genomic rearrangements of the 7q11-21 region and … · 2011-04-18 · 1.1.4: williams-beuren...

GENOMIC REARRANGEMENTS IN HUMAN AND MOUSE AND THEIR

CONTRIBUTION TO THE WILLIAMS-BEUREN SYNDROME PHENOTYPE.

by

Edwin James Young

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy,

Institute of Medical Science

University of Toronto

© Copyright by Edwin James Young (2010)

ii

Genomic rearrangements in human and mouse and their contribution to the Williams-

Beuren Syndrome phenotype.

Doctor of Philosophy (2010)

Edwin James Young

Institute of Medical Science

University of Toronto

Abstract:

Genomic rearrangements, particularly deletions and duplications, are known to cause

many genetic disorders. The chromosome 7q11.23 region in humans is prone to recurrent

chromosomal rearrangement, due to the presence of low copy repeats that promote non-allelic

homologous recombination. The most well characterized rearrangement of 7q11.23 is a

hemizygous 1.5 million base pair (Mb) deletion spanning more than 25 genes. This deletion

causes Williams-Beuren Syndrome (WBS; OMIM 194050), a multisystem developmental

disorder with distinctive physical and behavioural features.

Other rearrangements of the region lead to phenotypes distinct from that of WBS. Here

we describe the first individual identified with duplication of the same 1.5 Mb region, resulting

in severe impairment of expressive language, in striking contrast to people with WBS who have

relatively well preserved language skills. We also describe the identification of a new gene for a

severe form of childhood epilepsy through the analysis of individuals with deletions on

iii

chromosome 7 that extend beyond the boundaries typical for WBS. This gene, MAGI2, is part of

the large protein scaffold at the post-synaptic membrane and provides a new avenue of research

into both the molecular basis of infantile spasms and the development of effective therapies.

Individuals with smaller than typical deletions of 7q11.23 have delineated a minimal

critical region for WBS and have implicated two members of the TFII-I transcription factor

family. To better understand the contribution of these genes to WBS, I have generated animal

models with these genes deleted singly and in combination. Disruption of the first gene,

Gtf2ird1, resulted in phenotypes reminiscent of WBS including alterations in social behaviour,

natural fear response and anxiety. An alteration in serotonin function was identified in the

frontal cortex and may be linked to these behavioural phenotypes. Together with a model for the

second gene, Gtf2i, and the double deletion model that was generated using Cre-loxP

technology, these resources will permit the study of the individual and additive effects of

hemizygosity for Gtf2i and Gtf2ird1 and will greatly expand our understanding of the role the

TFII-I gene family in WBS.

iv

Acknowledgements

I want to first start off by thanking my supervisor Dr. Lucy Osborne and my committee

members Dr Steve Scherer and Dr Paul Franklin for all their technical assistance and especially

their patience. A special thank you to Drs. Bernice Morrow, Sue Quaggin and Johanna

Rommens, for agreeing to be members of my doctoral defense committee. I would also like to

thank the members of the Osborne lab past and present, in particular Jen O‘Leary for the

countless hours of ‗scientific discussion‘ over the last several years.

Thank you to the many collaborators and their respective lab members that I have had the

priveledge of working with including Dr John Roder, Dr Howard Mount, Dr Paul Fletcher, Dr

Evelyn Lambe (especially Eliane Proulx), Dr Andras Nagy (especially Marina Gerstenstein), the

Marsden Lab (especially Brent Steer), The Centre for Applied Genomics, Dr Carolyn Mervis, Dr

Colleen Morris and the WBS family members.

A special thanks my parents and family for although I do not think they always

understood why I did it, they were always there with motivation and enthusiasm. I would also

like to thank my inlaws Lino and Kathy Vrigini for all encouragement and support they have

provide me and my family throughout my studies.

Of course the greatest thanks have to go to my family; my wife Lisa, my son Owen and

our dog Lily. Lisa, I knew from the beginning that the journey would not be an easy one but

your unwavering love and support made the completion my studies possible. Although my son

Owen will not remember this period in his life, his safe arrival in the last year of my studies

provided not only a impetus to finish but also a great deal of perspective of what is truly

important in my life.

v

TABLE OF CONTENTS

Abstract ii

Acknowledgements iv

Table of Contents v

List of Figures x

List of Tables xii

List of Abbreviations xiv

Internet Resources xxi

Chapter I: Introduction to Williams-Beuren syndrome. 1

1.1 Literature Review. 2

1.1.1: Williams-Beuren syndrome history 2

1.1.2: Williams-Beuren syndrome clinical phenotype 3

1.1.3: Williams-Beuren syndrome cognitive and behavioral phenotype 7

1.1.4: Williams-Beuren Syndrome Cognitive Profile (WBSCP): 7

1.1.5: Genomic structure and molecular basis of Williams-Beuren Syndrome 11

1.1.6: WBS genotype-phenotype correlations 13

1.1.7: Identification of a WBS critical region 14

1.1.8: Transcription factors in human disease 15

1.1.9: GTF2I transcription factor gene family 17

1.1.10: The transcription factor GTF2I 19

1.1.11: The transcription factor GTF2IRD1 22

1.1.12: The transcription factor GTF2IRD2 23

1.2: Research Aims and Hypothesis 24

1.3: References

26

Chapter II: Genomic rearrangements of the human 7q11-q21 region 35

2.1: Literature Review. 36

2.1.1: Chromosomal rearrangements and the human genome 36

2.1.2: Chromosomal rearrangements and association with disease 39

2.1.3: Inversion of the WBS region 40

2.1.4: Duplication of the WBS region 41

2.1.5: Large deletions of the WBS region 42

2.2: Methods: Severe Expressive-Language Delay Related to Duplication of the

Williams–Beuren Locus

43

2.2.1: Participants 43

2.2.2: Clinical evaluation of language fundamentals and physical

manifestations

44

2.2.3: Fluorescence in situ hybridization 44

vi

2.2.4: Single-copy microsatellite markers 45

2.2.5: Site Specific Nucleotide (SSN) dosage analysis 45

2.2.6: Genomic analysis using quantitative PCR 46

2.2.7: Expression analysis using quantitative PCR 46

2.3: Methods: The Common Inversion of the Williams-Beuren Syndrome Region at

7q11.23 Does Not Cause Clinical Symptoms

47


2.3.2: Developmental assessment 48

2.3.3: Inversion testing 49

2.3.4: Expression analysis using quantitative PCR 49

2.3.5: Copy Number Variation (CNV) analysis 51


2.4: Methods: Infantile Spasms Is Associated with Deletion of MAGI2 on

Chromosome 7q11.23-q21.11

52


2.4.2: Preparation of genomic DNA 53



2.5: Results: Duplications and its Association with Speech Language Delay 56

2.5.1: Mild physical manifestation of 7q11.23 duplication 56

2.5.2: Severe expressive language delay is the most striking feature of

7q11.23 duplication

58

2.5.3: Duplication of the 1.5 Mb WBS region 60

2.5.4: Single-copy microsatellite markers 61

2.5.5: The duplication is the reciprocal of the WBS deletion 64

2.5.6: Genes within the duplication show altered expression 64

2.6: Results: Common Inversion Does Not Cause Clinical Symptoms 66

2.6.1: Clinical assessment 66

2.6.1.1: Medical and family history Participant 1 67

2.6.1.2: Medical and family history Participant 2 67

2.6.1.3: Physical examination Participant 1 68

2.6.1.4: Physical examination Participant 2 70

2.6.2: INV-1 participant 1 and 2 developmental assessment 72

2.6.3: Inversion testing using three-colour interphase FISH 76

2.6.4: INV expression analysis 76


2.7: Results: Identification of MAGI2 Deletions and its Association with IS 81

2.8: Conclusion and Discussion: 86

2.8.1: Severe expressive language delay related to duplication of the

Williams–Beuren locus:

86

2.8.2: The common inversion of 7q11.23 does not cause clinical symptoms 94

2.8.3: Infantile spasms (IS) is associated with deletion of MAGI2 102

2.9: References: 107

Chapter III: Analysis of Gtf2ird1 Mouse Model: 121

vii

3.1: Literature Review: 122

3.1.1: Contribution of the genes telomeric to elastin to the Williams-Beuren

syndrome phenotype

122

3.1.2: The neurobiology of fear, emotion and social cognition 125

3.1.3: The unique social profile seen in Williams-Beuren syndrome 126

3.1.4: Increased levels of generalized anxiety and specific phobias in WBS 128

3.1.5: Role of serotonin in emotional behaviors 130

3.2: Material and Methods: 132

3.2.1: Generation of targeted Gtf2ird1 mouse model 132

3.2.2: Expression analysis 133

3.2.3: General morphological analysis 135

3.2.4: Resident intruder/Olfactory function test 136

3.2.5: Elevated plus maze 136

3.2.6: Cube exploration/novel object recognition test 137

3.2.7: Locomotor activity in the Open Field 138

3.2.8: Morris Water Maze Test 138

3.2.9: Context and cued fear conditioning 139

3.2.10: Neurochemical analyses 140

3.2.11: Rotorod analysis 141

3.2.12: Microarray analysis 141

3.2.13: Western blotting analysis 142

3.2.14: Immunohistochemistry 143

3.2.15 Golgi-Cox Staining 143

3.2.16: Brain slice preparation and electrophysiology 144

3.2.17: Statistical Analysis 146

3.3: Results: 146

3.3.1: Characterization of Gtf2ird1 mice: 147

3.3.2: Phenotypic analysis of Gtf2ird1 targeted mice 151

3.3.3: Analysis of body weight 151

3.3.4: Assessment in the Open Field 152

3.3.5: Gtf2ird1-/-

mice are less anxious in the elevated plus maze 154

3.3.6: Gtf2ird1-/-

mice display deficits in cued based fear conditioning 155

3.3.7: Resident Intruder: Gtf2ird1-/-

mice are less aggressive and engage in

more social interaction

157

3.3.8: Gtf2ird1-/-

mice have normal visuo-spatial learning and memory 159

3.3.9: Gtf2ird1-/-

mice display cerebellar structural abnormalities and

muscular deficits along with deficits in motor co-ordination on the

rotorod test:

160

3.3.10: Gtf2ird1-/-

mice show altered serotonin metabolite levels in various

brain regions:

165

3.3.11: Alterations in neuronal activity in Gtf2ird1-/-

mice 167

3.3.12: Serotonin elicits larger outward currents in layer V pyramidal neurons

in Gtf2ird1-/-

mice

169

3.3.13: 5-HT-elicts direct outward currents mediated by 5-HT1A receptor in

Gtf2ird1-/-

mice.

171

3.3.14: Serotonin 5-HT1A outward currents are unchanged in prefrontal layer 173

viii

II/III in Gtf2ird1-/-

mice

3.3.15: Other inhibitory currents are not enhanced in layer V in Gtf2ird1-/-

mice 173

3.3.16: Spine density in layer V pyramidal cells in Gtf2ird1-/-

mice is

unchanged

175

3.3.17: 5-HT receptor expression is unchanged in Gtf2ird1-/-

mice 177

3.3.18: Identification of stress-induced changes in gene expression in Gtf2ird1-

/- mice using microarray analysis

179

3.4: Conclusion and Discussion: 182

3.4.1: Gtf2ird1+/-

and Gtf2ird1-/-

mice show mild growth retardation 183

3.4.2: Changes in behavior including aggression and anxiety and sociability in

Gtf2ird1-/-

mice

186

3.4.3: Gtf2ird1-/-

mice display deficits in muscle function 189

3.4.4: Gtf2ird1-/-

mice have altered fear-based learning, but normal spatial

learning and memory:

191

3.4.5: Gtf2ird1-/-

mice show altered serotonin metabolite levels in the brain 192

3.4.6: Gtf2ird1-/-

mice show altered neuronal activity 194

3.4.7: Implications of elevated 5-HT1A currents in Gtf2ird1-/-

mice 195

3.4.8: Altered stress-induced gene expression in the frontal cortex of

Gtf2ird1-/-

mice

199

3.5: References:

202

Chapter IV: Mouse Models: 215

4.1: Literature Review: 216

4.1.1: Mouse genome engineering 216

4.1.2: Existing mouse models of WBS genes 220

4.2: Methods: 226

4.2.1: Generation of Gtf2iloxP

mouse model 226

4.2.2: Preparation of genomic DNA 229

4.2.3: Genomic copy number analysis using conventional and quantitative

PCR

229

4.2.4: Re-deriving of parental Gtf2iloxP

G10 line 230

4.2.5: Identification and characterization of gene trap clones 230

4.2.6: Expression analysis of gene trap ES cells 232

4.2.7: Generation of gene trap mice 235

4.2.8: Generation and characterization of Gtf2i gene family deletion mice 235

4.2.9: Determination of methylation status of loxP sites 238

4.2.10: X-gal staining of the mouse cortex 239

4.3: Results: 240

4.3.1: Generation and characterization of Gtf2iloxP

mice 240

4.3.2: Identification and characterization of gene trap mice 242

4.3.3: Gtf2ird1GT+-

null mice are viable, Gtf2iGT+

-null mice are embryonic

lethal

243

4.3.4: Reduced expression of ― trapped‖ alleles 244

ix

4.3.5: TFII-IRD1 protein expression is predominantly in layer V of the frontal

cortex

246

4.3.6: TFII-I protein is strongly expressed throughout the brain 249

4.3.7: Determination of methylation status of loxP sites 250

4.3.8: Identification of cre-induced genomic recombination 252

4.4: Conclusion and Discussion 254

4.5: References

263

Chapter V: Summary and Future Direction: 269

5.1: Introduction 270

5.1.1: Summary: 270

5.1.2: Genomic rearrangements of the human 7q11.23-21.11 region 271

5.1.3: Targeting of Gtf2ird1 results in increased sociability, reduced fear and

aggression, altered serotonin metabolism and deficits in motor

function/co-ordination

273

5.1.4: Generation of gene trap and deletion mouse models for the Gtf2i gene

trap family

274

5.1.5: Future direction 275

5.2: References: 278

x

LIST OF FIGURES

Chapter I: Introduction to Williams-Beuren syndrome.

FIGURE 1.1. WBS patient with typical facial features 4

FIGURE 1.2. Example of spatial abnormalities 9

FIGURE 1.3. Physical map of the WBS region 12

FIGURE 1.4. Reported cases of individuals with atypical deletions of the WBS

region

14

FIGURE 1.5. Structural elements of the the proteins encoded by the Gtf2i gene

family members

18

Chapter II: Genomic rearrangements of the human 7q11-q21 region.

FIGURE 2.1. NAHR mechanisms resulting in deletions and duplications 37

FIGURE 2.2. Comparison of the faces of individuals with WBS and dup7q11.23 57

FIGURE 2.3. FISH analysis of the dup7q11.23 patient 61

FIGURE 2.4. Map of telomeric breakpoint region in dup7q11.23 patient 65

FIGURE 2.5. Participant 1 at age 17 years 68

FIGURE 2.6. Detection of 7q11.23 inversion using three-color FISH 76

FIGURE 2.7. Summary of copy number variants identified in patient 1 80

FIGURE 2.8. Summary of interstitial deletions of 7q11.23-q21.1 in cases with and

without infantile spasms

82

FIGURE 2.9. Comparison of human and mouse MAGI2 gene structure 103

FIGURE 2.10. MAGI2 expression in various tissues 104

Chapter III: Analysis of Gtf2ird1 Mouse Model:

FIGURE 3.1. Targeted disruption of the murine Gtf2ird1 gene 148

FIGURE 3.2. Disruption of Gtf2ird1 results in truncated transcript. 149

FIGURE 3.3. Decreased expression of full length Gtf2ird1 150

FIGURE 3.4. Alteration in body weight of Gtf2ird1-/-

mice 152

FIGURE 3.5. Behavioral Changes observed in the Open Field. 153

FIGURE 3.6. State and trait anxiety are reduced in Gtf2ird1-/-

mice 155

FIGURE 3.7. Altered cued-based fear conditioning in Gtf2ird1-/-

mice 156

FIGURE 3.8. Decreased aggression and increased sociability in V during the

resident-intruder test

158

FIGURE 3.9. Gtf2ird1-/-

mice perform normally in the Morris water maze 160

FIGURE 3.10. Decreased Purkinje Cell layer length in paraflocculus of Gtf2ird1-/-

mice

162

FIGURE 3.11. Altered grip strength in Gtf2ird1-/-

mice 163

FIGURE 3.12. Deficits in motor co-ordination in Gtf2ird1-/-

mice 164

FIGURE 3.13. Reduced c-Fos mRNA levels in the frontal cortex of Gtf2ird1-/-

mice 167

FIGURE 3.14. Reduced c-Fos-IR levels in layer V of the the frontal cortex of 168

xi

Gtf2ird1-/-

mice

FIGURE 3.15. Enhanced outward currents in layer V pyramidal neurons in Gtf2ird1-/-

mice

170

FIGURE 3.16. Enhanced outward currents are mediated by 5-HT1A receptors in

Gtf2ird1-/-

mice

172

FIGURE 3.17. Other inhibitory currents are not enhanced in layer V of the Gtf2ird1-/-

mice

174

FIGURE 3.18. Dendritic spine density is unaltered in Gtf2ird1-/-

mice 176

FIGURE 3.19. Decreased expression of Trpc4 in Gtf2ird1-/-

mice using qPCR and

Western Analysis

181

Chapter IV: Mouse Models:

FIGURE 4.1. Gene trapping mechanism 220

FIGURE 4.2. Syntenic WBS regions in human and mouse 222

FIGURE 4.3. Gap repair targeting of Gtf2i 228

FIGURE 4.4. Trans allelic meiotic recombination (TAMERE) 236

FIGURE 4.5. Analysis of targeted GTF2IloxP

ES cell lines 242

FIGURE 4.6. Genotyping of Gtf2i and Gtf2ird1 gene trap mice 244

FIGURE 4.7. Expression of Gtf2i and Gtf2ird1 in Gene Trap cell lines 245

FIGURE 4.8. Western blot analysis of Gtf2i gene family member expression in gene

trap and recombinant mouse lines.

246

FIGURE 4.9. Expression of TFII-IRD1/LacZ in various region of the mouse brain 248

FIGURE 4.10. Expression of TFII-I/LacZ in various region of the mouse brain 249

FIGURE 4.11. Methylation status of lox71 and loxP sites in Gtf2i and Gtf2ird1 gene

trap mice

251

FIGURE 4.12. Identification of Gtf2i gene family deletion 253

xii

LIST OF TABLES

Chapter I: Introduction to Williams-Beuren syndrome

Table 1.1 Clinical symptoms of Williams-Beuren syndrome 5

Table 1.2. Transcription factors that cause disease by haploinsufficiency 16

Chapter II: Genomic rearrangements of the human 7q11-q21 region.

Table 2.1. Contiguous Gene Disorders associated with chromosomal rearrangements 40

Table 2.2. Primers used for Expression analysis 50

Table 2.3. qPCR Primers Used to Characterize MAGI2 Breakpoints 55

Table 2.4. Standard Scores on Intellectual and Vocabulary Assessments 59

Table 2.5. Single-Copy Microsatellite Analysis Using Markers from Within the

WBS Region

63

Table 2.6. Genes Within the Duplication Show Altered Expression. 66

Table 2.7. Clinical and neurobehavioral features of individuals with Williams-

Beuren syndrome and of Participants 1 and 2

71

Table 2.8. Standard scores on intellectual and adaptive behaviour assessments for

Participants 1 and 2 and for adolescents and young adults with Williams-

Beuren syndrome

75

Table 2.9. Expression analysis of genes from the WBS region in individuals who

have WBS or individuals in the general population who have WBSinv-1

78

Table 2.10. Copy number variant analysis of Participants 1 and 2 80

Table 2.11. Summary of clinical features in participants with deletions of

chromosome 7q11.23-q21.1

84

Chapter III: Analysis of Gtf2ird1 Mouse Model:

Table 3.1. Primers for quantitative PCR amplification from cDNA 134

Table 3.2. Serotonin metabolite 5HIAA levels are increased in the amygdala,

parietal cortex and occipital cortex

166

Table 3.3. Expression of serotonin receptors in the frontal cortex of Gtf2ird1-

targeted mice.

