genetics lecture 8

Microbial Genetics

(Chapter 8)

Lecture Materials

for

Amy Warenda Czura, Ph.D.

Suffolk County Community College

Eastern Campus

Primary Source for figures and content:

Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson

Benjamin Cummings, 2004, 2007, 2010.

Genetics = science of heredity

study of what genes are, how they carry

info, how they are replicated, passed along,

and how expression of the info determines

characteristics of the organism

Genome = all genetic info in a cell

Chromosome = organized unit of genome;

bundle of DNA

bacteria have 1, humans have 46

Genes = segments of DNA that code for

functional products (rRNA, tRNA or

protein)

Genomics = field of genetics involved in

sequencing and molecular characterization

of genomes

Many organisms sequences known: e.g.

E.coli = 4 million bp (~3-4 thousand genes)

Yeast= 12 million bp (~5-6 thousand genes)

Human= 3 billion bp (~30 thousand genes)

DNA = macromolecule, strands of nucleotides

nucleotide = nitrogenous base + deoxyribose +

phosphate

-deoxyribose and phosphate

form linear strand, backbone

-nitrogenous bases hang

off side

-two strands held together by

H-bonding between bases,

forms a double helix, two

strands wound around each

other

-base pairing: A-T, G-C

-bases on one strand determine bases

on the other: the strands are

complementary

-sequence contains genetic info

Features of biological info storage:

1. linear sequence of bases provides actual

genetic info: only four bases but in chain of

X length there are 4X possibilities of

different orders

e.g. chain 2 bases long, using 4 possible

bases, 42 = 16 possible configurations:

AA TA CA GA

AT TT CT GT

AC TC CC GC

AG TG CG GG

2. complementary structure of DNA allows

precise duplication: one strand determines

sequence of other: A-T, G-C

Amy Warenda Czura, Ph.D. 1 SCCC BIO244 Chapter 8 Lecture Notes

Genotype = DNA, genetic makeup

all the genes that can encode characteristics

of an organism, potential properties

Phenotype = protein

the observed outcome of gene expression

the appearance or metabolic capabilities of

an organism

Gene expression = turning the info from the

gene in DNA into the molecule it encodes,

usually a protein

Not all genes are expressed: if not expressed

the gene cannot contribute to the

phenotype

DNA and Chromosomes

-bacteria: usually one chromosome

(yeast -7 humans -46)

-bacterial chromosome is circular DNA with

associated proteins, attached to plasma

membrane

(eukaryotes = linear chromosomes, in nucleus)

-the DNA is ~1000x longer than cell but

chromosome structure is organized to

occupy only 10% of cell volume

DNA Replication

-must replicate DNA to pass genetic info to

progeny cells

-process converts one parental molecule into

two identical daughter molecules

-process is

semi-conservative:

each strand of parental

molecule is template for

new strand, and new

molecules contain half

parental and half new

DNA complementary

base paired

-DNA is a directional molecule

-two strands in double helix are anti-parallel:

run in opposite directions

-directionality

dictated by the

sugar-phosphate

bonds of the

backbone:

P on 5carbon

of nucleotide

gets bound to

OH on 3

carbon of next

nucleotide

-DNA polymerase (enzyme for DNA

synthesis) can add nucleotides only to

the 3 end of a growing molecule


-new strands synthesized in opposite

directions

-energy for bond making comes from free

nucleotides in tri-phosphate forms: ATP,

TTP, GTP, CTP

-two phosphates are removed and energy is

used to create the sugar-phosphate (OH to

P) bond between nucleotides

DNA Replication Events

(on handout)

DNA Replication

1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication.

2. Proteins stabilize the unwound parental DNA creating the replication fork.

3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the

leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the

replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are

complementarily base paired with the parental strand and chemically bonded to the 3end of the

RNA primer and subsequently to each other at the 3ends (via removal of two phosphates) to create a

new DNA strand.

4. The lagging strand is synthesized discontinuously:

At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA.

Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the

3 end of the RNA primer and growing chain by DNA polymerase, working away from the

replication fork for ~1000bases. The resulting segment is called an Okazaki fragment.

5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3

end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA

primers on completed Okazaki fragments on the lagging strand and replaces them with DNA

nucleotides.

6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the

neighboring fragments into a single continuous molecule.

7. Replication continues down the full length of the chromosome until both parental strands are completely

separated and each is base paired to a newly synthesized strand.

Bacterial chromosomes can replicate

bidirectionally: one origin of replication

with two replication forks moving in

opposite directions

-origin of replication is associated with the

plasma membrane to insure separation of

duplicated chromosomes to each daughter

cell during binary fission

DNA replication accurate: DNA polymerase

has proofreading ability to insure proper

base pairing before backbone is chemically

bonded

Error rate = ~1 in 109 bases

error = mutation

Gene Expression:

RNA and protein synthesis

-DNA replication only occurs in cells that are

dividing

-gene expression occurs in all cells all the

time: cells are constructed of protein and

require enzymes to function

DNA --------------> RNA --------------> Protein transcription translation


Transcription = synthesis of complementary

strand of RNA from DNA template

Translation = synthesis of protein from info on

mRNA template

PromoterPromoterOpen Reading Frame (ORF)Open Reading Frame (ORF)

((codons codons for amino acids)for amino acids)TerminatorTerminator

Start codon Stop codon

Gene Structure (on handout)

The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be

transcribed

The start and stop codons are directions for the ribosome to indicate where the amino acid information for

translation begins and ends

The ORF is the coding region of the gene: it begins at the start codon and contains in order all the codons

for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of

the 20 amino acids) The ORF ends at the stop codon.

Transcription

making RNA from DNA

3 types of RNA:

1. Ribosomal RNA (rRNA) - integral part of

ribosomes, which carry out protein

synthesis

2. Transfer RNA (tRNA) - bring amino acids

to ribosome for use in protein synthesis

3. Messenger RNA (mRNA) - carries coded

info for synthesis of specific proteins from

DNA gene to ribosome for use

RNA is synthesized as complementary copy

of a DNA gene except that T is replaced by U

The complement is produced from the

template or sense strand of the DNA gene

Coding/Antisense strand of the DNA:

ATGGTATTCTCCTATCGTTAA

Template/Sense of the DNA gene:

TACCATAAGAGGATAGCAATT

RNA:

AUGGUAUUCUCCUAUCGUUAA

Transcription Events

(on handout)

Translation

-protein synthesis at the ribosome

DNA: 4 different bases in a particular order

make up the gene sequence

RNA: 4 bases complementary to the DNA

gene make up the RNA sequence

Nucleotide bases are like letters in the

alphabet: used in groups of three to make

words; each word indicates a particular

amino acid

3 nucleotides = 1 codon

Each codon = one amino acid of the 20

possible

Translation involves reading the codons on

the mRNA to build the polypeptide using

the correct amino acids in the order

specified by the gene

The Genetic Code

-all organisms use the same codons to specify

the particular amino acids


64 possible codons (43) but only 20 amino

acids: some are redundant

61 codons code for amino acids = sense

codons

3 nonsense codons serve as the STOP signal

to terminate protein synthesis

For each sense codon there is a tRNA with a

complementary antisense codon: this tRNA

carries the amino acid specified by the

codon

There are no tRNA molecules with anticodons

to the 3 nonsense codons (stop codons):

UAA, UAG, UGA, and thus no amino

acids

The start codon is AUG and codes for the

amino acid methionine

The start codon establishes the reading frame

of the mRNA: all other codons (each three

nucleotides) can be read once the start has

been identified

Use the genetic code chart to decode the

amino acid sequence of any mRNA:

AUG /GUA /UUC /UCC /UAU /CGU /UAA

AUG /GUA /UUC /UCC /UAU /CGU /UAA

Met - Val -Phe -Ser -Tyr -Arg -STOP

on h

ando

ut

Translation Events (on handout)

