generation and characterization of a single gene-encoded...

3118s Vol. 5, 3118s-3123s, October 1999 (Suppl.) Clinical Cancer Research

Generation and Characterization of a Single Gene-encoded Single- Chain-Tetravalent Antitumor Antibody I

A m e u r f i n a D. Santos , z S. V. S. K a s h m i r i ,

Pa tr i e ia H o r a n H a n d , J e f f r e y S c h l o m , a n d

E d u a r d o A. P a d l a n 3 Laboratory of Molecular Biology, National institute of Diabetes and Digestive and Kidney Diseases [A. D. S., E. A. P.] and Laboratory of Tumor Immunology and Biology, National Cancer Institute [S. V. S. K., P. H. H., J. S.], NIH, Bethesda, Maryland 20892

Abstract Monoclonal antibody (mAb) CC49, a murine IgG1,

reacts with the tumor-associated glycoprotein-72 expressed on a variety of carcinomas. In clinical trials, radiolabeled CC49 has shown excellent tumor localization to a variety of carcinomas. To minimize the immunogenicity of CC49 mAb in patients, a humanized CC49 (HuCC49) was generated by complementarity-determining region (CDR) grafting. The relative affinity of HuCC49 was 2-3-fold less than that of the murine mAb. With the aim of improving tumor targeting, attempts have been made to enhance the avidity of the HuCC49 mAb. Previous research has yielded a single gene- encoded immunoglobulin, SCIgcCC49ACH1, which is a dimer of a single chain consisting of CC49 single-chain Fv linked to the NH 2 terminus of the human 3'1 Fc through the hinge region. This molecule is comparable to the mouse- human chimeric CC49 in terms of in vitro antigen binding properties, cytolytic activity, and rate of plasma clearance in athymic mice bearing human tumor xenografts. Recently, a single gene encoding a single-chain immunoglobulin consisting of a HuCC49 diabody attached to human 3"1 Fc via the hinge region was constructed. The diabody, a bivalent antigen-binding structure, is made up of variable heavy (Vn)/ variable light (VL) domains and VL/Vn domains. In each of the variable domain pairs, the Vn and VL domains are linked through a short linker peptide. Meanwhile, the two pairs are linked via a 30-residue Gly-Ser linker peptide to yield two antigen-binding sites by lateral and noncovalent association of the V L of one pair with the VH of the other. Transfectomas expressing the single-gene immunoglobulin secrete a homodimer of about M r 160,000 that reacts to tumor-associated glycoprotein-72. This tetravalent humanized antitumor immunoglobulin molecule may potentially be

i Presented at the "Seventh Conference on Radioimmunodetection and Radioimmunotherapy of Cancer," October 15-17, 1998, Princeton, NJ. 2 Present address: Institute of Molecular Biology and Biotechnology, College of Science, University of the Philippines, Diliman, l l01 Quezon City, Philippines. 3 To whom requests for reprints should be addressed, at National Insti- tute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD 20892. Phone: (301) 402-1780; Fax: (301) 496-0201; E-mail: eap @ vger.niddk.nih.gov.

an efficacious therapeutic and diagnostic reagent against a wide range of human carcinomas.

In troduct ion mAb 4 CC49, a murine IgG1K (1), reacts with the pancar-

cinoma antigen TAG-72 expressed on a variety of carcinomas including adenocarcinomas of the gastrointestinal tract, ovary, breast, endometrium, pancreas, and lung (2). This high-affinity antitumor antibody efficiently targets human colon carcinoma xenografts in nude mice (3). In clinical trials, mAb CC49 has shown excellent tumor localization of carcinomas of the gastrointestinal tract, ovary, and prostate. 125I-labeled CC49 has de-

tected 90% of tumors in patients with primary and metastatic colorectal cancer (4). However, as expected of a routine mAb, CC49 elicits H A M A responses in patients (5, 6). H A M A responses render repeated mAb administration ineffective due to an increased rate of antibody clearance from the serum and may also cause allergic reactions in patients, cCC49 mAb was developed to minimize the HAMA response in patients. Later, a HuCC49 mAb was generated by grafting the CDRs of mAb CC49 onto V L and V H frameworks of the human mAbs LEN and 21/28'CL (7). However, the relative affinity of HuCC49 was 2-3-fold lower than that of the murine or cCC49 mAbs.

In an earlier development, a sFv fragment was derived from the murine mAb CC49 and showed rapid plasma and whole body clearance rates in mice and rhesus monkeys (8). The monomeric CC49 sFv and Fab' have an approximately 8-fold lower equilibrium association constant than that of the dimeric forms of the molecule. Later, a single gene-encoded SCIg (SCIgcCC49ACH1; Ref. 9) was developed, which is a homodimer of a single-chain protein consisting of the CC49 sFv linked to the NH 2 terminus of the human Fcy 1 region through the hinge region. This molecule is comparable to cCC49 in terms of in vitro antigen-binding properties, cytolytic activity, and rate of plasma clearance in athymic mice bearing human tumor xenografts.

