![Page 119: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/119.jpg)
Gene Therapy and Molecular Biology Vol 8, page 425
425
upstream sequence of wild type Ad5 fiber and the starting
genetic sequence encoding the Ad5 tail. This fragment was
subcloned into the NdeI site of the adenoviral transfer plasmid
pNEBpkFSP (Krasnykh et al, 1996) to ensure optimal splicing
conditions for the second chimeric fiber. Cloning strategy and
resulting construct is shown in Figure 2. Enzymes used were
obtained from LifeTechnologies and New England Biolabs.
Homologous recombination with the adenoviral backbone
pVK50 (Krasnykh et al, 1996) containing genes encoding
luciferase and Green Fluorescent Protein (GFP) in the E1-region
(Seki et al, 2002) resulted in a plasmid encoding AdF3F5.
Subsequent virus production was performed according to
the pAdEasy protocol (He et al, 1998). Expression of the two
fibers was detected by western blot analysis of 1010 boiled viral
particles separated on a 10% SDS-PAGE gel using the anti-tail
antibody 2D4 (Hong and Engler, 1991) generated at the
University of Alabama at Birmingham Hybridoma Core Facility.
C. VirusesTo compare the infection efficiency of AdF3F5 with
unretargeted Ad5, AdTL was used containing luciferase and GFP
in the E1 region (wild type Ad5 fiber, AdF5) (Alemany and
Curiel, 2001). To investigate the infection efficiency relative to
knob 3 mediated infection, Ad5/3Luc1 was used expressing a
chimeric fiber containing the knob of Ad3 in a Ad5 backbone
(AdK3) (Krasnykh et al, 2001). AdK3 encodes luciferase from a
different expression cassette and can therefore not be directly
compared to AdF5 and AdF3F5. Adenovirus type 3 was obtained
from the American Type Culture Collection. All viruses were
CsCl purified and quantified for viral particle (vp) number and
plaque forming units (pfu) according to standard procedures. The
vp/pfu ratios were 3.1, 3.7 and 2.2 for AdF3F5, AdF5 and AdK3,
respectively.
D. Inhibition of viral mediated gene transfer
by recombinant fiber proteinsMonolayers were grown to 70% confluency in 24 wells
plates and incubated with recombinant Ad3 knob (10 µg/ml
PBS), Ad5 knob (2 or 10 µg/ml), a combination of both knobs or
with plain PBS for 10 minutes at room temperature.
Recombinant proteins were obtained as described previously
(Krasnykh et al, 1996). Viruses (100 vp/cell) were added in 100
µl cell growth medium containing 2% fetal bovine serum (FBS,
hospital pharmacy University Hospital Groningen) and cells
were incubated for 1 hour at 37°C. Then, 500 µl growth medium
containing 10% FBS was added and cells were incubated for 2
days. Cells were lysed using Cell Culture Lysis Buffer and
luciferase activity was measured using a luminometer (Packard,
Groningen, the Netherlands), according to manufacturers
conditions (Luciferase Assay System, Promega, Leiden, the
Netherlands). Data are expressed as relative light units (RLU).
E. Infectivity assaysTo compare infection efficiency of the fiber-mosaic
adenovirus AdF3F5 with Ad5 infection (AdF5) and with
infection of Ad3 (Ad5/3-Luc1), different cell lines were grown to
70% confluent monolayers in 24 wells plates. Viruses were
diluted in 100 µl medium containing 2% FBS and cells were
infected at 100 vp/cell. After 1 hour of incubation at 37°C,
medium containing 10% FBS was added. After 2 days, cells were
lysed and luciferase activity was determined. Data are
represented as means of triplicates of representative experiments.
Students t-Tests were performed to analyze the differences
between infection efficiencies of AdF5 and AdF3F5.
Figure 2. Cloning strategy for the transfer plasmid pNEBpkFSP.F3F5 for construction of fiber-mosaic adenoviruses AdF3F5.
The chimeric fiber F3 was made by ligating the 5’ part of the tail of Ad5 (T5) to the PCR product of the Shaft and the Knob of Ad3
(SK3). Subsequently, this fragment (5T3SK) was ligated into pAd70-100dlE3 containing wild type fiber (F5). Restriction with NdeI of
plasmid pAd70-100(5T3SK) results in a fragment containing: 1) 3SK, 2) the wild type splicing sequences (*) upstream of fiber 5 and 3)
the initial portion of the tail of wild type fiber 5. Subcloning of this NdeI-fragment into pNEBpkFSP resulted in a transfer vector for
introduction of an additional fiber-encoding gene into the adenoviral backbone. Both fibers are under the control of the Major Late
Promoter, with the tripartite leader marked as black boxes and the wild type splicing sites denoted as *.
![Page 120: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/120.jpg)
Rots et al: Constructing fiber-mosaic adenoviruses
426
III. ResultsA. Construction of recombinant
adenoviral plasmid encoding the fiber-mosaic
adenovirus AdF3F5To circumvent low infection efficiency which is
hampering gene therapy approaches in vivo, we
constructed an adenovirus with two different fiber types
allowing two different mechanisms of cellular entry. Since
adenovirus type 5 is the most commonly used vector for
adenoviral gene therapy, we developed an approach to
incorporate the additional fiber into the capsid of Ad5. To
retain the trimerisation properties of adenoviral fiber
molecules, we focused on subgroup B viruses which do
not use the CAR receptor for entry. Optimal incorporation
of the chimeric additional fiber protein into the capsid of
Ad5, is ensured by cloning the Shaft and the Knob of Ad3
(3SK fragment) downstream of the initial coding sequence
for the Tail of Ad5 (5T) (Figure 2).
To achieve equal expression levels of the chimer
fiber compared to the wild type fiber, the chimeric fiber
(5T3SK) was cloned under the control of the same
promoter as the wild type fiber (the native adenoviral
Major Late Promoter). To this end, however, the splicing
signals of the wild type fiber 5 sequence also needed to be
retained. This has been achieved through subcloning of the
Ad3ShaftKnob-Ad5Tail Nde-fragment into another fiber
shuttle plasmid (see Materials and Methods). The fiber-
mosaic AdF3F5 viruses could be rescued on 293 cells as
efficiently as other first generation adenoviruses (up to
1012 viral particles/ml). Western blot analysis subsequently
confirmed the presence of both fiber types onto the CsCl-
purified virus material. The protein levels, however, were
not equal and higher levels of Ad5 fiber were detected
compared to Ad3 fiber (Figure 3).
B. Infectivity assays1. Functional validation of AdF3F5.To identify the pathway of entry of AdF3F5,
different cell lines (HeLa cells (expressing high levels of
both CAR and the receptor for Ad3), FaDu and SCC25
cells (both expressing low levels of CAR and high levels
of Ad3 receptor)) were incubated with AdF3F5, AdF5 and
AdK3 after preincubation with recombinant knob 3 and/or
knob 5 protein as described in Material and Methods.
Presence of knob 3 did slightly inhibit infection of
AdF3F5 (expressing both Ad3 and Ad5 fibers) and of
AdK3 (expressing the knob of Ad3, displaying an Ad3
infection spectrum) on HeLa cells (14 and 10% inhibition,
respectively) (Figure 4). However, more pronounced
inhibition of knob 3 mediated infection was observed on
FaDu (AdF3F5: 31% and AdK3: 58% inhibition) and
SSC25 (27 and 77%, respectively). Preincubation with
recombinant knob 5 protein efficiently inhibited infection
of AdF3F5 and AdF5 (wild type Ad5 fiber) on all cell
lines, especially on HeLa cells (over 90%). Combination
of both recombinant knob proteins inhibited the infection
efficiency of AdF3F5 even further on FaDu and SCC25
cells. Preincubation with knob 3 occasionally increased
infection efficiency of AdF5, whereas knob 5 could
marginally inhibit infection of AdK3 (shown for FaDu in
Figure 4b).
2. Determination of infection efficiency of
AdF3F5 on cancer cells.Some cancer types are known to be less susceptible
to infection with Ad5 compared to others due to low CAR
levels. To test improved infectivity of the fiber-mosaic
AdF3F5 on different cancer cell types, cell lines were
infected with AdF3F5, AdF5 and AdK3 (Figure 5).
Infection with AdF3F5 was as efficient as AdF5 on HeLa
and FaDu, while an 2- to 3-fold increase in efficiency was
observed for AdF3F5 compared to AdF5 on U373, U118
Figure 3. Western blot detecting adenoviral fiber molecules. Boiled CsCl-purified viruses (1010 viral particles) were separated on
SDS-PAGE gel, transferred to PVDF membrane and stained with 2D4 anti-tail antibody. Ad3 virions showed a band for the fiber
molecule at 35 kDa, whereas the fiber of Ad5 was detected around 65 kDa. For the fiber-mosaic AdF3F5, two bands were detectable:
one strong band at the size of the fiber of Ad5, whereas a weaker band could be detected at the size of Ad3 fibers.
![Page 121: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/121.jpg)
Gene Therapy and Molecular Biology Vol 8, page 427
427
Figure 4. Functional validation of AdF3F5. a) HeLa, FaDu and SCC25 cells were infected with AdF5, AdF3F5 and AdK3 (100
vp/cell) after pre-incubation with recombinant knob 3 (10 µg/ml) and/or knob 5 (2µg/ml). After 2 days, luciferase readings were
performed. Data are expressed as percentage of relative light units, 100% being no knob block present. b) to investigate cross-inhibition
of the knobs, FaDu cells were infected with AdF5, AdF3F5 and AdK3 (100 vp/cell) after pre-incubation with recombinant knob 3 or
knob 5 (10µg/ml).
![Page 122: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/122.jpg)
Rots et al: Constructing fiber-mosaic adenoviruses
428
Figure 5. Absolute and relative infection efficiencies of fiber-mosaic Ad on Ad3 receptor positive cells. Different cell lines were
incubated with AdF5, AdF3F5 and AdK3 viruses (100 vp/cell) and after two days infectivity efficiency was measured by determining
luciferase activity. Data are represented as mean values of triplicates + SD. To directly compare the different viruses, infectivity on HeLa
cells has been set at 100% in Figure 5b.
and on SKOV cells (p!0.01). Since the receptor levels of
Ad3 and Ad5 receptors on HeLa cells is similar, the
infection of the three viruses on HeLa cells was set at
100% to determine the relative infection efficiency of
AdF3F5 compared to AdK3. Although AdF3F5 showed
improved infection efficiency over AdF5, infection
efficiency of AdF3F5 was not improved compared to
AdK3 for any of the cell lines tested.
IV. DiscussionLow infection efficiency is hampering cancer gene
therapy from showing its full potential and vectorological
improvements are warranted. Moreover, virotherapy (the
conditional viral replication resulting in oncolysis) would
greatly benefit from infectivity enhanced agents as shown
by incorporation of different targeting moieties in fibers of
replication competent viruses (Hemminki et al, 2001;
Bauerschmitz et al, 2002; Kawakami et al, 2003). These
studies, however, again are limited to the expression of
one receptor type on tumor cells. In this study, we describe
the feasibility to grow fiber-mosaic adenoviral agents
targeting two different receptors simultaneously. We
showed that infection with this fiber-mosaic virus shows
advantage over AdF5 infection. Although no increase in
efficiency was observed compared to infection with AdK3
for low CAR cell lines, the technology provides a flexible
platform allowing increase of specificity by introduction
of two different targeting ligands.
Tropism of adenoviruses is determined by the knob
of the fiber protein and the penton base. We hypothesized
that the introduction of an additional different fiber type
provides a way of introducing an additional mechanism of
cellular entry of virus, thereby increasing efficiency of
infection and/or broadening the infection spectrum. Since
Ad3 has been demonstrated to efficiently infect several
CAR deficient (primary) tumor types (Stevenson et al,
1995; Kanerva et al, 2002; Volk et al, 2003), we choose
the Ad3 fiber molecule to be incorporated into the capsid
of type 5 adenoviruses in addition to the wild type Ad5
fiber.
We demonstrated that two different fiber proteins can
be incorporated into one viral capsid and that such fiber-
mosaic viruses can be efficiently rescued using
conventional methods. Although the additional fiber was
cloned under the control of the same Major Late Promoter,
using the same upstream splicing sequences as the wild
type fiber, incorporation of the chimeric fibers onto the
capsid was less efficient then for the wild type fiber, as
detected by western blot. This might be explained by a
packaging bias of one fiber type over the other as
previously described for naturally occurring fiber-mosaic
adenoviruses (Schoggins et al, 2003). However, in our
approach the tail of both fiber types starts with the first
amino acids of the tail of wild type Ad5 to avoid
inefficient incorporation. The imbalanced incorporation
most likely is explained by the low protein expression of
fiber observed after infection by Ad3 (Albiges-Rizo et al,
1991). However, we continued with this fiber chimera
since the shorter size of the fiber of Ad3 allowed easy
biochemical discrimination with the wild type Ad5 fiber.
Blocking experiments demonstrated that these fiber-
mosaic viruses exploit two ways of entry. Importantly,
infection efficiency was not impaired by incorporation of
the additional fiber into the capsid. As both the knob of
Ad5 (Belousova et al, 2002) as well as the knob of Ad3
(Uil et al, 2003) can be exploited to introduce targeting
moieties, fiber-mosaic viruses represents a powerful
platform for constructing efficient, but specific gene
therapy agents. Improved gene transfer efficiency by
introducing two retargeting moieties onto the viral capsid
has previously been obtained by incorporation of both the
RGD and a polylysine motif into the fiber (Wu et al,
2002), supporting our hypothesis.
Previously, we obtained fiber-mosaic adenoviruses
expressing both the fiber of Ad5 and a chimeric fiber
consisting of the tail and the shaft of Ad5 fiber and the
![Page 123: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/123.jpg)
Gene Therapy and Molecular Biology Vol 8, page 429
429
knob of Ad3 by co-culture of Ad5 and AdK3. The
resulting viruses incorporated both fibers on the same
virion as has also been described for co-culture of other
serotypes in the early 70s (Norrby and Gollmar, 1971).
These AdF5:AdK3 fiber-mosaic viruses demonstrated an
expanded infection spectrum (Takayama et al, 2003).
Interestingly, the viruses also showed an improved
infection efficiency on various cell types tested compared
to Ad5, suggesting synergism between knob 5 and knob 3.
In this study, we did not observe such profound synergism,
probably since the knob of Ad3 is expressed on the short
shaft of Ad3; Binding to the receptor of Ad3 through the
short shaft might prevent simultaneous binding to the
CAR via the long shaft. Any receptor-cross talk resulting
in synergism will therefore be prevented.
Although co-infection results in fiber-mosaic viruses,
the production is laborious and most likely not very
reproducible. The approach to genetically construct a
fiber-mosaic virus expressing two different fibers is
therefore preferred. Naturally occurring human fiber-
mosaic adenoviruses have been identified and belong to
subgroup F enteric viruses. These viruses (serotype 40 and
41) contain two separate genes encoding a short fiber of
200A (41 kDa) and a long fiber of 340A (61 kDa) (Kidd et
al, 1993; Favier et al, 2002). These viruses therefore are
very similar to the one described here as the fiber of Ad3
is 160A and the fiber of Ad5 is 370A. The long fiber of
Ad40 and Ad41 binds to the CAR receptor whereas
binding of the short fiber is CAR-independent (Roelvink
et al, 1998). The concept of tandem fiber genes to
construct fiber-mosaic viruses had previously been shown
feasible (Schoggins et al, 2003; Pereboeva et al, 2004). In
an elegant approach, Perebouva et al, introduced the
option of binding targeting ligands to the second fiber type
through a biotin-acceptor peptide (Pereboeva et al, 2004).
Schoggins et al, reported on the construction of a fiber-
mosaic adenovirus type 5 co-expressing the fiber of Ad7
either with the fiber of Ad5 or with the short fiber of
Ad41. Like AdF3F5, the fiber-mosaic F7F5 virus showed
similar infection efficiencies compared to Ad5 (Schoggins
et al, 2003). The infectivity of the Ad5 based fiber-mosaic
adenovirus expressing the fiber of Ad7 and the short fiber
of Ad41 virus was dramatically impaired in vitro. Also in
vivo, a 2-log lower transduction of the liver was observed.
Similarly, a 10-fold reduction in liver transduction has
been reported for an Ad5 based adenovirus expressing the
shaft and the knob of Ad3 on its capsid (Vigne et al,
2003). In this respect, fiber-mosaic viruses based on Ad5
show promise as a platform for engineering efficient gene
therapy agents with a liver-off profile.
In conclusion, we demonstrated that viruses
expressing two different fiber types can be constructed and
efficiently rescued. Both fiber types are functional in
infecting cells, which opens the way for infecting a
broader spectrum of tumors. The next step is to increase
the specificity of this potent vector by introducing
targeting moieties and/or tumor specific promoters to
selectively express a trangene or to restrict viral
replication.
AcknowledgmentsWe want to thank Dr Falck-Pederson from the
Department of Microbiology, Weill Medical College of
Cornell University, New York, USA for providing us with
pAd70-100dlE3. The study was supported by NIH grant
#5 P50 CA89019 (Breast Cancer SPORE) and NIH grant
#1 R01 CA94084 (Pancreatic Cancer).
ReferencesAlemany R and Curiel DT (2001) CAR-binding ablation does
not change biodistribution and toxicity of adenoviral vectors.
Gene Ther 8, 1347-1353.
Bauerschmitz GJ, Lam JT, Kanerva A, Suzuki K, Nettelbeck
DM, Dmitriev I, Krasnykh V, Mikheeva GV, Barnes MN,
Alvarez RD, Dall P, Alemany R, Curiel DT and Hemminki
A (2002) Treatment of ovarian cancer with a tropism
modified oncolytic adenovirus. Cancer Res 62, 1266-1270.
Belousova N, Krendelchtchikova V, Curiel DT and Krasnykh V
(2002) Modulation of adenovirus vector tropism via
incorporation of polypeptide ligands into the fiber protein. J
Virol 76, 8621-8631.
Chillon M, Bosch A, Zabner J, Law L, Armentano D, Welsh MJ
and Davidson BL (1999) Group D adenoviruses infect
primary central nervous system cells more efficiently than
those from group C. J Virol 73, 2537-40.
Cuzange A, Chroboczek J and Jacrot B (1994) The penton base
of human adenovirus type 3 has the RGD motif. Gene 146,
257-259.
Dmitriev I, Krasnykh V, Miller CR, Wang W, Kashentseva E,
Mikheeva G, Belousova N and Curiel DT (1998) An
adenovirus vector with genetically modified fibers
demonstrates expanded tropism via utilization of a
coxsackievirus and adenovirus receptor-independent cell
entry mechanism. J Virol 72, 9706-9713.
Douglas JT, Kim M, Sumerel LA, Carey DE and Curiel DT
(2001) Efficient oncolysis by a replicating adenovirus (ad) in
vivo is critically dependent on tumor expression of primary
ad receptors. Cancer Res 61, 813-817.
Favier AL, Schoehn G, Jaquinod M, Harsi C and Chroboczek J
(2002) Structural studies of human enteric adenovirus type
41. Virology 293, 75-85.
Gaggar A, Shayakhmetov DM and Lieber A (2003) CD46 is a
cellular receptor for group B adenoviruses. Nat Med 9,
1408-1412.
Gall J, Kass-Eisler A, Leinwand L and Falck-Pedersen E (1996)
Adenovirus type 5 and 7 capsid chimera, fiber replacement
alters receptor tropism without affecting primary immune
neutralization epitopes. J Virol 70, 2116-2123.
Glasgow JN, Bauerschmitz GJ, Curiel DT, Hemminki A (2004)
Transductional and transcriptional targeting of adenovirus for
clinical applications Curr Gene Ther 4,1-14.
He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein
B (1998) A simplified system for generating recombinant
adenoviruses. Proc Natl Acad Sci USA 95, 2509-2514.
Hemminki A, Dmitriev I, Liu B, Desmond RA, Alemany R and
Curiel DT (2001) Targeting oncolytic adenoviral agents to
the epidermal growth factor pathway with a secretory fusion
molecule. Cancer Res 61, 6377-6381.
Hong JS and Engler JA (1991) The amino terminus of the
adenovirus fiber protein encodes the nuclear localization
signal. Virology 185, 758-767.
Kanerva A, Mikheeva GV, Krasnykh V, Coolidge CJ, Lam JT,
Mahasreshti PJ, Barker SD, Straughn M, Barnes MN,
Alvarez RD, Hemminki A and Curiel DT (2002) Targeting
adenovirus to the serotype 3 receptor increases gene transfer
![Page 124: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/124.jpg)
Rots et al: Constructing fiber-mosaic adenoviruses
430
efficiency to ovarian cancer cells. Clin Cancer Res 8, 275-
280.
Kawakami Y, Li H, Lam JT, Krasnykh V, Curiel DT and
Blackwell JL (2003) Substitution of the adenovirus serotype
5 knob with a serotype 3 knob enhances multiple steps in
virus replication. Cancer Res 63, 1262-1269.
Kidd AH, Chroboczek J, Cusack S and Ruigrok RW (1993)
Adenovirus type 40 virions contain two distinct fibers.
Virology 192, 73-84.
Krasnykh VN, Mikheeva GV, Douglas JT and Curiel DT (1996)
Generation of recombinant adenovirus vectors with modified
fibers for altering viral tropism. J Virol 70, 6839-6846.
Krasnykh V, Belousova N, Korokhov N, Mikheeva G and Curiel
DT (2001) Genetic targeting of an adenovirus vector via
replacement of the fiber protein with the phage T4 fibritin. J
Virol 75, 4176-4183.
Marshall E (2001) Gene therapy. Viral vectors still pack
surprises. Science 294, 1640.
Nicklin SA and Baker AH (2002) Tropism-modified adenoviral
and adeno-associated viral vectors for gene therapy. Curr
Gene Ther 2, 273-293.
Norrby E and Gollmar Y (1971) Mosaics of Capsid Components
Produced by Cocultivation of Certain Human Adenoviruses
in Vitro. Virology 44, 383-395.
Pereboeva L, Komarova S, Mahasreshti PJ and Curiel DT (2004)
Fiber-Mosaic Adenovirus as a novel approach to design
genetically modified adenoviral vectors. Vir Res 105, 35-46.
Roelvink PW, Lizonova A, Lee JG, Li Y, Bergelson JM, Finberg
RW, Brough DE, Kovesdi I and Wickham TJ (1998) The
coxsackievirus-adenovirus receptor protein can function as a
cellular attachment protein for adenovirus serotypes from
subgroups A, C, D, E and F. J Virol 72, 7909-7915.
Rots MG, Curiel DT, Gerritsen WR and Haisma HJ (2003)
Targeted cancer gene therapy, the flexibility of adenoviral
gene therapy vectors. J Control Release 87, 159-165.
Schoggins JW, Gall JG and Falck-Pedersen E (2003) Subgroup B
and F fiber chimeras eliminate normal adenovirus type 5
vector transduction in vitro and in vivo. J Virol 77, 1039-
1048.
Seki T, Dmitriev I, Kashentseva E, Takayama K, Rots M, Suzuki
K and Curiel DT (2002) Artificial extension of the
adenovirus fiber shaft inhibits infectivity in coxsackievirus
and adenovirus receptor-positive cell lines. J Virol 76, 1100-
1108.
Shayakhmetov DM, Papayannopoulou T, Stamatoyannopoulos G
and Lieber A (2000) Efficient gene transfer into human
CD34(+) cells by a retargeted adenovirus vector. J Virol 74,
2567-2583.
Stevenson SC, Rollence M, White B, Weaver L and McClelland
A (1995) Human adenovirus serotypes 3 and 5 bind to two
different cellular receptors via the fiber head domain. J Virol
69, 2850-2857.
Stevenson SC, Rollence M, Marshall-Neff J and McClelland A
(1997) Selective targeting of human cells by a chimeric
adenovirus vector containing a modified fiber protein. J
Virol 71, 4782-4790.
Takayama K, Reynolds PN, Short JJ, Kawakami Y, Adachi Y,
Glasgow JN, Rots MG, Krasnykh V, Douglas JT and Curiel
DT (2003) A mosaic adenovirus possessing serotype Ad5
and serotype Ad3 knobs exhibits expanded tropism.
Virology 309, 282-293.
Uil TG, Seki T, Dmitriev I, Kashentseva E, Douglas JT, Rots
MG, Middeldorp JM and Curiel DT (2003) Generation of an
adenoviral vector containing an addition of a heterologous
ligand to the serotype 3 fiber knob. Cancer Gene Ther 10,
121-124.
Vigne E, Dedieu JF, Brie A, Gillardeaux A, Briot D, Benihoud
K, Latta-Mahieu M, Saulnier P, Perricaudet M, Yeh P (2003)
Genetic manipulations of adenovirus type 5 fiber resulting in
liver tropism attenuation. Gene Ther 10, 153-162.
Volk AL, Rivera AA, Kanerva A, Bauerschmitz G, Dmitriev I,
Nettelbeck DM and Curiel DT (2003) Enhanced adenovirus
infection of melanoma cells by fiber-modification,
incorporation of RGD peptide or Ad5/3 chimerism. Cancer
Biol Ther 2, 511-515.
Wu H, Dmitriev I, Kashentseva E, Seki T, Wang M and Curiel
DT (2002) Construction and characterization of adenovirus
serotype 5 packaged by serotype 3 hexon. J Virol 76, 12775-
12782.
Group picture of the Department of Therapeutic Gene Modulation. Dr. Marianne G. Rots is the third person shown in the
first row from right to left.
![Page 125: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/125.jpg)
Gene Therapy and Molecular Biology Vol 8, page 431
431
Gene Ther Mol Biol Vol 8, 431-438, 2004
Internal ribosome entry sites in cancer gene therapyReview Article
Benedict J Yan1 and Caroline GL Lee1,2,*1Department of Biochemistry, National University of Singapore, Singapore2Division of Medical Sciences, National Cancer Center, Singapore
__________________________________________________________________________________
*Correspondence: Caroline G. Lee, Ph.D., Division of Medical Sciences, National Cancer Center, Level 6, Lab 5, 11 Hospital Drive,
Singapore 169610; Tel: 65-6436-8353; Fax: 65-6224-1778; Email: [email protected]
Key words: cancer gene therapy, Tumor-directed therapy, Host-directed therapy, Internal ribosome,
Abbreviations: 5’ untranslated region, (5’UTR); cationic amino acid transporter, (Cat-1); dihydrofolate reductase, (DHFR); hypoxia-
inducible factor-1!, (HIF-1!); internal ribosome entry site, (IRES); methylguanine methyltransferase, (MGMT); multidrug-resistance 1
gene, (MDR1); open reading frames, (ORF); vascular endothelial growth factor, (VEGF)
Received: 14 October 2004; Accepted: 21 October 2004; electronically published: October 2004
Summary
Cancer gene therapy is a promising treatment modality. Strategies in cancer gene therapy include tumor-directed
therapy (e.g. the delivery of suicide, immunomodulatory, anti-angiogenic, apoptotic genes or oncolytic viruses or
genes to reinstate tumor suppressor activity) and host-directed therapy (e.g. the delivery of genes encoding factors
that enhance the antigen presenting function of dendritic cells or protect the patient against myelosuppression). As
cancer, a complex disorder, often results from several defective genes, efficacy of cancer gene therapy can be
improved by a combination approach whereby several different genes are targeted simultaneously. Of several
methods to effect co-expression of multiple genes, the employment of internal ribosome entry sites (IRES)
represents a promising approach. This review examines the various preclinical and clinical studies employing
IRESs for cancer gene therapy, as well as properties of various IRESs that could be exploited for cancer gene
therapy.
I. IntroductionEfforts to combat cancer with gene therapy have
been underway for more than a decade (Gottesman, 2003),
with several clinical trials having been conducted with
varying success (Schuler et al, 2001; Buller et al, 2002;
Kuball et al, 2002; Pagliaro et al, 2003). Because cancer
pathogenesis stems in part from genetic mutations, gene
therapy is, in concept, a viable approach to cancer
treatment. Gene therapy is also of considerable utility on
several fronts not directly pertaining to tumor-specific
therapy, for example the delivery of drug resistance genes
to mitigate myelotoxicity of chemotherapeutic agents.
II. Strategies in cancer gene therapyA. Tumor-directed therapyFundamental tenets in cancer biology are that
deregulated growth is due to a combination of the
activation of oncogenes and inhibition of tumor suppressor
genes, both of which present as obvious targets for cancer
gene therapy. To date, most of the clinical trials have
centered on reinstating tumor suppressor activity, in
particular p53. However, the results concerning clinical
efficacy have not been impressive (Zeimet and Marth,
2003; McNeish et al, 2004). One conceivable reason could
be that modifying the expression of a single gene alone is
insufficient to prohibit cancer growth because of numerous
diverse pathways that still permit cancer progression. This,
in theory, could be countered by the delivery of multiple
genes that act on different pathways, such that a
complementary or synergistic effect is obtained.
Other major themes in tumor-directed therapy
include the delivery of suicide, immunomodulatory, anti-
angiogenic, apoptotic genes and oncolytic viruses. Suicide
genes encode enzymes that convert prodrugs to their
cytotoxic form, and the herpes simplex virus thymidine
kinase, which converts ganciclovir to ganciclovir
phosphate, falls under this category. The
immunomodulatory genes employed often code for
cytokines, an example being interleukin 2, and these serve
to mobilize the immune system to effect tumor cell killing.
Strategies involving suicide and immunomodulatory genes
are a popular combination in cancer gene therapy (Pizzato
et al, 1998; Soler et al, 1999; Wen et al, 2001; Barzon et
al, 2002).
![Page 126: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/126.jpg)
Yan and Lee: Internal ribosome entry sites in cancer gene therapy
432
Tumor cells actively induce the formation of new
blood vessels, and a recent paradigm in oncology is the
use of agents to impede this process, with a number of
ongoing clinical trials evaluating the effectiveness of such
agents. Gene therapy has been proposed to have several
advantages over protein-based inhibitors, including the
sustained expression of antiangiogenic molecules and the
ability to deliver multiple transgenes (Kleinman and Liau,
2001).
The induction of apoptosis in cancer cells is another
strategy, and studies involving the delivery of genes
coding for pro-apoptotic factors, such as TRAIL, Bax and
Smac/Diablo, have been conducted (Waxman and
Schwartz, 2003). With an increasing recognition that most
anticancer treatment modalities such as chemotherapy or
radiotherapy trigger apoptosis of cancer cells, gene
therapy may also prove useful in sensitizing the cells to
the effects of conventional agents.
Oncolytic viruses selectively replicate in and kill
tumor cells, and this specificity has contributed to their
favorable safety profile. However, clinical trials have
demonstrated an over-attenuation of these agents to the
extent that efficacy has been compromised. Hence there
has been a move to arm them with therapeutic genes to
improve their tumor-killing capabilities (Hermiston and
Kuhn, 2002).
B. Host-directed therapyMyelosuppression is an extremely frequent
complication of treatment utilizing conventional
chemotherapeutic agents, and this at times may prove
fatal. Hence a leading paradigm in cancer gene therapy is
the delivery of genes to protect susceptible haemopoietic
cells from the effects of these cytotoxic agents. Commonly
employed drug-resistance genes include the multidrug-
resistance 1 gene (MDR1), dihydrofolate reductase
(DHFR) gene and methylguanine methyltransferase
(MGMT) gene (Sorrentino, 2002).
Figure 1. Strategies in Cancer Gene Therapy to date utilizing IRESs
![Page 127: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/127.jpg)
Gene Therapy and Molecular Biology Vol 8, page 433
433
Tumor vaccines are another promising modality
(Berzofsky et al, 2004), and there are a variety of methods
to induce tumor immunity. Naked DNA expression
plasmids encoding tumor antigens have been shown to
generate immune responses. Another approach is to
deliver genes coding factors that enhance the antigen
presenting function of dendritic cells.
III. Multiple gene delivery and
attendant problemsAs noted above, the ability to co-express multiple
genes would be of immense value in cancer gene therapy
because complementary or synergistic effects could lead to
improved efficacy. Viruses are popular vectors for gene
delivery because of their higher transduction efficiency,
but this advantage is offset by the constraints placed on the
vector size. Because most therapeutic genes are quite
large, a polycistronic vector must be designed in such
fashion that the system of effecting multigene delivery is
modest in scale.
There are several methods available to effect
multiple gene expression. One could be the incorporation
of multiple promoters such that different proteins are
produced from separate mRNAs. A major drawback of
this approach is the possibility of promoter suppression
(Emerman and Temin, 1984), a phenomenon whereby
expression of any gene may be attenuated for ill-defined
reasons.
Other methods including splicing, fusion proteins
and proteolytic processing have been reviewed by de
Felipe (2002).
IV. Internal ribosome entry sitesIn eukaryotes, initiation of translation of most
mRNAs begins by a cap-dependent mechanism whereby a
43S complex (comprising a 40S subunit, the initiator
methionine-tRNA and other initiation factors) is recruited
to the 5’ methylguanosine cap. Recognition of the 5’ end
is mediated through the cap-binding protein complex
eIF4F, which comprises three subunits eIF4E, eIF4A and
eIF4G subunits. The 43S complex then scans in a 5’ to 3’
direction until an initiation codon is encountered,
following which the initiation factors dissociate and a
larger 60S ribosomal subunit binds to form the 80S
ribosome. Protein synthesis then commences.
IRESs are RNA structures capable of initiating
ribosome binding and translation in the absence of a 5’
cap. Most commonly found in the 5’ untranslated region
(5’UTR) of mRNAs, they were first documented in
poliovirus and other viral RNA sequences (Pelletier and
Sonenberg, 1988), but were subsequently shown to exist in
cellular mRNAs as well. To date there have been more
than 50 reported viral and cellular IRESs in total, and the
list is steadily expanding. The subject of IRESs has been
extensively reviewed, both in the academic (Hellen and
Sarnow, 2001; Stoneley and Willis, 2004) and applied
(Ngoi et al, 2004) setting.
In utilizing this system for multiple gene co-
expression, an internal ribosome entry site (IRES) is
placed between two or more open reading frames (ORF),
such that a corresponding number of proteins are
generated from a single mRNA transcript.
V. Application of IRESs in cancer
gene therapyIRESs have been employed in a number of
preclinical and clinical studies with some success, and
selected ones, that span the gamut of cancer gene therapy,
are displayed in Table 1.
VI. Choice of IRES?Most of the studies detailed in Table 1 employ the
EMCV IRES, but a number of studies have reported that
other IRESs may possess greater activity than the EMCV
IRES, for example the eIF4G IRES (Wong et al, 2002).
IRESs display a huge variation in their activity in various
contexts, and given the burgeoning number of IRESs, it
might be possible to tailor an IRES for a particular
purpose, for example in the treatment of a certain type of
cancer. However, current data is too sparse to allow a
meaningful decision making process as to the best IRES
for a given tumor type. Some factors governing the choice
of IRES are discussed, and Table 2 displays known
properties of IRESs that might be useful in developing an
effective polycistronic vector.
A. Tissue/Cell type specificityIRESs have not been shown to display a narrow
tissue/cell type specificity, and therefore cannot be
employed in situations where this property is requisite for
expression of the 3’ cistron, in contrast to tumor-specific
promoters.
B. Tissue/Cell type activityUnfortunately not much is know about the tissue /
cell type specificity of the different IRESs. Most IRES
studies have investigated the activity of a particular IRES
in different cell types, but the most valuable information
pertaining to gene therapy application can only be gleaned
from studies that have compared the activity of different
IRESs in a particular tumor type. Nevertheless, known
properties of some IRESs are detailed in Table 2.
C. Milieu-dependent activityCertain stressful conditions are known to suppress
cap-dependent translation, for example hypoxia, starvation
or apoptosis, leading to a general decrease in protein
synthesis. In this regard, IRESs possess a theoretical
advantage over other modalities such as promoters,
because some IRESs continue to operate under such
conditions - conditions that are typically experienced by
tumor cells. For example, the vascular endothelial growth
factor (VEGF) IRES (Stein et al, 1998) and hypoxia-
inducible factor-1! (HIF-1!) IRES (Lang et al, 2002)
maintain activity during hypoxia; and the cationic amino
acid transporter (Cat-1) IRES (Fernandez et al, 2001)
exhibits increased activity during amino acid starvation.
Where an IRES, such as the BCL-2 IRES (Sherrill et al,
2004), displays increased activity following cytotoxic drug
![Page 128: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/128.jpg)
Yan and Lee: Internal ribosome entry sites in cancer gene therapy
434
Table 1. Preclinical and Clinical Studies to date utilizing IRESs
Preclinical Studies (Tumor-directed therapy)
Year
published
Strategy/Aim
of Study
IRES
employe
d
Therapeutic/market/re
porter genes encoded
Vector Cell Lines References
1. SW480 Colon cancer
2. HCT116 Colon cancerArming an
oncolytic virus
with a suicide
gene
EMCV yCD Human
adenovirus 5
3.HT29 Colon cancer
Human
(Fuerer and
Iggo, 2004)
1. A549 Lung cancer
2. EKVX Lung cancer
3. HT29 Colon cancer
4. IGROV1 Ovariancancer
5. MDA-
MB-231
Breast
cancer
6. MDA-
MB-435
Breast
cancer
7. NCI-
H226
Lung cancer
8. NCI-
H522
Lung cancer
9. PC-3 Prostate
cancer
10. RXF-
393
Renal cancer
11. T47-D Breast
cancer
12. U251 Glioblastoma
multiforme
Suicide gene
delivery
EMCV 1. P450
2. NADPH-cytochrome
P450 reductase
Replication-
defective
adenovirus
13. 786-0 Renal cancer
Human (Jounaidi
and
Waxman,
2004)
Fusion of
reporter gene to
variousoncolytic viral
genes
EMCV Luciferase reporter gene Conditionally
replicative
adenovirus
1. A549 Lung cancer Human (Rivera et al,
2004)
1. 293 Embryonic
kidney
2004
Antiangiogenes
is
EMCV 1. Angiostatin
2. Endostatin
3. GFP
Recombinant
adenovirus-
associated
virus
2.
SKOV3.ipl
Ovarian
cancer
Human (Ponnazhaga
n et al, 2004)
1. KB-3-1 Cervical
cancer
2. 293 Embryonic
kidney
3. HepG2 Liver cancer
Human (Wong et al,
2002)
Charecterizatio
n of activity of
different IRESs
in varying
contexts using
reporter assays
1.
EMCV
2. BIP
3. eIF4G
4. MYC
5. VEGF
1. CAT
2. GAL Plasmid
4. N2a Neuroblasto
ma
Mouse
1. WRO Thyroid
cancer
2. FTC-133 Thyroid
cancer
3. C8305 Thyroid
cancer
4. ARO Thyroidcancer
5. HeLa Cervical
cancer
6. AoU373 Astrocytoma
Suicide and
immunomodula
ting gene
delivery
EMCV 1. HSV-tk
2. IL-2
Retrovirus
7. HepG2 Liver cancer
Human (Barzon et
al, 2002)
1.
Cwr22Rv1
Prostate
cancer
2. Dul45 Prostate
cancer
3. DuPro Prostate
cancer
4. JCA-1 Prostate
cancer
5. LNCaP Prostate
cancer
2002
Induction of
apoptosis
EMCV 1. TRAIL
2. GFP
Adenovirus
6. PC-3 Prostate
cancer
Human
(Voelkel-
Johnson et
al, 2002)
![Page 129: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/129.jpg)
Gene Therapy and Molecular Biology Vol 8, page 435
435
7. PPC-1 Prostate
cancer
8. TsuPr1 Prostate
cancer
9. PrEC Primary
prostate
epithelial
cells
1. U266 Myeloma
2. OCI-
My5
Myeloma
3. ANBL-6 Myeloma
4. K562 Leukemia
2001 Immunotherapy 1.
EMCV
2.
FMDV
1. IL-12p40
2.IL-12p35
3. CD80
1. Retrovirus
2. Adenovirus
5. Namalwa Myeloma
Human (Wen et al,
2001)
1. HSV-tk
2. IL-4
3. Neomycin1999 Tumor cell
vaccine
EMCV
4. phosphotransferase
Retrovirus 1. 9L Gliosarcoma Rat (Okada et al,
1999)
1. IL-2 1. Al72 Glioblastoma Human1998 Suicide and
immunomodula
ting gene
delivery
EMCV
2. HSV-tk
Retrovirus
2. AoU373 Astrocytoma Human(Pizzato et
al, 1998)
Preclinical Studies (Host-directed therapy)
1. NIH3T3 Fibroblast Mouse2001 Myeloprotecti
on
EMCV 1. ALDH-1 Retrovirus
2. Primary CD34+ cells Human
(Takebe et
al, 2001)
1. K562 Leukemia1999 Myeloprotecti
on and cell-
surface
marking
EMCV 1. MDR1
2. "LNGFR
Retrovirus
2. Primary CD34+ cells
Human (Hildinger et
al, 1999)
Year
published
Strategy/Aim
of Study
IRES
employed
Therapeutic/market/re
porter genes encoded
Vector Tumor type References
1. IL-21999 Suicide and
immunomodul
ating gene
delivery
EMCV
2. HSV-tk
Retrovirus Glioblastoma mulriforme (Palu et al,
1999)
ALDH-1 (aldehyde dehydrogenase), CAT (chioramphenicol acetyltransferase), F/S DHFR (doubly mutated dihydrofolate reductase),
GAL (beta-galactosidase), GFP (green fluorescent protein), HSV-TK (herpes simplex virus thymidine kinase), IL2 (interleukin 2), IL 12
(interleukin 12), "LNGFR (truncated human low-affinity nerve growth factor receptor), yCD (yeast cytosine deaminase)
Table 2. Known properties of some IRESs
IRES Properties Cell lines References
BCL-2 Reported to exhibit 3.4-fold greater activityfollowing 8h treatment with 80µM etoposide
compared to untreated cells.
1. 293T Embryonic kidney Human (Sherrill et al, 2004)
Cat-1 Reported to exhibit 7-fold greater activity
following 12h amino acid starvation compared to
fed cells.
Activity compared to the EMCV TRES unknown
1. C6 Glioma Rat (Fernandez et al, 2001)
Connexin43 Reported to exhibit 18-fold greater activity than
the EMCV IRES.
1. HeLa Cervical cancer Human (Schiavi et al, 1999)
DAP5 Reported to exhibit at least 2-fold greater activity
than the EMCV IRES following 48h etoposide
treatment.
1. 293T Embryonic kidney Human (Nevins et al, 2003)
1. KB-3- 1 Cervical cancer HumaneIF4G Reported to exhibit at least 200-fold greater
activity than the EMCV IRES 2. HepG2 Liver cancer Human
(Wong et al, 2002)
Gtx 9-nucleotides in length. 10 linked copies reported
to exhibit 63-fold greater activity than the EMCV
IRES.
1. N2a Neuroblastoma Mouse (Chappell et al, 2000)
HIF- 1! Activity maintained during hypoxia. Activity
compared to the EMCV IRES unknown.
1. NIH3T3 Fibroblast Mouse (Lang et al, 2002)
1. NB2a Neuroblastoma MouseReported to exhibit 5-7 fold greater activity than
the c-myc IRES. 2. SH-SY5Y Neuroblastoma Human
N-myc
3-fold greater activity compared to the EMCV
IRES.
3. HeLa Cervical cancer Human
(Jopling and Willis, 2001)
VEGF Activity maintained during hypoxia. Activity
compared to the EMCV IRES during hypoxia
unknown.
1. C6 Glioma Rat (Stein et al, 1998)
![Page 130: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/130.jpg)
Yan and Lee: Internal ribosome entry sites in cancer gene therapy
436
administration, the design of therapeutic regimes to exploit
this property, for example to augment cytotoxicity, is
conceivable.
D. SizeMost IRESs tend to be relatively large, and this may
limit the number of transgenes that can be incorporated
into a polycistronic vector. A 9-nucleotide long IRES
residing in the 5’UTR of the Gtx homeodomain RNA has
been reported (Chappell et al, 2000), and appears to
function in a modular fashion, such that multiple linked
copies increase the expression of the downstream cistron.
Besides the advantages of its small size, it also allows for
regulated expression of the downstream cistron by varying
the number of intercistronic modules.
VII. Current problems with IRESs in
gene therapyA traditional problem concerning the use of IRESs is
that expression levels of the gene downstream of the IRES
is often significantly lower than that of the upstream gene,
typically around 20-50% (Mizuguchi et al, 2000) in
bicistronic plasmid vectors in relation to the upstream
gene, and even lower in retroviral vectors (de Felipe,
2002). Another major stumbling block is the inconsistency
of gene expression depending on the composition and
arrangement of genes in the vector (Hennecke et al, 2001).
VIII. Future directions
The vast majority of cancers result from defects in
multiple pathways, and hence an effective gene
therapeutic approach will probably have to be multi-
pronged, requiring delivery of different transgenes that
target the different pathways. The studies detailed in
Table 1 have demonstrated proof of concept for
employing IRESs to effect the co-expression of multiple
genes in diverse fields of cancer gene therapy. As noted
above more information concerning the activity of various
IRESs in a tissue/cell-type, both in vivo and in vitro, is
required to facilitate decision-making in the choice of
IRES. It is envisaged that the incorporation of IRESs with
desirable properties will result in polycistronic vectors
with improved downstream gene expression, and
consequently result in enhanced clinical efficacy.
ReferencesBarzon L, Bonaguro R, Castagliuolo I, Chilosi M, Gnatta E,
Parolin C, Boscaro M, Palu G (2002) Transcriptionally
targeted retroviral vector for combined suicide and
immunomodulating gene therapy of thyroid cancer. J Clin
Endocrinol Metab 87, 5304-5311.
Berzofsky JA, Terabe M, Oh S, Belyakov IM, Ahlers JD, Janik
JE, Morris JC (2004) Progress on new vaccine strategies for
the immunotherapy and prevention of cancer. J Clin Invest
113, 1515-1525.
Buller RE, Runnebaum IB, Karlan BY, Horowitz JA, Shahin M,
Buekers T, Petrauskas S, Kreienberg R, Slamon D, Pegram
M (2002) A phase I/II trial of rAd/p53 (SCH 58500) gene
replacement in recurrent ovarian cancer. Cancer Gene Ther
9, 553-566.
Chappell SA, Edelman GM, Mauro VP (2000) A 9-nt segment of
a cellular mRNA can function as an internal ribosome entry
site (IRES) and when present in linked multiple copies
greatly enhances IRES activity. Proc Natl Acad Sci U S A
97, 1536-1541.
de Felipe P (2002) Polycistronic viral vectors. Curr Gene Ther
2, 355-378.
Emerman M, Temin HM (1984) Genes with promoters in
retrovirus vectors can be independently suppressed by an
epigenetic mechanism. Cell 39, 449-467.
Fernandez J, Yaman I, Mishra R, Merrick WC, Snider MD,
Lamers WH, Hatzoglou M (2001) Internal ribosome entry
site-mediated translation of a mammalian mRNA is regulated
by amino acid availability. J Biol Chem 276, 12285-12291.
Fuerer C, Iggo R (2004) 5-Fluorocytosine increases the toxicity
of Wnt-targeting replicating adenoviruses that express
cytosine deaminase as a late gene. Gene Ther 11, 142-151.
Gottesman MM (2003) Cancer gene therapy: an awkward
adolescence. Cancer Gene Ther 10, 501-508.
Hellen CU, Sarnow P (2001) Internal ribosome entry sites in
eukaryotic mRNA molecules. Genes Dev 15, 1593-1612.
Hennecke M, Kwissa M, Metzger K, Oumard A, Kroger A,
Schirmbeck R, Reimann J, Hauser H (2001) Composition
and arrangement of genes define the strength of IRES-driven
translation in bicistronic mRNAs. Nucleic Acids Res 29,
3327-3334.
Hermiston TW, Kuhn I (2002) Armed therapeutic viruses:
strategies and challenges to arming oncolytic viruses with
therapeutic genes. Cancer Gene Ther 9, 1022-1035.
Hildinger M, Schilz A, Eckert HG, Bohn W, Fehse B, Zander A,
Ostertag W, Baum C (1999) Bicistronic retroviral vectors for
combining myeloprotection with cell-surface marking. Gene
Ther 6, 1222-1230.
Jopling CL, Willis AE (2001) N-myc translation is initiated via
an internal ribosome entry segment that displays enhanced
activity in neuronal cells. Oncogene 20, 2664-2670.
Jounaidi Y, Waxman DJ (2004) Use of replication-conditional
adenovirus as a helper system to enhance delivery of P450
prodrug-activation genes for cancer therapy. Cancer Res 64,
292-303.
Kleinman HK, Liau G (2001) Gene therapy for antiangiogenesis.
J Natl Cancer Inst 93, 965-967.
Kuball J, Wen SF, Leissner J, Atkins D, Meinhardt P, Quijano E,
Engler H, Hutchins B, Maneval DC, Grace MJ, Fritz MA,
Storkel S, Thuroff JW, Huber C, Schuler M (2002)
Successful adenovirus-mediated wild-type p53 gene transfer
in patients with bladder cancer by intravesical vector
instillation. J Clin Oncol 20, 957-965.
Lang KJ, Kappel A, Goodall GJ (2002) Hypoxia-inducible
factor-1! mRNA contains an internal ribosome entry site that
allows efficient translation during normoxia and hypoxia.
Mol Biol Cell 13, 1792-1801.
McNeish IA, Bell SJ, Lemoine NR (2004) Gene therapy progress
and prospects: cancer gene therapy using tumour suppressor
genes. Gene Ther 11, 497-503.
Mizuguchi H, Xu Z, Ishii-Watabe A, Uchida E, Hayakawa T
(2000) IRES-dependent second gene expression is
significantly lower than cap-dependent first gene expression
in a bicistronic vector. Mol Ther 1, 376-382.
Nevins TA, Harder ZM, Korneluk RG, Holcik M (2003) Distinct
regulation of internal ribosome entry site-mediated
translation following cellular stress is mediated by apoptotic
fragments of eIF4G translation initiation factor family
members eIF4GI and p97/DAP5/NAT1. J Biol Chem 278,
3572-3579.
Ngoi SM, Chien AC, Lee CG (2004) Exploiting internal
ribosome entry sites in gene therapy vector design. Curr
Gene Ther 4, 15-31.
![Page 131: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/131.jpg)
Gene Therapy and Molecular Biology Vol 8, page 437
437
Okada H, Giezeman-Smits KM, Tahara H, Attanucci J, Fellows
WK, Lotze MT, Chambers WH, Bozik ME (1999) Effective
cytokine gene therapy against an intracranial glioma using a
retrovirally transduced IL-4 plus HSVtk tumor vaccine.
Gene Ther 6, 219-226.
Pagliaro LC, Keyhani A, Williams D, Woods D, Liu B, Perrotte
P, Slaton JW, Merritt JA, Grossman HB, Dinney CP (2003)
Repeated intravesical instillations of an adenoviral vector in
patients with locally advanced bladder cancer: a phase I
study of p53 gene therapy. J Clin Oncol 21, 2247-2253.
Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M,
Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A,
Colombo F (1999) Gene therapy of glioblastoma multiforme
via combined expression of suicide and cytokine genes: a
pilot study in humans. Gene Ther 6, 330-337.
Pelletier J, Sonenberg N (1988) Internal initiation of translation
of eukaryotic mRNA directed by a sequence derived from
poliovirus RNA. Nature 334, 320-325.
Pizzato M, Franchin E, Calvi P, Boschetto R, Colombo M,
Ferrini S, Palu G (1998) Production and characterization of a
bicistronic Moloney-based retroviral vector expressing
human interleukin 2 and herpes simplex virus thymidine
kinase for gene therapy of cancer. Gene Ther 5, 1003-1007.
Ponnazhagan S, Mahendra G, Kumar S, Shaw DR, Stockard CR,
Grizzle WE, Meleth S (2004) Adeno-associated virus 2-
mediated antiangiogenic cancer gene therapy: long-term
efficacy of a vector encoding angiostatin and endostatin over
vectors encoding a single factor. Cancer Res 64, 1781-1787.
Rivera AA, Wang M, Suzuki K, Uil TG, Krasnykh V, Curiel DT,
Nettelbeck DM (2004) Mode of transgene expression after
fusion to early or late viral genes of a conditionally
replicating adenovirus via an optimized internal ribosome
entry site in vitro and in vivo. Virology 320, 121-134.
Schiavi A, Hudder A, Werner R (1999) Connexin43 mRNA
contains a functional internal ribosome entry site. FEBS Lett
464, 118-122.
Schuler M, Herrmann R, De Greve JL, Stewart AK, Gatzemeier
U, Stewart DJ, Laufman L, Gralla R, Kuball J, Buhl R,
Heussel CP, Kommoss F, Perruchoud AP, Shepherd FA,
Fritz MA, Horowitz JA, Huber C, Rochlitz C (2001)
Adenovirus-mediated wild-type p53 gene transfer in patients
receiving chemotherapy for advanced non-small-cell lung
cancer: results of a multicenter phase II study. J Clin Oncol
19, 1750-1758.
Sherrill KW, Byrd MP, Van Eden ME, Lloyd RE (2004) BCL-2
translation is mediated via internal ribosome entry during cell
stress. J Biol Chem. 279, 29066-29074.
Soler MN, Milhaud G, Lekmine F, Treilhou-Lahille F,
Klatzmann D, Lausson S (1999) Treatment of medullary
thyroid carcinoma by combined expression of suicide and
interleukin-2 genes. Cancer Immunol Immunother 48, 91-
99.
Sorrentino BP (2002) Gene therapy to protect haematopoietic
cells from cytotoxic cancer drugs. Nat Rev Cancer 2 , 431-
441.
Stein I, Itin A, Einat P, Skaliter R, Grossman Z, Keshet E (1998)
Translation of vascular endothelial growth factor mRNA by
internal ribosome entry: implications for translation under
hypoxia. Mol Cell Biol 18, 3112-3119.
Stoneley M, Willis AE (2004) Cellular internal ribosome entry
segments: structures, trans-acting factors and regulation of
gene expression. Oncogene 23, 3200-3207.
Takebe N, Zhao SC, Adhikari D, Mineishi S, Sadelain M, Hilton
J, Colvin M, Banerjee D, Bertino JR (2001) Generation of
dual resistance to 4-hydroperoxycyclophosphamide and
methotrexate by retroviral transfer of the human aldehyde
dehydrogenase class 1 gene and a mutated dihydrofolate
reductase gene. Mol Ther 3, 88-96.
Voelkel-Johnson C, King DL, Norris JS (2002) Resistance of
prostate cancer cells to soluble TNF-related apoptosis-
inducing ligand (TRAIL/Apo2L) can be overcome by
doxorubicin or adenoviral delivery of full-length TRAIL.
Cancer Gene Ther 9, 164-172.
Waxman DJ, Schwartz PS (2003) Harnessing apoptosis for
improved anticancer gene therapy. Cancer Res 63, 8563-
8572.
Wen XY, Mandelbaum S, Li ZH, Hitt M, Graham FL, Hawley
TS, Hawley RG, Stewart AK (2001) Tricistronic viral
vectors co-expressing interleukin-12 (1L-12) and CD80 (B7-
1) for the immunotherapy of cancer: preclinical studies in
myeloma. Cancer Gene Ther 8, 361-370.
Wong ET, Ngoi SM, Lee CG (2002) Improved co-expression of
multiple genes in vectors containing internal ribosome entry
sites (IRESes) from human genes. Gene Ther 9, 337-344.
Zeimet AG, Marth C (2003) Why did p53 gene therapy fail in
ovarian cancer? Lancet Oncol 4, 415-422
Benedict J Yan Caroline GL Lee
![Page 132: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/132.jpg)
Yan and Lee: Internal ribosome entry sites in cancer gene therapy
438
![Page 133: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/133.jpg)
Gene Therapy and Molecular Biology Vol 8, page 439
439
Gene Ther Mol Biol Vol 8, 439-450, 2004
The pathway of uptake of SV40 pseudovirions
packaged in vitro: from MHC class I receptors to the
nucleusResearch Article
Chava Kimchi-Sarfaty1, Susan Garfield2, Nathan S. Alexander1, Saadia Ali1,
Carlos Cruz1, Dhanalakshmi Chinnasamy3, and Michael M. Gottesman1*1Laboratory of Cell Biology, 2Laboratory of Experimental Carcinogenesis, National Cancer Institute, National Institutes of
Health, Bethesda, Maryland 20892, USA3Vince Lombardi Gene Therapy Laboratory, Immunotherapy Program, St. Luke’s Medical Center, Milwaukee, WI 53215,
USA
__________________________________________________________________________________
*Correspondence: Michael M. Gottesman, M.D., Laboratory of Cell Biology, National Cancer Institute, NIH, 37 Convent Drive, Room
2108, Bethesda, MD 20892-4256, USA, Tel: (301) 496-1530; Fax: (301) 402-0450, Email: [email protected]
Key words: Gene delivery; SV40 in vitro packaging; pathway of SV40 pseudovirions; MHC I receptors
Abbreviations: 5-Aza-2’-deoxycytidine, (DAC); bovine albumin, (BSA); Brefeldin A, (BFA); central polypurine tract sequence,
(cPPT); central polypurine tract, (cPPT); cholera toxin, (CT); Dulbecco’s modified Eagle medium, (DMEM); elongation factor 1(EF1);
endoplasmic reticulum, (ER); enhanced green fluorescent protein, (EGFP); fetal bovine serum, (FBS); green fluorescent protein, (GFP);
multidrug resistance gene, (MDR1); nuclear extracts, (NE); nuclear localization sequences, (NLS); paraformaldehyde, (PFA);
phosphate-buffered saline, (PBS); pigment epithelium derived factor, (PEDF); polyethyleneimine, (PEI); polyethyleneglycol, (PEG);
Propidium iodide, (PI); Trichostatin A, (TSA); trichostatin A, (TSA)
Received: 14 October 2004; Revised: 27 October 2004
Accepted: 16 November 2004; electronically published: November 2004
Summary
SV40 vectors packaged in vitro are an efficient delivery system in vitro and in vivo using plasmids up to 17.7 kb, with
or without SV40 sequences. Using confocal microscopy, we followed the pathway of SV40 pseudovirions in human
lymphoblastoid cells, which are rich in MHC I receptors, using fluorescence-tagged DNA and an antibody against
the main capsid protein, VP1. The wild-type SV40 virus as well as the pseudovirions enter the cells after binding to
MHC I. However, the MHC I route is not the only way that SV40 pseudovirions enter cells. From the cell surface,
the vectors progress through the Golgi to the ER, where they are unpackaged. Only the reporter DNA proceeds to
the nucleus; VP1 remains at the ER. Results indicate that some of the reporter DNA, carried by these vectors, is
trapped in the ER. Delivery of DNA plasmids which harbor nuclear localization sequences, such as the enhancer of
wild-type SV40 or the cPPT sequence from the HIV-1 virus upstream from the GFP cDNA, did not improve GFP
expression. However, improved expression from the EGFP reporter gene carried by SV40 vectors was achieved
using the histone deacetylase inhibitor, TSA.
I. IntroductionPackaging of SV40 pseudovirions in vitro results in a
non-viral delivery system which satisfies the criteria for a
successful gene transfer system: high efficiency, short-
term expression with no integration, non-immunogenic,
and relatively safe (Kimchi-Sarfaty et al, 2004b). The
SV40 wild-type virus capsid is composed of three viral
proteins: VP1, VP2, and VP3 (Tooze, 1981). The SV40 in
vitro packaging system uses nuclear extracts from Sf9
cells, transduced with VP1 baculovirus, to form SV40
capsids around any reporter gene up to 17.7 kb in length.
The efficiency of the system is very high, as almost every
cell is transduced. The expression is transient, and
relatively low compared to retroviral transduction
(Kimchi-Sarfaty et al, 2003). SV40 pseudovirions can
deliver DNA plasmids to a variety of cell lines (non-
dividing as well as cycling cells), and appear to be non-
immunogenic. SV40 pseudovirion vectors very efficiently
deliver reporter genes such as green fluorescent protein
(GFP), ABC transporter genes such as the multidrug
resistance gene (MDR1), a suicide gene (the Pseudomonas
exotoxin) and antiangiogenic genes (the pigment
![Page 134: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/134.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
440
epithelium derived factor, PEDF) (Kimchi-Sarfaty et al,
2004b). Although the pseudovirions are an excellent
vehicle for gene transfer, it is important to understand how
DNA packaged in SV40 capsids is delivered to the nucleus
in order to improve expression levels.
The entry of wild-type SV40 is thought to begin with
the virus binding to major histocompatibility complex
class I molecules that cover the cell surface (Norkin,
2001). The virus then enters via caveolin-1-containing
vesicles, and is transported to the endoplasmic reticulum
(ER). This pathway is similar to that taken by cholera
toxin (CT), which enters the Golgi via caveolae and is then
transported to the ER (Norkin, 1999, 2001, 2002; Parton
and Lindsay, 1999). However, it is possible that this
pathway bypasses the Golgi (Pelkmans et al, 2001;
Pelkmans and Helenius, 2002). Tsai and colleagues
(2003) showed that wild-type SV40 enters the cell using
specific ganglioses as receptors. Most other viruses enter
through the clathrin-coated, pit-mediated endosomal
pathway. Viruses which enter cells by endocytosis
generally disassemble in endosomes, where the pH is low.
However, since the SV40 wild-type entry pathway does
not lead to endosomes (Colomar et al, 1993; Khalili and
Stoner, 2001), SV40 disassembly is not dependent on low
pH in the endosomal compartment. For a number of years
it was believed that SV40 virions enter the nucleus and
disassemble there, but more recently it has been shown
that disassembly occurs in the ER. However, most of the
SV40 wild-type DNA does not enter the nucleus (Parton
and Lindsay, 1999; Norkin, 1999, 2001; Khalili and
Stoner, 2001; Norkin et al, 2002; Pelkmans et al, 2001,
2002).
Some viral delivery systems overcome low efficiency
and expression using viral sequences which can target the
nucleus, such as nuclear localization sequences of wild-
type SV40 or the cPPT sequence from the HIV-1 virus. In
a non-viral delivery system, the addition of
polyethyleneimine (PEI) or polyethyleneglycol (PEG)
increased delivery, mostly through the cell membrane, but
also to the nucleus (Ross and Hui, 1999).
In this study, we examined the pathway of entry of
SV40 pseudovirions packaged in vitro in human
lymphoblastoid cells. We tested different stages of the
pathway to find the limiting step responsible for the
relatively low expression found with SV40 pseudovirions
for gene delivery. Our findings indicate that disassembly
of the pseudovirions is not the rate-limiting step for gene
expression. We suggest that two steps in the
pseudovirion’s pathway are rate-limiting: DNA is trapped
in the ER so that it does not reach the nucleus, and
inefficient transcription from the DNA histone complex.
II. Materials and methodsA. Cell lines and cell culture.45 cells, human lymphoblastoid cells with high levels of
MHC I, .221 cells, human lymphoblastoid cells with low MHC I
receptors, and K562 human erythroleukemia cells were
maintained in RPMI media (Invitrogen, Carlsbad, CA). HeLa
cells and the HeLa subclone, KB-3-1 (Akiyama et al, 1985),
were maintained in Dulbecco’s modified Eagle medium
(DMEM) (Invitrogen, Carlsbad, CA). Bone marrow stem cells
from Cambrex (East Rutherford, NJ) were plated in HMSGM
medium with 10% FBS from Cambrex, but were grown in
DMEM, and were a gift of Louis Scavo, NIDDK, NIH.
Mesenchymal stem cells from teeth were grown in !MEM
(Invitrogen) with 20% fetal bovine serum (FBS) and were a gift
of Pamela Robey, NIDCR, NIH. All other media were
supplemented with 10% FBS (Hyclone, Logan, UT), 5 mM L-
glutamine, 50 µg/ml penicillin, and 50 µg/ml streptomycin
(Quality Biological, Gaithersburg, MD). All cell lines were
cultured at 37°C, in 5% CO2.
B. Infection of Sf9 cells with baculovirus,
preparation of nuclear extracts (NE) from Sf9
cells, and preparation of in vitro packaging
vectorsInfecting Sf9 cells, preparing NE and preparing in vitro
packaging vectors were as previously described (Kimchi-Sarfaty
et al, 2002, 2003) .The nuclear extract contained VP1, one of the
four viral late proteins (VP1, VP2, VP3, and agno). Packaged
DNA in this study included the pEGFP-C1 construct (4.7Kb;
Clontech, Palo Alto, CA), the pLUC construct (6.7Kb, Gene
Therapy Systems, Inc., San Diego, CA), and pGeneGrip
Fluorescein/ Luciferase (Gene Grip) (6.7Kb; Gene Therapy
Systems, Inc., San Diego, CA). In vitro vector titers were
calculated to be 5 " 104-5 " 105 particles per 1 ml, using CMT4
cells as previously described (Sandalon et al, 1997). In all the
experiments empty capsids, DNA only, and non-transduced cells
were used as controls.
C. Construction of plasmid DNAs carrying
the SV40 enhancer element or the central
polypurine tract (cPPT) sequence of HIV-1 as a
nuclear localization signalTo compare the effectiveness of the SV40 enhancer
sequence in translocating the plasmid, we used the pVitro2-
GFP/LacZ (InvivoGen, San Diego, CA) plasmid encoding the
enhanced green fluorescent protein (EGFP) cDNA under
transcriptional control of a human ferritin heavy chain (hFerH)
promoter in which the 5’UTR had been replaced by the 5’ UTR
of mouse elongation factor 1(EF1). This plasmid also contained a
72 bp repeat from the SV40 enhancer upstream from the hFerH
promoter to enhance gene expression and nuclear localization of
plasmid DNA. For comparison, we constructed a plasmid with a
similar backbone but devoid of the SV40 enhancer (pVitrop2-
GFP#NLS). To construct pVitrop2-GFP#NLS, we deleted the
SV40 enhancer sequence by digesting the pVitro2-GFP/LacZ
vector plasmid with NotI/PacI restriction enzymes. The E.coli
origin of replication (pMB1 ori) released from the pVitro2-
GFP/LacZ plasmid during NotI/PacI digestion (as ~720 bp
PacI/PacI fragment) was reinserted into the vector by blunt end
ligation. To generate the plasmid containing cPPT, a 118-bp
fragment of the central polypurine tract was amplified from
plasmid pCMV#R 8.91 (Naldini et al, 1996) utilizing the primers
cPPT 5’(5’-GCGGGGATCCTTTTAAAAGAAAAGGGGGG-
3’) and cPPT 3’ (5’-GCGGAGATCTAAA
ATTTTGAATTTTTGTAATTTG-3’), digested with BamHI and
BglII, and inserted at the BamHI site upstream of the internal
CMV promoter used to drive the transcription of GFP cDNA in
the lentiviral vector plasmid pCS-CG (Miyoshi et al, 1998).
D. Transduction of .45, .221, and K562 cells
with in vitro-packaged vectors and transfection of
HeLa and KB-3-1 cells with Lipofectamine-PlusAt concentrations indicated in each figure, cells were
transduced in suspension with the in vitro-packaged SV40
![Page 135: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/135.jpg)
Gene Therapy and Molecular Biology Vol 8, page 441
441
vectors in 10 tubes (104 cells each) or in a 60 mm culture dish
(105 cells in each). The dishes were then placed on an orbital
shaker at a constant speed for 2.5 h (at 37°C, 5% CO2), after
which the infection was stopped by the addition of RPMI
medium supplemented as before (Invitrogen, Carlsbad, CA)
(Kimchi-Sarfaty et al, 2004a). Every in vitro packaging
transduction experiment was done 3-6 times, and all the results
were comparable. Control transfections of HeLa and KB-3-1
cells (Akiyama et al, 1985) with the plasmid DNAs using
lipofectamine-plus were done according to the protocol provided
by ‘Lipofectamine-Plus’ (Invitrogen, Carlsbad, CA) without
modification. Every transfection experiment was done 4-6 times,
each with a similar resulting pattern.
E. GFP and multidrug resistance (MDR1)
expression detectionThe GFP reporter gene that was used in this study was
EGFP-C1 from Clontech (Palo Alto, CA). Two to forty days
post-infection, 2 x 105 cells were washed and suspended in 200
µl phosphate-buffered saline (PBS) (Invitrogen, Carlsbad, CA),
0.1% bovine albumin (BSA) (Sigma-Aldrich, St. Louis, MO) at
4°C and analyzed by FACS (FL1) for GFP as previously
described (Cormack et al, 1996) or studied by confocal
microscopy (detailed in Collection of confocal images below).
pHaMDR1 plasmid DNA, 15.2 kb in size, carried the multidrug
resistance gene (MDR1). Detection of the MDR protein was done
using a specific cell surface monoclonal antibody, MRK16, as
described previously (Kimchi-Sarfaty et al, 2003).
F. Brefeldin A (BFA), 5-Aza-2’-deoxycytidine
(DAC), and Trichostatin A (TSA) treatments of
.45 human lymphoblastoid and HeLa cellsBFA, which inhibits transport into the ER from the Golgi,
was used at 0.5-2.5 µg/ml 24 hours and 2 hours prior to
transduction, at the same time as transduction, and 2 1/2 hours
after transduction, to determine whether the pathway of entry of
pseudovirions is exclusively through the ER. TSA was added to
cells at a concentration of 0.1, 1, 10, 100 and 1000 ng/ml prior to
transduction. 5-Aza-2’-deoxycytidine (DAC) (Sigma, St. Louis,
MO) was added to cells at a concentration of 1-10 µM 24-72
hours prior to transduction.
G. Preparation of cells for confocal imagingPrior to immunostaining and between each
immunostaining step, transduced cells were washed twice with
PBS (Invitrogen, Carlsbad, CA) supplemented with 0.1% BSA
(Sigma-Aldrich, St. Louis, MO). Transduced cells were first
fixed for 0.5 h with 4% paraformaldehyde (PFA) (Sigma-
Aldrich, St. Louis, MO) or with additional fixation for 0.5 h with
70% ethanol at room temperature. Ethanol fixation could not be
performed when it was necessary to observe GFP in cells. The
presence of MHC I was detected using FITC – Anti-Human HLA
– A,B,C (1:100, Becton, Dickinson, and Co., Franklin Lakes,
NJ). The Golgi was detected using monoclonal antibody, #G2404
(Sigma, St. Louis, MO). For ER staining, fixed cells at 37°C
were treated with 10% normal donkey serum (Sigma-Aldrich, St.
Louis, MO). Cells were then washed once with PBS / 0.1% BSA
and stained with a primary antibody (calregulin, goat, 1:100,
Santa Cruz Biotechnology, Inc., Santa Cruz, CA) against the
lumen endoplasmic reticulum (also called calreticulin). Primary
immunostaining was done with a polyclonal VP1 antiserum
(rabbit, 1:40) to detect the presence of the VP1 protein.