178

Table 3.4. Microarray results for genes whose expression was increased or decreased

two-fold or greater.

179

Chapter IV: Mouse Models:

Table 4.1. Primers used in qPCR screening of Gtf2iloxP

targeted clones 230

Table 4.2. Primers used in genotyping of Gtf2iloxP

and gene trap mice 232

Table 4.3. Primers used in expression analysis of gene trap clones 234

xiii

Table 4.4. Primers used to genotype gene trap mice 235

Table 4.5. Primers used to genotype Gtf2i gene family deletion mice 237

Table 4.6. qPCR primers used to identify genomic rearrangements in Gtf2i gene

family deletion and duplication mice

238

Table 4.7. Primers used in bisulfite sequencing 239

Table 4.8 Trans-loxer males, litter sizes and efficiency of cre-induced

recombination

253

xiv

LIST OF ABBREVIATIONS, DISEASES AND GENE NAMES

5-HIAA 5-hydroxyindoleacetic acid

5-HT Serotonin

5-HT1A Serotonin 1A receptor

5-HT1B Serotonin 1B receptor

5-HT2A Serotonin 2A receptor

5-HT2C Serotonin 2C receptor

5-HTP 5-hydoxytryptophan

ACC Anterior cingulate cortex

ACE Agonist-induced Ca2+

entry

ACSF Artificial cerebrospinal fluid

ACTB Beta-actin

ACTH Adrenocorticotropic hormones

ADHD Attention deficit hyperactivity disorder

AMPA α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid

ANOVA Analysis of variance

APDC 2R,4R-4-Aminopyrrolidine-2,4-dicarboxylate

ASD Autism Spectrum Disorder

ASR Acoustic Startle Response

BAC bacterial artificial chromosome

BAZ1B Bromodomain Adjacent To Zinc Finger Domain, 1B

BDNF Brain-Derived Neurotrophic Factor

BSA Bovine Serum Albumin Or Basal Synaptic Activity

BTK Bruton Tyrosine Kinase

CA Chronological Age

xv

CaMKII Calmodulin Kinase II

CALN1 Calneuron 1

CELF-Preschool 2 Clinical Evaluation Of Language Fundamentals—Preschool Version 2nd

Ed.

CMT1A Charcot-Marie-Tooth Disease, Type 1A

CNS Central Nervous System

CNV Copy Number Variation

CR Conditioned Response

Cre Cyclization Recombination

CREB cAMP Response Element Binding

CREBP cAMP Response Element Binding Protein

CSF Cerebrospinal Fluid

CLIP2 Cytoplasmic Linker Protein 2

DA Dopamine

DAS Differential Abilities Scale

DD Distal Deletion

DGS DiGeorge Syndrome

DOPAC Dihydroxyphenylacetic Acid

EBV Epstien-Barr Virus

EDTA Ethylenediaminetetraacetic Acid

EEG Electroencephalograms

EGR1 Early Growth Response 1

EIF4H Eukaryotic Initiation Factor 4A

ELN Elastin

EPM Elevated Plus Maze

ERK Extracellular Signal-Regulated Kinase-1

ES Cell Embryonic Stem Cell

EVT Expressive Vocabulary Test

xvi

FISH Fluorescent In Situ Hybridization

FKBP6 FK506 Binding Protein 6

fMRI Functional MRI

FOXP2 Forkhead Box Protein P2

FZD9 Frizzled-9

GABA Gamma-Aminobutyric Acid

GABAA GABA Receptors (A-Type)

GABAB GABA Receptors (B-Type)

GAD Generalized Anxiety Disorder

GCA General Conceptual Ability

GIRK Gi/O-Protein Linked Inwardly Rectifying Potassium

GTF2I General Transcription Factor 2I

GTF2IRD1 General Transcription Factor 2I Repeat Domain Containing Protein 1

GTF2IRD2 General Transcription Factor 2I Repeat Domain Containing Protein 2

HEK Human Embryonic Kidney

HIP1 Huntingtin Interacting Protein 1

HLH Helix-Loop-Helix Domain

HMBS Hydroxymethylbilane Synthase

HNPP Hereditary Neuropathy With Liability To Pressure Palsies

HPLC High Performance Liquid Chromatography

HPRT1 Hypoxanthine Phosphoribosyltransferase 1

HVA 4-Hydroxy-3- Methoxyphenylacetic Acid

IC Insular Cortex

IGTC International Gene Trap Consortium

IIH Idiopathic Infantile Hypercalcemia

IR Immunoreactivity

IS Infantile Spasms

xvii

K-BIT Kaufman Brief Intelligence Test

KO Knockout

LacZ Beta-Galactosidase

LAT2 Linker for Activation of T Cells 2 (formerly WBSCR5)

LCR(S) Low-Copy Repeat(S)

LI Language Impairment

LIMK1 LIM Domain Kinase 1

loxP Locus of X-Over P1

LTD Long Term Depression

LTP Long Term Potentiation

LZ Leucine Zipper

MAGI2 Membrane-Associated Guanylate Kinase Inverted-2 (also known as S-

SCAM, Synaptic Scaffolding Molecule)

MAPK Mitogen Activated Protein Kinase

Mb Megabase (Million Base Pair)

MCR Minimal Critical Region

MEF2C Myocyte Enhancer-Binding Factor 2C

mGlur2/3 Metabotropic Glutamate Receptors Type 2 And 3

MLPA Multiplex Ligation-Dependent Probe Amplification

MaoA Monoamine Oxidase A

MRI Magnetic Resonance Imaging

NAHR Non Allelic Homologous Recombination

NCF1 Neutrophil Cytosolic Factor 1

NCoR Nuclear Receptor Co-Repressor

NE Norepinephrine

NEL Normalized Expression Level

NEO Neomycin

NMDA N-Methyl-D-Aspartic Acid

xviii

NPE Non-Pre-Exposed

NS Not Significant

OFC Orbitofrontal Cortex

OFT Open Field Test

OMIM Online Mendelian Inheritance In Man,

ORF Open Reading Frame

PB Phosphate Buffer

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

P/D Deletion of the WBS Syntenic Region (Chromosome 5G2) in the Mouse

PD Proximal Deletion

PE Pre-Exposed

PFA Paraformaldehyde

PFC Prefrontal Cortex

PGK1 Phosphoglycerate Kinase 1

PKA Protein Kinase A

PKC Protein Kinase C

PLC Phospholipase C

POM121 Pore Membrane Protein Of 121 kDa

PPI Prepulse Inhibition

PPS Peripheral Pulmonary Stenosis

PPVT-III Peabody Picture Vocabulary Test—3rd

Edition.

qPCR Quantitative Polymerase Chain Reaction

Rb Retinoblastoma Protein

RFC2 Replication Factor C (Activator 1) 2

RT-PCR Reverse Transcription Polymerase Chain Reaction

SA Splice Acceptor

xix

SDHA Succinate Dehydrogenase

SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

SEM Standard Error of the Mean

SERPIND1 Serpin Peptidase Inhibitor, Clade D (Heparin Cofactor), Member 1.

SERT Serotonin Transporter

SIB-R Scales of Independent Behavior-Revised

SHFM Split Hand/Foot Malformation

SLI Specific Language Impairment

SMC Smooth Muscle Cell

SMS Smith-Magenis Syndrome

SN Substantia Nigra

SNP(s) Single Nucleotide Polymorphism(s)

SRE Serum Response Element

SRF Serum Response Factor

SSN Site Specific Nucleotide

SSRI(S ) Serotonin Reuptake Inhibitor(S)

STX1A Syntaxin 1A

SVAS Supravalvular Aortic Stenosis

Sycp1 Synaptonemal Complex Protein 1

TAMERE Targeted Meiotic Recombination

TBP TATA-Box Binding Protein

TBS Tris-Buffered Saline

TBST TBS + 0.05% Tween

TCP Toronto Centre For Phenogenomics

TFII-I Transcription Factor 2 I

TFII-IRD1 Transcription Factor 2 I Repeat Domain Containing Protein 1

TFII-IRD2 Transcription Factor 2 I Repeat Domain Containing Protein 2

xx

TK Thymidine Kinase

TPH1 Tryptophan Hydroxylase 1

TPH2 Tryptophan Hydroxylase 2

TRIM50 Tripartite Motif-Containing 50

TRIM74 Tripartite Motif-Containing 74

TRPC4 Transient Receptor Potential Cation Channel, Subfamily C, Member 4

TST Tail Suspension Test

TTX Tetrodotoxin

UTR Untranslated Region

VCFS Velocardiofacial Syndrome

VMAT2 Vesicular Monoamine Transporter 2

VTA Ventral Tegmental Area

WASI Wechsler Abbreviated Scale Of Intelligence

WBS Williams-Beuren Syndrome

WBSCP Williams-Beuren Syndrome Cognitive Profile

WBSCR Williams-Beuren Syndrome Chromosome Region

WBSinv-1 Williams-Beuren Syndrome Inversion 1

WT Wild Type

xg relative centrifugal force

X-Gal 5- Bromo-Chloro-Indolyl-Galactopyranoside

YPEL1 Yippee-Like 1

xxi

INTERNET RESOURCES

Database of Genomic Variants, The Centre for Applied Genomics, Toronto. World Wide Web

URL: http://projects.tcag.ca/variation/

The Chromosome 7 Browser, The Centre for Applied Genomics, Toronto. World Wide Web

URL: http://www.chr7.org/

Online Mendelian Inheritance in Man (OMIM):

URL: http://www.ncbi.nlm.nih.gov/Omim

PAST (PAlaeontological STatistics),

URL: http://folk.uio.no/ohammer/past/

NCBI BLAST Server:

URL: http://www.ncbi.nlm.nih.gov/BLAST

University of California Santa Cruz (UCSC) Genome Browser:

URL: http://genome.ucsc.edu/

Primer3. Web-based PCR primer selection tool.

URL: http://frodo.wi.mit.edu/primer3/

Allen Brain Atlas. An interactive, genome-wide image database of gene expression.

URL: http://mouse.brain-map.org/

Repeatmaker. Screens DNA sequences in FASTA format against a library of repetitive elements

and returns a masked query sequence ready for database searches.

URL: http://www.repeatmasker.org/

The International Gene Trap Consortium (IGTC). Publicly available gene trap cell lines, which

are available on a non-collaborative basis for nominal handling fees.

URL: http://www.genetrap.org/

Webcutter. Online restriction digest tool.

URL: http://rna.lundberg.gu.se/cutter2/

1

CHAPTER I: INTRODUCTION TO WILLIAMS-BEUREN SYNDROME:

2

1.1: Literature Review:

1.1.1: Williams-Beuren syndrome history:

The history of Williams-Beuren Syndrome (WBS- also known as Williams syndrome:

OMIM #194050) began to unfold almost 60 years ago. In the early 1950s reports began to

emerge in Great Britain and Switzerland of an epidemic of idiopathic infantile hypercalcemia

(IIH) (Lightwood, 1952). It was soon determined that this rise in IIH was the result of infant

food being over fortified with vitamin D. With the subsequent reduction in the amount of vitamin

D supplementation, a substantial decrease in the incidence of IIH was seen by the end of the

1950‘s (Jones, 1990). It was noted however, that two forms of the disorder existed; a mild form

that could be treated by dietary restrictions and a more severe form that dated from birth and

involved additional features including an elfin facial appearance, mental retardation and cardiac

abnormalities (Fanconi et al., 1952; Lowe et al., 1954). Although severe cases of IIH were

reported throughout the 1950s, (with the first picture of a Williams syndrome individual believed

to have been published in 1956 by Scheslinger et al.) it was not until the early 1960s when a

cardiologist at Greenlane Hospital in Auckland, New Zealand, reported supravalvular aortic

stenosis or SVAS (a narrowing of the ascending aorta) present in four patients each associated

with distinctive facial features as well as physical and mental retardation in the absence of IIH

and recognized it as a distinct disorder (Williams et al., 1961). The following year Beuren et al.,

further identified three individuals with similar features and were the first to report a consistent

style of social behavior, stating “All have the same kind of friendly nature – they love everyone,

are loved by everyone, and are very charming” (Beuren et al 1962). Eventually this combination

of SVAS, distinctive faces, mental retardation and an overly friendly behavior evolved into the

clinical diagnosis of WBS.

3

However it was more than 30 years later that the etiology of WBS began to emerge. In

the mid 1990s, an SVAS patient was identified having a disruption of the elastin gene at 7q11.23

by a translocation, definitively linking the elastin gene to SVAS (Currran et al., 1993). It was

subsequently determined that WBS was caused by a submicroscopic deletion resulting in

hemizygosity at the elastin locus (Ewart et al., 1993). Generation of detailed physical and

transcription maps of the 7q11 chromosomal interval over the next ten years delineated the WBS

critical region to be 1.5 million base pairs encompassing at least 25 genes (Meng et al., 1998;

Osborne, 1999; Desilva et al, 2002; Merla et al., 2002). Although the deletion of ELN could

account for the cardiovascular disease in WBS, it was evident that the loss of neighbouring genes

was likely responsible for the remaining clinical features seen in WBS.

1.1.2: Williams-Beuren syndrome clinical phenotype:

It has been determined that WBS occurs at a frequency of between 1 in 7,500 and 20,000

(Greenberg 1990; Stromme et al, 2002) and results from non-allelic homologous recombination

between large low-copy repeat elements (LCRs) that flank the WBS deletion region (Bayés et

al., 2003). The vast majority of deletions are believed to occur in a sporadically and be de novo

in origninr; however there have been reported cases of autosomal dominant transmission from

mother to child (Morris et al., 1993). Although presentation shows variability both between

individuals and over time, the Williams-Beuren syndrome clinical profile (Table 1.1) is

distinguishable from other neurodevelopmental disorders by a recognizable pattern of symptoms;

dysmorphic facial features, mental retardation, a distinctive uneven cognitive and behavioral

profile, connective tissue abnormalities and cardiovascular disease (Morris and Mervis, 2000).

4

The distinctive physical appearance of WBS includes a wide forehead, bitemporal

narrowing, flat nasal bridge, pre-orbital fullness, stellate patterning of the iris, strabismus,

bulbous nasal tip, long philtrum, wide mouth, prominent cheeks, malocclusion, small jaw and

prominent earlobes (Morris and Mervis, 2000) (Figure 1.1). Growth delay is a common feature

in individuals with WBS with 30-40% falling below the third percentile on standard growth

curves (Franke, 1999). An abnormal pattern of growth is evident from birth with feeding

problems including colic, gastric reflux, constipation and failure to thrive (Pankau et al., 1992).

In addition, hypothyroidism (Stagi et al., 2005; Cambiaso et al., 2007; Stagi et al., 2008) and

growth hormone deficiency (Spadoni et al., 1983) have also been documented in a subset of

adult WBS cases.

Commonly observed neuroanatomical abnormalities in WBS include a decrease in brain

size (Meyer-Lindenberg et al., 2006) thought to be the result of a decrease in sub-cortical white

5

matter and significantly reduced neuronal density (Galaburda et al., 2002). The cerebrum is

enlarged in adults with WBS relative to age-matched normally developing controls. (Tassabehji,

2003). Other neurological abnormalities such as hypotonia and hyperflexia are thought to

contribute to the awkward gait seen in WBS (Morris and Mervis, 2000).

Table 1.1 Clinical Symptoms of Williams-Beuren Syndrome.

SYSTEM PROBLEM INCIDENCE (%)

Birth defects

Congenital heart disease

Umbilical hernia

Inguinal hernia

79

14

38

Nervous

Developmental delay, specific

learning disability,

attention deficit disorder during

childhood

Mental retardation - IQ<70 -

during adulthood

97

Cardiovascular

Supravalvular aortic stenosis

Supravalvular pulmonary stenosis

Hypertension in adulthood

64

24

47

Ocular

Stellate patterning of iris

Esotropia

Hyperopia

72

50

24

Auditory Hypersensitivity to sound

Chronic otitis media

85

43

Dental

Malocclusion

Enamel hypoplasia

Microdontia

85

48

55

Genitourinary Renal anomalies 52

6

SYSTEM PROBLEM INCIDENCE (%)

Gastrointestinal

Constipation

Vomiting, constipation and colic

in infancy

Hypercalcemia in infancy

43

45

67

Musculoskeletal

Joint limitation/

Curvature of spine

Awkward gait

Extra sacral crease

Fifth-finger clinodactyly

50

45

60

52

Integumentary

Dysmorphic facial features

Hoarse, low voice

Prematurely aging skin and

graying hair in adulthood

Hypoplastic nails

96

95

60

67

Adpated from Morris et al. 1988, J. Pediatrics. Total of 42 indviduals with Williams Syndrome.

One of the most well characterized aspects of the WBS phenotype is the cardiovascular

disease presenting as elastin arteriopathy that varies in WBS individuals from aortic hypoplasia

to severe stenosis (Pober et al., 2008). Cardiovascular problems including SVAS, peripheral

pulmonary stenosis (PPS), hypertension and mitral valve prolapsed collectively are thought to

occur in approximately 80% of WBS cases and with about half of these individuals requiring

surgery (Ensing et al., 1989). It has been reported that abnormal deposition of elastin in arterial

walls of patients with SVAS and SVAS in conjunction with WBS, leads to increased

proliferation of arterial smooth muscle cells (SMC), resulting in the formation of hyperplastic

lesions (Dridi et al., 2005). This structural abnormality results in arteriopathy throughout the

7

cardiovascular system with stenosis particularly affecting the brachiocephalic, carotid and renal

arteries (Morris et al., 2003).

Other connective tissue abnormalities include hernias and a deep/hoarse voice, soft skin,

joint limitations in older individuals or hyperextensibility in younger children, bladder/bowel

diverticulae as well as premature ageing of the skin (Morris and Mervis, 2000). Musculoskeletal

and orthopedic problems may also be present and include; kyphosis, lordosis, and scoliosis.

(Morris et al., 1998).

1.1.3: Williams-Beuren syndrome cognitive and behavioral phenotype:

The unique Williams-Beuren syndrome cognitive and behavioral phenotype is

characterized by relative strengths in language acquisition, verbal abstract reasoning, visual

attention to detail and facial processing alongside severe deficits in mathematics and numerical

reasoning, visuo-spatial construction, working memory and delayed language milestones (Mervis

et al. 2000). Individuals with WBS are said to have a gregarious personality and display a lack

of social inhibition that extends to unfamiliar people. However this high sociability is often

accompanied by deficits in interpretation of emotional expressions and despite their highly social

nature, individuals with WBS often have difficulties sustaining friendships and are often isolated

in class. (Frigerio et al., 2006). It has been said that individuals with WBS know no strangers

but have no friends.

1.1.4: Williams-Beuren syndrome cognitive profile (WBSCP):

8

One of the most intriguing aspects of WBS is the unique cognitive profile characterized

by distinctive strengths and weaknesses. Individuals with WBS show a unique cognitive profile

with strengths in auditory rote memory and language abilities alongside severe deficits in spatial

cognition (Morris and Mervis, 2000). Overall level of intellectual ability, as measured by full IQ

tests; typically indicate that IQs are generally in the mild to moderate mental retardation range

(50-60). Individuals with WBS have severe deficits in conceptual reasoning including difficulties

with problem solving, and mathematics (Bellugi et al., 2000). The unique WBS personality

profile is characterized as outgoing and gregarious and affected individuals are empathetic

towards others, have a positive social outlook but may also experience anxiety and simple

phobias (Bellugi et al., 1990). Individuals with WBS are easily distracted and approximately

two thirds of children with WBS meet the diagnostic criteria for attention-deficit hyperactivity

disorder (Pober and Dykens, 1996).