To enhance the clinical utility of HuCC49, it is desirable to increase its antigen binding affinity. Because the intact CC49 immunoglobulin, a bivalent molecule, has an 8-fold higher relative binding affinity than the monovalent CC49 sFv (8), one way of enhancing the antigen binding activity of HuCC49 could be by increasing its valency for the antigen. Dimeric antibody fragments or diabodies were designed by generating a pair of antigen-binding sites from two polypeptide chains comprising

4 The abbreviations used are: mAb, monoclonal antibody; TAG, tumor- associated glycoprotein; CDR, complementarity-determining region; sFv, single-chain Fv; V H, variable heavy; V L variable light; HAMA, human antimurine antibody; cCC49, mouse-human chimeric CC49; HuCC49, humanized CC49; SCIg, single-chain immunoglobulin; CHOdhfr-, dihydrofolate reductase-deficient Chinese hamster ovary; CMV, cytomegalovirus; BSM, bovine submaxillary mucin.

Research. on June 30, 2019. © 1999 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

Clinical Cancer Research 3119s

!VL ]! vt.~ ,' , \ ,,

Fig. 1 Schematic diagram of the single gene-encoded SCIgHuCC49db mAb. V L and V H, variable region light- and heavy-chain domains; CH2 and CH3, heavy-chain constant region domains of human IgG1.

the VL/V H and VH/V L domains (10). The VH and VL domains of one polypeptide chain were forced to pair with complementary domains of the other chain by linking the domains within each polypeptide through a linker that was 5 amino acid residues in length. Direct evidence of the structure of the diabody was later provided by crystallographic studies (11). Combining the diabody approach with the technique of generating SCIgs would make it feasible to develop a tetravalent HuCC49.

In this report, we describe the development of a single gene-encoded, SCIg designated SCIgHuCC49db, consisting of a HuCC49 diabody with the COOH terminus of one V L domain linked to the NH 2 terminus of the human "y1 Fc via the hinge region (Fig. l). This bivalent antigen-binding structure is made up of a set of VL/VH domains linked to a combination of VH/V L domains. A short Gly-Ser peptide linker of 5 amino acid residues was used to link the heavy and light variable domains within each set, whereas the two sets of domains were linked via a Gly-Ser linker peptide that was 30 residues long. This arrange- ment led to the formation of two antigen-binding sites by lateral and noncovalent association of the V L of one pair with the V~ of the other. Transfectomas expressing the single-gene expression construct secreted a homodimer with tetrameric binding sites for TAG-72. The relative binding affinity of SCIgHuCC49db was approximately 20-fold higher than that of HuCC49.

Materials and Methods mAbs and Cell Lines. CHOdhfr- cells were obtained

fi-om American Type Culture Collection (Manassas, VA) and maintained in DMEM/F12 (Life Technologies, Inc., Grand Is- land, NY) supplemented with 0.1 fXN hypoxanthine, 0.01 ~xm thymidine, and 10% fetal bovine serum. The medium was also supplemented with 100 units/ml penicillin and 100 Ixg/ml streptomycin. The generation and properties of murine CC49 (1), HuCC49 (7), and SCIgcCC49ACH1 (9) mAbs have been described previously. The horseradish peroxidase-conjugated goat antihuman IgG (Fc'y fragment-specific) and purified polyclonal human IgG were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA).

Synthetic Oligodeoxynucleotide Primers for DNA Am- plification. The reverse phase cartridge-purified oligonucleotide primers were supplied by Gene Probe (Gaithersburg, MD). Primer sequences "-are as follows: (a) primer 1 (5' VL1, coding), 5'-GTC- GAA TTCATTCCATGGATAGCCAGGCCC AGGTGCTC-3 '; (b) primer 2 (3' VI1, noncoding), 5'-GCTGCCACCTCCACCTTT- CAGTTCCAGCTT-3'; (c) primer 3 (5' V.2, coding), 5'-GGTG- GAGGTGGCAGCCAGGTCCAGCTGGTG-3'; (d) primer 4 (3' V~ 72, noncoding), 5'-CTCCTCCACCCGAGCCTCCGCCTCCCG- AGCCACCGCCTCCGCTGCCTCCGCCTCC 3'; (e) primer 5 (5' V H1, coding), 5'-CGGAGGCTCGGGTGGAGGAGGTTCTGGT- GGAGGAGGTAGCGGCGGTGGTGGATCTCAGGTCCAG- CTGGTG-3'; @ primer 6 (3' VH1, noncoding), 5'-AGATC- CGCCACCACCGCTGGAGACGGTGAC 3'; (g) primer 7 (5' VL2 Fc, coding), 5'-GGTGGTGGCGGATCTGACATCGT- GATGAGC-3'; and (h) primer 8 (3' VL2 Fc, noncoding), 5'GTA- GAA TTCttatcaTFFACCCGGAGACAGGGAGA GGCT-3'.

