genetic markers in plant breeding
DESCRIPTION
GENETIC MARKERS IN PLANT BREEDING. Marker. Gene of known function and location, or a mutation within a gene that allows studying the inheritance of that gene Genetic information resides in the genome. Genetic Marker. - PowerPoint PPT PresentationTRANSCRIPT
GENETIC MARKERS IN PLANT BREEDING
MarkerGene of known function and location, or a mutation within a gene that allows studying the inheritance of
that geneGenetic information resides in the genome
Genetic MarkerAny phenotypic difference controlled by the genes, that can be used for studying
recombination processes or selection of a more or less closely associated target gene
Genetic Marker Morphological marker Molecular marker
Readily detectable sequence of protein or DNA that are closely linked to a gene locus and/or a morphological or other characters of a plantReadily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment
1. Protein marker 2. DNA marker
Molecular markersMolecular markersR
eso l
utio
nR
eso l
utio
n po
wer
pow
er
allozymes (protein-allozymes (protein-electrophoresiselectrophoresis))
chloroplastDNA PCR-chloroplastDNA PCR-RFLPRFLP
RAPDRAPD(random amplified polymorphic (random amplified polymorphic DNA)DNA)
AFLPAFLP(Amplified Fragment Length (Amplified Fragment Length Polymorphism)Polymorphism)
Microsatellites (SSRs)Microsatellites (SSRs)
SequencingSequencing (SNPs)(SNPs)
non-waxy waxy
Morphological markerMorphological marker (phenotypic/naked eye marker)(phenotypic/naked eye marker)
hulled naked
2-rowed 6-rowed Black white
Karl Von Linne (1707-1778)
Molecular markers
Important aspect:Polymorphism
The existence of two or more forms that are genetically distinct from one another but contained within the same interbreeding population Pattern of inheritance
The pattern of genetic information transmission from parents to progeny
Polymorphism
Polymorphism-Parent 1 : one band-Parent 2 : a smaller band-Offspring 1 : heterozygote =
both bands-Offspring 2 : homozygote
parent 1
Polymorphism
Parent 1 : one band
-Parent 2 : no band
-Offspring 1 : homozygote parent 1
-Offspring 2 : ????
P 2P 1 O 2O 1
Gel configuration
Co-dominant marker
P 2
Gel configurationP 1 O 1 O 2
Dominant marker
Dominant Dominant versusversus Co-dominant Co-dominant
Dominant
No distinction between homo- and heterozygotes possibleNo allele frequencies availableNo allele frequencies available
RAPD
Co-dominantCo-dominant
Homozygotes can be distinguished from Homozygotes can be distinguished from heterozygotes;heterozygotes;
Allele frequencies can be calculatedAllele frequencies can be calculated
microsatellites, SNP, RFLPs
High PolymorphicCo-dominant inheritance
Occurs throughout the genomeReproducible
Easy, fast and cheap to detectSelectivity neutral
High resolution with large number of samplesNondestructive assayNondestructive assay
Random distribution throughout the genome Random distribution throughout the genome Assay can be automatedAssay can be automated
Desirable properties for a good molecular marker
Protein markers
a. Allozyme isoenzymes of proteins nature whose synthesis is usually controlled by codominant alleles and inherited by monogenic ratios. They show a specific banding pattern if separated by electrophoresisb. IsozymeA species of enzyme that exists in two or more structural form, which are easily identified by electrophoretic methods
Genetic markers which based on protein polymorphisms
Seed storage proteins
Isozymes
Proteins Polymorphisms
Isozyme Isozyme
Starch gel of the isozyme malate dehydrogenase (MDH). Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the The numbers indicate first the MDH locus, and next the
allele present (ie. 3-18 is locus 3 allele 18). Some bands are allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).heterodimers (intralocus or interlocus).
Isozyme Isozyme
DNA markerSegments of DNA with an identifiable
physical location on a chromosome and whose inheritance can be followed
Types of DNA Marker can be differentiated based on molecular technique used to develop the marker1.Restriction enzymes2.Hybridization3.PCR4.Sequencing
A marker can be a gene, or it can be some section of DNA with no known function
Chromosome to DNA
DNA structure
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ……….
Stretch of nitrogen fixation gene in soybean
DNA
Gene A Gene B
AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG
MFG
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag
MFG
DNA marker
M1 M2
readily detectable sequence of DNA whose inheritance can be monitored and associated with
the trait inheritance
Image from UV light table
Image from computer screen
Basis for DNA marker technology
•Restriction Endonucleases
•DNA-DNA hybridization
•Polymerase chain reaction (PCR)
•DNA sequencing
RFLP techniques
3
6
2
61 2 43 5
4
5
1MFG
RFLP Polymorphisms interpretation
Advantages and disadvantages of RFLP
• Advantages– Reproducible– Co-dominant– Simple
• Disadvantages– Time consuming– Expensive– Use of probes
RFLP based markers
Examine differences in size of specific DNA restriction fragments
Require pure, high molecular weight DNAUsually performed on total cellular genome
AFLP Markers
Most complex of marker technologies Involves cleavage of DNA with two different
enzymes Involves ligation of specific linker pairs to the
digested DNA Subsets of the DNA are then amplified by PCR The PCR products are then separated on
acrylamide gel 128 linker combinations are readily available Therefore 128 subsets can be amplified
AFLP Markers
Technically demanding Reliable and stable Moderate cost Need to use different kits adapted to
the size of the genome being analyzed.
