lable at ScienceDirect

Fish & Shellfish Immunology 35 (2013) 1395e1405

Contents lists avai

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate / fs i

Full length article

Genomic organization of the cytosolic manganese superoxidedismutase gene from the Pacific white shrimp, Litopenaeus vannamei,and its response to thermal stress

Suchonma Sookruksawong a,b, Siriporn Pongsomboon a,c, Anchalee Tassanakajon a,*

aCenter of Excellence for Molecular Biology and Genomics of Shrimp, Department of Biochemistry, Faculty of Science, Chulalongkorn University,254 Phayathai Road, Bangkok 10330, ThailandbBiotechnology Program, Faculty of Science, Chulalongkorn University, 254 Phayathai Road, Bangkok 10330, ThailandcNational Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani 12120,Thailand

a r t i c l e i n f o

Article history:Received 19 March 2013Received in revised form28 June 2013Accepted 7 August 2013Available online 29 August 2013

Keywords:Cytosolic manganese superoxide dismutaseLitopenaeus vannameiGenomic organizationThermal stress

* Corresponding author. Tel./fax: þ66 (0) 2218 5414E-mail address: anchalee.k@chula.ac.th (A. Tassana

1050-4648/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.fsi.2013.08.003

a b s t r a c t

Cytosolic manganese superoxide dismutase (cMnSOD) is an important antioxidant enzyme which cat-alyzes the conversion of superoxides to oxygen and hydrogen peroxide in several organisms. In thePacific white shrimp, Litopenaeus vannamei, three cMnSOD genes (LvcMnSOD1-3) have previously beencharacterized. Here, the genomic structure of LvcMnSOD2 and its mRNA expression in response tothermal stress was examined. Analysis of the nucleotide sequence demonstrated that LvcMnSOD2 iscomprised of 2392 bp spanning from the ATG translation start site to the stop codon and contains sixexons interrupted by five introns. The 50 region upstream of the LvcMnSOD2 gene contains severalputative regulatory elements but lacks the accepted TATA sequence. The putative transcription factorbinding elements that may be involved in LvcMnSOD2 mRNA expression level include activator protein-1(AP-1), cAMP response element binding protein (CREB), upstream stimulatory factor (USF), CAAT-enhancer binding protein (C/EBP), nuclear factor-kB (NF-kB) and heat shock regulatory element (HSE).In addition, we compared the 50 upstream sequences of the LvcMnSOD2 gene between two shrimpstrains that are resistant or susceptible to Taura syndrome virus (TSV), respectively, which revealed theabsence of the USF and C/EBP elements at positions �2125 and �1986, respectively, in the TSV-susceptible shrimp line. Moreover, genomic variations between the two shrimp strains were detectedin some of the putative C/EBP, USF, HSE and NF-kB transcription factor binding elements. That thesegenomic variations might be involved in the TSV resistance as well as in stress responses remains to beevaluated. The presence of 15 putative HSEs suggests that the expression of LvcMnSOD2 is regulatedunder thermal stress. Here, we found that in response to a 1 or 3 h thermal stress (35 �C), the mRNAexpression levels of LvcMnSOD2 were significantly increased and then gradually decreased in therecovering phase at room temperature (25 �C) to control levels by 3 h after the heat shock. Thus, theantioxidant system may be induced to protect cells from the oxidative damage caused by thermal stress.The genomic organization of LvcMnSOD2 likely provides a clue to the mechanisms that might regulatethe antioxidant defense pathway in shrimps and so potentially in marine invertebrates.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Aerobic organisms produce reactive oxygen species (ROS) dur-ing phagocytosis [1] and under physiological conditions that resultin oxidative stresses [2,3]. Previous studies have demonstrated thatROS are involved in cell signaling pathways and participate in

.kajon).

All rights reserved.

immune responses to invading pathogens [4]. However, ROS alsocause direct or indirect damage to various cell components, such aslipids, proteins and nucleic acids [5e7]. To prevent and eliminatethe toxicity of ROS from either spatially spreading into non-targetareas or temporally remaining beyond the required duration, or-ganisms have evolved effective enzymatic defense systems againstROS and in particular against superoxide anion radicals, whichinclude the enzymes superoxide dismutase (SOD), catalase andperoxidases [8]. SODs are the first and most important line ofantioxidant enzymes that eliminate superoxide radicals by

Table 1Sequences and genomic location of the PCR primers used for all experimentalprocedures.

Primer Sequence (50e30)

GSP1-1 CCACAGGTCGTGGTTGTGGATACCAATGSP1-2 TGTGGTGTGCTCGGATTCCACTCCAAGGGSP1-3 GAGCCATAACCAAGCCAGCCATAGTGTGAAGSP2-1 GATCATGCCGGAGATGTGAGGTTCAAGGSP2-2 AAGACAGTTGCACGTGTGCCTAGTTGGSP2-3 TAGCCTCTTCACGGGAGTAATTTGTTTGTCAP1 GTAATACGACTCACTATAGGGCAP2 ACTATAGGGCACGCGTGGT

SOD-Fa ATGGCTGAGGCAAAGGAAGCTTASOD-Ra TCAATGACCTGCATTCTTACGAGRT-SOD-F TAACAACCTAATTGCCGCTACART-SOD-R CTCATAACGCTCATTCACGTTCTb-actin-Fb ATCACCATCGGCAACGAGAb-actin-Rb GCTTGCTGATCCACATCTGCT

Primer sequences are derived from the indicated position (numbered 50e30) of thesequences in GenBank for:

a cMnSOD (DQ005531).b b-actin (AF300705).