The overlapping complementary sequences are underlined. The (Gly4-Ser) linker is encoded by the overlap of primers 2 and 3, as well as primers 6 and 7. The long peptide linker (Gly 4- Ser)6 is encoded by primers 4 and 5. The EcoRI recognition sequence is italicized, whereas the stop codons are in lowercase letters. In the text, the oligonucleotide primers will henceforth be referred to by their designated numbers.

Templates for DNA Amplification. To develop a single gene encoding SCIgHuCC49db, sequences encoding the VL1 and VH1 domains were generated by amplifying the VL and V H sequences from the construct pBac9HuCC49sFv, a baculovirus expression construct of HuCC49 sFv. 5 The VL1 sequence was amplified along with its leader sequence. A previously made construct, pdhfrSCIgHuCC49ACH1, was used as a template to generate the humanized VL 2 and VH2 sequences by PCR amplification. 6 The VL2 sequence was amplified along with the human -y I hinge and Fc sequences located contiguously 3' to the humanized V L sequence.

PCR. The PCR amplification of DNA sequences was carried out by a procedure that has essentially been described previously (9), except for some changes in the parameters of the reaction. Briefly, a 50-1xl reaction mixture containing 200 IxM of each deoxynucleotide triphosphate, 0.2 IxM of each primer, 1 unit of Vent polymerase (New England Biolabs, Beverly, MA), and 50 ng of template DNA was subjected to a 30-s denaturation step at 95~ followed by 30 cycles of denaturation (30 s at 95~ annealing (40 s at 55~ and extension (1 min at 72~ This was followed by a final primer extension for 15 min at 72~ Each of the amplified products was purified with the Wizard PCR preps DNA purification system (Promega, Madi- son, WI).

Expression Vector and Transfection. The expression vector pdhfr, which is derived from the ptasmid pRC/CMV (Invitrogen, Carlsbad, CA), has been described previously (12). It harbors an enhancer-promoter complex of the immediate early genes of the human CMV for the expression of the target gene.

5 R. Bei, M. Giuliano, J. Schlom, and S. V. S. Kashmiri, unpublished results.

H-S. Lee, J. Schlom, and S. V. S. Kashmiri, unpublished results.



3120s Tetravalent Antitumor Antibody CC49

The ptasmid also carries a dhfr expression unit driven by an enhancer-deficient SV40 early promoter and a neomycin resist- ance gene. CHOdhfr- cells, which were seeded at a density of 1 • 106 cells/60-mm Petri dish the night before transfection, were transfected with 10 p.g of DNA and 30 Ixl of N-[I-(2,3- dioleoyloxyl)propyl]-N,N,N-trimethylammoniummethyl sulfate cationic liposome reagent (Boehringer Mannheim, Indianapolis, IN) in 150 txl of HEPES-buffered saline, according to the supplier's instructions. After culturing the cells at 37~ with 5% CO2 for 16-18 h, the medium was replaced, and the cells were cultured for another 48 h. Subsequently, the cells were seeded into flat-bottomed 96-well plates at a density of 2.4 • l03 cells/well in oLMEM containing 10% dialyzed fetal bovine serum, 20 mM HEPES, 550 txg/ml G418 (Life Technologies, Inc.), and penicillin/streptomycin.

Protein Purification. Tissue culture supernatants were loaded onto a protein G-agarose column (Life Technologies, Inc.). The protein was eluted with 0.1 M glycine buffer (pH 2.5) and the pH value of the eluate was immediately adjusted to 7.0 using 1.0 M Tris (pH 8.0). After the fractions were collected, those containing recombinant proteins (as determined by ELISA) were pooled and concentrated using a Centricon 30 microconcentrator (Amicon, Beverly, MA). Protein concentra- tion was determined using Coomassie Plus Protein Assay Rea- gent (Pierce, Rockford, IL). The purity of the eluted protein was determined by analysis on precast 4-20% SDS-polyacrylamide Tris glycine gel (Novex, San Diego, CA) under reducing and nonreducing conditions. Proteins on the gel were visualized with Coomassie Brilliant Blue R-250.