Language acquisition is delayed in individuals with WBS with many not speaking until

the age of 3. Expressive language however, is relatively preserved in individuals with WBS,

with WBS individuals often having larger vocabularies relative to unaffected individuals of

similar mental ages (Lashkari et al., 1999). It also appears that the trajectory of learning is

altered in WBS with a delay in language acquisition but verbal skills improve over time with

WBS adults displaying an advanced vocabulary compared to IQ-matched individuals with

mental retardation (Grant et al., 2002). More importantly it appears that individuals with WBS

acquire language in the absence of important cognitive abilities that were once considered

essential to language acquisition (Tassabehji, 2003).

Although language appears to remain relatively intact in Williams syndrome, visuo-

spatial cognition is severely impaired compared to chronological age (CA) and IQ-matched

9

individuals with Down syndrome (Wang et al., 1995). Their specific deficit in visuo-spatial

construction is often described as focusing on the detail at the expense of the whole picture.

When ask to redraw a picture from memory they are often able to reproduce the individual

objects within the picture but the association between the objects is lost (Morris and Mervis,

2000) (Figure 1.2).

Given the unique pattern of relative strengths in language abilities and weaknesses in

visuo-spatial cognition observed in WBS, an IQ test known as the Kaufman Brief Intelligence

Test (K-BIT) is used to determine the general intelligence level since it measures verbal ability

and nonverbal reasoning ability but is not dependent on the visuo-spatial abilities of the

individual that is being tested (Kaufman and Kaufman, 1990). Mean IQs as measured by K-BIT

10

are generally in the mild to moderate mental retardation range (mean of 69.32) with a variability

(± 15.36) similar for individuals with WBS as for the general population (Mervis and Beccerra,

2006). When a full-scale assessment of intellectual ability including visuo-spatial construction

tasks such as the Differential Abilities Scale (DAS) general conceptual ability (GCA) score is

used, mean IQ levels are considerably lower. Given the high level of variability that exists

between individuals with WBS, a standardized method of assessment referred to as the Williams-

Beuren Syndrome Cognitive Profile (WBSCP) was developed and consists of four distinct

subtests from the DAS and is designed to measure strengths and weakness across a range of

abilities. A diagnosis of WBS if appropriate if the following criteria are met:

1. T-score for either Digit Recall, Naming/Definitions, or Similarities > 1st percentile

(corresponds to the prediction that WBS have strength in verbal abilities relative to

IQ scores, even for individuals who are very low functioning)

2. Pattern Construction T score < 20th percentile (absolute deficit in visuo-spatial

regardless of overall level of functioning)

3. Pattern Construction T score < mean T score (core subtests – weakness in visuo-

spatial ability relative to overall level of functioning)

4. Pattern construction T score < Digit Recall T score (auditory memory will be a

strength compared to visuo-spatial ability)

When tested on a large cohort of individuals with WBS, Mervis et al., (2000) found that

88% fit all four of the above criteria indicating a high degree of sensitivity and that when

individuals from a known mixed etiology group were evaluated 93% of them did not fit the

WBSCP indicating a high degree of specificity. The use of the WBSCP allows for an accurate

11

clinical diagnosis beyond the present conventional cytogenic testing that relies solely on the

presence or absence of the ELN gene as determined by FISH.

1.1.5: Genomic structure and molecular basis of Williams-Beuren syndrome:

Once disruption of the ELN gene locus was identified as the cause of SVAS and ELN

was shown to be deleted in WBS patients, an effort was undertaken to identify the nature of the

chromosome abnormality in WBS. Analysis in 1996 by Perez-Jurado et al., identified three

large repetitive DNA segments, called duplicons, labeled centromeric (c) medial (m) and

telomeric (t) that flank what is now known as the commoly deleted region in WBS. Each

duplicons is composed of three differentiated blocks (A/B/C blocks) containing genes and

pseudogenes that are aligned in direct as well as inverted orientation making it possible to

generate inversions, deletions and duplications through aberrant meiotic homologous

recombination (Figure 1.3). Haplotype analysis determined that 2/3 of deletions arise from inter-

chromosomal and 1/3 from intra-chromosomal recombination (Baumer et al., 1998). Although

atypical deletions have been identified, 95% of WBS individuals carry a 1.55 Mb deletion

between the centromeric (Bc) and medial (Bm) B blocks, since these segments have the greatest

homology (> 99.6 % identity), whilst the remaining 5% occur between the centromeric (Ac) and

medial (Am) A blocks to generate a 1.84Mb deletion (Bayes et al., 2003).

The underlying molecular basis of WBS is haploinsufficiency, or the inability of genes

within the deletion to compensate for the lack of one copy. From the physical and gene map of

the deleted region at 7q11.23 (Figure 1.3), there are 26-28 genes that are commonly deleted. Two

12

genes, GTF2IRD2 and NCF1, are variably deleted depending upon the exact point of

recombination within the B block.

Traditionally, fluorescent in situ hybridization (FISH) using bacterial artificial

chromosomes (BAC), P1 phage and cosmid probes to identify hemizygosity at the elastin (ELN)

locus were used to detect the presence of the 7q11.23 deletion. However, this technique was

time consuming and required fresh blood samples from the individual being studied as well as

control individuals. More recently, the arsenal of molecular diagnostic tools includes genome-

wide copy number variation (CNV) analysis using microarray chip technology that in addition to

detecting copy number changes in the WBS region may also detect variation at other genomic

13

locations. Simpler and more cost effective methods include the identification of deletions (as

well as duplications) using quantitative PCR (qPCR) as well as multiplex ligation-dependent

probe amplification (MLPA) using primers and probe oligonucleotides respectively generated

against specific genomic loci within the WBS region.

1.1.6: WBS genotype-phenotype correlations:

The classic features of Williams syndrome (facial features/ behavior/cognition) are all

highly penetrant and since the vast majority of deletions identified in WBS share common

breakpoints, deciphering the precise relationship between genetic and phenotypic components in

WBS has been a difficult task. To date, only the elastin gene has been unequivocally associated

with the WBS phenotype, namely the cardiovascular symptoms including SVAS (Currran et al.,

1993; Ewart et al., 1993). Point mutations and intragenic deletions in the elastin gene have been

shown to cause isolated SVAS (Tassabehji et al., 1997; Li et al. 1997). In the initial and

subsequent reports associating the elastin gene with SVAS, families were also identified who

were shown to carry deletions encompassing both ELN and the neighboring gene, LIMK1. In

addition to SVAS, it was reported that these individuals had aspects of the WBS cognitive

profile, implicating LIMK1 with the impaired visuo-spatial cognition that is characteristic of

WBS (Frangiskakis et al., 1996). However, subsequent studies identified other individuals with

similar or even larger deletions that did not fit the WBSCP (Tassabehji et al., 1999; Morris et al.,

2003). It therefore appears likely that the visuo-spatial deficits of WBS individuals are the result

of haploinsufficiency of multiple genes in the deleted region and that LIMK1 may be necessary

but insufficient to cause visual spatial impairment.

14

1.1.7: Identification of a WBS critical region:

Although the vast majority of patients with WBS have the same 1.5 Mb interval deleted,

a limited number of WBS patients have been identified who harbor atypical deletions.

Individuals with smaller deletions but who still exhibit the typical features of WBS have defined

a minimal critical region (MCR) (Botta et al., 1999; Heller et al., 2003) (Figure 1.4). This MCR

spans nine genes, extending from ELN at the centromeric end to GTF2I at the telomeric end.

15

From these studies it is predicted that haploinsufficiency of two or more of the genes found

within this minimal critical region is responsible for the majority of features of WBS and that the

loss of genes from ELN to GTF2I appear to be sufficient and necessary for ful WBS.

1.1.8: Transcription factors in human disease:

Regulation of gene expression (both spatially and temporally) is essential to proper

development and survival of all living things. Although this regulation can occur by multiple

mechanisms it is most efficiently achieved at the level of DNA transcription by the interaction of

trans-acting factors (Transcription Factors) with cis-acting regulatory DNA sequences. There are

believed to be more than 2500 proteins in the human genome that contain DNA-binding domains

and most of these are presumed to function as transcription factors; accounting for approximately

10% of genes in the genome code, making it the single largest family of human proteins (Babu et

al., 2004). Transcriptional regulators can be divided into two classes based on the location at

which they exert their influence on their respective genes. Those that regulate through core

DNA sequences in promoters and form part of the initiator complex are called General (or basal)

Transcription Factors (GTF) while those that bind to DNA sequences outside the core sequence

of the promoter are termed Transcriptional Regulatory Proteins. The regulation of expression

may involve a variety of mechanisms; 1) the recruitment of specific co-activators or co-

repressors to the initiator-DNA complex (Xu et al., 1999), 2) the stabilizing or blocking of the

transcriptional initiation complex to DNA, and 3) modification or remodeling of histones

through acylation or de-acylation of histones whereby acylation weakens the association between

16

histones and DNA resulting in an increase in transcription and de-acylation strengthen the

association resulting in decreased transcription (Narlikar et al., 2002), or

Disease phenotypes have been associated with recently identified mutations in several

transcription factors and many of the reported cases involve clear loss-of-function mutations

suggesting haploinsufficiency as the genetic mechanism involved in disease (Table 1.2).

Table 1.2. Transcription Factors that Cause Disease by Haploinsufficiency

Syndrome Gene Clinical Features

Rubinstein-Taybi CREB

Mental retardation; typical facial features; eye, skin, skeletal and

cardiovascular abnormalities; agenesis of corpus callosum;

broad thumbs and great toes.

Waardenburg PAX3 Pigmentary disturbance and hearing loss

Aniridia PAX6 Complete loss of the iris

Hypodontia PAX9 permanent molar teeth segregation

ATR-16 SOX8 mental retardation

Greig

Cephalopolysyn-

dactyly

GLI3 Affecting the fingers and toes (digits) and the head and facial

(craniofacial) area

Additional diseases known to be associated with haploinsufficiency of a transcription factor

include; Axenfeld-Rieger syndrome (FOXCI); Velocardial facial syndrome (TBX1); Holt-Oram

syndrome (TBX5); Rett Syndrome (MECP2); Rubinstein-Taybi syndrome (CREBBP), and WS

17

Waardenburg syndrome types I and II (PAX3 and MITF respectively) (Seidman and Seidman,

2002).

1.1.9: GTF2I transcription factor gene family:

General Transcription Factor 2I (GTF2I), GTF2I Repeat Domain containing 1

(GTF2IRD1) and GTF2I Domain Repeat containing 2 GTF2IRD2 (which is variably deleted in

WBS) comprise a novel three-member group of transcription factors characterized by the

presence of multiple helix-loop-helix (HLH) I-repeat domains that are significantly longer (90

amino acids) than in other HLH transcription factors, and an N-terminal leucine zipper (LZ)

motif (Figure 1.5). Both features are thought to be necessary for dimerization, which imparts

functionality (Roy, 2001). All three members of the family are highly conserved in vertebrates

and are thought regulate transcription through chromatin remodelling. Although the sequence

identity of the I-repeats is less than 50% between the different paralogs, the secondary structure

18

has been conserved through evolution (Hinsley et al., 2004). The gene products of GTF2I (TFII-

I) and GTF2IRD1 (TFII-IRD1) are widely expressed in both early embryonic stages of

development, including pre and post-implantation embryos, as well as in unfertilized oocytes.

Although the expression pattern of these genes in mice are similar throughout early development,

the localization of their protein products is significantly different at the stage of implantation

(E4.5) with TFII-I detectable in both the nucleus and the cytoplasm while TFII-IRD1 is a

predominantly nuclear protein (Bayarasaihan et al., 2003; Enkhmandakh et al., 2004). This is

19

suggestive of non-redundant differentially regulated roles of TFII-I and TFII-IRD1, despite their

similar protein structure.

1.1.10: The transcription factor GTF2I:

GTF2I was the first of the GTF2I gene family members to be identified and

characterized. GTF2I‘s gene product TFII-I was independently identified as TFII-I (Roy et al.,

1997), SPIN (Grueneberg et al., 1997) and BAP135 (Yang and Desiderio, 1997) by its

association with the adenovirus major late promoter, its interaction with Phox-1 and the serum

response factor (SRF), as well as being a downstream target of the Tec-family Bruton tyrosine

kinase (BTK). Analysis of the genomic structure indicates that GTF2I likely originated from

GTF2IRD1 as a result of gene duplication and its further structural evolution was associated with

its novel functional specialization (Makeyev et al., 2004). While it is not known exactly when

this duplication occurred, it is interesting to note that paralogs of GTF2IRD1 can be found in the

genomes of human and primates, mice, rat Xenopus, zebra fish and fungi whereas GTF2I is only

found in human and rodent species (Morris et al., 2006). TFII-I is unique from other

transcription factors in that it has been shown to act both as a basal factor, stimulating

transcription from transcription start site initiator elements (Inr) in promoters, as well as a signal-

inducible factor through binding Inr or E-Box sequences found in upstream enhancer elements

(Roy et al., 1997). Alternate splicing of two exons between the first and second I-repeat gives

rise to four different isoforms in humans and mice (Cheriyath et al., 2000). TFII-I promotes the

formation of higher order ―enhancesome‖ complexes and may function to bridge basal and

upstream regulatory sites and integrate multiple pathways.

20

In resting B-cells TFII-I has been shown to interact with Bruton‘s tyrosine kinase (BTK),

a hematopoietic non-receptor protein tyrosine kinase that is critical for B lymphocyte

development and upon activation of the surface B receptor TFII-I is phosphorylated, is released

and translocates from the cytoplasm to the nucleus (Sacristan et al., 2004). It has also been

demonstrated that TFII-I function is dependent on an active mitogen activated protein (MAP)

kinase pathway (Kim and Cochran, 2000). TFII-I contains putative MAPK tyrosine

phosphorylation sites at Y357 and Y462 in the loop of HLH domain (Egloff and Desiderio,

2001) and it has been demonstrated that tyrosine phosphorylation is necessary for activation and

translocation into the nucleus and that this process is regulated by both ras and rho pathways

(Kim et al., 1998).

TFII-I has also been shown to play an important role in the regulation of c-fos induced

expression in response to growth factor signaling. There are three known TFII-I binding sites in

the FOS promoter and it is believed that TFII-I may regulate transcription by forming protein-

protein complexes with the serum response factor (SRF) and members of the STAT family of

transcription factors that bind to the c-sis/platelet derived growth factor inducible element (SIE)

and the serum response element (SRE) respectively (Kim et al., 1998). In a mechanism similar

to its activation in B-cells, in response to growth factor signaling, TFII-I undergoes a tyrosine

phosphorylation on tyrosine residues 248 and 611 that has been demonstrated to be mediated by

c-Src tyrosine kinase (Cheriyath et al., 2002).

TFII-I is known to interact with multiple transcription factors including the TATA

Binding protein (TBP), USF-1, Phox-1, SRF, c-myc, Stat1/3, p50, NF-B and ATF-6 (Roy et al,

1993; Casteel et al., 2002) as well as HDAC3 and PIASx suggesting a role in histone

modification and SUMOylation (Enkhmandakh et al., 2004).

21

In adult mouse brain, TFII-I is present exclusively in neurons with the greatest expression

levels observed in cerebellar Purkinje cells – including the dendritic trees, hippocampal

interneurons in the CA1-3 region as well as the dentate gyrus and pyramidal neurons in the

cerebral cortex; areas that have shown to be functionally affected in WBS patients, suggesting

that it plays an important role in the functioning of the central nervous system (CNS) (Danoff et

al., 2004).

There is building evidence that TFII-I may also function outside the nucleus. It was

known that in resting B cells, a significant fraction of TFII-I is found in the cytoplasm

constitutively associated with (BTK) where upon cross linking of the Ig receptor, it is

phosphorylated, released translocates to the nucleus and suggesting that regulation of TFII-I`s

transcriptional activity is controlled through alteration in its sub-cellular localization. However,

Caraveo et al., (2006) have demonstrated TFII-I may also play a role in Ca2+

entry through the

plasma membrane. It was determined that the phosphorylated TFII-I also interacts with the src-

homology (SH)-2 domain of gamma isoform of phospholipase C (PLC-γ) which normally

activate surface transient receptor potential channels (TRPC) such as TRPC3 that modulate

calcium ion entry at the plasma membrane. TFII-I may competitively bind to PLC-γ resulting in

inhibition of TRPC3-mediated agonist-induced Ca2+

entry (ACE). Interaction with PLC- γ is

thought to occur through a split PH domain found in TFII-I that mimics that of TRPC3 and is

involved in the PLC-γ interaction. It was further demonstrated that loss of TFII-I in PC12

neuronal or human embryonic kidney (HEK) cells through gene silencing leads to increase

surface expression of TRPC3 and enhanced Ca2+

influx (Caraveo et al., 2006). It is intriguing to

postulate that the decrease in the expression of TFII-I in WBS may result in an alteration in the

conformational coupling of TRPC receptors that regulate many neuro-cognitive processes.

22

1.1.11: The transcription factor GTF2IRD1:

The gene product of GTF2IRD1 (TFII-IRD1 -also named WBSCR11, GTF3, BEN,

MusTRD1, Cream1) was originally identified as the protein MusTRD1 that binds the slow fibre-

specific upstream enhancer (USE) B1 element of the muscle gene troponin I slow gene

regulating troponin I expression in slow-twitch muscle needed for maintenance of posture and

tasks involving stamina (O‘Mahoney et al., 1998). It has recently been demonstrated that this

regulation may involve the interaction of TFII-IRD1 with both the myocyte enhancer-binding

factor 2C (MEF2C) as well as the nuclear receptor co-repressor (NCoR) (Polly et al., 2003). It

has also been shown to bind through its C-terminus to the retinoblastoma protein (Rb), known to

be an activator in cell-cycle regulation and necessary for terminal differentiation of skeletal

muscle (Yan et al., 2000). A known mouse TFII-IRD1 variant (referred to as BEN for binding

factor for early enhancer) containing 6 I-repeats, has also been to shown to be involved in the

regulation of the Hoxc8 homeobox gene involved in the control of spatial patterning during

embryogenesis (Bayarsaihan and Ruddle, 2000).

TFII-IRD1contains five I-repeats in human and 5 or 6 I-repeats in mice that share 70%

homology to TFII-I. Like TFII-I, it is thought to contain two DNA binding domains, between

amino acids 351-458 and amino acids 544-944, respectively, with serial deletion analysis

demonstrating that the repression of gene expression by TFII-IRD1 can occur in the absence of

DNA binding (Polly et al., 2003). Also similar to TFII-I, alternate splicing of exons gives rise to

multiple isoforms with 2 transcripts identified in humans. However, splicing in mice is far more

complex than Gtf2i in that it is not just exons that are alternately spliced. Two alternately spliced

23

individual exons in addition to two alternately spliced cassettes containing complete or partial

exon sequences giving rise to least 11 isoforms identified to date (Tay et al., 2003).

In developing embryos, the highest levels of TFII-IRD1 expression are found in areas of

epithelial-mesenchymal interaction such as limb buds, branchial arches and craniofacial areas

(Bayarsaihan and Ruddle, 2004), regions affected in WBS patients. From day 10 postnatal

mouse brains onward, the highest expression of TFII-IRD1 is found in the pons and cerebellum

(Danoff et al., 2004).