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e14051396

converting them to hydrogen peroxide and oxygen. Hydrogenperoxide is then transformed into water and oxygen by catalase,and so together these enzymes detoxify superoxides into harmlesscompounds to the host organism [8,9]. In addition, SODs are one ofthe potential indicators that can be used to identify healthy aquaticorganisms [10,11] and to detect environmental problems [12,13].SODs identified in mammals can be classified, depending on theirmetal content, into the three distinct groups of iron SODs, man-ganese SODs (MnSODs) and copper/zinc SODs [14]. With respect toMnSODs, two types have been recognized, as the mitochondrialMnSOD (mMnSOD), and cytosolic MnSOD (cMnSOD).The mMnSODs are homotetramers whilst the cMnSODs arehomodimers of 25 kDa subunits [15,16] that are encoded for bydifferent genes [14]. The mMnSODs are transported into themitochondria with the help of mitochondrial transit peptide aftertranslation, and are found in plants, invertebrates and vertebrates,plus in addition in bacteria [17]. The cMnSODs lack the encodedmitochondrial transit peptide and so are retained in the cytosol,and they occur in all crustaceans that use hemocyanin for oxygentransport. The characterization, gene expression and geneticstructure of cMnSODs have been reported in several decapodcrustaceans, such as the tiger shrimp Penaeus monodon(AY726542), Chinese shrimp Fenneropenaeus chinensis (GQ168792),kuruma shrimp Marsupenaeus japonicus (GQ181123), freshwaterprawn Macrobrachium rosenbergii (EU077526), grass shrimpPalaemontes pugio (AY211084), giant mud crab Scylla serrata(GU213434), blue crab Callinectes sapidus (AF264030), brownshrimp Farfantepenaeus aztecus (AY211085) and hydrothermalcrabs Bythograea thermydron (FM242567) [14,18e21]. Recently, thecharacterization of shrimp cMnSODs and their roles in immuno-modulation have been reported. Themolecular weight of immaturecMnSOD proteins is estimated to be around 31.2e31.5 kDa with pIsfrom 5.42 to 7.33, whilst the mature cMnSOD proteins have aconserved N-terminal that is used for their retention in the cytosol.The cMnSOD transcript level in the hemocytes of M. japonicus wassignificantly increased after injection of bacteria or b-glucan [22]. Inthe Pacific white shrimp, Litopenaeus vannamei, the mRNAexpression level of LvcMnSOD was significantly elevated in the gilland hepatopancreas after feeding with immunostimulant (Panaxginseng derived polysaccharides) [23]. In addition, a significantincrease in the LvcMnSOD transcript level was detected after in-jection with pathogen-associated molecular patterns (PAMPs),including laminarin, lipopolysaccharide (LPS) and poly I:C [24].Together these imply a potential function for cMnSODs in the im-mune system. Moreover, three different cMnSOD transcripts(LvcMnSOD1-3) have been found in L. vannamei and these aredifferentially expressed in the nervous system, hepatopancreas andhemocytes, respectively [25]. However, the genomic sequencestructure of these cMnSODs has not been extensively studied toreveal the potential mechanisms of regulation of their geneexpression in response to various stress factors. In this currentstudy, we report the genomic organization and promoter charac-terization of the LvcMnSOD2 gene and further examine the tran-script expression profile in response to heat stress. Studies into theregulatory regions of the LvcMnSOD2 gene should provide a betterunderstanding of the essential role of this enzyme in the hostdefense against oxidative damage and environmental stress in thiseconomically important aquatic species.

2. Materials and methods

2.1. Shrimp samples

L. vannamei shrimps from the Taura Syndrome virus (TSV)-resistant and TSV-susceptible strains, reared under pathogen-free

conditions, were obtained from SyAqua Siam Co. Ltd. These twoshrimp strains exhibit a significant difference in their survival levelwhen challenged with TSV (our unpublished data), where forexample shrimps from the TSV-resistant strain showed 60e80%survival following a challenge with TSV compared to only 20%survival in shrimps from the TSV-susceptible strain. Shrimps wereacclimatized in laboratory tanks that were continuously suppliedwith temperature controlled constant flow-through seawater at20 �C, 20 parts per thousand (ppt) salinity and continuous aerationfor 7 days before use in the experiments.

2.2. Characterization of the genomic structure and promoter regionof the LvcMnSOD2 gene

The genomic DNA from shrimps from the TSV-resistant andTSV-susceptible strains was isolated separately from the muscletissues of L. vannamei by a standard phenol extraction method [26].The sequence of the LvcMnSOD2 gene was examined by a directPCR-based strategy using genomic DNA as the template. The SOD-Fand SOD-R primers (Table 1) were designed from the availableLvcMnSOD2 cDNA sequence (GenBank accession no. DQ005531)and were then used to PCR amplify the genomic DNA [25,27]. PCRproducts were then cloned into pGEM-T Easy vector (Promega) forsequencing.

The upstream sequence of the LvcMnSOD2 gene from the TSV-resistant and TSV-susceptible lines was cloned using a UniversalGenomewalker Kit (Clontech). In brief, aliquots of L. vannameigenomic DNA were separately digested by DraI, EcoRV, PvuII andStuI restriction enzymes to completion and each digested DNAwaspurified and ligated with the Genomewalker adaptor to constructthe four respective genomic libraries following the manufacturer’sinstructions. Using the four genomic libraries as templates sepa-rately, primary PCRs were performed with the gene specific primer(one of GSP1-1, GSP1-2 and GSP1-3; Table 1) and the AdaptorPrimer AP1 (Clontech, USA). Secondary (nested) PCRs were per-formed with the internal gene specific primer (one of GSP2-1,GSP2-2 and GSP2-3; Table 1) and AP2, using the primary PCR re-action products (1/50-fold dilution) as the template. PCR conditionsused were as per the manufacturer’s instructions. In brief, a total of50 ng of template DNAwas used for the PCR amplification in a 50 mLfinal reaction volume containing one unit Advantage 2 PolymeraseMix (Clontech, USA), 1 � Advantage 2 buffer, 200 mM each dNTP,0.2 mM each primer and thermocycled with an initial denaturation

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e1405 1397

step at 94 �C for 2 min, followed by 30 cycles at 94 �C for 30 s, 55 �Cfor 30 s and 72 �C for 3 min with the final 72 �C for 10 min. Sec-ondary PCR reaction product(s) were resolved by agarose-TBEelectrophoresis and the band(s) were eluted, ligated into thepGEM-T Easy vector (Promega) and cloned in the Escherichia colistrain JM109. Subsequent minipreps of the plasmid weresequenced with an automated sequencer by a commercial service(Macrogen Inc., Korea). The obtained LvcMnSOD2 gene sequencewas compared to that of otherMnSODs from different species at theNCBI GenBank database using the online megaBLASTn searchprogram. A multiple sequence alignment of the obtained similarsequences was created using the online ClustalWalgorithm (http://www.ebi.ac.uk/clustalw/). The nucleotide sequence of the putativepromoter and transcription start site of the LvcMnSOD2 gene wereanalyzed using the neural network promoter prediction (http://www.fruitfly.org/seq_tools/promoter.html) and TRANSFAC Pro-moter signal scan (http://bimas.dcrt.nih.gov:80/molbio/signal/)programs [28]. Transcription factor binding sites were predicted bythe online Transcription Element Search Software (TESS) (http://www.cbil.upenn.edu/tess) [29].

2.3. Experimental animals and heat stress treatment

Three-month-old L. vannamei juveniles were collected from alocal farm located in Chachoengsao province (Eastern Thailand).Shrimps were acclimatized in seawater tanks with aeration andmaintained at room temperature (25 �C, RT) with 20 ppt salinity forone week before use in the experiments. For heat shock treatment,shrimps were transferred from the seawater tank at RT to one at35 �C for either 1 h or 3 h heat stress and then returned to the RTseawater tank to recover. Control shrimps were moved from the RTtank to another RT tank under otherwise the same conditions andtimes. The hemolymph was collected (with 10% (w/v) sodium cit-rate as an anticoagulant) at the end of the heat shock period andalso at 1 and 3 h after returning to the RT tank from nine differentshrimps per time point and treatment (no shrimp was used morethan once). The hemocytes, obtained from the extracted hemo-lymph as the pellet following centrifugation (5000 � g, 4 �C,10min), were then preserved in liquid nitrogen for subsequent RNAextraction to analyze the gene expression. Note that the hemo-lymph extraction to hemocyte freezing timewas<5min. Total RNAwas isolated from the rapidly thawed hemocyctes using the TRIREAGENT� (MRC) according to the manufacturer’s instructions andthen incubated with RNase-free DNase I (Promega) to eliminategenomic DNA contamination. For cDNA synthesis, 1 mg of total RNAderived from the hemocytes pooled from three shrimps wasreverse transcribedwith the oligo(dT) primer using the RevertAid�First Strand cDNA Synthesis kit (Fermentas) according to themanufacturer’s protocol. The resulting cDNAs were quantified toensure that all samples were of equal concentration.