ELISA Assay. ELISA assays were carried out as described previously (7). Individual wells of the 96-well polyvinyl microtiter plates were coated overnight at 4~ with 1.0 txg/well of the TAG-72-positive BSM I-S (Sigma, St. Louis, MO) in coating buffer (1% BSA in PBS). The plates were blocked with 5% BSA in PBS for 1 h at 37~ washed with PBS containing 1% BSA, and then incubated with 50 ~1 of culture supernatant of the transfectants for 1 h at 37~ After washing, the plates were incubated with 50 r of horseradish peroxidase-conjugated goat antihuman IgG (Fc~ fragment-specific; Jackson ImmunoResearch Laboratories) diluted 1:3000. After 1 h, 100 p~l of ELISA substrate buffer (0.02 M citric acid and 0.05 M Na2HPO4) containing 0.03% H202 and 50 pog of the substrate o-phenylenediamime hydrochloride were added per well. The enzyme reaction was stopped by adding 25 Ixl of 4 N H2SO 4. The absorbance was read at a wavelength of 490 nm.

Competition Immunoassay. For competition assay, biotinylated murine mAb CC49 was used as the labeled antibody, and the TAG-72-positive BSM was used as the target antigen. The remainder of the assay was performed as described previously (13). Briefly, 96-well polyvinyl microtiter plates were coated with BSM I-S, blocked with BSA, and washed as described earlier in this study. Twenty-five ~1 of the serially diluted test samples in PBS with 1% BSA or buffer control were added to individual wells, followed by 25 lxl of 1% BSA in PBS containing 100 ng of biotinylated mouse mAb CC49. Plates were incubated overnight at 4~ wells were washed, and 50 Ixl of the Vectastain ABC complex (Vector Laboratories, Burl- ingame, CA) were then added to each well. After 1 h of incubation at 37~ wells were washed, and the peroxidase

activity was assayed as described earlier. The percentage inhibition of labeled mAb CC49 binding to the TAG-72 antigen was calculated as described previously (9).

Results The Design of a Tetrameric Immunoglobulin,

SCIgHuCC49db. The homodimeric immunoglobulin-like molecule with tetravalent antigen-binding sites is presented schematically in Fig. 1. The design of the SCIg consists of two sets of variable domains: (a) VL1/VH2; and (b) VHI/VL2. In the VL1/VH2 set, the COOH terminus of the VL1 is covalently linked to the NH 2 terminus of the VH2. In the other set, the COOH terminus of the VH 1 is linked to the NH 2 terminus of the VL2. The variable domains within each set are linked together by a 5-residue (Gly4-Ser) linker. A 30-residue-long (Gly4-Ser)6 peptide linker tethers the COOH terminus of the VH2 to the NH 2 terminus of the VHI domain. The COOH terminus of the VL2 is joined to the NH 2 terminus of the CH2 domain of the human 3,1 Fc via the hinge region. Thus, the VL1, VH2, VH1, VL2, and human "yl Fc domains are part of a single peptide chain, and they are placed in the given order from the NH 2 terminus. The linker joining the variable domains within each set is too short to allow quaternary interaction and proper folding of the V L and the V H domains of the same set. The V L and V H domains are forced to pair with the complementary domains of the other set by lateral and noncovalent association.

In this SCIg, as in SCIgcCC49ACH1 (9) and cCC49- interleukJn 2 (14), the Cys 22~ of the genetic hinge, which held the heavy and light chains of native antibody together, was replaced with a Pro residue. Cys 226 and Cys 229, which provide the disulfide bonds between the two heavy chains, were re- tained.

Generation of a Single-Gene Construct Encoding mAb SCIgHuCC49db. A schematic flow diagram for the generation of the gene encoding mAb SCIgHuCC49db and its expression construct is shown in Fig. 2. Briefly, sequences encoding VH1 and VL1, along with its leader, were amplified using the construct pBac9HuCC49sFv as a template, whereas VH2 and VL2, along with the human Fc sequence, were amplified using the construct pdhfrSCIgHuCC49ACH1 as a template. The latter is a 1089-bp PCR product. Primers 2 and 3 have a 15-bp complementary overlap, which encoded the (Gly4-Ser) linker peptide. Primers 4 and 5 carried a 20-bp complementary overlap, and each encoded a part of the (Gly4-Ser)6 linker peptide. Using VL1, VH2, and VH1 amplified DNA fragments as templates and primers 1 and 6 as 5'- and 3'-end primers, a single 1.2-kb DNA fragment encompassing all three sequences was generated. The 3'-end of the 1.2-kb PCR product and the 5 '-end of the 1089-bp PCR product have a 15-bp complementing overlap encoding the (Gly4-Ser) linker peptide. Using these PCR products as templates and primers 1 and 8 as the 5'- and 3'-end primers, a final 2.3-kb DNA sequence encoding Vcl , VH2, VR1, VL2, and Fc domains was amplified. The final PCR product, a 2.3-kb DNA fragment, was purified, digested with EcoRI, and inserted into the pCdhfr expression vector at the EcoRI site located downstream from the CMV promoter. The insert in the resulting expression construct, pCdhfr SCHuCC49dbFc~/1, was sequenced using the Sequenase v.2