Although it has been demonstrated that TFII-IRD1 has a distinctive function from that of

its paralog TFII-I, there is also evidence that the two proteins may interact directly and indirectly

in the regulation of some genes. In 2001, Tussié-Luna et al., proposed the mechanism that TFII-

IRD1 may compete with TFII-I for nucleo-cytoplasmic shuttling components and that TFII-

IRD1 may sequester TFII-I in the cytoplasm. Originally identified as XWBSCR11, TFII-IRD1

was also shown to regulate the activin-nodal-inducible distal element of the Xenopus (Ring et al.,

1999) and more recently the mouse goosecoid promoter in response to TGF-β through a process

that is thought to be mediated by competition between TFII-I and TFII-IRD1 (Ku et al., 2005).

This counter regulation of transcription by competition between TFII-I and TFII-IRD1 has also

recently been suggested in the regulation of vascular endothelial growth factor receptor 2

(VEGFR-2) (Jackson et al., 2005).

1.1.12: The transcription factor GTF2IRD2:

GTF2IRD2 (gene product TFII-IRD2) is the most recently discovered gene in the TFII-I

gene family (Tipney et al., 2004). It is variably deleted in WBS, depending on the exact location

24

of chromosome recombination within the B block. It is also invariably deleted in the

approximately 5% of WBS patients who harbor a larger 1.8 Mb deletion. GTF2IRD2 is more

closely related to GTF2I than to GTF2IRD1 and is apparently derived from the GTF2I sequence

by gene duplication. The comparison of GTF2I and GTF2IRD2 gene sequence revealed two

distinct regions of homology, indicating that the structure of the GTF2IRD2 gene has been

generated by two independent genomic rearrangements (Makeyev et al., 2004). Genomic

structure analysis of both intron-exon boundaries and sequence similarity indicates that TFII-I

and TFII-IRD2 share the same N-terminal leucine zipper and the first I repeat. However repeats

I-2 to I-5 are absent, most likely due to deletion spanning introns 12 to 27. Exons 12-15 of Gtf2i

correspond to exons 28-31 of TFII-IRD2 and it appears that a random in-frame insertion of a

transposon-like Charlie8 domain has replaced the 3‘ end of the TFII-I, generating a functional

fusion gene (Makeyev et al., 2004). The Charlie8 domain is a mammalian-specific member of

the MER1 transposase family and contains a Cys-2/His-2 Zinc finger DNA binding domain and

a second LZ (Tipney et al., 2004). Most often, integration of transposable elements are not

advantages to the host. If, however, a transposable element integrates into a gene rather than a

non-coding sequence, expression of the gene will often be adversely affected. Such fusion

proteins will either be lost from the genome during evolution or in rare cases; the transposase can

insert in-frame and produce a viable protein with a novel biological functionality, and therefore

will be retained. Given that GTF2IRD2 is highly conserved among mammals, this appears likely

with GTF2IRD2, where the CHARLIE8 transposon has inserted itself in-frame likely producing

a novel functional protein.

1.2: Research Aims and Hypothesis:

25

The vast majority of Williams syndrome cases are caused by a deletion of a 1.5 to 1.8 Mb

interval on the long arm of chromosome 7. In addition to this common deletion other genomic

rearrangements of the region are known or predicted to occur and may lead to phenotypes

distinct from that of WBS. Identification and analysis of less common rearrangements of the

chromosome 7 region will allow for the deciphering of the roles that genes within the interval

contribute to the phenotype. Previous analysis of known atypical deletions of the WBS region

associated the distal end of the commonly deleted region, and in particular the GTF2I gene

family with the cognitive and behavioral aspects of the disorder. The GTF2I gene family

including the transcription factors GTF2I and GTF2IRD1 likely play a role in the WBS cognitive

and behavioral phenotype consistent with their expression in early stages of embryonic

development notably in the developing brain.

To determine their involvement in the WBS phenotype, an animal model of Gtf2ird1

deficiency was generated and analyzed to look for changes consistent with the WBS phenotype.

This analysis included identifying physical, behavioral and cognitive changes as well as, given

its role as a transcription factor, additional investigation at the molecular level to identify genes

whose expression was altered. In addition, mice carrying targeted alleles were generated for

Gtf2i as well as a double deletion of Gtf2i and Gtf2ird1 and a duplication of Gtf2i that will

provide valuable tools for elucidating the contribution these genes make to the WBS phenotype.

26

1.3: References:

Babu MM, Luscombe NM, Aravind L, Gerstein M, and Teichmann SA. (2004). Structure and

evolution of transcriptional regulatory networks. Current Opinions in Structural Biology.

14: 283–291.

Baumer A, Dutly F, Balmer D, Riegel M, Tükel T, Krajewska-Walasek M, and Schinzel AA.

(1998) High level of unequal meiotic crossovers at the origin of the 22q11. 2 and 7q11.23

deletions. Human Molecular Genetics. 7:887-894.

Bayarsaihan D, Bitchevaia N, Enkhmandakh B, Tussie-Luna MI, Leckman JF, Roy A, and

Ruddle FH. (2003) Expression of BEN, a member of TFII-I family of transcription factors,

during mouse pre- and postimplantation development. Gene Expression Patterns. 3:579-

589.

Bayarsaihan D, and Ruddle FH. (2000) Isolation and characterization of BEN, a member of the

TFII-I family of DNA-binding proteins containing distinct helix-loop-helix domains.

Proceedings of the National Academy of Sciences (USA) 97:7342-7347.

Bayés M, Magano LF, Rivera N, Flores R, and Pérez Jurado LA. (2003) Mutational mechanisms

of Williams-Beuren syndrome deletions. American Journal of Human Genetics. 73:131-

151.

Bellugi U, Bihrle A, Jernigan T, Trauner D, and Doherty S. (1990). Neuropsychological,

neurological, and neuroanatomical profile of Williams syndrome. American Journal of

Medical Genetics. 6:115-125.

Bellugi U, Lichtenberger L, Jones W, Lai Z, and St George M. (2000) The neuro-cognitive

profile of Williams Syndrome: a complex pattern of strengths and weaknesses. Journal of

Cognitive Neuroscience. 12(S1):7-29.

Bergman JD. (1996) Social, affective and behavioral impairments in Williams syndrome.

(Abstract) Professional Meeting of the Williams syndrome Association. Valley Forge, PA.

Beuren AJ, Apitz J, and Harmjanz D. (1962) Supravalvular aortic stenosis in association with

mental retardation and a certain facial appearance. Circulation. 26:1235-1240.

Bini R, and Pela I. (2004) New case of thyroid dysgenesis and clinical signs of hypothyroidism

in Williams syndrome. American Journal of Medical Genetics (A). 127A:183-185.

Botta A, Novelli G, Mari A, Novelli A, Sabani M, Korenberg J, Osborne LR, Digilio MC,

Giannotti A, and Dallapiccola B. (1999) Detection of an atypical 7q11.23 deletion in

Williams syndrome patients which does not include the STX1A and FZD3 genes. Journal

of Medical Genetics. 36:478-480.

27

Cambiaso P, Orazi C, Digilio MC, Loche S, Capolino R, Tozzi A, Faedda A, and Cappa M.

(2007) Thyroid morphology and subclinical hypothyroidism in children and adolescents

with Williams syndrome. Journal of Pediatrics. 150:62-65.

Casteel DE, Zhuang S, Gudi T, Tang J, Vuica M, Desiderio S, and Pilz RB. (2002) cGMP-

dependent protein kinase I beta physically and functionally interacts with the

transcriptional regulator TFII-I. Journal of Biological Chemistry. 277: 32003-32014.

Caraveo G, van Rossum DB, Patterson RL, Snyder SH, and Desiderio S. (2006) Action of TFII-I

outside the nucleus as an inhibitor of agonist-induced calcium entry. Science. 314:122-125.

Cheriyath V, Desgranges ZP, and Roy AL. (2002) c-Src-dependent transcriptional activation of

TFII-I. Journal of Biological Chemistry. 277:22798-22805.

Cherniske EM, Carpenter TO, Klaiman C, Young E, Bregman J, Insogna K, Schultz RT, and

Pober BR. (2004) Multisystem study of 20 older adults with Williams syndrome.

American Journal of Medical Genetics (A). 131:255-264.

Curran ME, Atkinson DL, Ewart AK, Morris CA, Leppert MF, and Keating MT. (1993) The

elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis.

Cell. 73:159-168.

Danoff SK, Taylor HE, Blackshaw S, and Desiderio S. (2004) TFII-I, a candidate gene for

Williams syndrome cognitive profile: parallels between regional expression in mouse brain

and human phenotype. Neuroscience. 123:931-938.

DeSilva U, Elnitski L, Idol JR, Doyle JL, Gan W, Thomas JW, Schwartz S, Dietrich NL,

Beckstrom-Sternberg SM, McDowell JC, Blakesley RW, Bouffard GG, Thomas PJ,

Touchman JW, Miller W, and Green ED. (2002) Generation and comparative analysis of

approximately 3.3 Mb of mouse genomic sequence orthologous to the region of human

chromosome 7q11.23 implicated in Williams syndrome. Genome Research. 12:3-15.

Doyle TF, Bellugi U, Korenberg JR, and Graham J. (2004) "Everybody in the world is my

friend" hypersociability in young children with Williams syndrome. American Journal of

Medical Genetics, Part A. 124A:263-273.

Dridi SM, Foucault Bertaud A, Igondjo Tchen S, Senni K, Ejeil AL, Pellat B, Lyonnet S, Bonnet

D, Charpiot P, and Godeau G. (2005) Vascular wall remodeling in patients with

supravalvular aortic stenosis and Williams Beuren syndrome. Journal of Vascular

Research. 42:190-201.

Egloff AM, and Desiderio S. (2001) Identification of phosphorylation sites for Bruton's tyrosine

kinase within the transcriptional regulator BAP/TFII-I. Journal of Biological Chemistry.

276:27806-27815.

Enkhmandakh B, Bitchevaia N, Ruddle F, and Bayarsaihan D. (2004) The early embryonic

expression of TFII-I during mouse preimplantation development. Gene Expression

Patterns. 4:25-28.

http://www.ncbi.nlm.nih.gov/pubmed/11373296?itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum&ordinalpos=2


28

Ensing GJ, Schmidt MA, Hagler DJ, Michels VV, Carter GA, and Feldt RH. (1989) Spectrum of

findings in a family with nonsyndromic autosomal dominant supravalvular aortic stenosis:

a Doppler echocardiographic study. Journal of the American College of Cardiology.

13:413-419.

Ewart AK, Morris CA, Atkinson D, Jin W, Sternes K, Spallone P, Stock AD, Leppert M, and

Keating MT. (1993a) Hemizygosity at the elastin locus in a developmental disorder,

Williams syndrome. Nature Genetics. 5:11-16.

Ewart AK, Morris CA, Ensing GJ, Loker J, Moore C, Leppert M, Keating M. (1993b) A human

vascular disorder, supravalvular aortic stenosis, maps to chromosome 7. Proceedings of the

National Acadmey of Sciences (USA). 90:3226-3230.

Fanconi G, Girardet P, Schlesinger B, Butler N, and Black J. (1952) Chronic hyperglycemia,

combined with osteosclerosis, hyperazotemia, nanism and congenital malformations.

Helvectica Paediatrica Acta. 7:314-349.

Frangiskakis JM, Ewart AK, Morris CA, Mervis CB, Bertrand J, Robinson BF, Klein BP, Ensing

GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg

SJ, and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired

visuospatial constructive cognition. Cell. 86:59-69.

Frigerio E, Burt DM, Gagliardi C, Cioffi G, Martelli S, Perrett DI, and Borgatti R. (2006) Is

everybody always my friend? Perception of approachability in Williams syndrome.

Neuropsychologia. 44:254-259.

Gagliardi C, Bonaglia MC, Selicorni A, Borgatti R, and Giorda R. (2003) Unusual cognitive and

behavioral profile in a Williams syndrome patient with atypical 7q11.23 deletion. Journal


Galaburda AM, Holinger DP, Bellugi U, and Sherman GF. (2002) Williams syndrome: neuronal

size and neuronal-packing density in primary visual cortex. Archives of Neurology.

56:1461-1467.

Grant J, Valian V, and Karmiloff-Smith A. (2002) A study of relative clauses in Williams

syndrome. Journal of Child Language. 29:403-416.

Greenberg F. (1990) Williams syndrome professional symposium. American Journal of Medical

Genetics. 6(S):85-88.

Grueneberg DA, Henry RW, Brauer A, Novina CD, Cheriyath V, Roy AL, and Gilman M.

(1997) A multifunctional DNA-binding protein that promotes the formation of serum

response factor/homeodomain complexes: identity to TFII-I. Genes and Development.

11:2482-2493.

Heller R, Rauch A, Lüttgen S, Schröder B and Winterpacht A. (2003) Partial deletion of the

critical 1.5 Mb interval in Williams-Beuren syndrome. Journal of Medical Genetics.

40:e99.

29

Hinsley TA, Cunliffe P, Tipney HJ, Brass A, and Tassabehji M. (2004) Comparison of TFII-I

gene family members deleted in Williams-Beuren syndrome. Protein Science. 13:2588-

2599.

Hirota H, Matsuoka R, Chen XN, Salandanan LS, Lincoln A, Rose FE, Sunahara M, Osawa M,

Bellugi U, and Korenberg JR. (2003) Williams syndrome deficits in visual spatial

processing linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in

Medicine. 5:311–321.

Hoogenraad CC, Eussen BH, Langeveld A, van Haperen R, Winterberg S, Wouters CH,

Grosveld F, De Zeeuw CI, and Galjart N. (1998) The murine CYLN2 gene: genomic

organization, chromosome localization, and comparison to the human gene that is located

within the 7q11.23 Williams syndrome critical region. Genomics. 53:348-358.

Hoogenraad CC, Koekkoek B, Akhmanova A, Krugers H, Dortland B, Miedema M, van Alphen

A, Kistler WM, Jaegle M, Koutsourakis M, Van Camp N, Verhoye M, van der Linden A,

Kaverina I, Grosveld F, De Zeeuw CI, and Galjart N. (2002) Targeted mutation of Cyln2 in

the Williams syndrome critical region links CLIP-115 haploinsufficiency to

neurodevelopmental abnormalities in mice. Nature Genetics. 32:116-127.

Hoogenraad CC, Akhmanova A, Galjart N, and De Zeeuw CI (2004) LIMK1 and CLIP-115:

linking cytoskeletal defects to Williams syndrome. Bioessays. 26:141-150.

Howald C, Merla G, Digilio MC, Amenta S, Lyle R, Deutsch S, Choudhury U, Bottani A,

Antonarakis SE, Fryssira H, Dallapiccola B, and Reymond A. (2006) Two high throughput

technologies to detect segmental aneuploidies identify new Williams-Beuren syndrome

patients with atypical deletions. Journal of Medical Genetics. 43:266-273.

Hultqvist M, Olofsson P, Holmberg J, Bäckström BT, Tordsson J, and Holmdahl R. (2004)

Enhanced autoimmunity, arthritis, and encephalomyelitis in mice with a reduced oxidative

burst due to a mutation in the Ncf1 gene. Proceedings of the National Acadmey of Sciences

(USA). 101:12646-12651.

Jackson TA, Taylor HE, Sharma D, Desiderio S, and Danoff SK. (2005) Vascular endothelial

growth factor receptor-2: counter-regulation by the transcription factors, TFII-I and TFII-

IRD1. Journal of Biological Chemistry. 280:29856-29863.

Jones KL. (1990) Williams syndrome: an historical perspective of its evolution, natural history,

and etiology. American Journal of Medical Genetics. S6:89-96.

Kaufman AS and Kaufman NL. (1990) Kaufman Brief Intelligence Test. Circle Pines, MN:

American Guidance Service.

Kim DW and Cochran BH. (2000) Extracellular signal-regulated kinase binds to TFII-I and

regulates its activation of the c-fos promoter. Molecular and Cellular Biology. 20: 1140-

1148.

30

Kim DW, Cheriyath V, Roy AL, and Cochran BH. (1998) TFII-I enhances activation of the c-fos

promoter through interactions with upstream elements. Molecular and Cellular Biology.

18:3310-3320.

Ku M, Sokol SY, Wu J, Tussie-Luna MI, Roy AL, and Hata A. (2005) Positive and negative

regulation of the transforming growth factor beta/activin target gene goosecoid by the

TFII-I family of transcription factors. Molecular and Cellular Biology. 25:7144-7157.

Lashkari A, Smith AK, and Graham JM Jr. (1999) Williams-Beuren syndrome: an update and

review for the primary physician. Clinical Pediatrics. 38:189-208.

Li DY, Toland AE, Boak BB, Atkinson DL, Ensing GJ, Morris CA, and Keating MT. (1997)

Elastin point mutations cause an obstructive vascular disease, supravalvular aortic stenosis.

Human Molecular Genetics. 6:1021-1028.

Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E, and Keating

MT. (1998a) Elastin is an essential determinant of arterial morphogenesis. Nature.

393:276-280.

Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, Boak B, and

Keating MT. (1998b) Novel arterial pathology in mice and humans hemizygous for elastin.

Journal of Clinical Investigation. 102:1783-1787.

Lightwood R. (1952). Idiopathic hypercalcemia with failure to thrive. Nephrocalcinosis

Proceedings of the Royal Society of Medicince. 45:401.

Lowe KG, Henderson JL, Park WW, and McGreal DA. (1954) The idiopathic hypercalcaemic

syndromes of infancy. Lancet. 267:101-110.

Makeyev AV, Erdenechimeg L, Mungunsukh O, Roth JJ, Enkhmandakh B, Ruddle FH, and

Bayarsaihan D. (2004) GTF2IRD2 is located in the Williams-Beuren syndrome critical

region 7q11.23 and encodes a protein with two TFII-I-like helix-loop-helix repeats.

Proceedings of the National Academy of Science (U S A). 101:11052-11057.

Meng X, Lu X, Li Z, Green ED, Massa H, Trask BJ, Morris CA, and Keating MT. (1998)

Complete physical map of the common deletion region in Williams syndrome and

identification and characterization of three novel genes. Human Genetics. 103:590-599.

Meng, Y. Zhang Y., Tregoubov V., Janus C., Cruz L., Jackson M., Lu W., MacDonald J., Wang

J., Falls D, and Jia Z. (2002) Abnormal Spine Morphology and Enhanced LTP in LIMK-1

Knockout Mice. Neuron. 35: 121-133.

Merla G, Ucla C, Guipponi M,and Reymond A. (2002) Identification of additional transcripts in

the Williams-Beuren syndrome critical region. Human Genetics. 110:429-438.

Mervis CB, Robinson BF, Bertrand J, Morris CA, Klein-Tasman BP, and Armstrong SC. (2000)

The Williams syndrome cognitive profile. Brain and Cognition. 44:604–628.

31

Mervis CB, and Becerra AM. (2007) Language and communicative development in Williams

syndrome. Mental Retardation and Developmental Disability Research Reviews. 13:3-15.

Meyer-Lindenberg A, Mervis CB, and Berman KF. (2006) Neural mechanisms in Williams

syndrome: a unique window to genetic influences on cognition and behaviour Nature

Reviews Neuroscience. 7:380-393.

Morris CA. (1988) Genetic aspects of supravalvular aortic stenosis. Current Opinion in

Cardiology. 13:214-219.

Morris CA, Thomas IT, and Greenberg F. (1993) Williams syndrome: autosomal dominant

inheritance. American Journal of Medical Genetics. 47:478-481.

Morris CA, and Mervis CB. (2000) Williams syndrome and related disorders. Annual Review of

Genomics and Human Genetics. 1:461-484.

Morris CA, Mervis CB, Hobart HH, Gregg RG, Bertrand J, Ensing GJ, Sommer A, Moore CA,

Hopkin RJ, Spallone PA, Keating MT, Osborne L, Kimberley KW, and Stock AD. (2003)

GTF2I hemizygosity implicated in mental retardation in Williams syndrome: genotype-

phenotype analysis of five families with deletions in the Williams syndrome region.

American Journal of Medical Genetics 123A:45-59.