Like RAPD markers need to be converted to quick and easy PCR based marker
RAPD
• Domimant markers• Reproducibility
problems
Amplifies anonymous stretches of DNA using arbitrary primers
Fast and easy method for detecting polymorphisms
RAPD Polymorphisms among landraces of sorghum
M
Sequences of 10-mer RAPD primers
Name Sequence
OP A08 5’ –GTGACGTAGG- 3’OP A15 5’ –TTCCGAACCC- 3’OP A 17 5’ –GACCGCTTGT- 3’OP A19 5’ –CAAACGTCGG- 3’OP D02 5’ –GGACCCAACC- 3’RAPD gel configuration
RAPD MarkersRAPD Markers
There are other problems with RAPD markers associated with reliability
Because small changes in any variable can change the result, they are unstable as markers
RAPD markers need to be converted to stable PCR markers.
How?
RAPD MarkersRAPD Markers
The polymorphic RAPD marker band is isolated from the gel
It is used a template and re-PCRed The new PCR product is cloned and
sequenced Once the sequence is determined,
new longer and specific primers can be designed
VNTRVNTRVariable Number of Tandem RepeatsVariable Number of Tandem Repeats
Tandem repeats (TR): DNA sequences which are existed in
repeated numbers in the genome• Satellite DNA• Minisatellites• Microsatellites
Variable Number (VN)High polymorphism in number of repeats
VNTRVNTRVariable Number of Tandem RepeatsVariable Number of Tandem Repeats
• Satellite DNA 2-250 bp repeat unit size Constitutes 1- 60% of the genome Some can be separated in CsCl
• ‘satellite band’
• Minisatellites 9-50 bp repeat unit size 100 – 1000 x repeated
• Microsatellites 2-6 bp repeat unit size 10s – 100 x repeated
Microsatellites Short tandem repeats (simple sequence repeat)
• 2 – dinucleotides• 3 – trinucleotides• 4 – tetranucleotides
Randomly distributed in genome Non-coding
• Some within coding sequences Especially trinucleotides
• Some related to diseases Nomenclature
• PerfectGCTAGCCACACACACACACATGCATC
• InterruptedGCTAGCCACACGTCACACACTGCATC
• CompoundGCTAGCCACACATATATGTGTGCATC
Sequence
GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC
ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG
ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA…..
Repeat
GGT(5)
SSR repeats and primers
AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2
P1 P2
SSR polymorphisms
Gel configuration
SNP (Single Nucleotide Polymorphisms)
• Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs.
• Many SNPs have no effect on cell function and therefore can be used as molecular markers.
Hybridization using fluorescent dyesSNPs on a DNA strand
Genetic marker characteristicsCharacteri
sticsMorpholog
ical markers
Protein markers
RFLP markers
RAPD markers
SSR markers
Number of Number of lociloci
LimitedLimited LimitedLimited Almost Almost unlimitedunlimited
UnlimitedUnlimited HighHigh
InheritanceInheritance DominantDominant CodominanCodominantt
CodominanCodominantt
DominantDominant CodominanCodominantt
Positive Positive featuresfeatures
VisibleVisible Easy to Easy to detectdetect
Utilized Utilized before the before the latest latest technologitechnologies were es were availableavailable
Quick Quick assays with assays with many many markersmarkers
Well Well distributed distributed within the within the genome, genome, many many polymorphipolymorphismsm
Negative Negative featuresfeatures
Possibly Possibly negative negative linkage to linkage to other other characterscharacters
Possibly Possibly tissue tissue specificspecific
RadioactiviRadioactivity ty requiremerequirements, rather nts, rather expensiveexpensive
High basic High basic investmentinvestment
Long Long developmedevelopment of the nt of the markers, markers, expensiveexpensive
Developing a Marker
Best marker is DNA sequence responsible for phenotype i.e. gene
If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA
Develop specific primers to gene that will distinguish the two forms
Developing a Marker
If gene is unknown, screen contrasting populations
Use populations rather than individuals Need to “blend” genetic differences
between individual other than trait of interest
Developing Markers Cross individual differing in trait you wish to
develop a marker Collect progeny and self or polycross the
progeny Collect and select the F2 generation for the
trait you are interested in Select 5 - 10 individuals in the F2 showing
each trait Extract DNA from selected F2sExtract DNA from selected F2s Pool equal amounts of DNA from each Pool equal amounts of DNA from each
individual into two samples - one for each traitindividual into two samples - one for each trait Screen pooled or “bulked” DNA with what Screen pooled or “bulked” DNA with what
method of marker method you wish to usemethod of marker method you wish to use
Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait
Loci
Types of traits (types of markers)
MFG
MFG
USES OF MOLECULAR MARKER Clonal identityClonal identity
Parental analysisParental analysis
Family structureFamily structure
Population structurePopulation structure
Gene flowGene flow
HybridisationHybridisation
PhylogenyPhylogeny
Measure genetic diversity
Mapping
Tagging
Genetic DiversityGenetic Diversity Define appropriate geographical scales for Define appropriate geographical scales for
monitoring and management (epidemology)monitoring and management (epidemology) Establish gene flow mechanismEstablish gene flow mechanism