EcoR I 5~1~

1 ~ LK~s VH1 I I I1 I

L VL1 ~ 2 ~ ' ~ 6 pBac9HuCC49sFv

EcoR I

L VL1 VH2 VH1 399 bp 390 bp 390 bp

A n n e a l i n g

1 ~ VL1 VH1

VH2

3X.~ 7 , ~ LK~ VL2 FC

I II I I v ~ * ~ 4 ~ - ~

pdhfrSCIgHuCC49ACH1 EcoR1

~ P C R EeoR,

I~ I II VL2 Fc

1089 bp

PeR

EcoR I ! I l l l{ I l k"q

L VL1 LKs VH2 LK~o VH1

1.2 kb

1._~.

Ec;R I

k~ I II Fc VL2

~ Annealing

IIIII1111

~ PCR

EcoF~ I SCIgHuCC49db EcoRI

I'll II I I I1 I I'1 L Vkl LKs VH2 Lifo VH1 kKs VL2 Fc

2.3 kb

ECOR I - l inearized pdhfr ~ ' ~ l E c o R I

I SCIgHuCC49db

CMV BGH pA

~ R I E C O ~

"t J- Amp

pdhfr-SCIgHuCC49db

Fig. 2 Schematic representation of the generation of the construct encoding the diabody SCIgHuCC49db. Horizontal numbered arrows, primers for DNA amplification described in "Materials and Methods;" L, leader peptide; LK5, the (GlY4-Ser) linker; LK15, the (Gly4-Ser)~ linker; LK30, the (Gly4-Ser)6 linker; Amp, ampicillin ~ gene; Neo, neomycin ~ gene; CMV, human CMV promoter; dhfr, dihydrofolate reductase gene; BGHpA, bovine growth hormone polyadenylation signal.

system (Amersham Life Science, Arlington Heights, IL), and the construct was used for the transfection of the CHOdhfr- cells.

Development of Transfectomas and Purification of the Antibody. The expression vector pCdhfr-SCIgHuCC49db was introduced into the CHOdhtu cells by lipofection. Two weeks of drug selection yielded 20 (5.2%) G418+-resistant clones from a total of 384 clones. ELISA assay of culture supernatants from the drug-resistant clones showed that 10 of the clones were positive for binding to TAG-72. The clone that

A k D a

2 2 5 ,

1 0 0 ,

5 0 ,

25

M 1 2 3

B k D a

2 2 5 - 150 - 1 0 0 -

7 5 - 5 0 - 3 5 - 2 5 -

M 1 2 3 ............................ ~;~ ~

Fig. 3 SDS-PAGE analysis under nonreducing (A) and reducing (B) conditions. Purified antibodies were electrophoresed on a 4%-20% precast gel. Lanes M, markers [left, size (in kilodaltons)]; Lanes 1, SCIgHuCC49db; Lanes 2, HuCC49; Lanes 3, SCIgcCC49ACH1.

secreted the highest titer of the TAG-72-reactive immunoglobulin was adapted for growth in serum-free medium (CHO-S- SFMII; Life Technologies, Inc.). The antibody was purified from the serum-free culture supernatant by protein G affinity chr~omatography. The yield was about 1 Ixg antibody/ml culture supernatant.

Physical Characterization. The size and purity of the protein G column-purified antibody was determined by SDS- PAGE. HuCC49 and SCIgcCC49ACH1 were included in the analysis for comparison (Fig. 3). Under nonreducing conditions (Fig. 3A), each of the three molecules showed a single band of apparently high molecular mass (Lanes 1-3). SCIgHuCC49db (Lane 1) showed significantly slower migration than HuCC49 (Lane 2), whereas SCIgcCC49ACH1 (Lane 3) is the fastest- migrating molecule of the three. The single band obtained with SCIgHuCC49db was consistent with a molecular weight of approximately 160,000. Under reducing conditions (Fig. 3B), HuCC49 (Lane 2) shows two distinct bands of 25-27 and 50-55 kDa corresponding to the heavy and light chains of an IgG1 molecule. In contrast, each of the SCIgHuCC49db and SCIgcCC49ACHI yielded a singte band with a molecular mass of approximately 80 and 60 kDa, respectively (Lanes 1 and 3). The single band of SCIgHuCC49db (Lane 1) showed significantly slower migration than the band yielded by mAb SCIgcCC49ACH1 (Lane 3), which, in turn, showed a slower migration than that of the heavy chain of HuCC9 (Lane 2). These results provide convincing evidence that mAb SCIgHuCC49db is expressed as a single-chain protein of approximately 160 kDa and is assembled as a homodimer before secretion.



