general enquiries on this form should be made...

General enquiries on this form should be made to:Defra, Procurements and Contracts Division (Science R&D Team)Telephone No. 0207 238 5734E-mail: [email protected]

SID 5 Research Project Final Report

SID 5 (Rev. 05/09) of 21

NoteIn line with the Freedom of Information Act 2000, Defra aims to place the results of its completed research projects in the public domain wherever possible. The SID 5 (Research Project Final Report) is designed to capture the information on the results and outputs of Defra-funded research in a format that is easily publishable through the Defra website. A SID 5 must be completed for all projects.

This form is in Word format and the boxes may be expanded or reduced, as appropriate.

ACCESS TO INFORMATIONThe information collected on this form will be stored electronically and may be sent to any part of Defra, or to individual researchers or organisations outside Defra for the purposes of reviewing the project. Defra may also disclose the information to any outside organisation acting as an agent authorised by Defra to process final research reports on its behalf. Defra intends to publish this form on its website, unless there are strong reasons not to, which fully comply with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.Defra may be required to release information, including personal data and commercial information, on request under the Environmental Information Regulations or the Freedom of Information Act 2000. However, Defra will not permit any unwarranted breach of confidentiality or act in contravention of its obligations under the Data Protection Act 1998. Defra or its appointed agents may use the name, address or other details on your form to contact you in connection with occasional customer research aimed at improving the processes through which Defra works with its contractors.

Project identification

1. Defra Project code SE3236

2. Project title

Development of a multiplex PCR to distinguish M. bovis from M. bovis BCG vaccine strains and M. microti.

3. Contractororganisation(s)

Dr. G. Michael Taylor,Senior Research Fellow,Research Department of Infection,Windeyer Institute UCL,46, Cleveland Street,London W1T 4JF

54. Total Defra project costs £ 31,540(agreed fixed price)

5. Project: start date................ 01 May 2009

end date................. 30/Sept,2009

SID 5 (Rev. 05/09) of 21

6. It is Defra’s intention to publish this form. Please confirm your agreement to do so...................................................................................YES NO (a) When preparing SID 5s contractors should bear in mind that Defra intends that they be made public. They

should be written in a clear and concise manner and represent a full account of the research project which someone not closely associated with the project can follow.Defra recognises that in a small minority of cases there may be information, such as intellectual property or commercially confidential data, used in or generated by the research project, which should not be disclosed. In these cases, such information should be detailed in a separate annex (not to be published) so that the SID 5 can be placed in the public domain. Where it is impossible to complete the Final Report without including references to any sensitive or confidential data, the information should be included and section (b) completed. NB: only in exceptional circumstances will Defra expect contractors to give a "No" answer.In all cases, reasons for withholding information must be fully in line with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

(b) If you have answered NO, please explain why the Final report should not be released into public domain

Executive Summary7. The executive summary must not exceed 2 sides in total of A4 and should be understandable to the

intelligent non-scientist. It should cover the main objectives, methods and findings of the research, together with any other significant events and options for new work.A quantitative real-time multiplex PCR has been developed which will distinguish between M. bovis BCG, M. microti and wild-type M. bovis , members of the mycobacterium tuberculosis (MTB) complex which may be present in clininical and environmental samples in areas associated with bovine tuberculosis and herd breakdown. The assay exploits large sequence polymorphisms (LSPs) or deletions present in the genomes of these mycobacteria to provide highly species-specific loci for amplification of microorganism DNA. Primers flanking the RD4 deletion in M. bovis identify the wild-type strains of M. bovis and primers flanking RD1bcg and RD1mic identify the attenuated vaccine strain of M. bovis BCG and M. microti respectively. Additional specificity is provided by dual-labelled hydrolysis reporter probes which hybridise across the respective deletion breakpoints in the three MTB species.

The assays have been optimised for single or combined use and show no reduction in sensitivity when run as a multiplex method. Minimum detection limits for the multiplex indicate 4 genome equivalents (GE) for M. bovis and M. bovis BCG and 13 GE for M. microti. The assays have been shown to be specific for the intended targets and show no cross-reactivity against a range of reference and environmental mycobacteria other than tuberculosis (MOTT). The inclusion of bovine serum albumin in the assay master mix was found to confer a high degree of resilience to inhibitors of the PCR reaction likely to be present in clinical and environmental samples. The new tests will complement existing diagnostic PCRs and molecular typing methods to support outbreak investigations. They will be useful in the assessment of BCG survival and shedding as a result of vaccination of badgers, data useful in supporting the licensing of oral vaccines.