identify the origin of individual (mutation identify the origin of individual (mutation detection)detection)
Monitor the effect of management practicesMonitor the effect of management practices manage small number of individual in ex situ manage small number of individual in ex situ
collectioncollection Establish of identity in cultivar and clones Establish of identity in cultivar and clones
(fingerprint)(fingerprint) paternity analysis and forensicpaternity analysis and forensic
Genetic Diversity
Mapping
The determination of the position and The determination of the position and relative distances of gene on chromosome relative distances of gene on chromosome
by means of their linkage by means of their linkage
Genetic mapA linear arrangement of genes or genetic markers
obtained based on recombinationAn ordering of genes and markers in a linear An ordering of genes and markers in a linear arrangement corresponding to their physical arrangement corresponding to their physical
order along the chromosome, based on order along the chromosome, based on linkagelinkage.. Physical map
A linear order of genes or DNA fragmentsAn ordering of landmarks on DNA, regardless of An ordering of landmarks on DNA, regardless of
inheritance, measured in base pairs.inheritance, measured in base pairs.
Physical Mapping
It contains ordered overlapping cloned DNA fragment
The cloned DNA fragments are usually obtained using restriction enzyme digestion
QTL MappingQTL Mapping
A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics
effects and location
To assist selection
Fundamental Genetics Fundamental Genetics (Background for Linkage Analysis)(Background for Linkage Analysis)
Rule of SegregationRule of Segregation• offspring receive ONE allele (genetic offspring receive ONE allele (genetic
material) from the pair of alleles material) from the pair of alleles possessed by BOTH parentspossessed by BOTH parents
Rule of Independent AssortmentRule of Independent Assortment• alleles of one gene can segregate alleles of one gene can segregate
independently of alleles of other genesindependently of alleles of other genes• (Linkage Analysis relies on the violation (Linkage Analysis relies on the violation
of Independent Assortment Rule)of Independent Assortment Rule)
Linkage AnalysisLinkage Analysis
Goal: Goal:
find a marker “linked” to a disease gene.find a marker “linked” to a disease gene. LOD score = log of likelihood ratioLOD score = log of likelihood ratio LR[θ;data] == k P[data; θ]LR[θ;data] == k P[data; θ] θθ = = estimate of genetic distance estimate of genetic distance
(recombination fraction) between marker and (recombination fraction) between marker and
quantitative traitsquantitative traits
= proportion of recombinant gametes/total = proportion of recombinant gametes/total gametesgametes
Linkage AnalysisLinkage Analysis
Genes near each other on a chromosome tend to be inherited together, that is, they are linked.
Linkage analysis are the techniques used to identify such linkages among genes
Linkage groups which include genetic markers and genes determinative of phenotype allow the identification of determinative alleles (and therefore prediction)
Linkage
Mendel showed that alleles segregate independently. Then he tested genes
Sometimes inheritance of two genes are independent of another, that is phenotype ratios are 9:3:3:1
Sometimes inheritance of two genes are linked together, showing a ratio of 3:0:0:1
Linkage can vary continuously from perfectly correlated to uncorrelated.
Why genes are linked
Alleles are arranged linearly Each parent passes only one of its two
chromosomes to an offspring. Recombination periodically switches
which chromosome in the parent is passed along
Alleles near each other are more likely to be passed along than ones further apart
Alleles on different chromosomes are always inherited independently.
Marker Assisted Selection
Breeding for specific traits in plants and animals is expensive and time consuming
The progeny often need to reach maturity before a determination of the success of the cross can be made
The greater the complexity of the trait, the more time and effort needed to achieve a desirable result.
MASMAS
The goal to MAS is to reduce the The goal to MAS is to reduce the time needed to determine if the time needed to determine if the progeny have traitprogeny have trait
The second goal is to reduce costs The second goal is to reduce costs associated with screening for traitsassociated with screening for traits
If you can detect the distinguishing If you can detect the distinguishing trait at the DNA level you can trait at the DNA level you can identify positive selection very early. identify positive selection very early.
Marker Assisted Breeding
MAS allows for gene pyramiding - incorporation of multiple genes for a
trait Prevents development of biological
resistance to a gene Reduces space requirements - dispose of unwanted plants and
animal early
Trait2.58.47.12.54.52.3
P.1P.2I.1I.2I.3I.4
M. 1133221
M. 2131131
M. 3131123
QTL study
Statistical programs used in molecular marker studies* SAS* ANOVA* Mapmaker* Cartographer
Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH.
QTL MappingQTL Mapping
Recombination picture
Crossover is the alternation of allele generating chromatid (half of chromosome)