3122s Tetravalent Antitumor Antibody CC49

6O

e~ , m e -

C : 4O

SCIgHuCC49db = murlne CC49

HulgG HuCC49 SCIgcCC49dCH1

/

-2O . . . . . . . . , . . . . . . . . , . . . . . . . . , . . . . . . . .

01 .1 1 10 100

nm

Fig. 4 Competition assay for binding of SCIgHuCC49db to TAG-72 antigen. The unlabeled antibodies were used in increasing concentra- tions to compete for the binding of biotinylated murine mAb CC49 to the TAG-72-positive BSM. Binding activity was analyzed by absorbance at 490 nm.

Relative Antigen Binding Affinity. Competition assays were performed to determine the relative binding affinity of SClgHuCC49db, SCIgcCC49ACHI, HuCC49, and the murine mAb CC49 to TAG-72 antigen. Unlabeled immunoglobulins were used to compete with biotinylated murine mAb CC49 for binding to the TAG-72-positive BSM. As shown in Fig. 4, all four mAbs competed completely, and the competition profiles of all four competitors showed similar slopes, indicating that these mAbs bind to the same TAG-72 epitope. Approximately 0.6 nanomole of SCIgHuCC49db was required for 50% inhibition of the binding of biotinylated murine CC49 to TAG-72. In contrast, 4.3-, 5.8-, and 20-fold more of SCIgcCC49ACHl, murine CC49, and the CC49 mAbs, respectively, were required to achieve a similar level of inhibition. The negative control antibody, human lgG1, did not compete with the biotinylated murine CC49. These results demonstrate the higher relative binding affinity of SCIgHuCC49db compared with other immunoglobulin forms of CC49.

Discussion For an antibody to be an effective therapeutic reagent

against human cancers, it must have minimal immunogenicity to allow repeated antibody administration, optimal antigen affinity and rate of clearance for efficient tumor targeting, and the ability to recruit human effector cells for tumor cytolysis.

To minimize immunogenicity of mAb CC49 in patients, a HuCC49 mAb was developed by grafting the CDRs of mAb CC49 onto V L and V H frameworks of mAbs LEN and 21/28'CL (7) The relative affinities of CC49 and HuCC49 were 2-3-fold less than that of nmrine CC49. To enhance the clinical potential of HuCC49, it was deemed desirable to increase its functional antigen binding affinity. It has been suggested that the functional affinity of an antibody depends on its valency for its ligand (15, 16). Enhancement of the functional affinity of biva-

lent antibodies has been achieved by multimerization of the antigen-binding site (17-20). Antibodies with multimeric binding sites have been developed by chemical cross-linking of antibody fragments or by genetically engineering "miniantibod- ies" and diabodies (for a review, see Ref. 21). To develop a molecule with higher valency, a tetravalent HuCC49 has now been generated. The design of this molecule is based on the structure of a SCIg, SCIgcCC49ACH1, that has been reported previously (9).

Unlike the homodimeric SCIgcCC49ACH1, whose single- chain protein consists of CC49 sFv linked to human y l Fc, the newly generated SCIgHuCC49db is a homodimer of a single- chain protein consisting of a HuCC49 diabody (10) genetically tethered to the human -/1 Fc. Because the diabody is a bivalent molecule, the homodimeric SCIgHuCC49db is tetravalent for its ligand, TAG-72. The HuCC49 diabody is made up of two sets of variable domains, VL/V H and VH/V L, linked together via a 30-amino acid peptide linker, whereas a 5-residue linker tethers the two variable domains to each other within each set. Because the linker within each set is too short to allow pairing of variable domains within the set, the variable domain of one set associates laterally and noncovalently with the complementary variable domains of the other set to generate two antigen-binding sites. The SDS-PAGE profile of SCIgHuCC49db presented in Fig. 3 provides convincing evidence that the tetravalent antibody is a homodimeric molecule. Under nonreducing conditions, SDS- PAGE analysis of this molecule showed a single band of approximately 160 kDa. Under reducing conditions, a distinct single band of approximately 80 kDa was detected. These data provide support tbr the schematic model presented in Fig. 1.