SID 5 (Rev. 05/09) of 21

Project Report to Defra8. As a guide this report should be no longer than 20 sides of A4. This report is to provide Defra with

details of the outputs of the research project for internal purposes; to meet the terms of the contract; and to allow Defra to publish details of the outputs to meet Environmental Information Regulation or Freedom of Information obligations. This short report to Defra does not preclude contractors from also seeking to publish a full, formal scientific report/paper in an appropriate scientific or other journal/publication. Indeed, Defra actively encourages such publications as part of the contract terms. The report to Defra should include: the scientific objectives as set out in the contract; the extent to which the objectives set out in the contract have been met; details of methods used and the results obtained, including statistical analysis (if appropriate); a discussion of the results and their reliability; the main implications of the findings; possible future work; and any action resulting from the research (e.g. IP, Knowledge Transfer).

Scintific Objective and Aims.The M. bovis sequencing project (Garnier et al, 2003) revealed a number of unique regions of difference (RD) compared with other closely-related mycobacterium tuberculosis (MTB) complex mycobacteria and these provide a basis for the development of highly specific PCR assays. The deletion associated with RD4 defines classic M. bovis and this was used in project SE3008 to develop a quantitative PCR for this pathogen in various animal tissues using the intercalating fluorophore SYBR Green (Taylor et al, 2007). Following on from this work, a hydrolysis probe-based assay centred on the RD4 deletion was developed for detecting M. bovis in the environment (Taylor and Huggett, unpublished observations). In the present project, this RD4 assay for M. bovis has been combined with methods which amplify the flanking region of RD1, a deletion event associated with attenuation in the vaccine strains of BCG and with the equivalent locus in M. microti. Thus, the assay is based on RD1bcg, a 9.7 Kb deletion that has occurred in M. bovis BCG vaccine strains (loci Rv 3871-Rv 3879) and on the overlapping RD1mic, a 14 Kb deletion that has occurred in the genomes of M. microti isolates (loci Rv 3864-Rv 3876) (see Figure 1 & Brodin et al, 2002). The present report details the development and initial validation of the resulting quantitative real-time multiplex PCR assay. This may be used to discriminate M. bovis, M. bovis BCG and M. microti in clinical and environmental samples. If required, the assays may be used individually, rather than as a multiplex, and could form initial screening tools before further genotyping. An obvious application is the ability to discriminate between wild-type M. bovis and M. bovis BCG, which may be shed from badgers in oral vaccine trial areas, from infection with wild-type M. bovis. A further consideration is the ability to distinguish between M. bovis and M. microti, the prevalence of which may be underestimated in the environment and is increasingly reported in companion animals such as cats (Cavanagh et al, 2002; Jahans et al, 2004; Taylor et al, 2006; Pacciarini et al, 2006).

Figure 1. Details of the RD1bcg and RD1mic regions and equivalent loci in M. tuberculosis strain H37Rv (after Brodin).

METHODS.

SID 5 (Rev. 05/09) of 21

DNA extractions.1. Environmental mycobacteria isolated from a farm in the south-west of England. DNA extracts were prepared from a sterile loop of material recovered from archived L-J slopes of mycobacteria. Over 50 isolates were studied. These are listed in Tables 1a and 1b. The material was suspended in 500µl TE buffer, boiled and then “snap”-frozen in liquid nitrogen 3 times to assist lysis. The samples were centrifuged at 10,000 rpm for 5 mins. and aliquots of the supernatants (1µl) taken into the various PCR assays.

2. BCG vaccine daughter strains archived at UCL. Material from ampoules of lyophilised vaccine strains (Table 2) were re-suspended in 1-2mls of molecular biology grade water (Chromanorm, HPLC grade, VWR). DNA was precipitated from the suspension by addition of an equal volume of isopropanol and 1/10 volume of 3M sodium acetate. The residues after centrifugation (10,000 rpm for 15mins.) were taken up into 1ml water and the isopropanol precipitation step repeated. The resulting pellets were washed in 70% ethanol twice, dried and resuspended in 200µl water. One µl was used in PCR reactions.3. Isolates of M. bovis wild-type, M. microti and M. bovis BCG Danish provided by VLA Weybridge.Five hundred microlitre of the heat-killed isolates were snap-frozen and isopropanol precipitated as described above (Methods 1). The residues were washed twice in 70% ethanol and resuspended in 200µl water. 4. DNA was also prepared from different amounts of badger faeces (weights 0.8, 1.2, 1.6 and 3g) using the NucliSensTM isolation reagents from BioMérieux. The silica eluates contained co-purified inhibitors of PCR. These were used to study the ability of bovine serum albumin (BSA) to overcome the effect of these inhibitors on the individual assays of the multiplex. The BSA used was non-acetylated (Sigma, B4287) and made up to a concentration of 10mg/ml. Aliquots (2.5µl) were added to each 25µl PCR reaction to provide a final concentration of 1mg/ml.