Morris CA, Lenhoff HM, and Wang PP. (2006) in Williams-Beuren Syndrome – Research,

Evaluation and Treatment, John Hopkins Press, Baltimore MD.

Narlikar GJ, Fan HY, and Kingston RE. (2002) Cooperation between complexes that regulate

chromatin structure and transcription. Cell. 108:475–87.

Osborne LR. (1999) Williams-Beuren syndrome: unraveling the mysteries of a microdeletion

disorder. Molecular Genetics and Metabolism. 67:1-10.

O'Mahoney JV, Guven KL, Lin J, Joya JE, Robinson CS, Wade RP, and Hardeman EC. (1998)

Identification of a novel slow-muscle-fiber enhancer binding protein, MusTRD1.

Molecular Cell Biology. 18:6641-6652.

Pankau R, Partsch CJ, Gosch A, Oppermann HC, and Wessel A. (1992) Statural growth in

Williams-Beuren syndrome. European Journal of Pediatrics. 151:751-755.

Payne WW. (1952) The blood chemistry in idiopathic hypercalcemia. Archives of Disease in

Childhood. 27:302.

Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definition

of the chromosome 7 deletion in Williams syndrome and parent-of-origin effects on

growth. American Journal of Human Genetics. 59:781-792.

Pober BR, and Dykens EM. (1996) Williams syndrome: An overview of medical, cognitive and

behavioral features. Child and Adolescent Psychiatric Clinics of North America. 5:929-

943.


32

Pober BR, Johnson M, and Urban Z. (2008) Mechanisms and treatment of cardiovascular disease

in Williams-Beuren syndrome. Journal of Clinical Invesigation. 118:1606-1615.

Polly P, Haddadi LM, Issa LL, Subramaniam N, Palmer SJ, Tay ES, and Hardeman EC. (2003)

hMusTRD1a1 represses MEF2 activation of the Troponin I slow enhancer. Journal of

Biological Chemistry. 278:36603–36610.

Ranheim EA, Kwan HC, Reya T, Wang YK, Weissman IL, and Francke U. (2005) Frizzled 9

knock-out mice have abnormal B-cell development. Blood. 105:2487-2494.

Reiss AL, Eliez S, Schmitt JE, Straus E, Lai Z, Jones W, and Bellugi U. (2000) IV.

Neuroanatomy of Williams syndrome: a high-resolution MRI study. Journal of Cognitive

Neuroscience. 12(S):65-73.

Ring C, Ogata S, Meek L, Song J, Ohta T, Miyazono K, and Cho KW. (1999) The role of a

Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription

factor in activin/nodal signaling. Genes and Development. 16:820-835.

Roy AL, Du H, Gregor PD, Novina CD, Martinez E, and Roeder RG. (1997) Cloning of an Inr

and E-box binding protein, TFII-I that interacts physically and functionally with USF1.

EMBO Journal. 16:7091–7104.

Roy AL. (2001) Biochemistry and biology of the inducible multifunctional transcription factor

TFII-I. Gene. 274:1–13.

Sacristán C, Tussié-Luna MI, Logan SM, and Roy AL. (2004) Mechanism of Bruton's tyrosine

kinase-mediated recruitment and regulation of TFII-I. Journal of Biological Chemistry.

279:7147-7158.

Seidman JG, and Seidman C. (2002) Transcription factor haploinsufficiency: when half a loaf is

not enough. Journal of Clinical Investigation. 109:451–455.

Schlesinger BE, Butler NR, and Black JA. (1956) Severe type of infantile hypercalcemia. British

Medical Journal. 1:127–134.

Spadoni GL, Colloridi V, Finocchi G, Manca Bitti ML, Chini L, and Boscherini B. (1983)

Williams syndrome and growth hormone deficiency. Journal of Pediatrics. 102:640.

Stagi S, Bindi G, Neri AS, Lapi E, Losi S, Jenuso R, Salti R, and Chiarelli F. (2005) Thyroid

function and morphology in patients affected by Williams syndrome. Clinical

Endocrinology (Oxf). 63:456-460.

Stagi S, Manoni C, Salti R, Cecchi C, and Chiarelli F. (2008) Thyroid hypoplasia as a cause of

congenital hypothyroidism in Williams syndrome. Hormone Research. 70:316-318.

Stromme P, Bjornstad PG, and Ramstad K. (2002) Prevalence estimation of Williams syndrome.

Journal of Child Neurology. 17:269–271.

33

Tassabehji M, Metcalfe K, Donnai D, Hurst J, Reardon W, Burch M, and Read AP. (1997)

Elastin: genomic structure and point mutations in patients with supravalvular aortic

stenosis. Human Molecular Genetics. 12:R229-R237.

Tassabehji M, Metcalfe K, Hurst J, Ashcroft GS, Kielty C, Wilmot C, Donnai D, Read AP, and

Jones CJ. (1998) An elastin gene mutation producing abnormal tropoelastin and abnormal

elastic fibres in a patient with autosomal dominant cutis laxa. Human Molecular Genetics.

7:1021-1028.

Tassabehji M, Metcalfe K, Karmiloff-Smith A, Carette MJ, Grant J, Dennis N, Reardon W,

Splitt M, Read AP, and Donnai D. (1999) Williams syndrome: use of chromosomal

microdeletions as a tool to dissect cognitive and physical phenotypes. American Journal of

Human Genetics. 64:118-125.

Tassabehji M. (2003) Williams-Beuren syndrome: a challenge for genotype-phenotype

correlations. Human Molecular Genetics. 15:R229-R237.

Tay ES, Guven KL, Subramaniam N, Polly P, Issa LL, Gunning PW, and Hardeman EC. (2003)

Regulation of alternative splicing of Gtf2ird1 and its impact on slow muscle promoter

activity. Biochemical Journal. 374:359-367.

Tipney HJ, Hinsley TA, Brass A, Metcalfe K, Donnai D, and Tassabehji M. (2004) Isolation and

characterisation of GTF2IRD2, a novel fusion gene and member of the TFII-I family of

transcription factors, deleted in Williams-Beuren syndrome. European Journal of Human

Genetics. 12:551-560.

Tussié-Luna MI, Bayarsaihan D, Ruddle FH, and Roy AL. (2001) Repression of TFII-I-

dependent transcription by nuclear exclusion. Proceedings of the National Academy of

Science (USA). 98:7789-7794.

Wang PP, Doherty S, Rourke SB, and Bellugi U. (1995) Unique profile of visuo-perceptual skills

in a genetic syndrome. Brain and Cognition. 29:54-65.

Williams JC, Barratt-Boyes BG, and Lowe JB. (1961) Supravalvular aortic stenosis. Circulation.

24:1311-1318.

Xu L, Glass CK, and Rosenfeld MG. (1999). Coactivator and corepressor complexes in nuclear

receptor function. Current Opinion in Genetic Development. 9:140–147.

Yan X, Zhao X, Qian M, Guo N, Gong X, and Zhu X. (2000) Characterization and gene

structure of a novel retinoblastoma-protein-associated protein similar to the transcription

regulator TFII-I. Biochemical Journal. 345:749-757.

Yang, W. and Desiderio S. (1997) BAP-135, a target for Bruton's tyrosine kinase in response to

B cell receptor engagement. Proceedings of the National Academy of Science (USA).

94:604-609.

34

Zhao C, Avilés C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ. (2005) Hippocampal and

visuospatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams

syndrome deletion interval. Development. 132:2917-2927.

Zhang MC, He L, Giro M, Yong SL, Tiller GE, and Davidson JM. (1999) Cutis laxa arising from

frameshift mutations in exon 30 of the elastin gene (ELN). Journal of Biological

Chemistry. 274:981-986.

35

CHAPTER II: GENOMIC REARRANGEMENTS OF THE HUMAN 7q11-q21 REGION.

36


2.1.1: Chromosomal rearrangements and the human genome:

Genomic rearrangement has played an important role in the development of human

genome. It is believed that as much as 5% of genome might be duplicated within large segments

of highly homologous DNA sequence known as segmental duplications or low-copy repeats

(LCRs) (Stankiewicz and Lupski, 2002). LCRs usually consist of segments of DNA from 10-

400kb in length with sequence identity of greater than 97% that are believed to have been

generated by the duplication of genomic sequence, resulting in paralogous regions (Shaw and

Lupski, 2004). It is believed that repeated genomic duplication events are responsible for the

creation of the β-globin and Hox gene clusters. Multiple domains within a single protein are also

likely due to the duplication of exons, and together contribute significantly to the karyotypic

evolution that has resulted in primate speciation (Stankiewicz and Lupski, 2002). However, the

presence of segmental duplications increases the likelihood of replication errors through non-

allelic homologous recombination (NAHR) between these region-specific LCRs. Recently it has

been determined that inversions may be present in a significant subset of the population and may

instigate illegitimate recombination events leading to chromosome deletion in offspring (Feuk et

al., 2005).

38

In the predicted model of NAHR, rearrangements mediated by duplicated sequences can

take place in one of three ways; between paralogs on the same chromatid (intra-chromatidal), on

sister chromatids (inter-chromatidal) or on the homologous chromosome (inter-chromosomal).

The first mechanism produces only interstitial deletion whereas in the latter two cases, a deletion

and a reciprocal duplication are generated (Figure 2.1) (Turner et al., 2008). It has been

demonstrated that germ-line rates of de novo meiotic deletion and duplication resulting from

inter-chromatidal recombination were negligible (Turner et al., 2008), consistent with previous

findings that the deletions of 7q11.23 in WBS are generated by inter-chromasomal (del+dup) or

intra-chromatidal rearrangements (Bayes et al., 2003). Since the latter mechanism produces only

a deletion the predicted frequency of occurrence for the WBS reciprocal duplication would be

expected to be less than the deletion frequency.

When the LCRs are in the same, or direct, orientation, deletions and duplications are

possible and occur by intra-chromosomal or inter-chromosomal misalignment. Deletions can

also be generated through intra-chromatid misalignment with an acentric supernumerary

chromosome also being produced. In rare cases, supernumerary chromosomes are stably

retained through subsequent cell division and if euchromatic sequence is present gene expression

can occur. If the genes contained with the supernumerary chromosome are dosage sensitive,

disease can occur; as is the case with some individuals with cat-eye syndrome, a rare

malformation involving human chromosome 22 (McDermid et al., 1986).

The presence of inverted repeats, where the homologous sequences are in the opposite

orientation to each other, results in an inversion of the region between the LCRs (Stankiewicz

and Lupski, 2002).

39

2.1.2: Chromosomal rearrangements and association with disease:

It is believed that cytogenetically visible chromosomal deletions occur in approximately

1 in every 7,000 live births (Jacobs et al., 1992) and although not all are pathogenic, deletions

and duplications can lead to the alteration of dosage-sensitive genes within the deleted and

duplicated genomic sequence. Depending on the size of the genomic segment between the LCRs

this genomic rearrangement may result in the disruption of a single gene leading to a Mendelian

disease or a contiguous gene disorder if more than one gene is dosage sensitive (Stankiewicz and

Lupski, 2002). In the case of inversions, the gene copy number is not altered but the

rearrangement can disrupt gene function at the junction of the inverted genomic segment or alter

gene expression by displacement of enhancer sequences if they occur outside the inverted

segment (Lupski, 1998). Deletions can also adversely affect the expression of genes outside the

deleted regions through a similar mechanism. The majority of the diseases caused by genomic

rearrangements are the result of a deletion. Duplications are likely less pathogenic than deletions

since over expression of a gene may not be as deleterious as a decrease in gene expression.

Mechanistically duplications are also less likely since intra-chromatidal misalignments that

generate deletions do not produce a reciprocal duplicated chromosome.

Examples of contiguous gene disorders caused by deletions and duplications are listed in

Table 2.1. Although both Smith-Magenis and Di George/VCFS are classified as contiguous

gene disorders due to the size of the genomic interval involved and number of genes deleted,

there is growing evidence that RAI1 and TBX1 respectively, are responsible for most of the

characteristic features of these diseases.

40

Table 2.1. Contiguous Gene Disorders Associated with Chromosomal Rearrangements

DISORDER CHROMOSOMAL

LOCATION

GENES

INVOLVED

REARRANGEMENT

TYPEB SIZE (kb)

Williams-Beuren Syndrome 7q11.23 ELN + DEL 1500

Smith-Magenis Syndrome 17p11.2 RAI1 DEL 4000

Dup(17)(p11.2p11.2) 17p11.2 ? DUP 4000

Prader-Willi Syndrome 15q11.2q13 SNRPN DEL 3500

DiGeorge Syndrome/VCFS 22q11.2 TBX1 DEL 3000/1500

Microduplication 22q11.2 22q11.2 TBX1 DUP 3000-6000

2.1.3: Inversion of the WBS region:

In 2001, an inversion of the WBS region was identified in WBS families using 3-colour

interphase FISH. It was determined that 33% (4/12) of parents from whose germ cells the

deletion was transmitted were carriers of the inversion (WBSinv-1) (Osborne et al., 2001; Bayés

et al, 2003). It was subsequently determined that the inversion exists as a polymorphism present

in approximately 7% of the general population suggesting that this newly identified genomic

variant within the population may be associated with a predisposition to subsequent NAHR

(Hobart et al., 2010). Indeed similar pre-disposing inversions have since been identified in the

parents of individuals with Angelman syndrome, Sotos syndrome and two recently identified

genomic disorders on chromosome 15 and 17 (Gimelli et al., 2003; Visser et al., 2005; Koolen et

al., 2006; Sharp et al., 2008).

41

The 7q11.23 inversion was also identified in 3 individuals that presented with a ―WBS-

LIKE‖ diagnosis based on their medical records but did not have a deletion of the WBS region

and it was theorized that the inversion in these atypical patients may be different from those seen

in parents and may be pathogenic due to disruption of gene function at one of the inversion

breakpoints (Osborne et al., 2001).

The generation of high-resolution physical maps of human chromosome 7q11.23 and its

syntenic region of mouse chromosome 5G have provided a valuable comparative sequence

resource (DeSilva et al., 2002). The syntenic WBS region in mouse has the full complement of

genes but without the LCRs that flank the human WBS region. Interestingly, the genes

commonly deleted in WBS occur in an inverted orientation in the mouse relative to neighbouring

genes with respect to the human sequence suggesting that human 7q11.23 underwent inversion

from the ancestral chromosome.

2.1.4: Duplication of the WBS region:

Although prior to 2005, duplications of the WBS region had not been identified, they had

been predicted because of the mechanism of NAHR. Supernumerary chromosomes containing

the 7q11.23 genomic region were known to exist resulting in deficits in language, in particular,

with a delay in expressive language and difficulty in articulation (Tan-Sindhunata et al., 2000).

The genetic basis underlying speech and language disorders are believed to be complex with

interaction of several loci as well as the environment to affect the susceptibility to disease (Fisher

et al., 2003). To date, only the rare Mendelian form of developmental verbal dyspraxia (OMIM

602081) can be directly associated with a specific gene, FOXP2 on chromosome 7 (Lai et al.,

2001). In 2001, mutations in FOXP2 were found to be associated with severe speech problems

42

in a large multigenerational family (Lai et al, 2001). Symptoms included orofacial dyspraxia

and the inability to select and produce the fine movements of the tongue and lips necessary for

the development of speech. Language disorders on the other hand, involve deficits in the

processing of linguistic information and may involve receptive (impaired language

comprehension), expressive (language production), or a combination of both (Fisher et al.,

2003). Examples of language disorders include specific language impairment, dyslexia and

aphasia.

The WBS phenotype also contains aspects of speech and language. Although the onset

of language is often delayed in WBS individuals, upon acquisition of speech, language abilities

develop at a faster rate than in a normal child. Since WBS is a contiguous gene disorder known

to be caused by a hemizygous deletion of the 7q11.23 region it can be inferred that the gene(s)

responsible for the language aspects of WBS are likely dosage sensitive. This is supported by

speech language difficulties seen in individuals with supernumerary chromosomes containing all

or portions of the WBS commonly deleted region.

2.1.5: Large deletions of the WBS region:

While atypical deletions smaller than the commonly deleted region have aided in the

identification of a minimal critical region, larger WBS-deletions have also been reported. These

larger deletions often share one breakpoint with the common deletion and can extend either

centromerically or telomerically. Deletions that extend telomerically are associated with a more

severe phenotype including serious cognitive impairments (Stock et al., 2003; Ferland et al.,

2006) often accompanied by infantile spasms (Mizugishi et al., 1998; Wu et al., 1999; Morimoto

43

et al., 2003). Infantile spasms (IS), also known as West syndrome, is a rare form of epilepsy seen

in the first year of life (4-8 months) (Hrachovy et al., 2002). In about one half of cases of IS, the

spasms are a symptom of a generalized brain disorder, CNS infection (Hongou et al., 1998) or of

developmental brain disturbances such as lissencephaly, focal cortical dysplasia (Palmini et al.,

1991), tuberous sclerosis (Curatolo, 1996), and neurofibromatosis (Korf et al., 1993). The other

50% of cases are idiopathic, occurring in the absence of brain malformation or neurological

insult (Palmini et al., 1991; Curatolo, 1996; Cowan, 2002).

In IS, the seizures are characterized by clusters of flexion jerks of the head neck trunk or

extremities that persist for 1-2 seconds and may occur repeatedly throughout the day. Distinctive

high voltage spike patterns on electroencephalograms (EEG) called hypsarrythmia may be

present in two thirds of cases (Gibbs and Gibbs, 1952). There is a significant risk of mortality

and morbidity associated with IS and treatments and may include adrenocorticotropic hormones

(ACTH) or inhibitors of the catabolism of GABA, such as Vigabatrin, although this is only

variably effective and carries the risk of serious side effects such as vision problems, weight

gain, hypertension and in rare cases, congestive heart failure (Riikonen et al., 2004). Without

treatment, the neurodevelopment of the immature brain may be impaired due to increased

neuronal excitability with over one half of individuals developing secondary forms of seizures

(Berg et al., 2001; Sillanpaa et al., 1998).

2.2: Methods: Severe Expressive-Language Delay Related to Duplication of the Williams–

Beuren Locus:

2.2.1: Participants:

44

All protocols complied with the ethics guidelines of the institutions involved and

appropriate informed consent was obtained from all human subjects. To determine the effect of

the reciprocal duplication of the WBS region, comparative evaluations were performed on both

the proband (KP) and an unaffected sibling (LP). Although KP‘s mother died when he was 4

years 3 months old, informed consent was obtained from the father and assent from the children

before performing genetic and psychological studies. Complete family medical records were

reviewed and KP, his sibling, and his father completed psychological assessments and were

examined for neurologic signs and dysmorphic features. At the time of assessment, KP was 8

years 10 months old and LP was 11 years 1 month old.

2.2.2: Clinical evaluation of language fundamentals and physical manifestations:

Language assessment was performed by Carolyn Mervis, dysmorphology assessment was

performed by Colleen Morris. Differential Abilities Scales (DAS), Peabody Picture Vocabulary

Test (PPVT-III), Expressive Vocabulary Test (EVT) and the Clinical Evaluation of Language

Fundamentals—Preschool Version 2nd

ed. (CELF-Preschool 2) were carried out as previously

described. (Elliott, 1990; Dunn and Dunn, 1997; Williams, 1997; Wiig et al., 2004).

2.2.3: Fluorescence in situ hybridization (FISH):

FISH analysis was performed on chromosome spreads from peripheral blood

lymphocytes using standard methodology. Briefly, for interphase analysis, lymphocytes were

cultured up to 72 hours, then synchronized with BrdU (0.18 μg/ml, Sigma) and washed and re-

45

cultured for 6 h in α-MEM (Invitrogen) with thymidine (2.5 μg/ml; Sigma). Slides from cell

lines or peripheral blood were dried at room temperature for 3 days. Prior to hybridization, slides

were denatured in 70% formamide/2 × SSC for 30 s at 70 °C and dehydrated with ethanol.