2.4. Determination of LvcMnSOD2 mRNA expression levels inhemocytes after heat stress

The expression level of LvcMnSOD2 transcripts in hemocyteswas determined by semi-quantitative RT-PCR. b-actin was used asthe internal reference and standardizing control for mRNAexpression levels. The semi-quantitative RT-PCR reaction was per-formed in a total volume of 25 mL containing 1 mL of the five-folddiluted first strand total cDNA, 1.25 U of Taq DNA polymerase(Geneaid), 2.5 mL of 10� Taq polymerase reaction buffer, 200 mM ofeach dNTP, 25 pmol of each primer (RT-SOD-F, RT-SOD-R) (Table 1)and 2 mM MgCl2. PCR profiles were performed on a C1000�Thermal Cycler (Biorad) under the following conditions: 94 �C for2 min, followed by 25 cycles of 94 �C for 30 s, 55 �C for 30 s, and

72 �C for 30 s, followed afterward by a final 5 min at 72 �C. Resultswere normalized to the b-actin transcript levels, derived from thesame template, as an internal standard. Ten mL of the amplificationproduct was analyzed by resolution through a TBE-2% (w/v)agarose gel and visualized by UV transillumination after ethidiumbromide staining. Differences in expression levels were analyzedusing one-way analysis of variance (ANOVA) [30]. A multiple-comparison (Duncan’s) test was used to examine significant dif-ferences among treatments using the SPSS software [31], withstatistical significance of difference being accepted at the p < 0.05level.

3. Results and discussion

3.1. The sequence of LvcMnSOD2 gene

SODs play an important role in the antioxidant defense path-ways in response to oxidative stress [32,33]. MnSODs can bedivided into the two groups of mMnSOD and cMnSOD, wheremMnSODs are conserved (in sequence) in crustaceans and insects,while cMnSODs only appear in crustaceans [11], including crabs,crayfish and shrimps, which use hemocyanin as an oxygen carrierprotein [14,19,20,34].

Although the isolation of cMnSOD cDNAs from aquatic animalshas been reported [35e37], their gene structure and regulation ofgene expression have not been comprehensively studied.In contrast, themodulation of transcription factor binding elementsin mammalian SODs has been well characterized [38e40].Expanding this kind of study to the crustacean cMnSODs could helpprovide a deeper insight into gene regulation of cMnSODs in theseimportant aquatic animals in response to their environmentalstresses.

Here, we examined the complete genomic sequence, includingthe 50-upstream region, of the LvcMnSOD2 gene. The DNA fragmentwas successfully amplified from L. vannamei genomic DNA usingthe SOD-F and SOD-R primers (Table 1). The PCR product waseluted and cloned into the pGEM-T Easy vector for sequencing. Thededuced sequence of the LvcMnSOD2 gene (submitted to GenBankwith accession code KC787355) was comprised of 2392 bp span-ning from the ATG translation start site to the stop codon andcontained six exons of 93, 148, 146, 192, 127 and 158 bp, interruptedby five introns of 114, 260, 831, 216 and 107 bp (Fig. 1).The consensus GT/AG rule was conserved at all exon/intronboundaries. The coding sequence of the LvcMnSOD2 gene wasfound to match (99% predicted amino acid sequence identity) withits cDNA counterpart (DQ00553), after its structure was deducedusing the Gene Structure Display Server (GSDS), (http://gsds.cbi.pku.edu.cn/index.php).

In general, most known animal MnSOD genes share a highlyconserved genomic organization of five exons interrupted by fourintrons [41e43], although the intron and exon lengths are quitevariable between species, with the total intron length roughlyproportional to the genome size (Fig. 2). The LvcMnSOD2 gene wasfound to contain the MnSOD signature (MSS) sequence (DVWE-HAYY) at positions 244e251, four putativemanganese binding sites(H115, H159, D244 and H248, respectively) and two putative N-glycosylation sites (NHT at positions 158e160, NMA at positions165e167) (Figs. 1 and 3), which are highly conserved in otherarthropod cMnSODs and mMnSODs [22,27]. At the N-terminus, thededuced amino acid sequence of LvcMnSOD2 gene contains aputative leader sequence of 61 amino acids, which revealed acytoplasmic localization [15,20].

The open reading frame (ORF) of LvcMnSOD2 is 861 bp encod-ing a predicted polypeptide of 286 amino acids (Figs. 1 and 4),giving a calculated molecular mass of 24.8 kDa and theoretical pI

Fig. 1. The genomic nucleotide sequence and deduced amino acid of the LvcMnSOD2 gene. The sequence of the six exons is shown in bold and is interrupted by five introns. Shadedboxes show the two putative N-glycosylation sites (NHT and NMA) and the MnSOD signature sequence (DVWEHAYY). Underlined H residues represent the putative manganesebinding sites and the double underlined L and R residues are those involved in the structural stability of MnSODs.

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e14051398

of 6.04 for the mature protein, as obtained using the online Prot-Param program (http://us.expasy.org/tools/protparam.html).The deduced amino acid sequence of LvcMnSOD2 showed a highamino acid sequence identity (77e99%) to the cDNA derivedsequences from other penaeid shrimps, L. vannamei e DQ005531(99%), L. vannamei e DQ298206 (98%), L. vannamei e DQ298207(99%), L. vannamei e DQ298209 (99%), M. japonicus e GQ181123

(96%), P. monodon e AY726542 (96%), M. rosenbergii e DQ073104(79%) and Procambarus clarkia e EU254488 (77%).

The (50) promoter sequence of the LvcMnSOD2 gene, includingseveral putative transcription factor binding sites, was obtained byPCR amplification of the genomic DNA by genome walking. A 2499(submitted to GenBank with accession code KC787355) and 2494(submitted to GenBank with accession code KC787356) bp

Fig. 2. Schematic drawing to compare the genomic structure of the LvcMnSOD2 gene with representative orthologs from other animal species. Exons and the untranslated region(UTR) are indicated by green and blue boxes, respectively, while introns are shown as black lines. C values were obtained from the Animal Genome Size Database (http://www.genomesize.com/index.php). N/A ¼ data not available. GeneID is noted at the left of each MnSOD gene. (For interpretation of the references to color in this figure legend, thereader is referred to the web version of this article.)