Following each primary immunostain, cells were washed and
incubated with an appropriate secondary immunostain. For VP1,
Alexa 568 (red) conjugated goat anti-rabbit IgG (Molecular
Probes, Inc., Eugene, OR) and for the ER or the Golgi antibodies,
Alexa 488 (green)-conjugated donkey anti-goat IgG (Molecular
Probes, Inc., Eugene) were used as secondary antibodies. All
secondary antibodies were used at a dilution of 1:250. In all
experiments, cells were stained using a secondary antibody alone
to determine non-specific staining. All serum, antiserum, and
antibody incubations were performed for 1 h at room
temperature. After the last antibody incubation, the cells were
washed with PBS/ 0.1% BSA as before, dropped onto lysine-
coated microscope slides (Erie Scientific Co., Portsmouth, NH),
and allowed to dry. Fluorescent mounting medium (DAKO
Corp., Carpinteria, CA) was then used to affix a glass coverslip
to the microscope slide, and the slides were stored in the absence
of light at 4°C.
H. Propidium iodide (PI) nuclear staining of
.45 and KB-3-1 cells for confocal imagingKB-3-1 cells were seeded on glass coverslips in wells of a
6-well plate, while .45 cells were grown in suspension in a T-25
flask. .45 cells were transduced with in vitro-packaged
pGeneGrip Fluorescein/Luciferase (pGeneGrip)
(GeneTherapySystems, San Diego, CA) DNA and KB-3-1 cells
(Akiyama, 1985) were lipo–transfected with the same construct
using the transduction protocols described above. Cells were
washed three times with PBS/ 0.1% BSA and then fixed with
70% ethanol for 15 minutes at -20°C. Cells were washed again
three times in PBS/ 0.1% BSA and then stained for 1 hour at
room temperature with 100 µl PI staining solution, which was
composed of 5 µl PI stock (100 µg/mL), 2 µl of RNAse
(10mg/ml), and 5 ml of PBS without Ca or Mg. Cells were then
washed three times with PBS/ 0.1% BSA. Coverslips with
KB-3-1 cells were dried, inverted, and mounted on lysine-coated
microscope slides. .45 cells were applied to slides as described
above.
I. Collection of confocal imagesConfocal fluorescent images were collected with a Bio-Rad
MRC 1024 confocal scan head mounted on a Nikon Optihot
microscope with a 60X planapochromat lens. Excitation at 488
nm and 568 nm was provided by a krypton-argon laser. Emission
filters of 598/40 and 522/32 were used for sequentially collecting
red and green fluorescence, respectively, in channel one and two
while phase contrast images of the same cell(s) were collected in
the third channel using a transmitted light detector. Z-sections
were taken at ~0.7 µm intervals at each wavelength, where
applicable, and after sequential excitation, red and green
fluorescent images of the same cell were merged for co-
localization using LaserSharp software (Bio-Rad, Hercules, CA),
and animation sequences were produced.
III. ResultsA. Entry of VP1 does not always correlate
with levels of MHC I receptorsIt has previously been shown that SV40 wild-type
binds MHC I receptors (Norkin, 1999). We investigated
whether the level of MHC I expression is a limiting factor
in gene expression in different cell lines, using the SV40-
based pseudovirion delivery system after in vitro
packaging. The results shown here, and our extensive
experience with other cell lines (data not shown), do not
demonstrate a direct correlation between MHC I levels
and GFP expression.
Four different cell lines expressing different levels of
MHC I (Figure 1, a,b,c,d left column) as detected by
FACS were tested for transduction using GFP DNA
![Page 136: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/136.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
442
encapsidated in VP1 (right column). We used one full
reaction of 660 µl (as defined by Kimchi-Sarfaty et al,
2004a), which saturates the cellular receptors (multiplicity
of infection of 0.5-5). This is the maximum volume of
pseudovirions enough to transduce cells without reducing
their viability. As can readily be seen, there was no
correlation between the levels of MHC I and GFP
expression (compare Figure 1, left and right columns).
Some cells with high MHC I levels (Figure 1d, left
column) had little or no GFP expression (Figure 1d, right
column), while other cells with low MHC I levels (Figure
1c, left column) showed strong GFP expression (Figure 1
c, right column).
To determine if the site of VP1 entry into cells is
coincident with the location of MHC I receptors, we
stained simultaneously for VP1 and MHC I in the human
lymphoblastoid cell line .45, which has high MHC I levels
(Figure 2). MHC I receptors appeared fairly uniformly
around the plasma membrane (panel b), but VP1 (panel a)
appeared in scattered locations around the membrane.
Some colocalization of VP1 and MHC I is seen (panel c),
but it is clear that the presence of MHC I (green
fluorescence) does not predict binding of VP1. A similar
phenomenon was observed in .221 stained cells although
less MHC I staining was observed, it was also not
colocalized with VP1 staining (data not shown).
All the experiments in this section were repeated 4
times, and each resulted in a similar pattern of staining.
Figure 1. Expression of major histocompatability complex I (MHC I) receptors and of Green Fluorescent Protein (GFP) using FACS
analysis in different cell lines. Cell lines were: H190 stem cells (a), .45 human lymphoblastoid cells (b), .221 human lymphoblastoid
cells (c), and Human Mesenchymal Stem Cells (d). Cells were tested for their MHC I receptor levels (grey) and background
fluorescence was detected using control antibody IGg2a (black) (left column). Expression studies of the EGFP-C1 reporter gene were
done using FACS two to four days after transduction (grey) (right column). All control cells, cells transduced with DNA only, mock-
transduction without reporter DNA, and untreated cells were tested for GFP expression in the same way as the experimental cells in all
the experiments described in this paper (black).
![Page 137: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/137.jpg)
Gene Therapy and Molecular Biology Vol 8, page 443
443
Figure 2. Expression of major histocompatability complex I (MHC I) receptors using confocal microscopy. Immediately after
transduction, cells for confocal analysis were fixed as described in the Materials and Methods section, and the following parallel
treatments were applied to cells: (1) VP1 polyclonal antibody staining with a secondary Texas Red antibody staining; (2) MHC I
antibody staining conjugated to a secondary FITC antibody; (3) VP1 polyclonal antibody staining with its secondary Texas Red
antibody, together with MHC I antibody staining conjugated to a secondary FITC antibody. No background was seen in secondary
antibody staining only. (a) .45 cell immunostained for SV40 VP1 using rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568-
conjugated (red) goat anti-rabbit IgG secondary antiserum. (b) .45 cells immunostained for MHC-I receptors using FITC-conjugated to
anti-human MHC-I (HLA-A, -B, -C). (c) Merge of panels a and b.
Figure 3. VP1 entry relative to Golgi apparatus in .45 cells. The following parallel treatments were applied to cells: (1) Same as in Fig.
2; (2) Monoclonal mouse anti-Golgi 58K protein antiserum staining, followed by a Alexa–488-conjugated (green) goat anti-mouse IgG
secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with monoclonal
mouse anti-Golgi 58K protein antiserum staining, with a Alexa–488-conjugated (green) goat anti-mouse IgG secondary antibody. No
background was seen in secondary antibody staining only. .45 cells were fixed and immunostained for SV40 VP1 capsid protein using
rabbit anti-SV40 polyclonal antiserum, followed by a Alexa-568-conjugated (red) goat anti-rabbit IgG secondary antiserum (a); then
cells were immunostained with monoclonal mouse anti-Golgi 58K protein antiserum, followed by a Alexa-488-conjugated (green) goat
anti-mouse IgG secondary antiserum (b). Panel c is a merge of panels a and b. Left top white arrow indicates Golgi staining only, Left
bottom white arrow indicates costaining of VP1 and Golgi and right white arrow indicate VP1 staining only. Scale bar, 5 µm.
B. Some of the VP1 capsid protein is
localized to the Golgi thirty minutes after
transduction.45 human lymphoblastoid cells (105 cells) were
transduced with in vitro-packaged GFP, and were
harvested immediately after transduction, and 10, 30, and
120 minutes later, as described in Materials and Methods.
Figure 3 demonstrates partial colocalization of VP1 and
the Golgi apparatus 30 minutes after transduction; some of
the VP1 (red) sites are costained with the Golgi (green)
and appear dark yellow (lower left arrow), while other
VP1 are not in the Golgi and appear red (right arrow).
Some of the Golgi staining is not covered by VP1 (upper
left arrow). The same pattern is seen at the other harvest
time-points full colocalization was not found. In 60% of
the cells there was no costaining of VP1 and the Golgi,
and in 40% there was some colocalization. All these
experiments were repeated five times with comparable
results.
C. Initial colocalization of VP1 with
calregulin, an ER marker, 30 minutes after
transductionThirty minutes after transduction, VP1 staining
appears throughout the cell, but not in the nucleus. To
verify the location of VP1 staining, .45 human
lymphoblastoid cells (105 cells) were transduced with in
vitro-packaged GFP, and were harvested immediately after
transduction, and at 10, 30, 120, and 240 minutes, 1, 2, 4,
and 7 days later, as described in Materials and Methods.
Figure 4 is a panel of Z sections of a cell seen via
confocal microscopy, as described in Materials and
Methods. We demonstrated that in 60% of the cells, 30
minutes after transduction, all VP1 (red) is colocalized to
![Page 138: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/138.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
444
Figure 4. Z stacks of sections of .45 cells stained for VP1 and ER. .45 cells were harvested and fixed at 30 minutes post-transduction
before immunostaining. The confocal microscope Z sections were collected at 0.3 µm intervals using sequential excitation for each
fluorophore. The following parallel treatments were applied to cells: (1) Same as in Fig. 2; (2) Monoclonal mouse ER lumen protein,
calregulin staining, against calreticulin, an ER membrane protein, followed by a Alexa–488-conjugated (green) donkey anti-goat IgG
secondary antiserum staining; (3) VP1 polyclonal antibody staining with its secondary Texas Red antibody, together with a monoclonal
ER lumen protein, calregulin, with a Alexa–488-conjugated (green) donkey anti-goat IgG secondary antiserum staining. No background
was seen with secondary antibody staining only.
the ER (green), where it appears as yellow. The same
phenomena is observed in the other 40% of the cells, but
later in the time course at the 120-minute time point, we
could observe green and yellow staining only. The same
pattern of full co-localization is seen at the other harvest
time-points beginning at 120 minutes. All these
experiments were repeated 6 times, and the results were all
similar.
D. EGFP expression is reduced in BFA-
treated cells transduced with SV40 in vitro-
packaged DNASince all VP1 was co-localized with calregulin to the
ER lumen, we wanted to determine whether VP1 transit
through the ER is essential for gene expression. This was
determined by blocking retrograde entry into the ER using
BFA, and monitoring the expression of EGFP delivered by
SV40 vectors. .45 cells were treated with different
concentrations of BFA (0.5-2.5 µg/ml) according to
Norkin and colleagues, (2002), 24, and 2 hours before
transduction, at the time of transduction, or at the end of
the transduction process, when fresh medium is added to
the cells. The effect of BFA treatment on GFP expression
was monitored in transduced cells at various time points
between 0-6 days post-transduction and compared with
that of BFA-untreated GFP-transduced cells. We found a
reduction in GFP expression in cells treated with 2.5
µg/ml BFA, but not a complete inhibition of GFP
expression. Even very high concentrations of BFA (25
µg/ml) did not completely inhibit GFP expression. A
concentration of 2.5 µg/ml led to a 50% reduction in GFP
expression on day one. However, 48 hours after
transduction, the reduction in GFP expression was less
than 20% compared to untreated cells. From day three
onward, decreasing the concentration of BFA (from 2.5
![Page 139: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/139.jpg)
Gene Therapy and Molecular Biology Vol 8, page 445
445
µg/ml to 0.6 µg/ml) actually increased the GFP expression
by 100% as compared to untreated cells (data not shown).
BFA experiments were repeated 6 times, and the results
were comparable in all experiments.
E. Dissociation of VP1 from fluorescent-
labeled DNA occurs in the ER 20 hours after
transduction.45 human lymphoblastoid cells (105 cells) were
transduced with SV40 vectors carrying fluorescent
pGeneGrip DNA and were harvested immediately after
transduction and at 2.5, 5.5, 10, 20, 30, 120, and 240
minutes, 1, 2, 4, and 7 days later, as described in Materials
and Methods. Several investigators (Oppenheim et al,
1986; Oppenheim and Peleg, 1989; Dalyot-Herman et al,
1999; Strayer, 1999, 2000; Strayer and Zern, 1999;
Kimchi-Sarfaty et al, 2002, 2003) have determined that all
types of SV40 delivery systems are able to deliver DNA
which is expressed in virtually all cells of many different
cell types that have been tested. In the present study, using
confocal microscopy to detect fluorescent-tagged DNA,
every .45 cell contains a label 3.5 hours after transduction.
These results clearly indicate that entry into cells is a very
efficient process using VP1 only for encapsidation in the
SV40-based delivery system.
Cells shown in Figure 5a are 5.5 hours post
transduction. The yellow staining clearly shows that VP1
(red) and the green Grip signal are co-localized, which
suggests that disassembly has not yet occurred at this time
point. However, 20 hours post-transduction (Figure 5b),
some of the red and the green staining is no longer co-
localized, which indicates that disassembly has occurred
and the DNA is no longer trapped within the VP1. 50
randomly chosen cells were examined thoroughly for each
time point.
F. Twenty hours post-transduction and
thereafter, Grip-DNA can be visualized in the
nucleusDoes disassociation of the DNA from VP1, starting
at 20 hours post-transduction, enable it to enter the
nucleus? .45 cells were harvested 2.5, 4, 5, 20, 24, 26, 28
hours after transduction. Grip-DNA and confocal sections
of cells were used to distinguish whether the green signal
was in the nucleus or just close to it. Figure 6a-c
demonstrates 3 stages of entry of the Grip-DNA into the
nucleus, taken from the animated movies, 4.5, 22.5, and 53
hours post-transduction. By 53 hours (Figure 6c), the
DNA (green) appears to be in the nucleus, stained with
propidium iodide (red).
We compared DNA entry into the nucleus using in
vitro-packaged SV40 pseudovirions and using a non-viral
delivery system Lipofectamine-Plus from Invitrogen.
Since lipofection of cells in suspension is not an efficient
process, we transfected KB-3-1 (HeLa) adherent cells. At
the same time points (4.5, 22.5, and 53 hours post-
transduction) we examined GeneGrip DNA entry to the
nucleus using lipofection as demonstrated in Figure 6d-f .
It is important to note that the only valid comparison
between the methods is the proportion of DNA in the
cytoplasm vs. in the nucleus, since the amount of DNA
used in the SV40 delivery system is approximately 103
lower compared to the Lipofectamine-Plus method. DNA
is delivered to the nucleus earlier using the Lipofectamine-
Plus delivery system. Based on our observation of 200
cells, 53 hours after transduction 59% of the DNA was
still located in the ER.
G. Neither nuclear localization sequences
(NLS) from SV40 wild-type, nor cPPT
sequences from the HIV-1 virus facilitated
DNA entry into the nucleus using the SV40
delivery systemPreviously it has been shown that an SV40 enhancer
comprised of a 72-base pair repeat could direct nuclear
localization of plasmids and allows the enhancement of
gene expression in a broad range of hosts (Dean, 1997,
1999; Vacik et al, 1999; Li et al, 2001). Similarly, the 188
bp central polypurine tract sequence (cPPT), a part of the
polymerase gene of HIV-1 virus, has been shown to
facilitate nuclear entry of HIV-1 preintegration complexes
in the context of wild-type HIV-1 virus as well as HIV-1-
based replication defective lentiviral vectors (Sirven et al,
2000; Zennou et al, 2000). To examine whether the
inclusion of these sequences could improve the nuclear
transfer of plasmid DNAs encapsidated in SV40
pseudovirions, we constructed plasmid DNAs encoding
Figure 5. VP1 and SV40 IVP-DNA
colocalization and disassembly in .45
cells. .45 cells transduced with IVP-
pGeneGrip (green), fixed and
immunostained for VP1 (red) at 5.5
hours post transduction (a) and at 20
hours post transduction (b).
![Page 140: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/140.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
446
Figure 6. pGeneGrip-DNA entry to the nucleus followed by PI staining. .45 cells transduced with SV40 IVP-pGeneGrip (panels a-c),
and KB-3-1 cells transduced with the same DNA using lipofectamine-plus (panels d-f) were fixed and immunostained at 5.5, 22.5, and
53 hours post-transduction. The nucleus is labeled with propidium iodide (PI).
the GFP reporter gene with an SV40 enhancer or HIV-1
cPPT sequences placed upstream of the promoter used to
drive transcription of GFP cDNA. We also constructed
identical plasmids without these sequences and used these
as controls for comparison.
A time course (1, 2, 3, 4, 5, and 6 days after
transduction) analysis of GFP expression from these two
constructs delivered to .45 cells by the SV40 system was
carried out using flow cytometry. As clearly seen in
Figure 7a (3 days post-transduction), there was no
detectable difference in GFP expression from constructs in
the presence or absence of the SV40 enhancer. As a
control, we compared the expression of GFP in HeLa and
KB-3-1 cells that were transfected with the same
constructs using Lipofectamine-Plus reagent and analyzed
at the same time points as before. Interestingly, in this
case, the plasmid carrying the SV40 enhancer sequence
clearly revealed higher GFP expression than that lacking
the NLS (Figure 7b – 4 days post transfection). Similar
experiments were carried out using two other GFP DNA
plasmids constructed with or without the cPPT sequence
from HIV-1 downstream to the GFP gene. As expected,
neither the in vitro-packaged SV40 vector (Figure 7c – 4
days after transduction), nor the transfection delivery
system carrying these DNA plasmids revealed any
differences in GFP expression over time (Figure 7d – 5
days post-transfection). These experiments were repeated
8 times, with similar results.
H. DNA histone acetylation, but not DNA
demethylation, promotes DNA expression via
SV40 in vitro vectorsIn order to increase gene expression, we treated .45
cells prior to transduction using the SV40 delivery system
with various concentrations of the DNA histone
deacetylase inhibitor, TSA. In order not to saturate the
cells, and to see the effect of TSA, only 2/3 of a
pseudovirion reaction (Kimchi-Sarfaty et al, 2004) was
used. Acetylation of histones allows DNA to be more
accessible to transcription factors by separating basic N-
termini of histones. This makes histone-DNA interaction
looser which results in gene activation. GFP expression
was monitored every day for 6 days. Expression was
higher starting 48 hours after transduction in treated cells.
An 8.6-fold increase in GFP expression (4.39 in cells
transduced with in vitro-packaged GFP as compared to
37.73 in cells treated with TSA and transduced with in
vitro-packaged GFP-median fluorescence intensity,
arbitrary units) was observed in cells treated with 10 ng/ml
6 days after transduction. A similar experiment using the
pHaMDR1 plasmid packaged in vitro revealed similar
results expression using the MRK16 monoclonal antibody
was 30% higher 48 hours post transduction after treating
the cells with 10 ng/ ml 24 prior to transduction.
TSA treatment (0.1, 1, 10 ng/ml) was used on KB-3-
1 and HeLa cells 24 hours prior to transfection with EGFP
using Lifofectamine-Plus reagent. Measuring 24 and 48
hours post transduction, we found that treatment with 0.1
and 1 ng/ml slightly increased GFP expression (1627.48 in
cells transduced with GFP as compared to 1968.52 in cells
treated with 0.1 ng/ml TSA and transduced with GFP-
median fluorescence intensity, arbitrary units), A higher
concentration of 10 ng/ml did not change GFP expression
level.
Treating cells with the DNA methylase inhibitor,
DAC which incorporates into the DNA in place of
cytosine but cannot be methylated, results in loss of DNA
methylation, and in some cases, gene reactivation. In
contrast to TSA treatment, treatment of cells with DAC
prior to transduction (24, 48, 72 hours prior to
![Page 141: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/141.jpg)
Gene Therapy and Molecular Biology Vol 8, page 447
447
Figure 7. GFP expression via Lipofectamine-Plus or SV40 delivery system using NLS sequences. (a) – .45 cells transduced with in vitro
packaged-EGFP-C1 plasmid DNA which carries the SV40 enhancer as NLS sequence (-__-), or with no NLS sequence (–––) 3 days
after transduction. Mock transduced cells are indicated with a solid line. (b) – HeLa cells transduced with GFP plasmid DNA which
carries the NLS sequence (-__-), or with no NLS (–––) sequence using lipofectamine-plus 4 days after transduction. Mock transduced
cells appear as a solid line . (c) – .45 cells transduced with in vitro packaged-GFP plasmid DNA which carries the HIV-1 cPPT sequence
(-__-), or with no cPPT (–––) sequence 4 days after transduction. Mock transduced cells appear as a solid line. Panel (d – HeLa cells
transduced with GFP plasmid DNA which carries the cPPT sequence (-__-), or with no cPPT (–––) sequence using lipofectamine-plus 5
days after transduction. Mock transduced cells appear as a solid line
.
transduction) at different concentrations (1-10 µM) did not
change the reporter gene expression (data not shown).
IV. DiscussionVectors which use the SV40 major capsid protein
VP1 can be used to package supercoiled plasmids up to
17.7 kb in size in vitro without an SV40 viral sequence
(Kimchi-Sarfaty et al, 2003). Previously we have shown
the high efficiency of delivery of SV40 pseudovirions, but
expression from in vitro encapsidated DNA is lower than
retroviral delivery systems (Kimchi-Sarfaty et al, 2003).
One of the aims of this work was to identify the limiting
step in the pathway of entry of SV40 pseudovirions in
order to improve expression of packaged DNA. Studying
the SV40 pseudovirion pathway in a human
lymphoblastoid cell line, we show here that the
pseudovirions colocalized to MHC I receptors as does the
wild-type SV40 virus, but a high level of MHC I is neither
necessary nor sufficient for entry. Over a period of several
hours, VP1 protein as well as packaged plasmid DNA
labeled with a fluorescent tag was detected by confocal
microscopy, and were shown to move from the surface of
the cell into the Golgi, eventually accumulating in the ER.
Initial disassembly of the packaged DNA from VP1 occurs
![Page 142: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/142.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
448
in the ER, with some of the tagged DNA appearing in or
near the nucleus 53 hours post transduction. No staining of
VP1 was observed within the nucleus. Trapping of some
of the DNA in the cytoplasm might explain the known
limitation in expression of in vitro packaged virions. To
overcome these limitations, we constructed GFP reporter
DNAs harboring the enhancer repeat of the SV40 early
promoter or the cPPT sequence from the HIV-1 virus, but
saw no effect on gene expression. However, GFP
expression was elevated when cells were treated with a
histone deacetylase inhibitor TSA prior to transduction.
A. Entry of pseudovirions into cellsThe efficiency of the entry of pseudovirions was
monitored here using a GRIP-fluorescent DNA, with
which we were able to demonstrate a fluorescent tag in
every cell. Wild-type SV40 utilizes MHC I as a receptor
(Norkin, 1999). Increased SV40 wild-type entry to cells
can be achieved by transfecting more MHC I molecules
into these cells (Breau et al, 1992). The results shown
here, and our extensive experience with other cell lines
(data not shown), do not demonstrate a direct correlation
between MHC I levels and GFP expression. These results
indicate that the MHC I level is not the limiting factor for
reporter gene expression using the SV40 in vitro
packaging delivery system. In some cell lines we found
high levels of MHC I receptors, but GFP expression was
low. These observations confirm our previous conclusions
about in vitro packaging, that enhancing MHC I receptor
levels in cells using interferon-$ does not enhance GFP
expression via the SV40 delivery system. Previously we
also measured MHC I receptors of .45 cells after multiple
pseudovirion transductions, and we found that even after
the third transduction, more than 60% of the cells still
express MHC I (unpublished data of the authors). We
speculate that other coreceptor(s) are needed for the entry
of the pseudovirions, and without these coreceptors even
high levels of MHC I are not sufficient for the entry of the
pseudovirions. SV40 vectors transit from the cell
membrane to the ER in .45 cells. However, blocking the
pathway to the ER did not completely inhibit GFP
expression, suggesting that alternative pathways are
available under these conditions.
B. The pathway of SV40 pseudovirions
from the ER to the nucleusThe process of DNA entry to the nucleus is slower
using the SV40 delivery system compared to transfection
using Lipofectamine-Plus, another type of non-viral gene
delivery. Godbey and colleagues (1999) used
poly(ethylenimine)/DNA complexes and showed that the
DNA initially appeared in the nucleus 4-5 hours post-
transfection. Similarly, our study showed that transfection
using lipids initially delivered the DNA to the nucleus 4.5
hours post-transduction. Using the SV40 system, the DNA
reporter plasmid appeared in the nucleus later, and a small
amount of DNA was localized in the nucleus 20 hours post
transduction. It was clear that most of the DNA did not
move to the nucleus, but was trapped in the ER. For mouse
polyomavirus, VP1 accumulates on nuclear membranes,
and its entry is not inhibited by BFA. The majority of the
polyomavirus viral DNA is also not delivered to the
nucleus, but moves back to the cytosol, and possibly
degrades (Mannova and Forstova, 2003). An earlier study
examining the pathway of the poly(ethylenimine)/DNA
complexes also revealed similar results: some of the DNA
was trapped in the cytoplasm and did not reach the nucleus
(Godbey et al, 1999).
C. The known NLS sequences, the
enhancer of SV40 wild-type virus and cPPT
sequence from lentivirus do not improve gene
expression using the SV40 pseudovirion
vectorsThe function of the nuclear membrane as a barrier
against macromolecules was described in the 1970s
(Dingwall and Laskey, 1992). However, according to
Whittaker and colleagues (2000), polyoma and papilloma
virus particles (up to 60 nm) are able to pass into the
nucleus. Previously, we have shown that the size of the
pseudovirions did not exceed 55 nm (while SV40 wild-
type is 45 nm). Therefore, it was surprising that we did not
find any VP1 staining within the nucleus.
NLS were used previously as peptides delivered in
trans to the DNA or in cis carried by the plasmid DNA
that needed to be delivered to the nucleus (Akuta et al,
2002). In the latter, fusion protein was expressed initially
in the cytosol, but moved to the nucleus under the
influence of the NLS. The enhancer repeat of the SV40
early promoter has been shown to increase the nuclear
transport of transfected plasmid DNAs and also enhance
the expression of transgenes in several cell types (Dean,
1997; Dean et al, 1999; Vacik et al, 1999; Li et al, 2001).
We could only detect a marked increase in GFP expression
when the same plasmid was tranfected into cells.
It has been shown that the SV40 enhancer contains
binding sites for several transcription factors. Several
cellular transcription factors have been demonstrated to
form nucleoprotein complexes after binding to their
specific DNA sequences in the SV40 enhancer. The DNA
sequences could interact with NLS receptors and enter the
nucleus using the normal nuclear protein import
machinery (Nigg, 1997). Other SV40 delivery systems
such as the one developed by Vera et al, (2004) always
imprint the NLS sequence of wild-type SV40. The failure
to obtain nuclear delivery of the plasmid DNA harboring
the SV40 enhancer using in vitro-packaged SV40 vectors,
and our success using a Lipofectamine-Plus delivery
system in the current study suggests that the NLS
sequences or binding sites of cellular transcriptional
factors in the SV40 enhancer might have been blocked or
inactive due to conformational changes when packaged in
the SV40 delivery system. Alternatively, we could
speculate that the cellular factor(s) necessary to facilitate
the SV40 enhancer-mediated nuclear transport is absent in
cell lines used in this study.
The cPPT sequence of HIV-1 virus pol gene virus
has been shown to increase nuclear transport of
preintegration DNA complexes formed after reverse
transcription of wild type HIV-1 genome or replication
![Page 143: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/143.jpg)
Gene Therapy and Molecular Biology Vol 8, page 449
449
defective HIV-1-based vectors in infected cells (Sirven et
al, 2000; Zennou et al, 2000). Although the nuclear
transport function of the cPPT sequence has been well
documented in the context of the wild type HIV-1 viral
infection or transduction with HIV-1-based vector
systems, its effectiveness in the context of plasmid DNA
delivery and/or gene expression has not been studied. Not
surprisingly, in the present study we were unable to detect
any differences in GFP expression when we used plasmid
DNA carrying or not carrying the cPPT sequence.
However, these results suggest that the SV40 system could
effectively package the HIV-1 based vectors and generate
pseudovirions capable of delivering the vector plasmid
into cells.
D. Inhibition of histone deacetylation
increases GFP expression delivered via SV40
pseudovirionsThese results led us to search for different ways to
increase the reporter gene expression via the SV40
delivery system. In this work, we show that inhibition of
histone deacetylation, but not DNA demethylation,
dramatically improves GFP expression delivered by the
SV40 in vitro packaging vectors. Treatment of cultured
cells with trichostatin A (TSA), a specific histone 4
deacetylase inhibitor, was shown to change gene
expression, probably by inducing hyperacetylation of
histones. Sowa and colleagues, (1997) and others
(Schuettengruber et al, 2003) demonstrated activation of
genes or gene promoters using TSA, but others (Siddiqui
et al, 2003) showed that TSA might repress transcription.
Treating other cell lines (KB-3-1 and HeLa) prior to
transduction using another delivery system-
Lipofectamine-Plus-produced only very slightly higher
GFP expression, as compared to delivery using the SV40
vectors. Therefore, we suggest that treatment with TSA
might not be a useful method to increase gene expression
for other delivery systems. White and Strayer, (2003)
found that DNA methylation can occur during SV40
production in the packaging cell line and this may explain
the relatively low expression of transgenes using other
SV40 virions for gene delivery. Our results, however,
indicated that inhibition of DNA methylation did not
increase transgene expression.
The SV40 in vitro packaging pathway characterized
in this study has many similarities to the wild-type
pathway. Both pathways are very efficient, both use MHC
I for entry, in both the virions are delivered to the ER, and
in both the efficiency of the delivery to the nucleus is not
very high. However, some differences were observed.
MHC I is not an exclusive pathway for the pseudovirions,
not all the pseudovirions travel through the Golgi, and a
large proportion of the reporter DNA is trapped in the ER.
Although we were not successful in improving the
efficiency of DNA delivery to the nucleus, blocking
acetylation of histone H4 appears to substantially increase
expression of DNA delivered by SV40 pseudovirions, and
this approach may prove useful in exploiting SV40-based
delivery systems.
AcknowledgmentsWe thank Ariella Oppenheim (The Hebrew
University, Hadassah Medical School and Hadassah
University Hospital, Jerusalem, Israel) for fruitful
collaboration on the SV40 vectors, and for providing us
the VP1, and VP2/3 polyclonal antibodies. We thank
Pamela Robey, and Sergei Kuznetsov, National Institutes
of Dental and Craniofacial Research, NIH, and Louis
Scavo, National Institute of Diabetes and Digestive and
Kidney Diseases, NIH for providing us with adult stem
cells, and George Leiman for insightful editorial
assistance.
ReferencesAkiyama S, Fojo A, Hanover JA, Pastan I, Gottesman MM
(1985) Isolation and genetic characterization of human KB
cell lines resistant to multiple drugs. Somat Cell Mol Genet
11, 117-126.
Akuta T, Eguchi A, Okuyama H, Senda T, Inokuchi H, Suzuki
Y, Nagoshi E, Mizuguchi H, Hayakawa T, Takeda K,
Hasegawa M, Nakanishi M (2002) Enhancement of phage-
mediated gene transfer by nuclear localization signal.
Biochem Biophys Res Commun 297, 779-786.
Breau WC, Atwood WJ, Norkin LC (1992) Class I major
histocompatibility proteins are an essential component of the
simian virus 40 receptor. J Virol 66, 2037-2045.
Colomar MC, Degoumois-Sahli C, Beard P (1993) Opening and
refolding of simian virus 40 and in vitro packaging of foreign
DNA. J Virol 67, 2779-2786.
Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized
mutants of the green fluorescent protein (GFP). Gene 173,
33-38.
Dalyot-Herman N, Rund D, Oppenheim A (1999) Expression of
beta-globin in primary erythroid progenitors of beta-
thalassemia patients using an SV40-based gene delivery
system. J Hematother Stem Cell Res 8, 593-599.
Dean DA (1997) Import of plasmid DNA into the nucleus is
sequence specific. Exp Cell Res 230, 293-302.
Dean DA, Dean BS, Muller S, Smith LC (1999) Sequence
requirements for plasmid nuclear import. Exp Cell Res 253,
713-722.
Dingwall C, Laskey R (1992) The nuclear membrane. Science
258, 942-947.
Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini, L (2000)
Gene transfer by lentiviral vectors is limited by nuclear
translocation and rescued by HIV-1 pol sequences. Nat
Genet 25, 217-222.
Godbey WT, Wu KK, Mikos AG (1999) Tracking the
intracellular path of poly(ethylenimine)/DNA complexes for
gene delivery. Proc Natl Acad Sci U S A 96, 5177-5181.
Khalili KAS, Stoner GL (2001) Human Polyomaviruses. New
York: Wiley-Liss, Inc.
Kimchi-Sarfaty C, Ben-Nun-Shaul O, Rund D, Oppenheim A,
Gottesman MM (2002) In Vitro-Packaged SV40
Pseudovirions as Highly Efficient Vectors for Gene Transfer.
Hum Gene Ther 13, 299-310.
Kimchi-Sarfaty C, Arora M, Sandalon Z, Oppenheim A,
Gottesman MM (2003) High cloning capacity of in vitro
packaged SV40 vectors with no SV40 virus sequences. Hum
Gene Ther 14, 167-177.
Kimchi-Sarfaty C, Alexander NS, Brittain S, Ali S, Gottesman
MM (2004a) Transduction of multiple cell types using
improved conditions for gene delivery and expression of
SV40 pseudovirions packaged in vitro. BioTechniques 37,
270-275.
![Page 144: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/144.jpg)
Kimchi-Sarfaty et al: In vitro-packaged SV40 vector pathway
450
Kimchi-Sarfaty C., Garfield, S., Alexander, N. S., Ali, S.,
Brittain, S., Cruz, C., Chinnasamy, D., and Gottesman, M.
M. (2004b) SV40 pseudovirions as highly efficient vectors
for gene transfer and their potential application in cancer
therapy. Curr Pharm Biotech 5, 451-458,
Li S, Maclaughlin FC, Fewell JG, Gondo M, Wang J, Nicol F,
Dean DA, Smith, LC (2001) Muscle-specific enhancement of
gene expression by incorporation of SV40 enhancer in the
expression plasmid. Gene Ther 8, 494-497.
Mannova P, Forstova J (2003) Mouse polyomavirus utilizes
recycling endosomes for a traffic pathway independent of
COPI vesicle transport. J Virol 77, 1672-1681.
Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM (1998)
Development of a self-inactivating lentivirus vector. J Virol
72, 8150-8157.
Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996)
Efficient transfer, integration, and sustained long-term
expression of the transgene in adult rat brains injected with a
lentiviral vector. Proc Natl Acad Sci U S A 93, 11382-
11388.
Nigg EA (1997) Nucleocytoplasmic transport: signals,
mechanisms and regulation. Nature 386, 779-787.
Norkin LC (1999) Simian virus 40 infection via MHC class I
molecules and caveolae. Immunol Rev 168, 13-22.
Norkin LC (2001) Caveolae in the uptake and targeting of
infectious agents and secreted toxins. Adv Drug Deliv Rev
49, 301-315.
Norkin LC, Anderson HA, Wolfrom SA, Oppenheim A (2002)
Caveolar endocytosis of simian virus 40 is followed by
brefeldin A-sensitive transport to the endoplasmic reticulum,
where the virus disassembles. J Virol 76, 5156-5166.
Oppenheim A, Peleg A, Fibach E, Rachmilewitz EA (1986)
Efficient introduction of plasmid DNA into human
hemopoietic cells by encapsidation in simian virus 40
pseudovirions. Proc Natl Acad Sci U S A 83, 6925-6929.
Oppenheim A, Peleg A (1989) Helpers for efficient
encapsidation of SV40 pseudovirions. Gene 77, 79-86.
Parton RG, Lindsay M (1999) Exploitation of major
histocompatibility complex class I molecules and caveolae
by simian virus 40. Immunol Rev 168, 23-31.
Pelkmans L, Kartenbeck J, Helenius A (2001) Caveolar
endocytosis of simian virus 40 reveals a new two-step
vesicular-transport pathway to the ER. Nat Cell Biol 3, 473-
483.
Pelkmans L, Helenius A (2002) Endocytosis via caveolae.
Traffic 3, 311-320.
Ross PC and Hui SW (1999) Polyethylene glycol enhances
lipoplex-cell association and lipofection, Biochim Biophys
Acta 1421, 273-83
Schuettengruber B, Simboeck E, Khier H, Seiser C (2003)
Autoregulation of mouse histone deacetylase 1 expression.
Mol Cell Biol 23, 6993-7004.
Siddiqui H, Solomon DA, Gunawardena RW, Wang Y, Knudsen
ES (2003) Histone deacetylation of RB-responsive
promoters: requisite for specific gene repression but
dispensable for cell cycle inhibition. Mol Cell Biol 23, 7719-
7731.
Sirven A, Pflumio F, Zennou V, Titeux M, Vainchenker W,
Coulombel L, Dubart-Kupperschmitt A, Charneau P, (2000)
The human immunodeficiency virus type-1 central DNA flap
is a crucial determinant for lentiviral vector nuclear import
and gene transduction of human hematopoietic stem cells.
Blood 96, 4103-4110.
Sowa Y, Orita T, Minamikawa S, Nakano K, Mizuno T, Nomura
H, Sakai, T (1997) Histone deacetylase inhibitor activates the
WAF1/Cip1 gene promoter through the Sp1 sites. Biochem
Biophys Res Commun 241, 142-150.
Strayer DS, Zern MA (1999) Gene delivery to the liver using
simian virus 40-derived vectors. Semin Liver Dis 19, 71-81.
Strayer DS (1999) Gene delivery to human hematopoietic
progenitor cells to address inherited defects in the erythroid
cellular lineage [editorial; comment]. J Hematother Stem
Cell Res 8, 573-574.
Strayer DS (2000) Effective gene transfer using viral vectors
based on SV40. Methods Mol Biol 133, 61-74.
Tsai B, Gilbert JM, Stehle T, Lencer W, Benjamin TL, Rapoport
TA (2003) Gangliosides are receptors for murine polyoma
virus and SV40. EMBO J 22, 4346-55.
Tooze J (1981) DNA Tumor Viruses. New York: Cold Spring
Harbor Laboratory.
Vacik J, Dean BS, Zimmer WE, Dean DA (1999) Cell-specific
nuclear import of plasmid DNA. Gene Ther 6, 1006-1014.
Vera M, Prieto J, Strayer DS, Fortes P (2004) Factors
Influencing the Production of Recombinant SV40 Vectors.
Mol Ther 10, 780-91.
White MK and Strayer DS (2003) DNA methylation modulates
expression of transgenes transduced by recombinant SV40
vectors. Molecular Therapy, Abstracts from the Sixth Annual
Meeting of the American Society of Gene Therapy, 7, S473.
Whittaker GR, Kann M, Helenius A (2000) Viral entry into the
nucleus. Annu Rev Cell Dev Biol 16, 627-651.
Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L,
Charneau P (2000) HIV-1 genome nuclear import is
mediated by a central DNA flap. Cell 101, 173-185.
Michael M. Gottesman
![Page 145: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/145.jpg)
Gene Therapy and Molecular Biology Vol 8, page 451
451
Gene Ther Mol Biol Vol 8, 451-464, 2004
The importance of PTHrP for cancer developmentReview Article
Jürgen DittmerUniversität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str. 40, 06097 Halle (Saale),
Germany
__________________________________________________________________________________
*Correspondence: Jürgen Dittmer, Universität Halle-Wittenberg, Universitätsklinik und Poliklinik für Gynäkologie, Ernst-Grube-Str.
40, 06097 Halle (Saale), Germany; Tel: +49-345-557-1338; Fax: +49-345-557-5261; e.mail: [email protected]
Key words : PTHrP for cancer development, cancer proliferation, invasion, metastasis, apoptosis, osteolysis, ets transcription factors,
regulating factors
Abbreviations: adenovirus protein E1A, (AdV E1A); adult T-cell leukemia/lymphoma, (ATLL); calcium-sensing receptor, (CaR);
cAMP-responsive element, (CRE); epidermal growth factor, (EGF)); extracellular matrix, (ECM); G-protein coupled receptors, (GPCR);
human T lymphotropic virus type I, (HTLV-I); hypercalcaemia of malignancy, (HHM); interleukin-6, (IL-6); nuclear localization
sequence, (NLS); parathyroid hormone 1 receptor, (PTH1R); parathyroid hormone, (PTH); Parathyroid hormone-related protein,
(PTHrP); protein kinase A, (PKA); protein kinase C, (PKC); receptor activator of NF-!B ligand, (RANKL); transforming growth factor
"2, (TGF"2); urokinase type plasminogen activator, (uPA); vascular smooth muscle, (VSM)
Received: 2 November 2004; Revised: 15 November 2004;
Accepted: 19 November 2004; electronically published: November 2004
Summary
Parathyroid hormone-related protein (PTHrP) is expressed by many cells and usually acts as an autocrine,
paracrine and/or intracrine factor to play numerous roles in embryonic development and normal physiology.
Evidence has been accumulated suggesting that PTHrP may also serve important functions in tumor development.
PTHrP has the potential to cause humoral hypercalcaemia of malignancy and is able to induce local osteolysis
which facilitates growth of tumor cells that have metastasized to bone. Furthermore, PTHrP has been shown to
stimulate proliferation as well as invasiveness of cancer cells and to protect cancer cells from apoptosis. In this
review, I summarize the current knowledge about the role of PTHrP in cancer development and about the factors
that control PTHrP expression in cancer.
I. Discovery of PTHrPPTHrP was originally discovered as a systemic
humoral factor that is released by tumor cells and causes
hypercalcaemia of malignancy (HHM) (Suva et al, 1987;
Wysolmerski and Broadus, 1994; Rankin et al, 1997; Grill
et al, 1998). The hypercalcaemic activity of PTHrP is
based on its partial homology to parathyroid hormone
(PTH) (Horiuchi et al, 1987; Kemp et al, 1987), a protein
that regulates calcium homeostasis. By being able to bind
to the parathyroid hormone 1 receptor (PTH1R) with equal
affinity as PTH (Juppner et al, 1991), PTHrP mimics PTH
action and stimulates cAMP production in bone and
kidney (Mannstadt et al, 1999). This results in bone
resorption and renal calcium retention eventually leading
to HHM.
It became clear that PTHrP is also expressed by non-
transformed cells in almost all tissues (dePapp and
Stewart, 1993) where it serves specific functions as an
autocrine or paracrine factor (Moseley and Gillespie;
1995, Philbrick et al, 1996; Strewler, 2000). In
embryogenesis, PTHrP plays an essential role in
mammary gland and bone development (Vortkamp et al,
1996, Wysolmerski et al, 1998). Disruption of the PTHrP
gene in mice leads to fatal skeletal dysplasia (Karaplis et
al, 1994; Karaplis and Deckelbaum, 1998). Rescued
PTHrP k.o. mice, carrying a transgenic PTHrP gene under
the control of a bone-specific promoter, lack mammary
epithelial ducts (Wysolmerski et al, 1998). The actions of
PTHrP in the developing bone and breast are paracrine in
nature and depend on PTH1R. In the developing bone,
PTHrP secreted from periarticular perichondrium activates
PTH1R on chondrocytes, thereby preventing premature
ossification (Vortkamp et al, 1996). In the developing
mammary gland, PTHrP from embryonic mammary
epithelial cells stimulates the mammary mesenchyme via
interaction with PTH1R to differentiate into mammary-
specific mesenchyme which then triggers ductal
morphogenesis (Dunbar et al, 1998).
II. The functional domains of PTHrPThe PTHrP transcripts are translated into three
different isoforms, PTHrP (-36/139), PTHrP (-36/141) and
![Page 146: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/146.jpg)
!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#(
!
!"#$%&'!()!!"#$%&'()*+',-$.+/,*'0$+%$ )"#$"&/,'$1!231$43+)#*'$,'.$*)0$ *')#3,()*+'$4,3)'#305$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$!:1$.#'+)#0$
4"+04"+3;-,)*+'$+%$!"3<=5$>>!>$0),'.0$%+3$3#0*.�$>#3??@A$>#3?BCA$!"3?BD$,'.$>#3?B<$,'.$EEEE$.#'+)#0$)"#*3$3#4-,(#/#')0$F;$,-,'*'#05$
G6H$ I$ (;(-*':.#4#'.#')$ J*',0#A$K1GL$I$K:43+)#*'$ (+&4-#.$ 3#(#4)+35$K3##'$ F,30$ 0"+M$ #9)#')*+'$ +%$ )"#$ 1!231$ 43+)#*'$ *'$ 04-*(*'7$
8,3*,')0$NBOP?Q?$,'.$NBOP?RB5$
$
$
1!231$ S:BOP?RBT$ S"#$%&'! (T5$ !"#;$ ,--$ (+'),*'$ )"#$ U:
)#3/*',-$ 0*7',-$ 0#V&#'(#$ %+3$ #')3,'(#$ *')+$ )"#$
#'.+4-,0/,)*($ 3#)*(&-&/$ ,'.$ )"#$ (+.*'7$ 3#7*+'$ F#)M##'$
3#0*.�$ ?$ ,'.$ ?B@$ SW,3)*'$ #)$ ,-A$ ?@@?X$ 1"*-F3*(J$ #)$ ,-A$
?@@OX$ >)3#M-#3A$ DCCCT5$ !"#$ %*30)$ ???$ ,/*'+$ ,(*.0$ +%$ )"#$
(+.*'7$3#7*+'$,3#$"*7"-;$(+'0#38#.$F#)M##'$/*(#A$3,)0$,'.$
"&/,'0$ 0&77#0)*'7$ )",)$ )"#;$ ,3#$ (3&(*,-$ %+3$ 1!231$
%&'()*+'5$ Y'$ (+')3,0)A$ )"#$ G:)#3/*'&0$ *0$ "*7"-;$ 8,3*,F-#5$
!"#$ *0+%+3/0$ 1!231$ S:BOP?Q?T$ ,'.$ )"#$ "&/,':04#(*%*($
1!231$S:BOP?RBT$43+.&()$%#,)&3#$#9)#'.#.$G:)#3/*'*5$!"#$
1!231$43+)#*'$*0$4+0):)3,'0-,)*+',--;$(-#,8#.$,)$,$'&/F#3$
+%$.*F,0*($0*)#0$ S6*#%#'F,(":Z,77#3$#)$,-A$?@@=X$6*)/#3$#)$
,-A$?@@OX$[&$#)$,-A$?@@OT$-#,.*'7$)+$)"#$3#/+8,-$+%$)"#$43#:
43+$ 0#V&#'(#$ F#)M##'$ NBO$ ,'.$ N?$ ,'.$ )+$ ,$ -*/*)#.$
%3,7/#'),)*+'$+%$)"#$43+)#*'5$!"#0#$%3,7/#')0$(+'),*'$+'#$
+3$/+3#$+%$)"#$)"3##$%&'()*+',-$.+/,*'0$M"*("$,3#$)"#$U:
)#3/*',-$S1!231$?:BOTA$)"#$/*.:3#7*+'$S1!231$B<:@QT$,'.$
)"#$G:)#3/*',-$.+/,*'$S1!231$?CR:?B@T5$
!"#$U:)#3/*',-$.+/,*'A$1!231$S?:BOTA$*0$3#04+'0*F-#$
%+3$)"#$1!2:-*J#$,()*8*);$+%$1!231$,'.$*0$,F-#$)+$F*'.$,'.$
,()*8,)#$ 1!2?L5$ E()*8,)*+'$ +%$ )"*0$ K:43+)#*'$ (+&4-#.$
3#(#4)+3$ SK1GLT$ -#,.0$ )+$ )"#$ 0)*/&-,)*+'$ +%$ )"#$ 43+)#*'$
J*',0#$E$S1HETA$43+)#*'$J*',0#$G$S1HGT$,'.P+3$(,-(*&/:
.#4#'.#')$4,)"M,;0$ SW,''0),.)$ #)$ ,-A$?@@@X$G,),*00+'$#)$
,-A$DCCCX$W,*+-*$,'.$\+3)*'+A$DCCQ,T5$$
W,';$+%$)"#$1!2?L:.#4#'.#')$1!231$#%%#()0$(,'$F#$
/*/*(J#.$F;$(EW1$*'.*(,)*'7$)",)$1HE$*0$,$/,]+3$),37#)$
+%$,()*8,)#.$1!2?L5$$
!"#$/*.:3#7*+'$.+/,*'$ *0$,F-#$ )+$#')#3$ )"#$'&(-#&05$
Y)$(+'),*'0$,$F*4,3)*)#$'&(-#,3$-+(,-*^,)*+'$0#V&#'(#$SU_>T$
(+'0*0)*'7$ +%$ 3#0*.�$ <<:@?$ ,'.$ ?CD:?CO$ SW,00%#-.#3$ #)$
,-A$?@@RT5$!"*0$0#V&#'(#$,-0+$,--+M0$1!231$)+$,((&/&-,)#$
*'$ )"#$ '&(-#+-&0$ S2#'.#30+'$ #)$ ,-A$ ?@@=T$ ,'.$ )+$ F*'.$ )+$
LUE$SE,3)0$#)$,-A$?@@@T5$U&(-#,3$),37#)*'7$(,'$F#$%&3)"#3$
,("*#8#.$ F;$ 3#0*.�$ OO:@Q$ M"*("$ *0$ 3#(+7'*^#.$ F;$
*/4+3)*'$!$S_,/$#)$,-A$?@@@,X$G*'7+-,'*$#)$,-A$DCCDT5$!"#$
/*.3#7*+'$ 0#V&#'(#$ ,-0+$ "+-.0$ ,$ G6H?S(.(DTPG6HD$
4"+04"+3;-,)*+'$ 0*)#$ S_,/$ #)$ ,-A$ ?@@@FT5$ \+--+M*'7$ *)0$
4"+04"+3;-,)*+'A$ 1!231$ *0$ 3#),*'#.$ *'$ )"#$ (;)+4-,0/$
0&77#0)*'7$)",)$)"#$,()*8*);$+%$'&(-#,3$1!231$*0$3#7&-,)#.$
F;$)"#$(#--$(;(-#5$$
!"#$ G:)#3/*',-$ .+/,*'A$ ,-0+$ (,--#.$ +0)#+0),)*'A$ *0$
,F-#$ )+$ *'"*F*)$ F+'#$ 3#0+34)*+'$ ,'.A$ )"#3#F;A$ ,'),7+'*^#0$
)"#$,()*+'$+%$ )"#$U:)#3/*',-$.+/,*'$+%$1!231$S\#')+'$#)$
,-A$ ?@@QX$ G+3'*0"$ #)$ ,-A$ ?@@RT5$ !"*0$ *'"*F*)+3;$ #%%#()$ +%$
+0)#+0),)*'$/,;$F#$ F,0#.$+'$ )"#$ ,F*-*);$+%$ )"*0$ 43+)#*'$ )+$
4";0*(,--;$*')#3,()$M*)"$!:E33#0)*'$SG+'-,'$#)$,-A$DCCDT5$!:
E33#0)*'0$ ,3#$ J'+M'$ )+$ 3#7&-,)#$ *')#3',-*^,)*+'$ ,'.$
.#0#'0*)*^,)*+'$ +%$ -*7,'.:0)*/&-,)#.$ K1GL0A$ 0&("$ ,0$
1!231:,()*8,)#.$ 1!2?L$ S\#33,3*$ #)$ ,-A$ ?@@@T5$ !"#$ G:
)#3/*',-$ .+/,*'$ ,-0+$ ",3F+30$ %+&3$ 4+)#')*,-$ ),37#)0$ %+3$
J*',0#0$,)$3#0*.�$??@A$?BCA$?BD$,'.$?B<$M"+0#$/&),)*+'$
%3+/$ ,$ 0#3*'#$ +3$ )"3#+'*'#$ )+$ ,'$ ,-,'*'#$ ,F3+7,)#.$ )"#$
/*)+7#'*($ ,()*8*);$ +%$ 1!231$ *'$ 8,0(&-,3$ 0/++)"$ /&0(-#$
(#--0$S\*,0("*:!,#0("$#)$,-A$DCCQT$
E'+)"#3$.+/,*'$0##/0$)+$F#$-+(,)#.$*'$)"#$#9)#'.#.$
G:)#3/*'&0$ +%$ )"#$ 1!231$ S:BOP?RBT$ )3,'0(3*4)*+',-$
43+.&()5$!"#$0#V&#'(#$F#)M##'$3#0*.�$?QC$,'.$?RB$",0$
F##'$ 0"+M'$ )+$ *')#3%#3#$ M*)"$ )"#$ '&(-#,3$ -+(,-*^,)*+'$ +%$
1!231$SK++/#3$#)$,-A$DCCCT$,'.$)+$3,*0#$)"#$(EW1$-#8#-$
S2,0)*'70$#)$,-A$DCCQT5$$
>;')"#0*^#.$ *'$)"#$#'.+4-,0/*($3#)*(&-&/A$1!231$*0$
,$ 0#(3#)+3;$ 43+)#*'$ M"*("$ '##.0$ )+$ *')#3,()$ M*)"$ 04#(*%*($
(#--$/#/F3,'#$3#(#4)+30$*'$+3.#3$)+$#9#3)$*)0$%&'()*+'5$>+$
%,3A$ +'#$ 0&("$ 3#(#4)+3A$ 1!2?LA$ ",0$ F##'$ *.#')*%*#.$ )",)$
3#(+7'*^#0$ )"#$1!231$U:)#3/*',-$.+/,*'5$L#(#4)+30$ )",)$
04#(*%*(,--;$*')#3,()$M*)"$+'#$+%$)"#$+)"#3$1!231$.+/,*'0$
/,;$ #9*0)$ ,0$ M#--5$ !"*0$ *0$ *'.*(,)#.$ F;$ )"#$ +F0#38,)*+'0$
)",)$ %3,7/#')0$ '+)$ (+'),*'*'7$ )"#$U:)#3/*',-$ .+/,*'$ ,3#$
43#0#')$+&)0*.#$+%$(#--0$S>+*%#3$#)$,-A$?@@DX$[&$#)$,-A$?@@OT$
,'.$)",)$)"+0#$%3,7/#')0$,3#$,F-#$)+$*')#3%#3#$M*)"$(#--&-,3$
%&'()*+'$M"#'$,..#.$#9+7#'+&0-;$SW,00%#-.#3$#)$,-A$?@@RX$
Q=D$
![Page 147: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/147.jpg)
Gene Therapy and Molecular Biology Vol 8, page 453
453
Luparello et al, 2001). In particular, the mid-regional
PTHrP (67-86) peptide, devoid of a functional NLS, has
been shown to mobilize calcium through a phospholipase
C-dependent pathway in squamous carcinoma cells (Orloff
et al, 1996). For NLS-containing mid-region fragments, an
intracrine way of action has been discussed. In order for
PTHrP to enter the nucleus, PTHrP is supposed to be
either synthesized directly in the cytosol or produced in
the endoplasmic reticulum and then re-translocated to the
cytosol (Fiaschi-Taesch and Stewart, 2003).
III. PTHrP and cancer growthThere is evidence that PTHrP has a tumor growth
effect. Mammary gland specific overexpression of PTHrP
led to a higher incidence of tumor formation in mice
(Wysolmerski et al, 2002). Also, a polymorphic PTHrP
variant is associated with increased incidence of skin
cancer in mice (Manenti et al, 2000). Furthermore, the
growth of rat pituitary cancer cells in the brain of rats was
found to be decreased upon treatment with anti-sense
oligonucleotides against PTHrP-RNA (Akino et al, 1996).
Similarly, the tumor volume formed by H-500 Leydig
cells inoculated into rats was reduced after PTHrP anti-
sense RNA had been administered to the animals (Rabbani
et al, 1995). And, treatment of tumor-bearing mice with
PTHrP-specific antibodies was shown to suppress growth
of human breast cancer metastasized to bone and renal
carcinoma injected into the skin (Guise et al, 1996;
Massfelder et al, 2004). Furthermore, PTHrP
overexpressing prostate cancer cells grew faster in
MatLyLu rats than control cancer cells (Dougherty et al,
1999) while, in athymic mice, the level of PTHrP
expression in human squamous cancer cells increased with
tumor growth (Yamato et al, 1995).
As for the value of PTHrP as a prognostic marker for
cancer, especially for breast cancer, the data are
conflicting. On the one hand, a study of Martin and
collegues showed that, in a cohort of 367 breast cancer
patients, immunoreactivity against N-terminal PTHrP in
paraffin sections of the primary tumor tissues correlated
with improved survival (Henderson et al, 2001). In
contrast, Linforth et al reported that, in a cohort of 176
breast cancer patients, positive immunohistochemical
staining for N-terminal PTHrP in primary tumors was
associated with a reduced disease-free survival (Linforth
et al, 2002). In the same study, it was shown that the RNA
level of PTH1R correlated with a decreased survival as
well and, interestingly, that co-expression of PTHrP with
its receptor predicted the worst clinical outcome. In
another study including 177 breast cancer patients,
tumoral PTHrP protein expression was found to be a
marker of poor prognosis (Yoshida et al, 2000). The
reason for the discrepancy between the outcomes of these
studies is not yet known. In other human cancers, PTHrP
expression seems to correlate with advanced disease. E.g.,
a study on a cohort of 108 colorectal tumor patients
showed that positive staining for PTHrP in the tumor was
associated with an increased incidence of lymph nodes and
liver metastasis (Nishihara et al, 1999). Increased PTHrP
serum levels in cancer patients were also found to
correlate with increased mortality (Hiraki et al, 2002;
Truong et al, 2003).
IV. PTHrP and metastasisIt is generally accepted that PTHrP plays a role in
bone metastasis. By inducing local osteolysis PTHrP
facilitates growth of osteotropic tumors, such as breast
cancer, in the dense bony tissue (Goltzman et al, 2000;
Guise, 1997; Kakonen and Mundy, 2003). PTHrP triggers
osteolysis by stimulating osteoblasts to produce
osteoclastogenesis-activating factors, such as receptor
activator of NF-!B ligand (RANKL) or interleukin-11
(Morgan et al, 2004; Thomas et al, 1999). However,
PTHrP does not appear to directly interfere with the
metastastic potential of tumor cells, at least not in mice
(Wysolmerski et al, 2002).
The importance of PTHrP for bone metastasis has
been demonstrated by a number of studies. A correlation
between PTHrP expression and formation of bone
metastasis was shown for breast and lung cancer cell lines
in nude mice (Guise et al, 1996; Miki et al, 2000).
Moreover, colonialization of bone tissue by MDA-MB-
231 breast cancer cells could be inhibited in nude mice by
PTHrP-specific antibodies (Guise et al, 1996). Similarly,
the formation of bone metastases, but not metastases in
other organs by SBC-5 small-lung cancer cells could be
reduced by anti-PTHrP antibodies in immuno-
compromised SCID mice (Miki et al, 2004). The
propensity of metastastic tumors in bone to express PTHrP
could further been shown for human breast cancer: the
highest frequency of PTHrP expression (73-92%) was
found in bone metastatic lesions, whereas only a minority
(17-20%) of breast cancer metastases at non-bone sites
produced PTHrP (Powell et al, 1991; Vargas et al, 1992).
PTHrP induces osteolysis in cooperation with other
factors, such as TGF" (Yin et al, 1999). TGF", a factor
that can either inhibit or promote tumor growth (Blobe et
al, 2000; Roberts and Wakefield, 2003), is present in the
bone matrix and is activated upon PTHrP-induced
osteolysis. The activation of TGF" initiates a vicious cycle
as active TGF" stimulates MDA-MB-231 cells to produce
more PTHrP. This, in turn, leads to more osteolysis and,
thus, higher levels of activated TGF" (Yin et al, 1999).
Another study compared the features of bone-seeking and
brain-seeking MDA-MB-231 sublines. The brain-seeking
subline expressed less PTHrP than the bone-seeking one
and also showed a much higher sensitivity to the growth-
inhibitory activity of TGF" (Yoneda et al, 2001). The
latter feature may have precluded survival of the brain-
seeking subline in the TGF"-rich environment of the bone.
Another support for a link between PTHrP and bone
metastasis comes from two studies with MCF-7 breast
cancer cells. Both down- and upregulation of the
endogenous PTHrP production interfered with the ability
of this cell line to form metastasic lesions in the bone
(Kitazawa and Kitazawa, 2002; Thomas et al, 1999).
In addition to TGF", also interleukin-6, tumor
necrosis factor # or transforming growth factor #, have
been shown to be able to enhance the bone destructive
effect of PTHrP (de la Mata et al, 1995; Guise et al, 1993;
![Page 148: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/148.jpg)
Dittmer: Importance of PTHrP for cancer development
454
Tumber et al, 2001; Uy et al, 1997). In some cases, PTHrP
may not be the major factor that facilitates colonialization
of breast cancer cells in the bone. Prostaglandine E2,
interleukin-6 and interleukin-8 may well substitute for
PTHrP (Bendre et al, 2003; Martin, 2002). E.g.,
interleukin-8 has been shown to mediate osteolysis of the
highly metastatic MDA-MET cell line that produces less
PTHrP, but higher amounts of interleukin-8 than the
MDA-MB-231 parental cell line (Bendre et al, 2002). On
the other hand, PTHrP and interleukin-8 expression may
be connected. This was shown for prostate cancer cells,
where PTHrP increased interleukin-8 production via its
intracrine pathway (Gujral et al, 2001). In contrast to
PTHrP, interleukin-8 can directly activate osteoclast
formation.
V. Biological effects of PTHrP on
cancer cellsNumerous studies have been conducted to analyze
the impact of PTHrP on proliferation, invasiveness and
resistance to apoptosis, biological activities that are crucial
for survival and growth of cancer cells. The results of
these studies are discussed below.
A. PTHrP and cancer proliferationDuring murine endochondrial ossification PTHrP
serves an important function by preventing chondrocytes
to prematurely differentiate into hypertrophic cells
(Vortkamp et al, 1996). In a positive feedback loop,
prehypertrophic chondrocytes secrete Indian hedgehog
(Ihh) that, by activating transforming growth factor "2
(TGF"2) (Alvarez et al, 2002), stimulates the periarticular
perichondrium to produce PTHrP (Vortkamp et al, 1996;
Karp et al, 2000; Kobayashi et al, 2002). PTHrP, in turn,
induces proliferation of the chondrocytes by interacting
with PTH1R. The activated receptor induces a decline in
the expression of cell cycle inhibitor p57kip2 (MacLean et
al, 2004) and an increase in the production of cyclin D1
(Beier et al, 2001). This well-studied example shows that
PTHrP can play a role in the regulation of the cell cycle.
This notion is further supported by a detailed study on
keratinocytes showing that PTHrP expression increases
when cells in G1-Phase enter S-Phase, an event that is
accompanied by relocation of PTHrP from the nucleolus
to the cytoplasm (Lam et al, 1997). Strikingly, PTHrP
expression in squamous cancer cells is constantly high
throughout the cell cycle (Lam et al, 1997) suggesting that
PTHrP expression becomes dysregulated in the course of
carcinogenesis.
1.Autocrine actions via PTH1RThere are a number of reports suggesting that PTHrP
may contribute to the high proliferative activity of cancer
cells. One report demonstrated that, in breast cancer,
PTH1R expression correlates well with the expression of
the proliferation marker Ki67 (Downey et al, 1997). In
another study, the mitogenic effect of PTHrP on MCF-7
breast cancer cells was found to be increased when
PTH1R was overexpressed (Hoey et al, 2003). In a third
study using the same cell line, the PTH1R ligand PTHrP
(1-34) alone could induce proliferation, which was
accompanied by an increase in the intracellular cAMP
level (Birch et al, 1995). The same peptide was also shown
to be able to stimulate growth of PC-3 and LnCaP prostate
cancer cells (Asadi et al, 2001) as well as of lung
squamous BEN-57 cancer cells (Burton and Knight,
1992). In the latter case, the effect of PTHrP (1-34) could
be reversed by addition of a PTHrP antibody.
Furthermore, proliferation of clear cell renal carcinoma in
nude mice could be equally inhibited by antibodies against
PTHrP or by a PTH1R antagonist (Massfelder et al, 2004).
These examples show that cancer cells can use the
PTHrP/PTH1R interaction to stimulate their own
proliferative activity.
2. Intracrine actionsSome reports also show anti-proliferative effects of
PTHrP on MCF-7 breast cancer and vascular smooth
muscle (VSM) cells (Massfelder et al, 1997; Falzon and
Du, 2000; Luparello et al, 2001; Pasquini et al, 2002).
Interestingly, in two of these cases, the anti-proliferative
activity of PTHrP was only observed when PTHrP
peptides (1-34, 1-36, 1-86, 1-108, 1-139, 1-141) were
exogenously administered to the cells (Massfelder et al,
1997; Falzon and Du, 2000). When PTHrP (1-139) was
transfected into the cells instead, proliferation was
increased (Massfelder et al, 1997; Falzon and Du, 2000;
Tovar Sepulveda et al, 2002). This mitogenic effect
required the integrity of the NLS suggesting that here the
mitogenic activity of PTHrP was entirely dependent on the
intracrine nuclear pathway of PTHrP. In VSM cells, the
mitogenic effect of PTHrP via the intracrine pathway was
also dependent upon three serines and one threonine
residues between positions 119 and 138 of the C-terminus
(Fiaschi-Taesch et al, 2004) suggesting that certain
phosphorylation events are essential for this PTHrP
activity.
The results by Falzon and Du (2000) showing an
anti-proliferative effect of the PTHrP (1-34) peptide on
MCF-7 breast cancer cells contradict the data obtained by
two other groups demonstrating a mitogenic effect of the
same peptide on these cells (Birch et al, 1995; Hoey et al,
2003) This discrepancy may be explained by the genetic
variability in MCF-7 sublines (Nugoli et al, 2003). In
different MCF-7 sublines, PTH1R may activate PKA,
PKC and the Ca2+ pathway to a different extent which may
lead to different proliferative activities (Maioli and
Fortino, 2004b). Alternatively, the PKA/cAMP pathway
may have different effects on proliferation in different
MCF-7 sublines. It is noteworthy in this respect that B-Raf
is able to convert cAMP from an anti-mitogenic to a
mitogenic factor (Fujita et al, 2002).
Overall, PTHrP seems to predominantly act as a
mitogenic factor on cancer cells. However, under certain
conditions (certain type of tumor, certain features of the
individual cell clone, the particular way PTHrP was
administered) PTHrP may also inhibit proliferation. How
easily PTHrP can switch from a mitogenic to an anti-
mitogenic agent is nicely demonstrated for a C-terminal
PTHrP peptide (Whitfield et al, 1992). This peptide was
found to inhibit proliferation of dividing keratinocytes, yet
![Page 149: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/149.jpg)
Gene Therapy and Molecular Biology Vol 8, page 455
455
it was shown to trigger cell cycle entrance of quiescent
cells.
B. PTHrP and invasionInvasive behavior is a hallmark of metastasizing
cancer cells. For the acquisition of an invasive phenotype,
cancer cells need to coordinate the interaction of many
proteins involved in adhesion, migration and proteolysis of
the extracellular matrix (ECM) (Price et al, 1997). PTHrP
has been found to interfere with the expression of some of
those proteins. In MCF-7 breast cancer cells and PC3
prostate cancer cells, overproduction of PTHrP induced
the expression of a number of integrins, in particular
integrins #6 and "4 (Shen and Falzon, 2003; Shen et al,
2004). Elevated levels of these integrins correlated with an
enhanced ability of PTHrP-treated MCF-7 cells to migrate
on the integrin #6/"4 ligand laminin and to invade
extracellular matrix. Integrin #6/"4 has also been shown
to increase invasiveness of MDA-MB-435 breast cancer
cells (Shaw et al, 1997). Modulation of invasiveness and
integrin expression by PTHrP in PC-3 and MCF-7 cells
required the integrity of the PTHrP-NLS suggesting that
PTHrP regulates invasiveness in these cells through the
intracrine pathway.
Effects of PTHrP on cellular invasiveness and on
proteins involved in this process were also observed when
PTHrP peptides were added exogenously. Administered to
chondrocytes, PTHrP (1-141) and (1-84) peptides induced
an increased expression of matrix metalloproteases
MMP2, MMP3 and MMP9 (Kawashima-Ohya et al,
1998). Added to 8701-BC breast cancer cells, the PTHrP
(67-86) peptide increased invasion and, at the same time,
upregulated urokinase type plasminogen activator (uPA)
(Luparello et al, 2003). This serine protease is involved in
cancer mediated ECM degradation (Price et al, 1997) and
has prognostic value for the survival of breast cancer
patients (Harbeck et al, 2002). On the other hand, PTHrP
(38-94) was found to reduce the ECM degrading activities
of a number of breast cancer cell lines (Luparello et al,
2001).
A single-nucleotide polymorphism in the C-terminal
region of the murine PTHrP revealed that also the C-
terminal part of PTHrP is important for invasion. Mice
carrying the PthlhPro allele at amino acid 130 of the mature
protein showed a higher susceptibility to skin
tumorigenesis than mice harboring the PthlhThr allele
(Manenti et al, 2000). When transfected into the human
squamous cell carcinoma line NCI-H520, PthlhPro
conferred to these cells a much greater ability to migrate
than PthlhThr (Benelli et al, 2003).
C. PTHrP and apoptosisEscaping apoptosis enables tumor cells to survive
and proceed in the neoplastic process (Naik et al, 1996).
By interfering with the apoptotic machinery, PTHrP may
contribute to this important step in carcinogenesis.
Overexpression of rat PTHrP rendered chondrocytes
resistant to serum starvation-induced apoptosis
(Henderson et al, 1995). Similarly, ectopic expression of
PTHrP (-5/139) protected MCF-7 breast cancer cells from
apoptosis which was accompanied by a rise in the
expression of anti-apoptotic proteins Bcl-2 and Bcl-xL
(Tovar Sepulveda et al, 2002). In both cases, the anti-
apoptotic PTHrP effect was mediated by the nuclear
pathway of PTHrP. Also exogenous PTHrP peptides are
potent anti-apoptotic factors. Treatment of chondrocytes
with PTHrP (1-37) stimulated the expression of Bcl-2 in a
PKA-dependent manner (Amling et al, 1997). PTHrP (1-
34) and PTHrP (140-173), but not PTHrP (38-64), PTHrP
(67-86) or PTHrP (107-139), were shown to protect lung
cancer cells from UV-induced caspase 3 activation and
apoptosis (Hastings et al, 2003). PTHrP (140-173) also
prevented Fas-dependent apoptosis in these cells. Both
PTHrP (1-37) and PTHrP (140-173) exerted their anti-
apoptotic effects by activating PKA (Amling et al, 1997,
Hastings et al, 2004). PTH1R-interacting peptides, namely
PTH (1-34), can also promote apoptosis. This was
demonstrated for confluent PTH1R-expressing
mesenchymal stem cells (Chen et al, 2002). Interestingly,
at lower cell density, the same peptide induced the inverse
effect. Both effects were dependent upon cAMP
demonstrating again the dual character of the cAMP
signaling system. Also Ca2+ can be involved in pro-
apoptotic effects of PTH1R ligands, as was found for the
apoptosis-inducing PTH effect on PTH1R overexpressing
human embryonal kidney 293 cells (Turner et al, 2000).