Effect of inhibitors on the assays of the multiplex method. Several substances known to inhibit PCR (Al -Soud & Rådström, 2001; Kreader, 1996) were studied for their effect on the multiplex methods. These were: bile (Sigma B3883), heparin (Sigma HO777) and tannic acid (Sigma T0200). Bile and heparin were bovine in origin and tannic acid was prepared from Chinese natural gall nuts. Working stock solutions of these were prepared based on their known ability to inhibit the SPUD assay, a frequently used internal control PCR to monitor for signs of inhibition (Nolan et al, 2006). The concentrations of working solutions used were: bile 3.2 mg/ml; heparin 1.2 µg/ml and tannic acid .015mM. Aliquots (1.6µl) of these solutions were added to 25 µl PCR reactions either in triplicate when added to standard curves or in quintuplicate when added to an internal “spike” of mycobacterial DNA to compare with controls receiving only water.

Quantification of partially-purified DNA from mycobacterial reference strains. DNA content and purity were assessed using a Nanodrop ND-1000 spectrophotometer (Labtech International, Ringmer, East Sussex, UK). Primers and hydrolysis probes.The sequences of all PCR primers used in the project are listed in Table 3. Table 4 lists the sequences of the hydrolysis probes designed to sit across the deletion breakpoints. The probes were designed initially and several primer pairs were assessed for their ability to work efficiently with each probe. The optimal primer pairs were then used in the multiplex method.

PCRa). Preliminary experiments. Conventional hot-start PCR (cPCR) was performed in a final volume of 25µl using the Excite Core kit from BioGene with minor modification to the manufacturer’s instructions. Each reaction contained 25 pmol of each primer in 1µl, 2.5 µl of 10x reaction buffer, 1.5-3µl Mg2Cl, 2.5µl bovine serum albumin (non-acetylated, BSA, Sigma B4287), 1µl of template and 0.5U of Taq polymerase. The volumes were made up to 25 µl with water (VWR). After an initial denaturation step (between 8 -15 min at 95 oC), 35-41 cycles of amplification were performed as follows: denaturation at 95o C for 10s, annealing at 58oC for 30 s, extension at 72oCfor 20 s. SYBR Green (2.5µl) was included in some experiments at a final dilution of 1/55 000, and reactions were performed and monitored on either a Corbett RotorGene 3000 or a 6000 real-time PCR platform. Melt analyses were performed with the RotorGene software and all products were also run on 3% agarose checker gels. When hybridisation probes were included, these were used at a final concentration of 100nM, through the addition of 1µl 2.5µM working stock of probe/ 25µl reaction. The magnesium concentration for these experiments was 3mM.

b). Later experiments. In later experiments the Hot start taq master mix kit from Qiagen (product 203445) was used. The effect of inclusion of BSA on product formation was also studied, as was the optimum magnesium concentration. Product formation was followed up to a maximum of 45cycles.c). Quantitative real-time PCR (QPCR). This was performed in a total reaction volume of 25µl using one or more of the dual labelled fluorogenic probes or, on occasion, with one of the probes combined with SYBR Green as described above. The Qiagen kit was always used. Six DNA standards were prepared from a working stock DNA extract of BCG Pasteur and spanned the range 30,000-0.3 genome equivalents (GE) / µl. Similarly, BCG Danish

SID 5 (Rev. 05/09) of 21

was used to prepare standards in later experiments (range 0.4 GE/µl to 404,255 GE/µl. In some experiments wild-type M. bovis strain AF2122/97 was used to prepare DNA standards and these spanned the range from 2.18 x106 GE/µl to 2.18 GE/µl. Two different DNA preparations were made from M. microti cultures. The first of these, prepared from combining a number of field strains (Table 5) covered the range 1.33 GE/µl to 1.336170 x 106 GE/µl. A second standard was prepared from isolate 61/0633/09, cultured at VLA. Standards from 0.51 GE/µl to 511,170 GE/µl were prepared from this isolate. Standards were run in triplicate. Assays were performed on the Stratagene 3005 Mx platform, or on one of the Corbett machines mentioned above. Non-template controls, with water in place of unknown or standard were assayed in triplicate.