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e1405 1399

segment of the 50-flanking region (upstream sequence from theATG translation start site) containing the putative regulatory ele-ments of LvcMnSOD2 gene was obtained from the TSV-resistantand TSV-susceptible shrimps, respectively. No putative TATA boxwas found in the upstream LvcMnSOD2 gene sequence from eithershrimp strain, which is in accordance with the MnSOD genesidentified in human [41,44], bovine and mouse [45], which havealso been found to lack the accepted TATA box. However, weidentified several putative important transcription factor bindingelements that may be associates with the control of cMnSOD2expression levels in L. vannamei, including eight activator protein-1 (AP-1), one cAMP response element binding protein (CREB), fiveupstream stimulatory factor (USF), 13 CAAT-enhancer bindingprotein (C/EBP), two nuclear factor-kB (NF-kB) and 15 heat shockregulatory element (HSE) sequences, by searching the TRANSFACdatabase (http://www.cbil.upenn.edu/tess) (Fig. 5). Of course,further such sites may also exist further upstream, as for exampleNF-kB binding sites are known to exist up to 5 kbp upstream of thegene. Nevertheless, for those sequences reported here thesetranscription factor-binding elements have been reported to beinvolved in the transcriptional regulation of SOD genes [44,46e48]. To further examine the potential control of gene expressionunder these regulatory elements, we compared the 50 upstreamregion of LvcMnSOD2 from the TSV-susceptible and TSV-resistantshrimp strains. The rational was based upon the observations thatthe TSV-resistant strain exhibited a significantly higherLvcMnSOD2 transcript levels than the TSV-susceptible strain (ourunpublished data), whilst in other genes several polymorphisms inthe 50 upstream region have been reported to be associated withdifferent environmental stresses and pathogen defense [49,50].Such variation in the promoter sequence region could alter thebinding of transcription factors and so lead to a different promoteractivity. Sequence alignment of the 50 upstream region ofLvcMnSOD2 gene from the two shrimp strains revealed variationsat several putative transcription factor binding sites (Fig. 5).An absence of USF and C/EBP at positions �2125 and �1986,respectively, was found in the TSV-susceptible shrimp line.Moreover, variations in some of the putative C/EBP (7/13; 54%),

Fig. 3. Gene structure for the LvcMnSOD2 gene. Exons are indicated by boxes and non-tranacid leader sequences, four putative manganese binding sites (H115, H159, D244 and H24dismutase signature sequence.

USF (1/5; 20%), HSE (7/15; 47%) and NF-kB (1/2; 50%) transcriptionfactor binding elements of the LvcMnSOD2 gene between the TSV-resistant and TSV-susceptible L. vannamei strains were detected.However, the actual association of these variations with alteredcontrol of gene expression let alone with the loss of viral resis-tance remains to be established.

The mechanisms controlling the induction of genes by oxidativestress have been fairly intensively investigated, and have revealedthat (i) many transcription factors are stimulated by ROS [51], andthat (ii) many transcriptional regulatory elements in the proximalpromoter regions of the SOD genes are binding sites for severaltranscription factors [52]. Here, putative transcriptional bindingsites for at least six different such factors were found in the 50

upstream region of the LvcMnSOD2 gene that might play animportant role in regulating the constitutive or inducible expres-sion levels of SOD. These are discussed in turn below.

3.1.1. Nuclear factor-kB (NF-kB)Two potential sites were found (�258 to �263 and �840 to

�857 bp, numbered 50 of the ATG initiation codon of the TSV-susceptible strain), of which one has variation in the sequencebetween the TSV-resistant and TSV-susceptible strains. Nuclearfactor-kB (NF-kB) is a redox-sensitive transcriptional factor thatacts as a regulator of gene expression by serving as an immediateresponder to harmful cellular stimuli [48,53,54]. NF-kB is found inthe cytoplasm as an inactive non-DNA binding form, associatedwith the IkB inhibitor protein that masks the nuclear translocationsignal and so prevents NF-kB from entering the nucleus [53].Oxidative stress causes a rapid ubiquitination and phosphorylationof the IkB complex, leading to the activation of NF-kB [55e57]. NF-kB-responsive elements have been located in both the promoterand intronic regions of all three human SOD genes [58e60], whilstinduction of the MnSOD mRNA level was shown to be controlled atthe transcription level [61] principally by NF-kB [62].

3.1.2. Activator protein-1 (AP-1)Eight potential sites were found (�142 to �152, �887 to �897,

�991 to �999, �1274 to �1282, �1325 to �1332, �1508 to �1518,

slated sequences by horizontal lines. The LvcMnSOD2 gene is composed of a 61 amino8), two putative N-glycosylation sites (NHT and NMA), and a manganese superoxide

Fig. 4. Multiple alignment of LvcMnSOD2 polypeptide sequence with its corresponding orthologs in crustacean species. GenBank accession numbers are EU254488 (Procambarusclarkia), DQ073104 (Macrobrachium rosenbergii), AY726542 (Penaeus monodon), DQ005531, DQ298206, DQ298207, DQ298208 (Litopenaeus vannamei) and GQ181123 (Marsupenaeusjaponicus). The score identity with LvcMnSOD2 is noted at the end of each sequence. The conserved leader sequence, manganese superoxide dismutase signature sequence(underlined), amino acids required for manganese binding (shaded gray) and residues involved in the structural stability of MnSOD (asterisks) are shown.

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e14051400

�1713 to �1720 and �2125 to �2132 bp, numbered 50 of the ATGinitiation codon of the TSV-susceptible strain). Activator protein-1(AP-1), is a homodimeric (Jun/Jun) or heterodimeric (Jun/Fos)complex that belongs to the c-Fos, c-Jun, and Fra families[48,53,63]. It is an important transcriptional regulator in modu-lating the signal transduction processes involved in cell prolifera-tion and transformation [64]. Some proinflammatory processes,such as the transcription of cytokine genes and the up-regulation ofprotective antioxidant genes, are controlled by AP-1 [53,54,66].Moreover, the excessive release of ROS and alteration of the cellularredox status can lead to the activation of AP-1 [47,53,54], andalteration of the SOD gene expression can modulate AP-1 activity[65,66]. Furthermore, in a murine skin cancer model, over-expression of the SOD2 gene reduced the tumor incidence bysuppressing AP-1 activation, whilst MnSOD insufficiency lead to anenhanced AP-1 expression level and increase in proliferation andapoptosis events [67]. Consequently, AP-1 can activate theexpression of SOD genes and be activated by the expression ofSODs [48].

3.1.3. CAAT-enhancer binding protein (C/EBP)Thirteen potential sites were found (�62 to �79, �381 to

�400, �535 to �553, �1290 to �1304, �1348 to �1365, �1348 to�1365, �1534 to �1551, �1626 to �1643, �1737 to �1753, �2229to �2246, �2340 to �2355, �2397 to �2410 and �2455 to�2471 bp, numbered 50 of the ATG initiation codon of the TSV-susceptible strain; plus the site at �1950 to �1967 in the TSV-resistant strain only), of which they have variations in thesequence between the TSV-resistant and TSV-susceptible strains.The C/EBPs are a subfamily of the larger basic region/leucinezipper (bZIP) transcription factor family, and consist of six types(C/EBPa to C/EBPx) that can interact with the CCAAT box motifpresent in many gene promoters [48,68,69]. C/EBP-related factorshave been shown to be necessary for basal SOD transcription [70].In humans, C/EBP-related factors stimulated SOD1 transcription[46,48], whilst the C/EBP binding site in the human SOD2 intronicenhancer region is involved in the MnSOD induction in responseto cytokine stimulation [46]. Furthermore, C/EBPa plays a majorrole in activating the transcription of the rat SOD1 gene [46,71].

3.1.4. Cyclic AMP response element binding (CREB)One site was found at �1975 to �1986 bp (numbered 50 of the

ATG initiation codon of the TSV-susceptible strain). The CREBtranscription factor, mediates responses to a number of physio-logical and pathological signals, such as neurotransmitters, syn-aptic activity, depolarization, mitogens, hypoxia and other stressfactors [72e75] regulating transcription of CRE motif-containinggenes [76e79]. CREB has been shown to modulate transcriptionof the rat SOD and neuropeptide Y (NPY) genes [80]. Moreover, inthe lung carcinoma cell line, where the cAMP-responsive element ispresent within the MnSOD promoter, MnSOD gene expression isdependent upon CREB activation [81,82].