VI. Regulation of PTHrP expression
in cancerGiven the evidence that links PTHrP expression to
cancer progression, it is important to understand the
mechanism(s) by which PTHrP is(are) regulated in cancer
cells. PTHrP expression is mainly regulated on the
transcriptional level (Inoue et al, 1993; Wysolmerski et al,
1996; Falzon, 1997; Lindemann et al, 2001). In humans,
transcription of the PTHrP gene can be driven by three
different promoters, P1, P2 and P3 (Figure 2). Of these
promoters, the distal (P1) and proximal promoters (P3)
were identified first (Suva et al, 1989; Mangin et al, 1990)
and subsequently called P1 and P2, respectively. Later,
when a third GC-rich promoter was found inbetween P1
and P2 (Vasavada et al, 1993), the GC-rich promoter
became P2 and the proximal was renamed P3. The PTHrP
transcripts that are generated by each promoter can easily
be distinguished by certain non-coding exons that they
specifically contain (Southby et al, 1995; Lindemann et al,
2001). This allows to assess the contribution of each
promoter to the PTHrP expression in a given cell
population. In solid cancers, the P3 promoter was found to
be always active (Southby et al, 1995) and to increase its
activity when breast cancers metastasize (Bouizar et al,
1999).
A. Regulation by Ets transcription factorsOne of the first proteins that have been shown to
activate the P3 promoter was HTLV-I Tax1 (Dittmer et al,
1993). HTLV-I Tax1 is a unique viral protein encoded by
the human T lymphotropic virus type I (HTLV-I) that
causes adult T-cell leukemia/lymphoma (ATLL)
(Franchini, 1995). In almost all ATLL patients, the PTHrP
![Page 150: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/150.jpg)
!"##$%&'()$*+&#,-.%(+/(012&0(/+&(.,-.%&(3%4%5+*$%-#(
!
!!
"#$%&'!*)!`37,'*^,)*+'$+%$)"#$"&/,'$1!231$7#'#5$!"#$/,7'*%*#.$,3#,$0"+M0$)"#$/,]+3$%&'()*+',-$#-#/#')0$+%$)"#$1!231$1B$43+/+)#3$
,'.$)"#$)3,'0(3*4)*+'$%,()+30$)",)$",8#$F##'$0"+M'$)+$*')#3,()$M*)"$)"#0#$6UE$0#V&#'(#05$!"#$;#--+M$F,30$*'.*(,)#$M"*("$6UE$F*'.*'7$
/+)*%P8#0$*0P,3#$#00#')*,-$%+3$3#7&-,)*+'$+%$)"#$1B$43+/+)#3$F;$!K\!A$2!_a:Y$!,9A$3#)*'+*($,(*.A$4"+3F+-$#0)#3A$,.#'+8*3&0$43+)#*'$b?E$
SE.a$b?ET$+3$bK\5$6#),*-0$,3#$7*8#'$*'$)"#$)#9)5$
$
$
43+)#*'$ -#8#-$ *'$ )"#$ F-++.$ *0$ *'(3#,0#.$ Sc,/,7&("*$ #)$ ,-A$
?@@QT$ ,'.$ 1!231$ *0$ .#)#(),F-#$ *'$ )"#$ -#&J#/*($ (#--0$
S[,),',F#$#)$,-A$?@@CT5$!,9?$ *0$,$)3,'0(3*4)*+',-$,()*8,)+3$
)",)$ F;$ *)0#-%$ *0$ &',F-#$ )+$ F*'.$ )+$ 6UE$ ,'.A$ *'0)#,.A$
*')#3,()0$ M*)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ /,'*4&-,)#$ )"#$
)3,'0(3*4)*+',-$ /,("*'#3;$ SK*)-*'$ #)$ ,-A$ ?@@BX$ _#'^/#*#3$
,'.$U;F+37A$?@@@T5$[#$%+&'.$)",)$!,9?$)#)"#30$)+$b)0?A$,$
/#/F#3$+%$)"#$b)0$%,/*-;$+%$)3,'0(3*4)*+'$%,()+30$S6*))/#3A$
DCCBTA$)+$,()*8,)#$)"#$1!231$1B$43+/+)#35$!"#$*')#3,()*+'$
+%$ b)0?$ M*)"$ )"#$ 43+/+)#3$ ),J#0$ 4-,(#$ ,)$ ,$ );4*(,-$ b)0$
KKEE:(+'),*'*'7$ F*'.*'7$ 0*)#$ *'$ (-+0#$ 43+9*/*);$ )+$ ,$
GGGEG$ #-#/#')5$ !"#$ GGGEG$ #-#/#')$ M,0$ 0"+M'$ )+$
3#(3&*)$>4?$)+$)"#$43+/+)#3$)+$%+3/$,'$b)0?P>4?$(+/4+0*)#$
#-#/#')$ )+7#)"#3$M*)"$ )"#$b)0$ 3#(+7'*)*+'$/+)*%$ ,--+M*'7$
b)0?$ ,'.$ >4?$ )+$ (++4#3,)*8#-;$ ,()*8,)#$ )"#$ 43+/+)#3$
S6*))/#3$ #)$ ,-A$ ?@@QT5$ !,9?$ *0$ ,F-#$ )+$ %+3/$ ,$ )#3',3;$
(+/4-#9$ M*)"$ F+)"$ )3,'0(3*4)*+'$ %,()+30$ )+$ %&3)"#3$
0)*/&-,)#$ )3,'0(3*4)*+'$ %3+/$ )"#$ 1B$ 43+/+)#3$ S6*))/#3$ #)$
,-A$?@@RT5$$
b)0$ ,'.$ >4?$ F*'.*'7$ 0*)#0$ ,-0+$ 4-,;$ ,$ 3+-#$ *'$ 1B:
.#4#'.#')$ 1!231$ )3,'0(3*4)*+'$ *'$ F3#,0)$ (,'(#3$ (#--05$ Y'$
W6E:Wd:DB?$(#--0A$!K\!:*'.&(#.$)3,'0(3*4)*+'$%3+/$)"#$
1B$ 43+/+)#3$ 3#V&*3#0$ )"#$ 3#04+'0*8#$ #-#/#')0$ %+3$ b)0?A$
>4?$ ,'.$ ,'$ EKEG$ F*'.*'7$ 0*)#A$ M"*("$ M,0$ %+&'.$ )+$
3#(3&*)$ )"#$!K\!$#%%#()+30$>/,.BP>/,.Q$)+$)"#$43+/+)#3$
S_*'.#/,''$ #)$ ,-A$ DCC?T5$ Y'$ )"#$ 43#0#'(#$ +%$ !K\!A$ b)0?$
M,0$ 0"+M'$ )+$ 0;'#37*0)*(,--;$ ,()*8,)#$ )"#$ 1!231$ 1B$
43+/+)#3$ *'$ (+'(#3)$M*)"$ >/,.B5$ Y'$ ,73##/#')$M*)"$ )"*0$
%*'.*'7A$ 0),F-#$ )3,'0%#()*+'$ +%$ W6E:Wd:DB?$ (#--0$ M*)"$
>/,.$ 43+)#*'0$ M#3#$ %+&'.$ )+$ *'(3#,0#$ !K\!:.#4#'.#')$
1!231$ 0#(3#)*+'$ SH,J+'#'$ #)$ ,-A$ DCCDT5$ G+'8#30#-;A$
43#8#')*'7$ !K\!:/#.*,)#.$ >/,.B$ '&(-#,3$ */4+3)$ F;$
*'"*F*)*'7$4B<$WE1$J*',0#$,F+-*0"#.$)"#$!K\!$#%%#()$+'$
1!231$#943#00*+'$SH,J+'#'$#)$,-A$DCCDX$_*'.#/,''$#)$,-A$
DCCB(T5$$
!K\!:.#4#'.#')$ 1!231$ #943#00*+'$ (+&-.$ ,-0+$ F#$
.*/*'*0"#.$ F;$ 1HG$ *'"*F*)+30$ S_*'.#/,''$ #)$ ,-A$ DCC?T5$
1,3)*(&-,3-;A$ 1HG"$ M,0$ %+&'.$ )+$ F#$ */4+3),')$ %+3$ )"#$
!K\!:.#4#'.#')$ ,()*8,)*+'$ +%$ )"#$ 1B$ 43+/+)#3$ *'$ F3#,0)$
(,'(#3$ (#--05$ !"*0$ J*',0#$ *0$ 3#V&*3#.$ )+$ ,--+M$ b)0?$ )+$
,()*8,)#$)"#$1B$43+/+)#3$*'$F3#,0)$(,'(#3$(#--0$S_*'.#/,''$
#)$,-A$DCCB,T$,'.$)+$/,*'),*'$b)0?$43+)#*'$#943#00*+'$*'$,$
8,3*#);$ +%$ (,'(#3$ (#--0$ Sa#))#3$ #)$ ,-A$ DCCQT5$ \&3)"#3$
#8*.#'(#$ %+3$ 1HG0$ F#*'7$ *'8+-8#.$ *'$ 1B:.3*8#'$ 1!231$
#943#00*+'$ *0$ 43+8*.#.$ F;$ 0)&.*#0$ &0*'7$ 4"+3F+-$ #0)#3$
S1WET$ )+$ &43#7&-,)#$ 1!231$ #943#00*+'$ *'$b)0?:.#%*(*#')$
WG\:R$ (#--0$ S_*'.#/,''$ #)$ ,-A$ DCCBFT5$ E$ 0;'#37*0)*($
#%%#()$ F#)M##'$ b)0DA$ ,$ (-+0#$ 3#-,)*8#$ +%$ b)0?A$ ,'.$ 1HG#$
M,0$ %+&'.$ )+$/#.*,)#$ )"#$1WE:*'.&(#.$,()*8,)*+'$+%$ )"#$
1!231$ 1B$ 43+/+)#35$ E7,*'$ )"#$ *')#73*);$ +%$ )"#$ >4?$
F*'.*'7$0*)#$M,0$3#V&*3#.5$$
b)0?$ ,'.P+3$b)0D$",8#$ ,-0+$F##'$ %+&'.$ )+$F#$4+)#')$
,()*8,)+30$ +%$ )"#$ 1!231$ 43+/+)#3$ *'$ 43*/,3;$ "&/,'$
J#3,)*'+(;)#0$ SG"+$ #)$ ,-A$ DCCQTA$ *'$ 1?@$ #/F3;+',-$
(,3(*'+/,$ (#--0$ SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ )&/+3*7#'*($
F3#,0)$ #4*)"#-*,-$ (#--$ -*'#$ U>D!DE?$ SG,),*00+'$ #)$ ,-A$
DCCBT5$ Y'$,..*)*+'A$ )"#$b)0$F*'.*'7$0*)#$",0$F##'$3#4+3)#.$
)+$ /#.*,)#$ ,)$ -#,0)$ *'$ 4,3)$ )"#$ #%%#()$ +%$ 3#)*'+*($ ,(*.$
SH,34#3*#'$ #)$ ,-A$ ?@@RT$ ,'.$ ,.#'+8*3&0$ b?E$ +'$ 1B$
43+/+)#3$,()*8*);$ S\+-#;$#)$,-A$?@@@T5$E-0+$0)*/&-,)*+'$+%$
Q=O$
![Page 151: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/151.jpg)
Gene Therapy and Molecular Biology Vol 8, page 457
457
PTHrP expression by epidermal growth factor (EGF)-like
factors may involve the Ets binding site (Cho et al, 2004).
EGF and EGF-like factors, such as transforming growth
factor # and amphiregulin, are potent activators of PTHrP
expression in a variety of cells (Allinson and Drucker,
1992; Burton and Knight, 1992; Ferrari et al, 1994; Heath
et al, 1995; Cramer et al, 1996b; Cho et al, 2004). They
are ligands of the EGF receptor (EGF-R, ErbB1) which is
aberrantly expressed in many cancers (Kolibaba and
Druker, 1997) and plays an important role in regulating
proliferation in estrogen receptor-negative breast
carcinoma cells (Biswas et al, 2000).
Ets1 and Ets2 are both involved in carcinogenesis
(Dittmer, 2003; Foos and Hauser, 2004) and are targets of
the Ras/MEK1/Erk1/2 pathway (Yang et al, 1996; Seidel
and Graves, 2002). Activation of this pathway leads to
phosphorylation and superactivation of these Ets proteins.
The Ras/MEK1/Erk1/2 pathway has shown to play a role
in the regulation of PTHrP expression. E.g. in rat Leydig
tumor H-500 cells, activation of the Ras/MEK/Erk
pathway stimulated PTHrP expression (Aklilu et al, 2000)
and, in keratinocytes, dominant negative versions of the
Ras and Raf protein downregulated PTHrP P3 promoter
activity (Cho et al, 2004). In addition, transfection with
Ras alone or in combination with Src increased PTHrP
production in fibroblasts (Li and Drucker, 1994; Motokura
et al, 1995; Aklilu et al, 1997). Also cotransfection of
fibroblasts with Ras and mutant p53 activated PTHrP
expression (Motokura et al, 1995). In particular, the
Ras/mutant p53 cooperative effect might have been
mediated by Ets1, as mutant p53 has been shown to
physically and functionally interact with this Ets protein
(Sampath et al, 2001). Given the importance of Ets1 for
PTHrP expression and the involvement of both proteins in
invasion, it is reasonable to suggest that Ets1 may exert
part of the invasion-promoting function through PTHrP.
B. Other PTHrP regulating factorsA variety of other proteins have been shown to
stimulate PTHrP expression in cancer cells. In lung cancer
cells, PTHrP production is increased in response to tumor
necrosis factor # (TNF#) and interleukin-6 (IL-6) (Rizzoli
et al, 1994). In HTLV-I infected MT-2 leukaemic cells and
in the human lung cancer cell line BEN, PTHrP expression
can be augmented by agents that raise the cAMP level
(Ikeda et al, 1993b; Chilco et al, 1998). Calcitonin and
cAMP have been shown to activate the P1 and the P3
promoter (Chilco et al, 1998). In the P1 promoter, a
cAMP-responsive element (CRE) could be identified that
mediates these effects.
Steriods, such as 1,25-dihydroxyvitamin D3,
dexamethasone and androgens, have been found to inhibit
PTHrP expression in cancer cells on the transcriptional
level (Ikeda et al, 1993a; Inoue et al, 1993; Glatz et al,
1994; Rizzoli et al, 1994; Falzon, 1997; Tovar Sepulveda
and Falzon, 2002; Pizzi et al, 2003). Vitamin D was shown
to affect P3 and upstream PTHrP promoters (Endo et al,
1994). Dexamethasone and non-calcaemic vitamin D
analogues were also demonstrated to inhibit tumor-
dependent hypercalcaemia and to reduce tumor burden in
mice (Endo et al, 1994; Cohen-Solal et al, 1995; El
Abdaimi et al, 1999).
There are conflicting data about the effect of
estrogen, an important mitogen in mammary
carcinogenesis (Keshamouni at al, 2002), on the regulation
of PTHrP expression in breast cancer cells. In MCF-7
cells, both estrogen and anti-estrogen tamoxifen where
shown to increase PTHrP mRNA levels in MCF-7 breast
cancer cells (Funk and Wei, 1998), whereas, in KPL-3C
breast cancer cells, estrogen inhibited and tamoxifen
stimulated PTHrP secretion (Kurebayashi and Sonoo,
1997). Estrogen has also been demonstrated to interfere
with PTHrP action by inhibiting PTHrP-induced bone
resorption (Kanatani et al, 1998).
PTHrP and calcium seem to be linked in several
ways. Not only can PTHrP increase the blood calcium
level and intracellularly activate the calcium-signalling
pathway, but it also can respond to extracellular calcium
(Buchs et al, 2000; Tfelt-Hansen et al, 2003). Extracellular
calcium is an important regulator of proliferation and
differentiation of normal cells. Deregulation of its
receptor, the calcium-sensing receptor (CaR), in cancer
cells can lead to cancer progression (Rodland, 2004). CaR
was shown to be responsible for the calcium-dependent
activation of PTHrP transcription in H-500 cells (Tfelt-
Hansen et al, 2003). CaR has also been found to
upregulate PTHrP synthesis and secretion in astrocytomas,
menigiomas and breast cancer cells (Chattopadhyay et al,
2000; Sanders et al, 2000). Overexpression and activation
of CaR in HEK293 cells revealed that MAP kinases
ERK1/2 and p38 are involved in the CaR effect on PTHrP
expression (MacLeod et al, 2003).
PTHrP expression is also influenced by the
substratum cells are attached to. Depending on the
extracellular matrix protein pancreatic adenocarcinoma
cells were grown on, PTHrP expression was either up- or
downregulated (Grzesiak et al, 2004). Reduced expression
of PTHrP was found when cells were plated on type I and
IV collagen or laminin, whereas higher expression was
observed with fibronectin or vitronectin.
Gene silencing may be another way by which PTHrP
abundance is regulated. Gene silencing can be
epigenetically induced by CpG island methylation which
appear to occur in cancer cells in an increased rate (Jones
and Laird, 1999). In the PTHrP gene, a single CpG island
is located upstream of the P3 promoter (Ganderton et al,
1995; Holt et al, 1993). In lung cancer biopsies, PTHrP
expression was found to be independent of the methylation
status of this CpG island (Ganderton and Briggs, 2000).
However, Methylation of certain CpG dinucleotides
upstream of the CpG island were shown to influence
PTHrP expression in renal carcinoma cell lines (Holt et al,
1993).
PTHrP expression seems also be controlled on the
post-trancriptional level. Von Hippel-Landau tumor
suppressor gene has been demonstrated to negatively
regulate PTHrP in clear cell renal carcinoma via a post-
transcriptional mechanism (Massfelder et al, 2004). In oral
squamous carcinoma cells, TGF" has been shown to
stimulate expression of PTHrP in part by increasing the
stability of its RNA (Sellers et al, 2002). In osteosarcoma
![Page 152: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/152.jpg)
Dittmer: Importance of PTHrP for cancer development
458
cells, serum increased PTHrP expression by both
upregulation of transcription and stabilization of PTHrP
RNA (Falzon, 1996). There is also evidence, that in
prostate cancer, PSA inactivates PTHrP by proteolytic
cleavage (Cramer et al, 1996a; Iwamura et al, 1996).
VII. Concluding remarksOriginally identified as a tumor-derived factor that
induces the paraneoplastic syndrome HHM, it is now
generally accepted that PTHrP also plays a role in
stimulating local osteolysis, thereby, facilitating growth of
metastatic cancer in the bony tissue. In addition, PTHrP
has the potential to regulate proliferation, invasion and
apoptosis in cancer cells in a way that is beneficial for
tumor growth. On the other hand, PTHrP has shown to
have anti-mitogenic effects and to inhibit angiogenesis
(Bakre et al, 2002) suggesting that PTHrP may also act as
an anti-tumor factor. Which of these activities of PTHrP
prevail might depend on the type of tumor and tumor
stage.
While the prognostic value of PTHrP in human
cancer is still unclear, PTHrP may be a useful predictive
marker for anti-PTHrP treatment response in bone
metastasis. A number of attempts have been made to
suppress PTHrP expression in cancer cells. Factors that
downregulate PTHrP transcription, such as vitamin D
analogues and modified guanosine nucleotides, have been
successfully used to inhibit PTHrP expression,
hypercalcaemia, osteolysis and bone metastasis in mice
(El Abdaimi et al, 1999; Gallwitz et al, 2002). PKC
inhibitors, novel anti-cancer drugs that have entered
clinical trials (Roychowdhury and Lahn, 2003), may also
be suitable to attenuate PTHrP synthesis on the
transcriptional level (Lindemann et al, 2001). By a
different mechanism, prostate secretory protein PSP-94
was found to suppress the ability of prostate cancer cells to
synthesize PTHrP, to grow and to form skeletal metastases
in rats (Shukeir et al, 2004). In another approach, PTHrP
activity is inhibited by an anti-PTHrP antibody, originally
shown by Guise et al (1996) to reduce formation of bone
metastasis in tumor-bearing mice and now being
humanized (Sato et al, 2003) for the use in clinical trials.
Further analysis of the mechanism underlying the
regulation of PTHrP expression in cancer is needed to
identify further targets for an anti-PTHrP therapy. It is also
important to identify the PTHrP-responsive genes and to
clarify the role of nuclear PTHrP in order to understand
the action of PTHrP in cancer.
AcknowledgmentsThis work was supported by BMBF grant NBL3
FKZ 6/07.
ReferencesAarts MM, Levy D, He B, Stregger S, Chen T, Richard S and
Henderson JE (1999) Parathyroid hormone-related protein
interacts with RNA. J Biol Chem 274, 4832-4838.
Akino K, Ohtsuru A, Yano H, Ozeki S, Namba H, Nakashima M,
Ito M, Matsumoto T and Yamashita S (1996) Antisense
inhibition of parathyroid hormone-related peptide gene
expression reduces malignant pituitary tumor progression
and metastases in the rat. Cancer Res 56, 77-86.
Aklilu F, Gladu J, Goltzman D and Rabbani SA (2000) Role of
mitogen-activated protein kinases in the induction of
parathyroid hormone-related peptide. Cancer Res 60, 1753-
1760.
Aklilu F, Park M, Goltzman D and Rabbani SA (1997) Induction
of parathyroid hormone-related peptide by the Ras oncogene:
role of Ras farnesylation inhibitors as potential therapeutic
agents for hypercalcemia of malignancy. Cancer Res 57,
4517-4522.
Allinson ET and Drucker DJ (1992) Parathyroid hormone-like
peptide shares features with members of the early response
gene family: rapid induction by serum, growth factors and
cycloheximide. Cancer Res 52, 3103-3109.
Alvarez J, Sohn P, Zeng X, Doetschman T, Robbins DJ and
Serra R (2002) TGF2 mediates the effects of hedgehog on
hypertrophic differentiation and PTHrP expression.
Development 129, 1913-1924.
Amling M, Neff L, Tanaka S, Inoue D, Kuida K, Weir E,
Philbrick WM, Broadus AE and Baron R (1997) Bcl-2 lies
downstream of parathyroid hormone-related peptide in a
signaling pathway that regulates chondrocyte maturation
during skeletal development. J Cell Biol 136, 205-213.
Asadi F, Faraj M, Malakouti S and Kukreja SC (2001) Effect of
parathyroid hormone related protein and dihydrotestosterone
on proliferation and ornithine decarboxylase mRNA in
human prostate cancer cell lines. Int Urol Nephrol 33, 417-
422.
Bakre MM, Zhu Y, Yin H, Burton DW, Terkeltaub R, Deftos LJ
and Varner JA (2002) Parathyroid hormone-related peptide is
a naturally occurring, protein kinase A-dependent
angiogenesis inhibitor. Nat Med 8, 995-1003.
Beier F, Ali Z, Mok D, Taylor AC, Leask T, Albanese C, Pestell
RG and LuValle P (2001) TGF" and PTHrP control
chondrocyte proliferation by activating cyclin D1 expression.
Mol Biol Cell 12, 3852-3863.
Bendre MS, Gaddy-Kurten D, Mon-Foote T, Akel NS, Skinner
RA, Nicholas RW and Suva LJ (2002) Expression of
interleukin 8 and not parathyroid hormone-related protein by
human breast cancer cells correlates with bone metastasis in
vivo. Cancer Res 62, 5571-5579.
Bendre MS, Montague DC, Peery T, Akel NS, Gaddy D and
Suva LJ (2003) Interleukin-8 stimulation of
osteoclastogenesis and bone resorption is a mechanism for
the increased osteolysis of metastatic bone disease. Bone 33,
28-37.
Benelli R, Peissel B, Manenti G, Gariboldi M, Vanzetto C,
Albini A and Dragani TA (2003) Allele-specific patterns of
the mouse parathyroid hormone-related protein: influences
on cell adhesion and migration. Oncogene 22, 7711-7715.
Birch MA, Carron JA, Scott M, Fraser WD and Gallagher JA
(1995) Parathyroid hormone (PTH)/PTH-related protein
(PTHrP) receptor expression and mitogenic responses in
human breast cancer cell lines. Br J Cancer 72, 90-95.
Biswas DK, Cruz AP, Gansberger E and Pardee AB (2000)
Epidermal growth factor-induced nuclear factor kappa B
activation: A major pathway of cell-cycle progression in
estrogen-receptor negative breast cancer cells. Proc Natl
Acad Sci U S A 97, 8542-8547.
Blobe GC, Shiemann WP and Lodish HF (2000) Role of
Transforming growth factor in Human Disease. N. Eng. J.
Med. 342, 1350-1358.
Bouizar Z, Spyratos F and De vernejoul MC (1999) The
parathyroid hormone-related protein (PTHrP) gene: use of
downstream TATA promotor and PTHrP 1-139 coding
pathways in primary breast cancers vary with the occurrence
of bone metastasis. J Bone Miner Res 14, 406-414.
![Page 153: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/153.jpg)
Gene Therapy and Molecular Biology Vol 8, page 459
459
Buchs N, Manen D, Bonjour JP and Rizzoli R (2000) Calcium
stimulates parathyroid hormone-related protein production in
Leydig tumor cells through a putative cation-sensing
mechanism. Eur J Endocrinol 142, 500-505.
Burton PB and Knight DE (1992) Parathyroid hormone-related
peptide can regulate the growth of human lung cancer cells
and may form part of an autocrine TGF-" loop. FEBS Lett
305, 228-232.
Cataisson C, Gordon J, Roussiere M, Abdalkhani A, Lindemann
RK, Dittmer J, Foley J and Bouizar Z (2003) Ets-1 activates
parathyroid hormone-related protein gene expression in
tumorigenic breast epithelial cells. Mol. Cell. Endocrinol
204, 155-168
Cataisson C, Lieberherr M, Cros M, Gauville C, Graulet AM,
Cotton J, Calvo F, de Vernejoul MC, Foley J and Bouizar Z
(2000) Parathyroid hormone-related peptide stimulates
proliferation of highly tumorigenic human SV40-
immortalized breast epithelial cells. J Bone Miner Res 15,
2129-2139.
Chattopadhyay N, Evliyaoglu C, Heese O, Carroll R, Sanders J,
Black P and Brown EM (2000) Regulation of secretion of
PTHrP by Ca(2+)-sensing receptor in human astrocytes,
astrocytomas and meningiomas. Am J Physiol Cell Physiol
279, C691-C699.
Chen HL, Demiralp B, Schneider A, Koh AJ, Silve C, Wang CY
and McCauley LK (2002) Parathyroid hormone and
parathyroid hormone-related protein exert both pro- and anti-
apoptotic effects in mesenchymal cells. J Biol Chem 277,
19374-19381.
Chilco PJ, Leopold V and Zajac JD (1998) Differential
regulation of the parathyroid hormone-related protein gene
P1 and P3 promoters by cAMP. Mol Cell Endocrinol 138,
173-184.
Cho YM, Lewis DA, Koltz PF, Richard V, Gocken TA, Rosol
TJ, Konger RL, Spandau DF and Foley J (2004) Regulation
of parathyroid hormone-related protein gene expression by
epidermal growth factor-family ligands in primary human
keratinocytes. J Endocrinol 181, 179-190.
Cingolani G, Bednenko J, Gillespie MT and Gerace L (2002)
Molecular basis for the recognition of a nonclassical nuclear
localization signal by importin ". Mol Cell 10, 1345-1353.
Cohen-Solal ME, Bouizar Z, Denne MA, Graulet AM, Gueris J,
Bracq S, Jullienne A and de Vernejoul MC (1995) 1,25
dihydroxyvitamin D and dexamethasone decrease in vivo
Walker carcinoma growth, but not parathyroid hormone
related protein secretion. Horm Metab Res 27, 403-407.
Conlan LA, Martin TJ and Gillespie MT (2002) The COOH-
terminus of parathyroid hormone-related protein (PTHrP)
interacts with "-arrestin 1B. FEBS Lett 527, 71-75.
Cornish J, Callon KE, Nicholson GC and Reid IR (1997)
Parathyroid hormone-related protein-(107-139) inhibits bone
resorption in vivo. Endocrinology 138, 1299-1304.
Cramer SD, Chen Z and Peehl DM (1996a) Prostate specific
antigen cleaves parathyroid hormone-related protein in the
PTH-like domain: inactivation of PTHrP-stimulated cAMP
accumulation in mouse osteoblasts. J Urol 156, 526-531.
Cramer SD, Peehl DM, Edgar MG, Wong ST, Deftos LJ and
Feldman D (1996b) Parathyroid hormone--related protein
(PTHrP) is an epidermal growth factor-regulated secretory
product of human prostatic epithelial cells. Prostate 29, 20-
29.
de la Mata J, Uy HL, Guise TA, Story B, Boyce BF, Mundy GR
and Roodman GD (1995) Interleukin-6 enhances
hypercalcemia and bone resorption mediated by parathyroid
hormone-related protein in vivo. J Clin Invest 95, 2846-
2852.
dePapp AE and Stewart AF (1993) Parathyroid hormone-related
protein: a peptide of diverse physiologic functions. Trends
Endocrinol Metab 4, 181-183.
Diefenbach-Jagger H, Brenner C, Kemp BE, Baron W, McLean
J, Martin TJ, and Moseley JM (1995) Arg21 is the preferred
kexin cleavage site in parathyroid-hormone-related protein.
Eur J Biochem 229, 91-8.
Ditmer LS, Burton DW, and Deftos LJ (1996) Elimination of the
carboxy-terminal sequences of parathyroid hormone-related
protein 1-173 increases production and secretion of the
truncated forms. Endocrinology 137, 1608-17.
Dittmer J (2003) The Biology of the Ets1 Proto-Oncogene. Mol
Cancer 2, 29.
Dittmer J, Gegonne A, Gitlin SD, Ghysdael J and Brady JN
(1994) Regulation of parathyroid hormone-related protein
(PTHrP) gene expression. Sp1 binds through an inverted
CACCC motif and regulates promoter activity in cooperation
with Ets1. J Biol Chem 269, 21428-21434.
Dittmer J, Gitlin SD, Reid RL and Brady JN (1993)
Transactivation of the P2 promoter of parathyroid hormone-
related protein by human T-cell lymphotropic virus type I
Tax1: evidence for the involvement of transcription factor
Ets1. J Virol 67, 6087-6095.
Dittmer J, Pise-Masison CA, Clemens KE, Choi KS and Brady
JN (1997) Interaction of human T-cell lymphotropic virus
type I Tax, Ets1 and Sp1 in transactivation of the PTHrP P2
promoter. J Biol Chem 272, 4953-4958.
Dougherty KM, Blomme EA, Koh AJ, Henderson JE, Pienta KJ,
Rosol TJ and McCauley LK (1999) Parathyroid hormone-
related protein as a growth regulator of prostate carcinoma.
Cancer Res 59, 6015-6022.
Downey SE, Hoyland J, Freemont AJ, Knox F, Walls J and
Bundred NJ (1997) Expression of the receptor for
parathyroid hormone-related protein in normal and malignant
breast tissue. J Pathol 183, 212-217.
Dunbar ME, Young P, Zhang JP, McCaughern-Carucci J, Lanske
B, Orloff JJ, Karaplis A, Cunha G and Wysolmerski JJ
(1998) Stromal cells are critical targets in the regulation of
mammary ductal morphogenesis by parathyroid hormone-
related protein. Dev Biol 203, 75-89.
El Abdaimi K, Papavasiliou V, Rabbani SA, Rhim JS, Goltzman
D and Kremer R (1999) Reversal of hypercalcemia with the
vitamin D analogue EB1089 in a human model of squamous
cancer. Cancer Res 59, 3325-3328.
Endo K, Ichikawa F, Uchiyama Y, Katsumata K, Ohkawa H,
Kumaki K, Ogata E and Ikeda K (1994) Evidence for the
uptake of a vitamin D analogue (OCT) by a human
carcinoma and its effect of suppressing the transcription of
parathyroid hormone-related peptide gene in vivo. J Biol
Chem 269, 32693-32699.
Falzon M (1996) Serum stimulation of parathyroid hormone-
related peptide gene expression in ROS 17/2.8 osteosarcoma
cells through transcriptional and posttranscriptional
mechanisms. Endocrinology 137, 3681-3688.
Falzon M (1997) The noncalcemic vitamin D analogues EB1089
and 22-oxacalcitriol interact with the vitamin D receptor and
suppress parathyroid hormone-related peptide gene
expression. Mol Cell Endocrinol 127, 99-108.
Falzon M and Du P (2000) Enhanced growth of MCF-7 breast
cancer cells overexpressing parathyroid hormone-related
peptide. Endocrinology 141, 1882-1892.
Fenton AJ, Martin TJ and Nicholson GC (1994) Carboxyl-
terminal parathyroid hormone-related protein inhibits bone
resorption by isolated chicken osteoclasts. J Bone Miner
Res 9, 515-519.
Ferrari SL, Behar V, Chorev M, Rosenblatt M and Bisello A
(1999) Endocytosis of ligand-human parathyroid hormone
receptor 1 complexes is protein kinase C-dependent and
![Page 154: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/154.jpg)
Dittmer: Importance of PTHrP for cancer development
460
involves "-arrestin2. Real-time monitoring by fluorescence
microscopy. J Biol Chem 274, 29968-29975.
Ferrari SL, Rizzoli R and Bonjour JP (1994) Effects of epidermal
growth factor on parathyroid hormone-related protein
production by mammary epithelial cells. J Bone Miner Res
9, 639-644.
Fiaschi-Taesch N, Takane KK, Masters S, Lopez-Talavera JC
and Stewart AF (2004) Parathyroid hormone-related protein
as a regulator of pRb and the cell cycle in arterial smooth
muscle. Circulation 110, 177-185.
Fiaschi-Taesch NM and Stewart AF (2003) Minireview:
parathyroid hormone-related protein as an intracrine factor--
trafficking mechanisms and functional consequences.
Endocrinology 144, 407-411.
Foley J, Wysolmerski JJ, Missero C, King CS and Philbrick WM
(1999) Regulation of parathyroid hormone-related protein
gene expression in murine keratinocytes by E1A isoforms: a
role for basal promoter and Ets-1 site. Mol Cell Endocrinol
156, 13-23.
Franchini G (1995) Molecular mechanisms of human T-cell
leukemia/lymphotropic virus type I infection. Blood 86,
3619-3639.
Fujita T, Meguro T, Fukuyama R, Nakamuta H and Koida M
(2002) New signaling pathway for parathyroid hormone and
cyclic AMP action on extracellular-regulated kinase and cell
proliferation in bone cells. Checkpoint of modulation by
cyclic AMP. J Biol Chem 277, 22191-22200.
Funk JL, and Wei H (1998) Regulation of parathyroid hormone-
related protein expression in MCF-7 breast carcinoma cells
by estrogen and antiestrogens. Biochem Biophys Res
Commun 251, 849-54.
Gallwitz WE, Guise TA and Mundy GR (2002) Guanosine
nucleotides inhibit different syndromes of PTHrP excess
caused by human cancers in vivo. J Clin Invest 110, 1559-
1572.
Ganderton RH and Briggs RS (2000) Increased upstream
methylation has no influence on the overexpression of the
parathyroid hormone-related protein gene in squamous cell
carcinoma of the lung. Eur J Cancer 36, 2128-2136.
Ganderton RH, Day IN and Briggs RS (1995) Patterns of DNA
methylation of the parathyroid hormone-related protein gene
in human lung carcinoma. Eur J Cancer 31A, 1697-1700.
Glatz JA, Heath JK, Southby J, O'Keeffe LM, Kiriyama T,
Moseley JM, Martin TJ and Gillespie MT (1994)
Dexamethasone regulation of parathyroid hormone-related
protein (PTHrP) expression in a squamous cancer cell line.
Mol Cell Endocrinol 101, 295-306.
Goltzman D, Karaplis AC, Kremer R and Rabbani SA (2000)
Molecular basis of the spectrum of skeletal complications of
neoplasia. Cancer 88, 2903-2908.
Goomer RS, Johnson KA, Burton DW, Amiel D, Maris TM,
Gurjal A, Deftost LJ and Terkeltaub R (2000) The tetrabasic
KKKK(147-150) motif determines intracrine regulatory
effects of PthrP 1-173 on chondrocyte PPi metabolism and
matrix synthesis. Endocrinology 141, 4613-4622.
Grill V, Rankin W and Martin TJ (1998) Parathyroid hormone-
related protein (PTHrP) and hypercalcaemia. Eur J Cancer
34, 222-229.
Grzesiak JJ, Clopton P, Chalberg C, Smith K, Burton DW,
Silletti S, Moossa AR, Deftos LJ and Bouvet M (2004) The
extracellular matrix differentially regulates the expression of
PTHrP and the PTH/PTHrP receptor in FG pancreatic cancer
cells. Pancreas 29, 85-92.
Guise TA (1997) Parathyroid hormone-related protein and bone
metastases. Cancer 80, 1572-1580.
Guise TA, Yin JJ, Taylor SD, Kumagai Y, Dallas M, Boyce BF,
Yoneda T and Mundy GR (1996) Evidence for a causal role
of parathyroid hormone-related protein in the pathogenesis of
human breast cancer-mediated osteolysis. J Clin Invest 98,
1544-1549.
Guise TA, Yoneda T, Yates AJ and Mundy GR (1993) The
combined effect of tumor-produced parathyroid hormone-
related protein and transforming growth factor-a enhance
hypercalcemia in vivo and bone resorption in vitro. J Clin
Endocrinol Metab 77, 40-45.
Gujral A, Burton DW, Terkeltaub R and Deftos LJ (2001)
Parathyroid hormone-related protein induces interleukin 8
production by prostate cancer cells via a novel intracrine
mechanism not mediated by its classical nuclear localization
sequence. Cancer Res 61, 2282-2288.
Harbeck N, Schmitt M, Kates RE, Kiechle M, Zemzoum I,
Janicke F and Thomssen C (2002) Clinical utility of
urokinase-type plasminogen activator and plasminogen
activator inhibitor-1 determination in primary breast cancer
tissue for individualized therapy concepts. Clin Breast
Cancer 3, 196-200.
Hastings RH, Araiza F, Burton DW, Bedley M and Deftos LJ
(2004) Parathyroid Hormone-Related Protein Regulates
Apoptosis in Lung Cancer Cells through Protein Kinase A.
Am J Physiol Cell Physiol, in press
Hastings RH, Araiza F, Burton DW, Zhang L, Bedley M and
Deftos LJ (2003) Parathyroid hormone-related protein
ameliorates death receptor-mediated apoptosis in lung cancer
cells. Am J Physiol Cell Physiol 285, C1429-C1436.
Heath JK, Southby J, Fukumoto S, O'Keeffe LM, Martin TJ and
Gillespie MT (1995) Epidermal growth factor-stimulated
parathyroid hormone-related protein expression involves
increased gene transcription and mRNA stability. Biochem J
307 ( Pt 1), 159-167.
Henderson JE, Amizuka N, Warshawsky H, Biasotto D, Lanske
BM, Goltzman D and Karaplis AC (1995) Nucleolar
localization of parathyroid hormone-related peptide enhances
survival of chondrocytes under conditions that promote
apoptotic cell death. Mol Cell Biol 15, 4064-4075.
Henderson M, Danks J, Moseley J, Slavin J, Harris T, McKinlay
M, Hopper J and Martin T (2001) Parathyroid hormone-
related protein production by breast cancers, improved
survival and reduced bone metastases. J Natl Cancer Inst
93, 234-237.
Hiraki A, Ueoka H, Bessho A, Segawa Y, Takigawa N, Kiura K,
Eguchi K, Yoneda T, Tanimoto M and Harada M (2002)
Parathyroid hormone-related protein measured at the time of
first visit is an indicator of bone metastases and survival in
lung carcinoma patients with hypercalcemia. Cancer 95,
1706-1713.
Hoey RP, Sanderson C, Iddon J, Brady G, Bundred NJ and
Anderson NG (2003) The parathyroid hormone-related
protein receptor is expressed in breast cancer bone
metastases and promotes autocrine proliferation in breast
carcinoma cells. Br J Cancer 88, 567-573.
Holt EH, Vasavada RC, Bander NH, Broadus AE and Philbrick
WM (1993) Region-specific methylation of the parathyroid
hormone-related peptide gene determines its expression in
human renal carcinoma cell lines. J Biol Chem 268, 20639-
20645.
Horiuchi N, Caulfield MP, Fisher JE, Goldman ME, McKee RL,
Reagan JE, Levy JJ, Nutt RF, Rodan SB, Schofield TL, et al
(1987) Similarity of synthetic peptide from human tumor to
parathyroid hormone in vivo and in vitro. Science 238, 1566-
1568.
Ikeda K, Charles L, Weir EC, Mangin M and Broadus AE
(1993a) Transcriptional regulation of the parathyroid
hormone-related gene by glucocorticoids and vitamin D in a
human C-cell line. J Biol Chem 264, 15743-15746.
Ikeda K, Okazaki R, Inoue D, Ogata E and Matsumoto T (1993b)
Transcription of the gene for parathyroid hormone-related
![Page 155: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/155.jpg)
Gene Therapy and Molecular Biology Vol 8, page 461
461
peptide from the human is activated through a cAMP-
dependent pathway by prostaglandin E1 in HTLV-I-infected
T cells. J Biol Chem 268, 1174-1179.
Inoue D, Matsumoto T, Ogata E and Ikeda K (1993) 22-
Oxacalcitriol, a noncalcemic analogue of calcitriol,
suppresses both cell proliferation and parathyroid hormone-
related peptide gene expression in human T cell
lymphotrophic virus, type I-infected T cells. J Biol Chem
268, 16730-16736.
Iwamura M, Hellman J, Cockett AT, Lilja H and Gershagen S
(1996) Alteration of the hormonal bioactivity of parathyroid
hormone-related protein (PTHrP) as a result of limited
proteolysis by prostate-specific antigen. Urology 48, 317-
325.
Jones PA and Laird PW (1999) Cancer epigenetics comes of age.
Nat Genet 21, 163-167.
Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E,
Richards J, Kolakowski LF, Jr., Hock J, Potts JT, Jr.,
Kronenberg HM, et al (1991) A G protein-linked receptor for
parathyroid hormone and parathyroid hormone-related
peptide. Science 254, 1024-1026.
Kakonen SM and Mundy GR (2003) Mechanisms of osteolytic
bone metastases in breast carcinoma. Cancer 97, 834-839.
Kakonen SM, Selander KS, Chirgwin JM, Yin JJ, Burns S,
Rankin WA, Grubbs BG, Dallas M, Cui Y and Guise TA
(2002) Transforming growth factor-" stimulates parathyroid
hormone-related protein and osteolytic metastases via Smad
and mitogen-activated protein kinase signaling pathways. J
Biol Chem 277, 24571-24578.
Kanatani M, Sugimoto T, Takahashi Y, Kaji H, Kitazawa R, and
Chihara K (1998) Estrogen via the estrogen receptor blocks
cAMP-mediated parathyroid hormone (PTH)-stimulated
osteoclast formation. J Bone Miner Res 13, 854-62.
Karaplis AC and Deckelbaum RA (1998) Role of PTHrP and
PTH-1 receptor in endochondral bone development. Front
Biosci 3, D795-D803.
Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VL,
Kronenberg HM and Mulligan RC (1994) Lethal skeletal
dysplasia from targeted disruption of the parathyroid
hormone-related peptide gene. Genes Dev 8, 277-289.
Karp SJ, Schipani E, St-Jacques B, Hunzelman J, Kronenberg H
and McMahon AP (2000) Indian hedgehog coordinates
endochondral bone growth and morphogenesis via
parathyroid hormone related-protein-dependent and -
independent pathways. Development 127, 543-548.
Karperien M, Farih-Sips H, Lowik CW, de Laat SW, Boonstra J
and Defize LH (1997) Expression of the parathyroid
hormone-related peptide gene in retinoic acid-induced
differentiation: involvement of ETS and Sp1. Mol
Endocrinol 11, 1435-1448.
Kawashima-Ohya Y, Satakeda H, Kuruta Y, Kawamoto T, Yan
W, Akagawa Y, Hayakawa T, Noshiro M, Okada Y,
Nakamura S and Kato Y (1998) Effects of parathyroid
hormone (PTH) and PTH-related peptide on expressions of
matrix metalloproteinase-2, -3 and -9 in growth plate
chondrocyte cultures. Endocrinology 139, 2120-2127.
Kemp BE, Moseley JM, Rodda CP, Ebeling PR, Wettenhall RE,
Stapleton D, Diefenbach-Jagger H, Ure F, Michelangeli VP,
Simmons HA, et al (1987) Parathyroid hormone-related
protein of malignancy: active synthetic fragments. Science
238, 1568-1570.
Keshamouni VG, Mattingly RR, and Reddy KB (2002)
Mechanism of 17-"-estradiol-induced Erk1/2 activation in
breast cancer cells. A role for HER2 AND PKC-delta. J Biol
Chem 277, 22558-65.
Kitazawa S and Kitazawa R (2002) RANK ligand is a
prerequisite for cancer-associated osteolytic lesions. J Pathol
198, 228-236.
Kobayashi T, Chung UI, Schipani E, Starbuck M, Karsenty G,
Katagiri T, Goad DL, Lanske B and Kronenberg HM (2002)
PTHrP and Indian hedgehog control differentiation of growth
plate chondrocytes at multiple steps. Development 129,
2977-2986.
Kolibaba KS and Druker BJ (1997) Protein tyrosine kinases and
cancer. Biochim Biophys Acta 1333, F217-F248.
Kurebayashi J, and Sonoo H (1997) Parathyroid hormone-related
protein secretion is inhibited by oestradiol and stimulated by
antioestrogens in KPL-3C human breast cancer cells. Br J
Cancer 75, 1819-25.
Lam MH, Briggs LJ, Hu W, Martin TJ, Gillespie MT and Jans
DA (1999a) Importin " recognizes parathyroid hormone-
related protein with high affinity and mediates its nuclear
import in the absence of importin. J Biol Chem 274, 7391-
7398.
Lam MH, House CM, Tiganis T, Mitchelhill KI, Sarcevic B,
Cures A, Ramsay R, Kemp BE, Martin TJ and Gillespie MT
(1999b) Phosphorylation at the cyclin-dependent kinases site
(Thr85) of parathyroid hormone-related protein negatively
regulates its nuclear localization. J Biol Chem 274, 18559-
18566.
Lam MH, Olsen SL, Rankin WA, Ho PW, Martin TJ, Gillespie
MT and Moseley JM (1997) PTHrP and cell division:
expression and localization of PTHrP in a keratinocyte cell
line (HaCaT) during the cell cycle. J Cell Physiol 173, 433-
446.
Lenzmeier BA and Nyborg JK (1999) Molecular mechanisms of
viral transcription and cellular deregulation associated with
the HTLV-I Tax protein. Gene Ther Mol Biol 3, 327-345.
Li X and Drucker DJ (1994) Parathyroid hormone-related
peptide is a downstream target for ras and src activation. J
Biol Chem 269, 6263-6266.
Lindemann RK, Ballschmieter P, Nordheim A and Dittmer J
(2001) Transforming growth factor " regulates parathyroid
hormone-related protein expression in MDA-MB-231 breast
cancer cells through a novel Smad/Ets synergism. J Biol
Chem 276, 46661-46670.
Lindemann RK, Braig M, Ballschmieter P, Guise TA, Nordheim
A and Dittmer J (2003a) Protein kinase C regulates Ets1
transcriptional activity in invasive breast cancer cells. Int J
Oncol 22, 799-805.
Lindemann RK, Braig M, Hauser CA, Nordheim A and Dittmer J
(2003b) Ets2 and PKCepsilon are important regulators of
parathyroid hormone-related protein expression in MCF-7
breast cancer cells. Biochem J 372, 787-797.
Lindemann RK, Nordheim A and Dittmer J (2003c) Interfering
with TGF"-induced Smad3 nuclear accumulation
differentially affects TGF"-dependent gene expression. Mol
Cancer 2, 20.
Linforth R anderson N, Hoey R, Nolan T, Downey S, Brady G,
Ashcroft L and Bundred N (2002) Coexpression of
parathyroid hormone related protein and its receptor in early
breast cancer predicts poor patient survival. Clin Cancer
Res 8, 3172-3177.
Luparello C, Romanotto R, Tipa A, Sirchia R, Olmo N, Lopez de
Silanes I, Turnay J, Lizarbe MA and Stewart AF (2001)
Midregion parathyroid hormone-related protein inhibits
growth and invasion in vitro and tumorigenesis in vivo of
human breast cancer cells. J Bone Miner Res 16, 2173-
2181.
Luparello C, Sirchia R and Pupello D (2003) PTHrP [67-86]
regulates the expression of stress proteins in breast cancer
cells inducing modifications in urokinase-plasminogen
activator and MMP-1 expression. J Cell Sci 116, 2421-2430.
MacLean HE, Guo J, Knight MC, Zhang P, Cobrinik D and
Kronenberg HM (2004) The cyclin-dependent kinase
![Page 156: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/156.jpg)
Dittmer: Importance of PTHrP for cancer development
462
inhibitor p57(Kip2) mediates proliferative actions of PTHrP
in chondrocytes. J Clin Invest 113, 1334-1343.
MacLeod RJ, Chattopadhyay N and Brown EM (2003) PTHrP
stimulated by the calcium-sensing receptor requires MAP
kinase activation. Am J Physiol Endocrinol Metab 284,
E435-E442.
Maioli E and Fortino V (2004a) The complexity of parathyroid
hormone-related protein signalling. Cell Mol Life Sci 61,
257-262.
Maioli E and Fortino V (2004b) PTHrP on MCF-7 breast cancer
cells: a growth factor or an antimitogenic peptide? Br J
Cancer 90, 1293-1294
Manenti G, Peissel B, Gariboldi M, Falvella FS, Zaffaroni D,
Allaria B, Pazzaglia S, Rebessi S, Covelli V, Saran A and
Dragani TA (2000) A cancer modifier role for parathyroid
hormone-related protein. Oncogene 19, 5324-5328.
Mangin M, Ikeda K, Dreyer BE and Broadus AE (1990)
Identification of an up-stream promoter of the human
parathyroid hormone-related peptide gene. Mol Endocrinol
4, 851-858.
Mannstadt M, Juppner H and Gardella TJ (1999) Receptors for
PTH and PTHrP: their biological importance and functional
properties. Am J Physiol 277, F665-F675.
Martin TJ (2002) Manipulating the environment of cancer cells
in bone: a novel therapeutic approach. J Clin Invest 110,
1399-1401.
Martin TJ, Moseley JM and Gillespie MT (1991) Parathyroid
hormone-related protein: biochemistry and molecular
biology. Crit Rev Biochem Mol Biol 26, 377-395.
Massfelder T, Dann P, Wu TL, Vasavada R, Helwig JJ and
Stewart AF (1997) Opposing mitogenic and anti-mitogenic
actions of parathyroid hormone-related protein in vascular
smooth muscle cells: a critical role for nuclear targeting.
Proc Natl Acad Sci U S A 94, 13630-13635.
Massfelder T, Lang H, Schordan E, Lindner V, Rothhut S,
Welsch S, Simon-Assmann P, Barthelmebs M, Jacqmin D
and Helwig JJ (2004) Parathyroid hormone-related protein is
an essential growth factor for human clear cell renal
carcinoma and a target for the von Hippel-Lindau tumor
suppressor gene. Cancer Res 64, 180-188.
Miki T, Yano S, Hanibuchi M and Sone S (2000) Bone
metastasis model with multiorgan dissemination of human
small-cell lung cancer (SBC-5) cells in natural killer cell-
depleted SCID mice. Oncol Res 12, 209-217.
Miki T, Yano S, Hanibuchi M, Kanematsu T, Muguruma H and
Sone S (2004) Parathyroid hormone-related protein (PTHrP)
is responsible for production of bone metastasis, but not
visceral metastasis, by human small cell lung cancer SBC-5
cells in natural killer cell-depleted SCID mice. Int J Cancer
108, 511-515.
Morgan H, Tumber A and Hill PA (2004) Breast cancer cells
induce osteoclast formation by stimulating host IL-11
production and downregulating granulocyte/macrophage
colony-stimulating factor. Int J Cancer 109, 653-660.
Moseley JM and Gillespie MT (1995) Parathyroid hormone-
related protein. Crit Rev Clin Lab Sci 32, 299-343.
Motokura T, Endo K, Kumaki K, Ogata E and Ikeda K (1995)
Neoplastic transformation of normal rat embryo fibroblasts
by a mutated p53 and an activated ras oncogene induces
parathyroid hormone-related peptide gene expression and
causes hypercalcemia in nude mice. J Biol Chem 270,
30857-30861.
Naik P, Karrim J and Hanahan D (1996) The rise and fall of
apoptosis during multistage tumorigenesis: down-modulation
contributes to tumor progression from angiogenic
progenitors. Genes Dev 10, 2105-2116.
Nishihara M, Ito M, Tomioka T, Ohtsuru A, Taguchi T and
Kanematsu T (1999) Clinicopathological implications of
parathyroid hormone-related protein in human colorectal
tumours. J Pathol 187, 217-222.
Nugoli M, Chuchana P, Vendrell J, Orsetti B, Ursule L, Nguyen
C, Birnbaum D, Douzery EJ, Cohen P and Theillet C (2003)
Genetic variability in MCF-7 sublines: evidence of rapid
genomic and RNA expression profile modifications. BMC
Cancer 3, 13.
Orloff JJ, Ganz MB, Nathanson MH, Moyer MS, Kats Y,
Mitnick M, Behal A, Gasalla-Herraiz J and Isales CM (1996)
A midregion parathyroid hormone-related peptide mobilizes
cytosolic calcium and stimulates formation of inositol
trisphosphate in a squamous carcinoma cell line.
Endocrinology 137, 5376-5385.
Pasquini GM, Davey RA, Ho PW, Michelangeli VP, Grill V,
Kaczmarczyk SJ and Zajac JD (2002) Local secretion of
parathyroid hormone-related protein by an osteoblastic
osteosarcoma (UMR 106-01) cell line results in growth
inhibition. Bone 31, 598-605.
Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ,
Yang KH, Vasavada RC, Weir EC, Broadus AE and Stewart
AF (1996) Defining the roles of parathyroid hormone-related
protein in normal physiology. Physiol Rev 76, 127-173.
Pizzi H, Gladu J, Carpio L, Miao D, Goltzman D and Rabbani
SA (2003) Androgen regulation of parathyroid hormone-
related peptide production in human prostate cancer cells.
Endocrinology 144, 858-867.
Powell GJ, Southby J, Danks JA, Stillwell RG, Hayman JA,
Henderson MA, Bennett RC and Martin TJ (1991)
Localization of parathyroid hormone-related protein in breast
cancer metastases: increased incidence in bone compared
with other sites. Cancer Res 51, 3059-3061.
Price JT, Bonovich MT and Kohn EC (1997) The biochemistry
of cancer dissemination. Crit Rev Biochem Mol Biol 32,
175-253.
Rabbani SA, Gladu J, Liu B and Goltzman D (1995) Regulation
in vivo of the growth of Leydig cell tumors by antisense
ribonucleic acid for parathyroid hormone-related peptide.
Endocrinology 136, 5416-5422.
Rankin W, Grill V and Martin TJ (1997) Parathyroid hormone-
related protein and hypercalcemia. Cancer 80, 1564-1571.
Rizzoli R, Feyen JH, Grau G, Wohlwend A, Sappino AP and
Bonjour JP (1994) Regulation of parathyroid hormone-
related protein production in a human lung squamous cell
carcinoma line. J Endocrinol 143, 333-341.
Roberts AB, and Wakefield LM (2003) The two faces of
transforming growth factor _ in carcinogenesis. Proc Natl
Acad Sci U S A 100, 8621-3.
Rodland KD (2004) The role of the calcium-sensing receptor in
cancer. Cell Calcium 35, 291-295.
Roychowdhury D and Lahn M (2003) Antisense therapy directed
to protein kinase C (Affinitak, LY900003/ISIS 3521):
potential role in breast cancer. Semin Oncol 30, 30-33.
Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro LH,
Wang Q, Zambetti GP and Schuetz JD (2001) Mutant p53
cooperates with ETS and selectively up-regulates human
MDR1 not MRP1. J Biol Chem 276, 39359-39367.
Sanders JL, Chattopadhyay N, Kifor O, Yamaguchi T, Butters
RR and Brown EM (2000) Extracellular calcium-sensing
receptor expression and its potential role in regulating
parathyroid hormone-related peptide secretion in human
breast cancer cell lines. Endocrinology 141, 4357-4364.
Sato K, Onuma E, Yocum RC, and Ogata E (2003) Treatment of
malignancy-associated hypercalcemia and cachexia with
humanized anti-parathyroid hormone-related protein
antibody. Semin Oncol 30, 167-73.
Seidel JJ and Graves BJ (2002) An ERK2 docking site in the
Pointed domain distinguishes a subset of ETS transcription
factors. Genes Dev 16, 127-137.
![Page 157: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/157.jpg)
Gene Therapy and Molecular Biology Vol 8, page 463
463
Sellers RS, Capen CC and Rosol TJ (2002) Messenger RNA
stability of parathyroid hormone-related protein regulated by
transforming growth factor-"1. Mol Cell Endocrinol 188,
37-46.
Shaw LM, Rabinovitz I, Wang HH, Toker A and Mercurio AM
(1997) Activation of phosphoinositide 3-OH kinase by the
6"4 integrin promotes carcinoma invasion. Cell 91, 949-60.
Shen X and Falzon M (2003) Parathyroid hormone-related
protein upregulates integrin expression via an intracrine
pathway in PC-3 prostate cancer cells. Regul Pept 113, 17-
29.
Shen X, Qian L and Falzon M (2004) PTH-related protein
enhances MCF-7 breast cancer cell adhesion, migration and
invasion via an intracrine pathway. Exp Cell Res 294, 420-
433.
Shukeir N, Arakelian A, Chen G, Garde S, Ruiz M, Panchal C
and Rabbani SA (2004) A synthetic 15-mer peptide
(PCK3145) derived from prostate secretory protein can
reduce tumor growth, experimental skeletal metastases and
malignancy-associated hypercalcemia. Cancer Res 64,
5370-5377.
Soifer NE, Dee KE, Insogna KL, Burtis WJ, Matovcik LM, Wu
TL, Milstone LM, Broadus AE, Philbrick WM and Stewart
AF (1992) Parathyroid hormone-related protein. Evidence
for secretion of a novel mid-region fragment by three
different cell types. J Biol Chem 267, 18236-18243.
Southby J, O'Keeffe LM, Martin TJ and Gillespie MT (1995)
Alternative promoter usage and mRNA splicing pathways for
parathyroid hormone-related protein in normal tissues and
tumours. Br J Cancer 72, 702-707.
Strewler GJ (2000) The physiology of parathyroid hormone-
related protein. N Engl J Med 342, 177-185.
Suva LJ, Mather KA, Gillespie MT, Webb GC, Ng KW,
Winslow GA, Wood WI, Martin TJ and Hudson PJ (1989)
Structure of the 5' flanking region of the gene encoding
human parathyroid-hormone-related protein (PTHrP). Gene
77, 95-105.
Suva LJ, Winslow GA, Wettenhall RE, Hammonds RG, Moseley
JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez
H, Chen EY, et al (1987) A parathyroid hormone-related
protein implicated in malignant hypercalcemia: cloning and
expression. Science 237, 893-896.
Tfelt-Hansen J, MacLeod RJ, Chattopadhyay N, Yano S, Quinn
S, Ren X, Terwilliger EF, Schwarz P and Brown EM (2003)
Calcium-sensing receptor stimulates PTHrP release by
pathways dependent on PKC, p38 MAPK, JNK and ERK1/2
in H-500 cells. Am J Physiol Endocrinol Metab 285, E329-
E337.
Thomas RJ, Guise TA, Yin JJ, Elliott J, Horwood NJ, Martin TJ
and Gillespie MT (1999) Breast cancer cells interact with
osteoblasts to support osteoclast formation. Endocrinology
140, 4451-4458.
Tovar Sepulveda VA and Falzon M (2002) Regulation of PTH-
related protein gene expression by vitamin D in PC-3
prostate cancer cells. Mol Cell Endocrinol 190, 115-124.
Tovar Sepulveda VA, Shen X and Falzon M (2002) Intracrine
PTHrP protects against serum starvation-induced apoptosis
and regulates the cell cycle in MCF-7 breast cancer cells.
Endocrinology 143, 596-606.
Truong NU, de BEMD, Papavasiliou V, Goltzman D and Kremer
R (2003) Parathyroid hormone-related peptide and survival
of patients with cancer and hypercalcemia. Am J Med 115,
115-121.
Tumber A, Morgan HM, Meikle MC and Hill PA (2001) Human
breast-cancer cells stimulate the fusion, migration and
resorptive activity of osteoclasts in bone explants. Int J
Cancer 91, 665-672.
Turner PR, Mefford S, Christakos S and Nissenson RA (2000)
Apoptosis mediated by activation of the G protein-coupled
receptor for parathyroid hormone (PTH)/PTH-related protein
(PTHrP). Mol Endocrinol 14, 241-254.
Uy HL, Mundy GR, Boyce BF, Story BM, Dunstan CR, Yin JJ,
Roodman GD and Guise TA (1997) Tumor necrosis factor
enhances parathyroid hormone-related protein-induced
hypercalcemia and bone resorption without inhibiting bone
formation in vivo. Cancer Res 57, 3194-3199.
Vargas SJ, Gillespie MT, Powell GJ, Southby J, Danks JA,
Moseley JM and Martin TJ (1992) Localization of
parathyroid hormone-related protein mRNA expression in
breast cancer and metastatic lesions by in situ hybridization.
J Bone Miner Res 7, 971-979.
Vasavada RC, Wysolmerski JJ, Broadus AE and Philbrick WM
(1993) Identification and characterization of a GC-rich
promoter of the human parathyroid hormone-related peptide
gene. Mol Endocrinol 7, 273-282.
Vetter M, Blumenthal SG, Lindemann RK, Manns J, Wesselborg
S, Thomssen C and Dittmer J (2004) Ets1 is a downstream
effector of protein kinase C in cancer cells. Oncogene in
press
Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM and
Tabin CJ (1996) Regulation of rate of cartilage
differentiation by Indian hedgehog and PTH-related protein.
Science 273, 613-622.
Watanabe T, Yamaguchi K, Takatsuki K, Osame M and Yoshida
M (1990) Constitutive expression of parathyroid hormone-
related protein gene in human T cell leukemia virus type 1
(HTLV-1) carriers and adult T cell leukemia patients that can
be trans-activated by HTLV-1 tax gene. J Exp Med 172,
759-765.
Whitfield JF, Chakravarthy BR, Durkin JP, Isaacs RJ,
Jouishomme H, Sikorska M, Williams RE and Rixon RH
(1992) Parathyroid hormone stimulates protein kinase C but
not adenylate cyclase in mouse epidermal keratinocytes. J
Cell Physiol 150, 299-303.
Wu TL, Vasavada RC, Yang K, Massfelder T, Ganz M, Abbas
SK, Care AD and Stewart AF (1996) Structural and
physiologic characterization of the mid-region secretory
species of parathyroid hormone-related protein. J Biol Chem
271, 24371-24381.
Wysolmerski JJ and Broadus AE (1994) Hypercalcemia of
malignancy: the central role of parathyroid hormone-related
protein. Annu Rev Med 45, 189-200.
Wysolmerski JJ, Dann PR, Zelazny E, Dunbar ME, Insogna KL,
Guise TA and Perkins AS (2002) Overexpression of
parathyroid hormone-related protein causes hypercalcemia
but not bone metastases in a murine model of mammary
tumorigenesis. J Bone Miner Res 17, 1164-1170.
Wysolmerski JJ, Philbrick WM, Dunbar ME, Lanske B,
Kronenberg H and Broadus AE (1998) Rescue of the
parathyroid hormone-related protein knockout mouse
demonstrates that parathyroid hormone-related protein is
essential for mammary gland development. Development
125, 1285-1294.
Wysolmerski JJ, Vasavada R, Foley J, Weir EC, Burtis WJ,
Kukreja SC, Guise TA, Broadus AE and Philbrick WM
(1996) Transactivation of the PTHrP gene in squamous
carcinomas predicts the occurrence of hypercalcemia in
athymic mice. Cancer Res 56, 1043-1049.
Yamaguchi K, Kiyokawa T, Watanabe T, Ideta T, Asayama K,
Mochizuki M, Blank A and Takatsuki K (1994) Increased
serum levels of C-terminal parathyroid hormone-related
protein in different diseases associated with HTLV-1
infection. Leukemia 8, 1708-1711.
Yamato H, Nagai Y, Inoue D, Ohnishi Y, Ueyama Y, Ohno H,
Matsumoto T, Ogata E and Ikeda K (1995) In vivo evidence
![Page 158: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/158.jpg)
Dittmer: Importance of PTHrP for cancer development
464
for progressive activation of parathyroid hormone-related
peptide gene transcription with tumor growth and stimulation
of osteoblastic bone formation at an early stage of humoral
hypercalcemia of cancer. J Bone Miner Res 10, 36-44.
Yang BS, Hauser CA, Henkel G, Colman MS, Van Beveren C,
Stacey KJ, Hume DA, Maki RA and Ostrowski MC (1996)
Ras-mediated phosphorylation of a conserved threonine
residue enhances the transactivation activities of c-Ets1 and
c-Ets2. Mol Cell Biol 16, 538-547.
Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser
R, Massague J, Mundy GR and Guise TA (1999) TGF"
signaling blockade inhibits PTHrP secretion by breast cancer
cells and bone metastases development. J Clin Invest 103,
197-206.
Yoneda T, Williams PJ, Hiraga T, Niewolna M and Nishimura R
(2001) A bone-seeking clone exhibits different biological
properties from the MDA-MB-231 parental human breast
cancer cells and a brain-seeking clone in vivo and in vitro. J
Bone Miner Res 16, 1486-1495.
Yoshida A, Nakamura Y, Shimizu A, Harada M, Kameda Y,
Nagano A, Inaba M and Asaga T (2000) Significance of the
parathyroid hormone-related protein expression in breast
carcinoma. Breast Cancer 7, 215-220.
Jürgen Dittmer
![Page 159: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/159.jpg)
Gene Therapy and Molecular Biology Vol 8, page 465
465
Gene Ther Mol Biol Vol 8, 465-474, 2004
Gene-based vaccines for immunotherapy of prostate
cancer - lessons from the pastReview Article
Milcho Mincheff* and Serguei ZoubakThe George Washington University Medical Center
__________________________________________________________________________________
*Correspondence: Milcho Mincheff, Head, Tumor Immunology Laboratory, Department of Medicine, The George Washington
Medical Center, 2300 Eye Street, N.W., Ross Hall 705, Washington, DC 20037; Tel: 202 994 7765; fax: 202 994 0465; e-mail:
Key words: PSMA, Gene-based vaccine, immunodominance, CTLA-4
Abbreviations: activation-inducible TNF receptor, (AITR); antigen-presenting cells, (APCs); cytotoxic T lymphocyte antigen 4,
(CTLA-4); delayed type hypersensitivity, (DTH); glucocorticoid-induced tumor necrosis factor receptor, (GITR); GITR ligand, (GITR-
L); prostate acidic phosphatase, (PAP); prostate-specific membrane antigen, (PSMA); “secreted” prostate-specific membrane antigen,
(sPMSA); T cell receptor, (TCR); truncated prostate-specific membrane antigen, (tPSMA); tumor-infiltrating lymphocytes, (TILs);
tyrosinase-related protein-1, (TRP-1)
Supported in part by the American Foundation for Biolological Research and by the Bulgarian Foundation for Biomedical
Research.
Supported in part by grant N00014-00-1-0787 from the Office of Naval Research.
Supported in part by award No DAMD17-02-1-0239. The U.S. Army Medical Research Acquisition Activity, 820
Chandler Street, Fort Detrick, MD 21702-5014 is the awarding and administering acquisition office.
The content of the information does not necessarily reflect the position or the policy of the Government, and no official
endorsement should be inferred. For purpose of this article, information includes news releases, articles, manuscripts,
brochures, advertisements, still and motion pictures, speeches, trade association proceedings etc.
Received: 15 October 2004; Accepted: 15 November 2004; electronically published: November 2004
Summary
Gene-based vaccination in its current mode of application is effective in breaking tolerance to a self- or tumor-
associated antigen, but the response is narrow and restricted to few of the potential epitopes due to
immunodominance. In cancer, immunodominance carries the risk of inefficient immune surveillance due to loss of
MHC alleles or point mutations in the recognized sequences. We have found that a T cell response to sub-dominant
epitopes can be primed with transfected dendritic cells in which the newly expressed antigen is purposefully
targeted for proteasomal degradation. Beginning in May 1998, we performed a phase I/II clinical trial for
immunotherapy of prostate cancer that targeted the prostate-specific membrane antigen (PSMA). The primary
objective of the study was to determine the safety of the described vaccines after repeated intradermal injections
(Mincheff et al., 2000a; Mincheff et al., 2000b), since using PSMA as a target could be seriously offset by the
development of autoimmunity (Gilboa, 1999b; Overwijk and Restifo, 2000). So far, six years since the study has
begun, no patient has experienced any short- or long-term side effects, including anti-DNA antibody. Twenty-nine
patients from this random population were treated solely by immunotherapy. Eighteen of them had biochemical
recurrence following radical prostatectomy and eleven responded to the therapy with a PSA drop exceeding 50% of
pre-therapy value. Patients with advanced disease and distant metastases were not influenced by the
immunotherapy despite the fact that they all showed signs of T cell immunity towards PSMA. We found, however,
that the post-vaccination T cell response was directed against only two of the potential 4 PSMA epitopes that had
high affinity for binding. At least in vitro, priming with one of our vaccines led to a poly-epitope response.
Unfortunately, even in such instances, consequent exposure to poly-epitope expressing dendritic cells during re-
immunization led to selection of an immunodominant clone. To alleviate immunodominance and decrease tumor
evasion due to loss of antigenic determinants, a poly-epitope T cell response would need to be maintained. Ensuring
![Page 160: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/160.jpg)
Mincheff and Zoubak: DNA vaccines for prostate cancer
466
such a cytotoxic T cell response, therefore, would require either construction of separate epitope encoding vectors
for boosting, an approach with limited therapeutic application, or identifying conditions during boosting that would
restrict immunodominance. CD4 T cell depletion, GITR-L signaling or CTLA-4 all show promise in achieving this
goal.