It has been shown that blocking of the NH 2 terminus of the V L or VH domain could adversely affect the antigen binding property of some antibodies (22, 23). In a single-chain diabody construct, the blocking of the NH 2 termini of all variable domains except the first one is inevitable. Therefore, in designing a single-chain diabody, the effect of blocking the NH2 temfini on the ligand binding property is of critical consideration. For mAb CC49, it has previously been demonstrated that the blocking of the NH 2 terminus of either VL(9) or VH 5 has no effect on its antigen binding property. Results of the competition assay (Fig. 4) show that mAb SCIgHuCC49db has a higher functional affinity for TAG-72 than murine CC49, SCIgcCC49zkCH1, or HuCC49 mAbs. Compared with HuCC49, the functional binding affinity of SCIgHuCC49db is approximately 20-fold higher. This significantly higher avidity of SCIgHuCC49db is consistent with the fact that mAb CC49 recognizes at least two epitopes of TAG-72 (24); the spatial configuration of the four binding sites of SCIgHuCC49db in a computer-generated model (data not shown) suggests that all four combining sites of this molecule could simultaneously bind to a multiepitopic antigen.

The single-chain mAb SCIgHuCC49db carries a human -,/1 Fc region. Hence, it is likely to be competent in cytolytic functions, such as antibody-dependent T-cell-mediated cytotoxicity and complement-dependent cytotoxicity. A similarly designed single-chain antibody, SCIgcCC49ACH1, was shown to mediate antibody-dependent T-cell-mediated cytotoxicity against carcinoma cell lines expressing TAG-72 on their cell surface. Exposure of human effector cells to interleukin 2 aug- mented the antibody-mediated lysis of the target cells (9).




The i m m u n o g e n i c i t y of S C I g H u C C 4 9 d b has yet to be evaluated. Because it is a h u m a n i z e d ant ibody, it is l ikely to be less i m m u n o g e n i c than its mur ine and ch imer ic counterpar ts . However , the possibi l i ty that it m a y elicit an ant i - idiotypic

response in pat ients cannot be ruled out at the present t ime. These studies demons t ra te that, for some ant ibodies , an

e n h a n c e m e n t of funct ional affinity cou ld be ach ieved by mul- t imer iza t ion of the an t igen-b inding site via d iabody format ion .

Because s ingle-chain S C I g H u C C 4 9 d b has an enhanced func- t ional aff ini ty and is l ikely to carry out Fc ef fec tor funct ions , it may be an ef f icac ious therapeut ic and diagnost ic reagent against

a wide range of h u m a n carc inomas.

Acknowledgments We thank Nicole Ryder for editorial assistance.

References 1. Muraro, R., Kuroki, M., Wunderlich, D., Poole, D. J., Colcher, D., Thor, A., Greiner, J. W., Simpson, J. F., Molinolo, A., Noguchi, P., and Schlom, J. Generation and characterization of B72.3 second generation monoclonal antibodies reactive with the tumor-associated glycoprotein 72 antigen. Cancer Res., 48: 4588-4596, 1988. 2. Johnson, V. G., Schlom, J., Paterson, A. J., Bennett, J., Magnani, J. L., and Colcher, D. Analysis of a human tumor-associated glycoprotein (TAG-72) identified by a monoclonal antibody B72.3. Cancer Res., 46: 850-857, 1986.

3. Colcher, D., Minelli, M. F., Roselli, M., Muraro, R., Simpson- Milenic, D., and Schlom, J. Radioimmunolocalization of human carcinoma xenografts with B72.3 second generation monoclonal antibodies. Cancer Res., 48: 4597-4603, 1988.

4. Arnold, M., Schneebaum, S., Berens, A., Petty, L., Mojziskik, C., Hinkle, G., and Martin, E. W. Intraoperative detection of colorectal cancer with radioimmunoguided surgery and CC49, a second generation mAb. Ann. Surg., 216: 627-632, 1992. 5. Divgi, E. R., Scott, A. M., McDermott, K., Falloone, P. S., Hilton, S., Siler, K., Carmichael, N., Daghighian, F., Rinn, R. D., Cohen, A. M., Schlom, J., and Larson, S. M. Clinical comparison of radiolocalization of two monoclonal antibodies (mAbs) against the Tag-72 antigen. Nucl. Med. Biol., 21: 9-15, 1994.

6. Mulligan, T., Can-asquillo, J. A., Chung, Y., Milenic, D. E., Schlom, J., Feurstein, I., Paik, C., Perentesis, P., Reynolds, J., Curt, G., Goeckler, W., Fordyce, W., Cheng, R., Riseberg, D., Cowan, K., and O'Shaughnessy, J. Phase I study of intravenous 177Lu-labeled CC49 murine monoclonal antibody in patients with advanced adenocarcinoma. Clin. Cancer Res., 1: 1447-1454, 1995. 7. Kashmiri, S. V. S., Padlan, E. A., Milenic, D. E., Schlom, J., and Hand, P. H. Generation, characterization and in vivo studies of humanized anticarcinoma antibody CC49. Hybridoma, 14: 461-473, 1995. 8. Milenic, D., Yokota, T., Filpula, D. R., Finkelman, M. A. J., Dodd, S. W., Wood, J. F., Whitlow, M., Snoy, P., and Schlom, J. Construction, binding properties, metabolism and tumor targeting of a single-chain Fv derived fi:om the pancarcinoma monoctonal antibody CC49. Cancer Res., 51: 6363-6371, 1991.