Probes were generated from genomic DNA isolated from BAC/PAC clones and labelled with

either biotin (green) or digoxigenin (red). Probes were denatured for 5 min at 75 °C and

hybridized to slides overnight (37 °C in 50% formamide with C0t-1 DNA). The slides were

washed, detection solution added, stained with DAPI and examined under a fluorescence

microscope.

2.2.4: Single-copy microsatellite markers:

PCR was performed using standard protocols at The Center for Applied Genomics

(TCAG). Single-copy microsatellite markers were amplified using fluorescently labeled primers

and the sizes of the resulting products determined using an Applied Biosystems 3730xl DNA

analyzer. Estimation of the number of alleles at multilocus microsatellites was performed by

comparing the relative ratios of the areas under the peaks from alleles of the same size in

different samples, using GeneMapper 3.5 software (PE Applied Biosystems).

2.2.5: Site specific nucleotide (SSN) dosage analysis:

Site Specific Nucleotide (SSN) dosage analysis was used when further delineation of the

duplication breakpoints could not be accomplished using FISH or microsatellite analysis due to

the high degree of sequence homology in the flanking LCRs. This method utilizes dosage

46

analysis of SSNs between the centromeric, medial and telomeric repeat blocks allowing for the

identification of the relative number of block B-type copies at each position analyzed to

determine whether the recombinant block B was Bm type (breakpoint proximal or centromeric to

the position) or Bc type (breakpoint distal or telomeric). The assay was performed as previously

described (Bayés et al., 2003). Briefly, PCR products for each SSN locus were generated using

standard PCR methods, purified and digested using restriction endonucleases according to

manufacturer‘s instructions, followed by size fractionation on 1%-3% agarose or 10%

polyacrylamide gels.

2.2.6: Genomic analysis using quantitative PCR:

To determine genomic copy number, real-time PCR was performed using an ABI

Prism7900HT sequence detection system with 10 l reactions containing 5ng of template and

Power®SYBR master mix (Applied Biosystems, Foster City, CA) for 40 cycles of amplification.

Each plate contained a No Template Control (water) and serially diluted concentrations (range

10-0.62 ng) of control genomic DNA (BD Bioscience) were used to generate a standard curve

for genomic quantification. Real-time PCR experiments were normalized using SDHA and

HMBS as reference genes assuming that the copy number of these reference genes would be

constant in both test and control samples. Primer sequences are listed in Table 2.2.

2.2.7: Expression analysis using quantitative PCR:

Expression analysis to identify changes in gene expression was carried out, using total

RNA extracted from EBV transformed lymphoblast cell lines using standard Trizol/chloroform

47

extraction procedures. 5 ug of total RNA was DNase treated (Fermentas) and reverse transcribed

in a 20 ul reaction with random hexamers using SuperScript™ First-Strand Synthesis System

(Invitrogen). Real-time PCR was carried out using an ABI Prism7900HT sequence detection

system with 11 ul reactions containing 5 ng of template and Power®SYBR master mix (Applied

Biosystems, Foster City, CA) for 40 cycles of amplification. All samples were run in triplicate

and the experiment was repeated twice with consistent results. Real-time PCR experiments were

normalized using ACTB, and HPRT as references. Each plate contained a No Template Control

(NTC – water) and serially diluted concentrations of control genomic DNA (range 10-0.62 ng) to

generate a standard curve for transcript quantification. Primer sequences are listed in Table 2.2.

All samples were run in triplicate and the experiment was repeated twice with consistent results.

Comparative expression ratios were calculated by dividing the averaged normalized values for

each of the test genes by the normalized test gene values for the control group.

2.3: Methods: The Common Inversion of the Williams-Beuren Syndrome Region at

7q11.23 Does Not Cause Clinical Symptoms:


Participants 1 and 2 were described previously as showing some features of WBS and

having an inversion but not a deletion of the 7q11.23 region (15441 and 12503 in Osborne et al.,

2001). The third patient originally reported in the paper is now deceased. To determine if the

inversion contributed to the observed syndromic features, a detailed family and medical history

was taken and a thorough clinical and developmental assessment and for each patient was

performed by Dr. Colleen A. Morris, an experienced dysmorphologist at the University of

48

Nevada School of Medicine. Immediate family members were also examined for features of

WBS. All other study participants were from families with WBS. All subjects presented in this

research were enrolled in a research study approved by the Research Ethics Board of the

University of Toronto. Informed consent was obtained before any clinical or genetic studies

were performed.

2.3.2: Developmental assessment:

The Williams Syndrome Cognitive Profile (WSCP) originally developed by Dr. Carolyn A.

Mervis and Dr Bonita P Klein-Tasman (2000) includes evaluation based on an individual‘s

performance on the DAS. To assess the cognitive and behavioral aspect of the reported

individuals, the following developmental assessments were performed by Dr. Carolyn Mervis: 1)

Differential Ability Scales (DAS) (Elliott, 1990) used to measure cognitive ability. 2) Wechsler

Abbreviated Scale of Intelligence (WASI) (Wechsler, 1999). The WASI is a standardized

measure of intelligence for the full age range of individuals in the patients‘ families (6 – 60

years) and includes 4 subtests (verbal: vocabulary, similarities; performance: block design,

matrices) and yields a verbal IQ, performance IQ, and full-scale IQ, and 3) Scales of

Independent Behavior-Revised (SIB-R) (Bruinsinks et al., 1996). The SIB-R is a standardized

measure of adaptive and maladaptive behavior. Four subscales of adaptive behavior (motor

skills, social interaction and communication skills, personal living skills, community living

skills) and three subscales of maladaptive behavior (internalized, asocial, externalized) were

measured.

49

2.3.3: Inversion testing:

Three-color fluorescence in situ hybridization (FISH) analysis was performed on both

blood and transformed lymphoblastoid cell lines from each participant, at The Center for Applied

Genomics, (Toronto, Canada) according to previously described protocols (page 50).

Chromosome spreads for interphase FISH analysis were prepared from peripheral blood

lymphocytes using standard methodologies. Three-color FISH was performed using two probes

located within the commonly deleted region, RP5-1186P10 at the GTF2IRD1 locus and CTA-

208H19 at the FZD9 locus, and one probe located telomeric to the WBS deleted region CTB-

139P11 at the HIP1 locus.

2.3.4: Expression analysis using quantitative PCR:

Expression analysis was carried out using total RNA extracted from transformed

lymphoblast cell lines as described previously (Section 2.2.7). Primer sequences are indicated in

Table 2.2. Each test gene was normalized to control genes hydroxymethylbilane synthase

(HMBS), hypoxanthine-guanine phosphoribosyltransferase (HPRT) and TATA binding protein

(TBP). A mean normal expression ratio was calculated for each of the control genes by averaging

the values for each gene obtained for the control group. Mean normal expression ratios were

then used to standardize the expression ratio across all three control genes, and averaged to

generate a normalized expression level (NEL). Comparative expression ratios for the WBSinv-1

and WBS deletion groups are expressed as a ratio of NEL of the test group relative to the control

group.

50

Table 2.2. Primers Used for Expression Analysis

Primer Name Sequence

ACTB-F AAAGCCACCCCACTTCTCTCTAA

ACTB-R ACCTCCCCTGTGTGGACTTG

ASLRTe10-F GCTGTGCATGACCCATCTC

ASLRTe10-R CATCTGAGAGCTGCACGAAG

BAZ1B-RTe4-F TCATCCTTTGGAGAAAGTGGA

BAZ1B-RTe4-R CTTCTGATGGTCCTGAGCAA

CYLN2-RTe2-F CACTCACCCTTGTCCACCTG

CYLN2-RTe2-R AAGCTGACCCAGTAGATGTCC

GTF2I-RTe2-F GAAATCTACAACCCAGGCAAA

GTF2I-RTe2-R GCAAAAGCAGAAATAGTCCTCAA

GTF2IRD1-RTe3-F CTCAGCGCTGTCCAAACTG

GTF2IRD1-RTe3-R CGGGCATTCAGGAACATTCT

HPRT1-RT-F GCCTATAGACTATCAGTTCCCTTTGG

HPRT1-RT-R TGCTGTGGTTTAAGAGAATTTTTTCA

KCTD7RTe4-F GAGTGTCCGCTCCTCAACTC

KCTD7RTe4-R TCCACTTCACAGTGGTGCTC

LIMK1-RTe3-F GAAGGATGGGCAGCTCTTCT

LIMK1-RTe3-R CAGTCCCTTGGTGATTTGCT

PORRTe14-F GGGGAGACGCTGCTGTACTA

PORRTe14-R ACGTTGAGCTGGGTGAGC

RFC2-RTe7-F AGTCCTCCGGTACACAAAGC

RFC2-RTe7-R GCTTCTAGGCCGTCATCAGT

51


WBSCR1-RT3‘-F GGCCACATCTTGGGGACA

WBSCR1-RT3‘-R CCCTAGCACTCCCACATAACT

WBSCR5-RTe2-F AGCTCGGGGACTGAACTG

WBSCR5-RTe2-R AGCAGCGCACACACAGAC

SERPIND1-RTe2-F CGGATCCAGCGTCTTAACAT

SERPIND1-RTe2-R CCAACGGGTGCTATGAAGA

YPEL1-RTe2-F GTCCCAGCTGTGTGGACAGT

YPEL1-RTe2-R GCTGGCCTCTCTGACAAAAG

The control group contained RNA samples from 8 individuals known not to carry a

rearrangement of the 7q11.23 region. The WBSinv-1 carrier group consisted of 8 individuals

determined to be carrying one WBSinv-1 inverted chromosome and the WBS group consisted of

5 individuals possessing the common 1.5 Mb deletion of 7q11.23.

Pair wise statistical comparison between was performed using a two-tailed student t-test to

look for differences in expression of each gene in the test groups relative to the control group.

Probabilities of P<0.05 were considered significant.

2.3.5: Copy number variation analysis:

Copy number variation (CNV) analysis was performed on Participant 1 and Participant 2 at The

Center for Applied Genomics by Dr. Christian Marshall using SNP array analysis. DNA samples

were genotyped with the Affymetrix GeneChip® Human Mapping NspI Array (Affymetrix Inc.,

52

Santa Clara, CA) according to the manufacturer‘s instructions. The NspI Array scans were

analyzed using dChip 2006 software (DNA Chip Analyzer) and copy number analysis was

performed as described previously (Zhao et al., 2004). The CNVs identified in each DNA

sample were compared with previously documented CNVs using the Database of Genomic

Variants, a curated catalogue of structural variations in the human genome (Iafrate et al., 2004).


The detected CNVs were confirmed using quantitative real-time PCR with primers located

within the SERPIND1 and YPEL1 genes listed in Table 2.2. Real-time PCR was carried out

using a 7900HT genetic analyzer (Applied Biosystems, Foster City, CA) with 11 ul reactions,

performed in triplicate, containing 5 ng of template and Power®SYBR master mix (Applied

Biosystems, Foster City, CA) for 40 cycles of amplification. The DNA copy number of each

gene was obtained from a calibration curve that assumes the reference genome is diploid.

Genomic ratios were determined by comparing absolute copy number of the two test genes to the

reference gene, HMBS.

2.4: Methods: Infantile Spasms is Associated with Deletion of MAGI2 on Chromosome

7q11.23-q21.11.


In order to determine whether a novel locus for IS could be defined, 12 cases were

identified with interstitial deletions of 7q11.23-q21 from our Chromosome 7 Annotation Project

53

clinical database. Additional subjects described in this study included four with a diagnosis of

WBS, six with a diagnosis of WBS plus IS, and three with a diagnosis of IS or other seizure

disorder, but not WBS. Clinical data for all subjects, plus the 13 additional subjects from the

literature with deletions of 7q11.23-q21.1 are presented in Table 2.11. Seizure history was

obtained for all cases and genotype-phenotype correlation was performed on the basis of the

presence or absence of IS or other forms of seizure activity.

2.4.2: Preparation of genomic DNA:

Genomic DNA was obtained directly from the Hospital for Sick Children (Toronto,

Canada) or prepared from peripheral blood lymphocytes using standard methodologies. Briefly,

cell pellets were digested in lysis buffer (10 mM Tris, 100 mM NaCl, 10 mM EDTA, 0.5% SDS,

0.4 ug/ml Proteinase K) overnight at 60oC. Potassium acetate was added to final concentration

of 1.2M and equal volume of chloroform. Samples were incubate 20 minutes at -20°C and

pelleted for 5 minutes at 12000 xg at room temperature. The aqueous phase was transferred to

fresh tube and DNA precipitated with 2 volumes of 100% ethanol. Pellet at 12000 xg at RT and

wash with 70% ethanol. Re-suspended in nuclease free water and store at -20°C. DNA was also

purified from buccal samples using the Oragene DNA Self-Collection Kit following

manufacturer‘s instructions.

2.4.3: CNV analysis:

Comparative intensity analysis was performed by Dr. Christian Marshall at the Center for

Applied Genomics (Toronto, Canada) on DNA samples from 17 of the 26 subjects in order to

54

establish the copy number variation (CNV) content and to define the breakpoints of the

interstitial 7q11.23-q21.1 deletions. For each DNA sample, an average of 250,000 SNPs were

genotyped using the GeneChip® Human Mapping NspI and StyI Array (Affymetrix, Inc., Santa

Clara, CA) according to the manufacturer‘s instructions and as described previously (Marshall et

al., 2008). Briefly, 250ng of genomic DNA was digested with NspI or StyI restriction enzyme

(New England Biolabs, Boston, MA), ligated to an adaptor and amplified by PCR. The PCR

products were then fragmented with DNase I to a size range of 250 to 2,000 bp, labeled, and

hybridized to the array. After hybridization, arrays were washed on the Affymetrix fluidics

stations, stained, and scanned using the Gene Chip Scanner 3000 7G and Gene Chip Operating

System. The NspI and StyI Arrays scans were analyzed independently using dChip 2006 software

(DNA Chip Analyzer) (Li and Wong, 2003). Array scans were normalized at the probe intensity

level with an invariant set normalization method (Li and Wong, 2001a). After normalization, a

signal value was calculated for each SNP using a model-based method (Li and Wong, 2001b). In

this approach, image artifacts were identified and eliminated by an outlier detection algorithm.

Using this approach, comparative intensity analysis enabled the mapping to within

approximately 10 Kb of the 7q11.23-q21.1 deletion boundaries in each subject sample. When the

deletion breakpoint was located within the low copy repeats flanking the WBS region, it was not

possible to identify the precise location of the breakpoint due to the presence of multiple copies

of SNPs within the low copy repeats.


Confirmation of the array data and refinement of the breakpoints within and around

MAGI2 was performed by quantitative real-time PCR analysis using the 7900HT genetic

55

analyzer (Applied Biosystems, Foster City, CA). The total volume was 11 ul and reactions were

performed in triplicate, using 5 ng of template and Power®SYBR master mix (Applied

Biosystems, Foster City, CA) for 40 cycles of amplification. The DNA copy number of each test

sequence was obtained from a calibration curve that assumes the reference genome is present in

two copies at that site. Genomic ratios were determined by comparing absolute copy number of

the test sequences to the reference gene, HMBS. Quantitative real-time PCR analysis of MAGI2

exon 1 and exon 21 was carried out on all 20 available DNA samples (Figure 2.8; Cases 1; 6-12;

13-21; 22-24) and breakpoints for critical cases were further refined using primer pairs listed in

Table 2.3.

Table 2.3. qPCR Primers Used to Characterize MAGI2 Breakpoints


hsMAGI2RTe1-F AGCTGGGCTTTGAACTGAAG

hsMAGI2RTe1-R ATTTGCTGCCGCTCTCATAG

hsMAGI2RTe2a-F GCGAATGGGTTGGATCAGTA

hsMAGI2RTe2a-R GAGCTCTGTTCAAAGGAAGCA

hsMAGI2RTe3-F ACCACAAGGCCACATAAGGA

hsMAGI2RTe3-R CCACTTTCTAGGAGAGCACCA

hsMAGI2RTe4-F CAGCAGAACCAGCACCATTA

hsMAGI2RTe4-R CTTCCGTTTTCCTTCAGCAC

hsMAGI2RTe19-F TGAAAGCAAGGCAAGATGTG

hsMAGI2RTe19-R CTGCTGGTAGTCCCCTCCT

hsMAGI2RTe22-F ACCCTTCCCACCAGATAAGC

hsMAGI2RTe22-R TGAAAGCTCCTTTGGTTTCC

56


hsMAGI2RT-3'-F CACTGCATGAAGGACTTGGA

hsMAGI2RT-3'-R GCTCCGTGCAGTTTGATTTT

2.5: Results: Duplications and its Association with Speech Language Delay:

Data from this section has been included in the following publication:

Somerville MJ*, Mervis CB*, Young EJ, Seo E-J, del Campo M, Bamforth JS, Peregrine E, Loo

W, Lilley M, Perez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe

expressive-language delay related to duplication of the Williams–Beuren locus. New England

Journal of Medicine 353:1694-1701.

*authors contributed equally to this work

The patient was identified by Dr. Stephen Bamforth and Margaret Lilley. The

duplication of 7q11.23 was initially found by Dr. Martin Somerville. Physical evaluation was

performed by Dr. Colleen Morris and assessment of speech, language and cognitive abilities was

performed by Dr. Carolyn Mervis and Ella Peregrine. FISH was performed by Drs. Eul-Ju So

(Dr. Stephen Scherer‘s lab). Site specific nucleotide (SSN) dosage analysis was performed by

Drs. Miguel del Campo and Luis Perez-Jurado. I determined the extent of the duplication and

evaluated changes in expression of deleted genes.

2.5.1: Mild physical manifestation of 7q11.23 duplication:

Although this is the first case of the reciprocal duplication of the WBS deletion, KP

displayed few physical symptoms, namely growth retardation and mild dysmorphism, unlike the

distinctive facial gestalt seen in WBS (Morris, 2005). In the physical assessment, KP‘s height,

weight and head circumference were found to be in the 2nd

, 5th and 30

th centile respectively.

Other dysmorphic features included dolichocephaly, a high narrow forehead, long eyelashes, a

57

high and broad nose, short philtrum, high arched palate, dental malocclusion (anterior open bite),

retrognathia, and asymmetric face (Figure 2.2).

It should be noted that KP did not exhibit any of the facial features commonly seen in

WBS (Morris, 2005). He had bilateral simian creases, and the left hand was smaller than the

right. On neurological exam, KP was noted to have mild dysmetria and some difficulty walking

and standing on one foot.

58

2.5.2: Severe expressive language delay is the most striking feature of 7q11.23 duplication:

The expressive language difficulties exhibited by KP were immediately apparent,

pronouncing only a very small number of words. The majority of words were approximations,

often composed of the first consonant (or a related consonant) and the first vowel (or a related or

neutral vowel) of the word being spoken. The results of the intellectual and vocabulary

assessments are summarized in Table 2.4. KP‘s performance on the nonverbal reasoning, spatial

ability, general conceptual ability and special nonverbal composite subtest of the Differential

Ability Scales (DAS) (Elliott, 1990) did not differ significantly from his sister who did not carry

the duplication of 7q11.23. On the Verbal subtest, where verbal responses, manual signs,

gestures, pantomime, and drawing were all considered acceptable responses, KP‘s score was

significantly lower than his sister and if only verbal responses had been accepted, his standard

score on the Verbal subtest would have been considerably lower.