I. IntroductionA. Tumor antigen recognitionEvidence that the immune system recognizes tumor
antigens is supported by the existence of tumor infiltrating
lymphocytes but, since cancer cells fail to establish and
support an effective immune milieu, tumors often prevail
and survive. Worsening the problem is the fact that
recognition of cancer antigens on tumor cells seems to
evoke a tolerant state by induction of anergy in antigen-
reactive T cells. In the past few years it has become
increasingly evident that induction of tissue-specific
autoimmunity can lead to tumor destruction. Initially
Coulie and colleagues (Coulie et al, 1994) discovered that
the target for a melanoma-specific CD8+ T cell clone
grown from a melanoma patient was wild-type tyrosinase,
a melanosomal enzyme selectively expressed in
melanocytes. Subsequently, a number of investigators
found that their melanoma-specific CD8+ T cells indeed
recognized melanocyte-specific antigens rather than
melanoma-specific antigens (Bakker et al, 1994; Cox et al,
1994; Kawakami et al, 1994). Most of these antigens
appear to be normal melanosomal proteins, and a number
of them, including tyrosinase, tyrosinase-related protein-1
(TRP-1), TRP-2, and glycoprotein 100 (gp100), are
involved in melanin biosynthesis. Other melanosomal
proteins such as MART1/Melan A have no known
function but are nonetheless melanocyte-specific tissue
differentiation antigens. As time progressed, evidence
accumulated that the dominant targets of immune
responses against tumors were tissue-specific or
differentiation antigens. In contrast, recognition of
peptides derived from unique tumor-specific mutations
represented infrequent reactivities (Coulie et al, 1995;
Wolfel et al, 1995; Robbins et al, 1996). Similar analysis
of the specificities of tumor-infiltrating lymphocytes
(TILs) in prostate cancer biopsies also revealed responses
against tissue-specific antigens (McNeel and Disis, 2000).
Possible targets included the prostate-specific membrane
antigen (PSMA) (Murphy et al, 1996; Eder et al, 2000),
the prostate-specific antigen (PSA) (Kim et al, 1998;
Sanda et al, 1999) and prostate acidic phosphatase (PAP)
(Fong et al, 2001).
The findings that the existing anti-tumor immune
responses are predominantly targeting tissue-specific
antigens open a new venue for cancer immunotherapy. In
practical terms, however, harnessing autoimmunity for
cancer therapy presents several problems:
i. Identification of a target antigen or a combination
thereof that will confer protection. In a recent study
performed in mice, anti-TRP-1 but not anti-TRP-2 or anti-
gp-100 specific T cells induced vitiligo and anti-tumor
immunity (Overwijk et al, 1999). This may have been true
for the particular mouse strain in that study but it does
show that targeting a single antigen based on analysis of T
cell responses from tumor bearing patients or animals may
be misleading. It also shows the shortcomings of using a
single peptide derived from a tissue specific antigen for
raising sustained autoimmunity sufficient to eradicate
tumor. A cancer vaccine against a multitude of peptides
against a tissue-specific antigen will definitely offer some
advantages. This approach is strengthened by the
discovery that, as is the case with different animal strains,
particular autoantigen in different people may manifest
different ability to break tolerance and induce
autoimmunity (Hammer et al, 1997).
ii. The prostate-specific membrane antigen (PSMA)
is a type II integral membrane glycoprotein with a
molecular weight of ~100 kDa (Israeli et al, 1993). It has
a folate hydrolase, as well as neuropeptidase activity.
PSMA is highly expressed in benign prostate secretory-
acinar epithelium, prostatic intraepithelial neoplasia and
prostate adenocarcinoma (Murphy et al, 1998). There is
good evidence that PSMA expression is increased in high
Gleason score tumors and in hormone-refractory tumor
cells (Troyer et al, 1995), which makes it an excellent
target for immunotherapy. More recently, weak expression
has been described in several normal tissues such as a
subset of proximal renal tubules, duodenal and colonic
mucosa. A shorter, alternatively spliced cytosolic form of
PSMA, named PSM’, is the predominant form expressed
in benign prostate epithelium (Grauer et al, 1998).
Recently PSMA expression has been detected in tumor
neovasculature (Chang et al, 1999), as well as in other
healthy tissues both in human (Renneberg et al, 1999) and
in mice (Bacich et al, 2001).
II. Clinical trialBreaking of tolerance to tissue-specific antigens
requires presentation of antigen to T cells by specialized,
antigen presenting cells: the dendritic cells. This can be
performed by a procedure known as naked DNA
immunization. We have already performed a clinical trial
on immunotherapy of prostate cancer using this approach
and we have demonstrated its safety. Beginning in May
1998, we performed in Sofia, Bulgaria, a phase I/II clinical
trial for immunotherapy of prostate cancer that targeted
the prostate-specific membrane antigen (PSMA). The
primary objective of the study was to determine the safety
of the described vaccines after repeated intradermal
injections (Mincheff et al, 2000a, b, 2001), since using
PSMA as a target could be seriously offset by the
development of autoimmunity (Overwijk and Restifo,
2000; Gilboa, 2001).
Sixty-five patients were accessed into the study and
were repeatedly immunized. Fifty-nine of them were in the
study for a period between 2.5 and 3 years. No patient
experienced short or long-term side effects including the
development of anti-DNA antibody (Mincheff et al,
![Page 161: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/161.jpg)
Gene Therapy and Molecular Biology Vol 8, page 467
467
2000a). We also found that repeated local intradermal
injection of rHuGM-CSF (Sargramostim) was a safe
procedure and was well tolerated. Heterologous
immunization regimen that consisted of two initial
intradermal immunizations at 3-week intervals with a
cocktail consisting of 200 µg plasmid DNA and 9 IU/m2
b.s.a., followed by a recombinant adenoviral boost (5x108
PFUs of Ad5PSMA) led to uniform immunization as
judged by the development of delayed type
hypersensitivity reaction (DTH) to PSMA. DTH was
measured 24 and 48 hours following intradermal injection
of the plasmid immunization cocktail and was compared
to reactions developing after intradermal injection at two
separate sites of plasmid cocktail that contained the empty
plasmid backbone instead, or of GM-CSF only. The
patients were heterogeneous with regard to local
advancement of disease, presence of distant metastases, or
hormone treatment and refractoriness, which does not
permit unequivocal interpretation of the results.
Nevertheless, several responders to the immunotherapy
could be identified. Twenty-nine patients from this
random population were treated solely by immunotherapy
(Table 1). Eighteen of them had biochemical recurrence
following radical prostatectomy and eleven responded to
the therapy with a PSA drop exceeding 50% of pre-
therapy value (Table 1). In contrast, only one of the 11
patients with advanced metastatic disease was influenced
by IT with the PSA remaining flat at 10-13 ng/ml and a
decrease in bone pains. The remaining 10 patients
experienced disease progression despite immunizations.
The PSA curve of a typical responder to
immunotherapy is shown on Figure 3. The patient was
prostatectomized in January, 1996, Gleason score 5,
negative margins. Biochemical recurrence was first
detected in February, 1999. Immunotherapy, consisting of
two plasmid immunizations followed by a recombinant
adenoviral boost was initiated in March, 1999. Regular
boosts were performed at 3-4 month intervals alternating
between the plasmid DNA and the adenoviral vector.
Patients with advanced disease and distant metastases
were not influenced by the immunotherapy despite the fact
that they all showed signs of T cell immunity towards
PSMA. Anti-PSMA immunity was assayed by the
presence of PSMA-reactive, !IFN-producing T cells in
their peripheral blood (Figure 2).
The escape of tumor cells from immune surveillance
despite presence of anti-PSMA T cell immunity in those
patients could be mediated through a number of
mechanisms:
III. Tumor evasionA. Tumor evasionEspecially in advanced disease with a big tumor load,
can be mediated through multiple pathways (Gilboa,
1999a; Ohm et al, 1999; Shah and Lee, 2000; Beck et al,
2001; Cefai et al, 2001; Garrido and Algarra, 2001;
Pasche, 2001; Smyth et al, 2001; Carbone and Ohm, 2002;
Dunn et al, 2002; Koyama et al, 2002; Ng et al, 2002;
Schreiber et al, 2002). Tumor cells secrete lymphokines
such as TGF-" and VEGF which suppress dendritic cell
and T cell function (Ohm et al, 1999; Shah and Lee, 2000;
Beck et al, 2001; Pasche, 2001; Dunn et al, 2002; Koyama
et al, 2002). Fas-L and other apoptosis inducing agents are
expressed on tumor cells and induce programmed cell
death in infiltrating lymphocytes (Cefai et al, 2001;
Koyama et al, 2002).
Figure 1. Serum PSA of a patient following radical
prostatectomy (1996), biochemical recurrence (January, 1999)
and immunotherapy (March 1999 – August 2000). SDs represent
three separate determination of PSA in serum derived from three
venipunctures on three consecutive days.
(P-thPSMA plasmid; Ad5 – Ad5PSMA)
Figure 2. . !-interferon-positive CD8+T cells following 6-hour
stimulation of peripheral blood from HLA-A2+ cancer patients
with HLA-A2-specific, PSMA-derived peptide
(MMNDQLMFL). Cells were stained using the FastImmune
CD8 intracellular cytokine detection kit. Diamonds – prior to
immunization (control), squares – post immunization. Data are
from five different experiments involving five patients.
![Page 162: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/162.jpg)
Mincheff and Zoubak: DNA vaccines for prostate cancer
468
B. ImmunodominanceThe response of the host immune system to only a
few of the many possible epitopes in an antigen,
additionally exacerbates the problem (Zinkernagel and
Doherty, 1979; Yin et al, 1993; Yewdell and Bennink,
1999; Wherry et al, 1999; Belz et al, 2000; Chen et al,
2000; Hislop et al, 2002; Palmowski et al, 2002;
Rodriguez et al, 2002). We find gene-based vaccination in
its current mode of application effective in breaking
tolerance to a self-antigen, but the boosting narrows and
restricts the response to few of the potential epitopes
(Mincheff et al, 2003). For example, the post-vaccination
T cell response of some of the HLA A2 patients from the
clinical trial performed by us was directed against only
two of the potential 4 PSMA peptide motifs that had high
affinity for binding (Figure 3).
Table 1. Results from a clinical trial on DNA
immunization for immunotherapy of prostate cancer
Immunotherapy only
Outcome Post-
Prostatectomy
Distant
metastases
Disease Progression 7 10
Improvement
(Responders* to
Therapy)
11 1
Total Number of
Patients
18 11
Responders* – Decrease of PSA exceeding 50% of initial value,
decrease in bone pains (where applicable).
Figure 3. !-IFN-positive CD3+ T cells following 6-hour
stimulation of peripheral blood of HLA-A2+ prostate cancer
patients. The following PSMA peptides were identified by
BIMAS to bind with high affinity to HLA A2, synthesized and
tested in an in vitro assay: MMNDQLMFL (PSMA663),
ALFDIESKV (PSMA711), LMFLERAFI (PSMA668) and
GIUDALFDI (PSMA707). Legend: Stimulation was performed by
a) squares – PSMA663, b) diamonds – PSMA711, c) triangles –
PSMA668. Results with PSMA707 are not shown but are
comparable to pre-immunization values (see Figure 1). Data are
from three separate experiments with blood from one patient.
Cells were stained using the FastImmune CD8 intracellular
cytokine detection kit.
Immunodominance ensures the tight specificity of
the immune reaction and prevents untoward autoimmunity
(Yewdell and Bennink, 1999; Rodriguez et al, 2002).
However, it carries the risk of inefficient immune
surveillance in cases such as cancer in which mutations of
the epitope or downregulation of MHC alleles occur
(Hicklin et al, 1998; Hiraki et al, 1999; Dunn et al, 2002;
Schreiber et al, 2002). Malignant transformation and
tumor progression are frequently associated with loss of
HLA class I antigens. For example, a recent review of the
literature (Ferrone and Marincola, 1995) reported that
~15% and ~55% of surgically removed primary and
metastatic melanoma lesions, respectively, were not
stained in immunohistochemical reactions by monoclonal
antibodies to monomorphic determinants of HLA class I
antigens. Loss or reduced HLA class I antigen expression
enables tumor cells to evade the host's immune response
(Cordon-Cardo et al, 1991; Rivoltini et al, 1995; Hicklin et
al, 1998; de la Salle et al, 1999; Hiraki et al, 1999) and
downregulation of HLA class I antigens in metastases
from patients with malignant melanoma is associated with
poorer prognosis (van Duinen et al, 1988).
Numerous factors combine to establish an
immunodominance hierarchy (Yewdell and Bennink,
1999). They include among others:
1. Lack of T cells that are responsive to a sub-
dominant epitope (Baldwin et al, 1999)
2. Low affinity of the epitope for binding to MHC
(Ma and Kapp, 2001)
3. Ineffective generation and transport of sub-
dominant epitopes by APCs (Mo et al, 2000)
4. Intrinsic control of CD8 T cells to respond to sub-
dominant epitopes (Noel et al, 1996; Boise and Thompson,
1996; Rabinowitz et al, 1996; Kersh et al, 1998; Schwartz
et al, 2001; Guntermann and Alexander, 2002)
5. Extrinsic regulatory networks (T regulatory cells)
(Suri-Payer et al, 1998; Thornton and Shevach, 1998;
Thornton and Shevach, 2000; Levings et al, 2001;
Piccirillo and Shevach, 2001; Shevach, 2001; Sanchez-
Fueyo et al, 2002; Sakaguchi, 2003).
We concentrated our efforts on studying the effects
of the extrinsic regulatory networks, particularly CTLA-4
and GITR-L signaling and T regulatory cell influence on
the establishment of immunodominance during priming
and boosting with a gene-based vaccine.
1. Immunodominance and CTLA-4 inhibitionA homologue of CD28, CTLA-4 also binds to the B-7
family members (Greene et al, 1996; Sanchez-Fueyo et al,
2002) but inhibits T cell activation (van der Merwe et al,
1997). Mice lacking CTLA-4 reveal a striking phenotype
of polyclonal T cell activation and tissue infiltration which
results in death by 3-4 weeks of age, indicating a powerful
regulatory role for CTLA-4 (Thompson and Allison, 1997;
Waterhouse et al, 1995). Weak signals through the T cell
receptor (TCR) are prompt to inhibition (Manzotti et al,
2002) and, at least in vitro, no CTL stimulation to
subdominant epitopes occurs if CTLA-4 is not inhibited
(Mincheff et al, 2004). Alternatively, CTLA-4 may act as
a non-signaling "decoy" receptor reducing the available
ligand for CD28 costimulation (Masteller et al, 2000;
![Page 163: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/163.jpg)
Gene Therapy and Molecular Biology Vol 8, page 469
469
Doyle et al, 2001; Mincheff et al, 2004). No matter what
the mechanism is, inhibition of CTLA-4 may alleviate
immunodominance and thus improve the efficacy of anti-
tumor vaccines.
2. CD4+CD25+ T cell depletion and cancer
immunodominanceEnhanced priming to sub-dominant epitopes by
CTLA-4 inhibition is at least partially mediated through
the inhibition of CD4+CD25+ T cell function (Mincheff et
al, 2004). These CD4+ T cells are a minor subpopulation
(10%) that co-expresses the IL-2 receptor #-chain (CD25)
(Sakaguchi et al, 1995) and they can prevent both the
induction and effector function of autoreactive T cells
(Suri-Payer et al, 1998; Shevach, 2001; Levings et al,
2001). Additionally, they suppress polyclonal T cell
activation in vitro by inhibiting IL-2 production (Thornton
and Shevach, 1998). Based on these data, we speculate
that immunodominance that develops after re-
immunization may be reduced by CD4+CD25+ T cell
depletion prior to boosting.
3. CD4+CD25+ T cell regulationVery little is known of the physiologic regulation of
CD4+CD25+ T cells in vivo (McHugh et al, 2002). Recent
reports suggest that glucocorticoid-induced tumor necrosis
factor receptor (GITR), also known as TNFRSF18 – a
member of the TNF-nerve growth factor receptor gene
superfamily – is predominantly expressed on CD4+CD25+
T cells (McHugh et al, 2002; Shimizu et al, 2002) and
stimulation of GITR abrogates CD4+CD25+ T cell-
mediated suppression (Shimizu et al, 2002). The gene
encoding the natural ligand of murine GITR has been
cloned and characterized. The putative GITR ligand
(GITR-L) is composed of 173 amino acids with features
resembling those of type II membrane proteins and is 51%
identical to the human activation-inducible TNF receptor
(AITR) ligand, TL6. Expression of the GITR-L is
restricted to immature and mature splenic dendritic cells.
GITR-L binds GITR expressed on HEK 293 cells and
triggers NF-$B activation. Functional studies reveal that
soluble CD8-GITR-L prevents CD4+CD25+ regulatory T-
cell-mediated suppressive activities (Kim JD et al, 2003).
Stimulation through this receptor has been shown to break
immunologic tolerance (Shimizu et al, 2002), i.e. it acts
similarly to CD4+CD25+ T cell depletion (Kwon et al,
2003).
IV. Immunodominance during
priming and boostingA. “Truncated” vs. secreted vaccines
(tVacs vs. sVacs). Dendritic cells transfected
with truncated vaccines primes to both
dominant and subdominant epitopes of the
target antigenTo enhance priming to sub-dominant epitopes, we
designed a vaccine (hPSMAT; truncated (tPSMA);
tVac)(Mincheff et al, 2003) whose product encoded for
only the extracellular domain of PSMA. The product,
expressed following transfection with this vector, is
retained in the cytosol and is degraded by the proteasomes.
For the “secreted” (sPMSA) vaccine, a signal peptide
sequence was added to the expression cassette. The
expressed protein following transfection with such
vaccines is glycosylated and directed to the secretory
pathway. Dendritic cells transfected in vitro with tVacs
primed T cells to both dominant and subdominant epitopes
(Mincheff et al, 2003). Subsequent boosting with antigen-
presenting cells (APCs) that expressed both dominant and
sub-dominant epitopes, however, narrowed the immune
response to the dominant ones (Mincheff et al, 2003).
Research from other groups has gained similar results
(Firat et al, 1999; Mateo et al, 1999; Loirat et al, 2000;
Smith et al, 2001; Palmowski et al, 2002). In all these
instances, boosting with polyepitope encoding constructs
resulted in failure to expand polyepitope CTLs. A likely
explanation is that competition between T cells for antigen
on individual APC leads to obscuring of responses to sub-
dominant epitopes when both the dominant and
subdominant epitopes are present on the same APC
(Palmowski et al, 2002; Kedl et al, 2003).
New vaccines (separate DNA vaccines encoding
isolated dominant and subdominant epitopes (Barouch et
al, 2001) might maximize epitope dispersal among APCs
thus inducing broad immunity against numerous epitopes,
dominant and subdominant. Due to the HLA
polymorphism of the human population, however,
construction of such separate vaccines is mainly of
academic interest and will have limited therapeutic
application. Different approaches for the maintenance of a
poly-epitope CTL response following repeated boosting,
therefore, are necessary. Some of those are listed below:
B. CTLA-4 inhibition and
immunodominance. Addition of anti-CTLA-4
antibodies during priming alleviates
immunodominanceWe find that in vitro priming to subdominant
responses is enhanced by CTLA-4 inhibition (Mincheff et
al, 2003). Will similar CTLA-4 inhibition during in vivo
re-immunization (boosting) preserve a poly-epitope CTL
response (Mincheff et al, 2004)? What will be the cytokine
production profile of the sub-dominant T cell clones?
T1/T2 polarization (!-IFN vs. IL-4 secretion) has been
shown to depend on the amount of the antigen and on the
affinity of the peptide for MHC (Kumar et al, 1995), with
weaker signals promoting IL-4 secretion. CTLA-4
inhibition may promote T cell activation at instances of
weak T cell receptor engagement (Manzotti et al, 2002).
Will there be a difference in the cytokine profile of the
sub-dominant clones raised by either minigene re-
immunization or CTLA-4 inhibition? Will sub-dominant
clones be cytotoxic to tumor cells?
C. CD4+CD25+ T cell prior to priming
reduces immunodominanceResults from our laboratory show that the enhanced
priming to sub-dominant epitopes by CTLA-4 inhibition is
at least partially mediated through the inhibition of
![Page 164: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/164.jpg)
Mincheff and Zoubak: DNA vaccines for prostate cancer
470
CD4+CD25+ T cell function (Mincheff et al, 2004). For
obvious reasons, CD4+CD25+ T cell depletion prior to in
vivo boosting may lead to serious side effects (Sakaguchi
et al, 2001). Could alleviation of immunodominance be
achieved by means other than CD4+CD25+ T cell
depletion?
D. In some cases, GITR-signaling during
priming reduces immunodominanceWe find that while CD4+CD25+ T cell depletion
prior to in vitro priming with sVacDCs alleviates
immunodominance, co-transfection of dendritic cells with
GITR-L does so in some but not all cases(Mincheff et al,
2004). Could immunodominance in vivo be restricted by
GITR signaling? Could this be achieved by the co-
administration of anti-GITR antibodies or by enhanced
GITR-L co-expression during re-immunization?
Preliminary results from our laboratory (Mincheff et al,
2004) suggest that in some cases in vitro, co-transfection
of dendritic cells with GITR-L alleviate
immunodominance.
V. ConclusionImmunotherapy is a safe, non-invasive, relatively
inexpensive procedure that can avoid side effects that
often result from surgical, cryosurgical or radiation
therapy. Gene based vaccination is effective in breaking
tolerance to tumor-associated antigens, but the response is
directed towards few of the potential epitopes due to
immunodominance. Tumor cells that have lost the
immunodominant epitope due to mutations are no-longer
recognized and evade immune surveillance. Designing a
protocol for immunotherapy, therefore, necessitates
stimulation of an immune response directed against a
multitude of epitopes. Increasing the number of epitopes
available for presentation to T cells is the initial step. It
mandates increased degradation of the antigen following
DNA immunization and we have already initiated
experimentation directed at this (Mincheff et al, 2003). A
logical continuation to the current work involves
manipulation of the intimate mechanisms controlling the
processes of stimulation and/or suppression of T cells
recognizing the “sub-dominant” epitopes.
ReferencesBacich DJ, Pinto JT, Tong WP and Heston WD (2001) Cloning,
expression, genomic localization, and enzymatic activities of
the mouse homolog of prostate-specific membrane
antigen/NAALADase/folate hydrolase. Mamm Genome 12,
117-123.
Bakker AB, Schreurs MW, de Boer AJ, Kawakami Y, Rosenberg
SA, Adema GJ and Figdor CG (1994) Melanocyte lineage-
specific antigen gp100 is recognized by melanoma-derived
tumor-infiltrating lymphocytes. J Exp Med 179, 1005-1009.
Baldwin KK, Trenchak BP, Altman JD and Davis MM (1999)
Negative selection of T cells occurs throughout thymic
development. J Immunol 163, 689-698.
Barouch DH, Craiu A, Santra S, Egan MA, Schmitz JE, Kuroda
MJ, Fu TM, Nam JH, Wyatt LS, Lifton MA, Krivulka GR,
Nickerson CE, Lord CI, Moss B, Lewis MG, Hirsch VM,
Shiver JW and Letvin NL (2001) Elicitation of high-
frequency cytotoxic T-lymphocyte responses against both
dominant and subdominant simian-human immunodeficiency
virus epitopes by DNA vaccination of rhesus monkeys. J
Virol 75, 2462-2467.
Beck C, Schreiber H and Rowley D (2001) Role of TGF-" in
immune-evasion of cancer. Microsc Res Tech 52, 387-395.
Belz GT, Stevenson PG and Doherty PC (2000) Contemporary
analysis of MHC-related immunodominance hierarchies in
the CD8+ T cell response to influenza A viruses. J Immunol
165, 2404-2409.
Boise LH and Thompson CB (1996) Hierarchical control of
lymphocyte survival. Science 274, 67-68.
Carbone JE and Ohm DP (2002) Immune dysfunction in cancer
patients. Oncology (Huntingt) 16, 11-18.
Cefai D, Favre L, Wattendorf E, Marti A, Jaggi R and Gimmi
CD (2001) Role of Fas ligand expression in promoting
escape from immune rejection in a spontaneous tumor
model. Int J Cancer 91, 529-537.
Chang SS, Reuter VE, Heston WD, Bander NH, Grauer LS and
Gaudin PB (1999) Five different anti-prostate-specific
membrane antigen (PSMA) antibodies confirm PSMA
expression in tumor-associated neovasculature. Cancer Res
59, 3192-3198.
Chen W, Anton LC, Bennink JR and Yewdell JW (2000)
Dissecting the multifactorial causes of immunodominance in
class I-restricted T cell responses to viruses. Immunity 12,
83-93.
Cordon-Cardo C, Fuks Z, Drobnjak M, Moreno C, Eisenbach L
and Feldman M (1991) Expression of HLA-A,B,C antigens
on primary and metastatic tumor cell populations of human
carcinomas. Cancer Res 51, 6372-6380.
Coulie PG, Brichard V, Van Pel A, Wolfel T, Schneider J,
Traversari C, Mattei S, De Plaen E, Lurquin C and Szikora
JP (1994) A new gene coding for a differentiation antigen
recognized by autologous cytolytic T lymphocytes on HLA-
A2 melanomas. J Exp Med 180, 35-42.
Coulie PG, Lehmann F, Lethe B, Herman J, Lurquin C,
Andrawiss M and Boon T (1995) A mutated intron sequence
codes for an antigenic peptide recognized by cytolytic T
lymphocytes on a human melanoma. Proc Natl Acad Sci U
S A 92, 7976-7980.
Cox AL, Skipper J, Chen Y, Henderson RA, Darrow TL,
Shabanowitz J, Engelhard VH, Hunt DF and Slingluff CL, Jr
(1994) Identification of a peptide recognized by five
melanoma-specific human cytotoxic T cell lines. Science
264, 716-719.
de la Salle H, Zimmer J, Fricker D, Angenieux C, Cazenave JP,
Okubo M, Maeda H, Plebani A, Tongio MM, Dormoy A and
Hanau D (1999) HLA class I deficiencies due to mutations in
subunit 1 of the peptide transporter TAP1. J Clin Invest 103,
R9-R13.
Doyle AM, Mullen AC, Villarino AV, Hutchins AS, High FA,
Lee HW, Thompson CB and Reiner SL (2001) Induction of
cytotoxic T lymphocyte antigen 4 (CTLA-4) restricts clonal
expansion of helper T cells. J Exp Med 194, 893-902.
Dunn GP, Bruce AT, Ikeda H, Old LJ and Schreiber RD (2002)
Cancer immunoediting: from immunosurveillance to tumor
escape. Nat Immunol 3, 991-998.
Eder JP, Kantoff PW, Roper K, Xu GX, Bubley GJ, Boyden J,
Gritz L, Mazzara G, Oh WK, Arlen P, Tsang KY, Panicali D,
Schlom J and Kufe DW (2000) A phase I trial of a
recombinant vaccinia virus expressing prostate-specific
antigen in advanced prostate cancer. Clin Cancer Res 6,
1632-1638.
Ferrone S and Marincola FM (1995) Loss of HLA class I
antigens by melanoma cells: molecular mechanisms,
functional significance and clinical relevance. Immunol
Today 16, 487-494.
![Page 165: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/165.jpg)
Gene Therapy and Molecular Biology Vol 8, page 471
471
Firat H, Garcia-Pons F, Tourdot S, Pascolo S, Scardino A, Garcia
Z, Michel ML, Jack RW, Jung G, Kosmatopoulos K, Mateo
L, Suhrbier A, Lemonnier FA and Langlade-Demoyen P
(1999) H-2 class I knockout, HLA-A2.1-transgenic mice: a
versatile animal model for preclinical evaluation of antitumor
immunotherapeutic strategies. Eur J Immunol 29, 3112-
3121.
Fong L, Brockstedt D, Benike C, Breen JK, Strang G, Ruegg CL
and Engleman EG (2001) Dendritic cell-based xenoantigen
vaccination for prostate cancer immunotherapy. J Immunol
167, 7150-7156.
Garrido F and Algarra I (2001) MHC antigens and tumor escape
from immune surveillance. Adv Cancer Res 83, 117-158.
Gilboa E (1999a) How tumors escape immune destruction and
what we can do about it. Cancer Immunol Immunother 48,
382-385.
Gilboa E (1999b) The makings of a tumor rejection antigen.
Immunity 11, 263-270.
Gilboa E (2001) The risk of autoimmunity associated with tumor
immunotherapy. Nat Immunol 2, 789-792.
Grauer LS, Lawler KD, Marignac JL, Kumar A, Goel AS and
Wolfert RL (1998) Identification, purification, and
subcellular localization of prostate-specific membrane
antigen PSM' protein in the LNCaP prostatic carcinoma cell
line. Cancer Res 58, 4787-4789.
Greene JL, Leytze GM, Emswiler J, Peach R, Bajorath J, Cosand
W and Linsley PS (1996) Covalent dimerization of
CD28/CTLA-4 and oligomerization of CD80/CD86 regulate
T cell costimulatory interactions. J Biol Chem 271, 26762-
26771.
Guntermann C and Alexander DR (2002) CTLA-4 suppresses
proximal TCR signaling in resting human CD4(+) T cells by
inhibiting ZAP-70 Tyr(319) phosphorylation: a potential role
for tyrosine phosphatases. J Immunol 168, 4420-4429.
Hammer J, Sturniolo T and Sinigaglia F (1997) HLA class II
peptide binding specificity and autoimmunity. Adv
Immunol 66, 67-100.
Hicklin DJ, Wang Z, Arienti F, Rivoltini L, Parmiani G and
Ferrone S (1998) "2-Microglobulin mutations, HLA class I
antigen loss, and tumor progression in melanoma. J Clin
Invest 101, 2720-2729.
Hiraki A, Kaneshige T, Kiura K, Ueoka H, Yamane H, Tanaka
M and Harada M (1999) Loss of HLA haplotype in lung
cancer cell lines: implications for immunosurveillance of
altered HLA class I/II phenotypes in lung cancer. Clin
Cancer Res 5, 933-936.
Hislop AD, Annels NE, Gudgeon NH, Leese AM and Rickinson
AB (2002) Epitope-specific evolution of human CD8(+) T
cell responses from primary to persistent phases of Epstein-
Barr virus infection. J Exp Med 195, 893-905.
Israeli RS, Powell CT, Fair WR and Heston WD (1993)
Molecular cloning of a complementary DNA encoding a
prostate-specific membrane antigen. Cancer Res 53, 227-
230.
Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Sakaguchi
K, Appella E, Yannelli JR, Adema GJ, Miki T and
Rosenberg SA (1994) Identification of a human melanoma
antigen recognized by tumor-infiltrating lymphocytes
associated with in vivo tumor rejection. Proc Natl Acad Sci
U S A 91, 6458-6462.
Kedl RM, Kappler JW and Marrack P (2003) Epitope
dominance, competition and T cell affinity maturation. Curr
Opin Immunol 15, 120-127.
Kersh EN, Shaw AS and Allen PM (1998) Fidelity of T cell
activation through multistep T cell receptor zeta
phosphorylation. Science 281, 572-575.
Kim JD, Choi BK, Bae JS, Lee UH, Han IS, Lee HW, Youn BS,
Vinay DS and Kwon BS (2003) Cloning and characterization
of GITR ligand. Genes Immun 4, 564-569.
Kim JJ, Trivedi NN, Wilson DM, Mahalingam S, Morrison L,
Tsai A, Chattergoon MA, Dang K, Patel M, Ahn L, Boyer
JD, Chalian AA, Schoemaker H, Kieber-Emmons T,
Agadjanyan MA, Weiner DB and Shoemaker H (1998)
Molecular and immunological analysis of genetic prostate
specific antigen (PSA) vaccine. Oncogene 17, 3125-3135.
Koyama S, Koike N and Adachi S (2002) Expression of TNF-
related apoptosis-inducing ligand (TRAIL) and its receptors
in gastric carcinoma and tumor-infiltrating lymphocytes: a
possible mechanism of immune evasion of the tumor. J
Cancer Res Clin Oncol 128, 73-79.
Kumar V, Bhardwaj V, Soares L, Alexander J, Sette A and
Sercarz E (1995) Major histocompatibility complex binding
affinity of an antigenic determinant is crucial for the
differential secretion of interleukin 4/5 or interferon g by T
cells. Proc Natl Acad Sci U S A 92, 9510-9514.
Kwon B, Kim BS, Cho HR, Park JE and Kwon BS (2003)
Involvement of tumor necrosis factor receptor
superfamily(TNFRSF) members in the pathogenesis of
inflammatory diseases. Exp Mol Med 35, 8-16.
Levings MK, Sangregorio R and Roncarolo MG (2001) Human
cd25(+)cd4(+) t regulatory cells suppress naive and memory
T cell proliferation and can be expanded in vitro without loss
of function. J Exp Med 193, 1295-1302.
Loirat D, Lemonnier FA and Michel ML (2000) Multiepitopic
HLA-A*0201-restricted immune response against hepatitis B
surface antigen after DNA-based immunization. J Immunol
165, 4748-4755.
Ma H and Kapp JA (2001) Peptide affinity for MHC influences
the phenotype of CD8(+) T cells primed in vivo. Cell
Immunol 214, 89-96.
Manzotti CN, Tipping H, Perry LC, Mead KI, Blair PJ, Zheng Y
and Sansom DM (2002) Inhibition of human T cell
proliferation by CTLA-4 utilizes CD80 and requires CD25+
regulatory T cells. Eur J Immunol 32, 2888-2896.
Masteller EL, Chuang E, Mullen AC, Reiner SL and Thompson
CB (2000) Structural analysis of CTLA-4 function in vivo. J
Immunol 164, 5319-5327.
Mateo L, Gardner J, Chen Q, Schmidt C, Down M, Elliott SL,
Pye SJ, Firat H, Lemonnier FA, Cebon J and Suhrbier A
(1999) An HLA-A2 polyepitope vaccine for melanoma
immunotherapy. J Immunol 163, 4058-4063.
McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach
EM, Collins M and Byrne MC (2002) CD4(+)CD25(+)
immunoregulatory T cells: gene expression analysis reveals a
functional role for the glucocorticoid-induced TNF receptor.
Immunity 16, 311-323.
McNeel DG and Disis ML (2000) Tumor vaccines for the
management of prostate cancer. Arch Immunol Ther Exp
(Warsz) 48, 85-93.
Mincheff M, Altankova I, Zoubak S, Tchakarov S, Botev C,
Petrov S, Krusteva E, Kurteva G, Kurtev P, Dimitrov V,
Ilieva M, Georgiev G, Lissitchkov T, Chernozemski I and
Meryman HT (2001) In vivo transfection and/or cross-
priming of dendritic cells following DNA and adenoviral
immunizations for immunotherapy of cancer--changes in
peripheral mononuclear subsets and intracellular IL-4 and
IFN-g lymphokine profile. Crit Rev Oncol Hematol 39,
125-132.
Mincheff M, Tchakarov S, Zoubak S, Loukinov D, Botev C,
Altankova I, Georgiev G, Petrov S and Meryman HT
(2000a) Naked DNA and adenoviral immunizations for
immunotherapy of prostate cancer: a phase I/II clinical trial.
Eur Urol 38, 208-217.
![Page 166: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/166.jpg)
Mincheff and Zoubak: DNA vaccines for prostate cancer
472
Mincheff M, Zoubak S, Altankova I, Tchakarov S,
Makogonenko Y, Botev C, Ignatova I, Dimitrov R,
Madarzhieva K, Hammett M, Pomakov Y, Meryman H and
Lissitchkov T (2003) Human dendritic cells genetically
engineered to express cytosolically retained fragment of
prostate-specific membrane antigen prime cytotoxic T-cell
responses to multiple epitopes. Cancer Gene Ther 10, 907-
917.
Mincheff M, Zoubak S, Altankova I, Tchakarov S, Pogribnyy P,
Makogonenko Y, Botev C and Meryman HT (2004)
Depletion of CD25+ cells from human T-cell enriched
fraction eliminates immunodominance during priming and
boosting with genetically modified dendritic cells. Cancer
Gene Ther, (accepted).
Mincheff M, Zoubak S and Meryman HT (2000b) Use of in
Vitro and in Vivo Genetically Manipulated Cells for
Immunotherapy of Cancer. In: Th Smit Sibinga C (ed).
Proceedings of the 25th International Symposium of Blood
Transfusion, Groningen, The Netherlands, 1999. Kluwer
Academic Publishers: Dordrecht, Boston and London, pp.
11-19.
Mo AX, van Lelyveld SF, Craiu A and Rock KL (2000)
Sequences that flank subdominant and cryptic epitopes
influence the proteolytic generation of MHC class I-
presented peptides. J Immunol 164, 4003-4010.
Murphy G, Tjoa B, Ragde H, Kenny G and Boynton A (1996)
Phase I clinical trial: T-cell therapy for prostate cancer using
autologous dendritic cells pulsed with HLA-A0201-specific
peptides from prostate-specific membrane antigen. Prostate
29, 371-380.
Murphy GP, Elgamal AA, Su SL, Bostwick DG and Holmes EH
(1998) Current evaluation of the tissue localization and
diagnostic utility of prostate specific membrane antigen.
Cancer 83, 2259-2269.
Ng CS, Novick AC, Tannenbaum CS, Bukowski RM and Finke
JH (2002) Mechanisms of immune evasion by renal cell
carcinoma: tumor-induced T-lymphocyte apoptosis and
NFkB suppression. Urology 59, 9-14.
Noel PJ, Boise LH and Thompson CB (1996) Regulation of T
cell activation by CD28 and CTLA4. Adv Exp Med Biol
406, 209-217.
Ohm JE, Shurin MR, Esche C, Lotze MT, Carbone DP and
Gabrilovich DI (1999) Effect of vascular endothelial growth
factor and FLT3 ligand on dendritic cell generation in vivo. J
Immunol 163, 3260-3268.
Overwijk WW, Lee DS, Surman DR, Irvine KR, Touloukian CE,
Chan CC, Carroll MW, Moss B, Rosenberg SA and Restifo
NP (1999) Vaccination with a recombinant vaccinia virus
encoding a "self" antigen induces autoimmune vitiligo and
tumor cell destruction in mice: requirement for CD4(+) T
lymphocytes. Proc Natl Acad Sci U S A 96, 2982-2987.
Overwijk WW and Restifo NP (2000) Autoimmunity and the
immunotherapy of cancer: targeting the "self" to destroy the
"other". Crit Rev Immunol 20, 433-450.
Palmowski MJ, Choi EM, Hermans IF, Gilbert SC, Chen JL,
Gileadi U, Salio M, Van Pel A, Man S, Bonin E, Liljestrom
P, Dunbar PR and Cerundolo V (2002) Competition between
CTL narrows the immune response induced by prime-boost
vaccination protocols. J Immunol 168, 4391-4398.
Pasche B (2001) Role of transforming growth factor " in cancer.
J Cell Physiol 186, 153-168.
Piccirillo CA and Shevach EM (2001) Cutting edge: control of
CD8+ T cell activation by CD4+CD25+ immunoregulatory
cells. J Immunol 167, 1137-1140.
Rabinowitz JD, Beeson C, Wulfing C, Tate K, Allen PM, Davis
MM and McConnell HM (1996) Altered T cell receptor
ligands trigger a subset of early T cell signals. Immunity 5,
125-135.
Renneberg H, Friedetzky A, Konrad L, Kurek R, Weingartner K,
Wennemuth G, Tunn UW and Aumuller G (1999) Prostate
specific membrane antigen (PSM) is expressed in various
human tissues: implication for the use of PSM reverse
transcription polymerase chain reaction to detect
hematogenous prostate cancer spread. Urol Res 27, 23-27.
Rivoltini L, Barracchini KC, Viggiano V, Kawakami Y, Smith
A, Mixon A, Restifo NP, Topalian SL, Simonis TB,
Rosenberg SA and et al (1995) Quantitative correlation
between HLA class I allele expression and recognition of
melanoma cells by antigen-specific cytotoxic T lymphocytes.
Cancer Res 55, 3149-3157.
Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D,
Appella E and Rosenberg SA (1996) A mutated "-catenin
gene encodes a melanoma-specific antigen recognized by
tumor infiltrating lymphocytes. J Exp Med 183, 1185-1192.
Rodriguez F, Harkins S, Slifka MK and Whitton JL (2002)
Immunodominance in virus-induced CD8(+) T-cell
responses is dramatically modified by DNA immunization
and is regulated by g interferon. J Virol 76, 4251-4259.
Sakaguchi S (2003) Regulatory T cells: mediating compromises
between host and parasite. Nat Immunol 4, 10-11.
Sakaguchi S, Sakaguchi N, Asano M, Itoh M and Toda M (1995)
Immunologic self-tolerance maintained by activated T cells
expressing IL-2 receptor #-chains (CD25). Breakdown of a
single mechanism of self-tolerance causes various
autoimmune diseases. J Immunol 155, 1151-1164.
Sanchez-Fueyo A, Weber M, Domenig C, Strom TB and Zheng
XX (2002) Tracking the immunoregulatory mechanisms
active during allograft tolerance. J Immunol 168, 2274-
2281.
Sanda MG, Smith DC, Charles LG, Hwang C, Pienta KJ, Schlom
J, Milenic D, Panicali D and Montie JE (1999) Recombinant
vaccinia-PSA (PROSTVAC) can induce a prostate-specific
immune response in androgen-modulated human prostate
cancer. Urology 53, 260-266.
Schreiber H, Wu TH, Nachman J and Kast WM (2002)
Immunodominance and tumor escape. Semin Cancer Biol
12, 25-31.
Schwartz JC, Zhang X, Fedorov AA, Nathenson SG and Almo
SC (2001) Structural basis for co-stimulation by the human
CTLA-4/B7-2 complex. Nature 410, 604-608.
Shah AH and Lee C (2000) TGF-"-based immunotherapy for
cancer: breaching the tumor firewall. Prostate 45, 167-172.
Shevach EM (2001) Certified professionals: CD4(+)CD25(+)
suppressor T cells. J Exp Med 193, F41-46.
Shimizu J, Yamazaki S, Takahashi T, Ishida Y and Sakaguchi S
(2002) Stimulation of CD25(+)CD4(+) regulatory T cells
through GITR breaks immunological self-tolerance. Nat
Immunol 3, 135-142.
Smith SG, Patel PM, Porte J, Selby PJ and Jackson AM (2001)
Human dendritic cells genetically engineered to express a
melanoma polyepitope DNA vaccine induce multiple
cytotoxic T-cell responses. Clin Cancer Res 7, 4253-4261.
Smyth MJ, Godfrey DI and Trapani JA (2001) A fresh look at
tumor immunosurveillance and immunotherapy. Nat
Immunol 2, 293-299.
Suri-Payer E, Amar AZ, Thornton AM and Shevach EM (1998)
CD4+CD25+ T cells inhibit both the induction and effector
function of autoreactive T cells and represent a unique
lineage of immunoregulatory cells. J Immunol 160, 1212-
1218.
Thompson CB and Allison JP (1997) The emerging role of
CTLA-4 as an immune attenuator. Immunity 7, 445-450.
Thornton AM and Shevach EM (1998) CD4+CD25+
immunoregulatory T cells suppress polyclonal T cell
activation in vitro by inhibiting interleukin 2 production. J
Exp Med 188, 287-296.
![Page 167: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/167.jpg)
Gene Therapy and Molecular Biology Vol 8, page 473
473
Thornton AM and Shevach EM (2000) Suppressor effector
function of CD4+CD25+ immunoregulatory T cells is
antigen nonspecific. J Immunol 164, 183-190.
Troyer JK, Beckett ML and Wright GL, Jr (1995) Detection and
characterization of the prostate-specific membrane antigen
(PSMA) in tissue extracts and body fluids. Int J Cancer 62,
552-558.
van der Merwe PA, Bodian DL, Daenke S, Linsley P and Davis
SJ (1997) CD80 (B7-1) binds both CD28 and CTLA-4 with a
low affinity and very fast kinetics. J Exp Med 185, 393-403.
van Duinen SG, Ruiter DJ, Broecker EB, van der Velde EA,
Sorg C, Welvaart K and Ferrone S (1988) Level of HLA
antigens in locoregional metastases and clinical course of the
disease in patients with melanoma. Cancer Res 48, 1019-
1025.
Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian
A, Lee KP, Thompson CB, Griesser H and Mak TW (1995)
Lymphoproliferative disorders with early lethality in mice
deficient in Ctla-4. Science 270, 985-988.
Wherry EJ, Puorro KA, Porgador A and Eisenlohr LC (1999)
The induction of virus-specific CTL as a function of
increasing epitope expression: responses rise steadily until
excessively high levels of epitope are attained. J Immunol
163, 3735-3745.
Wolfel T, Hauer M, Schneider J, Serrano M, Wolfel C,
Klehmann-Hieb E, De Plaen E, Hankeln T, Meyer zum
Buschenfelde KH and Beach D (1995) A p16INK4a-
insensitive CDK4 mutant targeted by cytolytic T
lymphocytes in a human melanoma. Science 269, 1281-
1284.
Yewdell JW and Bennink JR (1999) Immunodominance in major
histocompatibility complex class I-restricted T lymphocyte
responses. Annu Rev Immunol 17, 51-88.
Yin L, Poirier G, Neth O, Hsuan JJ, Totty NF and Stauss HJ
(1993) Few peptides dominate cytotoxic T lymphocyte
responses to single and multiple minor histocompatibility
antigens. Int Immunol 5, 1003-1009.
Zinkernagel RM and Doherty PC (1979) MHC-restricted
cytotoxic T cells: studies on the biological role of
polymorphic major transplantation antigens determining T-
cell restriction-specificity, function, and responsiveness. Adv
Immunol 27, 51-177.
Milcho Mincheff Serguei Zoubak
![Page 168: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/168.jpg)
Mincheff and Zoubak: DNA vaccines for prostate cancer
474
![Page 169: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/169.jpg)
Gene Therapy and Molecular Biology Vol 8, page 481
481
Figure 4. Effect of the HSFE on retroviral !-globin promoter DNase I sensitivity. (a) r!G, rH!G, and r2H!G construct maps
showing EcoR I (E), Asc I (A), and Sst I (S), and restriction sites, location of Southern blot probe, and size of parental band. (b) DNase I
assays of r!G, rH!G, and r2H!G pools. Intact nuclei were incubated with increasing concentrations of DNase I. Genomic DNA was
digested with the appropriate restriction enzymes. Parental bands are indicated by P, DNase I hypersensitive sites by arrows. (c)
Locations of the DNase I HSs for r!G, rH!G, and r2H!G. An approximately 110 bp HS maps over 20% of the promoter of integrated
r!G constructs. In the rH!G pool, the HS is approximately 230 bp in size and maps to the HSFE and the first 20 bp of the promoter. The
HS in the r2H!G pool is approximately 190 bp in size and maps to the promoter and 3' HSFE.
![Page 170: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/170.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
482
The Bln I concentration at which maximum promoter
digestion was achieved was in excess of 80 units per
reaction (data not shown). Pools were digested with 100
units of Bln I and representative Southern blot analyses are
shown in Figure 5b. In pools containing the r!G vector,
45% of the promoters were digested by Bln I (Figure 5c).
When a single HSFE or the enhancer plus an HSFE were
added, the proportion of accessible promoters increased by
5%. Tandem copies of the HSFE were able to increase the
percentage of open promoters to 56% (p < .01).
Figure 5. Quantitative effects of
the HSFE on retroviral !-globin
promoter accessibility. (a) r!G,
rH!G, rEH!G, and r2H!G construct
maps showing EcoR I (E), Sst I (S),
Xma I and Xho I restriction sites,
site of Bln I digestion (arrow) and
sizes of parental and Bln I digestion
products. (b) Representative
Southern blots from r!G, rH!G,
rEH!G, and r2H!G pools. Three
pools for each construct are shown.
Intact nuclei were incubated with
100 units of Bln I. Genomic DNA
was then isolated and digested with
the appropriate restriction enzymes
for Southern blotting. Parental bands
are indicated by P and sub-bands
resulting from Bln I digestion are
indicated with arrowheads. (c) Mean
percentage cutting +/- 1 SD for all
constructs (n=4). The p-values were
determined by Student's t-test.
![Page 171: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/171.jpg)
Gene Therapy and Molecular Biology Vol 8, page 483
483
B. The effect of the HSFE on human !-
globin gene expressionTo address the effects of the HSFE on gene
expression, we chemically induced globin gene expression
with hexamethylene bisacetamide (HMBA) and performed
ribonuclease protection assays on the isolated RNA
(Figure 6a). Human !-globin expression was normalized
to mouse "-globin expression and corrected for both the
average copy number of the pool and the different specific
activities of the probes. In pools containing the r!G vector,
human !-globin expression was 2.6% +/- 0.8% of mouse
!-globin (Figure 6b). Upon incorporation of the HSFE, !-
globin expression increased to 9.6%, a significant increase
of nearly 4-fold (p < .01) and incorporation of tandem
copies of the HSFE resulted in a 5-fold increase in !-
globin expression (p < .001). With the addition of the 36
bp HS2 enhancer 5' to the HSFE, human !-globin
expression also increased 4-fold compared to the promoter
alone (p = .01). When the positions of the HSFE and
enhancer were exchanged, !-globin expression was
increased only 3-fold (p = .01). There was no observable
difference between placing the enhancer element 5’ to the
HSFE compared to 3’.
IV. DiscussionWe have demonstrated that the HSFE is able to form
its characteristic structure in the context of a retroviral
vector and that tandem HSFEs increased the extent of
DNase I accessible promoter chromatin structure.
Furthermore, the HSFE, when present as single or tandem
copies, is able to increase retroviral !-globin expression up
to 5-fold compared to the promoter alone. These results
indicate a tissue-specific chromatin-opening element such
as the HSFE is able to significantly increase gene
expression in the context of a retroviral vector.
Additionally, an advantage of using the 101 bp HSFE
with a retroviral vector is that the probability of genetic
rearrangement and other technical barriers associated with
the use of larger LCR fragments vectors is reduced
By itself, the integrated human !-globin promoter
can form a weak hypersensitive site. The formation of this
site is consistent with previous reports describing the
formation of a weak hypersensitive site by the globin
promoters alone (Tuan et al, 1985; Forrester et al, 1986;
Dhar et al, 1990; Iler et al, 1999). The inclusion of the
HSFE doubled the region of hypersensitive chromatin in
the neighborhood of the !-globin promoter to
approximately 230 bp. However, the larger HS is almost
entirely localized to the HSFE sequence, encompassing
approximately 20% of the !-globin promoter. Although
the majority of promoter region is not hypersensitive for
either construct, the two critical CACCC boxes, which
bind EKLF, do reside within the HS (Miller and Bieker,
1993). However, when tandem copies of the HSFE were
used, the detected HS mapped to a region that included the
entire minimal promoter. This HS is formed by the 3’
HSFE. We observed a similar localization of the 3’ HS
when we stably transfected the tandem HSFE cassette into
MEL cells. We were unable to observe the HS formed by
the proximal HSFE, although in earlier studies we have
shown that both HSFE elements can establish distinct HSs.
Overall, the structural characteristics of the HSFE are still
intact in the context of a retroviral vector.
The incorporation of the HSFE did not increase the
percentage of open promoters. This was a somewhat
surprising result, as we had previously observed that the
addition of the HSFE resulted in a 20% increase in the
Figure 6. Effect of the HSFE on retroviral !-globin
expression. (a) Representative ribonuclease protection assays for
each set of pools for all constructs. Human bone marrow and
mouse fetal liver controls are indicated. Experimental samples
are underneath the black bar. Protected human !-globin (H!) and
mouse "-globin (M") mRNAs are indicated by arrows. Copy
numbers for each pool is shown in the top row of numbers
beneath each assay. Human !-globin gene expression for each
pool is shown in the second row of numbers. Expression was
quantified using densitometry. (b) Mean human b-globin
expression of each construct (n = 4). P-values were determined
by t-test.
![Page 172: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/172.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
484
percentage of open promoters (Iler et al, 1999). However,
tandem HSFEs (r2H!G) were able to significantly
increase the number of accessible promoters by 10%. The
question remains whether such an increase is
physiologically meaningful. Thus, it appears that our
elements have the capability to increase the size of the
region of hypersensitive chromatin but not the proportion
of promoters in an open configuration.
Even though inclusion of the HSFE did not cause
formation of hypersensitive chromatin along the entire
promoter, its presence resulted in a significant four-fold
increase in human !-globin expression compared to the
promoter alone. This increase was comparable to that
observed when we stably transfected the HSFE into MEL
cells (Nemeth et al, 2001). Novak et al, demonstrated a
similar 6-fold increase in clones containing a !-globin
retroviral vector incorporating the entire HS4 (Novak et al,
1990). Overall, we observed significant increases in gene
expression with all combinations tested. Combining the
HS2 enhancer element with the HSFE did not increase
gene expression compared to a single HSFE. Since the 36
bp enhancer has been shown to double expression in a !-
globin retroviral vector and the HSFE alone leads to a 4-
fold increase, the addition of the enhancer may be
redundant as the HSFE has already augmented expression
in all the permissive cells in the pool population (Liu et al,
1992).
The mechanism by which the HSFE augments gene
expression is still not clear. Our original hypothesis was
that the HSFE would increase the opportunity for critical
transcription factors to interact with the minimal !-globin
promoter resulting in increased transcription regardless of
the chromatin structure in which the vector was integrated.
However, our results, combined with other studies,
indicate that expression levels do not always correlate with
chromatin accessibility (Milot et al, 1996; Pikaart et al,
1998; Nemeth et al, 2001).
A simple model of increased transcription factor
accessibility does not explain the increased expression
observed with the HSFE. HS4, where the HSFE was first
mapped, has been shown to contain no classical enhancer
activity when studied in transient assays (Tuan et al,
1989). The HSFE may be inducing more subtle changes in
chromatin structure such as alterations in promoter
nucleosome acetylation or methylation patterns by
bringing important factors in these processes in proximity
to the promoter. For example, NF-E2, which binds to the
HSFE, has been shown to play a role in histone
hyperacetylation (Kiekhaefer et al, 2002). HSFE-bound
proteins may also recruit factors, such as CBP and p300,
which have endogenous histone acetyltransferase activity
and have been implicated in hematopoietic transcription
(reviewed in Blobel et al, 2000).
In order to meet the minimum level of in vivo
expression (roughly 15 to 20% of endogenous globin
expression) that could be therapeutically beneficial, cis-
elements in addition to the HSFE will have to be
considered. One candidate is the 1.2 kb fragment from
HS4 of the chicken !-globin LCR that has been shown to
act as a chromatin insulator in several in vitro and in vivo
systems (Chung et al, 1993; Pikaart et al, 1998). In
retroviral vectors, it has been shown that the insulator
increases gene expression by increasing the probability of
transcription (Rivella et al, 1998; Emery et al, 2000).
Another example is the inclusion of scaffold attachment
regions in retroviral vectors to achieve increased
expression (Murray et al, 2000). Potentially, the use of
different chromatin remodeling elements to achieve
specific molecular effects will be a useful strategy in the
development of vectors capable of long-term, high-level
therapeutic gene expression.
AcknowledgmentsThe authors wish to thank Drs. Brian Sorrentino, Elio
Vanin, Steve Fiering, Phillipe Leboulch and Jane
McInerney for reagents and helpful discussion. This
research was supported by grants HL52243 and HL73442
(CHL). MN was the recipient of Ryan Foundation and
Rosalind Borison Memorial Pre-Doctoral Fellowships.
ReferencesBarklis E, Mulligan RC and Jaenisch R (1986) Chromosomal
position or virus mutation permits retrovirus expression in
embryonal carcinoma cells. Cell 47, 391-399.
Blobel GA (2000) Creb-binding protein and p300: Molecular
integrators of hematopoietic transcription. Blood 95, 745-
755.
Challita P-MandKohn DB (1994) Lack of expression from a
retroviral vector after transduction of murine hematopoietic
stem cells is associated with methylation in vivo . Proc Natl
Acad Sci U S A 91, 2567-2571.
Chang JC, Liu D and Kan YW (1992) A 36-base-pair core
sequence of locus control region enhances retrovirally
transferred human !-globin gene expression. Proc Natl
Acad Sci U S A 89, 3107-3110.
Chen WYandTownes TM (2000) Molecular mechanism for
silencing virally transduced genes involves histone
deacetylation and chromatin condensation. Proc Natl Acad
Sci U S A 97, 377-382.
Chung JH, Whiteley M and Felsenfeld G (1993) A 5' element of
the chicken !-globin domain serves as an insulator in human
erythroid cells and protects against position effect in
drosophila. Cell 74, 505-514.
Dhar V, Nandi A, Schildkraut CL and Skoultchi AI (1990)
Erythroid-specific nuclease-hypersensitive sites flanking the
human b-globin domain. Mol. Cell Biol. 10, 4324-4333.
Emery DW, Yannaki E, Tubb J, Nishino T, Li Q and
Stamatoyannopoulos G (2002) Development of virus vectors
for gene therapy of ! chain hemoglobinopathies: Flanking
with a chromatin insulator reduces #-globin gene silencing in
vivo. Blood 100, 2012-2019.
Emery DW, Yannaki E, Tubb J and Stamatoyannopoulos G
(2000) A chromatin insulator protects retrovirus vectors from
chromosomal position effects. Proc Natl Acad Sci U S A 97,
9150-9155.
Epner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S,
Enver T, Martin DI, Kennedy M, Keller G and Groudine M
(1998) The !-globin lcr is not necessary for an open
chromatin structure or developmentally regulated
transcription of the native mouse !-globin locus. Molecular
Cell 2, 447-455.
Forrester W, Thompson C, Elder J and Groudine M (1986) A
developmentally stable chromatin structure in the human !-
![Page 173: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/173.jpg)
Gene Therapy and Molecular Biology Vol 8, page 485
485
globin gene cluster. Proc Natl Acad Sci U S A 83, 1359-
1363.
Goodwin AJ, McInerney JM, Glander MA, Pomerantz O and
Lowrey CH (2001) In vivo formation of a human b-globin
locus control region core element requires binding sites for
several factors including gata-1, nf-e2, eklf, and sp-1. J Biol
Chem 276, 26883-26892.
Grosveld F, Blom van Assendelft G, Greaves D and Kollias G
(1987) Position-independent, high-level expression of the
human !-globin gene in transgenic mice. Cell 51, 975-985.
Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic
N and Miller W (1997) Locus control regions of mammalian
!-globin gene clusters: Combining phylogenetic analyses and
experimental results to gain functional insights. Gene 205,
73-94.
Hawley RG, Lieu FH, Fong AZ and Hawley TS (1994) Versatile
retroviral vectors for potential use in gene therapy. Gene
Ther 1, 136-138.
Hoeben RC, Migchielsen AAJ, van der Jagt RCM, van Ormondt
H and van der Eb AJ (1991) Inactivation of the moloney
murine leukemia virus long terminal repeat in murine
fibroblast cell lines is associated with methylation and
dependent on its chromosomal position. J Virol 65, 904-912.
Iler N, Goodwin A, McInerney J, Nemeth M, Pomerantz O,
Layon M and Lowrey C (1999) Targeted remodeling of
human !-globin promoter chromatin structure produces
increased expression and decreased silencing. Blood Cells
Mol. Dis. 25, 47-60.
Imren S, Payen E, Westerman KA, Pawliuk R, Fabry ME, Eaves
CJ, Cavilla B, Wadsworth LD, Beuzard Y, Bouhassira EE,
Russell R, London IM, Nagel RL, Leboulch P and
Humphries RK (2002) Permanent and panerythroid
correction of murine ! thalassemia by multiple lentiviral
integration in hematopoietic stem cells. Proc Natl Acad Sci
U S A 99, 14380-14385.
Jahner DandJaenisch (1985) Retrovirus-induced de novo
methylation of flanking host sequences correlates with gene
activity. Nature 315, 594-597.
Karlsson S, Papayannopoulou T, Schweiger S,
Stamatoyannopoulos G and Nienhuis A (1987) Retroviral-
mediated transfer of genomic globin genes leads to regulated
production of rna and protein. Proc Natl Acad Sci U S A 84,
2411-2415.
Karpen G (1994) Position-effect variegation and the new biology
of heterochromatin. Curr. Opin. Gen. Dev. 4, 281-291.
Kiekhaefer CM, Grass JA, Johnson KD, Boyer ME and Bresnick
EH (2002) Hematopoietic-specific activators establish an
overlapping pattern of histone acetylation and methylation
within a mammalian chromatin domain. Proc Natl Acad Sci
U S A 99, 14309-14314.
Leboulch P, Huang GM, Humphries RK, Oh YH, Eaves CJ,
Tuan DY and London IM (1994) Mutagenesis of retroviral
vectors transducing human !-globin gene and !-globin locus
control region derivatives results in stable transmission of an
active transcriptional structure. EMBO J 13, 3065-3076.
Liu D, Chang JC, Moi P, Liu W, Kan YW and Curtin PT (1992)
Dissection of the enhancer activity of !-globin 5' dnase i-
hypersensitive site 2 in transgenic mice. Proc Natl Acad Sci
U S A 89, 3899-3903.
Lowrey CH, Bodine DM and Nienhuis AW (1992) Mechanism
of dnase i hypersensitive site formation within the human
globin locus control region. Proc Natl Acad Sci U S A 89,
1143-1147.
Miller IJandBieker JJ (1993) A novel, erythroid cell-specific
murine transcription factor that binds to the caccc element
and is related to the kruppel family of nuclear proteins. Mol.
Cell. Biol. 13, 2776-2786.
Milot E, Strouboulis J, Trimborn T, Wijgerde M, de Boer E,
Langeveld A, Tan-Un K, Vergeer W, Yannoutsos N,
Grosveld F and Fraser P (1996) Heterochromatin effects on
the frequency and duration of lcr-mediated gene
transcription. Cell 87, 105-114.
Murray L, Travis M, Luens-Abitorabi K, Olsson K, Plavec I,
Forestell S, Hanania EG and Hill B (2000) Addition of the
human interferon ! scaffold attachment region to retroviral
vector backbones increases the level of in vivo transgene
expression among progeny of engrafted human
hematopoietic stem cells. Hum Gene Ther 11, 2039-2050.
Nemeth MJ, Bodine DM, Garrett LJ and Lowrey CH (2001) An
erythroid-specific chromatin opening element reorganizes !-
globin promoter chromatin structure and augments gene
expression. Blood Cells Mol Dis 27, 767-780.
Novak U, Harris E, Forrester W, Groudine M and Gelinas R
(1990) High-level !-globin expression after retroviral
transfer of locus activation region-containing human !-
globin gene derivatives into murine erythroleukemia cells.
Proc Natl Acad Sci U S A 87, 3386-3390.
Orkin SH and Motulsky AG (1995) Report and recommendations
of the panel to assess the nih investment in research on gene
therapy, pp. Office of Recombinant DNA activities website.
Persons DA, Allay ER, Sawai N, Hargrove PW, Brent TP,
Hanawa H, Nienhuis AW and Sorrentino BP (2003a)
Successful treatment of murine !-thalassemia using in vivo
selection of genetically modified, drug-resistant
hematopoietic stem cells. Blood 102, 506-513.
Persons DA, Hargrove PW, Allay ER, Hanawa H and Nienhuis
AW (2003b) The degree of phenotypic correction of murine
!-thalassemia intermedia following lentiviral-mediated
transfer of a human #-globin gene is influenced by
chromosomal position effects and vector copy number.
Blood 101, 2175-2183.
Philipsen S, Pruzina S and Grosveld F (1993) The minimal
requirements for activity in transgenic mice of hypersensitive
site 3 of the ! globin locus control region. EMBO J 12,
1077-1085.
Philipsen S, Talbot D, Frase P and Grosveld F (1990) The !-
globin dominanat control region: Hypersensitive site 2.
EMBO J 9, 2159-2167.
Pikaart MJ, Recillas-Targa F and Felsenfeld G (1998) Loss of
transcriptional activity of a transgene is accompanied by
DNA methylation and histone deacetylation and is prevented
by insulators. Genes and Development 12, 2852-2862.
Pomerantz O, Goodwin AJ, Joyce T and Lowrey CH (1998)
Conserved elements containing nf-e2 and tandem gata
binding sites are required for erythroid-specific chromatin
structure reorganization within the human !-globin locus
control region. Nucleic Acids Res 26, 5684-5691.
Pruzina S, Hanscombe O, Whyatt D, Grosveld F and Philipsen S
(1991) Hypersensitive site 4 of the human ! globin locus
control region. Nucleic Acids Res 19, 1413-1419.
Ramezani A, Hawley TS and Hawley RG (2003) Performance-
and safety-enhanced lentiviral vectors containing the human
interferon-! scaffold attachment region and the chicken !-
globin insulator. Blood 101, 4717-4724.
Reik A, Telling A, Zitnik G, Cimbora D, Epner E and Groudine
M (1998) The locus control region is necessary for gene
expression in the human !-globin locus but not the
maintenance of an open chromatin structure in erythroid
cells. Mol. Cell. Biol. 18, 5992-6000.
Rivella S, Callegari J, May C and Sadelain M (1998) The
insulator element chs4 increases expression and prevents
promotor methylation of integrated retroviral vectors. Blood
Cells, Molecules and Diseases 24, 483.
![Page 174: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/174.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
486
Stamatoyannopoulos JA, Goodwin A, Joyce T and Lowrey CH
(1995) Nf-e2 and gata binding motifs are required for the
formation of dnase i hypersensitive site 4 of the human !-
globin locus control region. EMBO J 14, 106-116.
Talbot D, Philipsen S, Fraser P and Grosveld F (1990) Detailed
analysis of the site 3 region of the human !-globin dominant
control region. EMBO J. 9, 2169-2178.
Tuan D, Solomon W, Li Q and London I (1985) The "!-like-
globin" gene domain in human erythroid cells. Proc Natl
Acad Sci U S A 82, 6384-6388.
Tuan DYH, Solomon WB, London IM and Lee DP (1989) An
erythroid-specific, developmental- stage- independent
enhancer far upstream of the human "!-like globin" genes.
Proc Natl Acad Sci U S A 86, 2554-2558.
Wang L, Robbins PB, Carbonaro DA and Kohn DB (1998) High-
resolution analysis of cytosine methylation in the 5long
terminal repeat of retroviral vectors. Human Gene Therapy
9, 2321-2330.
![Page 175: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/175.jpg)
Gene Therapy and Molecular Biology Vol 8, page 475
475
Gene Ther Mol Biol Vol 8, 475-486, 2004
An erythroid-specific chromatin opening element
increases !-globin gene expression from integrated
retroviral gene transfer vectorsResearch Article
Michael J. Nemeth1 and Christopher H. Lowrey2,3,4,*1Hematopoiesis Section, Genetics and Molecular Biology Branch, National Human Genome Research Institute, Bethesda,
MD, USA,2Departments of Medicine3Pharmacology/Toxicology4The Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH 03755, USA
__________________________________________________________________________________
*Correspondence: Christopher H. Lowrey, M.D., Norrris Cotton Cancer Center, Dartmouth-Hitchcock Medical Center, Lebanon, NH
03756; Phone: 603-653-9967; Fax: 603-653-3543; e-mail: [email protected]
Key words: chromatin structure, !-globin, retrovirus, DNase I hypersensitive site, locus control region
Abbreviations: Fetal Bovine Serum, (FBS); green fluorescent protein, (GFP); hexamethylene bisacetamide, (HMBA); hypersensitive
sites, (HS); locus control region, (LCR); multiple cloning site, (MCS); murine stem cell virus, (MSCV)
Received: 14 November 2004; Accepted: 29 November 2004; electronically published: December 2004
Summary
Gene therapy strategies requiring long-term high-level expression from integrated genes are currently limited by
inconsistent levels of expression. This may be observed as variegated, silenced or position-dependent gene
expression. Each of these phenomena involve suppressive chromatin structures. We hypothesized that by actively
conferring an open chromatin structure on integrated vectors would increase transgene expression. To test this idea
we used a 100bp element from the !-globin locus control region (LCR) which is able to independently open local
chromatin structure in erythroid tissues. This element includes binding sites for GATA-1, NF-E2, EKLF and Sp-1
and is evolutionarily conserved. We constructed a series of MSCV-based vectors containing the !-globin gene
driven by a minimal !-globin promoter with combinations of the HSFE and LCR derived enhancer elements. Pools
of MEL clones containing integrated vectors were analyzed for chromatin structure and !-globin gene expression.
The HSFE increased the extent of nuclease sensitive chromatin over the promoters of the constructs. The most
effective vector included tandem copies of the HSFE and produced a 5-fold increase in expression compared to the
promoter alone. These results indicate that the HSFE is able to augment the opening of !-globin promoter
chromatin structure and significantly increase gene expression in the context of an integrated retroviral vector.
I. IntroductionClinical applications of gene therapy that require
long-term expression have been limited by an inability to
achieve consistent, high-level expression from integrated
gene therapy vectors such as retroviruses (Orkin and
Motulsky, 1995). These vectors exhibit highly variable or
position-dependent expression, which is proposed to be
due in part to the formation of highly condensed,
suppressive local chromatin structures at sites of
integration. In this model, transgene expression can range
from high to non-existent depending upon whether
integration occurs into a region of transcriptionally active
or inactive chromatin structure (Barklis et al, 1986). The
wide range in expression is often due to position effect
variegation, where local chromatin structure affects the
probability that a given cell within a population will
express the integrated gene (Karpen, 1994). Viral
integration into transcriptionally favorable chromatin
structure increases the probability of expression but some
cells within a clonal population will still not express the
transferred gene. Furthermore, integration could occur
initially into a region that is transcriptionally favorable but
becomes less permissive over time due to repressive
alterations in local chromatin structure. The resultant
transcriptional silencing is not due to a gradual decrease in
expression of all cells but rather the complete loss of
expression in an increasing proportion of cells (Hoeben et
al, 1991) Changes in chromatin structure, specifically
![Page 176: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/176.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
476
increased DNA methylation and histone deacetylation, are
often associated with transcriptional silencing (Jahner and
Jaenisch, 1985; Hoeben et al, 1991; Challita and Kohn,
1994; Wang et al, 1998; Chen and Townes, 2000).
Chromatin structure can affect the ability of the
integrated retroviral vector to achieve therapeutically
relevant levels of gene expression. Overcoming this
barrier is especially critical since retroviral vectors are the
most frequently used vector in clinical and scientific
applications where long-term gene expression is desired.
Recent generation lenteviral vectors are still subject to
these chromatin-related effects (Persons et al, 2003b).
While strategies such as drug selection (Persons et al,
2003a) and methods to achieve improved rates of
transduction (Imren et al, 2002) have been applied to
overcome low levels of expression from retrovirally
transduced globin genes, most approaches have focused on
combining various fragments of the LCR and testing them
to see which ones give optimal expression. Recently
genetic insulators and scaffold attachment regions have
been used to protect globin genes from the negative effects
of surrounding chromatin and enhance expression (Emery
et al, 2000,2003; Ramezani et al, 2003). Our approach has
been to investigate development of gene transfer vectors
that are able to autonomously open and maintain
surrounding domains of active chromatin structure
regardless of their site of integration within the genome
(Iler et al, 1999; Nemeth et al, 2001). In this study, we
have examined the strategy of incorporating a relatively
small cis-acting element which is able to alter local
chromatin structure in an erythroid-specific manner within
a globin-expressing retroviral vector.