3.1.5. Upstream stimulatory factor (USF)Five potential sites were found (�763 to �770, �1087 to �1094,

�1688 to �1697 and �2357 to �2366 bp, numbered 50 of the ATGinitiation codon of the TSV-susceptible strain, plus the site at�2117to �2124 only in the TSV-resistant strain), of which one has vari-ation in the sequence between the TSV-resistant and TSV-susceptible strains. USF, like c-myc/max/mad, belongs to the basichelixeloopehelix (bHLH) leucine zipper family of proteins thatinteract with DNA at symmetrical E-boxes with the consensussequence CANNTG in numerous gene promoters [83e85]. Firstidentified from its involvement in transcriptional control of theadenovirus major late gene in human cancer cells [86,87], thefunction of several such USF transcription factors is modified byoxidative stress. For example, the insulin gene promoted is acti-vated by USF and several other related factors [88], but is repressedby oxidative stress [89].

3.1.6. Heat shock regulatory element (HSE)A total of 15 potential HSE sites were found (�11 to �25, �96

to �110, �169 to �183, �427 to �442, �627 to �643, �659 to�673, �1163 to �1177, �1196 to �1210, �1241 to �1253, �1396to �1409, �1445 to �1459, �1890 to �1905, �1936 to �1950,�2014 to �2028 and �2061 to �2075 bp, numbered 50 of theATG initiation codon of the TSV-susceptible strain), of which theyhave variations in the sequence between the TSV-resistant andTSV-susceptible strains. HSEs are typically found as considerable

Fig. 5. Alignment of the putative 50 upstream genomic sequence of the LvcMnSOD2 gene from TSV-resistant (R) and TSV-susceptible (S) L. vannamei shrimps. The translation startsite (ATG) is defined as position þ1. The putative transcriptional factor binding elements are shown in bold with indicated names. Variations identified within some C/EBP, USF, HSEand NF-kB consensus sites are shaded gray.

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e1405 1401

Fig. 5. (continued).

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e14051402

components in the 50 upstream promoter region of any heatshock protein regulated gene, as found here in the 50 upstreamregion of the LvcMnSOD2 gene. Many organisms have the abilityto express heat shock protein regulated genes in response tostressful stimuli [90e92]. Under conditions of heat, or otherrelated stress stimulations, the activated heat shock factors willbind to the HSEs leading to the rapid transcription of those HSEcontaining genes [93].

3.2. Induction of the LvcMnSOD2 gene under heat stress treatment

Changes in environment factors, such as water temperature andsalinity, affect a variety of physiological stress responses in aquaticorganisms. Stress induced by these factors was recently associatedwith enhanced ROS generation, which caused oxidative damage.The presence of these putative HSEs within the 50 upstream regionof the LvcMnSOD2 gene suggested that the gene may be heatinducible. To investigate this speculation, LvcMnSOD2 transcriptlevels were determined in the hemocytes of juvenile shrimps

following heat stress for 1 or 3 h at 35 �C and subsequent recoveryat RT (Fig. 6). After a 1 h heat stress exposure the LvcMnSOD2transcript level of LvcMnSOD2was significantly increased (2.3-fold)from its untreated level. Increasing the heat stress exposure time to3 h resulted in a numerically higher mRNA transcript level, at 1.27-and 2.92-fold higher than at 1 h or the control, respectively (Fig. 6)were reached the highest level. The transcript levels then graduallydecreased in the post-heat shock recovery phase at RT, reachingcontrol levels within 3 h.

Previously, the temperature was shown to affect the productionof ROS in juvenile Macrobrachium nipponense shrimps [94]. SinceROS can damage DNA, protein and lipids [95], then organisms havea well developed antioxidant defense system to protect againstspatial spread or temporal extension of such oxidative stress. Theregulation of LvcMnSOD2 transcript expression levels under tem-perature changes, and so potential HSE-mediated regulation, sug-gests that shrimps increase the production of cMnSOD2 in order toreduce the oxidative stress induced by high temperature in theirenvironment. Understanding of the mechanisms regulating the

Fig. 6. Detection of LvcMnSOD2 transcripts in the hemocytes of heat stressed juvenileL. vannamei shrimps by semi-quantitative RT-PCR. (A) RT-PCR products of LvcMnSOD2compared to that for beta-actin as the internal control. Products are resolved in a 2%(w/v) agarose-TBE gel, and that shown is representative of at least 3 independentamplifications. (B) Relative transcript expression patterns of LvcMnSOD2, as evaluatedby semi-quantitative RT-PCR and standardized to that for B-actin, after heat shock (HS)for 1 h or 3 h, and subsequently 1 or 3 h recovery after heat shock at RT. Data areshown as the mean � 1 SD, and are derived from at least triplicate trials. Means withdifferent letters (a, b, c) are statistically significantly different (p < 0.05).

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e1405 1403

antioxidant defense pathway will pave the way to a better pro-tection of the animal from oxidative damage.

4. Conclusions

The complete genomic sequence of LvcMnSOD2 was obtainedand analyzed. LvcMnSOD2 gene contains six exons interrupted byfive introns. The putative transcription factor bindingmotifs in its 50

regulatory region that may be involved in the regulation ofLvcMnSOD2 expression include AP-1, CREB, USF, C/EBP, NF-kB aswell as HSE. Moreover, the comparison between the 50 upstreamsequences of the LvcMnSOD2 gene from resistant and susceptibleto Taura syndrome virus (TSV) shrimp strains demonstrated thatgenomic variations in some of the transcription factor binding el-ements might be involved in the TSV resistance and also in stressresponses. In addition, LvcMnSOD2 expression levels were signifi-cantly modulated by thermal stress. Further studies will be neededto better understanding the relation between sequence informa-tion regarding the regulatory elements and their physiologicalsignificance in the control of cMnSOD expression in organisms.

Acknowledgments

This work was supported by research grant from the HigherEducation Research Promotion and National Research UniversityProject of Thailand, Office of the Higher Education Commission(FW643A) and partially supported by Japan International Cooper-ation Agency (JICA). A Ph.D. student fellowship to Mrs. SuchonmaSookruksawong for the Strategic Scholarships Fellowships FrontierResearch Networks from the Commission on Higher Education isgreatly appreciated. We are grateful to SyAqua Siam Co. Ltd for thesupport of L. vannamei samples. We also thank ChulalongkornUniversity for the support under the Ratchadaphisek SomphotEndowment to the Center of Excellence for Molecular Biology andGenomics of Shrimp.

References

[1] Roch P. Defense mechanisms and disease prevention in farmed marineinvertebrates. Aquaculture 1999;172(1e2):125e45.

[2] Yu BP. Cellular defenses against damage from reactive oxygen species. Phys-iological Reviews 1994;74(1):139e62.

[3] Meszes M, Surai P, Salyi G, Speake BK, Gaal T, Maldjian A. Nutritional meta-bolic diseases of poultry and disorders of the biological antioxidant defencesystem. Acta Veterinaria Hungarica 1997;45(3):349e60.

