Genetic screening

What the spec says about “medical diagnosis”

The use of labelled DNA probes and DNA hybridisation to locate specific genes.

Once located, the base sequence of a gene can be determined by

• restriction mapping• DNA sequencing Looked at last term

Many human diseases result from mutated genes or from genes that are useful in one context but not in another, e.g. sickle cell anaemia.

(you will find out more about this by doing the application exercise on p 273)

DNA sequencing and the PCR are used to produce DNA probes that can be used to screen patients for clinically important genes. The use of this information in genetic counselling, e.g. for parents who are both carriers of defective genes and, in the case of oncogenes, in deciding the best course of treatment for cancers.

(This is covered on p20 in your booklet)

Candidates should understand the principles of these methods. They should be aware that methods are continuously updated and automated

(Eg DNA array, automated sequencing )

Aims for today

• Review genetic counselling from p20 in booklet

• Find out a bit more about DNA arrays• Find out about DNA fingerprinting and profiles

First of all - Southern Blotting

Read the top of p21 in your booklet which describes the process. You do not have to learn the steps in detail but should have an overview of what happens.

It’s just a way of transferring the patterns form the bands of DNA in a gel to a more robust nylon sheet.

DNA array

The different intensities of fluorescence under different colours of laser light indicate different levels of gene expression-enables us to screen lots of samples or one sample with lots of probes

Using gene probes to screen for sickle cell disease

Normal allele

Sickle allele

Darker band where two copies of the sickle allele are found – no band for the normal allele

Genetic fingerprintingAn organism’s genome contains many repetitive, non-coding base sequences.

Theprobability of two individuals having the same repetitive sequences is very low.

The technique of genetic fingerprinting in analysing DNA fragments, that have been cloned by PCR, and its use in determining genetic relationships and in determining the genetic variability within a population.

Candidates should be able to• explain the biological principles that underpin genetic fingerprinting techniques• interpret data showing the results of gel electrophoresis to separate DNA

fragments• explain why scientists might use genetic fingerprints in the fields of forensicscience, medical diagnosis, animal and plant breeding.

Repetitive, non-coding DNA• These are base sequences which don’t code for

proteins, and repeat next to each other over and over again, sometimes thousands of times eg CATGCATGCATGCATGCATG

• The number of repeats differs in each individual, so the length of the sequences will differ

• The pattern of these can be seen on an electrophoresis gel, using a DNA probe specific for a particular repeat

• This is the basis of genetic fingerprinting.

Basic idea: As different pieces of DNA have different lengths of repeated base sequences the distance between recognition sites of restriction endonuclease changes. This means pieces of DNA of different length are produced and these can be compared using gel electrophoresis.

Differences in repetitive, non-coding base sequences

Appearance of the southern blot after a labelled probe for the RFLPs has been added

Short tandem repeats (STRs)

Uses of DNA fingerprinting

• Determining relationships and variability• In forensic science• In medical diagnosis• In animal and plant breeding

Make brief notes under these headings using p 277-279 of your A2 book and/or p 98/99 of the revision guide.

• The next slide shows the results of the very first RFLP (repeated fragment length polymorphisms) analysis which led to a criminal receiving the death sentence in the USA.

• A young couple had been murdered whilst they slept in their car. Their bodies were discovered the next day. A post mortem showed they had both died of gunshot wounds and that the woman had been raped. One man was later arrested driving the couple’s stolen car. Under police questioning, he identified a friend who had been with him on the night of the murders.

• DNA from the semen found in the woman’s body and a DNA sample from each suspect was digested using the same restriction enzyme, and the restriction fragments separated using gel electrophoresis.

• Who did it?

• You will see that the DNA fingerprint of these men does not have the same pattern of restriction fragments as suspect 1 but does have the same pattern as suspect 2.

• On the basis of this evidence, suspect 2 was found guilty of rape and murder and given a double death sentence. The jury at the time was told that the chance of an innocent person showing the same pattern of restriction fragments was about 1 in 9 billion. At the time of the trial, the human population of the world was less than 6 billion.