The HSFE is an erythroid-specific chromatin
remodeling element derived from the human !-globin
LCR. The LCR is comprised of five DNase I
hypersensitive sites (HS) located 5 to 25 kb upstream of
the !-globin locus and is necessary for high-level
expression of the !-globin genes (Tuan et al, 1985;
Grosveld et al, 1987; Epner et al, 1998; Reik et al, 1998).
Originally, the HSFE was derived as a 101 bp element
from the core of HS4 and was found to be both necessary
and sufficient for the formation of a DNase I HS typical of
the LCR HS core structures (Lowrey et al, 1992). The
HSFE contains binding sites for the erythroid-specific
factors NF-E2, GATA-1, and EKLF and the ubiquitous
factor Sp-1, all of which are necessary to establish a
hypersensitive chromatin domain (Pruzina et al, 1991;
Lowrey et al, 1992; Stamatoyannopoulos et al, 1995;
Goodwin et al, 2001). Similar clusters of binding sites are
found within the other erythroid-specific LCR HS cores
where they are also required for HS formation and are
evolutionarily conserved (Philipsen et al, 1990; Talbot et
al, 1990; Philipsen et al, 1993; Hardison et al, 1997;
Pomerantz et al, 1998). Previously, we have demonstrated
that the HSFE can mediate functional tissue-specific
"opening" of a minimal human !-globin promoter and
increase expression of a linked human !-globin gene in
both MEL cell clones and in transgenic mice (Iler et al,
1999; Nemeth et al, 2001). We hypothesized that
incorporation of the HSFE into a !-globin retroviral vector
would result in a similar remodeling of human !-globin
promoter chromatin structure and a subsequent increase in
expression.
II. Materials and methodsA. !-globin retroviral vectorsAll retroviral !-globin constructs were generated using a
parent murine stem cell virus (MSCV) vector (Hawley et al,
1994). A 1.3 kb EcoR I-Hind III fragment was removed and
replaced with a multiple cloning site (MCS) that contained 5' -
EcoR I/Sal I/Xho I/Hind III-3'. A 1.3 kb Xho I-Sal I fragment
containing an IRES-GFP sequence was inserted into the Sal I site
of MSCV-MCS to create MSCV-GFP.
To construct r!G, a human !-globin gene vector (p141)
containing a 372 bp deletion within the second intern was
provided by Dr. Phillipe Leboulch (Harvard University, Boston,
MA). A BamH I-Eco R I fragment from p141 containing the
intern deletion (Genbank #U01317.1; bp 62718-63092) was then
subcloned into a wild-type human !-globin sequence between the
BamH I and EcoR I sites. The modified human !-globin gene
and minimal 110 bp human b-globin promoter was then inserted
into MSCV-GFP as an intact Xho I – Sal I fragment in an anti-
sense orientation with regards to viral transcription.
To construct rH!G, a 190 bp PCR fragment containing the
HSFE was synthesized (Genbank #U01317.1; bp 1060-1222) and
inserted into the Xho I site of r!G. This fragment also serves as
the 5' HSFE in the r2HbG construct. Both rEH!G and r2H!G
were constructed by inserting Xho I-Bgl II fragments excised
from the previously described pEH!G and p2H!G constructs
that contain the cis-acting elements as well as 10 bp of the
minimal promoter into the corresponding Xho I and Bgl II sites
located within the minimal !-globin promoter in r!G (Nemeth et
al, 2001). rHE!G was constructed by inserting a 220 bp Xho I-
Bgl II fragment containing the 36 bp enhancer sequence
upstream of the HSFE into the Xho I and Bgl II sites of r!G.
rE'H!G was constructed by inserting a 385 bp PCR fragment
from HS2 (Genbank #U01317.1; nucleotides 8480-8865) into
rH!G at the Xho I site upstream of the HSFE.
B. Retroviral transductionBriefly, 3 µg of each retroviral construct was transiently
co-transfected along with 3 µg pVPack-GP vector and 3 µg
pVPack-VSV-G vector (Stratagene, La Jolla, CA) into 2 x 106
293T cells by CaPO4 transfection using the CellPhect
transfection kit (Amersham Biosciences, Piscataway, NJ). The
293T cells were maintained in Dulbecco’s Modified Eagle
Medium supplemented with 10% Fetal Bovine Serum (FBS)
(Invitrogen Gibco, Carlsbad, CA). Cells were incubated under
cell culture conditions with the DNA precipitate for 8 hours.
Media was then removed and the cells treated with 15% glycerol
in isotonic HEPES (pH 7.5) for 3 minutes. The glycerol/HEPES
solution was then removed and the cells washed once with media
before being replenished with media and returned to culture
conditions. Twenty-four hours later, the media was removed
from the 293T cells and replaced with pre-warmed media and
collection of viral particles begun. Media containing viral
particles was collected 48 hours later and added to 1 x 105 MEL
cells. Pre-warmed media was then added to the packaging cells,
collected 24 hours later, and added to the MEL cells. Viral
transduction was facilitated through the addition of 6 ng/ml
hexamethedrine bromide (Polybrene$; Sigma, St. Louis, MO) to
MEL cells co-cultured with viral supernatant. MEL cells were
then cultured for 48 hours before FACS analysis.
Transduced MEL cells were collected and assayed for GFP
expression. Approximately 1.5 x 104 GFP+ cells per experimental
vector were sorted in 1 ml FBS. The cells were then centrifuged
and resuspended in 10 ml Improved MEM Zinc Option media
![Page 177: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/177.jpg)
Gene Therapy and Molecular Biology Vol 8, page 477
477
(Invitrogen Gibco) supplemented with 10% FBS and maintained
at 37°C. To determine intact transfer of the !-globin and
associated LCR sequence to the MEL cell, 10 µg of genomic
DNA from each pool was digested with Xho I and Sal I.
Digestion products were detected by Southern blotting as
described. The bamboo-EcoR I region of the !-globin gene was
used as the probe. To determine the multiplicity of infection, 10
µg genomic DNA from pools containing the r!G and rH!G
vectors were digested with EcoR I. Digestion products were
detected by Southern blotting using the same !-globin probe.
Copy number for each pool was determined by slot-blot analysis.
C. Nuclease sensitivity assaysDNase I hypersensitivity assays were performed on nuclei
isolated from transduced pools as previously described (Iler et al,
1999). Pools were maintained in culture conditions until they
reached log phase growth (8 x 105 - 1 x 106 cells/ml). Nuclei
corresponding to approximately 200 µg per reaction were
incubated with DNase I (Worthington Biochemical, Lakewood,
NJ) at concentrations ranging from 0 to 4.0 mg/ml DNase I for
10 minutes at 37°C. Regions of DNase I hypersensitivity were
mapped by plotting the migration distance of the molecular
weight markers versus the logarithm of their size in base pairs for
each blot. These data points were then fitted to the equation:
fragment size (bp) = m % e i % migration d i s t a n c e in cm( )&
' ( )
This produces a straight line where "m" is the slope of the
line and "i" is the y-intercept. By measuring the migration
distances of the upper and lower limits of each DNase I HS and
applying the above formula, the size, and therefore location, of
the HS boundaries within the parental fragment was determined.
Restriction endonuclease sensitivity assays using Bln I
were performed on intact nuclei as described (Iler et al, 1999).
For initial experiments, nuclei (200 µg DNA/reaction) were
digested with Bln I at amounts of 0, 10, 20, 40, 80 and 160 units
at 37°C for 20 minutes. In subsequent experiments Bln I amounts
of 0 and 100 units were used because complete cutting was
consistently obtained above 80 units per reaction. Relative band
intensities were determined by densitometry performed on
images captured on a Phosphor Screen and resolved with the
PhosphorImager 445 SI (Molecular Dynamics, Sunnyvale, CA).
The percentage of restriction enzyme digestion was determined
by dividing the intensity of the sub-band by the sum of the
intensities of the sub-band and the parental band (S/(P+S)).
Statistical analysis was performed using Student's t-test.
D. Human !-globin RNA analysisFor all pools, globin expression was induced by 3mM
HMBA for 4 days. RNA was isolated with Trizol (Invitrogen)
Human !-globin and mouse "-globin expression were quantified
using ribonuclease protection analysis using the RPA III kit
(Ambion, Austin, TX). RNA probes were synthesized using the
T7 MaxiScript kit (Ambion). pT7M" and pT7!M were used to
generate probes for mouse "-globin and human !-globin
respectively and were a kind gift from Dr. Qiliang Li (University
of Washington, Seattle, WA). pT7M" protects a 128 bp fragment
and pT7!M protects a 206 bp fragment. Each hybridization
reaction consisted of approximately 1 µg of RNA and 1 x 106
cpm of both probes (the specific activity of each probe generally
ranged from 1-2 x 106 cpm/ng). Hybridization products were
electrophoresed on an 8.0% acrylamide/6 M urea gel and relative
expression levels were quantified by PhosphorImager analysis.
Human !-globin expression was corrected for both copy number
and the different specific activities of the probes and normalized
to mouse "-globin. Statistical analysis was performed using
Student's t-test.
III. ResultsWe subcloned the HSFE element upstream of a
minimal human !-globin promoter and gene in the context
of a MSCV vector (Figure 1a). This vector also contains
the enhanced green fluorescent protein (GFP) gene, which
is transcribed from the viral 5' LTR. In order to prevent
removal of the !-globin introns, which are necessary for
high-level expression, the LCR, promoter, and gene
sequences are oriented in an antisense direction with
respect to viral transcription (Karlsson et al, 1987). A 372
bp region from the second intern of the !-globin gene was
also removed, which has been shown that this deletion
improves both viral titer and the genetic stability of the
vector without adversely affecting !-globin gene
expression (Leboulch et al, 1994). Altogether, six !-globin
vectors were made (Figure 1b). Briefly, r!G contains the
110 bp minimal human !-globin promoter alone, rH!G
contains the HSFE upstream of the promoter, rEH!G
contains a 36 bp erythroid-specific enhancer derived from
HS2 located at the 5' end of the HSFE (Chang et al, 1992),
r2H!G contains tandem HSFE elements separated by
approximately 150 bp, rHE!G contains the 36 bp enhancer
and the HSFE in reverse order, and rE'H!G contains a 374
bp fragment from HS2 (which contains the 36 bp
enhancer) upstream of the HSFE.
These constructs were transduced into MEL cells
using a transient VSV-G packaging cell line. FACS
analysis was then used to select GFP+ MEL cells (Figure
2). After transduction of MEL cells with either r!G or
rH!G, approximately 1-3% of MEL cells were positive for
GFP expression. Similar percentages were observed for
the other constructs (data not shown). GFP+ cells were
sorted and separated into three to four pools per construct.
To ensure the intact transfer of the human !-globin
gene and any associated regulatory elements, genomic
DNA was isolated from the transduced pools and analyzed
for copy number and the integrity of the !-globin gene
sequence (Figure 3a). The !-globin gene, promoter, and
any associated LCR elements were integrated intact into
the MEL genome for all constructs except rE'H!G. This
vector, which contains a 374 bp HS2 enhancer, was
genetically rearranged as indicated by loss of the !-globin
gene.
To determine whether our retroviral pools contained
multiple integration sites, genomic DNA was digested
with EcoR I, which cuts the human !-globin gene at a
single site in all vectors. A representative analysis is
shown in Figure 3b for the r!G and rH!G vectors. For
both constructs, each pool contained multiple integration
sites, as indicated by " smearing" of the Southern blot
signal over a wide range.
A. Chromatin structure of the integrated
human !-globin promoterTo determine the extent of the hypersensitive domain
in our retroviral constructs, we performed DNase I
sensitivity assays on the retroviral pools and mapped the
size and location of detected HSs (Figure 4).
Representative Southern blot analyses depicting formation
![Page 178: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/178.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
478
of the hypersensitive sites are shown in Figure 4b. The
integrated r!G vector, which contains the minimal
promoter by itself, contained a hypersensitive site
approximately 110 bp long and included the first 20 bp of
the promoter itself (Figure 4c). The addition of the HSFE
approximately doubled the region of hypersensitive
chromatin from 110 bp to 230 bp. In both the presence and
absence of the HSFE, only approximately 20bp of the
distal promoter was hypersensitive. However, while the
incorporation of tandem HSFE elements created a
similarly sized 190 bp HS, this HS was shifted to include
most of the minimal !-globin promoter.
Figure 1. Retroviral !-globin vectors used to evaluate HSFE activity. (a) Design of the !-globin retroviral vector. The parent vector
is the murine stem cell retrovirus (MSCV). The vector contains a GFP gene transcribed from the 5' LTR and the human !-globin gene
transcribed from the minimal human !-globin promoter in an anti-sense orientation. A 372 bp region of the second !-globin intron has
been deleted. The chromatin opening elements are subcloned 3' of the promoter in an anti-sense orientation. (b) !-globin retroviral
vectors. Construction of vectors is described in Methods. Elements used to construct the vectors include the 110 bp minimal human !-
globin promoter (Pro), HSFE, the 36 bp erythroid-specific HS2 enhancer (Enh), and a 385 bp fragment from HS2, containing which the
36 bp enhancer (Enh’).
![Page 179: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/179.jpg)
Gene Therapy and Molecular Biology Vol 8, page 479
479
Figure 2. Generation of !-globin retroviral vector pools. GFP-FACS analysis of transduced MEL cells. Representative histograms
displaying the percentage of GFP expressing MEL cells after transduction with r!G and rH!G vectors. Wild-type MEL cells and a MEL
clone that expresses GFP served as negative and positive controls respectively.
![Page 180: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/180.jpg)
Nemeth and Lowrey: A chromatin opening element increases !-globin expression
480
Figure 3. Analysis of integrated !-globin vector DNA. (a) Top:
Vector schematic displaying Xho I (X) and Sal I (S) restriction
sites and the range of sizes of the digestion products. Bottom:
Integrity of retroviral vectors. Southern blot displaying intact !-
globin sequences for 5 out of 6 vectors. Human bone marrow
DNA (H!) was digested with Pst I/Bgl II as a positive control.
Genomic DNA from each pool was isolated and digested with
Xho I/Sal I. (b) Multiple integration sites of retroviral pools.
Genomic DNA isolated from r!G and rH!G pools was digested
with Eco RI which cuts once within the vector.
To quantify the proportion of !-globin promoters
accessible to restriction endonuclease digestion, and
therefore in an open chromatin configuration, we
performed restriction endonuclease assays on all pools
generated from selected constructs. Intact nuclei were
performed restriction endonuclease assays on all pools
generated from selected constructs. Intact nuclei were
digested with Bln I, which uniquely digests at a single site
within the !-globin promoter (Figure 5a).
![Page 181: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/181.jpg)
Gene Therapy and Molecular Biology Vol 8, page 487
487
Gene Ther Mol Biol Vol 8, 487-494, 2004
Decreased tumor growth using an IL-2 amplifier
expression vectorResearch Article
Xianghui He1, Farha H Vasanwala2, Tom C Tsang1, Phoebe Luo1, Tong Zhang3
and David T Harris1
1Gene Therapy Group, Department of Microbiology and Immunology, University of Arizona, Tucson, Arizona 85724,
USA2Department of Microbiology and Immunology, Indiana University, Indianapolis, IN 462023Department of Microbiology and Immunology, Dartmouth Medical School, Dartmouth-Hitchcock Medical Center,
Lebanon, NH 03766
__________________________________________________________________________________
*Correspondence: Dr. David T. Harris, Gene Therapy Group, Department of Microbiology and Immunology, PO Box 245049, 1501 N.
Campbell Ave, Life Sciences North, University of Arizona, Tucson, AZ 85724; Tel: +1-520-626-5127; Fax: +1-520-626-2100; E-mail
address: [email protected]
Key words: Cancer, interleukin-2, amplifier vector, gene therapy
Abbreviations: cytomeglovirus, (CMV); enzyme-linked immunosorbent assay, (ELISA); horseradish peroxidase, (HRP); interferon-!,
(IFN-!); interleukin-2, (IL-2)
Received: 3 December 2004; Accepted: 10 December 2004; electronically published: December 2004
Summary
The success of gene therapy relies on sufficient gene expression in the target tissue. The application of non-viral
vectors, such as plasmid DNA, is limited by low in vivo transfection efficiency compared to viral vectors. Strategies
to enhance gene transcription should augment target gene expression and make the vector more efficient. In the
present study we describe a transcription factor- based amplifier strategy to enhance transgene expression. Our
data showed that compared to CMV promoter driven IL-2 expression, expression of TAT in the same plasmid
downstream of the HIV LTR significantly enhanced the expression level of IL-2 (up to 20-fold). Gene-modification
of murine B16 melanoma with the amplifier IL-2 expression vector resulted in decreased tumor growth and
prolonged animal survival in vivo.
I. IntroductionGene therapy is one of the newest strategies for
treating human disease. Since Rosenberg et al. performed
the first human gene therapy trial in 1989, over 900
clinical trials have been completed or are ongoing
worldwide (Edelstein et al, 2004). Non-viral vectors have
been used in approximately 25% of the trails performed to
date. Non-viral vectors are safe and easy to manufacture.
However, their application is hindered by the lower levels
of transgene expression compared to viral vectors. Efforts
to increase transgene production are of great interest.
Strategies explored to increase transgene production
include improvement in the efficiency of gene delivery
through application of new technologies such as
electroporation and polycations, and enhancement in the
activity of gene transcription and translation by
manipulation of expression cassettes such as the use of
strong promoters, proper introns and even chromatin
regulatory elements (Xu et al, 2001; Thomas and
Klibanov, 2003; Jaroszeski et al, 2004; Recillas-Targa et
al, 2004). Currently, the most widely used promoter in
gene therapy trials is the cytomeglovirus (CMV) promoter,
which is considered to be the strongest of the commonly
used promoters (Yew et al, 1997). However, therapeutic
levels of transgene expression are not achieved in many
cases, especially for cytokine-based cancer immuno-gene
therapy.
Because of its prevalence and tendency to recur after
traditional therapy, cancer has been targeted by two-thirds
of gene therapy clinical trials. Cytokine-based immuno-
gene therapy is a major player and one quarter of genes
transferred in clinical trails are cytokine genes (Jaroszeski
et al, 2004). Cytokines such as interleukin-2 (IL-2) and
interferon-! (IFN-!) can augment immune responses. IL-2
gene therapy experiments with laboratory mice have
shown cures of up to 100% of established tumors
(Porgador et al, 1993; Toloza et al, 1996), but the level of
success in human clinical trials has lagged behind. Similar
![Page 182: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/182.jpg)
He et al: Gene therapy using amplifier IL-2 expression vectors
488
results have been seen for other stimulatory cytokines in
cancer therapy. Low levels of transgene expression have
been thought to be a limiting factor in these trails. In a
previous study we developed amplifier gene expression
plasmid vectors to achieve high levels of IL-2 expression
(Tsang et al, 2000). Here, we compare these vectors with
traditional CMV promoter-based vectors and apply them
for immuno-gene therapy of murine melanoma.
II. Materials and MethodsA. Mice and cell linesC57BL/6J mice (aged 6-12 weeks) mice were purchased
from Jackson Laboratories (Bar Harbor, ME). Animals were
maintained under specific pathogen-free conditions in the animal
facility at the University of Arizona. Human lung carcinoma
A549 cells, the human breast carcinoma cell line MCF-7, mouse
melanoma B16 cells and mouse mammary carcinoma 4T1 cells
were obtained from American Type Culture Collection
(Manassas, VA). All cells were maintained in RPMI 1640
medium supplemented with 10% fetal bovine serum (Irvine
Scientific, CA), 2mM glutamine, 1mM pyruvate, 50µM 2-
mercaptoethanol, penicillin (200units/ml), and streptomycin
(200µg/ml) at 37°C in a 5% CO2/95% air atmosphere. For gene-
modified cells, Geneticin (G418, 600µg/ml, Invitrogen, Carlsbad,
CA) was added to the medium.
B. Genetic constructsThe following plasmid vectors were constructed (Figure
1): (1) pCI-IL2-neo: CMV promoter driving the expression of
human IL-2. (2) pHi1-IL2-neo-C-TAT: HIV1 long terminal
repeat driving the expression of human IL-2, and the CMV
promoter driving the expression of HIV Tat. (3) pHi2-IL2-neo-
C-TAT: HIV2 long terminal repeat driving the expression of
human IL-2, and the CMV promoter driving the expression of
HIV TAT.
To construct pCI-IL-2-neo, the human IL-2 gene (a gift
from Dr. Evan Hersh, University of Arizona, Tucson, AZ) was
adapted for the EcoR I site of pCI-neo (Promega, Madison, WI)
with the Sac-Kiss-Lambda vector (Tsang et al, 1996). The IL-2
gene was then excised from pSac-Kiss-IL2 as an EcoR I
fragment and inserted into the EcoR I site of pCI-neo. To
construct pHi2-IL2-neo-C-TAT, the HIV2 LTR was excised
from pGL2-HIV2 (a gift from Dr. Gunther Krauss, Vienna
University Medical School, Austria) by Bgl II digestion followed
by partial digestion with Hind III. The 0.8 kb Bgl II-Hind III
fragment containing the HIV2 promoter then replaced the CMV
promoter in Bgl II and Hind III digested pCI-neo to create
pHIV2-neo. The IL-2 gene excised from pSac-Kiss-IL2 with
EcoR I was inserted into the EcoR I site of pHIV2-neo to yield
the plasmid, pHIV2-IL2 neo. A pCEP4 (Invitrogen, Carlsbad,
CA) –derived CMV promoter was then inserted at the BamH I
site of pHIV2-IL2 neo to create pHi2-IL-2-neo-C. The tat gene
was excised from the plasmid pTAT (Arya et al, 1985) with Xba
I and ligated with Xba I digested Kpn-Kiss-Lambda to create
Kpn-Kiss-TAT. The tat gene was then cut back out with Not I
and inserted into the Not I site following the CMV promoter in
pHi2-IL2-neo-C and resulted in the pHi2-IL2-neo-C-TAT.
Similarly, the HIV1 LTR was excised with Hind III from pGL2-
HIV1 (obtained from Dr. L. Luznick, University of Arizona,
Tucson, AZ) and replaced the HIV-2 promoter in the Hind III
site of pHIV2-IL2 –neo to generate pHIV1-IL2-neo. The CMV
promoter was then inserted into pHIV1-IL2-neo to generate
pHi1-IL2-neo-C. pHi1-IL2-neo-C-TAT was created by inserting
the Not I fragment from Kpn-Kiss-TAT into the Not I site of
pHi1-IL2-neo-C. In addition, to assess transfection efficiencies,
the EGFP (Enhanced Green Fluorescence Protein) gene was also
cloned into the same site as IL-2 in these vectors to generate pCI-
EGFP, pHi2-EGFP-neo-C-TAT, and pHi1-EGFP-neo-C-TAT.
C. Cell transfectionTumor cells were transfected with plasmid DNA using
cationic lipid DMRIE-C (Invitrogene, Carlsbad, CA) according
to the manufacturer’s protocol. Briefly, 1µg DNA of DNA and
4µl of lipid were mixed separately with 500µl of OPTI-MEM
media (GIBCO, Rockville, MD). The two solutions were then
mixed together and allowed to incubate for 45 min. at room
temperature to form lipid/DNA complexes. The target cells were
washed once with OPTI-MEM media, the transfection mixture
added and the cells were incubated with lipid/DNA complexes
for 4 hours. The medium was then replaced with fresh culture
medium. While selecting stable transgene expressing clones, the
tumor cells were selected in 600µg/ml Geneticin containing
medium 48 hours after transfection, and cloned by limiting
dilution in 96-well plates. The transfection efficiency was
determined by measuring the percent of GFP positive cells
within the EGFP-expressing plasmids transfected groups by flow
cytometry.
D. Cytokine expression and bioactivity assaysIL-2 expression was tested by enzyme-linked
immunosorbent assay (ELISA) using either the IL-2 EASIA kit
(Medgenix Diagnostic, Fleurus, Belgium) or the OptEIA Human
IL-2 Set (Pharmingen, San Diego, CA) according to the
manufacturer’s protocol. Briefly, after washing, a standardized
IL-2 solution and cell culture supernatants were then added to the
wells of capture monoclonal antibody-coated 96 well plate.
Following two hours of incubation, the plate was washed. A
biotin-labeled detection antibody and avidin-horseradish
peroxidase (HRP) was then added. After another 1-hour
incubation and washing, the substrate solution was added and
then read at 450nm. A standard curve was plotted and IL-2
concentrations were determined by interpolation from the
standard curve. Results were calculated as IU/ml of IL-2 and the
values of IL-2 were reported as per million cells per ml. The
biological activity of the IL-2 in the culture supernatants of IL-2
expressing plasmid transfected cells was determined by
stimulation of cell proliferation with a mouse cytotoxic T cell
line, CTLL-2, which requires IL-2 for growth (Gillis and Smith,
1977).
E. In vivo tumor growth studiesC57BL/6 mice were injected subcutaneously in the hind
flank with either 0.5 x 106 B16 cells, 0.5 x 106 B-10 cells (B16
cells transfected with the pCI-IL2 plasmid) or 0.5 x 106 BB-15
cells (B16 cells transfected with the pHi2-IL2-neo-C-TAT
plasmid) in 100µl of PBS. Tumor growth was monitored over
time and tumor size was measured with vernier calipers.
III. ResultsA. Construction of amplifier gene
expression vectorsThe CMV promoter is the most commonly used
promoter in gene therapy. We constructed the plasmid
pCI-IL2-neo, in which the CMV promoter drives human
IL-2 gene expression, as a control to develop high level
gene expression vectors. We first replaced the CMV
promoter with either the HIV-1 or the HIV-2 LTR to drive
IL-2 expression (plasmids pHi1-IL2-neo-C and pHi-IL2-
neo-C, respectively). The CMV promoter was placed
downstream of the neo gene, to drive second gene
![Page 183: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/183.jpg)
Gene Therapy and Molecular Biology Vol 8, page 489
489
expression in these plasmids. The HIV transcriptional
activator, the tat gene, was then introduced into these
plasmids under the control of the CMV promoter, resulting
in pHi1-IL2-neo-C-TAT and pHi2-IL2-neo-C-TAT
(Figure 1). The expression of the tat gene should enhance
the transcriptional activity of the LTR and result in
enhanced gene product. In addition, to assess transfection
efficiencies, the EGFP gene was also cloned into these
vectors replacing the IL-2 gene, resulting in plasmids
termed pCI-EGFP, pHi2-EGFP-neo-C-TAT, and pHi1-
EGFP-neo-C-TAT.
B. High level gene expression through co-
expression of a transcription factor within the
same plasmidThe IL-2 expression plasmids and the EGFP
expression plasmids were transfected individually into two
different human cell lines, A549 and MCF-7. Supernatants
were collected 24 hours after transfection to measure IL-2
secretion, and the cells transfected with the EGFP
expression plasmids were harvested to assess EGFP
expression by flow cytometry as a measure of transfection
efficiency. Figure 2 shows that higher levels of IL-2 were
achieved by the pHi2-IL2-neo-C-TAT and pHi1-IL2-neo-
C-TAT plasmids, as compared to the plasmid pCI-IL-2-
neo, after transfection of both A549 and MCF-7 cells. In
A549 cells, pHi2-IL2-neo-C-TAT and pHi1-IL2-neo-C-
TAT transfection resulted in 357 IU/ml and 182 IU/ml of
IL-2 respectively, whereas pCI-IL2 resulted in 18 IU/ml.
The EGFP flow cytometry data indicated that the three
different plasmids had similar transfection efficiencies
(around 70%) in A549 cells (Figure 3). Thus, the
differences observed in the IL-2 levels must therefore have
resulted from differences in transcriptional activity of
these plasmids.
The IL-2 expression plasmids were also tested in
mouse tumor cells. B16 melanoma and breast carcinoma
4T1 cells were transfected and IL-2 levels were measured
24 hours post-transfection. As shown in Figure 4 , higher
levels of IL-2 were obtained from the pHi2-IL2-neo-C-
TAT plasmid (140 pg/ml in B16 cells and 136 pg/ml in
4T1 cells) than from the CMV IL-2 plasmid (14 pg/ml in
B16 cells and 18.5 pg/ml in 4T1 cells), indicating that the
HIV promoter and tat gene were active in these mouse cell
lines. The IL-2 levels obtained from the pHi1-IL2-neo-C-
TAT (60 pg/ml in B16 cells) were also higher than IL-2
levels from the pCI-IL2-neo plasmid, but lower than pHi2-
IL2-neo-C-TAT. In addition, the biological activity of the
transgenic IL-2 harvested from the culture supernatants of
IL-2 expressing plasmid transfected cells was confirmed
by CTLL-2 assay (data not shown).
C. Gene-modification of B16 melanomaB16 cells were transfected with either the pCI-IL2-
neo or the pHi2-IL2-neo-C-TAT plasmid and neomycin-
resistant clones were obtained 14 days after selection with
G418. The clones were assayed for IL-2 secretion by
ELISA. Figure 5 shows four representative clones. Clone
B-10 (9.6 pg/ml) was derived from cells transfected with
pCI-IL2-neo, in which the IL-2 gene is under the control
of CMV promoter. Clone BB-15 (165 pg/ml) was derived
from cells transfected with pHi2-IL2-neo-C-TAT, in
which the IL-2 gene is driven by HIV2 LTR and the tat
gene is under the control of CMV promoter. These two
clones had the same doubling time in vitro as the parental
(untransfected) B16 cells and were used in the in vivo
study.
D. Decreased tumorigenicity of amplified
IL-2 expressing B16 tumorsThe same number of parental B16, B-10 and BB-15
cells (0.5 x 106 per mouse) were injected subcutaneously
into syngeneic C57BL/6 mice in the hind flank. Tumor
size was monitored for 46 days. Figure 6A shows the
average tumor growth in each group of mice over time.
The results demonstrated that tumor cells transfected with
the highest IL-2 producing clone, BB-15 (B16 cells
transfected with pHi2-IL2-neo-C-TAT) showed slower
tumor growth, although it did not prevent tumor
development. The tumor sizes were smaller for B-10
injected mice (B16 cells transfected with pCI-IL2-neo)
than mice injected with the parental B16 tumor. Mice
injected with the BB-15 cells had smaller tumors than the
mice injected with the B-10 cells.
Figure 1 . Diagrammatic representation of the different IL-2 constructs. The expression cassettes of plasmids pCI-IL-2-neo, pHi1-IL2-
neo-C-TAT, and pHi2-IL2-neo-C-TAT are shown. CMV: cytomegalovirus; HIV1 LTR: human immunodeficiency virus 1 long terminal
repeat; HIV2 LTR: human immunodeficiency virus 2 long terminal repeat; pA: polyadenylation signal; SVneo: SV40 promoter driving
the neomycin resistant gene. TAT: HIV tat (trans-activator of transcription).
![Page 184: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/184.jpg)
He et al: Gene therapy using amplifier IL-2 expression vectors
490
On day 18 after injection, the average tumor size for the
B16 injected group was 327mm2, while the average tumor
size of the B-10 group was 119mm2 and that of the BB-15
group was 41mm2.
The mean survival time for each group of mice is
shown in Figure 6B. There was an increase in survival
time in mice that had been injected with tumor cells
transfected with the pHi2-IL2-neo-C-CMV plasmid 46
days (BB-15) as compared to the group of mice injected
with either the parental B16 tumor (21 days) or the group
of mice injected with the clone B10 tumor (36 days).
Figure 2. IL-2 levels secreted by transfected MCF-7 and A549 cells. MCF-7 and A549 cells were transfected with DMRIE-C and cell
culture supernatants were harvested 24 hours later. IL-2 secretion was determined using an IL-2 EASIA kit. Data represent the IL-2
production in IU/ml from 1"106 MCF-7 and 1"106 A549 cells transfected with pHi2-IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCI-
IL2-neo plasmid. Data is representative of three experiments.
![Page 185: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/185.jpg)
Gene Therapy and Molecular Biology Vol 8, page 491
491
Figure 3. Flow cytometric analysis of EGFP expression by transfected A549 cells. A549 cells were transfected with either the pCI-
EGFP (B), pHi1-EGFP-neo-C-TAT (D) or pHi2-EGFP-neo-C-TAT (C) plasmid. Cells were harvested 24 hours after transfection and
analyzed by flow cytometry. Wild type A559 cells (A) were used as control.
Figure 4. IL-2 production by transfected B16 and 4T1 tumor cells. 1 "106 B16 (A) and 4T1 tumor (B) cells were transfected with pHi2-
IL2-neo-C-TAT, pHi1-IL2-neo-C-TAT or the pCI-IL2-neo plasmid. Supernatants were analyzed 48 hours after transfection for IL-2
levels by ELISA and are reported as pg/ml IL-2. (*p<0.05). Data is representative of three experiments.
![Page 186: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/186.jpg)
He et al: Gene therapy using amplifier IL-2 expression vectors
492
Figure 5. Decreased growth of IL-2 expressing B16 tumors in C57BL/6 mice. Three groups of C57BL/6 mice were injected with either
B16 cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15 (pHi2-IL2-neo-C-TAT gene-modified B16 cells), and
tumor growth was monitored. Each group consisted of four mice. Average tumor sizes with standard deviations within each group are
shown in mm2 (*p<0.05).
Figure 6 . Survival curves of mice challenged with wild type B16 or IL-2 gene-modified B16 tumor cells. Three group of mice (four
mice per group) were injected with either parental B16 tumor cells, clone B-10 (pCI-IL2-neo gene-modified B16 cells) or clone BB-15
(pHi2-IL2-neo-C-TAT gene-modified B16 cells), and the survival of injected mice was monitored.
![Page 187: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/187.jpg)
Gene Therapy and Molecular Biology Vol 8, page 493
493
IV. DiscussionThe success of gene therapy relies on sufficient gene
expression in the target tissue. Non-viral vectors, such as
plasmid DNA are safe, ease to produce and administer,
and low in immunogenicity. However, the application of
non-viral vectors is limited by the relatively low target
gene expression in vivo. Although improved gene delivery
protocols, such as electroporation can increase the overall
amount of gene product by increasing transfection
efficiency, strategies to enhance gene transcription should
further augment target gene expression. In the present
study, we describe a transcriptional amplifier strategy to
enhance IL-2 gene expression through co-expression of a
transactivator gene in the plasmid vector. Applying this
gene-modification to mouse melanoma resulted in
decreased tumor growth and prolonged animal survival in
vivo.
The expression levels of a transgene depend
primarily on the strength of transcription and the gene
delivery efficiency (McKnight and Tjian, 1986). Great
efforts have been made to develop gene transfer vectors.
Viral vectors are widely used in gene therapy clinical trails
because of their relatively high gene delivery efficiency.
However, their efficiency may be compromised by the
immune responses induced after repeated administration.
Non-viral vectors are less immunogenic, but need to be
improved in order to achieve sufficient gene expression.
Traditionally, extensive efforts have been made in search
of gene promoters capable of the highest levels of
expression (Pasleau et al, 1985; Martin-Gallardo et al,
1988). Studies comparing different cellular and viral gene
promoters have generally concluded that the CMV
promoter is the strongest available promoter (Boshart et al,
1985; Oellig and Seliger, 1990). Indeed, the CMV
promoter is the most commonly available commercial
promoter and is widely used in human clinical trails. Other
transcriptional regulatory elements, such as introns and
polyadenylation signal sequences have also been evaluated
(Xu et al, 2001), and with the latter found to have
significant effects on transgene expression. In the present
study, we describe a HIV promoter and transcription
factor-based amplifier strategy to enhance transgene
expression. HIV Tat (trans-activator of transcription)
protein binds to the TAR (transactivation response
element) in the R region of HIV LTR (long terminal
repeat) to greatly increase the efficiency of transcription
elongation (Cullen, 1991). Our data showed that compared
to CMV promoter driven IL-2 expression, expression of
TAT in the same plasmid downstream of the HIV LTR-
driven IL-2 expression cassette significantly enhanced the
expression level of IL-2. pHi1-IL2-neo-C-TAT, which has
the HIV1 LTR driving IL-2 expression, gave rise to an
over 20-fold increase of IL-2 expression in human A549
cells (357 IU/ml of HIV1 LTR vs. 18 IU/ml of CMV in
A549 cells). Of note, lower levels of IL-2 secretion were
seen upon transfection of these plasmids into murine cell
lines as compared to the absolute IL-2 levels obtained in
human cell lines. This result may be due to the fact that the
tat gene is known to interact with human cellular factors
needed for HIV transcription (Wang et al, 2000). The
absence/modification of such host factors in murine cell
lines may account for the lower IL-2 levels observed.
IL-2 is a T-cell growth factor capable of stimulating
antigen-specific cytotoxic T lymphocytes (CTL) and non-
specific immune responses such as those mediated by
natural killer (NK) cells. Recombinant IL-2 (rIL-2) has
been used to treat malignant melanoma and renal cell
carcinoma (Parkinson et al, 1990; Toloza et al, 1996).
However, systemic administration of IL-2 can cause
serious side-effects such as pulmonary vascular leak and
liver toxicity (Siegel and Puri, 1991). IL-2 gene therapy
provides a promising alternative. Animal models have
shown that tumor cells genetically engineered to express
the IL-2 gene can cause rejection of IL-2 –modified and
unmodified tumor cells (Porgador et al, 1993). In addition,
vaccination with IL-2 gene-modified tumor cells can
induce rejection of pre-established metastatic lesions (Palu
et al, 1999). Clinical trials including vaccination with
tumor cells engineered to express IL-2 or direct intra-
tumoral injection of IL-2 expressing plasmid vectors (with
or without lipid) have shown that these IL-2 gene therapy
approaches had very low toxicity and in some cases, there
was evidence that anti-tumor immunity was induced
(Galanis et al, 1999; Palmer et al, 1999; Walsh et al,
2000). Unfortunately, few patients showed significant
clinical responses. One reason for the lack of clinical
responses may be insufficient IL-2 production. In the
present study, we developed new vectors that can produce
higher levels of IL-2 than the CMV promoter-based
vectors. Our animal data showed that the amplifier IL-2
expression vectors resulted in decreased tumor growth and
prolonged animal survival compared to CMV promoter-
based vectors.
In summary, we developed a high level IL-2
expression plasmid vector though a HIV LTR and TAT-
based amplifier strategy. Increased IL-2 expression
resulted in decreased tumor growth of gene-modified
mouse melanoma cells. The amplifier strategy described
here resulted in significantly increased transgene
expression. The application of the amplifier strategy is not
limited to non-viral systems. In a viral system, increasing
transgene expression could help to decrease the amount of
viral vector required to achieve a clinical effect as well as
any side effects. In addition, other than expressing
cytokines for immunotherapy, the amplifier strategy can
be used to express other therapeutic molecules, such as
small interfering RNA (siRNA) directed against cancer or
infectious diseases. This strategy may also apply to
mammalian expression systems to more efficiently
produce large molecules such as antibodies or growth
factors.
ReferencesArya SK, Guo C, Josephs SF, and Wong-Staal F (1985) Trans-
activator gene of human T-lymphotropic virus type III
(HTLV-III) Science 229, 69-73.
Boshart M, Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B,
and Schaffner W (1985) A very strong enhancer is located
upstream of an immediate early gene of human
cytomegalovirus. Cell 41, 521-530.
Cullen BR (1991) Human immunodeficiency virus as a
prototypic complex retrovirus. J Virol 65, 1053-1056.
![Page 188: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/188.jpg)
He et al: Gene therapy using amplifier IL-2 expression vectors
494
Edelstein ML, Abedi M R, Wixon J, and Edelstein RM (2004)
Gene therapy clinical trials worldwide 1989-2004-an
overview. J Gene Med 6, 597-602.
Galanis E, Hersh EM, Stopeck AT, Gonzalez R, Burch P, Spier
C, Akporiaye ET, Rinehart JJ, Edmonson J, Sobol RE,
Forscher C, Sondak VK, Lewis BD, Unger EC, O'Driscoll
M, Selk L, and Rubin J (1999) Immunotherapy of advanced
malignancy by direct gene transfer of an interleukin-2
DNA/DMRIE/DOPE lipid complex: phase I/II experience. J
Clin Oncol 17, 3313-3323.
Gillis S and Smith KA (1977) Long term culture of tumour-
specific cytotoxic T cells. Nature 268, 154-156.
Jaroszeski MJ, Heller LC, Gilbert R, and Heller R (2004)
Electrically mediated plasmid DNA delivery to solid tumors
in vivo. Methods Mol Biol 245, 237-244.
Martin-Gallardo A, Montoya-Zavala M, Kelder B, Taylor J,
Chen H, Leung FC, and Kopchick JJ (1988) A comparison of
bovine growth-hormone gene expression in mouse L cells
directed by the Moloney murine-leukemia virus long
terminal repeat, simian virus-40 early promoter or
cytomegalovirus immediate-early promoter. Gene 70, 51-56.
McKnight S and Tjian R (1986) Transcriptional selectivity of
viral genes in mammalian cells. Cell 46, 795-805.
Oellig C and Seliger B (1990) Gene transfer into brain tumor cell
lines: reporter gene expression using various cellular and
viral promoters. J Neurosci Res 26, 390-396.
Palmer K, Moore J, Everard M, Harris J.D, Rodgers S, Rees RC,
Murray AK, Mascari R, Kirkwood J, Riches PG, Fisher C,
Thomas JM, Harries M, Johnston SR, Collins MK, and Gore
ME (1999) Gene therapy with autologous, interleukin 2-
secreting tumor cells in patients with malignant melanoma.
Hum Gene Ther 10, 1261-1268.
Palu G, Cavaggioni A, Calvi P, Franchin E, Pizzato M,
Boschetto R, Parolin C, Chilosi M, Ferrini S, Zanusso A, and
Colombo F (1999) Gene therapy of glioblastoma multiforme
via combined expression of suicide and cytokine genes: a
pilot study in humans. Gene Ther. 6, 330-337.
Parkinson DR, Abrams JS, Wiernik PH, Rayner AA, Margolin
KA, Van Echo DA, Sznol M, Dutcher JP, Aronson FR, and
Doroshow JH (1990) Interleukin-2 therapy in patients with
metastatic malignant melanoma: a phase II study. J Clin
Oncol 8, 1650-1656.
Pasleau F, Tocci M.J, Leung F, and Kopchick JJ (1985) Growth
hormone gene expression in eukaryotic cells directed by the
Rous sarcoma virus long terminal repeat or cytomegalovirus
immediate-early promoter. Gene 38, 227-232.
Porgador A, Gansbacher B, Bannerji R, Tzehoval E, Gilboa E,
Feldman M, and Eisenbach L (1993) Anti-metastatic
vaccination of tumor-bearing mice with IL-2-gene-inserted
tumor cells. Int J Cancer 53, 471-477.
Recillas-Targa F, Valadez-Graham V, and Farrell CM (2004)
Prospects and implications of using chromatin insulators in
gene therapy and transgenesis. Bioessays 26, 796-807.
Siegel JP and Puri RK (1991) Interleukin-2 toxicity. J Clin
Oncol 9, 694-704.
Thomas M and Klibanov AM (2003) Non-viral gene therapy:
polycation-mediated DNA delivery. Appl Microbiol
Biotechnol 62, 27-34.
Toloza EM, Hunt K, Swisher S, McBride W, Lau R, Pang S,
Rhoades K, Drake T, Belldegrun A, Glaspy J, and Economou
JS (1996) In vivo cancer gene therapy with a recombinant
interleukin-2 adenovirus vector. Cancer Gene Ther. 3, 11-
17.
Tsang TC, Brailey JL, Vasanwala FH, Wu RS, Liu F, Clark PR,
Meade-Tollin L, Luznick L, Stopeck AT, Akporiaye ET, and
Harris DT (2000) Construction of new amplifier expression
vectors for high levels of IL-2 gene expression. Int J Mol
Med 5, 295-300.
Tsang TC, Harris DT, Akporiaye ET, Schluter SF, Bowden G.T,
and Hersh EM (1996) Simple method for adapting DNA
fragments and PCR products to all of the commonly used
restriction sites. Biotechniques 20, 51-52.
Walsh P, Gonzalez R, Dow S, Elmslie R, Potter T, Glode LM,
Baron AE, Balmer C, Easterday K, Allen J, and Rosse P
(2000) A phase I study using direct combination DNA
injections for the immunotherapy of metastatic melanoma.
University of Colorado Cancer Center Clinical Trial. Hum
Gene Ther 11, 1355-1368.
Wang WK, Chen MY, Chuang CY, Jeang KT, and Huang LM
(2000) Molecular biology of human immunodeficiency virus
type 1. J Microbiol Immunol Infect 33, 131-140.
Xu ZL, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T, and
Hayakawa T (2001) Optimization of transcriptional
regulatory elements for constructing plasmid vectors. Gene
272, 149-156.
Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J,
McNeilly D, Cherry M, Osburn W, and Cheng SH (1997)
Optimization of plasmid vectors for high-level expression in
lung epithelial cells. Hum Gene Ther 8, 575-584.
From the left to the right: Dr. Xianghui He, Dr. David T Harris, Dr. Tom C Tsang
![Page 189: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/189.jpg)
Gene Therapy and Molecular Biology Vol 8, page 495
495
Gene Ther Mol Biol Vol 8, 495-500, 2004
Multiple detection of chromosomal gene correction
mediated by a RNA/DNA oligonucleotideResearch Article
Alvaro Galli, Grazia Lombardi, Tiziana Cervelli and Giuseppe Rainaldi*Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR , Area della Ricerca CNR, via G. Moruzzi
1, 56124 Pisa, Italy
__________________________________________________________________________________
*Correspondence: Giuseppe Rainaldi, Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica CNR, Area della
Ricerca CNR, via G. Moruzzi 1, 56124 Pisa, Italy; Tel +39 050 3153108; Fax + 39 050 3153328; e-mail: [email protected]
Key words: chimeric RNA/DNA oligonucleotide, gene correction, chromosomal target, HeLa cells, HygB/EGFP fusion gene.
Abbreviations: Dulbecco’s medium, (DMEM); enhanced green fluorescence gene, (EGFP); Restriction fragment length polymorphism,
(RFLP); RNA/DNA oligonucleotide, (RDO);
Received: 25 November 2004; Revised: 10 December 2004
Accepted: 15 December 2004; electronically published: December 2004
Summary
Chimeric RNA/DNA oligonucleotide (RDO)-mediated gene correction of a single base mutation in a gene of an
eukaryotic cell is still a controversial strategy. To better define the potential and applicability of this strategy, new
systems, that allow to detect RDO-mediated gene correction in the chromosomal DNA of human cells, are needed.
Here, we developed a construct containing hygromycin resistance mutant gene fused to the EGFP gene as target for
correction. HeLaS3 cells were transfected with the fusion gene and clones, which had integrated one or two copies
of the mutated fusion gene, were isolated and expanded. These cells were transfected with a RDO with a mismatch
at the position 336 of the bacterial hygromycin resistance gene. If the gene correction occurs, the expression of both
hygromycin resistance and EGFP genes is recovered. The RFLP and FACS analysis demonstrated that hygromycin
resistance phenotype was due to the correction of the mutation.
I. IntroductionA chimeric RNA/DNA oligonucleotide (RDO) is a
double stranded molecule consisting of RNA and DNA
residues, usually 70-80 bases in length, capped at both
ends by sequences which fold in a hairpin (Kmiec et al,
1994; Cervelli et al, 2002). The chimeric RDO contains a
single nucleotide that differs from the target sequence and,
therefore, forms a specific mismatch.
The method of targeted gene correction by specific
RDO or modified DNA oligonucleotide was developed to
generate or correct point mutations (Rice et al, 2001;
Brachman and Kmiec, 2002; Liu et al, 2003). This strategy
has been successfully used in several genetic systems both
in vitro using mammalian cells or mammalian and plant
cell free extracts, and in vivo using several animal models
(Cole-Strauss et al, 1996; Yoon et al, 1996; Kren et al,
1997, 1999; Xiang et al, 1997; Alexeev and Yoon, 1998;
Bartlett et al, 2000; Gamper et al, 2000; Rando et al, 2000;
Liu et al, 2001; Kenner et al, 2002, 2004; Parekh-Olmedo
and Kmiec, 2003). Recent data have contributed to
understand the mechanisms and the genetic requirements
of gene correction (Rice et al, 2001; Liu et al, 2001,
2002a, b; Parekh-Olmedo et al, 2002). It has been
proposed that the DNA strand of RDO is responsible for
gene correction activity and that the active DNA strand
has to be generated inside the cell nearby the target site of
correction (Andersen et al, 2002; Liu et al, 2003;
Igoucheva et al, 2004). The stimulation of gene correction
was also observed after DNA damage induction and
following the activation of homologous recombination
indicating that in mammalian cells the efficiency of gene
correction may depend on the ability of the cells to
undergo homologous recombination (Ferrara and Kmiec,
2004; Ferrara et al, 2004). However, the frequency of gene
correction still remains highly variable and the reason for
these differences is not yet clear. The lack of standardized
assays for evaluating the gene correction at phenotypic
level without the PCR analysis and the not yet proved
mechanism that can direct the RDO-mediated correction
of a chromosomal gene are the two main concerns about
the applicability (Zhang et al, 1998; Rice et al, 2001; Yoon
et al, 2002; Kmiec 2003). In this work, we generated two
HeLa–derivative cell lines that contain in the genome a
fusion construct composed by a mutated antibiotic-
resistance gene (Hygromycin B) and the enhanced green
fluorescence gene (EGFP). We report that, when gene
![Page 190: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/190.jpg)
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide
496
correction was measured following RDO transfection,
cells both resistant to hygromycin and expressing EGFP
were recovered indicating that RDO is able to induce gene
correction at chromosomal level.
II. Materials and methodsA. Cell line and culture conditionsHeLaS3 cells (from Margherita Bignami, ISS, Rome, Italy)
were routinely cultured in Dulbecco’s medium (DMEM)
supplemented with 10% fetal calf serum, 100UI/ml penicillin and
100 µg/ml streptomycin at 37°C in a humidified atmosphere
containing 6% CO2.
B. Construction of the plasmid pHygNSNeo,
transfection and Southern analysisPlasmid pHygNSNeo was constructed from pHygEGFP
(Clontech) (Figure 1A) and pMC1neo (Stratagene). pHygEGFP
was restricted with HindIII and SalI. This resulted in 2 fragments
that are 2123 bp and 3669 bp long, respectively. The 2123 bp
fragment was further digested with NcoI obtaining 2 fragments
that are 714 bp and 1409 bp long. The 714 bp NcoI-HindIII
fragment was PCR amplified from pHygEGFP. The forward
primer, 5'-TAGAAGCTTTATTGCGGTAGTTTATCACAG-3',
was designed with HindIII restriction site at 5’end. The reverse
primer, 5'-TTTCCATGGCCTCCGCGACCGGCTACA-3', was
designed with NcoI restriction site at the 5’end such to introduce
a point mutation (A) at the position 336 of hygB gene. This
mutation produces a stop codon and the loss of the PstI
restriction site. Amplification was performed by denaturation at
94°C for 3 min, followed by 35 cycles of 94°C for 30 sec, 67°C
for 45 sec, and then extension at 72°C for 2 min. The direct
ligation of the new 714 bp NcoI-HindIII fragment containing the
stop codon with the 1409 bp NcoI-SalI fragment and the 3669 bp
HindIII-SalI fragment formed the plasmid pHygNS. Afterward,
the neomycin resistance gene (neo) was inserted into the SalI site
of pHygNS by cloning the 1100 bp XhoI-SalI fragment from
pMC1neo. The new vector containing a stop codon 336 bases
downstream to the ATG of the hygB-EGFP fusion and the neo
marker was named pHygNSNeo. The presence of the stop codon
was confirmed by sequence analysis.
Plasmid pHygNSNeo was transfected in HeLaS3 by
electroporation. A sample of 3.5x106 exponentially growing cells
and 10 µg of pHygNSNeo linearized with restriction enzyme
ClaI were resuspended in 250 µl DMEM without serum and
antibiotics. The suspension was then transferred to 50 x 4 mm
cuvette (Equibio) and incubated on ice for 10 min. Afterward, the
cuvette was exposed to one pulse (330 V, 1000 µF, 200 !) using
the Electroporator II apparatus (Invitrogen) connected to a power
supply (330 V, 25 mA, 25 W). The cell suspension was then
cooled for 15 min on ice, resuspended in complete medium and
seeded in four 100 mm diameter dishes at density of 5x105 cells
per dish. After 24 hours, 1000 µg/ml G418 (Invitrogen) were
added to every dish. After 15-21 days, one G418 resistant
(G418R) colony per dish was isolated, expanded to clonal
population and analyzed for the presence of pHygNSNeo as
follows. Genomic DNA was digested with HindIII and analyzed
by standard Southern blot procedures. Briefly, 10µg DNA per
sample was electrophoresed on 0.8% agarose gel, transferred to
nylon positively charged membrane (Roche) and hybridized with
digoxigenin labeled HygEGFP as probe. The labeling was
carried out by Random primed DNA labeling kit (Roche).
C. Synthesis and transfection of the chimeric
RNA/DNA oligonucleotide (Ch867)
The chimeric RDO, named Ch867, was obtained by using
the standard phosphoramidite chemistry in an automatic
synthesizer Expedite 8909 (Millipore). After ammonia
deprotection, Ch867 was purified, desalted and stocked at –20°C.
The structure of Ch867 is depicted in Figure 1C.
Cells of HeLa S3/G418R clones were seeded at density of
4x105 cells per 30 mm diameter dish in 3 ml of growth medium.
18 µg of Ch867 were diluted with DMEM without serum and
antibiotics to a total volume of 100 µl and incubated with 22 µl
of PolyFect Lipofection Reagent (Qiagen). The lipofection
complex was added according to the manufacture’s
recommendation.
Each transfected clone was grown for 96 h in normal
medium to allow the correction and the expression of hyg gene.
At that time, 3x105 cells were seeded on 100 mm diameter dish
in selective medium containing 300 µg/ml hygromycin (Roche),
a selective dose derived from dose response curve carried out for
HeLaS3 (data not shown). The selective medium was changed
every 4 days and after 12 days, hygromycin resistant colonies
were harvested, expanded as polyclonal population in complete
growth medium without hygromycin, and analyzed by RFLP and
FACS analysis.
D. Flow cytometryThe count of fluorescent HeLaS3 cells was performed by
flow-cytometry on a fluorescence-activated cell sorting apparatus
(FACScan, Lysys II software, Becton Dickinson, San Jose, CA).
Briefly, 5x105 cells were resuspended in 100 µl PBS and the
fluorescence of 104 cells was determined.
E. Restriction fragment length polymorphism
(RFLP)Genomic DNA extracted from polyclonal populations was
amplified by PCR. The forward and reverse primers sequences
were 5’-TGATGCAGCTCTCGGAGG-3’ and 5’-
AGTGTATTGACCGATTCCTTG-3’ respectively. The PCR
conditions to generate a 361-bp fragment were 94°C for 30 sec,
54°C for 30 sec, 72°C for 45 sec for 35 cycles. 10 µl PCR
product was incubated overnight with PstI in a final volume of
20 µl. Later on, 10 µl were loaded onto 2% agarose gel (1X TBE,
EtBr 1 µg/ml), electrophoresed for 2 h at 50 V, and the migration
profile analyzed.
40 ng of 361 bp PCR product were submitted to the
automatic sequencing to verify the occurrence of base correction.
III. ResultsTo study the chimeric RDO-mediated gene
correction in the chromosomal DNA of HeLaS3 cells we
first constructed the plasmid pHygNSNeo containing a
point mutation within the coding region of bacterial hygB
gene at the position 336 (C"T) generating a stop codon
(TAG) and the loss of PstI restriction site (Figure 1A).
Therefore, the hygB gene is not functional and the fused
EGFP gene is not translated. Thereafter, we transfected
HeLaS3 cells with pHygNSNeo and then selected them in
medium containing G418. Two independent G418
resistant colonies were isolated, expanded to clonal
population and analyzed for the presence of hygB gene.
Genomic DNA was digested with HindIII, which cuts only
once in pHygNSNeo, blotted and hybridized with DIG-
labeled HygEGFP fusion gene as probe. As shown in the
Figure 1B, the clone 20105.3A (lane 3) has at least 2
copies and the clone 20105.6A (lane 4) only one copy of
the integrated vector. Furthermore, the migration profile
![Page 191: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/191.jpg)
Gene Therapy and Molecular Biology Vol 8, page 497
497
Figure 1. Plasmid pHygNSNeo and chimeric RNA/DNA oligonucleotide Ch867. (A) Diagram of the pHygNSNeo plasmid containing a
single point mutation, thymine, at the position 336 in the coding region of hygB gene (bold letter). (B) Southern blot analysis of G418
resistant clones. Sample of DNA (10 µg) were digested with HindIII and analyzed by Southern blotting. The fused gene was used as
probe. Lane 1: pHygNSNeo, lane 2: HeLaS3, lane 3: 20105.3A and lane 4: 20105.6A. (C) Sequences of the target site before and after
correction by Ch867. Ch867 consists of a 35 bp long duplex bracket by 4 base long hairpin loops. Each RNA residue (small letters) is
modified by the inclusion of a 2’-O-methyl group on ribose sugar. The DNA (capital letters) contains the designed base for correction.
analysis indicated that the integration occurred at different
genomic sites. A chimeric RDO, named Ch867, was
designed according to Gamper and colleagues who
demonstrated that the most efficient chimeric RDO has
one strand containing 2’-O-methyl RNA homologous to
the target site and a DNA strand bearing the mismatched
base (Figure 1C)(Gamper et al, 2000). A gene correction
event mediated by Ch867 not only will recover the hygB
wild type sequence, but also restore the PstI site and,
consequently, the right frame leading to the expression of
the fusion HygEGFP. We then transfected the chimeric
RDO Ch867 in the two clones 20105.3A and .6A
according to the transfection protocol that gives high level
of nuclear localization of the RDO (Cervelli et al, 2002).
The Ch867 transfection increased significantly (p#0.01)
the frequency of hygR clones by 6.7 fold (20105.3A) and
3.7 fold (20105.6A) above the spontaneous level (Table
1). Vice versa, 20105.3A and 20105.6A cells transfected
with an unrelated RDO showed no increase in hygromycin
resistance frequency as compared to the non-transfected
control has been observed (data not shown) (Cervelli et al,
2002).
To test whether the enhancement of hygromycin
resistance frequency was due to the correction of the stop
mutation of hygB gene, hygromycin resistant colonies
formed after 12 days of growth in selective medium were
analyzed as a whole population (pools of 10-20 clones) for
the presence of PstI restriction site in the integrated hygB
target. Therefore, genomic DNA extracted from
polyclonal hygR populations was subjected to PCR and the
amplification products were digested with PstI. The
digestion of the 361 bp PCR fragment with PstI yielded a
fragment of 98 bp and one of 263 bp as shown by the PstI
digestion of pHygNSNeo (Figure 2A, panel 1). As shown
in the Figure 3A, the PstI site was present in the two
populations 20105.3A and 20105.6A transfected with
Ch867 (Figure 2A panel 3 and 4). On the other hand, the
PstI site is not present in 361bp hygB fragment amplified
![Page 192: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/192.jpg)
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide
498
Table 1. Effect of Ch867 on hygromycin resistance frequency in HeLaS3 cells
hygromycin resistance frequency x 10-5 a
G418R clones - Ch867 + Ch867 Fold increaseb
20105.3A 0.78±0.66 5.25±0.98** 6.7
20105.6A 2.08±1.39 7.75±2.06** 3.7
Results are reported as mean±standard deviation of at least 3 independent experiments. Results are statistically analysed with the Student
“t” test; ** p#0.01a hygromycin resistance frequency has been calculated dividing the number of hygR colonies by the number of viable cells.b Fold increase represents the ratio between the two hygR frequencies obtained with and without transfection of Ch867.
Figure 2. (A) RFLP analysis of the 361 bp PCR fragment from pHygNSNeo (panel 1), from hygR polyclonal population of 20105.3A
and .6A transfected with Ch867 (panel 3 and 4), and from hygR polyclonal population of non transfected 20105.3A (panel 2). 500-600ng
DNA were digested with PstI and loaded in each lane (+). The same amount of DNA was loaded as control (-). (B) Sequence of the PCR
fragment from a PstI positive polyclonal population. Only the region flanking the nucleotide 336 is shown. Arrow indicates the targeted
base for correction.
by genomic DNA extracted from the polyclonal
hygromycin resistant population derived from 20105.3A
non transfected (Figure 2A, panel 2) and 20105.6A (data
not shown). Moreover, PstI restriction of PCR fragment
from pHygNSNeo was complete, whereas, PstI restriction
of PCR fragments from polyclonal transfected populations
was only partial (Figure 2A, panel 1, 3 and 4). This
observation was also confirmed by the sequencing of a
PstI-positive polyclonal population that showed a mixture
of T (mutated nucleotide) and C (correct wild type
nucleotide) at position 336 of hygB gene (Figure 2B).
This indicated that Ch867 corrected the mutant sequence.
To ascertain whether the base correction, which
restored the PstI site, allows the expression of the fused
EGFP gene, spontaneous and Ch867-induced hygromycin
resistant clones were analyzed by FACS. Fluorescence
profile of PstI negative clone (thick line) was overlapped
that of parental population (thin line), whereas that PstI
positive clone was only in part overlapped that of parental
population (Figure 3A and 3B). Thus, the fluorescence of
the PstI positive clone was higher than PstI negative clone
demonstrating that the correction also restored the EGFP
expression.
IV. DiscussionThe reason for the differences in the gene correction
rate observed in several experiments is not yet elucidated
(Santana et al, 1998; Rice et al, 2001; Brachman and
![Page 193: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/193.jpg)
Gene Therapy and Molecular Biology Vol 8, page 499
499
Figure 3. Flow cytometry of spontaneous PstI negative hygR clone (A) and PstI positive hygR clone of 20105.3A cells (B). The
fluorescence profile of both clones (red area) (thick line) is compared to the profile of the parental cell population (thin line).
Kmiec 2002). The major concerns on the chimeric RDO
mediated-gene correction derive from the use of PCR
amplification as primary screen for the detection of the
correction event (Zhang et al, 1998). The set up of new
systems where the gene correction events leads to the
reversion of a mutation in a gene conferring more than one
phenotype is ideal to overcome the problem. Here, we
described an additional eukaryotic assay to study
chromosomal gene correction in human cells in which the
gene correction event is screened by multiple detection. A
fusion HygEGFP gene was mutated by the insertion of a
stop codon in the HygB sequence. Therefore, cells having
this construct integrated in the genome are hygromycin
sensitive and do not express EGFP. We designed a
chimeric RDO, named Ch867, to correct the stop mutation
of the hygB gene. After transfection with Ch867, HeLaS3
containing the hygB mutated gene integrated as single or
multiple copies showed an enhancement of hygromycin
resistance frequency over the spontaneous baseline, and
restored both PstI site and EGFP expression. The RDO
transfection increased 6.7 fold the frequency of gene
correction in the cells containing at least two copies of the
hygB mutated gene, and 3.7 fold in cells with one copy of
the hygB mutated gene suggesting that the copy number of
the integrated target may have an influence on gene
correction. However, the direct comparison of the
frequencies demonstrated that the difference is not
statistically significant (p= 0.114).
A confounding effect in the detection of gene
correction is represented by the presence of hygR
spontaneous clones. For that, we were forced to carry out
the analyses in the polyclonal populations. To rule out the
possibility to get false positive results due to PCR artifact,
in other words, to exclude that chimeric RDO itself could
serve as primer and template in the PCR amplification
(Zhang et al, 1998), we analyzed hygR polyclonal
population of transfected and non transfected cells after
growing them for 12 days in presence of hygromycin. The
RFLP analysis (Figure 2A) and the sequencing of PCR
fragments (Figure 2B) revealed a mixture of correct and
mutant sequences in hygR polyclonal populations derived
from Ch867 transfected cells. Fluorescence intensity of a
PstI positive hygR clone obtained from Ch867 transfection
was significantly higher than that of PstI negative hygR
clone. All these results demonstrated that Ch867 precisely
corrected the base mutation given that the expression of
the fused HygEGFP gene was obtained. Therefore, a
system in which the gene correction is tested by multiple
detection, such as hygromycin resistance, RFLP and
FACS analysis, may be useful to select for accurate
correction event.
The results of this study confirm that the chimeric
RDO strategy may be feasible to correct single base
mutation and, therefore, useful to treat single gene
diseases.
AcknowledgementsAuthors wish to thank Margherita Bignami for
HeLaS3 cell line, Antonio Piras and Federica Mori for
their technical support, and Lorenzo Citti for RDO
synthesis.
ReferencesAlexeev V and Yoon K (1998) Stable and inheritable changes in
genotype and phenotype of albino melanocytes induced by
an RNA-DNA oligonucleotide. Nat Biotechnol 16, 1343-
1346.
Andersen MS, Sorensen CB, Bolund L and Jensen TG (2002)
Mechanisms underlying targeted gene correction using
chimeric RNA/DNA and single-stranded DNA
oligonucleotides. J Mol Med 80, 770-781.
Bartlett RJ, Stockinger S, Denis MM, Bartlett WT, Inverardi L,
Le TT, thi Man N, Morris GE, Bogan DJ, Metcalf-Bogan J
and Kornegay JN (2000) In vivo targeted repair of a point
mutation in the canine dystrophin gene by a chimeric
RNA/DNA oligonucleotide. Nat Biotechnol 18, 615-622.
Brachman EE and Kmiec EB (2002) The 'biased' evolution of
targeted gene repair. Curr Opin Mol Ther 4, 171-176.
Cervelli T, Lombardi G, Citti L, Galli A, Locci MT and Rainaldi
G (2002) Targeting of A701G nucleotide at the human
![Page 194: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/194.jpg)
Galli et al: Chromosomal gene correction by a RNA/DNA oligonucleotide
500
ATP1A1 locus using a RNA/DNA chimera. Nucleosides
Nucleotides Nucleic Acids 21, 775-784.
Cole-Strauss A, Yoon K, Xiang Y, Byrne BC, Rice MC, Gryn J,
Holloman WK and Kmiec EB (1996) Correction of the
mutation responsible for sickle cell anemia by an RNA-DNA
oligonucleotide. Science 273, 1386-1389.
Ferrara L and Kmiec EB (2004) Camptothecin enhances the
frequency of oligonucleotide-directed gene repair in
mammalian cells by inducing DNA damage and activating
homologous recombination. Nucleic Acids Res 32, 5239-
5248.
Ferrara L, Parekh-Olmedo H and Kmiec EB (2004) Enhanced
oligonucleotide-directed gene targeting in mammalian cells
following treatment with DNA damaging agents. Exp Cell
Res 300, 170-179.
Gamper HB, Jr., Cole-Strauss A, Metz R, Parekh H, Kumar R
and Kmiec EB (2000) A plausible mechanism for gene
correction by chimeric oligonucleotides. Biochemistry 39,
5808-5816.
Gamper HB, Parekh H, Rice MC, Bruner M, Youkey H and
Kmiec EB (2000) The DNA strand of chimeric RNA/DNA
oligonucleotides can direct gene repair/conversion activity in
mammalian and plant cell-free extracts. Nucleic Acids Res
28, 4332-4339.
Igoucheva O, Alexeev V and Yoon K (2004) Oligonucleotide-
directed mutagenesis and targeted gene correction: a
mechanistic point of view. Curr Mol Med 4, 445-463.
Kenner O, Kneisel A, Klingler J, Bartelt B, Speit G, Vogel W
and Kaufmann D (2002) Targeted gene correction of hprt
mutations by 45 base single-stranded oligonucleotides.
Biochem Biophys Res Commun 299, 787-792.
Kenner O, Lutomska A, Speit G, Vogel W and Kaufmann D
(2004) Concurrent targeted exchange of three bases in
mammalian hprt by oligonucleotides. Biochem Biophys Res
Commun 321, 1017-1023.
Kmiec EB (2003) Targeted gene repair -- in the arena. J Clin
Invest 112, 632-636.
Kmiec EB, Cole A and Holloman WK (1994) The REC2 gene
encodes the homologous pairing protein of Ustilago maydis.
Mol Cell Biol 14, 7163-7172.
Kren BT, Cole-Strauss A, Kmiec EB and Steer CJ (1997)
Targeted nucleotide exchange in the alkaline phosphatase
gene of HuH-7 cells mediated by a chimeric RNA/DNA
oligonucleotide. Hepatology 25, 1462-1468.
Kren BT, Parashar B, Bandyopadhyay P, Chowdhury NR,
Chowdhury JR and Steer CJ (1999) Correction of the UDP-
glucuronosyltransferase gene defect in the gunn rat model of
crigler-najjar syndrome type I with a chimeric
oligonucleotide. Proc Natl Acad Sci U S A 96, 10349-
10354.
Liu L, Cheng S, van Brabant AJ and Kmiec EB (2002a) Rad51p
and Rad54p, but not Rad52p, elevate gene repair in
Saccharomyces cerevisiae directed by modified single-
stranded oligonucleotide vectors. Nucleic Acids Res 30,
2742-2750.
Liu L, Parekh-Olmedo H and Kmiec EB (2003) The
development and regulation of gene repair. Nat Rev Genet
4, 679-689.
Liu L, Rice MC and Kmiec EB (2001) In vivo gene repair of
point and frameshift mutations directed by chimeric
RNA/DNA oligonucleotides and modified single-stranded
oligonucleotides. Nucleic Acids Res 29, 4238-4250.
Liu L, Rice MC, Drury M, Cheng S, Gamper H and Kmiec EB
(2002b) Strand bias in targeted gene repair is influenced by
transcriptional activity. Mol Cell Biol 22, 3852-3863.
Parekh-Olmedo H and Kmiec EB (2003) Targeted nucleotide
exchange in the CAG repeat region of the human HD gene.
Biochem Biophys Res Commun 310, 660-666.
Parekh-Olmedo H, Drury M and Kmiec EB (2002) Targeted
nucleotide exchange in Saccharomyces cerevisiae directed by
short oligonucleotides containing locked nucleic acids.
Chem Biol 9, 1073-1084.
Rando TA, Disatnik MH and Zhou LZ (2000) Rescue of
dystrophin expression in mdx mouse muscle by RNA/DNA
oligonucleotides. Proc Natl Acad Sci U S A 97, 5363-5368.
Rice MC, Bruner M, Czymmek K and Kmiec EB (2001) In vitro
and in vivo nucleotide exchange directed by chimeric
RNA/DNA oligonucleotides in Saccharomyces cerevisae.
Mol Microbiol 40, 857-868.
Rice MC, Czymmek K and Kmiec EB (2001) The potential of
nucleic acid repair in functional genomics. Nat Biotechnol
19, 321-326.