[4] Zelko IN, Mariani TJ, Folz RJ. Superoxide dismutase multigene family: acomparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3)gene structures, evolution, and expression. Free Radical Biology & Medicine2002;33(3):337e49.

[5] Fridovich I. Superoxide dismutases. Annual Review of Biochemistry1975;44:147e59.

[6] Winston GW. Oxidants and antioxidants in aquatic animals. ComparativeBiochemistry and Physiology e C. Pharmacology Toxicology & Endocrinology1991;100(1e2):173e6.

[7] Krotz F, Sohn HY, Gloe T, Zahler S, Riexinger T, Schiele TM, et al. NAD(P)Hoxidase-dependent platelet superoxide anion release increases plateletrecruitment. Blood 2002;100(3):917e24.

[8] Pipe RK, Porte C, Livingstone DR. Antioxidant enzymes associated with theblood cells and haemolymph of the mussel Mytilus edulis. Fish and ShellfishImmunology 1993;3(3):221e33.

[9] Bendich A. Physiological role of antioxidants in the immune system. Journal ofDairy Science 1993;76(9):2789e94.

[10] Monari M, Matozzo V, Foschi J, Marin MG, Cattani O. Exposure to anoxia of theclam, Chamelea gallina, II: modulation of superoxide dismutase activity andexpression in haemocytes. Journal of Experimental Marine Biology andEcology 2005;325(2):175e88.

[11] Cheng W, Tung YH, Chiou TT, Chen JC. Cloning and characterisation of mito-chondrial manganese superoxide dismutase (mtMnSOD) from the giantfreshwater prawn Macrobrachium rosenbergii. Fish and Shellfish Immunology2006;21(4):453e66.

[12] Choi JI, Takahashi N, Kato T, Kuramitsu HK. Isolation, expression, and nucle-otide sequence of the sod gene from Porphyromonas gingivalis. Infection andImmunity 1991;59(4):1564e6.

[13] Bebianno MJ, Géret F, Hoarau P, Serafim MA, Coelho MR, Gnassia-Barelli M,et al. Biomarkers in Ruditapes decussatus: a potential bioindicator species.Biomarkers 2004;9(4e5):305e30.

[14] Brouwer M, Hoexum Brouwer T, Grater W, Brown-Peterson N. Replacement ofa cytosolic copper/zinc superoxide dismutase by a novel cytosolic manganesesuperoxide dismutase in crustaceans that use copper (haemocyanin) foroxygen transport. Biochemical Journal 2003;374(1):219e28.

[15] Brouwer M, Brouwer TH, Grater W, Enghild JJ, Thogersen IB. The paradigmthat all oxygen-respiring eukaryotes have cytosolic CuZn-superoxide dis-mutase and that Mn-superoxide dismutase is localized to the mitochondriadoes not apply to a large group of marine arthropods. Biochemistry1997;36(43):13381e8.

[16] Atzenhofer W, Regelsberger G, Jacob U, Peschek GA, Furtmüller PG, Huber R,et al. The 2.0�A resolution structure of the catalytic portion of a cyanobacterialmembrane-bound manganese superoxide dismutase. Journal of MolecularBiology 2002;321(3):479e89.

[17] Fink RC, Scandalios JG. Molecular evolution and structureefunction relation-ships of the superoxide dismutase gene families in angiosperms and theirrelationship to other eukaryotic and prokaryotic superoxide dismutases.Archives of Biochemistry and Biophysics 2002;399(1):19e36.

[18] Brouwer M, Brown-Peterson NJ, Larkin P, Patel V, Denslow N, Manning S, et al.Molecular and whole animal responses of grass shrimp, Palaemonetes pugio,exposed to chronic hypoxia. Journal of Experimental Marine Biology andEcology 2007;341(1):16e31.

[19] Marchand J, Leignel V, Moreau B, Chénais B. Characterization andsequence analysis of manganese superoxide dismutases from Brachyura(Crustacea: Decapoda): hydrothermal Bythograeidae versus littoral crabs.Comparative Biochemistry and Physiology Part B: Biochemistry and Mo-lecular Biology 2009;153(2):191e9.

[20] Chai Y-M, Yu S-S, Zhao X-F, Zhu Q, Wang J-X. Comparative proteomic profilesof the hepatopancreas in Fenneropenaeus chinensis response to white spotsyndrome virus. Fish and Shellfish Immunology 2010;29(3):480e6.

[21] Li J, Chen P, Liu P, Gao B, Wang Q. The cytosolic manganese superoxide dis-mutase cDNA in swimming crab Portunus trituberculatus: molecular cloning,characterization and expression. Aquaculture 2010;309(1e4):31e7.

[22] Lin YC, Lee F, Wu CL, Chen JC. Molecular cloning and characterization of acytosolic manganese superoxide dismutase (cytMnSOD) and mitochon-drial manganese superoxide dismutase (mtMnSOD) from the kurumashrimp Marsupenaeus japonicus. Fish and Shellfish Immunology2010;28(1):143e50.

[23] Liu XL, Xi QY, Yang L, Li HY, Jiang QY, Shu G, et al. The effect of dietary Panaxginseng polysaccharide extract on the immune responses in white shrimp,Litopenaeus vannamei. Fish and Shellfish Immunology 2011;30(2):495e500.

[24] Ji PF, Yao CL, Wang ZY. Immune response and gene expression in shrimp(Litopenaeus vannamei) hemocytes and hepatopancreas against somepathogen-associated molecular patterns. Fish and Shellfish Immunology2009;27(4):563e70.

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e14051404

[25] Gómez-Anduro GA, Sotelo-Mundo RR, Muhlia-Almazán A, Yepiz-Plascencia G.Tissue-specific expression and molecular modeling of cytosolic manganesesuperoxide dismutases from the white shrimp Litopenaeus vannamei. Devel-opmental and Comparative Immunology 2007;31(8):783e9.

[26] Ho S-H, Song Y-L. Cloning of penaeidin gene promoter in tiger shrimp(Penaeus monodon). Fish and Shellfish Immunology 2009;27(1):73e7.

[27] Gómez-Anduro GA, Barillas-Mury CV, Peregrino-Uriarte AB, Gupta L, Gollas-Galván T, Hernández-López J, et al. The cytosolic manganese superoxidedismutase from the shrimp Litopenaeus vannamei: molecular cloning andexpression. Developmental and Comparative Immunology 2006;30(10):893e900.

[28] Reese MG. Application of a time-delay neural network to promoter annotationin the Drosophila melanogaster genome. Computers and Chemistry2001;26(1):51e6.

[29] Schug J. Using TESS to predict transcription factor binding sites in DNAsequence. In: Baxevanis AD, editor. Current protocols in bioinformatics. NewJersey: J. Wiley and Sons; 2003.

[30] Steel RGD, Torrie JH. Principles and procedures of statistics. New York:McGraw-Hill; 1980.

[31] Duncan DB. Multiple-range and multiple F test. Biometrics 1955;11:1e42.[32] Fridovich I. Superoxide radical and superoxide dismutases. Annual Review of

Biochemistry 1995;64:97e112.[33] Fujii J, Suzuki K, Taniguchi N. Physiological significance of superoxide dis-

mutase isozymes. Nippon rinsho. Japanese Journal of Clinical Medicine1995;53(5):1227e31.