Translation begins at the AUG codon


Translation ends at the stop codon because:-no tRNA with a complementary anticodon

exists to pair with a stop codon

-no amino acid arrives to be peptide bonded

to the chain

Once the ribosome begins moving along the

mRNA molecule the start codon is exposed

and another ribosome can assemble and

begin translation

In prokaryotes

there is no

nuclear

separation

so translation

can begin

before

transcription

is complete


In eukaryotes, transcription occurs in the

nucleus: mRNA must exit to the cytoplasm

before translation can begin

Also eukaryotic RNA must be processed

before a functional mRNA is generated

Eukaryotic genes contain introns and exons

exons = coding portion (codons)

introns = junk

RNA generated by complementary base

pairing to the template DNA contains both

introns and exons.

Exons can provide variability: many mRNA

configurations can be formed from a single

gene with multiple exons

e.g. use all or only some of the exons:

3 exons = 7+ different mRNAs (and thus

proteins) 1-2-3, 1-2, 1-3, 2-3, 1, 2, 3

Small nuclear ribonucleoproteins (snRNPs)

cut out the introns and splice together the

exons to form mRNA that can be used for

translation

Regulation of Bacterial Gene Expression

-protein synthesis metabolically expensive:

cells only make what is needed

-60-80% of genes constitutively expressed:

housekeeping genes

-genes not involved in normal or continuous

processes have expression regulated

-feedback inhibition regulates enzymes that

have already been synthesized

-genetic control mechanism control the

synthesis of new enzymes

Genetic Control Mechanisms:

-regulate transcription of mRNA, thus control

enzyme synthesis

Two Mechanisms:

1. Induction

2. Repression

1. Induction = mechanism that turns on the

transcription of a gene and thus

translation of its enzyme product

-tends to control catabolic pathway

enzymes

-gene expression induced by substrate for

pathway

-default position of gene expression is off

Mode of Action:

-Gene expression is off because active

repressor protein blocks RNA

polymerase

-Inducer (substrate) binds to repressor thus

inactivating it

-RNA polymerase now free to transcribe

gene (gene expression on)

-mRNA synthesized

-protein synthesized

Inducible gene system ! inducible enzyme


2. Repression = mechanism that inhibits gene

expression thus decreasing synthesis of

corresponding enzyme

-tends to control anabolic pathway enzymes

-gene expression repressed by final product

produced in pathway

-default position of gene expression is on

Mode of Action:

-Gene expression is on

-Repressor (regulatory protein) is activated

by corepressor (product)

-repressor + corepressor block RNA

polymerase

-no mRNA synthesis (gene expression off)

-no protein synthesis

All genes involved in one pathway are often

organized together on the chromosome

under control of one promoter in a unit

called an operon

Operon consists of:

1. Promoter: region of DNA where RNA

polymerase initiates transcription

2. Operator: region of DNA that serves as

stop/go signal for transcription

3. Genes: all the ORFs for all the enzymes in

the pathway linked end to end; each has its

own start and stop codon

4. Terminator: region of DNA where RNA

polymerase ends transcription

Terminator

An operon has only one promoter and one

operator that control all the genes at once:

all are expressed or none are.

Each gene has its own start & stop codon: all

will be transcribed on one mRNA but

during translation each ORF will form its

own separate protein.

Transcription

Translation

EED

CB A

Terminator

O

Examples of genetic control of gene expression:

1. Lac Operon (on handout)


2. Tryptophan Synthesis Operon

(on handout)

Genetic Mutations

Mutation = change in base sequence of DNA

Silent mutation = no change in the activity of

the gene product

-no change in amino acid (often third base

in codon )e.g. G-C-anything = alanine

-change in amino acid did not affect

function of the protein

Some mutations harmful:

decreased activity, loss of activity

Some mutations beneficial:

new or enhanced activity

(this drives evolution)

Types of mutations:

1. Base substitution / point mutation

single base at one point in DNA

replaced by another base

A. Silent point mutation: does not change

the amino acid

B. Missense point mutation: causes

insertion of the wrong amino acid

e.g. Sickle cell anemia:

A ! T, GAG ! GTG in hemoglobin

glutamic acid (+ charge) ! valine (neutral)

folded hemoglobin globular ! fibrous

RBCs round ! elongated (block

capillaries, dont carry O2 well

C. Nonsense point mutation: creates a stop

codon in the middle of a gene - protein

will be incompletetemplate


2. Frameshift mutation

one or a few nucleotides are deleted or

inserted - this can alter the translational

reading frame

e.g. AUG GCU ACC GUC...

Met - Ala - Thr - Val

insert A at 4th position:

AUG AGC UAC CGU C

Met - Ser - Tyr - Arg-

Frameshift mutations almost always cause

long stretch of altered amino acids

resulting in inactive protein.

Nonsense mutations (stop codons) can also

be created

template

Spontaneous mutations: occur in absence of

any mutation causing agent, represent the

error rate of DNA polymerase (1 in 109)

Mutagen = agent in environment that brings

about DNA mutation. Usually chemically

or physically interact with DNA to cause

change. Once mistake is fixed into the

DNA the change is permanent.

1. Chemical mutagens (examples)

A. Nitrous acid: converts A so it pairs with

C instead of T

B. Nucleoside analogs: have chemical

structure similar to a base but do not

base pair correctly

e.g. 5-bromouracil incorporated in place

of T but base pairs with G not A

C. Benzopyrene (cigarette smoke): causes

frameshift mutations: binds between

bases and offsets the double helix

strands, repair mechanisms add a base

to the other strand to re-set alignment

2. Radiation

A. x-rays and "-rays: create ions and free

radicals that break molecular bonds

B. UV: causes crosslinking of T bases

(Thymine dimer) which can prevent

unwinding for replication or

transcription

Cells have light repair enzymes called

photolyases which cut out damaged Ts

and replace them


Nucleotide excision repair = enzymes that

function to cut out and replace DNA damage

ATGCTAGGCTATTATCG

TACGATCCGATAATAGC

ATGCTAGGCTATTATCG

TACGATCCGATAATAGC

ATGCT GCTATTATCG

TACGAT GATAATAGC

ATGCTA?GCTATTATCG

TACGAT?CGATAATAGC

Damage on one strand Damage on both strands

1. damaged parts are removed leaving gap in

strand

2. gap is filled by complementary base pairing

from other strand

-often repair restores correct sequence

-sometimes errors are made during repair:

once nucleotide excision repair mechanisms

seal the DNA, mutation is permanent

Mutation rate = probability that gene will

mutate when cell divides

Spontaneous mutation rate ~10-9

(1 in a billion)

Average gene ~103 bp long, so approximately

1 in 106 genes mutated each replication

Mutations are random

If harmful, organism dies

If beneficial, organism thrives and passes

mutation to offspring (drives adaptation

and evolution)

Mutagens change rate 10-1000 fold: up to

1:1000 genes mutated each replication

Genetic Transfer and Recombination

genetic recombination = exchange of genes

between two DNA molecules to form new

combinations of genes on chromosome

-involves crossing over


Genetic recombination contributes to

population diversity: recombinations more

likely than mutations to provide beneficial

change since it tends not to destroy gene

function

Eukaryotes: recombination during meiosis for

sexual reproduction

-creates diversity in offspring but parent

remains unchanged

-vertical gene transfer = genes passed from

organism to offspring

Prokaryotes: recombination via gene transfer

between cells or within cell by

transformation, conjugation, or

transduction

-original cell is altered

-horizontal gene transfer = genes passed to

neighboring microbes of same generation

-transfer involves donor cell that gives portion

of DNA to recipient cell

-when donor DNA incorporated into recipient,

recipient now called recombinant cell

-if recombinant cell acquired new

function/characteristic as result of new

DNA, cell has been transformed

Generation of recombinant cells is very low

frequency event (less than 1%): very few

cells in population are capable of

exchanging and incorporating DNA

Three methods of prokaryotic gene transfer:

1. Bacterial Transformation

-genes transferred as naked DNA

-can occur between unrelated genus/species

-discovered by F. Griffith 1928 who studied

Streptococcus pneumoniae

-virulent strain had capsule

-non-virulent stain did not

-in mouse, dead virulent strain could

pass virulence factor to live non-

virulent strain

-competent cells can pick up DNA from dead

cells and incorporate it into genome by

recombination (e.g. antibiotic resistance)

-transformed cell

than passes

genetic

recombination

to progeny

competent =

permeable to

DNA:

alterations in

cell wall that

allow large

molecule like DNA to get through (in lab

we use chemical agents to poke holes)

-transformation works best when donor and

recipient are related but they do not have to

be


2. Conjugation

-genes transferred between two live cells via

sex pilus (Gram -) or surface adhesion

molecules (Gram +)

-transfer mediated by a plasmid: small circle

of DNA separate from genome that is self

replicating but contains no essential genes

-plasmid has genes for its own transfer

-Gram negative plasmids have genes for pilus

-Gram positive plasmids have genes for

surface adhesion molecules

Conjugation requires cell to cell contact

between two cells of opposite mating type,

usually the same species, must be same

genus

During conjugation plasmid is replicated and

single stranded copy is transferred to

recipient. Recipient synthesizes

complementary strand to complete plasmid

-plasmid can remain as separate circle or

-plasmid can be integrated into host cell

genome resulting in permanent

chromosomal changes

3. Transduction

-DNA from a donor is carried by a virus to a

recipient cell

Bacteriophage / Phage = virus that infects

bacterial cells

-each phage is species specific (donor and

recipient are the same species)

Transduction mechanism:

1. Phage attaches to donor cell and injects

phage DNA

2. Phage DNA directs donor cell to synthesize

phage proteins and DNA, phage enzymes

digest the bacterial chromosome

3. New phages are

assembled: phage

DNA is packaged

into capsids

Occasionally

bacterial DNA is

packaged by mistake

4. Capsid containing

bacterial DNA

infects new host

recipient cell by

injecting the DNA

5. Donor DNA does not

direct viral

replication (not viral

DNA): instead

integrates into

recipient genome


DNA entities used for genetic change:

(in both prokaryotes and eukaryotes)

1. Plasmids = self-replicating circle of DNA

containing extra genes

A. conjugative plasmids: used in bacterial

conjugation, at minimum contain genes for

pili or adhesion molecules

B. dissimilation plasmids: carry genes that

code for enzymes to trigger catabolism of

unusual carbs or hydrocarbons

C. pathogenicity plasmids: carry genes that

code for virulence traits ! capsules,

toxins, adhesion molecules, bacteriocins

D. resistance factor plasmids: carry genes for

resistance to antibiotic and toxins

-plasmids can be transferred between species:

-allows spread of antibiotic resistance

between different pathogens

-wide use of antibiotics has put selective

pressure on microbes to develop and

share resistance genes

2. Transposons = small segments of DNA that

can move independently from one region

of DNA to another

-discovered 1950s by McClintock: mosaic

pattern in indian corn (Nobel Prize 1983)

-transposons pop out and randomly insert at

rate of 10-5 to 10-7 per generation

-integration is random: can disrupt genes

-at minimum transposons carry genetic info to

carry out own transposition, may also carry

other genes

Simplest transposon = insertion sequence

-gene for transposase (enzyme that cuts DNA

at recognition sites and religates it

elsewhere in genome)

-two recognition sites called inverted repeats,

mark ends of transposon, recognized by

transposase

-complex transposons have inverted repeats

outside other genes

-genes will get carried with transposon when it

moves

-transposons can be carried between cells on

plasmids or by viruses, even between

species

-depending on where it inserts and what genes

it carries it can mediate good or bad

genetic changes


genetics lecture 8

Documents