Santana E, Peritz AE, Iyer S, Uitto J and Yoon K (1998)
Different frequency of gene targeting events by the RNA-
DNA oligonucleotide among epithelial cells. J Invest
Dermatol 111, 1172-1177.
Xiang Y, Cole-Strauss A, Yoon K, Gryn J and Kmiec EB (1997)
Targeted gene conversion in a mammalian CD34+-enriched
cell population using a chimeric RNA/DNA oligonucleotide.
J Mol Med 75, 829-835.
Yoon K, Cole-Strauss A and Kmiec EB (1996) Targeted gene
correction of episomal DNA in mammalian cells mediated by
a chimeric RNA.DNA oligonucleotide. Proc Natl Acad Sci
U S A 93, 2071-2076.
Yoon K, Igoucheva O and Alexeev V (2002) Expectations and
reality in gene repair. Nat Biotechnol 20, 1197-1198.
Zhang Z, Eriksson M, Falk G, Graff C, Presnell SC, Read MS,
Nichols TC, Blomback M and Anvret M (1998) Failure to
achieve gene conversion with chimeric circular
oligonucleotides: potentially misleading PCR artifacts
observed. Antisense Nucleic Acid Drug Dev 8, 531-536.
Giuseppe Rainaldi
![Page 195: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/195.jpg)
Gene Therapy and Molecular Biology Vol 8, page 501
501
Gene Ther Mol Biol Vol 8, 501-508, 2004
Nitric oxide and endotoxin-mediated sepsis: the role
of osteopontinReview Article
Philip Y. Wai and Paul C. Kuo*Department of Surgery, Duke University Medical Center, Durham, NC 27710
__________________________________________________________________________________
*Correspondence: Paul C. Kuo, M.D., Department of Surgery, 110 Bell Building, Duke University Medical Center, Durham, NC
27710; Tel: 919-668-1856; Fax: 919-684-8716; e-mail: [email protected]
Key words: osteopontin, hnRNP A/B, sepsis, endotoxin, LPS, nitric oxide
Abbreviations: bactericidal/permeability-increasing, (BPI); basic fibroblast growth factor, (bFGF); cardiac index, (CI); cholesterol ester
transfer protein, (CETP); chromatin immunoprecipitation, (ChIP); c-Jun N-terminal kinase, (JNK); cyclic monophosphate, (cGMP);
endothelial NOS, (eNOS); Gly-Arg-Gly-Asp-Ser, (GRGDS); glycosylphosphatidyinositol, (GPI); heterogeneous ribonucleoprotein A/B,
(hnRNP A/B); inducible NO synthase, (iNOS); interferon gamma, (IFN-!); interleukin-1, (IL-1); lipopolysaccharide, (LPS); mean
arterial pressure, (MAP); neuronal NOS, (nNOS); NG-nitro-L-arginine methyl ester, (L-NAME); Nitric oxide, (NO); NO synthase,
(NOS); osteopontin, (OPN); phorbol 12-myristate 13-acetate, (PMA); phospholipid transfer protein, (PLTP); platelet activating factor,
(PAF); poly-ADP ribose synthase, (PARS); protein kinase RNA-regulated, (PKR); pulmonary vascular resistance, (PVR); reactive
oxygen species, (ROS); suppression subtractive hybridization, (SSH); systemic inflammatory response syndrome, (SIRS); systemic
vascular resistance, (SVR); TNF" receptor-associated factor-6, (TRAF6); Toll-like receptor 4, (TLR4); tumor necrosis factor-", (TNF-
")
Received: 2 November 2004; Revised: 9 December 2004
Accepted: 10 December 2004 electronically published: December 2004
Summary
Septic shock continues to be a life threatening complication of systemic infection despite advances in the clinical
care of these patients. The incidence of severe sepsis in critically ill patients has increased annually by 8.7% and
mortality rates are excessive, ranging from 30%-60%. Nitric oxide plays a central role in the molecular biology and
biochemistry of septic shock. In endotoxin-mediated sepsis and septic shock, pro-inflammatory cytokines are
elaborated and inducible nitric oxide synthase is systemically expressed in multiple cell types. The sustained
production of nitric oxide in high concentration regulates multiple cellular and biochemical functions. Multiple
studies have investigated the role of nitric oxide synthase antagonists in the treatment of septic shock in both animal
models of endotoxemia and human clinical trials. However, cumulative data from these studies have not provided
definitive evidence for a survival benefit in the use of these agents in humans. While the signalling pathways that
activate iNOS expression or activity are well characterized, little is known about the endogenous molecular
determinants that decrease NO. In this regard, osteopontin, recently identified as an intrinsic regulator of iNOS
expression in endotoxin-stimulated macrophages, represents a novel target in the understanding of nitric oxide
pathobiology in sepsis. The purpose of this review is to discuss the S-nitrosylation of heterogeneous
ribonucleoprotein A/B in the transcriptional regulation of osteopontin in nitric oxide- mediated sepsis.
I. IntroductionSepsis refers to a heterogeneous group of
inflammatory syndromes that represent various stages
involved in the host-response to infection. Septic shock
has been previously defined as sepsis-induced hypotension
that persists despite adequate fluid resuscitation with
characteristic clinical manifestations such as lactic
acidosis, oliguria or coagulopathy (Bone et al, 1992; Levy
et al, 2003). There is a continuum and natural progression
between the different stages of the inflammatory response
from systemic inflammatory response syndrome (SIRS) to
sepsis, severe sepsis, shock, and multiple organ
dysfunction (Brun-Buisson, 2000). Risk factors identified
as independently associated with severe sepsis include
age, male sex, the presence of indwelling catheters or
devices, chronic liver insufficiency, immunodepression, or
severe underlying disease (Brun-Buisson et al, 1995, 2004;
Balk, 2004). Septic shock continues to be a life threatening
complication of systemic infection despite advances in the
clinical care of these patients. The incidence of severe
sepsis in critically ill patients has increased annually by
![Page 196: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/196.jpg)
Wai and Kuo: Regulation of NO in sepsis by OPN
502
8.7% (Balk, 2004) with mortality rates ranging from 30%-
60% (Brun-Buisson et al, 1995, 2004; Martin et al, 2003;
Balk, 2004).
Nitric oxide (NO) plays a central role in the
molecular biology and biochemistry of septic shock. In
endotoxin-mediated sepsis and septic shock, pro-
inflammatory cytokines are elaborated and inducible NO
synthase (iNOS) is systemically expressed in multiple cell
types. The sustained production of NO in high
concentration regulates multiple cellular and biochemical
functions, including inotropic and chronotropic cardiac
responses, systemic vasomotor tone, intestinal epithelial
permeability, endothelial activation, and microvascular
permeability (Finkel et al, 1992; Kilbourn et al, 1997;
Chavez et al, 1999).
In the decade since the discovery of NO as
endothelium derived relaxing factor, multiple studies have
investigated the role of NO synthase (NOS) antagonists in
the treatment of septic shock in both animal models of
endotoxemia and human clinical trials. The cumulative
data from these studies do not reach consensus and
conflict on whether NOS antagonists decrease sepsis-
related mortality. Certainly, substantial evidence supports
that NOS inhibition improves physiological endpoints
during septic shock (Vincent et al, 2000; Cobb, 2001;
Feihl et al, 2001). The non-selective and non-physiologic
effects of these inhibitors used in model systems may
account for some of the adverse effects observed in these
studies and for the failure of these agents in increasing
survival in clinical studies. Few studies have attempted to
modulate iNOS expression by manipulating the intrinsic,
homeostatic mechanisms that lead to iNOS down-
regulation. Interestingly, while the signalling pathways
that activate iNOS expression or activity are well
characterized, little is known about the endogenous
molecular determinants that decrease NO. In this regard,
the recent discovery of osteopontin (OPN) as an intrinsic
regulator of iNOS expression in endotoxin-stimulated
macrophages represents an area of investigation that may
yield novel targets for the therapeutic modulation of NO
during sepsis.
In this discussion, we review the lipopolysaccharide
(LPS) signalling pathways that lead to upregulation of
iNOS expression and the biochemistry and physiology of
NO in septic shock. In addition, we will describe the role
of OPN in the regulation of NO and the identification of
heterogeneous ribonucleoprotein A/B (hnRNP A/B) as an
endogenous, NO-dependent, transcriptional regulator of
OPN.
II. The LPS signalling pathway in
sepsisLPS endotoxin is the principal component of the
outer membrane of Gram-negative bacteria. The structural
components of LPS include an outer O-antigen
polysaccharide region; outer, intermediate, and inner core
polysaccharide regions; and the toxic lipid A moiety
embedded deep within the outer membrane (Alexander
and Rietschel, 2001; Lazaron and Dunn, 2002).
Stimulation with LPS activates the cells of the innate
immune system to produce a variety of inflammatory
cytokines including interleukin-1 (IL-1), IL-6, IL-8, tumor
necrosis factor-" (TNF-") and NO. However,
overstimulation of the monocytic signalling pathways with
LPS can lead to systemic inflammation resulting in sepsis
or shock.
The LPS signalling cascade involves the complex co-
operation of a multitude of receptors, cofactors and
messenger proteins (Figure 1).
The processing of LPS for signal transduction begins
in the extracellular space with the ligation of LPS by LPS-
binding protein (LBP). Derived from hepatic synthesis,
LBP is secreted into the serum, and responds to LPS
stimulation with a 5- to 20- fold increase in LBP
concentration (Lazaron and Dunn, 2002). Sequence
analysis and cloning of LBP cDNA has led to the
identification of a family of related proteins that include
bactericidal/permeability-increasing protein (BPI),
cholesterol ester transfer protein (CETP), and
phospholipid transfer protein (PLTP). The
glycosylphosphatidyinositol (GPI)-linked membrane
protein, CD14, is a myeloid surface antigen that lacks a
transmembrane domain. A non-GPI-containing soluble
form of CD14 is also secreted into the serum (Lazaron and
Dunn, 2002). CD14 functions by recognizing the LPS-
LBP complex (Figure 1). Loss-of-function studies have
demonstrated that LBP and CD14 are necessary for the
rapid and sensitive induction of the monocyte/macrophage
inflammatory response to LPS (Diks et al, 2001). These
cofactors appear to enhance the function of Toll-like
receptor 4 (TLR4), the putative signalling receptor for
LPS. Studies using murine macrophages with a targeted
loss-of-function in TLR4 resulted in the ablation of the
physiologic response to LPS (Guha and Mackman, 2001).
TLR4 activity was found to be dependent on MD-2, a
secreted protein that associates with TLR4 and enhances
TLR4-dependent signalling pathways (Figure 1).
TLR4 regulates multiple intracellular, inflammatory
signalling cascades including the NF-#B, ERK, JNK and
p38 pathways. Cumulative data suggests that MyD88, IL-1
receptor-associated kinase (IRAK) and TNF" receptor-
associated factor-6 (TRAF6) mediate TLR4 activation of
NF-#B by enhancing phosphorylation of IKK$, which in
turn phosphorylates I#B and leads to the translocation of
NF-#B p50 and p65 into the nucleus (Diks et al, 2001;
Guha and Mackman, 2001). LPS also activates the extra-
cellular signal-regulated kinase (ERK1/2) signalling
pathway. LPS-mediated activation of MEK-ERK1/2
appears to occur via diverse mechanisms as both Ras/c-
Raf -dependent and -independent pathways have been
identified (Guha and Mackman, 2001). One downstream
target of the MEK-ERK1/2 pathway is the transcription
factor Elk-1, which co-operates with SRF to activate target
genes. The c-Jun N-terminal kinase (JNK) signalling
pathway can also be activated by LPS. Upstream
activators of JNK include mPAK3, hPAK1, GCK,
MEKK1 and MKK4/7 and the targeted transcription
factors consist of c-Jun, ATF-2 and Elk-1 (Guha and
Mackman, 2001). The p38 signalling pathway is yet
another unique signalling pathway that is regulated by
LPS. Cdc42, PAK , Rac1, protein kinase RNA-regulated
(PKR) and MKK3/6 are some of the upstream signalling
![Page 197: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/197.jpg)
Gene Therapy and Molecular Biology Vol 8, page 503
503
Figure 1. The LPS signalling
pathway regulates transcription of
the inflammatory mediator genes IL-
1, IL-6, IL-8, TNF-", and iNOS
(Alexander and Rietschel, 2001;
Diks et al, 2001; Guha and
Mackman, 2001; Lazaron and Dunn,
2002). Please see text for details.
Partialy reproduced from Guha and
Mackman, 2001 with kind
permission from Cellular Signalling.
molecules that activate p38. Target transcription factors
activated by p38 include ATF-2, Elk-1, CHOP, MEF2C,
Sap1a, CREB and ATF-1 (Guha and Mackman, 2001).
Terminal signalling events from these different cascades
regulate gene expression of TNF-", IL-1, IL-6, IL-8, G-
CSF, GM-CSF, MCP-1, IL-2 R" and iNOS.
III. Increased nitric oxide production
in sepsisA. NO biosynthesis, mechanism of action,
and pathophysiologyAn important downstream effector of LPS signalling
is iNOS, the primary regulator of NO production in sepsis.
NO is a ubiquitous biological molecule produced by
several cell types. The terminal guanidino group of the
amino acid L-arginine gives rise to NO under redox-
regulation by NOS in a calmodulin-dependent manner
(Figure 2) (Nathan and Xie, 1994). The three known
isoforms of NOS have been identified as neuronal NOS
(nNOS/NOS-I), inducible NOS (iNOS/NOS-II), and
endothelial NOS (eNOS/NOS-III). While the expression
of nNOS and eNOS are constitutive, iNOS expression can
be significantly upregulated in response to bacterial
products and pro-inflammatory cytokines. NO production
and iNOS expression play a central role in the
pathobiology of sepsis. In the preceding section, we
briefly reviewed some of the signalling pathways by
which LPS signalling transcriptionally activates iNOS.
However, a variety of stimuli, including microbes, IL-1,
IL-6, IL-12, TNF, interferon-!, "/$ and platelet activating
factor (PAF), can promote iNOS expression (Nathan and
Xie, 1994; Nathan, 1997; Taylor and Geller, 2000).
During sepsis, these agents act synergistically to induce
iNOS gene transcription through complex signalling
pathways that involve the NF-#b, cyclic AMP-CREB-
C/EBP and Jak-Stat pathways (Nathan and Xie, 1994;
Nathan, 1997; Taylor and Geller, 2000; Diks et al, 2001).
Secondary auxiliary signalling pathways include AP-1,
phospholipase C, protein kinase C, Ras-MAP kinase, and
hypoxia inducible factor-1.
Figure 2. NO is produced by iNOS under redox conditions in a
calmodulin-dependent manner. L-arginine and oxygen are
catalytic substrates for iNOS during the production of NO and L-
citrulline. The reaction occurs with the oxidation of NAPDH to
NADP+.
![Page 198: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/198.jpg)
Wai and Kuo: Regulation of NO in sepsis by OPN
504
NO is a pleuripotent regulator of multiple cellular
and biochemical functions, including allosteric receptor
modification, enzymatic activity and transcriptional
regulation (Crapo and Stamler, 1994; Morris and Billiar,
1994; Simon et al, 1996). NO, a highly-diffusable, gaseous
free-radical, binds to heme-containing proteins such as
guanylate cyclase which it activates to release guanosine
3'5'-cyclic monophosphate (cGMP), a potent intracellular
second-messenger. NO also mediates S-nitrosylation of
key target molecules in many biological processes (Feihl
et al, 2001). Using these different mechanisms, NO can
generate a variety of downstream activators. NO and its
derivatives also possess innate biochemical properties as
reactive oxygen species (ROS). ROS species include NO,
its metabolic products (nitrite, nitrate and peroxynitrite)
and other related-molecules such as superoxide anion,
hydroxyl anion and hydrogen peroxide. Production of
ROS is enhanced in sepsis and these products exert toxic
effects on nucleic acids, lipids, and proteins (Symeonides
and Balk, 1999). In particular, peroxynitrite impairs
mitochondrial respiration, activates poly-ADP ribose
synthase (PARS), reduces NAD pools, cellular glycolysis,
electron transport, and limits ATP generation (Vincent et
al, 2000). These free-radical species are thought to be
responsible for significant cellular damage during severe
sepsis.
In endotoxin-mediated sepsis and septic shock, the
sustained production of NO in high concentration in
multiple cell types modifies inotropic and chronotropic
cardiac responses, systemic vasomotor tone, pulmonary
vasomotor tone, intestinal epithelial permeability,
endothelial activation, microvascular permeability, renal
tubular-glomerular feedback, platelet adhesion and
aggregation, and insulin metabolism (Finkel et al, 1992;
Kilbourn et al, 1997; Chavez et al, 1999; Symeonides and
Balk, 1999; Vincent et al, 2000). The natural history of
septic shock stems from the combination of negative
inotropic cardiac effects, pulmonary vasoconstriction and
hypertension, decreased vasomotor tone and profound
vasodilation with resultant hyperdynamic-cardiovascular
collapse, leading to overwhelming tissue hypoxia and
multiple organ dysfunction (Symeonides and Balk, 1999).
B. The negative feedback regulation of
NOOver the past decade, studies utilizing NOS
antagonists to treat the deleterious effects of septic shock
have produced conflicting results (Symeonides and Balk,
1999; Vincent et al, 2000; Cobb, 2001; Feihl et al, 2001).
NOS antagonists can be categorized as amino-acid- or
non-amino-acid-based competitive analogs whose
members primarily exert either iNOS -selective or -non-
selective effects (Vincent et al, 2000). In preclinical
animal models of septic shock, the use of NOS inhibitors
have shown that mean arterial pressure (MAP) and
systemic vascular resistance (SVR) can be significantly
increased (Symeonides and Balk, 1999; Vincent et al,
2000). Benefit on survival, however, has been less clear.
Moreover, there are several potential detrimental effects to
non-specific NOS inhibition including decreased organ
perfusion, elevation of mean pulmonary artery pressure,
pulmonary vascular resistance (PVR), renal vascular
resistance and decreased renal blood flow (Vincent et al,
2000). The use of NOS inhibitors in animal models of
endotoxemia has been associated with a decrease in
cardiac index (CI) and tissue oxygen delivery and an
increase in lactic acidosis and hepatic toxicity (Vincent et
al, 2000; Cobb, 2001). In several studies, non-selective
NOS inhibition was found to be associated with increased
mortality (Symeonides and Balk, 1999; Vincent et al,
2000; Cobb, 2001). Clinical trials in human subjects have
been performed and they revealed similar effects on SVRI,
MAP, PVRI, CI, PCWP and CVP as those found in animal
models of sepsis (Symeonides and Balk, 1999; Vincent et
al, 2000; Cobb, 2001).
Many of these studies utilize compounds that are
added exogenously to model systems. The investigation of
in situ, homeostatic mechanisms that regulate iNOS
expression and NO production represents a novel approach
to understanding the complex biology of iNOS regulation
and may yield new therapeutic targets. In contrast to iNOS
activation pathways, the endogenous counter-regulatory
pathways which inhibit iNOS expression and activity in a
biologically relevant manner are largely unknown.
Certainly, glucocorticoids, IL-4, IL-8, IL-10, transforming
growth factor (TGF-$1, $2, $3), NAP110, kalirin and
macrophage deactivating factor are among identified
inhibitors of iNOS activation (Nathan and Xie, 1994;
Nathan, 1997; Taylor and Geller, 2000). While TGF-$-
exerts transcriptional and post-translational control of
iNOS (Nathan and Xie, 1994), kalirin and NAP110 inhibit
iNOS activity by preventing iNOS homodimer formation
(Ratovitski et al, 1999a, b). Substrate and cofactor
availability can also modulate iNOS activity (Nathan and
Xie, 1994). Studies investigating these inhibitors have
underscored the immense complexity and species-, signal-
and cell-dependent nature of iNOS regulation. Moreover,
the biological relevance of many of these inhibitors is
unknown as their effects on iNOS activity have largely
been determined in model systems in which they have
been exogenously administered. In addition, the
underlying signal transduction pathway for each inhibitory
agent has not well characterized. An interesting and
unique feature of iNOS counter-regulation is the negative
feedback characteristic of NO (DelaTorre et al, 1997). NO,
as the end-product of iNOS activity, can both directly and
indirectly feedback inhibit iNOS expression. These
endogenous inhibitory pathways by which NO feedback
regulates iNOS expression remain poorly understood. NO
may downregulate expression or activity of an iNOS
inducing stimulus or conversely, upregulate expression or
activity of an iNOS repressor. One example of how NO
can biochemically trigger iNOS regulators is the S-
nitrosylation of intermediary proteins. The biochemical
kinetics of NO-mediated S-nitrosylation of NF-#B has
been investigated and NO decreases the dissociation
constant by four-fold. This suggests that NO modifies NF-
#B active site-thiols and inhibits NF-#B DNA binding and
subsequent iNOS gene transcription (DelaTorre et al,
1997). Critical thiol and non-heme iron groups which may
serve as targets for NO are not limited to NF-#B. S-
nitrosylation targets of NO include p53, caspase-8,
![Page 199: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/199.jpg)
Gene Therapy and Molecular Biology Vol 8, page 505
505
transglutaminase, glyceraldehyde-3-phosphate de-
hydrogenase, and glutiathione reductase (Calmels et al,
1997). The ubiquity of negative feedback regulation as a
mechanism for modulation of protein activity suggests that
inhibitory mechanisms for iNOS may be NO-dependent
and that there exists a pool of NO-regulated genes and
proteins, which potentially serve as mediators in NO-
feedback regulation.
Using suppression subtractive hybridization (SSH),
we have recently identified OPN as a regulator of iNOS
that is itself NO-dependent (Guo et al, 2001). In ANA-1
murine macrophages, we hypothesized that endotoxin
(LPS)-mediated NO production induces a specific set of
genetic programs that may serve to alter cellular NO
metabolism. To identify genes differentially expressed in
LPS-stimulated cells producing NO, RNA from LPS-
treated cells was used as a "tester" and RNA from LPS
plus NG-nitro-L-arginine methyl ester (L-NAME) was used
as a "driver". Individual cDNA clones generated by SSH
were used as probes in Northern blot analysis to identify
differentially expressed genes. Using SSH, OPN was
found to be specifically induced in the presence of LPS-
induced NO synthesis.
IV. Osteopontin, nitric oxide synthase
and hnRNP A/BA. OPN structure, receptors and functionOPN is a hydrophilic and negatively charged
sialoprotein of ~298 amino acids that contains a Gly-Arg-
Gly-Asp-Ser (GRGDS) integrin-binding motif and
additional domains for calcium-binding, phosphorylation
and glycosylation (Wai and Kuo, 2004). Post-translational
modifications account for cell-type and condition-specific
OPN-isoforms, which can be measured between 41-75 kD
(Wai and Kuo, 2004). This secreted phosphoprotein
mediates diverse regulatory functions, including cell
adhesion, migration, tumor growth and metastasis,
atherosclerosis, aortic valve calcification, and repair of
myocardial injury. Many of these functions appear to be
regulated by signalling through the integrin and CD44
families of receptors (Wai and Kuo, 2004). OPN
expression is tissue-specific and subject to regulation by
many factors (Hijiya et al, 1994; Guo et al, 1995;
Chellaiah et al, 1996; Wai and Kuo, 2004). Constituitive
expression of OPN exists in several cell types but induced
expression is found in T lymphocytes, epidermal cells,
bone cells and macrophages in response to phorbol 12-
myristate 13-acetate (PMA), 1,25-dihydroxyvitamin D,
basic fibroblast growth factor (bFGF), TNF-", IL-1,
interferon gamma (IFN-!) and endotoxin. Interestingly,
OPN and iNOS are induced in response to many of the
same agents such as TNF-", IL-1$, IFN-!, and LPS
(Nathan and Xie, 1994).
B. OPN and inflammationRecently the relationship between OPN, NO and
inflammation has been examined by a number of
investigators. Rollo et al, (1996) demonstrated that
exogenous recombinant OPN protein was effective in
blocking RAW264.7 murine macrophage NO production
and cytotoxicity toward the NO-sensitive mastocytoma
cells. Their work suggested that OPN in extracellular fluid
protects certain tumor cells from the macrophage-
mediated destruction by inhibiting the synthesis of NO.
Singh et al, (1995, 1999) reported that a synthetic 20-
amino acid OPN peptide analogue decreased iNOS mRNA
and protein levels in ventricular myocytes and cardiac
microvascular endothelial cells. Transfection of cardiac
microvascular endothelial cells with an antisense OPN
cDNA increased iNOS mRNA in response to IL-$ and
IFN-!, suggesting that endogenous OPN inhibits NO
production. Using an antibody directed against the OPN
"v$3 integrin receptor, Attur et al, (2001) demonstrated
that ligand binding results in trans-dominant inhibition of
NO production in human cartilage. Hwang et al, (1994a,
b) found that OPN suppressed NO synthesis induced by
interferon and LPS in primary mouse kidney proximal
tubule epithelial cells. These studies clearly demonstrate
that endogenous OPN can inhibit induction of iNOS and
that OPN is an important regulator of the NO signalling
pathway and NO-mediated cytoregulatory processes.
However, the converse relationship, the role of NO in the
induction of OPN synthesis, has not been well studied.
In our laboratory, we have recently demonstrated that
LPS-induced NO synthesis up-regulates OPN promoter
activity and protein expression (Guo et al, 2001). We have
shown that LPS-treated ANA-1 and RAW 264.7
macrophages express high levels of OPN protein while
untreated macrophages show no detectable level of
immunoreactive OPN protein. The addition of L-NAME
(competitive NOS inhibitor) to LPS-treated cells ablates
OPN protein expression whereas the co-addition of the
NO donor, S-nitroso-N-acetylpencillamine (SNAP),
restores OPN expression in LPS + L-NAME treated cells.
These data suggest that LPS-mediated NO production is
associated with significantly increased OPN protein
secretion in both ANA-1 and RAW 264.7 macrophages.
Using nuclear run-on analysis, we showed that the NO-
mediated increase in macrophage-OPN mRNA levels was
the result of increased gene transcription. Transient
transfection of plasmid constructs containing an 865-bp
OPN promoter cloned upstream from a luciferase reporter
gene, demonstrated that LPS-induced NO production
increased OPN promoter activity by ~7-fold compared
with controls (Guo et al, 2001). Together these data
provide evidence to suggest that NO expression induced
by LPS increases OPN promoter activity, and OPN mRNA
and protein levels. We have also shown that blockade of
the OPN-integrin cell surface receptor with GRGDSP
increases macrophage NO production in response to LPS
stimulation while the addition of exogenous OPN with
LPS to ANA-1 cells maximally decreased nitrite levels by
50%. Together, these data suggest that OPN plays a
functional role in regulating LPS-mediated NO
production.
![Page 200: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/200.jpg)
Wai and Kuo: Regulation of NO in sepsis by OPN
506
C. S-nitrosylation of hnRNP A/B
regulates OPN transcription during
endotoxin stimulationCloning of the human, porcine and murine OPN
promoters has uncovered numerous consensus regulatory
sequences (Wai and Kuo, 2004). Early investigations with
the human OPN promoter revealed multiple candidate
elements that contain consensus sequences for known
transcription factors including TATA-like (-27 to -22 nt)
and CCAAT-like (-73 to -68 nt) sequences, vitamin-D-
responsive (VDR)-like motifs (-1892 to -1878 and -698 to
-684 nt), GATA-1 (-851 to -847 nt), AP-1 (TGACACA, -
78 to -72 nt), PEA3 (-1695 to -1690 and -1418 to -1413 nt)
and Ets-1 (-47 to -39 nt) binding sequences and multiple
TCF-1 sites (31). Craig and Denhardt identified similar
sequences in the murine OPN promoter: a characteristic
TATA box (-27 to -22 nt), an inverted CCAAT box (-53 to
-49 nt), a positive transcription element (-543 to -253 nt)
and a negative transcription element (-777 and -543 nt)
(Craig and Denhardt, 1991). Several investigators have
since shown that transcriptional regulation of OPN is
complex and involves multiple pathways. Several inter-
related signalling pathways and transcription factors
regulate the OPN promoter including AP-1, Myc, Oct-1,
USF, v-Src, Runx/CBF, TGF-B/BMPs/Smad/Hox, Wnt/ß -
catenin/APC/GSK-3ß/Tcf-4, Ras/RRF and TP53 (Wai and
Kuo, 2004).
Recently, we have identified heterogeneous nuclear
ribonucleoprotein A/B (hnRNP A/B) as a constitutive
transcriptional repressor of OPN whose DNA binding
activity is decreased by LPS-mediated S-nitrosylation of a
key cysteine thiol. hnRNPs were originally described as a
group of chromatin-associated RNA-binding proteins that
form complexes with RNA polymerase II transcripts. The
hnRNP family is a collection of more than 20 proteins that
contribute to the complex around nascent pre-mRNA and
are thus able to modulate RNA processing (Krecic and
Swanson, 1999). Members of the group are characterized
by their ability to bind to RNA with limited specificity,
and they are among the most abundant of all of the nuclear
proteins. Despite its function in RNA handling, the precise
physiological role of hnRNPs has yet to be fully defined
and may include trans-regulatory effects. Recent studies
have shown that the hnRNPs D0B, E2BP, and K are able
to bind to double-stranded DNA motifs within the
complement receptor 2, hepatitis B virus, and c-myc
promoters, respectively (Tay et al, 1992; Tomonaga and
Levens, 1995; Tolnay et al, 1999). hnRNP K possesses
both transcriptional activator and repressor functions
(Michelotti et al, 1996).
hnRNP A/B is a unique member of the hnRNP
family in that it possesses a DNA-binding sequence
domain that is separate from the repression domain. The
p40 isoform contains 331 amino acid residues, whereas
p37 contains 284. The amino acid sequences are identical
with the exception of an additional 47 amino acids at the
C-terminal region of p40. In this regard, Yabuki et al,
(2001) found that hnRNP A/B p40 binds to the rat aldolase
B promoter to inhibit activity, whereas hnRNP A/B p37
had no effect. Further studies by this group found that the
DNA-binding region for both isoforms reside with amino
acids 67-159, 67-75, and 147-159 are absolute
requirements for binding activity (Saitoh et al, 2002). This
67-159-amino acid region contains the S-nitrosylation
target Cys 104, which was found to be responsible for NO-
mediated inhibition of DNA binding in our experiments.
Using OPN promoter deletion constructs cloned
upstream from a luciferase reporter gene we localized a
NO-sensitive cis-acting element in the OPN promoter (-
174 to -209 nt). Deletion of this segment resulted in > 4-
fold increase in OPN promoter activity (Gao et al, 2004).
Electromobility shift assay demonstrated that nuclear
protein is bound to the OPN promoter in the region of nt -
183 to nt -196 in unstimulated control cells. In the
presence of LPS and NO, binding is ablated, and OPN
promoter activity is increased. Utilizing the biotin-
streptavidin DNA affinity technique with the identified
DNA-binding sequence, the candidate repressor-
transcription factor was then purified and isolated from
nuclear extract isolated from unstimulated control RAW
264.7 macrophages. The purified proteins were separated
by SDS-PAGE and analyzed after tryptic digestion and
yielded results that matched with hnRNP A/B
(GenBankTM accession number NM 010448). Supershift
assays confirmed the identity of the gel-shift band and
chromatin immunoprecipitation (ChIP) -assay analysis
demonstrated in vivo binding of hnRNP A/B to the OPN
promoter (Gao et al, 2004). This binding was inhibited in
the presence of NO that was either endogenously induced
by LPS or exogenously delivered. Finally, we
demonstrated that S-nitrosylation of hnRNP A/B p37 is
significantly enhanced in the presence of LPS-mediated
NO synthesis and that S-nitrosylation of the p37 cysteine
residue at position 104 is associated with diminished DNA
binding in gel shift assays. Together these data suggest
that LPS-induced S-nitrosylation of hnRNP A/B inhibits
its activity as a constitutive repressor of the OPN promoter
(Figure 3).
Figure 3. S-nitrosylation of hnRNP A/B relieves transcriptional
repression of OPN during LPS-mediated production of NO and
serves as a negative feedback mechanism for iNOS regulation.
![Page 201: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/201.jpg)
Gene Therapy and Molecular Biology Vol 8, page 507
507
V. ConclusionIn sepsis, endotoxin-mediated production of NO
involves complex signalling pathways that regulate iNOS
expression. NO has wide-ranging biochemical and
physiologic effects in multiple organ systems and mediates
some of the processes that lead to cardiovascular collapse,
tissue hypoxia and organ failure in the septic patient.
While many studies have focused on the modulation of
NO production as a means of reducing the mortality
associated with septic shock, little is known about the
endogenous, homeostatic pathways that lead to down-
regulation of NO synthesis. Our current findings suggest
that LPS-induced S-nitrosylation of hnRNP inhibits its
activity as a constitutive repressor of the OPN promoter.
This represents a novel target for S-nitrosylation
regulatory functions as hnRNP proteins are better
characterized as participants in telomere biogenesis,
splicing, and mRNA transport. Further study to determine
the potential role of S-nitrosylation in these other hnRNP-
dependent functions may expand the known regulatory
roles for NO and S-nitrosylation.
ReferencesAlexander C, Rietschel ET (2001) Bacterial lipopolysaccharides
and innate immunity. J Endotoxin Res 7, 167-202
Attur MG, Dave MN, Stuchin S, Kowalski AJ, Steiner G,
Abramson SB, Denhardt DT, Amin AR (2001) Osteopontin,
an intrinsic inhibitor of inflammation in cartilage. Arthritis
Rheum 44, 578-84
Balk RA (2004) Optimum treatment of severe sepsis and septic
shock, evidence in support of the recommendations. Dis
Mon 50, 168-213
Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus
WA, Schein RM, Sibbald WJ (1992) Definitions for sepsis
and organ failure and guidelines for the use of innovative
therapies in sepsis. The ACCP/SCCM Consensus Conference
Committee. American College of Chest Physicians/Society
of Critical Care Medicine. Chest. 101, 1644-55.
Brun-Buisson C (2000) The epidemiology of the systemic
inflammatory response. Intensive Care Med 26 Suppl 1,
S64-74.
Brun-Buisson C, Doyon F, Carlet J, Dellamonica P, Gouin F,
Lepoutre A, Mercier JC, Offenstadt G, Regnier B (1995)
Incidence, risk factors, and outcome of severe sepsis and
septic shock in adults. A multicenter prospective study in
intensive care units. French ICU Group for Severe Sepsis.
JAMA 274, 968-74
Brun-Buisson C, Meshaka P, Pinton P, Vallet B; EPISEPSIS
Study Group (2004) EPISEPSIS, a reappraisal of the
epidemiology and outcome of severe sepsis in French
intensive care units. Intensive Care Med 30, 580-8.
Calmels S, Hainaut P, Ohshima H (1997) Nitric oxide induces
conformational and functional modifications of wild-type
p53 tumor suppressor protein. Cancer Research 57, 3365-
3369
Chavez AM, Menconi MJ, Hodin RA, Fink MP (1999) Cytokine-
induced intestinal epithelial hyperpermeability, role of nitric
oxide. Crit Care Med 27, 2246-51
Chellaiah M, Fitzgerald C, Filardo EJ, Cheresh DA, Hruska KA
(1996) Osteopontin activation of c-src in human melanoma
cells requires the cytoplasmic domain of the integrin alpha v-
subunit. Endocrinology 137, 2432-40
Cobb JP (2001) Nitric oxide synthase inhibition as therapy for
sepsis, a decade of promise. Surg Infect (Larchmt) 2, 93-
100; discussion 100-1.
Craig AM, Denhardt DT (1991) The murine gene encoding
secreted phosphoprotein 1 (osteopontin), promoter structure,
activity, and induction in vivo by estrogen and progesterone.
Gene 100, 163-71
Crapo JD and Stamler JS (1994) Signaling by nonreceptor
surface mediated redox active biomolecules. J Clin Invest
93, 2304.
DelaTorre A, Schroeder RA, Kuo PC (1997) Alteration of NF-
#B p50 binding kinetics by S-nitrosylation. Biochem
Biophys Res Commun 238, 703-706
Diks SH, van Deventer SJ, Peppelenbosch MP (2001)
Lipopolysaccharide recognition, internalisation, signalling
and other cellular effects. J Endotoxin Res 7, 335-48
Feihl F, Waeber B, Liaudet L (2001) Is nitric oxide
overproduction the target of choice for the management of
septic shock? Pharmacol Ther 91, 179-213
Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG,
Simmons RL (1992) Negative inotropic effects of cytokines
on the heart mediated by nitric oxide. Science 257, 387-9
Gao C, Guo H, Wei J, Mi Z, Wai P, Kuo PC (2004) S-
nitrosylation of heterogeneous nuclear ribonucleoprotein A/B
regulates osteopontin transcription in endotoxin-stimulated
murine macrophages. J Biol Chem 279, 11236-43
Guha M, Mackman N (2001) LPS induction of gene expression
in human monocytes. Cell Signal 13, 85-94
Guo H, Cai CQ, Schroeder RA, Kuo PC (2001) Osteopontin is a
negative feedback regulator of nitric oxide synthesis in
murine macrophages. J Immunol 166, 1079-86
Guo X, Zhang YP, Mitchell DA, Denhardt DT, Chambers AF
(1995) Identification of a ras-activated enhancer in the mouse
osteopontin promoter and its interaction with a putative ETS-
related transcription factor whose activity correlates with the
metastatic potential of the cell. Mol Cell Biol 15, 476-87
Hijiya N, Setoguchi M, Matsuura K, Higuchi Y, Akizuki S,
Yamamoto S (1994) Cloning and characterization of the
human osteopontin gene and its promoter. Biochem J 303,
255-62
Hwang SM, Lopez CA, Heck DE, Gardner CR, Laskin DL,
Laskin JD, Denhardt DT (1994a) Osteopontin inhibits
induction of nitric oxide synthase gene expression by
inflammatory mediators in mouse kidney epithelial cells. J
Biol Chem 269, 711-5
Hwang SM, Wilson PD, Laskin JD, Denhardt DT (1994b) Age
and development-related changes in osteopontin and nitric
oxide synthase mRNA levels in human kidney proximal
tubule epithelial cells, contrasting responses to hypoxia and
reoxygenation. J Cell Physiol 160, 61-8
Kilbourn RG, Traber DL, Szabo C (1997) Nitric oxide and
shock. Dis Mon, 277-348
Krecic AM, Swanson MS (1999) hnRNP complexes,
composition, structure, and function. Curr Opin Cell Biol
11, 363-71
Lazaron V, Dunn DL (2002) Molecular biology of endotoxin
antagonism. World J Surg 26, 790-8. Epub 2002 Apr 15
Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook
D, Cohen J, Opal SM, Vincent JL, Ramsay G;
SCCM/ESICM/ACCP/ATS/SIS (2003) 2001
SCCM/ESICM/ACCP/ATS/SIS International Sepsis
Definitions Conference. Crit Care Med 31, 1250-6
Martin GS, Mannino DM, Eaton S, Moss M (2003) The
epidemiology of sepsis in the United States from 1979
through 2000. N Engl J Med 348, 1546-54
Michelotti EF, Michelotti GA, Aronsohn AI, Levens D (1996)
Heterogeneous nuclear ribonucleoprotein K is a transcription
factor. Mol Cell Biol 16, 2350-60
![Page 202: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/202.jpg)
Wai and Kuo: Regulation of NO in sepsis by OPN
508
Morris SM and Billiar TR (1994) New insights into the
regulation of inducible nitric oxide synthesis. Am J Physiol
266, 829-839.
Nathan C (1997) Inducible nitric oxide synthase, what difference
does it make? J Clin Invest 100, 2417-2423
Nathan C and Xie QW (1994) Regulation of biosynthesis of
nitric oxide. J Biol Chem 269, 13725-13728
Ratovitski EA, Alam MR, Quick RA, McMillan A, Bao C,
Kozlovsky C, Hand TA, Johnson RC, Mains RE, Eipper BA,
Lowenstein CJ (1999a) Kalirin inhibition of inducible nitric-
oxide synthase. J Biol Chem 274, 993-9
Ratovitski EA, Bao C, Quick RA, McMillan A, Kozlovsky C,
Lowenstein CJ (1999b) An inducible nitric-oxide synthase
(NOS) -associated protein inhibits NOS dimerization and
activity. J Biol Chem 274, 30250-7
Rollo EE, Laskin DL, Denhardt DT (1996) Osteopontin inhibits
nitric oxide production and cytotoxicity by activated
RAW264.7 macrophages. J Leukoc Biol 60, 397-404
Saitoh Y, Miyagi S, Ariga H, Tsutsumi K (2002) Functional
domains involved in the interaction between Orc1 and
transcriptional repressor AlF-C that bind to an
origin/promoter of the rat aldolase B gene. Nucleic Acids
Res 30, 5205-12
Simon DI, Mullins ME, Jia L, Gaston B, Singel DJ, Stamler JS
(1996) Polynitrosylated proteins, characterization,
bioactivity, and functional consequences. Proc Natl Acad
Sci 93, 4736-4741
Singh K, Balligand JL, Fischer TA, Smith TW, Kelly RA (1995)
Glucocorticoids increase osteopontin expression in cardiac
myocytes and microvascular endothelial cells. Role in
regulation of inducible nitric oxide synthase. J Biol Chem
270, 28471-8
Singh K, Sirokman G, Communal C, Robinson KG, Conrad CH,
Brooks WW, Bing OH, Colucci WS (1999) Myocardial
osteopontin expression coincides with the development of
heart failure. Hypertension 33, 663-70
Symeonides S, Balk RA (1999) Nitric oxide in the pathogenesis
of sepsis. Infect Dis Clin North Am 13, 449-63
Tay N, Chan SH, Ren EC (1992) Identification and cloning of a
novel heterogeneous nuclear ribonucleoprotein C-like protein
that functions as a transcriptional activator of the hepatitis B
virus enhancer II. J Virol 66, 6841-8
Taylor BS and Geller DA (2000) Molecular regulation of the
human inducible nitric oxide synthase (iNOS) gene. Shock
13, 413-424.
Tolnay M, Vereshchagina LA, Tsokos GC (1999) Heterogeneous
nuclear ribonucleoprotein D0B is a sequence-specific DNA-
binding protein. Biochem J 338, 417-25
Tomonaga T, Levens D (1995) Heterogeneous nuclear
ribonucleoprotein K is a DNA-binding transactivator. J Biol
Chem 270, 4875-81
Vincent JL, Zhang H, Szabo C, Preiser JC (2000) Effects of
nitric oxide in septic shock. Am J Respir Crit Care Med
161, 1781-5
Wai PY, Kuo PC (2004) The role of Osteopontin in tumor
metastasis. J Surg Res 121, 228-241
Yabuki T, Miyagi S, Ueda H, Saitoh Y, Tsutsumi K (2001) A
novel growth-related nuclear protein binds and inhibits rat
aldolase B gene promoter. Gene 264, 123-9)
![Page 203: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/203.jpg)
Gene Therapy and Molecular Biology Vol 8, page 509
509
Gene Ther Mol Biol Vol 8, 509-514, 2004
Feasibility to delineate distribution of solution
injected intraprostatic using an ex-vivo canine modelResearch Article
Charles J. Rosser1, Noriyoshi Tanaka1, R. Jason Stafford2, Roger E. Price3, John
D. Hazle2, Motoyoshi Tanaka1, Ashish M. Kamat1, Louis L. Pisters1*1Department of Urology,2Department of Imaging Physics,3Department of Veterinary Medicine and Surgery, The University of Texas M. D. Anderson Cancer Center, Houston,
Texas
__________________________________________________________________________________*Correspondence: Louis L. Pisters, M.D., Department of Urology, Unit 446, The University of Texas M. D. Anderson Cancer Center,
1515 Holcombe Blvd., Houston, TX 77030; Phone: 713-792-3250; Fax: 713-794-4824; Email: [email protected]
Key words: prostate, gadolinium, magnetic resonance imaging, gene therapy
Abbreviations: dilution of gadolinium DTPA, (Gd-DTPA); Institutional Animal Care and Use Committee, (IACUC); magnetic
resonance, (MR)
Charles J. Rosser and Noriyoshi Tanaka contributed equally to the manuscript
Supported by the Cancer Center Support Grant CA16672 from the National Cancer Institute and a grant from the American
Foundation of Urologic Disease.
Received: 5 October 2004; Accepted: 3 November 2004; electronically published: December 2004
Summary
We sought to identify an injection scheme and amount of solution injected resulting in optimal distribution of an
injected solution into the prostate and to determine whether magnetic resonance (MR) imaging is suitable for
evaluating intraprostatic distribution of an injected solution. Freshly excised canine prostates mounted in gelatin
were injected under ultrasound guidance with a standard volume (3 ml) of 1:10 dilution of gadolinium DTPA (Gd-
DTPA) and a 1:10 dilution of 1% methylene blue in phosphate-buffered saline. Three different schemes were used:
three-core, 10-core, and 20-core injection schemas. The prostates were subsequently imaged by MR imaging. After
imaging, samples were fixed in formalin, sectioned transversely, and digitally photographed. The distributions of
injected solution on photographs and MR images were compared. Findings on MR images correlated well with
photographic findings. Regions of injected solution were generally seen as hyperintense on the T1-weighted images.
A 20-core injection scheme distributed the injected solution better than a three-core or 10-core scheme. A 20-core
injection scheme resulted in optimal distribution within the prostate of injected methylene blue–Gd-DTPA solution.
MR imaging may be useful for imaging the distribution of solution injected into the prostate.
I. IntroductionIntraprostatic injection of a therapeutic solution is not
a new concept. Specifically, gene therapy for
localize/locally advanced prostate cancer routinely relies
on intraprostatic injection of vector. Since 1995, more than
55 gene therapy trials have been initiated in patients with
prostate cancer (Recombinant DNA Advisory Committee,
2003; Steiner and Gingrich, 2001). The few data we have
from such trials demonstrate the feasibility and safety of
gene therapy for prostate cancer, but show minimal if any
therapeutic benefit (Harrington et al, 2001; Steiner and
Gingrich, 2001). The disappointing results may be due to
the use of ineffective genes or the inability to transduce
the desired gene into a sufficient number of tumor cells.
Since various genes have been shown to inhibit
prostate tumor growth in vitro, (Issacs et al, 1991; Moody,
et al, 1994; Vieweg et al, 1994; Gotoh et al, 1997; Steiner
et al, 2000) we believe the disappointing clinical results
are due to the inability to transduce genes into a sufficient
number of tumor cells. In several reports on prostate
cancer gene therapy, there is no mention of gene
transduction, indicating that transduction may have been
low or may not have occurred (Eder et al, 1998; Gulley et
al, 1998; Herman et al, 1999; Lu et al, 1999; Pisters et al,
1999; Simons et al, 1999; Belldegrun et al, 2001).
![Page 204: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/204.jpg)
Rosser et al: Intraprostatic injection to mimic gene therapy
510
Initiation of further studies relying on injection of a
therapeutic solution into the prostate will be pointless until
we determine: a) how to inject the solution into the
prostate, b) how much to inject into the prostate, and c)
can we visualize where the injected solution is in the
prostate. We believe that if we could increase the exposure
of the prostate to therapeutic solutions such as viral
vectors used in gene therapy, we could increase the gene
transduction rate and demonstrate a therapeutic response.
In this feasibility study of assessing distribution of
injectate, we set out to determine in an ex vivo model a)
the injection scheme and b) the amount of solution
injected that gives the widest distribution. We also will
compared c) the distributions of this injected solution as
observed on MR imaging and gross histologic examination
to determine whether MR imaging is suitable for
evaluating the distribution of solutions injected into the
prostate.
II. Materials and methodsTwelve random-source adult male dogs housed in the
animal care facility at The University of Texas M. D. Anderson
Cancer Center were included in this study. All the animals were
originally a part of other investigators’ protocols that had been
approved by the institution’s Institutional Animal Care and Use
Committee (IACUC). Dogs were euthanized by induction of
anesthesia, exsanguinated, and then the prostates were resected.
Then the prostate was removed as follows. A lower midline
incision was made. The peritoneal contents were reflected
superiorly, and the bladder was visualized and palpated. Inferior
to the bladder, the prostate, which is intra-abdominal, was
palpated. The urethra just distal to the prostate was sharply
transected and reflected superiorly. Then the prostate was sharply
transected at the bladder, and the specimen was placed in normal
saline.
The prostates were embedded in gelatin (Knox Gelatin,
Camden, NJ). A 5/7.5-MHz biplanar linear array transrectal
ultrasound probe (UST 664, Wallingford, CT) was used to
visualize the embedded prostates. Then a standard volume (3 ml)
of an injectable solution composed of a 1:10 dilution of Gd-
DTPA (Magnavista) and a 1:10 dilution of 1% methylene blue in
phosphate-buffered saline was injected into the prostate
according to one of three injection schemes (3-core, 10-core, or
20-core injection schema). Our choice of methylene blue was
supported by a previous study in which an adenoviral vector with
methylene blue was injected into muscles and showed that the
areas of gene transduction correlated well with the distribution of
methylene blue on gross histologic examination (O’Hara et al,
2001). For each injection of methylene blue-Gd–DTPA solution,
a 3-inch-long, 22-gauge spinal needle connected to a standard 1-
ml Luer-Lok syringe containing the appropriate aliquot for
injection was guided into the prostate according to the
appropriate injection scheme. The needle tip was localized within
the prostatic parenchyma with ultrasound guidance.
All experiments were performed on a 1.5 T scanner (Signa
Echospeed, General Electric Medical Systems, Milwaukee, WI).
The scanner is equipped with a high-performance gradient
hardware package (SR120) and fast-receiver hardware. The
maximum achievable slew rate is 120 mT/m/s, and the maximum
amplitude is 23 mT/m. The fast receiver has a bandwidth of +/-
500 MHz. Gel-mounted samples were placed in a custom 16-
element, 10-cm-diameter birdcage transmit-receive
radiofrequency coil designed in house and imaged at high
resolution (234 x 234 µm) over a 60-mm field-of-view using a
256 x 256 acquisition matrix. Two-dimensional slice thickness
was 1.6 mm with 0.5-mm gaps, and three-dimensional images
were 0.60 mm thick with no gap. T1-weighted spin-echo images
were acquired using TR/TE = 300 ms/15 ms, NEX (excitations)
= 6, and bandwidth = +/-16 kHz. T2-weighted fast spin-echo
images were acquired using TR/TE = 4,400 ms/84 ms, NEX = 8,
bandwidth = +/-16 kHz, and echo train = 8. Proton-density-
weighted images were acquired using a fast spin-echo with
TR/TE = 4400 ms/17.4 ms, NEX = 4, bandwidth = +/-25 kHz,
and echo train = 4. T2*-weighted images were acquired using a
gradient-recalled acquisition in the steady state with TR/TE =
650 ms/20 ms, flip angle = 60°, NEX = 6, and bandwidth = +/-16
kHz. The T1-weighted three-dimensional sequence was acquired
using a fast spoiled gradient-recalled echo with TR/TE = 13.4
ms/4.2 ms, flip angle = 20°, NEX = 6, bandwidth = +/-16 kHz,
and 72 scan locations per block.
After MR imaging, prostates were removed from their
containers and gelatin molds and fixed in 10% formalin.
Subsequently, samples were transversely sectioned in 3-mm-
thick sections and digitally photographed. The distribution of
methylene blue seen on photographs was then compared with the
distribution of gadolinium seen on MR imaging. Furthermore,
the distribution of methylene blue on photographs was
quantitated using Image Pro Plus 4 software (Media Cybernetics,
Carlsbad, CA). Statistical analyses were performed using the
Bonferroni Multiple Comparison Test. Differences with P values
! 0.05 were considered significant.
Cell Line and Recombinant Adenovirus Vector. LNCaP
prostatic tumor cells, purchased from American Type Culture
Collection (Manassas, VA), were maintained in RPMI
supplemented with 10% fetal bovine serum, 100 units/ml
penicillin, 100 µg/ml streptomycin, and 4 mM glutamine. All
cells were incubated at 370C in a humidified atmosphere of 5%
CO2 in air. Recombinant adenovirus vector Ad-X-gal, which
expresses the X-gal reporter gene under the control of the human
cytomegalovirus immediate-early promoter/enhancer was
provided by Introgen, Inc. (Houston, TX). The titer of Ad-X-gal
was 1.5 x 1011 plaque-forming units per milliliter. All in vitro
experiments were performed in triplicate using a MOI of 10. X-
gal staining was performed by standard protocol (Zhang et al,
2003).
III. ResultsFigure 1 shows the distribution of methylene blue on
histologic examination and the distribution of gadolinium
on MR imaging for a representative prostate from each of
the three injection scheme groups.
The mean volume of the prostates was 22.9 ml ± 7.9
ml. The mean proportion of the prostate to which
methylene blue was distributed was 28.5 ± 3.8% for the 3-
core technique. The 3-core injection scheme left multiple
untreated areas in the lateral horns of the prostate as well
as in the anterior portion of the prostate. The mean
proportion of the prostate to which methylene blue was
distributed was 28.7% ± 3.4 for the 10-core technique and
53.5 ± 4.0% for the 20-core technique. The 20-core
injection technique provided the greatest coverage of
prostatic volume (P < 0.001).
The distribution of methylene blue on photographs
correlated well with the distribution of Gd-DTPA on MR
images. In general, regions of injected material were
observed as hyperintense on the T1-weighted spin-echo
and spoiled gradient-recalled echo images because of the
shortening of the spin-lattice relaxation time (T1) due to
Gd-DTPA. In regions where the concentration of Gd-
DTPA was high, such as the injection site fistulae, signal
![Page 205: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/205.jpg)
Gene Therapy and Molecular Biology Vol 8, page 511
511
was sometimes hypointense on the T1-weighted spin-echo
images because of shortening of T2. This effect was rarely
observed on the T1-weighted three-dimensional fast
spoiled gradient-recalled echo images because of the short
echo time. Regions of high Gd-DTPA concentration
appeared hypointense on the T2-weighted and proton-
density-weighted images as well (Figure 2). These
hypointense regions on T2- and T2*-weighted images
correlated well with the distribution of methylene blue
seen on whole-mount examination, but did not
demonstrate the same level of contrast seen in the T1-
weighted images.
Figure 1. Distribution of methylene blue on whole-mount histologic evaluation from each of the three injection schemes. Comparison of
3-core vs. 10-core, p > 0.05; 3-core vs. 20-core, p < 0.001; and 10-core vs. 20-core, p < 0.001.
Figure 2. Appearance of tissue sections
from the same prostate on gross
pathologic examination and on MR
imaging. (a) Distribution of methylene
blue seen on whole-mount examination.
(b) Distribution of Gd-DTPA observed
best on three-dimensional T1-weighted
MR imaging. (c) T1-weighted spin-echo
images show enhancement with regions
of reduced signal intensity corresponding
to large concentrations of Gd. (d)
Proton-density-weighted and (e) T2-
weighted images demonstrate the effect
of shortened T2 values. (f) T2*-weighted
images show additional darkening due to
Gd-DTPA susceptibility.
![Page 206: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/206.jpg)
Rosser et al: Intraprostatic injection to mimic gene therapy
512
Subsequent studies demonstrated two key points.
First, in the ex-vivo model we determined that for every 5
grams of prostatic tissue, 1 ml of solution should be
injected for best coverage (data not shown). In addition,
LNCaP prostatic tumors cell lines were grown under
standard conditions and treated with various
concentrations of gadolinium combined with 10 MOI of
nonreplicating adenovirus with a cytomegalovirus reporter
and X-gal gene. Standard concentrations of gadolinium
were not toxic to the adenovirus and did not affect gene
transduction rates (data not shown).
IV. DiscussionLocalized prostate cancer is a multifocal disease, and
the inability to deliver a therapeutic solution to the entire
prostate would make intraprostatic injection unlikely to
succeed. Indeed, despite promising preclinical findings
with gene therapy, the reported clinical trials of gene
therapy for prostate cancer have found little or no
therapeutic effect (Harrington et al, 2001; Steiner and
Gingrich, 2001). However initiation of further studies
relying on injection of a therapeutic solution into the
prostate will be pointless until we further study the
distribution of a solution when injected into the prostate.
We have demonstrated that when a standard volume
of solution is injected into a canine prostate ex vivo, a 20-
core injection scheme results in greater coverage of the
prostate than a 3-core or 10-core injection scheme. The 3-
and 10-core injection scheme resulted in a more intense,
localized distribution of the methylene blue, which left
multiple untreated areas in the lateral horns of the prostate
as well as in the anterior portion of the prostate. As
previous research has demonstrated, a significant number
of tumors are found in the lateral horn of the prostate.
Thus, treatment of these areas is of the utmost importance.
Two other very important concepts were discovered
in subsequent studies. When a prostate is evaluated prior
to injection of a solution, we believe a transrectal
sonographic volume study should be performed initially
and that for every 5 grams of prostate, 1 ml of solution
should be injected for best coverage (data no shown). In
addition, in another subsequent study, prostatic epithelium
tumors in vitro were treated with various concentrations of
gadolinium combined with 10 MOI of nonreplicating
adenovirus with a cytomegalovirus reporter and X-gal
gene. Standard concentrations of gadolinium were not
toxic to the adenovirus and did not affect gene
transduction rates (data not shown). Thus, gadolinium can
be used in combination with viral vectors to monitor
vector distribution without affecting gene transfer.
This study has several limitations. First and
foremost, the injections were performed in an ex vivo
setting. In vivo injection with ongoing diffusion and
perfusion may result in an even greater distribution of
injected solution. Second, the canine prostate does not
exactly mimic the human prostate. The canine prostate has
multiple vertical septations, which may affect the
distribution of the injected solution. Finally, on the basis
of a subsequent study in which we determined that 1 ml of
solution should be injected for every 5 grams of prostate
tissue to achieve optimal distribution within the prostate.
In conclusion, the limited therapeutic effects seen in
previous studies when a solution is injected into the
prostate, specifically gene therapy for prostate cancer may
be due in part to inadequate treatment of the entire
prostate. In this pilot study, we demonstrated that a 20-
core injection scheme resulted in wider intraprostatic
distribution of a standard volume of material injected into
canine prostates than did a 3-core or 10-core scheme and
that for every 5 grams of prostatic tissue 1 ml of solution
should be injected. Furthermore, these preliminary results
indicate that MR imaging, particularly T1-weighted three-
dimensional imaging, may be useful as a noninvasive
method for evaluating the distribution of intraprostatic
injections. Finally, subsequent studies should confirm that
1 mL of solution can cover 5 grams of prostatic tissue thus
achieving optimal distribution.
ReferencesBelldegrun A, Tso CL, Zisman A, Naitoh TJ, Said J, Pantuck AJ,
Hinkel A, deKernion J, Figlin R (2001) Interleukin 2 gene
therapy for prostate cancer: phase I clinical trial and basic
biology. Hum Gene Ther 12, 883-892.
Eder JP, Kantoff PW, Bubley GJ (1998) A phase I trial of
recombinant vaccinia virus, PROSTVAC, that expresses
prostate specific antigen (rV-PSA) as a vaccine in men with
advanced prostate cancer. Presented at the annual meeting of
the American Society of Clinical Oncology, Los Angeles,
1998. Available at: http://www.asco.org/ac/1,1003,_12-
002326-00_18-001998-00_19-0013825-00_29-00A,00.asp.
Accessed April 11, 2003.
Gotoh A, Kao C, Ko SC, Hamada K, Liu TJ, Chung LW (1997)
Cytotoxic effects of recombinant adenovirus p53 and cell
cycle regulator genes (p21 and p16) in human prostate
cancers. J Urol 158, 636-641.
Gulley J, Chen AP, Dahut W, Arlen PM, Bastian A, Steinberg
SM, Tsang K, Panicali D, Poole D, Schlom J, Michael
Hamilton J (1998) A phase I study of recombinant vaccinia
virus (RV) that expresses prostate specific antigen (PSA) in
adult patients with adenocarcinoma of the prostate. Presented
at the annual meeting of the American Society of Clinical
Oncology, Los Angeles, 1998. Available at:
http://www.asco.org/ac/1,1003,_12-002326-00_18-001998-
00_19-0013429-00_29-00A,00.asp. Accessed April 11,
2003.
Harrington KJ, Spitzweg C, Bateman AR, Morris JC, Vile RG
(2001) Gene therapy for prostate cancer: current status and
future prospects. J Urol 166, 1220-1233.
Herman JR, Adler HL, Aguilar-Cordova E, Rojas-Martinez A,
Woo S, Timme TL, Wheeler TM, Thompson TC, Scardino
PT (1999) In situ gene therapy for adenocarcinoma of the
prostate: a phase I clinical trial. Hum Gene Ther 10, 1239-
1249.
Issacs WB, Carter BS, Ewing CM (1991) Wild-type p53
suppresses growth of human prostate cancer cells containing
mutant p53 alleles. Cancer Res 51, 4716-4720.
Lu Y, Carraher J, Zhang Y, Armstrong J, Lerner J, Rogers WP,
Steiner MS (1999) Delivery of adenoviral vectors to the
prostate for gene therapy. Cancer Gene Ther 6, 64-72.
Moody DB, Robinson JC, Ewing CM, Lazenby AJ, Issacs WB
(1994) Interleukin-2 transfected prostate cancer cells
generate a local antitumor effect in vivo. Prostate 24, 244-
251.
O’Hara AJ, Howell JM, Taplin RH, Fletcher S, Lloyd F, Kakulas
B, Lochmuller H, Karpati G (2001) The spread of transgene
![Page 207: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/207.jpg)
Gene Therapy and Molecular Biology Vol 8, page 513
513
expression at the site of gene construct injection. Muscle
Nerve 24, 488-495.
Pisters LL, Pettaway CA, Hossan E, Evans R, Steiner MS, Wood
CG, Troncoso P, McDonnell TJ, Fenstenmacher MJ,
Logothetis CJ (1999) Intraprostatic AD-p53 gene therapy
followed by radical prostatectomy: feasibility and
preliminary results. Prostate Cancer Prostatic Dis 2,
(S3):S27.
Recombinant DNA Advisory Committee. Office of
Biotechnology Activities. National Institutes of Health.
Clinical Trials in Human Gene Transfer. Available at:
http://www4.od.nih.gov/oba/rac/clinicaltrial.htm. Accessed
April 10, 2003.
Simons JW, Mikhak B, Chang JF, Demarzo AM, Carducci MA,
Lim M, Weber CE, Baccala AA, Goemann MA, Clift SM,
Ando DG, Levitsky HI, Cohen LK, Sanda MG, Mulligan
RC, Partin AW, Carter HB, Piantadosi S, Marshall FF,
Nelson WG (1999) Induction of immunity to prostate cancer
antigens: results of a clinical trial of vaccination with
irradiated autologous prostate tumor cells engineered to
secrete granulocyte-macrophage colony-stimulating factor
using ex vivo gene transfer. Cancer Res 59, 5160-5168.
Steiner MS, Gingrich JR (2001) Gene therapy for prostate
cancer: where are we now? J Urol 164, 1121-1136.
Steiner MS, Zhang Y, Farooq F, Lerner J, Wang Y, Lu Y (2000)
Adenoviral vector containing wild-type p16 suppresses
prostate cancer growth and prolongs survival by inducing
cell senescence. Cancer Gene Ther 7, 360-372.
Vieweg J, RosenthaI FM, Bannerji R, Heston WD, Fair WR,
Gansbacher B, Gilboa E (1994) Immunotherapy of prostate
cancer in the Dunning rat model: use of cytokine gene
modified tumor vaccines. Cancer Res 5, 1760-1765.
Zhang X, Multani AS, Zhou JH, Shay JW, McConkey D, Dong
L, Kim CS, Rosser CJ, Pathak S, Benedict WF (2003)
Adenoviral-mediated Rentinoblastoma 94 Produces Rapid
Telomere Erosion, Chromosomal Crisis, and Caspase-
dependent Apoptosis in Bladder Cancer and Immortalized
Human Urothelial Cells but not in Normal Urothelial Cells.
Cancer Res 63, 760-765.
Charles J. Rosser
![Page 208: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/208.jpg)
Rosser et al: Intraprostatic injection to mimic gene therapy
514
![Page 209: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/209.jpg)
Gene Therapy and Molecular Biology Vol 8, page 515
515
Gene Ther Mol Biol Vol 8, 515-522, 2004
ER stress and the JNK pathway in insulin resistanceReview Article
Hideaki Kaneto*, Yoshihisa Nakatani, and Munehide MatsuhisaDepartment of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka,
Suita, Osaka 565-0871, Japan
__________________________________________________________________________________
*Correspondence: Hideaki Kaneto, MD, PhD, Department of Internal Medicine and Therapeutics, Osaka University Graduate School
of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan; Tel. (81-6) 6879-3633; Fax (81-6) 6879-3639; e-mail:
Key words: diabetes JNK pathway, ER stress, insulin resistance
Abbreviations: ! subunit of translation initiation factor 2, (eIF2!); antisense ORP150 expressing adenovirus,(Ad-AS-ORP); c-Jun N-
terminal kinase, (JNK); disappearance rate, (Rd); dominant-negative JNK expressing adenovirus, (Ad-DN-JNK); dominant-negative
type, (DN); endoplasmic reticulum, (ER); fluorescein isothiocyanate, (FITC); GFP expressing control adenovirus, (Ad-GFP); glucose
infusion rate, (GIR); glucose-6-phosphatase, (G6Pase); hepatic glucose production, (HGP); human immunodeficiency virus, (HIV-1);
insulin receptor substrate-1, (IRS-1); intraperitoneal glucose tolerance test, (IPGTT); intraperitoneal insulin tolerance test, (IPITT); islet-
brain-1, (IB-1); JNK-interacting protein-1, (JIP-1); mouse embryo fibroblasts, (MEFs); oxygen-regulated protein 150, (ORP150);
pancreatic ER kinase, (PERK); phosphoenolpyruvate carboxykinase, (PEPCK); protein transduction domains, (PTDs); sense ORP150
expressing adenovirus,(Ad-S-ORP); wild type, (WT); X-box–binding protein–1, (XBP-1)
Received: 29 November 2004; Revised: 9 December 2004
Accepted: 14 December 2004; electronically published: January 2005
Summary
The endoplasmic reticulum (ER) is an organelle which synthesizes various secretory and membrane proteins. These
proteins are correctly folded and assembled by chaperones in the ER. During stressful conditions such as upon an
increase in the misfolded protein level, the chaperons become overloaded and the ER fails to fold and export newly
synthesized proteins, leading to ER stress. Under diabetic conditions ER stress is induced and the JNK pathway is
subsequently activated, which is involved in the insulin resistance. Increase of ER stress and activation of the JNK
pathway interferes with insulin action. In reverse, reduction of ER stress and suppression of the JNK pathway in
obese diabetic mice markedly improve insulin resistance and ameliorate glucose tolerance. Taken together, increase
of ER stress and subsequent activation of the JNK pathway play a crucial role in the progression of insulin
resistance found in diabetes and thus could be a potential therapeutic target for diabetes.
I. Involvement of ER stress in insulin
resistanceType 2 diabetes is the most prevalent and serious
metabolic disease affecting people all over the world. The
hallmark of the disease is insulin resistance as well as
pancreatic "-cell dysfunction. Under diabetic conditions,
various insulin target tissues such as liver, muscle, and fat
become less responsive or resistance to insulin. This state
is also often linked to other common diseases such as
obesity, hyperlipidemia, hypertension, and atherosclerosis.
The pathophysiology of insulin resistance involves a
complex network of insulin signaling pathways. After
insulin binds to insulin receptor on cell surface, insulin
receptor and its substrates are phosphorylated, which leads
to activation of various insulin signaling pathways. The
endoplasmic reticulum (ER) is an organelle which
synthesizes various secretory and membrane proteins.
These proteins are correctly folded and assembled by
chaperones in the ER. During stressful conditions such as
upon an increase in the misfolded protein level, the
chaperons become overloaded and the ER fails to fold and
export newly synthesized proteins, leading to ER stress
(Aridor et al, 1999; Harding et al, 1999; Ron et al, 2002;
Tirasophon et al, 1998; Wang et al, 1998). Once ER stress
is provoked in the cells, various pathways are activated
(Figure 1). The pancreatic ER kinase (or PKR-like kinase)
(PERK) is an ER transmembrane protein kinase that
phosphorylates the ! subunit of translation initiation factor
2 (eIF2!) in response to ER stress, and eIF2!
phosphorylation leads to reduction of translation and
induction of apoptosis (Shi et al, 1998; Harding et al,
1999; Shi et al, 2003). It is also known that ER stress
activates the c-Jun N-terminal kinase (JNK) pathway,
leading to induction of apoptosis in various cells (Urano et
al, 2000). Furthermore, ER stress is known to trigger X-
![Page 210: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/210.jpg)
Kaneto et al: ER stress and the JNK pathway in insulin resistance
516
box-binding protein-1 (XBP-1) splicing. XBP-1 is a
transcription factor that modulates the ER stress response,
and its spliced form is a key molecule in ER stress
response through transcriptional regulation of various
genes including molecular chaperones (Figure 1)
(Yoshida et al, 2001; Iwawaki et al, 2003). It was
previously reported that ER stress is involved in pancreatic
"-cell apoptosis (Figure 2) (Inoue et al, 1998, Harding et
al, 2001, 2002; Oyadomari et al, 2001, 2002). Oxygen-
regulated protein 150 (ORP150), a molecular chaperone
found in the ER, has been shown to protect cells from ER
stress (Kuwabara et al, 1996; Tamatani et al, 2001). We
recently reported that ORP150 overexpression markedly
improved insulin resistance and ameliorated glucose
tolerance in diabetic animals, indicating that ER stress
plays a crucial role in insulin resistance (Figure 2)
(Nakatani et al, 2004).
To examine whether ER stress is increased in the
liver under diabetic conditions, we evaluated the ER stress
level in the livers of 10 week-old obese diabetic
C57BL/KsJ-db/db mice. Expression levels of KDEL and
Bip, both of which are ER stress markers, were much
higher in the obese diabetic mice compared to 10 week-old
non-diabetic C57BL6 mice, indicating that ER stress is
actually increased under diabetic conditions (Figure 2)
(Nakatani et al, 2004). It was also reported that expression
levels of several ER stress markers are increased in dietary
(high-fat diet-induced) and genetic (ob/ob) models of
obesity. PERK and eIF2! phosphorylation was increased
in the liver of obese mice compared with lean controls.
Furthermore, it was recently reported that increase of free
fatty acids, one of the contributory mechanisms for insulin
resistance in obesity and type 2 diabetes, causes pancreatic
"-cell apoptosis via ER stress (Kharroubi et al, 2004).
Taken together, ER stress is induced in various tissues
under diabetic conditions.
Consistent with earlier observations (Hirosumi et al,
2002), total JNK activity was also dramatically elevated in
the obese mice (Ozcan et al, 2004). It was reported that
when Fao liver cells were treated with tunicamycin or
thapsigargin, agents commonly used to induce ER stress,
insulin-stimulated tyrosine phosphorylation of insulin
receptor substrate 1 (IRS-1) was significantly decreased.