[34] Zhu H, Doumen C. Identification of a cytoplasmic manganese superoxidedismutase (cMnSOD) in the red swamp crawfish, Procambarus clarkii: cDNAcloning and tissue expression. Zoological Science 2009;26(4):284e8.

[35] Kim KY, Lee SY, Cho YS, Bang IC, Kim KH, Kim DS, et al. Molecular charac-terization and mRNA expression during metal exposure and thermal stress ofcopper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotisdiscus discus. Fish and Shellfish Immunology 2007;23(5):1043e59.

[36] Zhang Q, Li F, Wang B, Zhang J, Liu Y, Zhou Q, et al. The mitochondrialmanganese superoxide dismutase gene in Chinese shrimp Fenneropenaeuschinensis: cloning, distribution and expression. Developmental and Compar-ative Immunology 2007;31(5):429e40.

[37] Bao Y, Li L, Zhang G. The manganese superoxide dismutase gene in bay scallopArgopecten irradians: cloning, 3D modelling and mRNA expression. Fish andShellfish Immunology 2008;25(4):425e32.

[38] Maehara K, Hasegawa T, Xiao H, Takeuchi A, Abe R, Isobe KI. Cooperativeinteraction of NF-kB and C/EBP binding sites is necessary for manganese su-peroxide dismutase gene transcription mediated by lipopolysaccharide andinterferon-g. FEBS Letters 1999;449(2e3):115e9.

[39] Kaneko M, Takahashi T, Niinuma Y, Nomura Y. Manganese superoxide dis-mutase is induced by endoplasmic reticulum stress through IRE1-mediatednuclear factor (NF)-kB and AP-1 activation. Biological and PharmaceuticalBulletin 2004;27(8):1202e6.

[40] Mao X, Moerman-Herzog AM, Wang W, Barger SW. Differential transcrip-tional control of the superoxide dismutase-2 kB element in neurons and as-trocytes. Journal of Biological Chemistry 2006;281(47):35863e72.

[41] Henkle-Duhrsen K, Tawe W, Warnecke C, Walter RD. Characterization of themanganese superoxide dismutase cDNA and gene from the human parasiteOnchocerca volvulus. Biochemical Journal 1995;308(2):441e6.

[42] Cho YS, Lee SY, Bang IC, Kim DS, Nam YK. Genomic organization and mRNAexpression of manganese superoxide dismutase (Mn-SOD) from Hemibarbusmylodon (Teleostei, Cypriniformes). Fish and Shellfish Immunology2009;27(4):571e6.

[43] Lee SY, Kim KY, Bang IC, Nam YK. Characterization of copper/zinc-superoxidedismutase (Cu/Zn-SOD) gene from an endangered freshwater fish speciesHemibarbus mylodon (Teleostei; Cypriniformes). Fisheries and Aquatic Science2011;14(1):43e54.

[44] Zhang N. Characterization of the 50 flanking region of the human MnSOD gene.Biochemical and Biophysical Research Communications 1996;220(1):171e80.

[45] Meyrick B, Magnuson MA. Identification and functional characterization of thebovine manganous superoxide dismutase promoter. American Journal ofRespiratory Cell and Molecular Biology 1994;10(1):113e21.

[46] Seo SJ, Kang SS, Cho G, Rho HM, Jung G. C/EBP a and C/EBP b play similar rolesin the transcription of the human Cu/Zn SOD gene. Gene 1997;203(1):11e5.

[47] Li N, Karin M. Is NF-kB the sensor of oxidative stress? FASEB Journal1999;13(10):1137e43.

[48] Miao L, St. Clair DK. Regulation of superoxide dismutase genes: implications indisease. Free Radical Biology & Medicine 2009;47(4):344e56.

[49] Forsberg L, Lyrenäs L, Morgenstern R, de Faire U. A common functional C-Tsubstitution polymorphism in the promoter region of the human catalasegene influences transcription factor binding, reporter gene transcription andis correlated to blood catalase levels. Free Radical Biology & Medicine2001;30(5):500e5.

[50] Kovacs A, Green F, Hansson L-O, Lundman P, Samnegård A, Boquist S, et al.A novel common single nucleotide polymorphism in the promoter region ofthe C-reactive protein gene associated with the plasma concentration of C-reactive protein. Atherosclerosis 2005;178(1):193e8.

[51] Pinkus R, Weiner LM, Daniel V. Role of oxidants and antioxidants in the in-duction of AP-1, NF-kB, and glutathione S-transferase gene expression. Journalof Biological Chemistry 1996;271(23):13422e9.

[52] Morel Y, Barouki R. Repression of gene expression by oxidative stress.Biochemical Journal 1999;342(3):481e96.

[53] Rahman I. Regulation of nuclear factor-kB, activator protein-1, and gluta-thione levels by tumor necrosis factor-a and dexamethasone in alveolarepithelial cells. Biochemical Pharmacology 2000;60(8):1041e9.

[54] Rahman I, MacNee W. Regulation of redox glutathione levels and gene tran-scription in lung inflammation: therapeutic approaches. Free Radical Biology& Medicine 2000;28(9):1405e20.

[55] Mihm S, Galter D, Droge W. Modulation of transcription factor NFkB activityby intracellular glutathione levels and by variations of the extracellularcysteine supply. FASEB Journal 1995;9(2):246e52.

[56] Ginn-Pease ME, Whisler RL. Optimal NFkB mediated transcriptional responsesin Jurkat T cells exposed to oxidative stress are dependent on intracellularglutathione and costimulatory signals. Biochemical and Biophysical ResearchCommunications 1996;226(3):695e702.

[57] Mercurio F, Manning AM. NF-B as a primary regulator of the stress response.Oncogene. 1999;18(45):6163e71.

[58] Xu Y, Kiningham KK, Devalaraja MN, Yeh CC, Majima H, Kasarskis EJ, et al. Anintronic NF-kB element is essential for induction of the human manganesesuperoxide dismutase gene by tumor necrosis factor-a and interleukin-1b.DNA and Cell Biology 1999;18(9):709e22.

[59] Fattman CL, Schaefer LM, Oury TD. Extracellular superoxide dismutase inbiology and medicine. Free Radical Biology & Medicine 2003;35(3):236e56.

[60] Hoffmann A, Natoli G, Ghosh G. Transcriptional regulation via the NF-kBsignaling module. Oncogene 2006;25(51):6706e16.

[61] St. Clair DK, Porntadavity S, Xu Y, Kiningham K, Lester P. Transcriptionregulation of human manganese superoxide dismutase geneIn Methods inenzymology, vol. 349. Academic Press; 2002. p. 306e12.

[62] Eastgate J, Moreb J, Nick HS, Suzuki K, Taniguchi N, Zucali JR. A role formanganese superoxide dismutase in radioprotection of hematopoietic stemcells by interleukin-1. Blood 1993;81(3):639e46.

[63] Tsai SF, Yang C, Liu BL, Hwang JS, Ho SP. Role of oxidative stress inthuringiensin-induced pulmonary toxicity. Toxicology and Applied Pharma-cology 2006;216(2):347e53.

[64] Angel P, Karin M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochimica et Biophysica Acta e Reviewson Cancer 1991;1072(2e3):129e57.