The Peabody Picture Vocabulary Test (PPVT-III) (Dunn and Dunn, 1997), measuring

receptive vocabulary, and the Expressive Vocabulary Test (EVT) (Williams, 1997) were

administered to provide a direct comparison of KP‘s receptive and expressive language abilities

(Table 2.4). Even though words and word approximations as well as manual signs were

considered acceptable responses, KP‘s standard score for receptive vocabulary was in the low

average range (age equivalent of 6 years 10 months) in contrast to his expressive vocabulary

standard score which was in the severe impairment range (age equivalent of 2 years 3 months),

59

Table 2.4. Standard Scores on Intellectual and Vocabulary Assessments

Assessment KP LP

Differential Ability Scales (DAS)

Verbala 65 93

Nonverbal Reasoning 65 70

Spatial 70 68

General Conceptual Ability 62 73

Special Nonverbal Composite 65 67

Vocabulary

PPVT-III 82 106

EVTb 40 104

aKP responded with a combination of words, manual signs, gestures, and pantomime; all these

modes were acceptable for the DAS Verbal Cluster, provided his meaning was clear. bFor KP, responses composed of words or manual signs (but not gesture or pantomime) were

acceptable for the EVT.

Due to the impairment of KP‘s language abilities he was unable to complete the age-

appropriate version of the Clinical Evaluation of Language Fundamentals. Therefore, the

Clinical Evaluation of Language Fundamentals - Preschool Version 2nd

ed. (CELF-Preschool 2)

(Wiig et al., 2004) was administered. On the subtests evaluating receptive language, KP

demonstrated that he understood a variety of grammatical constructions, was able to categorize

pictures of objects, and understood simple relational language. Overall, his performance was

consistent with moderate language impairment.

In contrast to his receptive language abilities, KP was unable to answer a single question

correctly on the three primary expressive subtests: recall of sentences, expressive vocabulary,

60

and word structure, indicative of severe expressive language impairment. These subtests

measured production of grammatical markers such as plural or past tense, ability to repeat

verbatim sentences spoken by the examiner, and ability to label pictures (using either words or

signs). Although KP's standard scores were in the mild mental deficiency range on the DAS

Nonverbal Reasoning and Spatial Clusters, his abilities were similar to those of his sister and are

also consistent with the type of difficulties his mother was also reported to have had. Both

children‘s scores on the DSM-IV Inattentive, Hyperactive-Impulsive and the Conners‘ Rating

Scale (Conners, 1997) were consistent with their previous diagnosis of ADHD. Therefore the

primary basis for these difficulties is likely not the duplication of the 7q11.23 region.

2.5.3: Duplication of the 1.5 Mb WBS region:

KP was initially referred to a diagnostic centre for velocardiofacial syndrome (VCFS)

testing. Using real-time PCR-based methods, the assay identified abnormal genomic ratios of

several genes located within the WBS critical region (7q11.23) (Christiansen et al., 2004). FISH

analysis with probes from the 7q11.23 region (Morris, 2005) showed that the duplication was

limited to the region commonly deleted in WBS. Three signals on interphase FISH spreads were

observed using BAC probes from within the WBS common deletion region (CTA-208H19, RP5-

1186P10), while BAC probes flanking the common deletion region (RP11-815K3, CTB-139P11)

gave only two signals (Figure 2.3). Two signals were also seen using the cosmid LL07NCO1-

207g3, which lies between the medial and telomeric LCRs, indicating that the duplication was

restricted to the region spanning the centromeric and medial LCRs, corresponding to the region

61

commonly deleted in WBS. No duplication was detected in KP‘s father or sister or in over 250

other WBS or non-WBS controls examined.

2.5.4: Single-copy microsatellite markers:

Single-copy microsatellite analysis using markers from within the WBS region of KP

identified distinctive alleles at the following loci D7S2476, D7S3194 and D7S1870 (Table 2.5).

At all three markers, only one of the alleles was found to be present in the father indicating that

KP mostly likely inherited two different copies of the WBS region from his mother. Subsequent

analysis of single-copy microsatellite markers from both maternal grandparents determined that

62

the duplicated chromosome was derived from segments of chromosome 7 inherited

independently from each maternal grandparent (Table 2.5). Therefore, the inter-chromosomal

recombination that led to the duplication took place during meiosis in the mother‘s germ cells,

and that the recombination was a de novo rearrangement.

Two multi-copy microsatellite markers were also used: BASTR1 (D7S489) which is

present in the centromeric (D7S489Cc), medial (D7S489A) and telomeric (D7S489Ct) A-blocks

as well as within the commonly deleted region (D7S489B), and BBSTR1, which is present in

each of the three B-blocks (Bayés et al., 2003). An additional copy of each locus was identified

in KP‘s DNA when compared to his father, indicating a gain of a B block.

63

Table 2.5. Single-Copy Microsatellite Analysis Using Markers from Within the WBS

Region

FAMILY MEMBER MARKER

ALLELE 1 ALLELE 2 ALLELE 3

Size in base pairs

Proband 216 222

Sibling 222 222 Father D7S653 216 222

Mat GF 222 222

Mat GM 222 222

Proband 140 150

Sibling 144 144

Father D7S672 144 150

Maternal Grandfather 140 140 Maternal Grandmother 142 144

Wil

liam

s-B

eure

n s

yn

dro

me

regio

n

Proband 156 162 168

Sibling 156 168

Father D7S2476 156 156

Mother (reconstructed) 162 168

Maternal Grandfather 154 162

Maternal Grandmother 154 168

Proband 202 204 208

Sibling 204 204

Father D7S3194 202 204




Proband 134 132 136

Sibling 134 136

Father D7S1870 134 134




Proband 210 210

Sibling 206 210

Father D7S2455 206 210



Proband 207 207

Sibling 207 211 Father D7S675 207 211



64

2.5.5: The 7q11.23 duplication is the reciprocal of the WBS deletion:

Due to the high sequence identity of the LCRs, further narrowing of the duplication

breakpoints could not be accomplished with FISH or microsatellite analysis. Previously, it has

been demonstrated that site-specific nucleotide (SSN) dosage analysis can be used to refine the

breakpoints of the WBS deletion within the repetitive B-blocks of sequence (Bayés et al., 2003).

This method utilizes dosage analysis of SSNs between the centromeric, medial and telomeric

repeat blocks enabling the determination of the relative number of block B-type copies at each

position analyzed and whether the recombinant block B was Bm type (breakpoint proximal or

centromeric to the position) or Bc type (breakpoint distal or telomeric). Analysis of seven SSNs

spanning 7q11.23 showed that in KP the transition between block Bm and Bc occurred within

the NCF1 gene between SSN 4 and SSN 6 (Figure 2.4) similar to 95% WBS deletion breakpoints

(Valero et al., 2000; Bayés et al., 2003), indicating that the duplication is the exact reciprocal of

the common WBS deletion.

2.5.6: Genes within the duplication show altered expression:

Quantitative PCR gene expression analysis using RNA derived from lymphoblastoid cell

lines demonstrated that 5 of 6 genes within the duplicated region (GTF2I, LIMK1, EIF4H, RFC2,

BAZ1B) showed increased expression in KP and reduced expression in individuals with WBS

(Table 2.6). Only LAT2 (formerly WBSCR5), which showed a 60% reduction in expression in

individuals with WBS, displayed levels consistent with control individuals in KP. WBSCR16,

located just outside the telomeric WBS deletion/duplication breakpoint, also did not show altered

expression in either KP or WBS patients, indicating that this rearrangement breakpoint did not

65

af

fect the expression of WBSCR16. Calneuron 1 (CALN1), the nearest gene outside the

centromeric WBS boundary, was not expressed in lymphoblast cell lines. However, since it is at

least 300 kb from the proximal B block (Bayés et al., 2003) and the breakpoint is separated from

CALN1 by the complex and actively transcribed LCRs, it is unlikely the duplication or deletion

breakpoint would affect its expression although it cannot be ruled out.

66

Table 2.6. Genes Within the Duplication Show Altered Expression

Gene

Comparative Expression Ratio (vs. control group n=9)

WBS Patients (n=9)

Mean ± SEM

KP Duplication

Mean ± SD

BAZ1B 0.42 (± 0.07) 1.47 (± 0.15)

WBSCR18 0.39 (±0.04) 1.44 (± 0.12)

LIMK1 0.50 (± 0.22) 1.57 (± 0.17)

EIF4H 0.45 (±0.05) 1.35 (± 0.10)

LAT2 0.38 (± 0.17) 1.05 (± 0.28)

RFC2 0.50 (± 0.06) 1.30 (± 0.02)

GTF2I 0.56 (± 0.08) 1.58 (± 0.13)

WBSCR16 0.99 (±0.12) 0.94 (± 0.37)

2.6: Results: Common Inversion Does Not Cause Clinical Symptoms:


Tam E, Young EJ, Morris CA, Marshall CR, Loo W, Scherer SW, Mervis CB, Osborne LR.

(2008) The common inversion of the Williams-Beuren syndrome region at 7q11.23 does not

cause clinical symptoms‖ American Journal of Medical Genetics: Part A. 146A:1797-1806.

Figures reprinted with permission.

Physical evaluation was performed by Dr. Colleen Morris and assessment of speech,

language and cognitive abilities was performed by Dr. Carolyn Mervis. CNV analysis was

performed by Dr. Christian Marshall (Dr. Stephen Scherer‘s lab). Wayne Loo, Elaine Tam and I

performed expression analysis.

2.6.1: Clinical assessment:

67

2.6.1.1: Medical and family history Participant 1:

Participant 1 was a female, delivered at term and was noted to have ectrodactyly of the feet

at birth. She did not walk until between 16 and 18 months. She pronounced her first words at

age 1 year, and was able to speak in sentences by the age of 3 years. With the exception of the

occurrence of inguinal hernias in a maternal uncle, a five-generation family history did not reveal

any symptoms common to individuals with WBS. Subsequent physical examination of her half

sister, mother, and both maternal grandparents revealed no dysmorphic features.

2.6.1.2: Medical and family history Participant 2:

Participant 2 is a female that was delivered at term with initial respiratory distress. She had

delayed motor development and was diagnosed with static encephalopathy (cerebral palsy).

When she was evaluated at the age of 2 years, due to developmental delay, her head

circumference was 43 cm, which was below the 2nd percentile. Six months later, she was noted

to have increased tone in her lower extremities as well as a wide based gait. As a young child,

she had a past history of a seizure disorder, which resolved by the age of 12 years, as well as a

history of chronic ear infections (otitis media). Initial karotyping studies revealed no

abnormalities and a DNA test for Fragile X was also negative. She was diagnosed with a growth

hormone deficiency at the age of 12 years and responded well to growth hormone therapy. A

four-generation family history failed to identify any symptoms common to people with WBS

although Participant 2‘s older sister had been diagnosed with Grave‘s disease. Further physical

examination of Participant 2‘s parents and sister revealed no dysmorphic features.

68

2.6.1.3: Physical examination Participant 1:

A summary of clinical presentation can be found in Table 2.7. At the time of examination,

Participant 1 was 17 years old. Participant 1‘s head circumference was at the 40th percentile, and

her cranial shape was dolichocephalic although her facial measurements were with the normal

range with the exception of a wide mouth (Figure 2.5). She had bilateral epicanthal folds and the

69

palpebral fissures were down slanting. Participant 1 possessed a mildly webbed neck and there

was a low posterior hairline, although in general, her hair pattern was normal. Participant 1 had

sloping shoulders, there was a tight heel cord on the right and her right leg was smaller than the

left. Participant 1 also exhibited bilateral ectrodactyly of the feet with the right foot showing a

70

severe ectrodactyly with pes cavus, and the left foot showing a mild ectrodactly (four toes were

present), resulting from a previously identified 24 Mb inversion disrupting the 7q21.3 region that

has been associated with split hand/foot malformation (SHFM) (Scherer et al., 1994).

Participant 1 did not meet the clinical criteria for WBS. Participant 1 did have 2 of 17

facial features consistent with WBS (WBS have >9) including strabismus and a wide mouth with

bowed upper lip (Mervis and Morris, 2007). Other common physical features consistent with

WBS include: radio-ulnar synostosis, sloping shoulders, lordosis, and joint contractures although

the latter may be due to her ectrodactyly and leg length discrepancy.

2.6.1.4: Physical examination of Participant 2:

A summary of her clinical presentation can be found in Table 2.7. Participant 2 was

examined at age 22 years of age. Her height and weight scored at the 5th percentile, and her head

circumference was 51.5 cm, which is below the 3rd percentile. Participant 2 had a low anterior

hairline, left esotropia (strabismus) and mildly up-slanting palpebral fissures. She had

hypotelorism with inner canthal distance; inter pupilary distance and outer canthal distance all

below the 3rd percentile. Participant 2 had a broad nose and her mouth width was at the 25th

percentile. Participant 2‘s fingers were thin and tapered and a bilateral shortening of the fifth

fingers. Participant 2 had tight heel cords and hamstrings with the right worse than left, as well

as a mild two-three toe syndactyly on her left foot.

Participant 2 possessed none of the common physical features typically associated with

WBS. Strabismus was the only WBS associated facial feature identified (Mervis and Morris,

71

2007). The joint contractures in Participant 2 were related to her static encephalopathy and

microcephaly.

Table 2.7. Clinical and Neurobehavioral Features of Individuals with Williams-Beuren

Syndrome and of Participants 1 and 2

Williams-Beuren Syndrome Participant 1 Participant 2

Faces

Broad forehead Normal forehead Microcephaly

Bitemporal narrowing Normal bitemporal area Microcephaly

Low nasal root & bulbous nasal tip Normal nose Broad nose

Prominent earlobes Low set and posteriorly

rotated ears

Ears normally placed and

formed

Periorbital fullness Normal periorbital area Normal periorbital area

Stellate iris Normal iris Normal iris

Malar flattening but full cheeks Mild malar hypoplasia Normal mala

Long philtrum Normal philtrum Normal philtrum

Full lips and wide mouth Wide mouth (2 SD >mean) Small mouth

Small jaw Prominent jaw Normal jaw

Small, widely spaced teeth Normal sized teeth Normal sized teeth

Normal palate Normal palate High, arched palate

Other Physical

Low birth weight Normal birth weight Normal birth weight

Growth retardation Normal growth Growth retardation

Kidney & bladder abnormalities Renal ultrasound normal Incontinence

Kyphosis, lordosis, joint

contractures, radio-ulnar synostosis

Lordosis, joint contractures.

Radio-ulnar synostosis of the

left elbow

Joint contractures, bilateral

hallux valgus

72

Williams-Beuren Syndrome Participant 1 Participant 2

Ectrodactyly of both feet

Hypercalcemia Not tested Not tested

Ocular problems: strabismus,

hyperopia

Strabismus, myopia Strabismus

Cardiovascular problems: SVAS Normal echocardiogram None reported

Cognitive Abilities

Mild mental retardation Mild mental retardation Mild mental retardation

Weakness in spatial skills and math Relative strength in spatial

skills and math

Relative strength in spatial

skills

Relative strength in expressive

language

Relative weakness in verbal

skills

Relative weakness in

verbal skills

Behaviour

Excessively social Normal social interaction Normal social interaction

Attention deficit hyperactivity

disorder

No hyperactivity

Mild attention problems

No hyperactivity

Mild attention problems

Hypersensitivity to sound and

specific phobia of loud noises

Normal response to loud

noises

Normal response to loud

noises

2.6.2: INV-1 Participants 1 and 2 developmental assessment:

Standard scores on intellectual and adaptive behavior assessments for Participants 1 and 2

are presented in Table 2.8. Patient 1‘s full-scale IQ was determined to be 0.43 SD below the

mean for a group of 28 adolescents and young adults with WBS and 0.29 SD below the mean for

a group of 27 adolescents and young adults with Down syndrome (DS). Patient 2‘s full-scale IQ

was determined to be 1.07 SD below the mean for WBS and 0.77 SD below the mean for DS

(Mervis and Morris, 2007). On the four subtests, both participants score highest on the Block

73

Design subtest, on which individuals with WBS typically have the most difficulty. Information

provided by Participant 1‘s mother, and the results of the DAS indicate that her math skills are

more advanced than her reading skills in contrast to most people with WBS who perform

considerably better on reading than on math. Also, in contrast to people with WBS, Participant 2

displayed an aptitude for remembering dates, such as birthdays and ages; while most people with

WBS do not know the ages of their siblings (never mind their uncles, aunts, or cousins), and

almost never know in what year these people were born.

Attention problems were not identified in either patient and both were able to stay on task

throughout the 2 hours it took to complete the testing, although it was reported that both had

difficulty staying on task in group situations. In contrast to this finding, the majority of

individuals with WBS find it difficult to stay on task even in one-on-one situations. Neither

participant showed any of the characteristic behavioral features seen in individuals with WBS

Participant 1 sat quietly while examiners spoke with her family, and spoke only when asked a

direct question. Participant 2 regarded the examiners as strangers and spoke only when it was

appropriate. Participant 2 did not ask any personal questions and stayed on topic during

conversations.

On the SIB-R adaptive behavior test, Participant 1‘s Broad Independence standard was in

the range expected for WBS although this is consistent with other syndrome associated with

mild-to-moderate mental retardation. Participant 2‘s Broad Independence standard score was

determined to be considerably below individuals with WBS. Overall maladaptive behavior

scores for both participants were also within the normal range.

74

As mentioned in the introduction, persons with the WSCP are required to fit all four of

the following criteria on the DAS met by 89% of individuals with WBS (Mervis et al., 2000).

Participant 1 did not fit the WSCP because her DAS T scores did not fit criteria 3 and 4.

Participant 1‘s mother (WBSinv-1 carrier), maternal grandmother (WBSinv-1 carrier), maternal

grandfather (no inversion) and half-sister (WBSinv-1 carrier) all had full-scale IQ scores in the

average range and none fit the WSCP. Participant 2 did not fit the WSCP because her DAS T

scores did not fit criteria 1 and 3. Participant 2‘s mother, father and sister all had IQ scores in the

average range and none fit the WSCP.

75

Table 2.8. Standard Scores on Intellectual and Adaptive Behavior Assessments for

Participants 1 and 2 and for Adolescents and Young Adults with Williams-Beuren

Syndrome

Test Population

Mean ± SD

WBS

Mean ± SD

Participant

1

Participant

2

WASI

Verbal IQ 100 ± 15 71.9 ± 13.2 64 55

Performance IQ 100 ± 15 67.5 ± 12.7 61 58

Full-scale IQ 100 ± 15 67.6 ± 12.7 59 53

DAS

Pattern construction 50 ± 10 23.2 ± 5.3 26 21

Definitions 50 ± 10 29.7 ± 8.8 29 20

Similarities 50 ± 10 30.1 ± 10.8 35 20

Digit Recall 50 ± 10 34.6 ± 10.2 22 26

Mean T (six core subtests) 50 ± 10 28.3 ± 6.3 25.5 20.2

SIB-R

Adaptive Behavior:

Motor skills 100 ± 15 48.8 ± 13.1 48 27

Social interaction and

communication skills

100 ± 15 70.6 ± 11.5 64 56

Personal living skills 100 ± 15 59.2 ± 11.7 69 38

Community living skills 100 ± 15 47.4 ± 14.2 57 16

Broad independence 100 ± 15 47.3 ± 11.5 52 23

Maladaptive Behavior:

Internalized

0 ± 10

-8.9 ± 8.6

-17

-3

Asocial 0 ± 10 -9.2 ± 10.8 4 2

Externalized 0 ± 10 0.3 ± 6.4 1 3

General 0 ± 10 -9.3 ± 6.9 -6 -1

76

2.6.3: Inversion testing using three-colour interphase FISH:

The inversions present in Participants 1 and 2 had been identified previously (Osborne et

al., 2001). To further characterize the possible origins of the rearrangement, additional members

of each patient‘s family were analysed using FISH (Figure 2.6). In Participant 1‘s family, seven

other family members were tested using three-colour interphase FISH. The WBSinv-1 was found

to be present in Participant 1‘s mother, half-sister, grandmother, and one great-aunt while no

WBSInv-1 was found in Participant 1‘s aunt, grandfather and one great-aunt. In Participant 2‘s

family, three other family members were available for testing using three-color interphase FISH.