IRS-1 is a substrate for insulin receptor tyrosine kinase,
and serine phosphorylation of IRS-1, particularly mediated
by JNK, reduces insulin receptor signaling. Indeed,
pretreatment of Fao cells with tunicamycin produced a
significant increase in serine phosphorylation of IRS-1.
Tunicamycin pretreatment also suppressed insulin-induced
Akt phosphorylation (Figure 3) (Ozcan et al, 2004).
Furthermore, inhibition of JNK activity with the synthetic
inhibitor, SP600125, reversed the ER stress-induced serine
phosphorylation of IRS-1. Pretreatment of Fao cells with a
highly specific inhibitory peptide derived from the JNK-
binding protein, JIP, also completely preserved insulin
receptor signaling in cells exposed to tunicamycin. Similar
results were obtained with the synthetic JNK inhibitor,
SP600125. These results indicate that ER stress promotes a
JNK-dependent serine phosphorylation of IRS-1, which in
turn inhibits insulin receptor signaling (Figure 3) (Ozcan
et al, 2004).
Figure 1. ER stress signaling. Once ER stress is induced in the cells, various pathways are activated. Induction of ER stress leads to
eIF2! phosphorylation, JNK activation and XBP-1 splicing
![Page 211: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/211.jpg)
Gene Therapy and Molecular Biology Vol 8, page 517
517
Figure 2. Role of ER stress in diabetes. ER stress is induced under diabetes conditions, which is involved in insulin resistance and
pancreatic "-cell apoptosis.
Figure 3. ER stress and the JNK pathway in insulin resistance. The JNK pathway is activated under diabetic cinditions, which increases
insulin resistance and worsens glucose tolerance
To examine a role of ER stress in insulin resistance
in vivo, we prepared sense ORP150 expressing adenovirus
(Ad-S-ORP), and a GFP expressing control adenovirus
(Ad-GFP), and delivered each adenovirus to 8 week-old
C57BL/KsJ-db/db obese diabetic mice from the cervical
vein. We confirmed an increase in ORP150 expression in
the liver upon adenovirus injection, but not in other tissues
such as muscle and adipose tissue. In addition, expression
levels of KDEL and Bip in Ad-S-ORP-treated mice were
lower compared to those in Ad-GFP treated db/db mice,
indicating that ORP150 is actually acting to decrease ER
stress in the liver. There was no difference in body weight
and food intake between Ad-S-ORP-treated- and Ad-GFP-
treated-db/db mice. When C57BL/KsJ-db/db mice were
treated with Ad-S-ORP, nonfasting blood glucose levels
were markedly reduced, whereas no such effects were
observed in Ad-GFP-treated mice. Fasting blood glucose
concentrations were also significantly lower in Ad-S-
ORP-treated mice compared to Ad-GFP-treated mice. To
examine the effects of ORP150 overexpression in the liver
on insulin resistance, we performed the intraperitoneal
insulin tolerance test (IPITT). The hypoglycemic response
to insulin was larger in Ad-S-ORP-treated C57BL/KsJ-
db/db mice compared to Ad-GFP-treated mice. To
investigate this point further, we performed the
euglycemic hyperinsulinemic clamp test. The GIR of Ad-
![Page 212: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/212.jpg)
Kaneto et al: ER stress and the JNK pathway in insulin resistance
518
S-ORP-treated mice were significantly higher compared to
Ad-GFP-treated mice, indicating that ORP150
overexpression in the liver reduces insulin resistance and
thus ameliorates glucose tolerance in C57BL/KsJ-db/db
mice. We also evaluated endogenous hepatic glucose
production (HGP) in Ad-S-ORP-treated mice using tracer
methods. HGP was significantly lower in Ad-S-ORP-
treated mice compared to Ad-GFP-treated mice. These
results indicate that the reduction of insulin resistance and
amelioration of glucose tolerance by Ad-S-ORP
overexpression are mainly due to the suppression of HGP
(Figure 3) (Nakatani et al, 2004).
Similarly, to examine the effects of antisense
ORP150 expression in the liver on insulin sensitivity and
glucose tolerance in non-diabetic animals, we prepared an
antisense ORP150 expressing adenovirus (Ad-AS-ORP)
and delivered each adenovirus to 8 week-old C57BL6
mice. The intraperitoneal glucose tolerance test (IPGTT)
revealed that glucose tolerance is markedly worsened upon
antisense ORP150 expression. Furthermore, in the
euglycemic hyperinsulinemic clamp study, glucose
infusion rate (GIR) of Ad-AS-ORP-treated C57BL6 mice
were significantly lower compared to Ad-GFP-treated
mice, indicating that ER stress in the liver reduces insulin
sensitivity in C57BL6 mice. Furthermore, we evaluated
HGP in Ad-AS-ORP-treated mice using tracer methods.
HGP in Ad-AS-ORP-treated mice was significantly
greater compared to Ad-GFP-treated mice. These results
indicate that antisense ORP150 expression decreases
insulin sensitivity at least in part by increasing HGP in
non-diabetic mice (Nakatani et al, 2004).
To examine the molecular mechanisms involved in
the alteration of insulin action by ER stress in our
experiments, we evaluated the phosphorylation state of
IRS-1 and Akt in the liver, which are key molecules for
insulin signaling. IRS-1 tyrosine phosphorylation was
markedly increased in Ad-S-ORP-treated C57BL/KsJ-
db/db mice compared to Ad-GFP-treated mice.
Concomitantly, an increase in Akt serine 473
phosphorylation was observed in Ad-S-ORP-treated
C57BL/KsJ-db/db mice compared to Ad-GFP-treated mice
(Figure 3). We next examined the expression levels of the
key gluconeogenic enzymes phosphoenolpyruvate
carboxykinase (PEPCK) and glucose-6-phosphatase
(G6Pase), both of which are known to be regulated by
insulin signaling. Both the expression of PEPCK and
G6Pase was markedly decreased by Ad-S-ORP treatment
in C57BL/KsJ-db/db mice. These results indicate that
reduction of ER stress enhances insulin signaling which
leads to a decrease in gluconeogenesis and amelioration of
glucose tolerance (Nakatani et al, 2004). Taken together,
sense ORP150 overexpression decreased insulin resistance
and markedly improved glycemic control in diabetic
model animals, and in contrast antisense ORP150
expression induced insulin resistance in nondiabetic
control mice, indicating that ER stress plays a crucial role
in the insulin resistance found in diabetes (Figures 2, 3).
Furthermore, it was reported that mice deficient in
XBP-1, a transcription factor that modulates the ER stress
response, develop insulin resistance. The spliced form of
XBP-1 is a key molecule in ER stress response through
transcriptional regulation of various genes including
molecular chaperones (Figure 1). In mouse embryo
fibroblasts (MEFs) derived from XBP-1–/– mice,
tunicamycin treatment resulted in increase of PERK
phosphorylation. In these cells, there was also a rapid and
robust activation of JNK in response to ER stress. When
spliced XBP-1 expression was induced, there was a
dramatic reduction in both PERK phosphorylation and
JNK activation after tunicamycin treatment, indicating that
XBP-1–/– cells are prone to ER stress. Thus, it is likely that
alteration in the levels of spliced XBP-1 protein results in
alteration in the ER stress responses. Furthermore,
tunicamycin-induced IRS-1 serine phosphorylation was
significantly reduced in fibroblasts exogenously
expressing spliced XBP-1. The extent of IRS-1 tyrosine
phosphorylation was significantly higher in cells
overexpressing spliced XBP-1. In contrast, IRS-1 serine
phosphorylation was strongly induced in XBP-1–/– MEFs
compared with XBP-1+/+ controls even at low doses of
tunicamycin treatment. After insulin stimulation, the
amount of IRS-1 tyrosine phosphorylation was
significantly decreased in tunicamycin-treated XBP-1–/–
cells compared with tunicamycin-treated wild-type
controls (Ozcan et al, 2004).
Since complete XBP-1 deficiency results in
embryonic lethality, BALB/c-XBP-1+/– mice with a null
mutation in one XBP-1 allele were used in order to
investigate the role of XBP-1 in insulin resistance and
diabetes in vivo. XBP-1+/– mice treated with high fat diet
developed continuous and progressive hyperinsulinemia.
Blood glucose levels were also increased in the XBP-1+/–
mice treated with high fat diet. During insulin tolerance
test, the hypoglycemic response to insulin was also
significantly lower in XBP-1+/– mice compared with XBP-
1+/+ littermates (Ozcan et al, 2004). PERK phosphorylation
was increased in the liver of obese XBP-1+/– mice
compared with wild-type controls treated with high fat
diet. There was also a significant increase in JNK activity
in XBP-1+/– mice compared with wild type controls.
Consistently, Ser307 phosphorylation of IRS-1 was
increased in XBP-1+/– mice compared with wild-type
controls. There was no detectable difference in any of the
insulin receptor signaling components in liver and adipose
tissues between genotypes taking regular diet. However,
after treatment with high fat diet, major components of
insulin receptor signaling in the liver, including IRS-1
tyrosine- and Akt serine-phosphorylation, were decreased
in XBP-1+/– mice compared with wild type controls. A
similar suppression of insulin receptor signaling was also
evident in the adipose tissues of XBP-1+/– mice compared
with XBP-1+/+ mice (Ozcan et al, 2004). Taken together,
induction of ER stress or reduction in the compensatory
capacity through down-regulation of XBP-1 leads to
suppression of insulin receptor signaling in intact cells via
IRE-1!-dependent activation of the JNK pathway.
Experiments with mouse models also yielded data
consistent with the link between ER stress and systemic
insulin action. Deletion of an XBP-1 allele in mice leads to
enhanced ER stress, activation of the JNK pathway,
reduced insulin receptor signaling, systemic insulin
resistance, and type 2 diabetes. Therefore, ER stress is
![Page 213: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/213.jpg)
Gene Therapy and Molecular Biology Vol 8, page 519
519
involved in progression of insulin resistance and thus
could be a potential therapeutic target for diabetes
(Figures 2, 3).
II. Involvement of the JNK pathway in
insulin resistanceThe JNK pathway (Hibi et al, 1993; Derijard et al,
1994; Davis et al, 2000; Chang et al, 2001) is known to be
activated by ER stress (Urano et al, 2000) and thus is
possibly involved in the progression of insulin resistance.
We have recently examined the effects of modulation of
the JNK pathway in the liver on insulin resistance and
glucose tolerance (Nakatani et al, 2004). Overexpression
of dominant-negative type (DN) JNK in the liver of obese
diabetic mice dramatically improved insulin resistance and
markedly decreased blood glucose levels. When
C57BL/KsJ-db/db mice were treated with Ad-DN-JNK,
nonfasting blood glucose levels were markedly reduced,
whereas no such effect was observed in Ad-GFP-treated
mice. IPITT, the hypoglycemic response to insulin was
larger in Ad-DN-JNK-treated C57BL/KsJ-db/db mice
compared to Ad-GFP-treated mice. To investigate this
point further, we performed the euglycemic
hyperinsulinemic clamp test. GIR in Ad-DN-JNK-treated
mice was higher than that in Ad-GFP-treated mice,
indicating that suppression of the JNK pathway in the liver
reduces insulin resistance and thus ameliorates glucose
tolerance in C57BL/KsJ-db/db mice. Furthermore, HGP
was significantly lower in Ad-DN-JNK-treated mice. In
contrast, there was no difference in the glucose
disappearance rate (Rd) between these two groups. These
results indicate that reduction of insulin resistance and
amelioration of glucose tolerance by DN-JNK
overexpression are mainly due to suppression of HGP
(Figure 3) (Nakatani et al, 2004).
It has been reported that serine phosphorylation of
IRS-1 inhibits insulin-stimulated tyrosine phosphorylation
of IRS-1, leading to an increase in insulin resistance
(Aguirre et al, 2000). IRS-1 serine 307 phosphorylation
was markedly decreased in Ad-DN-JNK-treated mice. We
also found an increase in IRS-1 tyrosine phosphorylation
in Ad-DN-JNK-treated mice compared to control mice.
Reduction of Akt serine 473 phosphorylation was
observed in Ad-DN-JNK-treated C57BL/KsJ-db/db mice
(Nakatani et al. 2004). Therefore, an increase in IRS-1
serine phosphorylation may be closely associated with the
development of insulin resistance induced by JNK
overexpression (Figure 3). Next, we examined the
expression levels of the key gluconeogenic enzymes,
PEPCK and glucose-6-phosphatase (G6Pase), both of
which are known to be regulated by insulin signaling.
Expression levels of both enzymes were markedly
decreased by Ad-DN-JNK treatment in C57BL/KsJ-db/db
mice (Nakatani et al, 2004). These results indicate that
suppression of the JNK pathway enhances insulin
signaling which leads to a decrease in gluconeogenesis
and amelioration of glucose tolerance. Similar effects were
observed in high-fat / high-sucrose diet-induced diabetic
mice. Conversely, expression of wild type JNK in the liver
of normal mice decreased insulin sensitivity. Taken
together, these findings suggest that suppression of the
JNK pathway in the liver exerts greatly beneficial effects
on insulin resistance status and glucose tolerance in both
genetic and dietary models of diabetes (Figure 3)
(Nakatani et al, 2004).
It has been also reported recently that JNK activity is
abnormally elevated in the liver, muscle and adipose
tissues in obese type 2 diabetic mouse models and that
insulin resistance is substantially reduced in mice
homozygous for a targeted mutation in the JNK1 gene
(JNK-KO mice) (Hirosumi et al, 2002). When the JNK-
KO mice were placed on a high-fat / high-caloric diet,
obese wild type mice developed mild hyperglycemia
compared to lean wild type control mice. In contrast,
blood glucose levels in obese JNK-KO mice was
significantly lower compared to those in obese wild type
mice. In addition, serum insulin levels in obese JNK-KO
mice were significantly lower compared to those in obese
wild type mice. IPITT showed that hypoglycemic response
to insulin in obese wild type mice was lower compared to
that in obese JNK-KO mice. Also, IPGTT revealed a
higher degree of hyperglycemia in obese wild type mice
than in obese JNK-KO mice (Hirosumi et al, 2002). These
results indicate that the JNK-KO mice are protected from
the development of dietary obesity-induced insulin
resistance. Furthermore, targeted mutations in JNK were
introduced in genetically obese mice (ob/ob). Blood
glucose levels in ob/ob-JNK-KO mice were lower
compared to those in ob/ob wild type mice, and the ob/ob
wild type mice displayed a severe and progressive
hyperinsulinemia. Thus, JNK deficiency can provide
partial resistance against obesity, hyperglycemia and
hyperinsulinemia in both genetic and dietary models of
diabetes. Taken together, obese type 2 diabetes is
associated with activation of the JNK pathway, and the
absence of JNK results in substantial protection from
obesity-induced insulin resistance. These results strongly
suggest that activation of the JNK pathway plays a crucial
role in progression of insulin resistance found in type 2
diabetes (Figure 3).
Furthermore, activation of the JNK pathway is
involved in pancreatic "-cell dysfunction as well as insulin
resistance. Indeed, it was reported that activation of the
JNK pathway leads to reduction of insulin gene expression
and that suppression of the JNK pathway can protect "-
cells from oxidative stress and some of the toxic effects of
hyperglycemia (Kaneto et al, 2002; Kawamori et al, 2003).
When isolated rat islets were exposed to oxidative stress,
JNK, p38 MAPK, and PKC pathways were activated,
preceding the decrease of insulin gene expression.
Adenovirus-mediated overexpression of DN-JNK, but not
the p38 MAPK inhibitor SB203580 nor the PKC inhibitor
GF109203X, protected insulin gene expression and
secretion from oxidative stress. Moreover, wild type (WT)
JNK overexpression suppressed both insulin gene
expression and secretion (Kaneto et al, 2002). These
results were correlated with changes in the binding of the
important transcription factor PDX-1 to the insulin
promoter; adenoviral overexpression of DN-JNK
preserved PDX-1 DNA binding activity in the face of
oxidative stress, while WT-JNK overexpression decreased
![Page 214: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/214.jpg)
Kaneto et al: ER stress and the JNK pathway in insulin resistance
520
PDX-1 DNA binding activity. Thus, it is likely that JNK-
mediated suppression of PDX-1 DNA binding activity
accounts for some of the suppression of insulin gene
transcription and of "-cell function, which fits with the
phenomenon that PDX-1 expression DNA binding activity
is decreased in association with reduction of insulin gene
transcription after chronic exposure to a high glucose
concentration. Thus, it is likely that activation of JNK
pathway leads to decreased PDX-1 activity and subsequent
suppression of insulin gene transcription in the diabetic
state (Kaneto et al, 2002).
To examine whether DN-JNK can protect "-cells
from the toxic effects of hyperglycemia and to explore the
potential therapeutic application for islet transplantation,
we performed islet transplantation into diabetic mice.
Isolated rat islets were infected with Ad-DN-JNK or Ad-
GFP and cultured for 2 days; then 500 islets were
transplantated under kidney capsules of STZ-induced
diabetic Swiss nude mice. Blood glucose levels were not
sufficiently decreased by transplantation of islets infected
with Ad-GFP, which was probably due to toxic effects of
hyperglycemia upon a marginal islet number, but were
markedly decreased by Ad-DN-JNK. Four weeks after
transplantation of islets infected with Ad-GFP, insulin
mRNA levels in islet grafts were clearly decreased
compared with those before transplantation, but relatively
preserved by DN-JNK overexpression (Kaneto et al,
2002). These results suggest that DN-JNK can protect "-
cells from some of the toxic effects of hyperglycemia
during this transplant period, providing new insights into
the mechanism through which oxidative stress suppresses
insulin gene transcription in "-cells.
III. The JNK pathway as a therapeutic
target for diabetesProtein transduction domains (PTDs) such as the
small PTD from the TAT protein of human
immunodeficiency virus (HIV-1), the VP22 protein of
Herpes simplex virus, and the third !-helix of the
homeodomain of Antennapedia, a Drosophila transcription
factor, are known to allow various proteins and peptides to
be efficiently delivered into cells through the plasma
membrane, and thus there has been increasing interest in
their potential usefulness for the delivery of bioactive
proteins and peptides into cells (Elliott et al, 1997; Frankel
et al, 1988; Nagahara et al, 1998; Schwarze et al, 1999;
Rothbard et al, 2000;Noguchi et al, 2003, 2004). We have
recently evaluated the potential usefulness of a JNK
inhibitory peptide in the treatment of type 2 diabetes and
found that the cell permeable JNK inhibitory peptide
(amino acid sequence: GRK KRR QRR RPP RPK RPT
TLN LFP QVP RSQ DT) is very effective. This peptide is
derived from the JNK binding domain of JNK-interacting
protein-1 (JIP-1), also known as islet-brain-1 (IB-1), and
has been reported to function as a dominant inhibitor of
the JNK pathway (Bonny et al, 2001). To convert the
minimal JNK-binding domain into a bioactive cell-
permeable compound, a 20-amino acid sequence derived
from the JNK-binding domain of JIP-1 (RPK RPT TLN
LFP QVP RSQ DT) was covalently linked to a 10-amino
acid carrier peptide derived from the HIV-TAT sequence
(GRK KRR QRR R); then to monitor peptide delivery,
this JIP-1-HIV-TAT peptide was further conjugated with
fluorescein isothiocyanate (FITC). First, to examine the
effectiveness of the JNK inhibitory peptide in vivo,
C57BL/KsJ-db/db obese diabetic mice were injected
intraperitoneally with the JIP-1-HIV-TAT-FITC peptide.
The FITC-conjugated peptide showed fluorescence signals
in insulin target organs (liver, fat, muscle) and in insulin
secreting tissue (pancreatic islets). Next, we examined
whether the JNK pathway is inhibited after the treatment
with JIP-1-HIV-TAT-FITC. In various tissues (liver, fat,
and muscle), the JNK activity was actually suppressed by
JIP-1-HIV-TAT-FITC in a dose-dependent manner
(Kaneto et al, 2004).
To investigate whether suppression of the JNK
pathway exerts beneficial effects on diabetes, we treated
C57BL/KsJ-db/db mice with the intraperitoneal injection
of the JNK inhibitory peptide, JIP-1-HIV-TAT-FITC.
There was no difference in body weight and food intake
between the JIP-1-HIV-TAT-FITC-treated and untreated
mice. Glucose tolerance test performed showed that
glucose tolerance in JIP-1-HIV-TAT-FITC-treated mice
was significantly ameliorated compared to untreated or the
scramble peptide-treated mice. These data indicate that the
JNK pathway is involved in the exacerbation of diabetes
and that suppression of the JNK pathway could be a
therapeutic target for diabetes (Kaneto et al, 2004). To
investigate the possible effects of the JNK inhibitory
peptide on insulin action, we performed insulin tolerance
test. Reduction of blood glucose levels in response to
injected insulin was much larger in JIP-HIV-TAT-FITC-
treated mice compared to untreated mice, indicating that
the peptide treatment improves the insulin sensitivity. To
further investigate the effect of the peptide on insulin
resistance, we performed the euglycemic hyperinsulinemic
clamp test. The steady-state GIR in JIP-1-HIV-TAT-
FITC-treated mice was significantly higher than that in
untreated mice, indicating that JIP-1-HIV-TAT-FITC
reduces insulin resistance in C57BL/KsJ-db/db mice
(Kaneto et al, 2004). Furthermore, we evaluated
endogenous HGP and glucose Rd in the JNK inhibitory
peptide-treated mice. It is noted that Rd reflects glucose
utilization in the peripheral tissues. HGP in JIP-1-HIV-
TAT-FITC-treated mice was significantly lower than that
in untreated mice. In addition, Rd in JIP-1-HIV-TAT-
FITC-treated mice was significantly higher than that in
untreated mice (Kaneto et al, 2004). These results indicate
that JIP-1-HIV-TAT-FITC treatment reduces insulin
resistance through decreasing HGP and increasing Rd.
These data provide strong evidence that JNK is indeed a
crucial component of the biochemical pathway responsible
for insulin resistance in vivo. Furthermore, IRS-1 serine
307 phosphorylation was decreased in JIP-1-HIV-TAT-
FITC-treated mice compared to control mice. We also
found the increase of IRS-1 tyrosine phosphorylation in
the peptide-treated mice compared to control mice.
Concomitantly, increase of Akt serine 473 and threonine
308 phosphorylation both of which are known to be
important for activation of the Akt pathway was observed
in JIP-1-HIV-TAT-FITC-treated mice (Kaneto et al,
![Page 215: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/215.jpg)
Gene Therapy and Molecular Biology Vol 8, page 521
521
2004). In addition, to examine the effect of JIP-1-HIV-
TAT-FITC treatment on insulin biosynthesis, we measured
insulin mRNA level and content in pancreata of
C57BL/KsJ-db/db mice which had been treated with the
peptide. Insulin mRNA level and insulin content were
significantly higher in the peptide-treated mice. Thus, we
assume that the JNK inhibitory peptide exerted some
beneficial effects on the pancreatic islets (Kaneto et al,
2004). Taken together, the cell-permeable JNK inhibitory
peptide, JIP-1-HIV-TAT-FITC, improves insulin
resistance and ameliorates glucose intolerance, indicating
the critical involvement of the JNK pathway in diabetes
and the usefulness of the cell-permeable JNK inhibitory
peptide as a novel therapeutic agent for diabetes.
IV. ConclusionUnder diabetic conditions ER stress is induced and
the JNK pathway is subsequently activated, which is
involved in the insulin resistance. Increase of ER stress
and activation of the JNK pathway interfere with insulin
action. In reverse, reduction of ER stress and suppression
of the JNK pathway in obese diabetic mice markedly
improve insulin resistance and ameliorate glucose
tolerance. Taken together, increase of ER stress and
subsequent activation of the JNK pathway play a crucial
role in the progression of insulin resistance found in
diabetes and thus could be a potential therapeutic target for
diabetes.
ReferencesAguirre V, Davis R and White MF (2000) The c-Jun NH2-
terminal kinase promotes insulin resistance during
association with insulin receptor substrate-1 and
phosphorylation of Ser307. J Biol Chem 275, 9047-9054.
Aridor M and Balch WE (1999) Integration of endoplasmic
reticulum signaling in health and disease. Nature Med 5,
745-751.
Bonny C, Oberson A, Negri S, Sause C and Schorderet DF
(2001) Cell-permeable peptide inhibitors of JNK: novel
blockers of "-cell death. Diabetes 50, 77-82.
Chang L and Karin M (2001) Mammalian MAP kinase signalling
cascades. Nature 410, 37-40.
Davis RJ (2000) Signal transduction by the JNK group of MAP
kinases. Cell 103, 239-252.
Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M
and Davis RJ (1994) JNK1: a protein kianse stimulated by
UV light and Ha-Ras that binds and phosphorylates the c-Jun
activation domain. Cell 76, 1025-1037.
Elliott G and O’Hare P (1997) Intracellular trafficking and
protein delivery by a herpesvirus structure protein. Cell 88,
223-233.
Frankel AD and Pabo CO (1988) Cellular uptake of the tat
protein from human immunodeficiency virus. Cell 55, 1189-
1193.
Harding HP and Ron D (2002) Endoplasmic reticulum stress and
the development of diabetes: a review. Diabetes 51, S455-
461.
Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H,
Sabatini DD and Ron D (2001) Diabetes mellitus and
exocrine pancreatic dysfunction in perk-/- mice reveals a role
for translational control in secretory cell survival. Mol Cell
7, 1153-1163.
Harding HP, Zhang Y and Ron D (1999) Protein translation and
folding are coupled by an endoplasmic-reticulum-resident
kinase. Nature 397, 271-274.
Hibi M, Lin A and Karin M (1993) Identification of an
oncoprotein- and UV-responsive protein kinase that binds
and potentiates the c-Jun activation domain. Genes Dev 7,
2135-2148.
Hirosumi J, Tuncman G, Chang L, Karin M and Hotamisligil GS
(2002) A central role for JNK in obesity and insulin
resistance. Nature 420, 333-336.
Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, Bernal-
Mizrachi E, Mueckler M, Marshall H, Donis-Keller H, Crock
P, Rogers D, Mikuni M, Kumashiro H, Higashi K, Sobue G,
Oka Y and Permutt MA (1998) A gene encoding a
transmembrane protein is mutated in patients with diabetes
mellitus and optic atrophy (Wolfram syndrome). Nature
Genet 20, 143-148.
Iwawaki T, Akai R, Kohno K, Miura M (2004) A transgenic
mouse model for monitoring endoplasmic reticulum stress.
Nature Med 10, 98-102
Kaneto H, Nakatani Y, Miyatsuka T, Kawamori D, Matsuoka T,
Matsuhisa M, Kajimoto Y, Ichijo H, Yamasaki Y and Hori
M (2004) Possible novel therapy for diabetes with cell-
permeable JNK inhibitory peptide. Nature Med 10, 1128-
1132.
Kaneto H, Xu G, Fujii N, Kim S, Bonner-Weir S and Weir GC
(2002) Involvement of c-Jun N-terminal kinase in oxidative
stress-mediated suppression of insulin gene expression. J
Biol Chem 277, 30010-30018.
Kawamori D, Kajimoto Y, Kaneto H, Umayahara Y, Fujitani Y,
Miyatsuka T, Watada H, Leibiger IB, Yamasaki Y and Hori
M (2003) Oxidative stress induces nucleo-cytoplasmic
translocation of pancreatic transcription factor PDX-1
through activation of c-Jun N-terminal kinase. Diabetes 52,
2896-2904.
Kharroubi I, Ladriere L, Cardozo AK, Dogusan Z, Cnop M,
Eizirik DL (2004) Free fatty acids and cytokines induce
pancreatic "-cell apoptosis by different mechanisms: role of
nuclear factor-#B and endoplasmic reticulum stress.
Endocrinology. 145, 5087-96.
Kuwabara K, Matsumoto M, Ikeda J, Hori O, Ogawa S, Maeda
Y, Kitagawa K, Imuta N, Kinoshita T, Stern DM, Yanagi H
and Kamada T (1996) Purification and characterization of a
novel stress protein, the 150-kDa oxygen-regulated protein
(ORP150), from cultured rat astrocytes and its expression in
ischemic mouse brain. J Biol Chem 271, 5025-5032.
Nagahara H, Vocero-Akbani AM, Snyder EL, Ho A, Latham
D.G, Lissy NA, Becker-Hapak M, Ezhevsky SA and Dowdy
SF (1998) Transduction of full-length TAT fusion proteins
into mammalian cells:TAT-p-27Kip1 induces cell migration.
Nature Med 4, 1449-1452.
Nakatani Y, Kaneto H, Kawamori D, Hatazaki M, Miyatsuka T,
Matsuoka T, Kajimoto Y, Matsuhisa M, Yamasaki Y and
Hori M (2004) Modulation of the JNK pathway in liver
affects insulin resistance status. J Biol Chem 279, 45803-
45809.
Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M,
Matsuoka T, Ozawa K, Ogawa T, Hori M, Yamasaki Y and
Matsuhisa M (2004) Involvement of ER stress in insulin
resistance and diabetes. J Biol Chem (in press).
Noguchi H, Kaneto H, Weir GC and Bonner-Weir S (2003)
PDX-1 protein containing its own Antennapedia-like protein
transduction domain can transduce pancreatic duct and islet
cells. Diabetes 52, 1732-1737.
Noguchi H, Matsushita M, Okitsu T, Moriwaki A, Tomizawa K,
Kang S, Li ST, Kobayashi N, Matsumoto S, Tanaka K,
Tanaka N and Matsui H (2004) A new cell-permeable
![Page 216: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/216.jpg)
Kaneto et al: ER stress and the JNK pathway in insulin resistance
522
peptide allows successful allogeneic islet transplantation in
mice. Nature Med 10. 305-309.
Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E
and Mori M (2002) Targeted disruption of the Chop gene
delays endoplasmic reticulum stress-mediated diabetes. J
Clin Invest 109, 525-532.
Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M,
Wada I, Akira S, Araki E and Mori M (2001) Nitric oxide-
induced apoptosis in pancreatic beta cells is mediated by the
endoplasmic reticulum stress pathway. Proc Natl Acad Sci
USA 98, 10845-10850.
Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E,
Tuncman G, Gorgun C, Glimcher LH and Hotamisligil GS
(2004) Endoplasmic reticulum stress links obesity, insulin
action and type 2 diabetes. Science 306: 457-461.
Ron D (2002) Translational control in the endoplasmic reticulum
stress response. J Clin Invest 110, 1383-1388.
Rothbard JB, Garlington S, Lin Q, Kirschberg T, Kreider E,
McGrane PL, Wender PA and Khavari PA (2000)
Conjugation of arginine oligomers to cyclosporin A
facilitates topical delivery and inhibition of inflammation.
Nature Med 6, 1253-1257.
Schwarze SR, Ho A, Vocero-Akbani AM and Dowdy SF (1999)
In vivo protein transduction: delivery of a biologically active
protein into the mouse. Science 285, 1569-1572.
Shi Y, Taylor SI, Tan S.-L and Sonenberg N (2003) When
Translation Meets Metabolism: Multiple Links to Diabetes.
Endocr Rev 24, 91-101.
Shi Y, Vattem KM, Sood R, An J, Liang J, Stramm L and Wek
RC (1998) Identification and Characterization of Pancreatic
Eukaryotic Initiation Factor 2!-Subunit Kinase, PEK,
Involved in Translational Control. Mol Cell Biol 18, 7499-
7509.
Tamatani M, Matsuyama T, Yamaguchi A, Mitsuda N,
Tsukamoto Y, Taniguchi M, Che YH, Ozawa K, Hori O,
Nishimura H, Yamashita A, Okabe M, Yanagi H, Stern DM,
Ogawa S and Tohyama M (2001) ORP150 protects against
hypoxia/ischemia-induced neuronal death. Nature Med 7,
317-323.
Tirasophon W, Welihinda AA and Kaufman RJ (1998) A stress
response pathway from the endoplasmic reticulum to the
nucleus requires a novel bifunctional protein
kinase/endoribonuclease (Ire1p) in mammalian cells. Genes
Dev 12, 1812-1824.
Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP
and Ron D (2000) Coupling of Stress in the ER to Activation
of JNK Protein Kinases by Transmembrane Protein Kinase
IRE1. Science 287, 664-666.
Wang XZ, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M and
Ron D (1998) Cloning of mammalian Ire1 reveals diversity
in the ER stress responses. EMBO J 17, 5708-5717.
Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001)
XBP1 mRNA is induced by ATF6 and spliced by IRE1 in
response to ER stress to produce a highly active transcription
factor. Cell 107, 881-91.
Hideaki Kaneto
![Page 217: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/217.jpg)
Gene Therapy and Molecular Biology Vol 8, page 523
523
Gene Ther Mol Biol Vol 8, 523-538, 2004
Molecular insight into human heparanase and
tumour progressionReview Article
Erich Rajkovic, Angelika Rek, Elmar Krieger and Andreas J Kungl*Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophysics-Group, Karl-Franzens-University of Graz
__________________________________________________________________________________
*Correspondence: Andreas J Kungl, PhD, Institute of Pharmaceutical Sciences, Proteinchemistry- and Biophyiscs-Group,
Universitaetsplatz 1, A-8010 Graz, Austria; Tel: + 43 316 380 5373; Fax: + 43 316 382 541; Email: [email protected]
Key words: human heparanase, angiogenesis, tumour progression, metastasis, angiogenic factors, molecular modeling
Abbreviations: basic fibroblast growth factor, (bFGF); chinese hamster ovary, (CHO); complex extracellular matrix, (ECM);
connective-tissue-activating peptide III, (CTAP III); endothelial cells, (ECs); glycosaminoglycan, (GAG); heparan sulfate proteoglycans,
(HSPGs); heparan sulfate, (HS); human heparanase 1, (Hpa 1); human heparanase 2, (Hpa2); matrix metalloproteinase, (MMP); platelet-
derived growth factor, (PDGF); transforming growth factor-!, (TGF-!); tumour necrosis factor-", (TNF-"); vascular endothelial growth
factor, (VEGF)
Received: 13 December 2004; Accepted: 10 January 2005; electronically published: January 2005
Summary
The human heparanase is a key enzyme in tumour vascularisation and metastasis. Here we review the current
molecular knowledge on this protein and present a model of its active domain.
I. IntroductionA. Angiogenesis-A key event in tumour
progression from its cellular aspectsAngiogenesis or neovascularization is denoted as the
process of the formation of new capillaries and vessels
from preexisting blood vessels during the development as
well as during the maintenance of all organ systems. This
is in clear contrast to arteriogenesis or vasculogenesis,
which is characterised by the assembly of new vessels
from endothelial precursor cells. On the one hand
angiogenesis is known to occur in selected physiological
processes during the development of the vasculature, e.g.
ovulation or wound healing, but on the other hand it also
plays a significant role in pathophysiology, for example by
mediating the vascularization of tumours. In both cases it
is a very tightly regulated and complex cascade of multiple
interrelating processes involving endothelial cell activation
and migration, proliferation, extracellular proteolysis,
multicellular organisation and differentiation including
final branching and stabilisation (Nicosia and Madri,
1987; Buschmann and Schaper, 1999; Jain 1999). A
delicate balance between positive angiogenic stimuli and
endogenous inhibitors (Folkman, 1995) has to exist since
observations of new ("de novo") blood vessel formation
initiated in vivo by a local application of an exogenous
angiogenesis factor, showed abnormal rapid involution
due to the discontinuation of the angiogenic stimulus
(interruption of the exogenous factor) (Liotta et al, 1991;
Benett and Stetler-Stevenson, 2001). Thus, the angiogenic
response associated with many pathological phenomena
(e.g. cancer metastasis, Kaposi`s sarcoma, rheumatoid
arthritis, psoriasis) probably involves both the continuous
release of potent angiogenic signals, as well as down-
regulation or even the removal of natural antiangiogenic
effectors.
Angiogenesis takes place in a structurally
heterogenous and complex extracellular matrix (ECM)
environment and is therefore strongly influenced by the
ECM organisation and composition. Remodelling of the
extracellular matrix in terms of modulating endothelial and
vascular cell behaviours (Kalluri, 2003) is a major
prerequisite for the growth (formation) of new blood
vessels. This involves an initial breakdown of the
subendothelial basement membrane, an amorphous, dense,
sheet-like structure, which is 50 to 100 nm thick (Kalluri,
2003), as well as the turn over of the intercellular matrix
components during new vessel outgrowth. These
modifications, which obviously necessitate a finely
controlled interplay of proteinases and proteinase
inhibitors, remove physical barriers (e.g. basement
membrane, ECM macromolecules) and prepare states that
may stimulate endothelial cell migration (Iozzo and San
Antonio, 2001; Cleaver and Melton, 2003) (Figure 1).
The series of tissue-cell-matrix interactions of all
invasive cell types is generally divided into three phases
(Stetler-Stevenson, 1993): (i) modification of cell-cell
contacts and establishing new cell-matrix contacts
(Sasisekharan et al, 2002; Sanderson, 2001); (ii)
proteolytic modification of the ECM that removes barriers,
![Page 218: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/218.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
524
restructures cell-matrix contacts, and prepares the matrix
to facilitate cell movement (Sharma et al, 1998; Iozzo and
San Antonio, 2001); (iii) migration of the invasive cell
through the proteolysed matrix to establish new matrix
contacts (Carmeliet and Jain, 2000). This cycle is repeated
until the new blood vessel is fully developed (Seftor et al,
1992; Ray and Stetler-Stevenson, 1994).
B. Proteoglycans-Bridging
macromolecules in cell-cell communication
and cell-growthThe enormous heterogeneity of the extracellular
matrix is probably one of its most important properties and
therefore responsible for its functional diversity in
relationship to angiogenesis (Mecham, 1998). Some
components are designed to be rigid (e.g. collagens),
others elastic (e.g. elastin); some wet, others sticky. These
diverse modular designs impart diverse roles, yet allow for
highly specialized functions. Beside collagen-proteins,
which are designed to provide structure and resilience to
tissues, and the microfibrillar proteins like elastin and
fibrillin, that ensure the structural integrity and function of
tissues in which reversible extensibility or deformability
are crucial, proteoglycans complete the complexity of the
ECM.
Proteoglycans - found in most mammalian cells and
tissues - are composed of glycosaminoglycan (GAG)
chains covalently linked to a core protein. While the
protein part determines the localisation of the proteoglycan
in the cell membrane or in the ECM, the GAG component
mediates the broad functional interactions with a great
variety of ligands (Guimond et al, 1993; Walker and
Gallagher, 1996).
GAGs are complex, linear polysaccharides consisting
of a disaccharide repeat unit of glucosamine linked to
either an iduronic or a glucuronic acid. Further
modification of the individual backbone introduces
additional structural complexity. The variations can occur
at the 2-O position of the uronic acid and the 6-O and 3-O
positions of the glucosamine. The N-position can either be
sulphated or acetylated but can also stay unmodified
(Sasisekharan et al, 2002).
The polysaccharide chains are flexible in a certain
way, but cannot fold up into the compact globular
structures that polypeptide chains typically form.
Moreover, they are highly negatively charged and strongly
hydrophilic. Thus GAGs tend to adopt extended
conformations that occupy a huge volume and enable cell-
cell-interactions over extensive regions inside of tissues.
On the basis of their structural composition GAG
chains are classified into different groups, i.e. heparan
sulfate (HS)/heparin, keratan sulfate, chondroitin sulfate
and some more (Esko and Lindahl, 2001). Most important
for angiogenesis are heparan sulfate proteoglycans
(HSPGs) as they are predominantly found on cell surfaces
and in the ECM. Particular sulfation patterns in their GAG
![Page 219: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/219.jpg)
Gene Therapy and Molecular Biology Vol 8, page 525
525
Figure 1. A rough scheme of angiogenesis (I) and tumour metastasis (II)
(I) (A) Most tumours start growing as nodules provided with nutrients by diffusion processes until they reach a steady-state size of
proliferating and apoptosing cells. Massive tumour growth however necessitates the process of angiogenesis. In the first steps, pericytes
detach from the vessel, the blood vessel dilates to a limited extent (B) before the basement membrane and the extracellular matrix
undergo degradative and structural changes as a result of the release of matrix metalloproteinases (MMPs) and growth factors. The
growth factors, for example vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and platelet-derived
growth factor (PDGF) are released from the basement membrane, but also produced by tumour cells, fibroblasts and immune cells. This
induces the endothelial cells to emigrate into the intercellular space towards the angiogenic stimuli triggered by the tumour-nodule. (C)
The endothelial cells proliferate and start forming the sprout into a new blood vessel, which is guided and supported by pericyte-cells. At
the same time new intermediate basement membranes are built up. (D) Finally, the endothelial cells adhere tightly to each other to
strengthen the new lumen, the intermediate basement membrane matures and pericytes attach again to the blood vessel (not shown in the
picture). Thus the new blood vessel is in working order and is integrated in the circulatory system by flooding. The blood-vessel
formation will continue as long as the tumour grows and the hypoxic and necrotic areas of the tumour are provided with essential
nutrients and oxygen.
(II) (E) The metastasis of tumour cells starts with the destruction of heparan sulfate rich basement membrane by the release of
heparanase into the microenvironment of the tumour. This is the prerequisite for the tumour cells for invading the underlying extra
cellular space towards the endothelial cells. The extracellular matrix is degraded and heparan sulfate chains are presented on cell
surfaces. The resulting fragments of the heparan sulfate chains activate growth and motility factors in the surrounding area of the
tumour. (F) Prior to "invasion", the entry of tumour cells in the blood vessel, the basement membrane has to be fully disrupted and in
addition the tight junctions between the endothelial cells have to be loosened. (G) Finally the tumour cells pass into the blood vessel and
are transported by the blood-system through the whole organism.
chains allow interactions with a series of bioactive
molecules, such as growth factors, chemokines,
morphogenes, lipoproteins and enzymes. These
interactions are mainly driven by electrostatic forces of the
HS-sulfate groups with the basic amino acids, like lysine,
arginine or histidine of the protein counterpart. Van-der-
Waals- and hydrophobic forces may also affect the process
of ligand binding to a significant extent (Thompson et al,
1994).
Among the signalling molecules which influence
normal and pathologic processes like tissue repair, neurite
outgrowth, inflammation and autoimmunity, there are
growth factors including fibroblast growth factor 1 and 2
(FGF1 and 2), vascular endothelial growth factor (VEGF),
transforming growth factor-! (TGF-!) and other factors,
which have not been identified yet (Sasisekharan and
Venkataraman, 2000; Turnbull et al, 2001), that are
important for tumour development and angiogenesis.
![Page 220: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/220.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
526
Binding to HS can modulate a tethered molecule's
biological activity or protect it from proteolytic cleavage
and inactivation. Due to the multifaceted roles of HSPGs
in cell physiology, their cleavage is likely to alter the
integrity and functional state of tissues and to provide a
mechanism by which cells can respond rapidly to changes
in the extracellular environment. It is a fact that cancer
cells, as part of the transformation process, do not only
alter their HSPGs profile, including differential expression
of particular proteoglycan protein-core sequences, as well
as alter the heparan sulfate glycosaminoglycan fine
structure of given proteoglycans, but also change their
protein expression levels. Thus higher amounts of
angiogenic differentiation and development factors
(Burnfield et al, 1999; Tumova et al, 2000; Esko and
Lindahl, 2001) are available and increased enzymatic
degradation of such HSPGs plays a crucial role at the
beginning stages of angiogenesis.
Invading cells, particularly metastatic tumour cells
and leukocytes, traverse ECM barriers and basement
membranes by liberating masses of degradative enzymes.
A large number of proteases (e.g. matrix
metalloproteinases, serine, cysteine and aspartatic protease
families) have been described that can disassemble the
extracellular matrix (Vlodavsky et al, 1999; Parish et al,
2001). However, for efficient degradation of the
extracellular environment, a cooperative action of
proteases and HSPG cleaving enzymes is indispensable.
The crucial enzyme for HS degradation is the human
heparanase.
II. Human heparanase–Molecular
biology and structureA. Genetic organisation of the human
heparanaseThe cloning of only one single human heparanase
cDNA sequence was independently published by several
groups, resulting in an identical sequence being obtained
from a human placental cDNA library and a human T- cell
lymphoma cell line (Hulett et al, 1999; Kussie et al, 1999;
Toyoshima and Nakajima, 1999; Vlodavsky et al, 1999).
The human gene of the heparanase-enzyme is located on
the chromosome 4q21.3, contains 50 kilo base pairs and
encircles 14 exons and 13 introns. As a consequence of
alternative splicing the gene-information may either be
translated as 2,0 kb or as 4,4 kb mRNA (Hulett et al,
1999). While the 50 kb species contains 14 exons and 13
introns, the 1,7 kb form is created with the first and
fourteenth exon remaining untranslated. Nonetheless both
transcripts contain the same open reading frame,
producing the single heparanase enzyme, which is also
abbreviated as Hpa1 (Dong et al, 2000; Parish et al, 2001).
Early, rather controversial, developments determined
heparanase activity for several proteins ranging from 8
kDa, over 50 kDa up to 134 kDa in molecular mass (Oosta
et al, 1982; Freeman and Parish, 1998). There have also
been claims that the enzyme is a heat shock protein
(Graham et al, 1994) or might even be related to the CXC
chemokine, !-thromboglobuline, also known as
connective-tissue-activating peptide III (CTAP III)
(Hoogewerf et al, 1995). Further findings of a full length
rat heparanase cDNA and a partial mouse heparanase
(Miao et al 2002) cDNA sequence in combination with
reported amino acid sequences in rat and chicken
(Goldshmidt et al 2001; Podyma-Inoue et al, 2002; Kizaki
et al, 2003) indicate that all these proteins are highly
conserved, as confirmed by 80 % identity in the amino
acid sequence between the human and murine protein and
nearly 93 % identity between mouse and rat sequences
(Hulett et al, 1999). The 214 amino acids encoding cDNA
fragment of bovine heparanase is to 82 % identical with
the human heparanase. Only recently a human cDNA
fragment encoding a novel human protein, namely human
heparanase 2 (Hpa 2), with significant homology to
heparanase was cloned (McKenzie et al, 2000). However,
differences in expression profiles, predicted cellular
locations and tissue distributions suggest that human
heparanase 1 (Hpa 1) and Hpa2 may somehow be related
but clearly exhibit distinct biological functions and
represent members of two dissimilar mammalian
heparanase families (McKenzie et al, 2000). In addition,
some more heparanases (C1A, C1B, C2A, C2B) of
different molecular weights have been partially purified
from chinese hamster ovary cells (CHO cells) and have
been preliminarily characterised (Bame et al 1998; Bame,
2001).
Despite the existence of several heparanases the
hypothesis of multiple enzymes with similar biological
function has never really been established. More likely is
the assumption of the Hpa1 enzyme being unique and
being the only transcript used by invading cells to degrade
heparan sulfate proteoglycans. In summary, its molecular
characteristics are described as follows.
The complete human heparanase cDNA contains
1629 bp and encircles an open reading frame that encodes
a polypeptide of 543 amino acids with a calculated
molecular weight of 61,2 kDa which appears as a ~65 kDa
band in the SDS-PAGE analysis.
B. Protein function of the human
heparanaseDiscussing the features of the heparanase at protein
level will give insights into the specific mechanism of its
biological function. The hydropathic profile (Vlodavsky et
al, 1998) of the heparanase protein indicates a
hydrophobic region at the N-terminus (Met1 to Ala35)
which is assumed to function as signal peptide for
secretion. Conversely, the chicken heparanase signal
peptide which spans 19 amino acids and which shows only
39 % homology (Goldshmidt et al, 2001) to the human
analogue, ensures that the chicken enzyme is readily
secreted. These findings suggest that human heparanase is
primarily localised in perinuclear acidic endosomal and
lysosomal cellular granules before it is secreted/
translocated to the extracellular space (Mollinedo et al,
1997; Bame, 2001; Goldshmidt et al, 2001). The C-
terminus is a highly conserved and hydrophobic stretch
ranging from Pro515 to Ile543. One could argue that this part
defines the putative transmembrane domain or a GPI
anchor which could be responsible for the enzyme's
retention on the cell surfaces (Bartlett et al, 1995; Hulett et
![Page 221: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/221.jpg)
Gene Therapy and Molecular Biology Vol 8, page 527
527
al, 1999; Parish et al, 2001). Further prediction of a
hydrophilic region between the amino acids 110 and 170
indicates that this fragment is exposed at the protein's
surface and therefore accessible for proteases (Vlodavsky
et al, 1999).
The active form of the human heparanase has long
been thought to be a 50 kDa polypeptide, isolated and
purified from various tissues. However, several attempts to
obtain heparanase activity after expression of the 50 kDa
subunit in insect cells as well as in mammalian systems
(Vlodavsky et al, 1999; McKenzie et al, 2003) failed,
suggesting that the N-terminal part including an 8 kDa
fragment is important for enzymatic activity. More likely
is that the isolated 50 kDa fragment represents a processed
form of the native, full-length 65 kDa heparanase
(Freeman and Parish, 1998; Toyoshima and Nakajima,
1999) as it always appears together with the 8 kDa peptide
when analysing the purified enzyme on a SDS-PAGE gel.
This observation supports the hypothesis that the 65 kDa
full length protein represents the immature, inactive
enzyme, which is subsequently called pro-heparanase
(Gln36 to Ile543) originating from a pre-pro-form (Met1 to
Ile543) after removal of the putative signal peptide (Met1 to
Ala35) (Figure 2). This pro-form undergoes further
proteolytic processing which is likely occur within the
hydrophilic region at two potential cleavage sites, Glu109 to
Ser110 and Gln157 to Lys158, yielding an 8 kDa polypeptide
at the N-terminus and a 50 kDa polypeptide at the C-
terminus. Subsequent complexation of the two obtained
subunits finally forms the active, mature heparanase
protein and an intervening 6 kDa linker peptide (Ser110 to
Gln157) (Fairbanks et al, 1999; Parish et al, 2001;
Vlodavsky et al, 2001; Levy-Adam et al, 2003; Nardella et
al, 2004). Additionally, the region Glu288 – Lys417 in the 50
kDa large fragment is believed to facilitate the physical
association to the 8 kDa subunit (Levy-Adam et al, 2003).
Assumptions that the active heparanase enzyme is a
noncovalently linked heterodimer were confirmed by
several cloning- and expression attempts in mammalian
systems and insect cells showing that neither the 8 kDa
nor the 50 kDa fragment on their own were able to digest
substrate (Vlodavsky et al, 1999; McKenzie et al, 2003).
Additional attempts to obtain active protein by
reconstituting the small and large units after expressing
them separately failed, proposing that active folding needs
Figure 2 . The processing of the human heparanase. A scheme of the predicted domain structure of the human heparanase and the
processing procedure towards the active form of the enzyme: the non covalent association of the 8 kDa and 50 kDa subunit after the
processing of an intervening 6 kDa propeptide. The pre-proheparanase is believed to be translated, first, and is subsequently processed
by removal of the propeptide (from amino acid 110 to 157) and by the removal of the signal peptide at the N-terminus of the protein
from the residue 1 to 35. Final cleavage results in the 8 kDa subunit from Gln36 to Glu109 and the 50 kDa subunit from Lys158 to Ile543.
The six putative N-linked glycosylation sites (N 162, N 178, N 200, N 217, N 238, N 459) are located on the large subunit, from which
five cluster in the first 80 amino acids, and the putative catalytic proton donor on Glu225 and proton acceptor on Glu343.
![Page 222: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/222.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
528
a cellular environment. In contrast co-expressed 8 kDa and
50 kDa polypeptides showed high levels of activity. Also
notable is the fact that insect expression of the
unprocessed 65 kDa precursor form produced little or no
active enzyme, respectively, concluding that the
mammalian cell facilities are needed to process the human
heparanase to its active heterodimer (McKenzie et al,
2003). The involvement of one or even several proteases
for this activation-degradation process is highly likely but
yet not confirmed as so far they have not been isolated.
Deglycosylation of the sugar-residues attached to the six
putative N-glycosylation sites, five of which cluster within
the first 80 amino acids of the 50 kDa mature protein, had
no detectable effect on the enzymatic activity (Vlodavsky
et al, 1999). Nevertheless they seem to be responsible for
proper translocation and secretion of the enzyme (Simizu
et al, 2004).
C. Regulation of the human heparanase
expressionDue to the fact that inadvertent cleavage and
modeling of heparan sulfate causes potential tissue
damage, it is obvious that the expression of the heparanase
enzyme has to be tightly regulated. However, very little is
known about factors influencing its expression and activity
in normal and in malignant cells. Inflammatory cytokines,
endothelial cells, leukocytes, tumour necrosis factor "
(TNF ") are known to enhance the expression-levels
(Bartlett et al, 1995; Parish et al, 1998). Latest
experiments showed effects of fatty acids, especially oleic
acid on the activation of the Sp1 binding site, which is
located 192 to 201 bp upstream from the initial ATG
codon (Cheng et al, 2004) of the heparanase coding
sequence. In the context of breast cancer, putative estrogen
response elements in the regulatory sequence of the
heparanase gene were identified. Estrogen- induced
mRNA transcription could be demonstrated in estrogen-
receptor positive, but not in estrogen-receptor negative
breast cancer cells, confirming this finding (Elkin et al,
2003).
D. Putative substrate recognition sites for
the human heparanaseCharacterising the heparanase interaction with its
natural glycosaminoglycan substrates, the human
heparanase, which constitutes a !-endoglucuronidase,
cleaves glycosidic bonds with a hydrolase mechanism and
is thus distinct from bacterial heparinases which
depolymerise heparin and heparan sulfate by eliminative
cleavage generating unsaturated bonds. Secondary
structure predictions suggest that the heparanase enzyme
consists of a ("/!)8-TIM-barrel architecture. This fold is
frequently observed in glycosylases and is also proposed
for this protein. As the 50 kDa subunit on its own forms 6
"/! units, the missing structural elements have to be
completed by the 8 kDa polypeptide, showing a predicted
secondary structure of a !/"/! element (Nardella et al,
2004), thereby generating the native fold. The heparanase
exhibits the common catalytic mechanism typical for the
family of glycosylhydrolases, involving two conserved
amino acid residues, the putative proton donor Glu225 and
the putative proton acceptor (nucleophile) Glu343.
Conserved basic residues are found in proximity to the
proposed catalytic proton donor (KK residues 231 and
232) and nucleophile (KK residues 337 and 338)
responsible for additional, adhesive interactions with
GAGs, i.e. HS (Hulett et al, 2000).
The heparan sulfate glycosaminoglycans are cleaved
by the enzyme at only a few sites, creating fragments of 10
to 20 sugar units. This observation confirms the thesis that
the heparanase enzyme recognizes particular and quite rare
heparan sulfate motifs (Freeman and Parish, 1998; Pikas et
al, 1998). On the one hand, it has been shown that a 6-O-
sulfate group on a glucosamine residue, located two
monosaccharide units away from the cleavage site at its
non-reducing end, and a 2-sulfated glucosamine-structure
on the reducing side are essential for substrate recognition
(Figure 3). Substrate cleavage, on the other hand, was
found to require a hexuronic carboxyl group (Bai et al,
1997; Vlodavsky and Friedmann, 2001; Okada et al, 2002)
and heparan sulfate comprising unsubstituted glucosamine
residues is not processed (Parish et al, 1999; Dempsey et
al, 2000). Structurally related heparin, however, has a high
inhibitory effect on the enzyme's activity (Bar-Ner et al,
1987; Vlodavsky et al, 1994) due to the predominant
existence of the [IdoUA(2-OSO3)-GlcNSO3(6-OSO3)-]n
repeat structure. In contrast to the proposed endolytic
cleavage mechanism, it has recently been postulated that
human heparanase can also cleave defined oligosaccharide
structures in an exolytic action (Gong et al, 2003). Thus
the precise localisation of sulfation patterns and the
sequences of heparan sulfate residues required for
recognition as well as for subsequent cleavage are yet
uncertain.
IV. Human heparanase – Involvement
in physiological and patho-physiological
processes and its inhibitionA. PhysiologyMost studies particularly underline the involvement
of the heparanase enzyme in pathophysiology with a
strong leaning towards cancer. Although only little is
known about the enzyme`s contribution to normal cell and
tissue function it is strongly suggested that the heparanase
plays a crucial role in embryo implantation, which
involves invasive cell immigration and interaction
between HS-binding proteins (i.e. growth factors) and
heparan sulfate proteoglycans in order to ensure normal
development (Selleck, 1999; Dempsey et al, 2000; Reiland
et al, 2004). In many facets the embryonic cell migration,
proliferation and differentiation is similar to its
involvement in tumour metastasis, angiogenesis and
inflammation. There have been lines of transgenic mice
generated which ubiquitously overexpress the human
heparanase (Zcharia et al, 2004). Biochemical analysis of
isolated heparan sulfate oligosaccharides of transgenic
mice revealed a decrease in the size of the HS chains
compared to HS from control mice. This is interpreted as
an enhanced heparanase cleavage activity in almost every
tissue (Zcharia et al, 2004).
![Page 223: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/223.jpg)
Gene Therapy and Molecular Biology Vol 8, page 529
529
Figure 3. Substrate of the human heparanase
(A) The lower part of this figure encircles schematically the localisation and role of heparan sulfate proteoglycans in vascularisation and
metastasis. HSPGs are predominantly found on cell surfaces and everywhere in the extracellular-matrix. With their core-proteins they
are anchored in the cell membrane. The number and composition of the covalently linked heparan sulfate chains varies enormously
depending on the tissue and cell functions, respectively, and the state of cell differentiation - different heparan sulfate expression
patterns. Particular the sulfation patterns in the carbohydrate-chains allow interactions with a series of bioactive molecules (e.g. growth
factors). Heparanase secreted by the surrounding tumour cells is responsible for the degradation of this heparan sulfate chains and for the
release of tethered molecules by cleaving at certain sites. (B) The upper part of this figure summerizes the structural characteristics of the
minimal human heparanase cleavage site, known so far. It is composed of the trisaccharide sequence between the brackets and occurs
quite rarely in HS chains. The arrow indicates the glucuronidic bond cleaved by the heparanase. Highly sulfated structures seem to be
essential for the enzymes activity. The N-sulfation on the reducing side, the 6-O-sulfation of the glucosamine on the non reducing side,
both indicated in green, and the carboxy-group (hold in red font) on the glucuronic-acid seem to be essential for the enzyme's activity.
The additional 2-N-sulfate group on the nonreducing GlcN and the 6-O-sulfate group on the reducing GlcN both have a promoting effect
on the heparanase activity (magenta colored). The function of the 3-O-sulfate group in blue remains controversial. In principle it is
thought to inhibit the enzyme, but it may also have a promoting effect due to its negative charge.
![Page 224: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/224.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
530
Although the mice appeared normal, fertile, and exhibited
a normal life span, pregnant transgenic mice had a
significant increase in the number of implanted embryos
compared with control mice. There also was a higher
miscarriage and embryonic lethality confirming the
necessity of normal HS structures during embrionic
growth and morphogenesis (Lin et al, 2000; Zcharia et al,
2004). Because of less intact HS, thereby also affecting the
basement membrane structure, the kidney function was
insufficient. Elevated levels of proteins were found in the
urine, indicating that heparanase is able to disrupt the
filtration barrier as well as to have an impact on the
reabsorption function of the kidneys (Weinstein et al,
1992; Levidiotis et al, 2001; Katz et al, 2002; Zcharia et
al, 2004). The mammary glands of virgin transgenic mice
showed similar development and maturation to the ones of
normal mice at day 12 of pregnancy. An even more
pronounced development was observed when those
transgenic mice became pregnant, most probably due to
heparanase-induced overbranching, hyperplasia and
widening of ducts (Zcharia et al, 2004). Furthermore, the
heparanase overexpressing mice showed accelerated hair
growth by enhancing the vascularization and maturation of
the hair follicle (Yano et al, 2001; Zcharia et al, 2004).
Upon aging the expression levels of the heparanase
become negligibly low. In an adult organism the enzyme
only appears during wound repair (Vlodavsky and
Friedmann, 2001), fracture repair (Saijo et al, 2003), tissue
regeneration (Dempsey et al, 2000), and immune
surveillance (Zcharia et al, 2001). In addition, following
vascular injury, it is believed that heparanase, probably
secreted from infiltrating and extravasating leukocytes,
degrades heparan sulfate to induce smooth muscle cell
proliferation, which is normally inhibited by the intact HS
chains (Campbell et al, 1992; Francis et al 2003).
B. PathophysiologyWith regard to the specific structural interaction of
HSPGs with various extracellular matrix and basement
membrane macromolecules, they play a key role in self-
assembly, modeling and insolubility of ECM components,
as well as cell adhesion, harvesting and locomotion
(Kjellen and Lindahl, 1991; Iozzo, 1998; Vlodavsky et al
1999). Cleavage of the HS sidechains by HS-degrading
enzymes, such as heparanase, therefore results in
disassembly of the extracellular matrix and in the
permeability of the underlying basement membranes,
occurring as a crucial triggering process in the
extravasation of blood borne cells (Parish et al, 1987;
Vlodavsky et al, 1992, 1994; Nakajima et al, 1988; Parish
et al, 1999). Immunohistochemical investigations revealed
that the heparanase enzyme appeared primarily in
neutrophils, macrophages, platelets, keratinocytes,
capillary endothelium and neurons, but very seldom in
normal epithelia. While the expression levels of the
enzyme in normal tissues are very low and its incidence is
restricted to the placenta and to lymphoid organs, elevated
levels of heparanase were observed in tumour bearing
animals and cancer patients suffering for example from
bladder cancer (Gohji et al, 2001), colon cancer
(Friedmann et al, 2000), gastric cancer (Tang et al, 2002),
breast cancer (Maxhimer et al, 2002), oral cancer,
oesophageal cancer (Ikuta et al, 2001), pancreatic cancer
(Koliopanos et al, 2001; Kim et al, 2002; Rohloff et al,
2002), brain cancer (Marchetti et al, 2001), endometrial
cancer (Watanabe et al, 2003) and acute myeloid leukemia
(Bitan et al, 2002; Vlodavsky et al, 2002; Sanderson et al,
2004). Moreover, the expression of the human heparanase
correlates with the metastatic potential of human tumour
cells. Since this is also the case for other extracellular
matrix degrading enzymes, i.e. for the group of matrix
metalloproteinases (MMPs) - the feature of inducing
angiogenesis in addition to the initiation of cell invasion
becomes more obvious (Hulett et al, 1999; Parish et al,
2001; Goldshmidt et al, 2002; Takaoka et al, 2003;
Watanabe et al, 2003). Together with the degradation of
ECM components (collagens, laminins, fibronectin,
vitronectin etc) a continuous cleavage of heparan sulfate
proteoglycans by the human heparanase is fulfilled. This
process increases the bioavailability and activity of growth
factors and other bioactive molecules, which have been
tethered and inactivated by binding to heparan sulfate
structures, and promotes the migration and proliferation of
endothelial cells (ECs) to form vascular sprouts.
Heparanase has also been implicated in the degradation of
subendothelial basement membrane by leucocytes
(Naparstek et al, 1984; Parish et al, 2001). During chronic
inflammation leukocytes enter and accumulate in
inflammatory areas by the continous extravasation through
the blood vessel wall. Several in vitro studies have
confirmed this assumption (Vlodavsky et al, 1992; Bartlett
et al, 1995; Parish et al, 1998; Hulett et al, 1999). Both
tumour masses and inflammatory sites provide the acidic
environment which human heparanase requires for
degradation of heparan sulfate structures. The enzyme has
its maximal endoglycosidase activity between pH 5,0 and
6,0 (more precisely from pH 5,6 to 5,8) and is inactivated
at pH greater than 8,0. Under physiological conditions (pH
7,4) heparanase binds heparan sulfate but does not degrade
its substrate. This is in accordance with the findings that
inactive recombinant heparanase enzyme still binds to HS
molecules without subsequent degradation and therefore
enables the adhesion of cells (Goldshmidt et al, 2003).
C. InhibitionThe knowledge of heparanase biological function
collected so far, is sufficient for its consideration as a
promising target for cancer therapy. Great efforts are being
made in order to develop a potent inhibitor, and sulfated
polysaccharides, like heparin, dextran sulfate, xylan
sulfate, fucoidan, carageenan-gamma and laminaran
sulfate, which have primarily anticoagulant activity, are
already known to be effective inhibitors of tumour
metastasis. Their inhibitory effect in experimental
metastasis is more related to their ability to inhibit the
heparanase enzyme than to their anticoagulant properties
(Parish et al, 1987; Nakajima et al, 1988; Vlodavsky et al,
1994; Miao et al, 1999; Parish et al, 1999).
In addition, other polyanionic molecules, such as
phosphomannopentaose sulfate (PI-88) and maltohexaose
sulfate, have proven to be as potent as heparin concerning
the inhibition of heparanase activity (IC50 ~ 1 – 2 µg/ml),
![Page 225: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/225.jpg)
Gene Therapy and Molecular Biology Vol 8, page 531
531
confirming the assumption that the oligosaccharide chain
length and the degree of sulfation are more important than
sugar composition and type of linkage (N- or O-sulfated)
(Vlodavsky et al, 1994, 2001; Lapierre et al, 1996; Parish
et al, 1999). PI-88 has successfully passed through the
preclinical studies as its application confirmed the
inhibition of tumour growth and tumour angiogenesis. It is
currently being tested on cancer patients in a Phase II
clinical trial (Parish et al 1999).
Furthermore, in a parallel study, by screening 10000
culture broths of microorganisms (actinomycetes, fungi
and bacteria), a specific actinomycete-strain (RK99-A234)
emerged for the reason of compensating heparanase
enzyme activity. The responsible neutralizing interaction
partner was identified as RK-682 (IC50 ~ 17µM), already
known to inhibit protein tyrosine phosphatases
(Hamaguchi et al, 1995; Ishida et al, 2004). Using RK-682
as a lead compound structure a more selective heparanase
inhibitor was designed, namely 4-Benzyl-RK-682 (Ishida
et al, 2004).
Finally, Suramin (IC50 < 10µM in vitro), a
polysulfonated naphthylurea, and Trachyspic acid (IC50 ~
50µM), isolated from Talaromyces trachyspermus, have to
be mentioned in order to complete the short enumeration
of potent heparanase inhibitors known so far. The
inhibitory mechanisms of both are as yet unknown,
although the structure of Trachyspic acid is similar to 4-
Benzyl-RK-682 concluding that both of the substances
bind and block as mimic substrates the heparanase's
cleavage site (Nakajima et al, 1991; Shiozawa et al, 1995;
Hirai et al, 2002).
IV. Biophysical remarks and
conclusionsA. Development of heparanase activity
assays described in the literatureAlthough the human heparanase and its role in
regulating proteoglycan function in angiogenesis have
been known for many years, the enzyme as a potential
pharmaceutical target has not yet received as much
attention as other angiogenetic factors, like for example
FGF and VEGF. The main starting point for interfering in
non physiological angiogenic processes has so far been the
synthesis of specific heparan sulfate glycosaminoglycan
sequences with high affinity for growth factor binding,
thereby silencing downstream signalling in angiogenesis.
One reason for the lack of interest in designing a
heparanase inhibitor is mainly determined by initial major
difficulties in the establishment of an assay that could
easily monitor enzyme activity by following the
degradation of its HS substrate, unlike bacterial lyases
which cleave HS- or heparin chains by an elimination
mechanism, a reaction that can be detected
spectroscopically as unsaturated products are generated
(Linhardt et al, 1986). The human as well as the
mammalian heparanases in general constitute hydrolases
cleaving without double bond formation. Thus more
sophisticated assays for activity determination had to be
developed in order to facilitate heparanase purification
from tissues for subsequent protein characterisation.
Besides, the definition of the heparanase specific substrate
turned out to be difficult, because most of the HS
molecules purified from diverse tissues have already been
cleaved and the unprocessed oligosaccharide chain could
not be reconstructed. In some cases heparin has been used,
but because it is highly modified, it does not fullfill the
domain structure of heparan sulfate (Oosta et al, 1982;
Lyon and Gallagher, 1998). Despite difficulties in the
beginning, major progress in the development of different
heparanase activity assays could be reported in the last few
years.
Radioactive- (35S) and fluorescence- (FITC) labeled
HS substrates were used to detect the size-shift of the
degraded glycosaminoglycan to smaller fragments upon
incubation with active heparanase. The thus obtained
cleavage products were finally analysed by gel filtration
chromatography (Toyoshima and Nakajima, 1999;
Vlodavsky et al, 1999). These assays are highly sensitive
but not suitable for screening large amounts of substrate
samples. In addition the handling of the single separated
steps of the reaction procedure as well as the detection
were quite laborious but nevertheless were accepted.
When it came to attempts to searching for an inhibitor,
however, a simple and efficient heparanase assay method
became absolutely indispensable in order to guarantee a
promising high throughput analysis. This approach
became possible by forming polyacrylamide tablets
containing defined amounts of HS stained with Alcian
blue. The colour density of the tablets correlates with the
HS concentration and is quantified. After adding active
heparanase, degraded fragments are excluded out of the
tablets which results in a decrease of the colour density, a
process which can easily be visually detected (Ishida et al,
2004). Another assay method is described on the principle
of ultrafiltration. Based on limited cleavage sites of HS
chains, the degradation of radioactively labeled
glycosaminoglycans with approximately 30 kDa molecular
size results in products ranging from 7 to 10 kDa is
exploited. A subsequent separation of the cleaved
fragments is performed by using a special molecular
weight cutoff, which exhibits minimal permeability to the
undigested HS, while permitting maximum permeability to
the digested products which can then be detected by
radioactive scintillation counting (Nakajima et al, 1988;
Tsuchida et al 2004).
Several reasons retarded the research progress for the
human heparanase, among which the already well
characterised growth factors with a great potential for
interference in angiogenesis and the lack of a powerful
enzymatic assay played a decisive role. In addition, the
protein is not very abundant in vivo and therefore getting
enough material to purify adequate amounts of enzyme for
characterisation is still a challenge. Beside the very small
amounts of protein, another difficulty is related to the
unstable nature of the heparanase. Several attempts to
purify human heparanase or heparanase subunits from
diverse tissues to homogeneity resulted in the loss of
enzymatic activity. The cloning of the full length cDNA
and of the two subunits in diverse expression systems
(mammalian cells or insect cells) is reported by various
groups (Hulett et al, 1999; Vlodavsky et al, 1999; Elkin et
![Page 226: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/226.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
532
al, 2001; Nardella et al, 2004) and delivers sufficient
amounts of active heparanase but exact details concerning
the nature of the active complex, formed by the respective
subunits after posttranslational processing are so far
unknown.