d). The final multiplex PCR protocol. This is performed in a final volume of 25µl. The six PCR oligonucleotide primers are each used at a concentration of 20 pmoles/reaction. For convenience, it is suggested that a premix of these is prepared in advance so that initial concentration of each is 120 moles/µl, six times that normally used. Then, 1 µl of the primer premix can be added per reaction set up. The Qiagen 2 x hot start master mix kit (product 203445, containing 1.5mM MgCl2) is used and supplemented to provide a final magnesium concentration of 3mM. This is necessary for optimal efficiency of the fluorogenic probes. Each of the 3 probes (RD4, BCG and M. microti) should be used at a final concentration of 100nM. Non-acetylated BSA (2.5 µl of 10mg/ml in mol.biol.grade water) is added to provide a final concentration of 1mg/ml. Template 1µl/reaction of unknown, blank or standard is added and the volume made up to 25µl with HPLC or other molecular biology grade water. The thermal profile set-up consists of 15 min at 95C to activate the polymerase followed by 41 cycles of denaturation at 95C for 10S, annealing at 58C for 30S and extension for 1min at 76C. Fluorescence data is acquired during the latter step on all relevant channels (i.e. FAM, CY5 and HEX).

Automated DNA sequencing.PCR products were separated on 3% (wt/vol) low-melting-point agarose (Invitrogen) and bands were excised with a sterile scalpel blade and purified using a Geneclean III DNA isolation kit (Fisher Life Sciences, UK). Templates were sequenced using both forward and reverse primers by Cogenics Ltd., Takeley, Essex, UK.

RESULTS.Primer specificity.In initial experiments it was shown that the BCG primers flanking the RD1 deletion detected only BCG Pasteur and related vaccine strains and did not amplify DNA from either M. bovis wild-type or M. microti (Figure 2).

Figure 2. Lanes 1-3, BCG primers (104 BP) with: Lane 1, BCG DNA. Lane 2, M. bovis wild-type DNA. Lane 3, template blank. Lane 4: nil. Lanes 5-7, RD4 primers with: Lane 5, BCG DNA. Lane 6, M. bovis wild-type. Lane 7, template blank. L 1 2 3 4 5 6 7

Primers flanking The RD4 deletion produced the expected amplicon of 112 bp from wild-type M. bovis and all the BCG vaccine strains tested (Figure 3). They did not yield an amplicon from M. microti DNA. The microti flanking primers (RD1mic) amplified only DNA from that species and not from M. bovis (AF2122/97) or from M. bovis BCG Danish or BCG Pasteur (Figure 4).

SID 5 (Rev. 05/09) of 21

Figure 3. RD4 PCR. Lane 1: M. microti DNA. Lane 2: AF2122/97 M. bovis. Lane 3: BCG (Danish). Lane 4. M. bovis field isolate. Lane 5: BCG Pasteur. Lane 6: Template blank.

L 1 2 3 4 5 6

Figure 4. Testing of RD1mic primers. Lane 1, 100 bp DNA size markers. Lane 2: M. microti DNA (61/0634/09). Lane3: M. bovis AF2122/97. Lane 4: BCG Danish. Lane 5: M. bovis field isolate. Lane 6: BCG Pasteur. Lane 7: Template blank (water).

L 1 2 3 4 5 6 7

Further testing of the BCG and microti primers was undertaken to confirm that they would detect all strains likely to be encountered in practice. To this end, DNA was extracted from a reference collection of BCG vaccine strains archived at UCL. The strains tested are listed in Table 2. The BCG primers were used in both cPCR and real-time PCR experiments with the FAM labelled probe. DNA amplified from all the daughter strains and gel-electrophoresis confirmed the product size (Figure 5). The various strains were also all positive by real-time PCR using the FAM probe complementary to the breakpoint region (not shown).

Figure 5. BCG vaccine strains amplified with BCG specific primers. Lane 2: BCG Danish. Lane 3:Japanese (1). Lane 4: BCG Pasteur. Lane 5:Illinois. Lane 6: Japanese (2). Lane 7: Soviet strain. Lane 8: Copenhagen. Lane 9: Glaxo. Lane 10:Moscow (Russian). Lane 11:Connaught. Lane 12: Moreau. Lane 13: Prague.

L 2 3 4 5 6 7 8 9 10 11

SID 5 (Rev. 05/09) of 21

L 12 13

Similarly, the microti primers detected a variety of M. microti strains with different spoligotype and VNTR patterns, kindly provided by VLA Weybridge. The microti types examined are detailed in Table 5 and Figure 6 shows gel electrophoresis of the PCR products. Sequencing of the M. microti amplicons from this experiment showed the sequence around the RD1mic sequence was identical in all strains with differing spoligotypes.

Figure 6. A range of microti field isolates amplified with the RD1mic primers. Lanes 1 & 11: 100 bp DNA ladder. Lanes 2-4: Type “0”. Lanes 5,6: Type 3. Lane 7: Type 18. Lanes 8,9: Type 19. Lanes 10-12: Type 31. Lane 13: Type 32. Lanes 14,15: Type 34. Lanes 16,17: Water blanks.