9. Shu, L., Qi, C-F., Schlom, J., and Kashmiri, S. V. S. Secretion of a single-gene-encoded immunoglobulin fi'om myeloma cells. Proc. Natl. Acad. Sci. USA, 90: 7995-7999, 1993.

10. Holliger, P., Prospero, T., and Winter, G. "Diabodies": small bivalent and bispecific antibody fragments. Proc. Natl. Acad. Sci. USA, 90: 6444-6448, 1993.

11. Perisic, O., Webb, P. A., Holliger, P., Winter, G., and Williams, R. L. Crystal structure of a diabody, a bivalent antibody fragment. Structure, 2: 1217-1226, 1994.

12. Ryu, C. J., Padlan, E. A., Lin, B. R., Yoo, O. J., and Hong, H. J. A humanized antibody with specificity for hepatitis B surface antigen. Hum. Antibod. Hybridomas, 7." 1 i3-122, I996.

13. Horan Hand, P., Calvo, B., Milenic, D., Yokota, T., Finch, M., Snoy, P., Garmestani, K., Gansow, O., Schlom, J., and Kashmiri, S. V. S. Comparative biological properties of a recombinant chimeric anti-carcinoma mAb and a recombinant aglycosylated wlriant. Cancer Immunol. Immunother., 35: 165-174, 1992.

14. Shu, L., Qi, C-F., Horan Hand, P., Schlom, J., and Kashmiri, S. V. S. Generation and characterization of a single gene-encoded, single-chain immunoglobulin-interleukin-2 fusion protein, hnmuno- technology, 1 :231-241, 1995.

15. Karush, F. Affinity and the immune response. Ann. N. Y. Acad. Sci., 169: 56-64, 1970.

16. Karush, F. The affinity of antibody: range, variability, and the role of multivalence. In: G. W. Litman and R. W. Good (eds.), Comprehensive Immunology, Vol. 5, pp. 85-116. New York: Ple- num Press, 1978.

17. Greenspan, N. S., and Cooper, L. J. Intermolecular cooperativity: a clue to why mice have IgG3? immunol. Today, 13: 164-168, 1992.

18. Wolff, E. A., Esselstyn, J., Maloney, G., and Raft, H. V. Human monoclonal antibody homodimers: effect of valency on in vitro and in vivo antibacterial activity. J. Immunol., 148: 2469-2474, 1992.

19. Adams, G. P., McCartney, J. E., Wolf, E. J., Tai, M. S., Schier, R., Stafford, W. F., Marks, J. D., Bookman, M. A., Huston, J. S., and Weiner, L. M. Influence of avidity on the tumor retention of monospe- cific and bispecific anti-c-erbB-2 single-chain Fv dimers. Proc. Am. Assoc. Cancer Res., 37: 472, 1996.

20. Adams, G. P., Schier, R., McCall, A. M., Crawford, R. S., Wolf, E. J., Weiner, L. M., and Marks, J. D. Prolonged in vivo turnout retention of a human diabody targeting the extracellular domain of human HER2/neu. Br. J. Cancer, 77: 1405-1412, 1998.

21. Pltickthun, A., and Pack, P. New protein engineering approaches to multivalent and bispecific antibody fragments. Immunotechnology, 3: 83-105, 1997.

22. Panka, D. J., Mudgett-Hunter, M., Parks, D. R., Peterson, L. L., Herzenberg, L. A., Haber, E., and Margolies, M. N. Variable region framework differences result in decreased or increased affinity of variant anti-digoxin antibodies. Proc. Natl. Acad. Sci. USA, 85: 3080-3084, 1988.

23. Padlan, E. A. Anatomy of the antibody molecule. Mol. lmmunol., 31: 169-217, 1994.

24. Kuroki, M., Fernsten, F. D., Weinderlich, D., Colcher, D., Simpson, J. F., Poole, D. J., and Schlom, J. Serological mapping of the TAG-72 tumor-associated antigen using 19 distinct monoclonal antibodies. Can- cer Res., 50: 4872-4879, 1990.



1999;5:3118s-3123s. Clin Cancer Res Ameurfina D. Santos, S. V. S. Kashmiri, Patricia Horan Hand, et al. Single-Chain-Tetravalent Antitumor AntibodyGeneration and Characterization of a Single Gene-encoded

Updated version

http://clincancerres.aacrjournals.org/content/5/10/3118s

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/5/10/3118sTo request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



generation and characterization of a single gene-encoded...

Documents