B. Novel aspects in the molecular
characterisation of the human heparanaseThe design of specific inhibitors seems to make only
slow progress. With the exception of PI-88 which is
currently being tested in phase II clinical trials in
Australia, there are no other heparanase inhibitors in
clinical studies to our knowledge. Furthermore, a
multitude of existing inhibiting molecules, like suramin,
are not suitable for in vivo experiments because of severe
side effects and toxicity (Parish et al, 2001). Added to this,
the mechanisms of inhibition are yet unknown or cannot
precisely be correlated with heparanase action, as for
example PI-88 also shows high binding affinities to
growth factors, like FGF-1, FGF-2 and VEGF (Cochran et
al, 2003).
In the literature, no paper describes a structure based
design of heparanase inhibitors and the protein itself
remains a structurally uncharacterised enzyme. In addition
nearly no published article investigates the structure of
human heparanase or its biophysical properties.
Encouraged by this gap in heparanase characterisation and
in order to provide information for structure based drug
design, a method which has been successfully applied for
other proteins, we decided to produce this enzyme in our
labs using a different cloning strategy to that reported so
far. We cloned the respective subunits, 8 kDa and the 50
kDa, known to form the active heterodimer, separately.
Rather laborious efforts were made to purify the two
fragments after several purification attempts had failed.
But finally, the activity of the enzyme could be tested, as
mentioned above, by analysing degraded FITC labeled
heparan sulfate. Neither the 8 kDa fragment nor the 50
kDa polypeptide on their own showed cleavage activity
when being incubated with HS. But the reconstitution of
both subunits in crude lysates led to an active recombinant
human heparanase, which can now be exactly
characterised with regard to its biophysical properties.
For the further development of structure and
substrate specific inhibitors it is absolutely essential to
resolve the 3 dimensional structure of the active
heterodimer with and without ligands. As this project may
turn out to be time consuming regarding the size and the
difficult handling of the protein we will further support
this aim of structure determination by performing
biophysical techniques to study the molecular properties of
the human heparanase.
In addition we have performed a more theoretical
approach to mimic the possible structure of the human
heparanase in vivo, namely the molecular modeling.
BLAST (NCBI tools) searches with the full length amino
acid sequence of the human protein resulted in a few
significant sequences. The mouse-, rat- and chicken-
heparanase show high similarity to the human sequence.
Less similar to the query are two putative proteins from
Arabidopsis thaliana, with as yet unknown functions.
Some further proteins of glycosyl hydrolases from bacteria
have been found, but these similarities seem to be rather
unreliable.
Although secondary predictions (Hulett et al, 2000;
Nardella et al, 2004; and our findings) result in an
alternating "/! series, similar to the ("/!) TIM barrel
protein fold, “swiss-model”, or “SDSC1” - programmes on
the expasy homepage for protein structure homology
modeling - and some others could not design a three
dimensional structure of the human protein (“sorry, no
suitable template for modeling could be found”).
With the knowledge of the identified active residues
(E225 and E343) and putative basic amino acids near to these
sites we started to calculate a possible structure for the
human heparanase (Figure 4).
Figure 4. Molecular Model of the
human heparanase
Molecular modeling of the 50 kDa
subunit of the human heparanase
(amino acid residue 158 to 514)
without its putative transmembrane
domain. Functionally important
amino acids are indicated in green:
the two acitve sites Glu225 and Glu343,
positive loaded amino acids near to
the proton donor and acceptor, that
can bind heparan sulfate, Lys231,
Lys232 and Lys337, Lys338. Sectors of
basic amino acid residues from
Gln157 to Asn162 and Pro271 to Met278
may also interact in the substrate
binding towards the enzymatic active
site.
![Page 227: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/227.jpg)
Gene Therapy and Molecular Biology Vol 8, page 533
533
The model should facilitate and illustrate - together
with the biophysical characterisation - investigations on
intramolecular and molecular effects and interactions of
the human heparanase with its surrounding environment.
C. Future perspectivesEven if the three dimensional structure of the protein
heterodimer is established in the near future by X-ray
diffraction or NMR-methods, the biophysical techniques
particularly allow studying exactly the dynamics and
conformational effects of the human heparanase in context
with ligands. With the resulting findings it would be
possible to understand better the affinities and activities of
this enzyme in its immediate environment, to search for
natural compounds which inhibit more efficiently and to
design a specific, competitive heparanase-action-inhibitor
to establish a new promising cancer therapy.
AcknowledgmentsThis work was supported by OENB
Jubiläumsfondsprojekt No 10855 and by the Austrian
Science Fund project No P15969.
ReferencesBai X, Bame KJ, Habuchi H, Kimata K, and Esko JD (1997)
Turnover of heparan sulfate depends on 2-O-sulfation of
uronic acids. J Biol Chem 272, 23172-23179.
Baldwin GS, Curtain CC, and Sawyer WH (2001) Selective,
high-affinity binding of ferric ions by glycine-extended
gastrin(17). Biochemistry 40, 10741-10746.
Bame KJ (2001) Heparanases: endoglycosidases that degrade
heparan sulfate proteoglycans. Glycobiology 11, 91R-98R.
Bame KJ, Hassall A, Sanderson C, Venkatesan I, and Sun C
(1998) Partial purification of heparanase activities in chinese
hamster ovary cells: evidence for multiple intracellular
heparanases. Biochem J 336, 191-200.
Bar-Ner M, Eldor A, Wasserman L, Matzner Y, Cohen IR, Fuks
Z, and Vlodavsky I (1987) Inhibition of heparanase-mediated
degradation of extracellular matrix heparan sulfate by non-
anitcoagulant heparin species. Blood 70, 551-557.
Bartlett MR, Cowden WB, and Parish CR (1995) Differential
effects of the anti-inflammatory compounds heparin,
mannose-6-phosphate, and castanospermine on degradation
of the vascular basement membrane by leukocytes,
endothelial cells, and platelets. J Leukoc Biol 57, 207-213.
Bartlett MR, Underwood PA, and Parish CR (1995) Comparative
analysis of the ability of leucocytes, endothelial cells and
platelets to degrade the subendothelial basement membrane:
evidence for cytokine dependence and detection of a novel
sulfatase. Immunol Cell Biol 73, 113-124.
Baud S, Margeat E, Lumbroso S, Paris F, Sultan C, Royer C and
Poujol N (2002) Equilibrium binding assays reveal the
elevated stoichiometry and salt dependence of the interaction
between full-length human sex-determining region on the Y
chromosome (SRY) and DNA. J Biol Chem 277, 18404-
18410.
Bennet TA and Stetler-Stevenson WG (2001) Matrix
metalloproteinases (matrixins) and their inhibitors (TIMPs)
in angiogenesis. In: Tumor Angiogenesis and
Microcirculation. Ed by Emile E Voest and Patricia A
D`Amore. Marcel Dekker Inc. New York 2001, 29-58.
Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML,
Lincecum J, and Zako M (1999) Functions of cell surface
heparan sulfate proteoglycnas. Annu Rev Biochem 68, 729-
777.
Bitan M, Polliack A, Zecchina G, Nagler A, Friedmann Y,
Nadav L, Deutsch V, Pecker I, Eldor A, Vlodavsky I, Katz
BZ (2002) Heparanase expression in human leukemias is
restricted to acute myeloid leukemias. Exp Hematol 30, 34-
41
Buschmann I and Schaper W (1999) Arteriogenesis versus
Angiogenesis: Two mechanisms of vessel growth. News
Physiol Sci 14, 121-125.
Campbell JH, Rennick RE, Kalevitch SG, and Campbell GR
(1992) Heparan sulfate-degrading enzymes induce
modulation of smooth muscle phenotype. Exp Cell Res 200,
156-167.
Carmeliet P and Jain RK (2000) Angiogenesis in cancer and
other diseases. Nature 407, 249-257.
Chen G, Wang D, Vikramadithyan R, Yagyu H, Saxena U,
Pillarisetti S, and Goldberg IJ (2004) Inflammatory cytokines
and fatty acids regulate endothelial cell heparanase
expression. Biochemistry 43, 4971-4977.
Chen XP, Liu YB, Rui J, Peng SY, Peng CH, Zhou ZY, Shi LH,
Shen HW, and Xu B (2004) Heparanase mRNA expression
and point mutation in hepatocellular carcinoma. World J
Gastroenterol 10, 2795-2799.
Cleaver O and Melton DA (2003) Endothelial signaling during
development. Nat Med 9, 661-668.
Cochran S, Li C, Fairweather JK, Kett WC, Coombe DR, and
Ferro V (2003) Probing the interaction of
phosphosulfomannans with angiogenic growth factors by
surface plasmon resonance. J Med Chem 46, 4601-4608.
Dempsey LA, Brunn GJ, and Platt JL (2000) Heparanase, a
potential regulator of cell-matrix interactions. Trends
Biochem Sci 25, 349-351.
Dong J, Kukula AK, Toyoshima M, and Nakajima M (2000)
Genomic organization and chromosome localization of the
newly identified human heparanase gene. Gene 253, 171-
178.
Elkin M, Cohen I, Zcharia E, Orgel A, Guatta-Rangini Z, Peretz
T, Vlodavsky I, and Kleinman HK (2003) Regulation of
heparanase gene expression by estrogen in breast cancer.
Cancer Res 63, 8821-8826.
Elkin M, Ilan N, Ishai-Michaeli R, Friedmann Y, Papo O, Pecker
I, and Vlodavsky I (2001) Heparanase as mediator of
angiogenesis: mode of action. FASEB J 15, 1661-1663.
Esko JD and Lindahl U (2001) Molecular diversity of heparan
sulfate. J Clin Invest 108, 169-173.
Fairbanks MB, Mildner AM, Leone JW, Cavey GS, Mathews
WR, Drong RF, Slightom JL, Bienkowski MJ, Smith CW,
Bannow CA, and Heinrikson RL (1999) Processing of the
human heparanase precursor and evidence that the active
enzyme is a heterodimer. J Biol Chem 274, 29587-29590.
Falsone SF, Kurkela R, Charandini G, Vihko P, and Kungl AJ
(2001) Ligand affinity, homodimerization, and ligand-
induced secondary structural change of the human vitamin D
receptor. Biochem Biophys Res Commun 285, 1180-1185.
Falsone SF, Weichel M, Crameri R, Breitenbach M, and Kungl
AJ (2002) Unfolding and double-stranded DNA binding of
the cold shock protein homologue Cla h 8 from
Cladosporium herbarum. J Biol Chem 277, 16512-16516.
Folkman J (1995) Angiogenesis in cancer, vascular, rheumatoid
and other disease. Nat Med 1, 27-31.
Francis DJ, Parish CR, McGarry M, Santiago FS, Lowe HC,
Brown KJ, Bingley JA, Hayward IP, Cowden WB, Campbell
![Page 228: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/228.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
534
JH, Campbell GR, Chesterman CN, and Khachigian LM
(2003) Blockade of vascular smooth muscle cell proliferation
and intimal thickening after balloon injury by the sulfated
oligosaccharide PI-88. Phosphomannopentaose sulfate
directly binds FGF-2, blocks cellular signaling, and inhibits
proliferation. Circ Res 92, e70-e77.
Freeman C and Parish CR (1998) Human platelet heparanase:
purification, characterization and catalytic activity. Biochem
J 330, 1341-1350.
Friedmann Y, Vlodavsky I, Aingorn H, Aviv A, Peretz T, Pecker
I, and Pappo O (2000) Expression of heparanase in normal,
dysplastic, and neoplastic human colonic mucosa and stroma.
Evidence for its role in colonic tumorigenesis. Am J Pathol
157, 1167-1175.
Goger B, Halden Y, Rek A, Mösl R, Pye D, Gallagher J, and
Kungl AJ (2002) Different affinities of glycosaminoglycan
oligosaccharides for monomeric and dimeric interleukin-8: A
model for chemokine regulation at inflammatory sites.
Biochemistry 41, 1640-1646.
Gohji K, Okamoto M, Kitazawa S, Toyoshima M, Dong J,
Kasuoka Y, and Nakajima M (2001) Heparanase protein and
gene expression in bladder cancer. J Urol 166, 1286-1290.
Goldshmidt O, Zcharia E, Abramovitch R, Metzger S, Aingorn
H, Friedmann Y, Schirrmacher V, Mitrani E, and Vlodavsky
I (2002) Cell surface expression and secretion of heparanase
markedly promote tumor angiogenesis and metastasis. Proc
Natl Acad Sci 99, 10031-10036.
Goldshmidt O, Zcharia E, Aingorn H, Guatta-Rangini Z, Atzmon
R, Michal I, Pecker I, Mitrani E, and Vlodavsky I (2001)
Expression pattern and secretion of human and chicken
heparanase are determined by their signal peptide sequence.
J Biol Chem 276, 29178-29187.
Goldshmidt O, Zcharia Y, Cohen M, Aingorn H, Cohen I, Nadav
L, Katz BZ, Geiger B, and Vlodavsky I (2003) Heparanase
mediates cell adhesion independent of its enzymatic activity.
FASEB J 17, 1015-1025.
Gong F, Jemth P, Escobar Galvis ML, Vlodavsky I, Horner A,
Lindahl U, and Li JP (2003) Processing of macromolecular
heparin by heparanase. J Biol Chem 278, 35152-35158.
Graham LD (1994) Tumor rejection antigens of the hsp90 family
(GP96) closely resemble tumour-associated heparanase
enzymes. Biochem J 301, 917-918.
Guimond S, Maccarana M, Olwin BB, Lindahl U, and Rapraeger
AC (1993) Activating and inhibitory heparin sequences for
FGF-2 (basic FGF). Distinct requirements for FGF-1, FGF-2,
and FGF-4. J Biol Chem 268, 23906-23914.
Hamaguchi T, Sudo T, and Osada H (1995) RK-682, a potent
inhibitor of tyrosine phosphatase, arrested the mammalian
cell cycle progression of G1phase. FEBS Lett 372, 54-58.
Harley MJ, Toptygin D, Troxler T, and Schildbach JF (2002)
R150A mutant of F TraI relaxase domain: reduced affinity
and specificity for single-stranded DNA and altered
fluorescence anisotropy of a bound labeled oligonucleotide.
Biochemistry 41, 6460-6468.
Hirai K, Ooi H, Esumi T, Iwabuchi Y, and Hatakeyama S (2003)
Total synthesis of (+/-)-trachyspic acid and determination of
the relative configuration. Org lett 5, 857-859.
Hoogewerf AJ, Leone JW, Reardon IM, Howe WJ, Asa D,
Heinrikson RL and Ledbetter SR (1995) CXC chemokines
connective tissue activating peptide-III and neutrophil
activating peptide-2 are heparin/heparan sulfate-degrading
enzymes. J Biol Chem 270, 3268-3277.
Hulett MD, Freeman C, Hamdorf BJ, Baker RT, Harris MJ, and
Parish CR (1999) Cloning of mammalian heparanase, an
important enzyme in tumor invasion and metastasis. Nat
Med 5, 803-809.
Hulett MD, Hornby JR, Ohms SJ, Zuegg J, Freeman C, Gready
JE, and Parish CR (2000) Identification of active-site
residues of the pro-metastatic endoglycosidase heparanase.
Biochemistry 39, 15659-15667.
Ikeguchi M, Hirooka Y, and Kaibara N (2003) Heparanase gene
expression and its correlation with spontaneous apoptosis in
hepatocytes of cirrhotic liver and carcinoma. Eur J Cancer
39, 86-90.
Ikuta M, Podyma KA, Maruyama K, Enomoto S, and
Yanagishita M (2001) Expression of heparanase in oral
cancer cell lines and oral cancer tissues. Oral Oncol 37, 177-
184.
Iozzo RV (1998) Matrix proteoglycans: from molecular design to
cellular function. Annu Rev Biochem 67, 609-652.
Iozzo RV and San Antonio JD (2001) Heparan sulfate
proteoglycans: heavy hitters in the angiogenesis arena. J
Clin Invest 108, 349-355.
Ishida K, Teruya T, Simizu S, and Osada H (2004) Exploitation
of heparanase inhibitors from microbial metabolites using an
efficient visual screening system. J Antiobiot 57, 136-142.
Jain RK (2003) Molecular regulation of vessel maturation. Nat
Med 9, 685-693.
Kalluri R (2003) Basement membranes: structure, assembly and
role in tumour angiogenesis. Nat Rev Cancer 3, 422-433.
Katz A, Van-Dijk DJ, Aingorn H, Erman A, Davies M, Darmon
D, Hurvitz H, and Vlodavsky I (2002) Involvement of human
heparanase in the pathogenesis of diabetic nephropathy. Isr
Med Assoc J 4, 996-1002.
Kelly SM and Price NC (1997) The application of circular
dichroism to studies of protein folding and unfolding.
Biochim Biophys Acta 1338, 161-185.
Kelly T, Miao HQ, Yang Y, Navarro E, Kussie P, Huang Y,
MacLeod V, Casciano J, Joseph L, Zhan F, Zangari M,
Barlogie B, Shaughnessy J, and Sanderson RD (2003) High
heparanase activity in multiple myeloma is associated with
elevated microvessel density. Cancer Res 63, 8749-8756.
Kim AW, Xu X, Hollinger EF, Gattuso P, Godellas CV, and
Prinz RA (2002) Human heparanse-1 gene expression in
pancreatic andenocarcinoma. J Gastrointest Surg 6, 167-
172.
Kizaki K, Yamada O, Nakano H, Takahashi T, Yamauchi N,
Imai K, and Hashizume K (2003) Cloning and localization of
heparanase in bovine placenta. Placenta 24, 424-430.
Kjellen L and Lindahl U (1991) Proteoglycans: structures and
interactions. Annu Rev Biochem 60, 443-475.
Koliopanos A, Friess H, Kleeff J, Shi X, Liao Q, Pecker I,
Vlodavsky I, Zimmermann A, and Buchler MW (2001)
Heparanase expression in primary and metastatic pancreatic
cancer. Cancer Res 61, 4655-4659.
Kristl S, Zhao S, Knappe B, Sommerville RL, and Kungl AJ
(2000) The influence of ATP on binding of aromatic amino
acids to the ligand response domain of the tyrosine repressor
of Haemophilus influenzae. FEBS Lett 467, 87-90.
Kussie PH, Hulmes JD, Ludwig DL, Patel S, Navarro EC,
Seddon AP, Giorgio NA, and Bohlen P (1999) Cloning and
functional expression of a human heparanase gene. Biochem
Biophys Res Comm 261, 183-187.
Lapierre F, Holme K, Lam L, Tressler RJ, Storm N, Wee J, Stack
RJ, Castellot J, and Tyrrell DJ (1996) Chemical
modifications of heparin that diminish its anticoagulant but
preserve its heparanase-inhibitory, angiostatic, anti-tumor
and anit-metastatic properties. Glycobiology 6, 355-366.
![Page 229: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/229.jpg)
Gene Therapy and Molecular Biology Vol 8, page 535
535
LeTilly V and Royer CA (1993) Fluorescence anisotropy assays
implicate protein-protein interactions in regulating trp
repressor DNA binding. Biochemistry 32, 7753-7758.
Levidiotis V, Kanellis J, Ierino FL, and Power DA (2001)
Increased expression of heparanase in puromycin
aminonucleoside nephrosis. Kidney Int 60, 1287-1296.
Levy-Adam F, Miao HQ, Heinrikson RL, Vlodavsky I, and Ilan
N (2003) Heterodimer formation is essential for heparanase
enzymatic activity. Biochem Biophys Res Commun 308,
885-891.
Lin X, Wei G, Shi Z, Dryer L, Esko JD, Wells DE, and Matzuk
MM (2000) Disruption of gastrulation and heparan sulfate
biosynthesis in EXT1-deficient mice. Dev Biol 224, 299-311.
Linhardt RJ, Galliher PM, and Cooney CL (1986) Polysaccharide
lyases. Appl Biochem Biotechnol 12, 135-176.
Liotta LA, Steeg PS, and Stetler-Stevenson WG (1991) Cancer
metastasis and angiogenesis: an imbalance of positive and
negative regulation. Cell 64, 327-336.
Lopez MM, Yutani K, and Makhatadze GI (2001) Interactions of
the cold shock protein CspB from Bacillus subtilis with
single-stranded DNA. Importance of the T base content and
position within the template. J Biol Chem 276, 15511-
15518.
Lusti-Narasimhan M, Chollet A, Power CA, Allet B, Proudfoot
AE, and Well TN (1996) A molecular switch of chemokine
receptor selectivity. Chemical modification of the
interleukin-8 Leu25 –> Cys mutant. J Biol Chem 271, 3148-
3153.
Lyon M and Gallagher JT (1998) Bio-specific sequences and
domains in heparan sulphate and the regulation of cell
growth and adhesion. Matrix Biol 17, 485-493.
Manavalan P and Johnson WC Jr (1987) Variable selction
method improves the prediction of protein secondary
structure from circular dichroism spectra. Anal Biochem
167, 76-85.
Marchetti D and Nicolson GL (2001) Human heparanse: a
molecular determinant of brain metastasis. Adv Enzyme
Regul 41, 343-359.
Maxhimer JB, Quiros RM, Stewart R, Dowlatshahi K, Gattuso P,
Fan M, Prinz RA, and Xu X (2002) Heparanase-1 expression
is associated with metastatic potential of breast cancer.
Surgery 132, 326-333.
McKenzie E, Tyson K, Stamps A, Smith P, Turner P, Barry R,
Hircock M, Patel S, Barry E, Stubberfield C, Terrett J, and
Page M (2000) Cloning and expression profiling of Hpa2, a
novel mammalian heparanase family member. Biochem
Biophys Res Commun 276, 1170-1177.
McKenzie E, Young K, Hircock M, Bennett J, Bhaman M, Felix
R, Turner P, Stamps A, McMillan D, Saville G, Ng S, Mason
S, Snell D, Schofield D, Gong H, Townsend R, Gallagher JT,
Page M, Parekh R, and Stubberfield C (2003) Biochemical
characterization of the active heterodimer form of human
heparanase (Hpa1) protein expressed in insect cells.
Biochem J 373, 423-435.
Mecham RP (1998) Overview of extracellular matrix. Current
Protocols in Cell Biology. John Wiley & Sons, Inc, 10.1.1-
10.1.14.
Miao HQ, Elkin M, Aingorn E, Ishai-Michaeli R, Stein CA, and
Vlodavsky I (1999) Inhibition of heparanase activity and
tumor metastasis by laminarin sulfate and synthetic
phosphorothioate oligodeoxynucleotides. Int J Cancer 83,
424-431.
Miao HQ, Navarro E, Patel S, Sargent D, Koo H, Wan H, Plata
A, Zhou Q, Ludwig D, Bohlen P, and Kussie P (2002)
Cloning, expression, and purification of mouse heparanase.
Protein Expr Purif 26, 425-431.
Mikami S, Ohashi K, Usui Y, Nemoto T, Katsube K, Yanagishita
M, Nakajima M, Nakamura K, and Koike M (2001) Loss of
syndecan-1 and increased expression of heparanase in
invasive esophageal carcinomas. Jpn J Cancer Res 92,
1062-1073.
Mollinedo F, Najajima M, Llorens A, Barbosa E, Callejo S,
Gajate C, and Fabra A (1997) Major co-localization of the
extracellular-matrix degradative enzymes heparanase and
gelatinase in tertiary granules of human neutrophils.
Biochem J 327, 917-923.
Nakajima M, DeChavigny A, Johnson CE, Hamada J, Stein CA,
and Nicolson GL (1991) Suramin. A potent inhibitor of
melanoma heparanase and invasion. J Biol Chem 266, 9661-
9666.
Nakajima M, Irimura T, and Nicolson GL (1988) Heparanases
and tumor metastasis. J Cell Biochem 36, 157-167.
Naparstek Y, Cohen IR, Fuks Z, and Vlodavsky I (1984)
Activated T lymphocytes produce a matrix-degrading
heparan sulphate endoglycosidase. Nature 310, 241-244.
Nardella C, Lahm A, Pallaoro M, Brunetti M, Vannini A, and
Steinkuhler C (2004) Mechanism of activation of human
heparanase investigated by protein engineering.
Biochemistry 43, 1862-1873.
Nicosia RF and Madri JA (1987) The microvascular extracellular
matrix. Developmental changes during angiogenesis in the
aortic ringplasma clot model. Am J Pathol 128, 78-90.
Nikov GN, Eshete M, Rajnarayanan RV, and Alworth WL
(2001) Interactions of synthetic estrogens with human
estrogen receptor. J Endocrinol 170, 137-145.
Okada Y, Yamada S, Toyoshima M, Dong J, Nakajima M, and
Sugahara K (2002) Structural recognition by recombinant
human heparanase that plays critical roles in tumor
metastasis. Hierarchical sulfate groups with differential
effects and the essential target disulfated trisaccharide
sequence. J Biol Chem 277, 42488-42495.
Oosta GM, Favreau LV, Beeler DL, and Rosenberg RD (1982)
Purification and properties of human platelet heparitinase. J
Biol Chem 257, 11249-11255.
Parish CR, Coombe DR, Jakobsen KB, Bennett FA, and
Underwood PA (1987) Evidence that sulphated
polysaccharides inhibit tumour metastasis by blocking
tumour-cell-derived heparanases. Int J Cancer 40, 511-518.
Parish CR, Freeman C, and Hulett MD (2001) Heparanase: a key
enzyme involved in cell invasion. Biochim Biophys Acta
1471, M99-M108.
Parish CR, Freeman C, Brown KJ, Francis DJ, and Cowden WB
(1999) Identification of sulfated oligosaccharide-based
inhibitors of tumor growth and metastasis using novel in
vitro assays for angiogenesis and heparanase activity.
Cancer Res 59, 3433-3441.
Parish CR, Hindmarsh EJ, Bartlett MR, Staykova MA, Cowden
WB, and Willenborg DO (1998) Treatment of central
nervous system inflammation with inhibitors of basement
membrane degradation. Immunol Cell Biol 76, 104-113.
Parker GJ, Law TL, Lenoch FJ, and Bolger RE (2000)
Development of high throughput screening assays using
fluorescence polarization: nuclear receptor-ligand-binding
and kinase/phosphatase assays. J Biomol Screen 5, 77-88.
Perczel A, Park K, and Fasman GD (1992) Analysis of the
circular dichroism spectrum of proteins using convex
constraint algorithm: a practical guide. Anal Biochem 203;
83-93.
![Page 230: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/230.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
536
Pikas DS, Li JP, Vlodavsky I, and Lindahl U (1998) Substrate
specificity of heparanases from human hepatoma and
platelets. J Biol Chem 273, 18770-18777.
Podyma-Inoue KA, Yokote H, Sakaguchi K, Ikuta M, and
Yanagishita M (2002) Characterization of heparanase from a
rat parathyroid cell line. J Biol Chem 277, 32459-32465.
Ray JM and Stetler-Stevenson WG (1994) The role of matrix
metalloproteinases and their inhibitors in tumor invasion,
metastasis and angiogensis. Eur Respir J 7, 2062-2072.
Reiland J, Sanderson RD, Waguespack M, Barker SA, Long R,
Carson DD, and Marchetti D (2004) Heparanase degrades
syndecan-1 and perlecan heparan sulfate: functional
implications for tumor cell invasion. J Biol Chem 279,
8047-8055.
Rek A, Geretti E, Goger B, and Kungl A (2002) The biophysics
of chemokine/glycosaminoglycan interactions. Res Devel
Biophys Biochem 2, 319-340.
Rohloff J, Zinke J, Schoppmeyer K, Tannapfel A, Witzigmann
H, Mossner J, Wittekind C, and Caca K (2002) Heparanase
expression is a prognostic indicator for postoperative
survival in pancreatic adenocarcinoma. Br J Cancer 86,
1270-1275.
Saijo M, Kitazawa R, Nakajima M, Kurosaka M, Maeda S, and
Kitazawa S (2003) Heparanase mRNA expression during
fracture repair in mice. Histochem Cell Biol 120, 493-503.
Sanderson RD (2001) Heparan sulfate proteoglycans in invasion
and metastasis. Semin Cell Dev Biol 12, 89-98.
Sanderson RD, Yang Y, Suva LJ, Kelly T (2004) Heparan
sulfate proteoglycans and heparanase--partners in osteolytic
tumor growth and metastasis. Matrix Biol 23, 341-52
Sasisekharan R and Venkataraman G (2000) Heparin and
heparan sulfate: biosynthesis, structure and function. Curr
Opin Chem Biol 4, 626-631.
Sasisekharan R, Shriver Z, Venkataraman G, and Narayanasami
U (2002) Roles of heparan-sulphate glycosaminoglycans in
cancer. Nat Rev Cancer 2, 521-528.
Seftor RE, Seftor EA, Gehlsen KR, Stetler-Stevenson WG,
Brown PD, Ruoslahti E, and Hendrix MJ (1992) Role of the
" v ! 3 integrin in human melanoma cell invasion. Proc Natl
Acad Sci USA 89, 1557-1561.
Selleck SB (1999) Overgrowth syndromes and the regulation of
signaling complexes by proteoglycans. Am J Hum Genet
64, 372-377.
Sharma B, Handler M, Eichstetter I, Whitelock JM, Nugent MA,
and Iozzo RV (1998) Antisense targeting of perlecan blocks
tumor growth and angiogenesis in vivo. J Clin Invest 102,
1599-1608.
Shiozawa H, Takahashi M, Takatsu T, Kinoshita T, Tanzawa K,
Hosoya T, Furuya K, Takahashi S, Furihata K, and Seto H
(1995) Trachyspic acid, a new metabolite produced by
Talaromyces trachyspermus, that inhibits tumor cell
heparanase: taxonomy of the producing strain, fermentation,
isolation, structural elucidation, and biological activity. J
Antibiot (Tokyo) 48, 357-362.
Simizu S, Ishida K, Wierzba M, and Osada H (2004) Secretion of
heparanase protein is regulated by glycosylation in human
tumor cell lines. J Biol Chem 279, 2697-2703.
Simizu S, Ishida K, Wierzba MK, Sato TA, and Osada H (2003)
Expression of heparanase in human tumor cell lines and
human head and neck tumors. Cancer Lett 193, 83-89.
Sreerama N and Woody RW (1994) Protein secondary structure
form circular dichorism spectroscopy. Combining variable
selection principle and cluster analysis with neural network,
ridge regression and self-consistent methods. J Mol Biol
242, 497-507.
Stetler-Stevenson WG, Liotta LA, and Kleiner DE Jr (1993)
Extracellular Matrix 6: role of matrix metalloproteinases in
tumor invasion and metastasis. FASEB J 7, 1434-1441.
Takaoka M, Naomoto Y, Ohkawa T, Uetsuka H, Shirakawa Y,
Uno T, Fujiwara T, Gunduz M, Nagatsuka H, Nakajjima M,
Tanaka N, and Haisa M (2003) Heparanase expression
correlates with invasion and poor prognosis in gastric
cancers. Lab Invest 83, 613-622.
Tang W, Nakamura Y, Tsujimoto M, Sato M, Wang X,
Kurozumi K, Nakahara M, Nakao K, Nakamura M, Mori I,
and Kakudo K (2002) Heparanase: a key enzyme in invasion
and metastasis of gastric carcinoma. Mod Pathol 15, 593-
598.
Thompson LD, Pantoliano MW, and Springer BA (1994)
Energetic characterization of the basic fibroblast growth
factor-heparin interaction: identification of the heparin
binding domain. Biochemistry 33, 3831-3840.
Toyoshima M and Nakajima M (1999) Human heparanase.
Purification, characterization, cloning, and expression. J Biol
Chem 274, 24153- 24160.
Tsuchida S, Podyma-Inoue KA and Yanagishita M (2004)
Ultrafiltration-based assay for heparanase activity. Anal
Biochem 331, 147-152.
Tudan C, Willick GE, Chahal S, Arab L, Law P, Salari H, and
Merzouk A (2002) C-terminal cyclization of an SDF-1 small
peptide analogue dramatically increases receptor affinity and
activation of the CXCR4 receptor. J Med Chem 45, 2024-
2031.
Tumova S, Woods A, and Couchmann JR (2000) Heparan sulfate
proteoglycans on the cell surface: versatile coordinators of
cellular functions. Int J Biochem Cell Biol 32, 269-288.
Turnbull J, Powell A, and Guimond S (2001) Heparan sulfate:
decoding a dynamic multifunctional cell regulator. Trends
Cell Biol 11, 75-82.
Vlodavsky I and Friedmann Y (2001) Molecular properties and
involvement of heparanase in cancer metastasis and
angiogenesis. J Clin Invest 108, 341-347.
Vlodavsky I, Eldor A, Haimovitz-Friedman A, Matzner Y, Ishai-
Michaeli R, Lider O, Naparstek Y, Cohen IR, and Fuks Z
(1992) Expression of heparanase by platelets and circulating
cells of the immune systeme: possible involvement in
diapedesis and extravasation. Invasion Metastasis 12, 112-
127.
Vlodavsky I, Friedmann Y, Elkin M, Aingorn H, Atzmon R,
Ishai-Michaeli R, Bitan M, Pappo O, Peretz T, Michal L,
Spector L, and Pecker I (1999) Mammalian heparanase: gene
cloning, expression and function in tumor progression and
metastasis. Nature Medicine 5, 793-802.
Vlodavsky I, Goldshmidt O, Zcharia E, Atzmon R, Rangini-
Guatta Z, Elkin M, Peretz T, and Friedmann Y (2002)
Mammalian heparanase: involvement in cancer metastasis,
angiogenesis and normal development. Semin Cancer Biol
12, 121-129.
Vlodavsky I, Goldshmidt O, Zcharia E, Metzger S, Chajek-Shaul
T, Atzmon R, Guatta-Rangini Z, and Friedmann Y (2001)
Molecular properties and involvement of heparanase in
cancer progression and normal development. Biochimie 83,
831-839.
Vlodavsky I, Moshen M, Lider O, Svahn CM, Ekre HP, Vigoda
M, Ishai-Michaeli R, and Peretz T (1994) Inhibition of tumor
metastasis by heparanase inhibiting species of heparin.
Invasion Metastasis 14, 290-302.
Walker A and Gallagher JT (1996) Structural domains of
heparan sulphate for specific recognition of the C-terminal
![Page 231: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/231.jpg)
Gene Therapy and Molecular Biology Vol 8, page 537
537
heparin-binding domain of human plasma fibronectin
(HEPII). Biochem J 317, 871-877.
Watanabe M, Aoki Y, Kase H, and Tanaka K (2003) Heparanase
expression and angiogenesis in endometrial cancer. Gynecol
Obstet Invest 56, 77-82.
Weinstein T, Cameron R, Katz A, and Silverman M (1992) Rat
glomerular epithelial cells in culture express characteristics
of parietal, not visceral, epithelium. J Am Soc Nephrol 3,
1279-1287.
Yang YJ, Zhang YL, Li X, Dan HL, Lai ZS, Wang JD, Wang
QY, Cui HH, Sun Y, and Wang YD (2003) Contribution of
eIF-4E inhibition to the expression and activity of heparanase
in human colon adenocarcinoma cell line: LS-174T. World J
Gastroenterol 9, 1707-1712.
Yano K, Brown LF, and Detmar M (2001) Control of hair
growth and follicle size by VEGF-mediated angiogenesis. J
Clin Invest 81, 409-417.
Zcharia E, Metzger S, Chajek-Shaul T, Aingorn H, Elkin M,
Friedmann Y, Weinstein T, Li JP, Lindahl U, and Vlodavsky
I (2004) Transgenic expression of mammalian heparanase
uncovers physiological functions of heparan sulfate in tissue
morphogenesis, vascularization, and feeding behavior.
FASEB J 18, 252-263.
Zcharia E, Metzger S, Chajek-Shaul T, Friedmann Y, Pappo O,
Aviv A, Elkin M, Pecker I, Peretz T, and Vlodavsky I (2001)
Molecular properties and involvement of heparanase in
cancer progression and mammary gland morphogenesis. J
Mammary Gland Biol Neoplasia 6, 311-322.
Zetser A, Bashenko Y, Miao HQ, Vlodavsky I, and Ilan N (2003)
Heparanase affects adhesive and tumorigenic potential of
human glioma cells. Cancer Res 63, 7733-7741.
![Page 232: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/232.jpg)
Rajkovic et al: Molecular insight into human heparanase and tumour progression
538
![Page 233: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/233.jpg)
Gene Therapy and Molecular Biology Vol 8, page 539
539
Gene Ther Mol Biol Vol 8, 539-546, 2004
Two dimensional gel electrophoresis analyses of
human plasma proteins. Association of retinol
binding protein and transthyretin expression with
breast cancerResearch Article
Karim Chahed1,2, Bechr Hamrita1, Hafedh Mejdoub3, Sami Remadi1,4, Anouar
Chaïeb5 and Lotfi Chouchane1,*1Laboratoire d’Immuno-Oncologie Moléculaire, Faculté de Médecine de Monastir, Tunisia2Institut supérieur de Biotechnologie de Monastir, Tunisia3Faculté des Sciences de Sfax, Tunisia4Laboratoire Cytopath, Sousse, Tunisia5Service d’Obstétrique et des maladies féminines, Hôpital Universitaire Farhat Hached, Sousse Tunisia.
__________________________________________________________________________________*Correspondence: Prof. Lotfi Chouchane, Laboratoire d’Immuno-oncologie Moléculaire, Faculté de Médecine de Monastir, 5019
Monastir, Tunisie; Tel: 216-73-462-200; Fax: 216-73-460-737; e-mail: [email protected]
Key words: Two dimensional gel electrophoresis. Breast cancer. Acute phase proteins.
Abbreviations: carcinoembryonic antigen, (CEA); cellular retinol, (CRBP); isoelectrofocalisation, (IEF); National Center for
Biotechnology Information, (NCBI); prostate specific antigen, (PSA); retinoic acid, (RA); retinol binding protein, (RBP); Serum
amyloid P, (SAP); transthyretin, (TTR)
This work was supported by le Ministère de la Recherche Scientifique et de Technologie, le Ministère de l’Enseignement
Supérieur and le Ministère de la Santé Publique de la République Tunisienne.
Received: 10 December 2004; Revised: 11 January 2005
Accepted: 17 January 2005; electronically published: March 2005
Summary
The identification of markers for either early diagnosis, treatment response or for survival of breast cancer is of
critical importance. The plasma carries an archive of important histological information whose determination may
help to improve early disease detection. Using two dimensional gel electrophoresis and protein sequencing we
investigated the changes in protein expression profiles derived from analysis of plasma from healthy Tunisian
women and patients with breast carcinoma. We have found an association between retinol binding protein,
transthyretin expression and breast cancer. The levels of acute phase proteins known to accompany both acute and
chronic inflammatory disorders comprising haptoglobin, serum amyloid P, apolipoprotein A1, !1-antitrypsin and
!1-acidic glycoprotein were also intimately associated with this neoplastic disease.
I. IntroductionBreast cancer is the most frequent malignancy among
women representing a major health problem in many
countries. Considering the cellular complexity and the
dynamic structures of mammary tumors breast cancer is
mainly classified according to the cellular origin of the
cancer cells and on the evolution of the disease
(Hondermarck, 2003). Current methods used to detect
breast tumors are based on mammography. It is a widely
used and clinically screening method that is effective in
detecting early stage breast cancer before clinical
symptoms appear (Brenner, 2002). However, since a
tumor should be at least a few millimeters in size, it is
already late when breast cancer is detected. So, there is a
considerable need for the identification of useful
pathological markers that can help not only in early
detection but also for typing and treatment.
It is well established that changes that occur in
disease versus normal tissues at either the gene (genomic)
or protein (proteomic) level are regarded as an appropriate
way to identify markers of pathologies that could be
correlated with drug response and patient survival.
![Page 234: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/234.jpg)
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
540
Proteomics with the recent advances in mass spectrometry
has brought with it the hope of discovering novel
biomarkers that could be used to diagnose diseases.
Probably, the most widely used proteomic technology is
the identification of alterations in protein expression
between two samples through comparative 2-DE (Conrads
et al, 2003). In such investigation a biomarker is defined
as a protein having more or less intensity on one gel
compared with the other and should be particularly
associated with the disease.
The search for biomarkers and specific alterations
using proteomic methods largely focus upon plasma or
serum (Anderson and Anderson, 1977; Hoogland et al,
1999). These biological fluids are clinically relevant since
they could be obtained in sufficient quantities from
patients. It is well known that during necrosis and
apoptosis content of cells could be released into the
plasma. In addition, plasma may contain proteins or
peptides that are aberrantly shed or secreted from cells in
response to a disease (Adkins et al, 2002). It might be
expected that the presence of a disease could be
determined by measuring the altered presence or
abundance of the constituant molecular species and
reinforces the benefits of using a 2-DE approach for
identifying biomarkers for disease states (Wrotnowski,
1998).
Blood plasma like cells contains many high abundant
proteins. The major constituents include albumine,
haptoglobin, immunoglobulins, transferrin, lipoproteins,
fibrinogene B and fibrinogene ". Other very low abundant
proteins are commonly present in plasma (Wrotnowski,
1998; Anderson and Anderson, 2002). They represent the
low molecular weight plasma proteome and could be
generated from larger proteins by proteolysis within the
circulatory system or in the environment of the tumors.
Searching for human plasma alterations using 2-DE
with regard to neoplastic disease has been extensively
investigated. As early as 1974, 2-DE was carried to look
for differences between protein patterns of individuals
suffering cancer (Wright, 1974). Since, several markers
were characterized and are currently used for diagnosis.
As an example, increased levels of molecular markers
such as prostate specific antigen (PSA) and CA 125 are
now routinely used for the detection of cancer in the
prostate and ovary respectively (Charrier et al, 2001;
Petricoin et al, 2002). Other markers are effective for
diagnosing primary or advanced neoplastic diseases. The
carcinoembryonic antigen (CEA) is used for detecting
colorectal cancer, Her2/neu, CA 15-3 and CA 27-29 for
advanced breast cancer (Diamandis, 1996; Buzdor and
Hortobagy, 1999). Kallikreins, a family of secreted serine
proteases were highly associated with ovarian carcinoma
as well as with breast and prostate cancers (Yousef and
Diamandis, 2001).
The plasma carries an archive of important
histological information whose determination could help
to improve early disease detection. In the present study, by
using 2-DE investigations of human plasma proteins we
have found an association between the levels of retinol
binding protein (RBP), transthyretin (TTR) and breast
carcinoma among Tunisian women.
II. Materials and methodsA. Patients and controlsPlasma samples were collected from six untreated patients
diagnosed with infiltrating breast ductal carcinoma. Control
subjects (16) were healthy blood donors having no evidence of
any personal or family history of cancer (or other serious illness).
Controls and patients were selected from the same population
living in the middle coast of Tunisia. All the samples were
collected with informed consent according to protocols approved
by the institutional review boards of the respective hospitals.
Plasma samples were stored at -80°C before analysis.
B. Two dimensional gel electrophoresis and
evaluation of 2D data
1. Isoelectrofocalisation of proteins (first
dimension) and SDS-PAGETo the plasma, four volumes of cold acetone (-20°C) were
added and the solution was incubated for 1 Hour at -20°C. The
pellet was washed with cold acetone (80%), dried under partial
vacuum and solubilised in 7.0 M urea, 2.0 M Thiourea, 4% (w/v)
CHAPS, 0,5% w/v DTT and 2% ampholytes (1 part pH 3/10, 1
part pH 5/7, 2parts pH 6/8). Acetone precipitation led to a better
resolution of abundant plasma proteins, but there has been
significant loss in lower molecular weight proteins. Protein
contents were determined according to the procedure described
by Bradford (Bradford, 1976) and modified by Ramagli and
Rodriguez (Ramagli and Rodriguez, 1985). Bovine serum
albumin (Fraction V, Sigma) was used as a standard. Analytical
2D-PAGE was carried out in a Bio-Rad system (Miniprotean II).
Equal amounts of proteins issued from control or breast cancer
samples were subjected simultaneously to isoelectrofocalisation
(IEF) and SDS-PAGE analysis. Extraction of proteins,
solubilisation, IEF, SDS-PAGE and staining were carried under
very similar conditions for the different samples. Each
experiment was repeated for at least three times. Focused strips
were equilibrated in SDS equilibration buffer and were then
loaded onto SDS gel slabs for separation in the second dimension
(Laemmli, 1970).
2. Gel stainingAfter separation in SDS-PAGE gels, the proteins were
visualised by a sensitive colloidal coomassie G-250 stain
(Neuhoff et al, 1985). The dye solution contained 17% (w/v)
ammonium sulfate, 3% (v/v) phosphoric acid, 0,1% (w/v)
coomassie G250 and 34% (v/v) methanol. The staining solution
was changed once after 12 hours staining and the gel slabs
subjected to a 24 hours cycle for increasing dye deposition on
low abundance proteins. The detection was then increased by
placing the gel into 1% v/v acetic acid for producing a better
contrast between spots and gel. Silver staining was done
according to Oakley et al, (1980). All coomassie and
silver–stained gels were scanned into adobe photoshop 6.0.
Alterations in protein levels defined as clear differences in size
and/or density of the protein spot on the gel were confirmed
through differential analyses using melanie 3.0 software tools.
Comparison of the 2D patterns with published human plasma
protein 2D-PAGEs of the Swiss-2DPAGE database (Sanchez et
al, 1995) allowed characterization of the indicated plasma
proteins.
3. N-terminal amino acid sequencingAs the experimental and theoretical positions of a protein
may differ significantly, the identity of proteins of interest was
confirmed by sequencing. Plasma proteins (500 µg) were
![Page 235: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/235.jpg)
Gene Therapy and Molecular Biology Vol 8, page 541
541
fractionated on 12 cm IEF rod gels (1.5 mm diameter) at 300
volts for 1 hour, 450 volts for 2 hours and 650 volts for 15 hours.
SDS-PAGE was performed under constant current intensity (35
mA/gel). Following electrophoresis, proteins were electroblotted
on Immobilon P using a semi-dry blotter system (Millipore) and
stained with coomassie blue according to the manufacturer’s
instructions. Spots on Immobilon membranes, corresponding to
polypeptides of interest were collected ans subjected to Edman
degradation using an applied biosystem modele (Procise). Amino
acid sequence analysis and data base search were performed at
the National Center for Biotechnology Information (NCBI) and
comparison with the Swiss Prot data bases.
III. Results and DiscussionPlasma proteomic analysis of six malignant breast
cancer samples and 16 samples from human healthy
donors were compared by high resolution two dimensional
gel electrophoresis. Several proteins were up-regulated in
all of the breast cancer samples compared to that of
healthy controls. The majority of the protein
identifications appeared to represent differences in overall
abundance. 2-DE investigations showed elevated levels of
acute phase proteins such as haptoglobin (#-chain), serum
amyloid P, !1-antitrypsin, !1-antichymotrypsin and !1-
acidic glycoprotein in plasma from patients diagnosed
with breast cancer (Figure 1). Two other proteins, highly
elevated in cancer plasma, were identified as RBP and
TTR.
The first group of proteins designed as positive acute
phase proteins is known to accompany both acute and
chronic inflammatory disorders (Doherty et al, 1998).
During tumoral growth, acute phase proteins have also
been described to accumulate at high levels and could be
used to distinguish tumor type and prognosis (Negishi et
al, 1987; Schmid et al, 1995; Alaiya et al, 2000). This is
well described for prostate cancer where the association of
antichymotrypsin and PSA is well investigated to help in
the differential diagnosis of prostate cancer from benign
prostate hyperplasia (Charrier et al, 2001). In a recent
study, Cho W C et al, (2004) identified serum amyloid A
as a serum biomarker that could be useful in the diagnosis
of relapse in nasopharyngeal cancer.
As our investigation, several studies have examined
aspects of the acute phase response in which many high
abundant plasma proteins increase or decrease following a
range of inflammatory insults or cancer (Bini et al, 1992).
In acute inflammatory responses and in rheumatoid
arthritis, differences in the levels of 19 acute phase
proteins were reported to be affected. These studies, based
on quantitative serum analysis, showed that high abundant
acute phase–related proteins could be good prognostic
markers of inflammation (Doherty et al, 1998). Gianazza
and co-workers (Miller et al, 1999, Eberini et al, 2000)
identified, using 2-DE, 34 proteins with human
homologues showing changes in protein abundance and
were associated with inflammatory diseases. Several other
2-DE studies have examined aspects of the acute phase
response following an inflammatory insult. Changes in
haptoglobin levels were reported in duchenne muscular
dystrophy (John and Purdom, 1989), human gonadotropin
isoforms in patients with trophoblastic tumors (Hoemann
et al, 1993) and ApoA-1 during parturition (Del Piore et
al, 1991) and heart disease (Cassler et al, 1992). The levels
of other acute phase proteins such as serum amyloid A
were altered after a severe head injury (Choukaite et al,
1989) or viral infections (Bini et al, 1996). By comparative
proteome analysis, Vejda et al (2002) found elevated
levels of degradation products of antiplasmin and laminin
"-chain in cancer samples. They also found significantly
elevated levels of the acute phase proteins !1-acidic
glycoprotein, !1-antitrypsin, !1-antichymotrypsin and
haptoglobin. The !1-antitrypsin and laminin "-chain were
described as being anti-apoptotic factors (Yoshida et al,
2001; Vejda et al, 2002). Kuhajda et al, (1989) reported
that haptoglobins could be associated with phenotypically
aggressive neoplasia and serve as mediators of some
malignant processes in breast cancer. They were also
found to stimulate collagen synthesis in fibroblasts from
cancerous body fluids (Viellard et al, 1974). Detection and
quantification of haptoglobins could also be a useful
diagnostic procedure in cancer. A recent study of
haptoglobin polymorphism in breast cancer patients
demonstrates that haptoglobin 1 and 2 alleles were over-
represented in patients with familial and non familial
breast cancer respectively (Awadallah and Atoum, 2004).
Other studies provided evidence that the haptoglobin !
subunit is specifically increased in sera of ovarian cancer
patients. It has been postulated that Hp! might affect the
immune response as a potent immunosuppressant (Bini et
al, 2003). The study we carried out showed an increase in
the levels of haptoglobin (# chain) in all breast cancer
samples (Figure 1). However, we were unable to draw
conclusions concerning !1 and !2 chains because of the
genetic polymorphism associated with the corresponding
gene. In the case of two other protein family members, !1-
acidic glycoprotein and !1-antitrypsin, showing elevated
levels in our breast cancer samples, a direct anti-apoptotic
mode of action has been demonstrated on tumor necrosis
factor-induced apoptosis of hepatocytes (Van Molle et al,
1997). The increase in the levels of protease inhibitors in
plasma such as !1-antitrypsin and !1-antichymotrypsin
could be related to the high proteolytic activity mediated
by proteases such as plasmin in cancer samples (Anderson
et al, 1993; Vejda et al, 2002). These two related
glycoprotein protease inhibitors, present in plasma could
also neutralize proteases released by leucocytes in
response to trauma and inflammatory stimuli (Bergman et
al, 1993). Serum amyloid P (SAP), a plasma glycoprotein,
shows also a slight increase in breast cancer samples
(Figure 1). This pentraxin protein has been shown to bind
chromatin in apoptotic and necrotic cells, thus preventing
antinuclear auto-immunity (Bickerstaff et al, 1990). The
SAP protein recognizes ligands from necrotic cells, binds
to late apoptotic cells and is involved in their phagocytosis
by human monocyte derived macrophages (Familian et al,
2001; Bijl et al, 2002).
A second set of proteins designed as negative acute
phase proteins comprising TTR and retinol binding protein
(RBP) displayed interestingly increased intensities in all
the breast cancer samples (Figure 1). A lower amount of
RBP and TTR was found in all control samples regardless
to the age. This result suggests that the association
![Page 236: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/236.jpg)
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
542
Figure 1. Two dimensional gel electrophoresis analyses of plasma proteins derived from (A) a healthy donor and (B) a breast cancer
patient. Partial 2-DE images from a control gel (A) and from a breast cancer sample (B) are shown. Abr: STF: serotransferrin ; ALB:
albumin ; ACT: anti-chymotrypsin ; ATR: anti-trypsin ; AGP: acidic glycoprotein ; Hp: haptoglobin ; Fb: fibrinogen beta chain ; ApoAI:
apoAI lipoprotein ; SAP: serum amyloid P ; RBP: retinol binding protein.
between RBP and TTR expression in plasma and breast
cancer is unlikely to be related to the age.
Further characterization of the RBP and TTR spots
was performed by protein sequencing. The two spots were
electroblotted on immobilon P and subjected to N-terminal
amino acid sequence analyses. The deduced sequences
(RBP:1ERDCRVSSFRVKENFDKARF20;TTR:1GPTGTGE
SKCPLMVKVLDAV20) were compared with the Swiss
Prot data bases and found to correspond, respectively, to
retinol binding protein and transthyretin.
The high levels of RBP and TTR found in plasma of
Tunisian patients with breast cancer as revealed by 2D-
PAGE were not reported for other populations (Mehta et
al, 1987; Basu et al, 1988;1989; Russell et al, 1988; Vejda
et al, 2002). This may be attributable to differences in
study design, to the analyzed populations, as well as to the
presence of different confounding factors.
The retinol binding protein is a member of the
lipocalins family and has been used as a marker of
diseases associated with inflammation and cancer (Xu and
Venge, 2000). It is synthesized predominantly by the liver
and is the principal carrier of all-trans retinol (vitamin A)
in the blood stream (Goodman, 1984). Transthyretin acts
as a transport protein for thyroxin T4 and is the primary
![Page 237: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/237.jpg)
Gene Therapy and Molecular Biology Vol 8, page 543
543
indirect carrier of vitamin A through its interaction with
retinol binding protein. It is well established that the
metabolism of RBP and TTR is highly associated with that
of vitamin A (Rosales et al, 2000). In the blood, the
retinol/ RBP complex further binds to transthyretin at a
ratio of 1:1:1 and is then transported to the target cells.
Retinol is then metabolized to its active form, retinoic acid
(RA), which is an important transcription modulator that
acts in the regulation of proliferation and differenciation of
many cell types (Blomhoff, 1994). Retinoids act also as
cancer chemopreventive and chemotherapeutic agents
(Honk and Sporn, 1997). They were also reported to
inhibit the growth of several breast cancer cell lines (Chen
et al, 1997). The action of retinol and RA is mediated by
their binding to cellular retinol (CRBP) and retinoic acid
binding proteins (CRABPI and CRABPII) and through
two different families of nuclear RA receptors. The latters
behave as ligand-activated–trans-acting transcription
factors that can regulate the expression of several retinoid-
responsive genes and hence alters the growth of normal
and cancer cells (Mangelsdorf et al, 1994).
Recent studies indicate that the metabolism of retinol
to retinoids is greatly reduced in several human carcinoma
cell lines and tumor specimens (Guo and Gudas, 1998;
Guo et al, 2000, 2001). Carcinoma cells from the breast
showed a decrease in their ability to esterify retinol to
retinyl esters (Chen et al, 1997). It has been suggested that
this could lead to an inappropriate growth and to the loss
of normal differenciation processes (Mira-Y-Lopez et al,
2000). Another frequent event in a subset of human breast
cancers is the loss of CRBP expression. This protein is
postulated to regulate the formation of retinyl esters and
the synthesis of retinoic acid (Ong et al, 1994). It was
suggested that CRBP down regulation occurs through
DNA hypermethylation in human breast cancer and
contributes to breast tumor progression (Arapshian et al,
2004). The decrease in the levels of CRBP leads to a
restriction of the effects of intracellular vitamin A levels
on breast cells (Kuppumbatti et al, 2000; Arapshian et al,
2004). Furthermore, it has been shown that increasing the
levels of CRABPII, an intracellular lipid-binding protein
that associates with retinoic acid, in mammary carcinoma
cells (MCF7) strongly enhances their sensitivity to retinoic
acid-induced growth inhibition (Budhu and Noy, 2002).
These data provide the evidence that increasing the
intracellular levels of retinyl esters in malignant cells
could be a good approach to treat patients with breast
cancer. The increase in the plasma levels of RBP and TTR
could thus be linked to the lack of sufficient internal
retinyl ester stores necessary to regulate retinoid
responsive genes in malignant cells.
In conclusion, the present study showing the high
production of RBP and TTR in plasma of patients with
breast cancer suggests that overproduction of these
proteins could correlate with a decrease of retinyl esters in
tumor cells.
AcknowledgmentsThis work was supported by le Ministère de la
Recherche Scientifique et de Technologie, le Ministère de
l’Enseignement Supérieur and le Ministère de la Santé
Publique de la République Tunisienne.
ReferencesAdkins JN, Varnum SM, Auberry KJ, Moore RJ, Angell NH,
Smith RD, Springer DL and Pounds JG (2002) Toward a
human blood serum proteome: Analysis by multidimensional
separation coupled with mass spectrometry. Mol Cell
Proteomics 1, 917-955.
Alaiya AA, Franzen B, Hagman A, Slitversward C, Moberger B,
Linder S and Aner G (2000) Classification of human ovarian
tumors using multivariate data analysis of polypeptide
expression patterns. Int JCancer 86, 731-736.
Anderson C, Gelin J, Iresjo BM and Lundholm K (1993) Acute
phase proteins in response to tumor growth. J Surg Res 55,
807-814.
Anderson L and Anderson N.G (1977) High resolution two-
dimensional gel electrophoresis of human plasma proteins.
Proc Natl Acad Sci USA 74, 5421-5425.
Anderson NL and Anderson NG (2002) The human plasma
proteome. Mol Cell Proteomics, 845-867.
Arapshian A, Bertran S, Kuppumbatti YS, Nakajo S and Lopez
RM (2004) Epigenetic CRBP down regulation appears to be
an evolutionarily conserved (human and mouse) and
oncogene specific phenomenon in breast cancer. Molecular
Cancer, 3-13.
Awadallah SM and Atoum MF (2004) Haptoglobin
polymorphism in breast cancer patients from jordan. Clin
Chim Acta 341, 17-21.
Basu TK and Sasmal P (1988) Plasma vitamin A, retinol-binding
protein, and prealbumin in postoperative breast cancer
patients. Int J Vitam Nutr Res 58 , 281-3.
Basu TK, Hill GB, Ng D, Abdi E and Temple N (1989) Serum
vitamins A and E, beta-carotene, and selenium in patients
with breast cancer. J Am Coll Nutr 8, 524-529.
Bergman D, Kadner SS, Cruz MR, Esterman AL, Tahery MM,
young BK and Finlay TH (1993) Synthesis of !1-
antichymotrypsin and !1-antitrypsin by human trophoblast.
Pediatr Res 34, 312-7.
Bickerstaff MC, Botto M, Hutchinson WL, Herbert J, Tennent
GA, Bybee A, Mitchell DA, Cook HT, Butler PJ, Walport
MJ and Pepys MB, (1990) Serum amyloid P component
controls chromatin degradation and prevents antinuclear
autoimmunity. Nat Med 5, 694-697.
Bijl M, Horst G, Bootsma H, Limburg PC and Kallenberg CGM
(2002) Serum amyloid P component (SAP) binds to late
apoptotic cells and mediates their phagocytosis by
macrophages. Arthritis Res 4, 8.
Bini L, Magi B, Cellesi C, Rossolini A and Pallini V (1992) Two
dimensional electrophoresis analysis of human serum
proteins during the acute-phase response. Electrophoresis
13, 743-746.
Bini L, Nagi B, Marzocchi B, Celiesi C, Berti B, Raggiaschi R,
Rossolini A and Pallini V (1996) Two dimensional
electrophoretic patterns of acute-phase human serum proteins
in the course of bacterial and viral diseases. Electrophoresis
17, 612-616.
Bini Ye, Cramer DW, Skates SJ, Gygi SP, Pratomo V, Fu LF,
Horick NK, Licklider LJ, Schorge JO, Berkowitz RS and
Mok SC (2003) Haptoglobin !-subunit as potential
biomarker in ovarian cancer. Clinical Cancer Res 9, 2904-
2911.
Blomhoff R, (1994) Overview of vitamin A metabolism and
function, in Blomhoff R (Ed)-Vitamin A in health and
disease, Marcel Dekker, New York, 1-35.
![Page 238: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/238.jpg)
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
544
Bradford M (1976) A rapid and sensitive method for the
quantification of microgram quantities of protein utilizing the
principle of protein dye binding. Anal Biochem 72, 248-254.
Brenner DJ, Sawant SG, Hande MB, Miller RC, Elliston CD, Fu
Z, Randers-pehrson G and Marino SA (2002) Routine
screening mammography: how important is the radiation-risk
of the benefit-risk equation?. Int J radia Biol 78, 1065-1067.
Budhu AS and Noy N (2002) Direct channeling of retinoic acid
between cellular retinoic acid-binding protein II and retinoic
acid receptor sensitizes mammary carcinoma cells to retinoic
acid-induced growth arrest. Mol Cell Biol 22, 2632-2641.
Buzdor AU and Hortobagy CN (1999) Breast cancer: in Pinedo
HM, Londo DL, Chabner BA eds- Cancer chemotherapy and
biological response modifiers. Annual 18, Amsterdam.
Elsevier-Sciences B V, 435-69.
Cassler AB, Johansen JJ and Kendrick NC (1992) Two
dimensional gel analysis of serum apolipoprotein A-1
isoforms. Preliminary analysis suggests altered ratios in
individuals with heart disease. Appl Theor Electrophoresis
3, 41-46.
Charrier JP, Tournel C, Michel C, Comby S, Reynaud CJ,
Passagot J, Alban PD, Chauvard D and Jolivet M (2001)
Differential diagnosis of prostate cancer and benign prostate
hyperplasia using two dimensional electrophoresis.
Electrophoresis 22, 1861-1866.
Chen AC, Guo X, Derguini F and Gudas LJ (1997) Human
breast cancer cells and normal mammary epithelial cells:
retinol metabolism and growth inhibition by the retinol
metabolite 4-oxoretinol. Cancer Res 57, 4642-4651.
Cho WC, Yi PC, Yip V, Thulasiraman V, Ngan RK, Yip TT, Lan
WH, Au JS, Law SC, Cheng WW, Nja VW and Lim CK
(2004) Identification of serum amyloid A protein as a
potentially useful bio-marker to monitor relapse of
nasopharyngeal cancer by serum proteomic profiling. Clin
Cancer Res 10, 45-52.
Choukaite A, Visvikis S, Steihmetz J, Calteau MM, Kabbaj O,
Ferard G, Melais R and Siest G (1989) Two dimensional
electrophoresis of plasma proteins and high density
lipoproteins during inflammation. Electrophoresis 10, 781-
784.
Conrads TP, Zhou M, Petricoin EF, Liotta L and Veenstra TD
(2003) Cancer diagnosis using proteomic patterns. Expert
Rev Mol Diagn 3, 411-420.
Del Piore G, Chatterton R, Lee C, Silver R, Berg L and Lee MJ
(1991) Comparison of mononuclear cell proteins and plasma
proteins before and during parturition by two dimensional
electrophoresis. J Perinat Med 19, 373-377.
Diamandis EP (1996) Prognostic markers in breast cancer. Clin
Lab News 22, 235-9.
Doherty NS, Lillman BI, Reilly K, Swindell AC, Buss JM and
Anderson NI (1998) Analysis of changes in acute-phase
plasma proteins in an acute inflammatory response and in
rheumatoid arthritis using two dimensional gel
electrophoresis. Electrophoresis 19, 355-363.
Eberini I, Agnallo D, Miller I, Villa P, Fratelli M, Ghezzi P,
Gemeiner M, Chau J, Aebersold R and Gianazza E (2000)
Protein of rat serum V: Adjuvant arthritis and its modulation
by non steroidal anti-inflammatory drugs. Electrophoresis
21, 2170-2179.
Familian A, Zwart B, Huisman HG, Rensink I, Roem D, Hordijk
PL, Aarden LA and Harck CE (2001) Chromatin-
independent binding of serum amyloid P Component to
apoptotic cells. J Immunol 167, 647-654.
Goodman DS, (1984) In th retinoids (Sporn MB, Roberts AB and
Goodman DS eds). Academic Press, New York 2, 41-88.
Guo X and Gudas LJ (1998) Metabolism of all-trans retinol in
normal human cell strains and squamous cell carcinoma
(SCC) lines from the oral cavitiy and skin: reduced
esterification of retinol in SCC lines. Cancer Res 58, 166-
176.
Guo X, Nanus DM, Ruiz A, Rando RR, Lorraine DB and Gudas
LJ (2001) Reduced levels of retinyl esters and vitamin A in
human renal cancers. Cancer Res 61, 2774-2781.
Guo X, Ruiz A, Rando RR, Bok D and Gudas LJ (2000)
Esterification of all-trans-retinol in normal human epithelial
cell strains and carcinoma lines from the oral cavity, skin and
breast: reduced expression of lecithin retinol acyltransferase
(LRAT) in the carcinoma lines. Carcinogenesis (Lond) 21,
1925-1933.
Hoemann R, Spoetti C, Crossmann M, Saller B and Mann K
(1993) Molecular heterogeneity of human chorionic
gonadotropin in serum and urine from patients with
trophoblastic tumors. Clin Investig 71, 953-960.
Hondermarck H (2003) Breast cancer: when proteomics
challenges biological complexity. Mol Cell Proteomics,
281-291.
Honk WK and Sporn MB (1997) Recent advances in
chemoprevention of cancer. Science 278, 1073-1077.
Hoogland C, Sanchez JC, Tonella L, Bairoch A, Hochstrasser OF
and Appel RD (1999) The Swiss 2D-PAGE database: what
has changed during the last year. Nucl Acid Res 27, 289-
291.
John H and Purdom IF (1989) Elevated plasma levels of
haptoglobin in duchenne muscular dystrophy: electrophoretic
variants in patients with a severe form of the disease.
Electrophoresis 10, 489-493.
Kuhajda FP, Katumuluwa AI and Pasternack GR (1989)
Expression of haptoglobin-related protein and it’s potential
rôle as a tumor antigen. Proc Natl Acad Sci USA 86, 1188-
1192.
Kuppumbatti YS, Bleiweiss IJ, Mandeli JP, Waxman S and
Lopez RMY (2000) Cellular retinol-binding protein
expression and breast cancer. J Natl Cancer Inst 92, 475-
480.
Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680-
685.
Mangelsdorf DJ, Umesono K and Evans RM (1994) The
retinoids receptors, sporn MB, Roberts AB, Goodman DS
eds. The retinoids: Biology, chemistry and medicine, Raven
Press, 319-350.
Mehta RR, Hart G, Beattie CW and Das Gupta TK (1987)
Significance of plasma retinol binding protein levels in
recurrence of breast tumors in women. Oncology 44 (6) 350-
5
Miller I, Haynes P, Eberini I, Gemeiner M, Aebersold R and
Gianazza E (1999) Proteins of rat serum. III.Gender-related
differences in protein concentration under base line
conditions and upon experimental inflammation as evaluated
by two dimensional electrophoresis. Electrophoresis 20,
836-845.
Mira-Y-Lopez R, Zheng WL, Kuppumbatti YS, Rexer B, Jing Y,
Ong DE (2000) Retinol conversion to retinoic acid is
impaired in breast cancer cell lines relative to normal cells. J
Cell Physiol 185, 302-9.
Negishi Y, Furukawa T, Oka T, Sakamodo M, Hirata T, Okabe
K, Matayoshi K, Akiya K and Soma H (1987) Clinical use of
CA125 and its combination assay with other tumor markers
in patients with ovarian carcinoma. Gynecol Obstet Investig
23, 200-207.
Neuhoff V, Stamm R and Elbl H (1985) Clear background and
highly sensitive protein staining with coomassie blue dyes in
polyacrylamide gels: a systematic analysis. Electrophoresis
6, 427-448.
![Page 239: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/239.jpg)
Gene Therapy and Molecular Biology Vol 8, page 545
545
Oakley BR, Kirsch DR and Morris NR (1980) A simplified ultra-
sensitive silver stain for detecting proteins in polyacrylamide
gels. Anal Biochem 105, 361-363.
Ong DE, Newcomer ME and Chytil F (1994) Cellular retinoid-
binding proteins, Sporn MB, Roberts AB, Goodman DS eds.
The retinoids: Biology, chemistry and medicine, Raven
Press, 283-317.
Petricoin LI, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA,
Steinberg SM, Mills GB, Simone C, Fishman DA, Kohn EC
and Liotta LA (2002) Use of proteomic patterns in serum to
identify ovarian cancer. Lancet 359, 572-577.
Ramagli LS and Rodriguez LU (1985) Quantitation of
microgram amounts of proteins in two-dimensional
polyacrylamide gel electrophoresis sample buffer.
Electrophoresis 6, 559-563.
Rosales JF, Topping JD, Smith JE, Shankar AH and Ross C
(2000) Relation of serum retinol to acute phase proteins and
malarial morbidity in papua new guinea children. Am J Clin
Nutr 71, 1582-8.
Russell MJ, Thomas BS and Bulbrook RD (1988) A prospective
study of the relationship between serum vitamins A and E
and risk of breast cancer. Br J Cancer 57, 213-5.
Sanchez JC, Appel RD, Golaz O, Pasquali C, Ravier F, Bairoch
A and Hochstrasser DF (1995) inside swiss 2D-PAGE data
base. Electrophoresis 16, 1131-1151.
Schmid HR, Schmiller D, Blum P, Miller M and Vonderschmill
D (1995) Lung tumor cells. A multivariate approach to cell
classification using two dimensional protein paterns.
Electrophoresis 16, 1961-1968.
Van Molle W, Libert C, Fiers W and Brouckaert P (1997) !1-
antitrypsin inhibit TNF-induced but not anti-Fas induced
apoptosis of hepatocytes in mice. J Immunol 159, 3555-
3564.
Vejda S, Posovszky C, Zelzer S, Peter B, Bayer E, Gelbmann D,
Hermann RS and Gerner C (2002) Plasma from cancer
patients featuring a characteristic protein composition
mediated protection against apoptosis. Mol Cell Proteomics,
387-393.
Viellard A, Lonbart C, Borel JP and Jayle MF (1974) In-vitro
influence of haptoglobin and its complex with hemoglobin
on the biosynthesis of collagen. Pathol Biol 22, 741-742.
Wright GL (1974) Two dimensional acrylamide gel
electrophoresis of cancer patient serum proteins. Ann Lab
Sci 4, 281-293.
Wrotnowski C (1998) the future of plasma proteins. Genet Engl
News, 18 14.
Xu S and Venge P (2000) Lipocalins as biochemical markers of
disease. Biochim Biophys Acta 1482, 298-307.
Yoshida Y, Hosokawa K, Dantes A, Kotsuji F, Kleinman HK
and Amsterdam (2001) A Role of laminin in ovarian cancer
tumor growth and metastasis via regulation of mdm2 and
Bcl2 expression. Int J Oncol. 18, 913-921.
Yousef GM and Diamandis FP (2001) The new human tissue
kallikrein gene family: structure, function and association to
disease. Endocr Rev 22, 148-204.
![Page 240: Gene Therapy & Molecular Biology Volume 8 Issue B](https://reader034.vdocument.in/reader034/viewer/2022050713/568bd6481a28ab20349b7bcd/html5/thumbnails/240.jpg)
Chahed et al: Association of retinol binding protein and transthyretin expression with breast cancer
546