1 2 3 4 5 6 7 8 9 10

11 12 13 14 15 16 17

The three primer pair sets (RD4, BCG and Mic) were also tested against DNA extracted from a number of environmental strains gathered from farms in the south-west of England. A number of there were successfully cultured and identified at UCL as part of an earlier longitudinal study (Donoghue et al, 1997). A further ten of the most commonly isolated biotypes were also studied (Table 1b). Using a PCR for the 16S rRNA region (Kox et al, 1997), it was initially shown that DNA from all of these mycobacterial isolates had been extracted successfully. As part of the current project, sequencing of the 16S products from the 10 biotypes was performed in an attempt

SID 5 (Rev. 05/09) of 21

to identify the species. This was achieved in two cases, but the majority were not found in the database; in these cases the nearest match and number of mismatches was recorded (Table 1b).

Primers from all three methods were found not to cross-react with any of the environmental strains tested individually. However, a number of the isolates generated bands which were initially difficult to distinguish from the expected products when tested with conventional PCR and gel electrophoresis. This was the case particularly with the M. microti and BCG methods. Figure 7 illustrates this observation when the microti PCR was used. Note bands present in lanes 2,4,5,7 and 8. Six of the bands of approximately 100 bp, which might have been interpreted as correct product, were purified from the gel and sent for DNA sequencing. None of these sequenced with the microti primers, showing that these were not the correct product. When the dual–labelled microti probe became available the environmental extracts were re-tested. The real-time method did not report any cross-reactivity with the environmental isolates.

Figure 7. Microti PCR applied to the UCL collection of environmental strains.

L 1 2 3 4 5 6 7 8 9 10

L 11 12 13 14 15 16 17 18 19 20

The Multiplex Method.The individual PCR assays for M. bovis, M. bovis BCG and M. microti were first studied and optimised before being brought together in the multiplex method. To achieve this, the methods were run with a dilution series of the respective DNA preparations to determine the reaction efficiencies, minimum detection limits and the linearity of the reactions. After optimisation, the assays were then combined and the same parameters compared. Figures 8-10 show standard curves and amplification profiles for the individual M. bovis, M. bovis BCG and M. microti methods, together with the reaction parameters obtained. Figure 11 shows a summary of the curves for the individual assays and Figures 12-13 for the multiplex components. In this example the microti curve is shown separately as the value of the standards differs from those of the RD4 and BCG methods and the Stratagene software does not allow this to be presented. Therefore, in future experiments it is recommended that the working stocks of DNA prepared from all templates (M. microti, M. bovis BCG and M. bovis) be diluted to the same value of genomic equivalents (GE). It was found that reaction efficiencies and sensitivities of the individual assays was not compromised by combining them into a multiplex method (Table 6).

Figure 8. RD4 real-time PCR method for M. bovis.

SID 5 (Rev. 05/09) of 21

Figure 9. M. bovis BCG real-time PCR method.

SID 5 (Rev. 05/09) of 21

Figure 10. M. microti real-time PCR method.

Figure 11. Individual PCR curves superimposed.

SID 5 (Rev. 05/09) of 21

Figure 12. M. bovis (RD4) and BCG run as part of the multiplex.

Figure 13. M. microti PCR run as part of the multiplex (same experimental run as Figure 12).

The Multiplex method and PCR inhibition.As the multiplex method may well be applied to clinical and environmental samples such as soil and faeces, it is important that it be resilient to inhibitors of the PCR reaction which are inevitably co-purified alongside faunal DNA. Therefore, the susceptibility of the method to inhibition was investigated using a number of well known inhibitory substances. These were: 1. purified sources of bovine bile and heparin and tannic acid extracted from Chinese gall nuts. DNA extracts from badger faecal material were also prepared and assayed for inhibitory activity in the SPUD PCR assay and then also against the multiplex PCR.In preliminary experiments (not shown) it was first demonstrated that at the concentrations used (METHODS), all the inhibitory substances caused a right shift in Ct of the SPUD assay and decrease in amplification efficiency. The same was also found for badger faecal extracts. This is seen in Figure 14.

SID 5 (Rev. 05/09) of 21

Figure 14. SPUD assay of PCR inhibitors present in badger faecal extracts. Note right shift of between 3 and 5 Ct over the range of faecal weights extracted.

Similarly, badger faecal extract, bile, heparin and particularly tannic acid also caused inhibition in the multiplex assay. The individual assays were affected to different extents by the various inhibitors. This is illustrated in the following Figures 15 and 16 which show the RD4 and the microti assay exposed to bile, heparin and tannic acid. The latter was a particularly effective PCR inhibitor of all methods. The effect of inhibition by badger faeces is illustrated in Figure 17. The inclusion of non-acetylated BSA (1mg/ml final) in the Qiagen master mix was found to counteract the inhibitory effects of faeces in the BCG assay and so this was investigated for similar properties in the other PCRs.