[65] Huang CY, Fujimura M, Chang YY, Chan PH. Overexpression of copperezincsuperoxide dismutase attenuates acute activation of activator protein-1 aftertransient focal cerebral ischemia in mice. Stroke 2001;32(3):741e7.

[66] Zhou W, Zhang Y, Hosch MS, Lang A, Zwacka RM, Engelhardt JF. Subcellularsite of superoxide dismutase expression differentially controls AP-1 activityand injury in mouse liver following ischemia/reperfusion. Hepatology2001;33(4):902e14.

[67] Zhao Y, Oberley TD, Chaiswing L, Lin SM, Epstein CJ, Huang TT, et al. Man-ganese superoxide dismutase deficiency enhances cell turnover via tumorpromoter-induced alterations in AP-1 and p53-mediated pathways in a skincancer model. Oncogene 2002;21(24):3836e46.

[68] Takiguchi M. The C/EBP family of transcription factors in the liver and otherorgans. International Journal of Experimental Pathology 1998;79(6):369e91.

[69] Qiu X, Aiken KJ, Chokas AL, Beachy DE, Nick HS. Distinct functions of CCAATenhancer-binding protein isoforms in the regulation of manganese superox-ide dismutase during interleukin-1b stimulation. Journal of Biological Chem-istry 2008;283(38):25774e85.

[70] Seo SJ, Kim HT, Cho G, Rho HM, Jung G. Sp1 and C/EBP-related factor regulatethe transcription of human Cu/Zn SOD gene. Gene 1996;178(1e2):177e85.

[71] Kim YH, Yoo HY, Chang MS, Jung G, Rho HM. C/EBPa is a major activator forthe transcription of rat Cu/Zn superoxide dismutase gene in liver cell. FEBSLetters 1997;401(2e3):267e70.

[72] Sheng M, Thompson MA, Greenberg ME. CREB: a Ca2þ-regulated transcriptionfactor phosphorylated by calmodulin-dependent kinases. Science1991;252(5011):1427e30.

[73] Ghosh A, Greenberg ME. Calcium signalling in neurons: molecular mecha-nisms and cellular consequences. Science 1995;268(5208):239e47.

[74] Vo N, Goodman RH. CREB-binding protein and p300 in transcriptional regu-lation. Journal of Biological Chemistry 2001;276(17):13505e8.

[75] Mishra OP, Ashraf QM, Delivoria-Papadopoulos M. Phosphorylation of cAMPresponse element binding (CREB) protein during hypoxia in cerebral cortex ofnewborn piglets and the effect of nitric oxide synthase inhibition. Neurosci-ence 2002;115(3):985e91.

[76] Meyer TE, Habener JF. Cyclic adenosine 30 ,50-monophosphate responseelement binding protein (CREB) and related transcription-activating deoxy-ribonucleic acid-binding proteins. Endocrine Reviews 1993;14(3):269e90.

[77] Hardingham GE, Chawla S, Johnson CM, Bading H. Distinct functions of nu-clear and cytoplasmic calcium in the control of gene expression. Nature1997;385(6613):260e5.

[78] Montminy M. Transcriptional regulation by cyclic AMP. Annual Review ofBiochemistry 1997;66:807e22.

[79] Silva AJ, Kogan JH, Frankland PW, Kida S. CREB and memory. Annual Review ofNeuroscience 1998;21:127e48.

[80] Hsieh YS, Yang SF, Chu SC, Ho YJ, Kuo CS, Kuo DY. Transcriptional interruptionof cAMP response element binding protein modulates superoxide dismutaseand neuropeptide Y-mediated feeding behavior in freely moving rats. Journalof Neurochemistry 2008;105(4):1438e49.

S. Sookruksawong et al. / Fish & Shellfish Immunology 35 (2013) 1395e1405 1405

[81] Kim HP, Roe JH, Chock PB, Yim MB. Transcriptional activation of the humanmanganese superoxide dismutase gene mediated by tetradecanoylphorbolacetate. Journal of Biological Chemistry 1999;274(52):37455e60.

[82] Galeotti T, Pani G, Capone C, Bedogni B, Borrello S, Mancuso C, et al. Protectiverole of MnSOD and redox regulation of neuronal cell survival. Biomedicineand Pharmacotherapy 2005;59(4):197e203.

[83] Ferre-D’Amare AR, Pognonec P, Roeder RG, Burley SK. Structure and functionof the b/HLH/Z domain of USF. EMBO Journal 1994;13(1):180e9.

[84] Chang JTC, Yang HT, Wang TCV, Cheng AJ. Upstream stimulatory factor(USF) as a transcriptional suppressor of human telomerase reverse tran-scriptase (hTERT) in oral cancer cells. Molecular Carcinogenesis2005;44(3):183e92.

[85] Corre S, Galibert MD. USF as a key regulatory element of gene expression. USF:Un regulateur essentiel de la transcription 2006;22(1):62e7.

[86] Meier JL, Luo X, Sawadogo M, Straus SE. The cellular transcription factor USFcooperates with varicella-zoster virus immediate-early protein 62 to sym-metrically activate a bidirectional viral promoter. Molecular and CellularBiology 1994;14(10):6896e906.

[87] Sirito M, Lin Q, Maity T, Sawadogo M. Ubiquitous expression of the 43- and44-kDa forms of transcription factor USF in mammalian cells. Nucleic AcidsResearch 1994;22(3):427e33.

[88] Ammendola R, Mesuraca M, Russo T, Cimino F. The DNA-binding efficiency ofSp1 is affected by redox changes. European Journal of Biochemistry1994;225(1):483e9.

[89] Matsuoka TA, Kajimoto Y, Watada H, Kaneto H, Kishimoto M, Umayahara Y,et al. Glycation-dependent, reactive oxygen species-mediated suppression ofthe insulin gene promoter activity in HIT cells. Journal of Clinical Investigation1997;99(1):144e50.

[90] Parsell DA, Lindquist S. The function of heat-shock proteins in stress toler-ance: degradation and reactivation of damaged proteins. Annual Review ofGenetics 1993;27:437e96.

[91] An MI, Choi CY. Activity of antioxidant enzymes and physiological responsesin ark shell, Scapharca broughtonii, exposed to thermal and osmotic stress:effects on hemolymph and biochemical parameters. Comparative Biochem-istry and Physiology Part B: Biochemistry and Molecular Biology 2010;155(1):34e42.

[92] Zhou J, Wang L, Xin Y, WangWN, HeWY, Wang AL, et al. Effect of temperatureon antioxidant enzyme gene expression and stress protein response in whiteshrimp, Litopenaeus vannamei. Journal of Thermal Biology 2010;35(6):284e9.

[93] Chuang KH, Ho SH, Song YL. Cloning and expression analysis of heat shockcognate 70 gene promoter in tiger shrimp (Penaeus monodon). Gene2007;405(1e2):10e8.

[94] Wang WN, Wang AL, Liu Y, Xiu J, Liu ZB, Sun RY. Effects of temperature ongrowth, adenosine phosphates, ATPase and cellular defense response of juve-nile shrimpMacrobrachium nipponense. Aquaculture 2006;256(1e4):624e30.

[95] Halliwell B, Gutteridge JMC. Antioxidant defenses. In: Halliwell B,Gutteridge JMC, editors. Free radicals in biology and medicine. New York:Oxford University Press; 1999. p. 175.