Figure 15. The effects of bile, heparin and tannic acid on the RD4 PCR method. Note the method is more susceptible to tannic acid (No Ct) and bile than to heparin.

SID 5 (Rev. 05/09) of 21

Figure 16. The effects of bile, heparin and tannic acid on the M. microti PCR method. Note the method is again completely inhibited by tannic acid (No Ct) and inhibited by bile and heparin to a lesser extent.

Figure 17. Effect of badger faecal extract (green profiles) on the BCG assay. The experiment shows the effect of addition of 1µl extract added to a 25µl multiplex PCR reaction. The inclusion of BSA completely overcomes the observed inhibition.

Experiments were then undertaken to see if the addition of BSA to the master mix would overcome the inhibition seen with bile, heparin and tannic acid. Additionally, as the above experiment appeared to indicate an enhancement of amplification profile and final plateau fluorescence values when BSA was included, it was decided to study its effects on the efficiency of the multiplex.

SID 5 (Rev. 05/09) of 21

Figure 18. RD4 PCR: Effect of BSA added to multiplex master mix in the presence of inhibitors.

Figure 19. Microti PCR: Effects of addition of BSA to the multiplex master mix in the presence of inhibitors.

A similar recovery from inhibition was also seen in the BCG PCR. From these experiments it can be concluded that non-acetylated BSA is capable of overcoming much of the effects of inhibitors of the PCR reaction which are likely to be present in clinical and environmental samples. Table 7 summarises the effects of inhibitors (bile, heparin and tannic acid) on individual PCRs of the multiplex the reversal of inhibition by BSA.To ensure the inclusion of BSA would not be derogatory to the multiplex assay, standards curves were run both without and with the inclusion of BSA and the profiles and other parameters compared. The results are shown in Figures 20 and 21 respectively.

SID 5 (Rev. 05/09) of 21

Figure 20. Multiplex PCR standard curves for RD4, BCG and M. microti assayed without BSA.

Figure 21. Multiplex PCR standard curves for RD4, BCG and M. microti assayed with BSA.

This experiment showed that BSA had no detrimental effect on the reaction efficiencies or minimum detection limits of the multiplex PCR methods . The results are further summarised in Table 8.

The final protocol for the multiplex assay is detailed above (Methods PCR section d.)

SID 5 (Rev. 05/09) of 21

Project SE3236 – TABLES.

Table 1a. MOTT strains used in specificity testing of the multiplex PCR. The I6 S PCR was used to confirm extraction of mycobacterial DNA.

SID 5 (Rev. 05/09) of 21

No. Species 16S PCR RD4 BCG Microti1 M. smegmatis + - - -2 M. phlei + - - -3 M. fortuitum + - - -4 M. fortuitum + - - -5 M. fortuitum + - - -6 M. fortuitum + - - -7 M.marinum NCTC 10011 47 + - - -8 M. marinum + - - -9 M. flavescens ACTC 14474 + - - -10 M. gordonae NCTC 10267 76 + - - -11 M. smegmatis 77 + - - -12 M. phlei (red 46) + - - -13 M. gilvum 132 + - - -14 M. aquae + - - -15 M. tomidae + - - -16 M. gordonae 275 + - - -17 M. aurum NCTC 10438 (red 28) + - - -18 M.chitae NCTC 10485 + - - -19 M. terrae + - - -20 M. terrae + - - -21 M. diernoferi + - - -22 M. thermoresistibile ACTC 19527 + - - -23 M. thermoresistibile ACTC 19528 + - - -24 M. fortuitum 800 + - - -25 M. aurum NCTC 10437 + - - -26 M. rhodesiae + - - -27 M. fortuitum 844 + - - -28 M. peregrinum + - - -29 1204 (red 42) + - - -30 M. farcinogenes Senegalense + - - -31 M. gordonae + - - -32 M. gastri 1465 + - - -33 M. gastri 1466 + - - -34 M. vaccae 1483 + - - -35 M. vaccae 1484 + - - -36 M. asiaticum + - - -37 M. abscessus 292 + - - -38 M. chelonae (lab strain) + - - -39 NCTC 946 - - - -40 M. chelonae (Vaccine strain) + - - -41 15291 + - - -42 M. gadium + - - -43 M. obuense + - - -44 FMR 279 (red 38) + - - -45 M. Hiberniae 49874 + - - -46 M. hiberniae 1768 + - - -47 M. hiberniae 2383 + - - -48 Rhodococcus Equi 10844 + - - -49 Rhodococcus rhodochrous (1) - - - -50 Rhodococcus rhodochrous(2) - - - -

Table 1b. Most commonly isolated biotypes from farms in the south west

Biotype Ident. No. Sequencing(nearest match)

16SPCR

IS1081 PCR

RD4 PCR

BCG PCR

MicrotiPCR

1 J902 IP 20010516 + - - - -3 S514 IP 20010516 + - - - -7 SP621 M. Gordonae + - - - -9 M542 M. Gordonae

Strain 79/02+ - - - -

24 UCH 104 M. peregrinum/M. septicum

+ - - - -

26 MP9 m3 M. terrae Fl 0765 + - - - -29 J122 M. species Dra-55, then

M. peregrinum+ - - - -

38 SP141 M. ellin 5036 & 7055 + - - - -41 D424 M sp. Clone STMO-535 (1mm) + - - - -44 M412 M sp. DL 049 (2mm) + - - - -mm = mismatch.

Table 2. BCG strains tested by cPCR and by real-time dual labelled probe.BCG vaccine strain cPCR result Reported by probe Expected size on gelDanish + Yes YesJapanese 1 + yes yesPasteur + Yes YesIllinois (Tice) + yes yesJapanese 2 + Yes Yes Danish (lot I-738) + yes yesSoviet + Yes YesCopenhagen (Danish) + yes yesGlaxo 172 + Yes YesMoscow (lot E- 010) + yes yesConnaught + Yes YesMoreau (Brazilian) + yes yesPrague + Yes Yes

Table 3. Details of PCR oligonucleotides used in the project and their physical properties.Primer Name Sequence Length G+C

%Tm(nn)

Amplicon(bp)

16S F 5-GRGRTACTCGAGTGGCGAAC-3 20 55-65 55 20816S R 5-GGCCGGCTACCCGTCGTC-3 18 78 57RD4 F2 5-TGTGAATTCATACAAGCCGTAGTCG-3 25 44 57 112RD4 R2 5-ATGGCTATTGACCAGCTAAGATATCCG-3 27 44.4 60BCG F 5-CGTTCGTGGTGGAGCGGATTTGAC-3 24 58.3 60 104BCG F2* 5-GACCTGACGACGGCGCAGCT-3 20 70 62 131BCG R 5-AGGCCGACGGGCAGCTATGC-3 20 70 61Mic F 5-GCAGGATCGGCGATGAAATGC-3 21 57.1 58 98Mic R 5-CACCGGTTCGTCGCTGTTCAAC-3 22 59.1 58* Recommended for final multiplex protocol.

Table 4. Hydrolysis probes used in multiplex project.Probe name Sequence Length G+C % TmRD4 [CY5-5]CAACACTCTTGGAGTGGCCTACAACGGC 3[BHQ2] 28 57 74BCG [6FAM]CGACGATTGGCACATCCAGCCGCCCGGATC[BHQ1] 30 67 87.8Microti [HEX]CGC TGC GCC GAG TCC CAT TTT GTC GC[BHQ1] 26 65 83.5

SID 5 (Rev. 05/09) of 21

Table 5. M. microti strains defined by spoligotyping patterns.

VLA pattern. International M.microti PCR Sequencing of breakpoint.

0 NA* + As expected3 SB0657 + “18 SB0326 + “19 SB0112 + “31 SB0155 + “32 SB0654 + “34 SB0118 + “VNTR patterns 4-3-5-6*-2-2.2 and 9-3-5-7*-1-2.2.

Table 6. Typical parameters of the individual PCR methods and when combined as a multiplex.

Individual PCR RSq value Slope (Y) Efficiency Sensitivity (GE)*M. bovis (RD4) 0.997 -3.394 97.1 4 M. bovis BCG 0.997 -3.411 95.3 4M. microti 0.999 -3.439 95.3 13.4

PCR as part of MultiplexM. bovis RD4 0.997 -3.570 90.5 4M. bovis BCG 0.995 -3.515 92.5 4M. microti 0.994 -3.411 95.4 13.4*Standards within linear range of standard curve.

Table 7. The effect of addition of selected inhibitors on internal control spikes added to individual PCR methods of the multiplex assay. Note that expts. with / without BSA were performed separately on different days with different control spike values.

PCR Control Ct (Plateau range)

Bile Ct (Plateau range)

Heparin Ct(Plateau range)

Tannic acid Ct(Plateau range)

RD4- BSA

22.21(877-1055)

21.80(526-952)

21.79(842-960)

No Ct(nil)

BCG-BSA

22.88(4300-4800)

21.13(4815-5327)

21.88(5080-5325) (674-4541)

Microti-BSA

31.48(3019-3248)

33.21(1915-2630)

32.85(2694-2962)

No Ct(nil)

RD4+BSA

26.39(1351-1455)

26.24(1345-1658)

26.22(1342-1406)

26.35(930-1539)

BCG+BSA

26.55(5951-6246)

26.28(6256-7239)

26.14(6253-6555)

26.34(4579-6897)

Microti+BSA

28.79(3035)

28.72(3254-3578)

29.19(3284-3391)

29.72(1497-3370)

SID 5 (Rev. 05/09) of 21

Table 8. Multiplex assay + presence of BSA in master mix.

PCR target -BSA RSq value Slope Efficiency % Min.detection (GE)

RD4 0.999 -3.495 93.3 0.4BCG 0.998 -3.26 102.7 0.4Mic 0.995 -3.37 98.2 5.1

PCR target + BSARD4 0.990 -3.530 92.0 4BCG 0.991 -3.086 110.9 0.4Mic 0.993 -3.191 105.8 5.1

References to published material

SID 5 (Rev. 05/09) of 21

9. This section should be used to record links (hypertext links where possible) or references to other published material generated by, or relating to this project.Al-Soud WA, Rådström P. Purification and Characterization of PCR-Inhibitory Components in Blood Cells. J.Clin.Microbiol. 39: 485-493, 2001.

Brodin P, Eiglmeier K, Marmiesse M, Billault A, Garnier T, Niemann S, Cole ST, Brosch R. Bacterial artificial chromosome-based comparative genomic analysis identifies Mycobacterium microti as a natural ESAT-6 deletion mutant. Infect Immun. 70: 5568-5578, 2002.

Cavanagh R, Begon M, Bennett M, Ergon T, Graham IM, De Haas PE, Hart CA, Koedam M, Kremer K, Lambin X, Roholl P, Soolingen Dv D. Mycobacterium microti infection (vole tuberculosis) in wild rodent populations. J. Clin. Microbiol. 40: 3281-3285, 2002.

Donoghue HD, Overend E, Stanford JL. A longitudinal study of environmental mycobacteria on a farm in south-west England. J. Appl. Microbiol. 82: 57-67, 1997.

Garnier T, Eiglmeier K, Camus JC, Medina N, Mansoor H, Pryor M, Duthoy S, Grondin S, Lacroix C, Monsempe C, Simon S, Harris B, Atkin R, Doggett J, Mayes R, Keating L, Wheeler PR, Parkhill J, Barrell BG, Cole ST, Gordon SV, Hewinson RG. The complete genome sequence of Mycobacterium bovis. Proc. Natl. Acad. Sci. U S A. 2003 Jun 24;100(13):7877-82. Epub 2003 Jun 3.

Jahans K, Palmer S, Inwald J, Brown J, Abayakoon S. Isolation of Mycobacterium microti from a male Charolais-Hereford cross. Vet. Rec. 155: 373-374, 2004.

Kox LFF, Jansen HM, Kuijper S, Kolk AHJ. Multiplex PCR method for immediate identification of the infecting species in patients with mycobacterial disease. J.Clin.Microbiol. 35: 1492-1498, 1997.

Kreader CA. Relief of Amlification Inhibition in PCR with bovine serum albumin or T4 Gene 32 Protein. Appl. Environ. Microbiol. 62: 1102-1106, 1996. Nolan T, Hands RE, Ogunkolade W, Bustin SA. SPUD: a quantitative PCR assay for the detection of inhibitors in nucleic acid preparations. Anal Biochem. 351: 308-310, 2006. Epub 2006 Feb 20.

Pacciarini ML, Boniotti MB, Gaffuri A, Tagliabue S, Zanoni M, Sala G. Detection and genotyping of Mycobacterium tuberculosis complex in lymph nodes of wild boar (Sus Scrofa) populations in Lombardy region. Poster 68 at: European Society of Mycobacteriology, 27th Annual Congress, 9-12th July, 2006, University of Greenwich, London, UK.

Taylor C, Jahans K, Palmer S, Okker M, Brown J, Steer K. Mycobacterium microti isolatedfrom two pigs. Vet. Rec. 159: 59-60, 2006.

Taylor GM, Worth DR, Palmer Si, Jahans K, Hewinson RG. Rapid detection of Mycobacterium bovis DNA in cattle lymph nodes with visible lesions using PCR. BMC Veterinary Research 3: 12, 2007.doi:10.1186/1746-6148-3-12.

SID 5 (Rev. 05/09) of 21

http://www.ncbi.nlm.nih.gov/pubmed/16524557?ordinalpos=2&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum

http://www.ncbi.nlm.nih.gov/pubmed/16524557?ordinalpos=2&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum

general enquiries on this form should be made...

Documents