The Participant‘s mother, father and sister were all negative for the 7q11.23 inversion.

2.6.4: INV expression analysis:

It was determined in a group of individuals with the common WBS deletion (n=5) that

levels of expression of eight genes within the WBS region showed a reduction in expression of

55 to 90% (Table 2.9). In addition, the expression of 3 genes found outside the commonly

deleted WBS region were also shown to be reduced from 40 to 70% and the expression of one

gene (WBSCR16) was determined to be increased by 60% in WBS individuals.

78

Table 2.9. Expression Analysis of Genes from the WBS Region in Individuals who have

WBS or Individuals in the General Population who have WBSinv-1

Chromosome

position Gene

Comparative Expression Ratio

(vs. control group n=8) Mean ± SEM

Individuals

with WBS

(n=5)

Individuals

with

WBSinv-1

(n=8)

Atypical

WBS

Participant 1

Atypical

WBS

Participant 2

6.5 Mb cen ASL 0.606 ± 0.043# 1.29 ± 0.089* 1.13 ± 0.261 1.23 ± 0.365

6 Mb cen KCTD7 0.561 ± 0.073# 1.06 ± 0.064 1.05 ± 0.072 0.871 ± 0.231

WB

Sin

v-1

reg

ion

WB

S c

om

mon d

elet

ion r

egio

n

BAZ1B 0.101 ± 0.011# 0.877 ± 0.049 0.876 ± 0.363 0.855 ± 0.314

WBSCR18 0.291 ± 0.045# 1.16 ± 0.093 1.185 ± 0.108 1.12 ± 0.110

STX1A 0.244 ± 0.031# 1.18 ± 0.075* 0.792 ± 0.231 0.903 ± 0.096

LIMK1 0.320 ± 0.040# 1.08 ± 0.041 1.07 ± 0.317 0.873 ± 0.325

WBSCR1 0.450 ± 0.035# 1.05 ± 0.050 1.11 ± 0.0460 0.994 ± 0.096

RFC2 0.324 ± 0.027# 0.947 ± 0.046 1.18 ± 0.234 0.904 ± 0.060

CYLN2 0.371 ± 0.028# 0.993 ± 0.041 1.28 ± 0.193 1.03 ± 0.304

GTF2I 0.245 ± 0.030# 1.17 ± 0.088 1.28 ± 0.167 0.936 ± 0.317

WBSCR16 0.991 ± 0.121 1.21 ± 0.075* 1.12 ± 0.166 0.923 ± 0.314

Next gene tel HIP1 0.714 ± 0.108 1.18 ± 0.209 1.14 ± 0.163 0.797 ± 0.225

1 Mb tel POR 0.311 ± 0.022 # 1.19 ± 0.075 1.24 ± 0.441 0.783 ± 0.225

1.2 Mb tel MDH2 1.26 ± 0.139 1.08 ± 0.116 0.985 ±0.278 0.878±0.192

T-test, * P<0.05, #P<0.001

In contrast, expression analysis revealed no significant difference in expression between

control individuals without a WBSinv-1 chromosome (n=8), or a group of individuals carrying a

WBSinv-1 chromosome with no clinical symptoms (n=8) for all but one selected gene from

79

within the common WBS deletion region (Table 2.9). The exception was STX1A whose

expression was increased by 19%. Although statistically significant, the increase was small and

not consistent with the decrease in expression of STX1A found in individuals with WBS.

Further, an individual identified who was homozygous for the WBSinv-1 chromosome also

showed similar levels of gene expression to the control group, although it was not possible to

perform statistical analysis since it was a single sample.

2.6.5: Copy number variation analysis:

The CNV analysis for Participant 1 identified the presence of three previously

characterized CNVs on chromosomes 9p24, 9p21 and 22q11.1, as well as a novel duplication at

22q11.22 spanning the region between 19,428,100 Mb and 20,742,400 Mb (1.3 Mb) according to

the human reference sequence (NCBI Build 36) (Table 2.10). The novel 22q11.22 duplication

partially overlapped three known CNVs, but also included a unique 380 kb duplicated region

spanning three known genes (DUP1) and a 248 kb duplicated region spanning five known genes

(Dup2) (Figure 2.7). The two novel 22q11.22 duplicated regions identified in Participant 1 were

confirmed using real-time PCR with primer pairs generated for genes unique for each duplicated

region; SERPIND1 and YPEL1 respectively.

80

Table 2.10. Copy Number Variant Analysis of Participants 1 and 2

Participant Cytogenetic

band

Size of

CNV

(bp)

Type Present in

Database of

Genomic

Variants

Unique gene copy

number alteration

1

9q24.3 55,124 Gain Yes -

9p21.1 172,600 Loss Yes -

22q11.1 140,300 Gain Yes -

22q11.22

1,314,300

Gain

Partial

overlap

SERPIND1, SNAP29,

CRKL, AIFM3, LZTR1,

SDF211, PPIL2, YPEL1

2 7p14.3 182,000 Gain Yes -

17q21.3 631,100 Gain Yes -

It was determined that three copies of both genes were present in Participant 1 with

genomic ratios of 1.564 (± 0.167) and 1.461 (± 0.156) for SERPIND1 and YPEL1 respectively.

Although her father‘s DNA was not available for analysis, real-time PCR was used to determine

that the identified CNV was not present in DNA from Participant 1‘s mother. Participant 1 also

exhibits ectrodactyly resulting from a previously identified 24MB inversion disrupting the

7q21.3 region that has been associated with split hand/foot malformation (SHFM) (Scherer et al.,

1994). The results of CNV analysis for Participant 2 identified the presence of two previously

characterized CNVs on chromosomes 7p14.3 and 17q21. No other changes in copy number were

identified.

81

2.7: Results: Identification of MAGI2 Deletions and its Association with IS.


Marshall CR*, Young EJ*, Pani AM, Freckmann M-L, Lacassie Y, Howald C, Fitzgerald K,

Peippo M, Morris CA, Shane K, Priolo M, Morimoto M, Kondo I, Manguoglu E, Berker-

Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P, Tassabehji

M, Gregg RG, Scherer SW, Osborne LR. (2008) Infantile Spasms Is Associated with Deletion of

82

the MAGI2 Gene on Chromosome 7q11.23-q21.11. American Journal of Human Genetics.

(2008) 83:106-111. Figures reprinted with premission

*Authors contributed equally to this work

Deletions were identified and characterized by CNV and qPCR analysis by Dr. Christian

Marshall (Dr. Stephen Scherer‘s lab) and myself, respectively. All other authors contributed

clinical samples.

From the Chromosome 7 Annotation Project clinical database as well as 16 cases

previously identified in the literature (Ferland et al., 2006; Stock et al., 2003: Mizugishi et al.,

1998; Morimoto et al., 2003: Wu et al., 1999; DeBerardinis et al., 2003; Tzschach et al., 2007;

Courtens et al., 2005; Edelmann et al., 2007; Manguoglu et al., 2005; McElveen et al., 1995) we

identified deletions of 7q11.23-q21.1 ranging from 1.8 Mb to more than 20 Mb in size (Figure

2.8 and Table 2.11). For all cases a seizure history was determined and genotype-phenotype

correlation was made on the basis of the presence or absence of IS or other forms of seizure

activity. From these cases a region of overlap, approximately 700 kb in length was identified

associated with IS, spanning part of the 1.4 Mb membrane-associated guanylate kinase inverted-

2 gene (MAGI2).

It was determined that only one of 14 individuals identified with a chromosome 7

deletion and IS was not deleted for all or part of MAGI2 (Participant #10, Table 2.11/Figure 2.8).

In addition, only one of 11 individuals missing any part of MAGI2 was without a history of

seizure activity (Participant #26). To date, there are no known CNVs that span exons of MAGI2

(Iafrate et al., 2004), further supporting the hypothesis that hemizygosity of MAGI2 results in a

phenotypic effect.

84

Table 2.11. Summary of Clinical Features in Participants with Deletions of Chromosome

7q11.23-q21.1

Case Gender

Deletion

Size

(Mb)

Breakpoint

Mapping Clinical Description Ref.

1 1M 3.4 Array/QPCR WBS with severe hypercalcemia TS

2,3,4 2M, 1F 2.4 FISH WBS with moderate MR (ref 1 cases 15481, 18393, 18317)

1

5 F 4.2 Array WBS with severe MR (ref 1 case 23162) 1/TS

6 M 4.2 Array WBS with severe MR TS

7 F 4.3 QPCR WBS with severe MR (ref 1 case 29948) 1/TS

8 F 4.2 Array WBS with periventricular heterotopia, severe MR, non-verbal

2/TS

9 F 2.4-2.8 QPCR

WBS cognitive-behavioral profile with

moderate MR and autism spectrum disorder

3

10 M 4.4 Array/QPCR

WBS with IS (variation from

hypsarrhythmia), severe developmental

delay

4/TS

11 F 6.7 QPCR

WBS with IS (hypsarrhythmia) at 4

months and severe global developmental

delay

TS

12 M 5.5 QPCR WBS with severe delays, IS, myoclonic and tonic seizures

TS

13 M 11-12.5 QPCR

WBS with IS, hypotonia, severe PMD,

non-verbal, Wolff-Parkinson-White

syndrome

TS

14 F 10 QPCR WBS with IS, hypoglycemia,

contractures, severe PMD TS

15 M 8.3 Array/QPCR WBS with IS, focal seizures at 5 months,

severe MR TS

16 M 11 Array WBS with IS, severe MR (ref 5 case

020495) 1/TS

17 M 17 Array/QPCR WBS with IS (hypsarrhythmia) at 2

months and severely retarded PMD 5/TS

18 M 19.6 Array/QPCR WBS with EEG abnormalities, severe

PMD, marked hypotonia TS

19 F >9 MMA WBS with petit mal seizures, macrocephaly, severe MR and minimal

speech

6

20 M 17 Array/QPCR WBS with IS, minimal development and

blindness TS

21 M 26 QPCR

IS, childhood epilepsy, optic nerve

hypoplasia, cerebral palsy, severe MR,

non-verbal

TS

22 F 11.5 Array/QPCR Myoclonus epilepsy, developmental delay, non-verbal

TS

23 F 16 MMA IS, PMD and dysmorphism 7

24 F 15-20 MMA Seizure disorder age 7 years, non-verbal TS

85

Case Gender

Deletion

Size

(Mb)

Breakpoint

Mapping Clinical Description Ref.

25 F 19 Array/QPCR IS, severe MR, microcephaly, scoliosis,

dysmorphism and ectrodactyly 8/TS

26 F 3 Array/QPCR Growth retardation, MR, clinodactyly, mild spasticity, hypersensitivity to noise

9/TS

27 F 16 Array Growth retardation, severe MR,

micorcephaly, complete hearing loss 10

28 M 12-14 FISH Microcephaly, short stature, myoclonus-dystonia syndrome (e-sarcoglycan

deletion), developmental delay

11

WBS, Williams-Beuren syndrome; MR, mental retardation; PMD, psychomotor delay; IS, infantile spasm; ns, not

specified; M, male; F, female; Array, Affymetric® Human Mapping 500K of Genome-Wide Human SNP arrays;

FISH, fluorescent in situ hybridization; QPCR, quantitative real-time polymerase chain reaction, MMA,

microsatellite marker analysis. Shaded rows indicate a diagnosis of infantile spasm or other seizure disorder.

References: TS, This study; 1 - Stock et al., 2003; 2 – Ferland et al., 2006; 3 – Edelmann et al., 2007; 4 – Morimoto

et al., 2003; 5 – Mizugishi et al., 1998; 6 – Wu et al., 1999; 7 – Courtens et al., 2005; 8 – McElveen et al., 1995; 9 – Manguoglu et al., 2005; 10 – Tzschach et al., 2007; 11 – DeBeradinis et al., 2003.

Since all the reported IS individuals possessed deletions spanning multiple genes, it could

be suggested that the resulting IS phenotype may be the consequence of the deletion of two or

more genes, or may result from a position effect mediated by the loss of the large segment of

chromosomal DNA. The variable deletion sizes and the chromosomal location of the

overlapping deletions however do not support these hypotheses. There are deletions that extend

both telomerically and centromerically from the MAGI2 locus, there are several deletions where

the telomeric or centromeric breakpoints are found within MAGI2, thereby resulting in deletions

of completely different sets of genes (Figure 2.8, Cases 11 & 12 vs. Cases 22-24). This makes a

two or more-gene hypothesis extremely unlikely. Additionally, since there are individuals with

large deletions outside the critical interval, but no seizures (Figure 2.8, Cases 1-9 and 25 & 26) a

position effect on surrounding genes caused by the deletion itself also seems an unlikely

explanation for IS,

86

There was identified however, a single previously published case of WBS including well

documented IS where the individual possessed a deletion that did not span any part of MAGI2

(Figure 2.8, Case 10) (Morimoto et al., 2003). However, since it has been shown that IS can be

attributed to many underlying causes, it remains possible that the IS in this individual is

unrelated to their chromosome 7 deletion. There was also identified, a single case that possessed

a deletion that removed part of MAGI2, where no IS was documented (Figure 2.8, Case 26)

(Manguoglu et al., 2005). This individual possesses a small de novo deletion and was referred for

genetic testing because of non-specific mental retardation at the age of 10.5 years. Although

there has been no documented seizure activity in this individual since the age of 10.5 years, their

early clinical history was not available, therefore the possibility that they may have had earlier

episodes of epilepsy or IS in cannot be excluded.

2.8: Conclusion and Discussion:

2.8.1: Severe expressive language delay related to duplication of the Williams–Beuren

region:

It is believed that as much as 5-10% of the human genome has been duplicated within the

past 40 million years and that these segmental duplications may have played a vital role in the

evolution of the human genome (Eichler, 2001). Evolutionarily, these segmental duplications

arose during primate speciation and are major mechanisms contributing to non-pathogenic

structural variation in the human genome (Stankiewicz and Lupski, 2002). However, when

duplicated segments are separated by stretches of transcriptionally active genomic DNA they can

87

create instability generating inversions, deletions and duplications of the intervening sequences

that can result in the gene copy alterations of dosage sensitive genes and lead to disease.

The presence of segmental duplications flanking the WBS regions in humans increases

the likelihood that the region will undergo non-allelic homologous recombination (NAHR)

resulting in genomic rearrangements including inversions, deletions and duplications.

Reciprocal recombination products have been identified for several NAHR hotspots including:

duplication of the 17p11.2, 22q11.2, 15q11.2q13 regions commonly deleted in Smith-Magenis

syndrome, DiGeorge/velocardiofacial syndrome and Prader-Willi/Angelman syndrome

respectively (Bi et al., 2003; Ensenauer et al., 2003; Bolton et al., 2001). Interestingly, the low

number of individuals possessing genomic rearrangements often makes the ascertainment of the

underlying mechanism difficult. Although it is generally believed that duplications arise by a

similar mechanism to the corresponding deletions, an exception to this rule appeared initially to

be genomic rearrangements involving the 17p11.2-p12 region responsible for Charcot-Marie

Tooth type 1A and HNPP. It was reported by Lopes et al., (1997) that duplication of 17p11.2-

p12 resulting in CMT1A were predominantly paternal in origin and arise by inter-chromosomal

rearrangements while the deletion responsible for HNPP were predominantly maternal and arise

through intra-chromosomal rearrangements. It has since been shown that in fact almost all of the

de novo deletions and duplications are paternal in origin and that the first study was somewhat

skewed by the inclusion of familial cases (Borecole et al., 1999)

Although inversions and deletions of WBS region have been previously characterized,

only recently has the reciprocal duplication been identified (Somerville et al., 2005). There are

several hypotheses as to why the duplication would be under diagnosed. Mechanistically, the

deletions can be generated by recombination between duplicated sequences (paralogs) in one of

88

three ways: intra-chromatidal, intra-chromosomal or inter-chromosomal recombination by non-

allelic homologous recombination whereas duplications are generated as the reciprocal product

of only intra-chromosomal and inter-chromosomal recombination. It has been demonstrated that

intra-chromatidal recombination is the dominant mechanism in NAHR and therefore deletions

would occur at greater frequency (Turner et al., 2008) although they did not study men with

inversions, where one would assume the dominant mechanism would be inter-chromosomal

NAHR since the inversion is so common in WBS parents. Phenotypically, it was also proposed

that the duplication of the 7q11.23 region resulted in embryonic lethality, no phenotypic

consequence or a clinical presentation that did not overlap that of WBS and therefore was not

present within the WBS study populations. Ultimately it was a combination of the latter two

hypotheses that were correct.

The phenotype associated with duplication of 7q11.23 includes severe language deficits,

developmental delay and a subtle but identifiable facial dysmorphism. There have been

documented reports of individuals with larger duplications of the region resulting from

supernumerary ring chromosome 7 that have noted expressive language delay or impairment

accompanied by articulation problems, but none of the reports contained standardized assessment

results or specifically compared expressive and receptive language. In addition, karyotypes were

derived from G-banding and not from higher resolution molecular analysis, so the extent of the

duplication was unknown (see Lichtenbelt et al., 2005 for review of cases).

This study is the first case report of a novel syndrome caused by reciprocal duplication of

the commonly deleted WBS region, dup7q11.23. Interestingly, the intellectual strengths and

weaknesses observed in the individual possessing dup7q11.23 (KP) are in direct contrast to those

of children with WBS. In particular, for children with WBS, expressive language is a relative

89

strength (Mervis and Klein-Tasman, 2000) whereas expressive language, especially syntax and

phonology, was the area of greatest weakness for KP. Initially it was argued that WBS was

characterized by ―intact‖ language despite severe mental retardation (Bellugi et al., 1988).

However most investigators studying WBS do not believe language ability in WBS to be

independent of cognitive ability. It is thought that language acquisition and early speech

perception abilities are delayed in WBS with age of acquisition of 100 words below the 5th

percentile (Mervis and Becerra, 2007; Mervis and Robinson, 2000). At 18 months children with

WBS often express only immature babble patterns, however, individuals with WBS appear to

outgrow problems with articulation by early school years (Velleman et al., 2006). By age 4,

children with WBS usually have a more advanced vocabulary, grammar, verbal memory, and

non-verbal abilities (Mervis and Becerra, 2007) and by late childhood they speak in complete

sentences with correct grammar. It has been shown that WBS adults have advanced receptive

concrete vocabulary for such things as objects, actions and description, but receptive

conceptual/relational vocabulary involving spatial, temporal and quantitative terms is weaker

(Mervis, 2006), as is their level of visuo-spatial construction ability. (Osborne and Mervis, 2007;

Mervis and Becerra, 2007). In contrast, KP often communicated by vocalization, gesture,

pantomimes and drawing and only rarely produced word combination. KP was able to correctly

pronounce only few words correctly and his scores on tests for expressive language were in the

severe impairment range although he scored in the low to average range on receptive and non-

language tasks.

It has been well documented that visuo-spatial construction (including drawing) is

severely deficient in WBS children of the same age as KP, with most only able to draw a small

number of identifiable objects (Bertrand et al., 1997). In contrast to this, KP displayed strong

90

drawing ability and when he encountered difficulty communicating, he frequently resorted to

drawing what he was trying to express. However, unlike individuals with WBS, KP had

appropriate social interaction skills and lacked the dis-inhibition and increased sociability

associated with WBS. KP had a diagnosis of ADHD, which is also seen in WBS, but his sister

who did not carry dup7q11.23 was also receiving medication for ADHD and both their parents

were reported to have sufferance from attention problems, making it unlikely that the ADHD

was the result on alteration of expression of genes found within the duplicated region.

Following this preliminary work, several subsequent reports have been published that

provided further evidence for the role of the 7q11.23 duplication in the initially observed

phenotype (Kriek et al., 2006; Kirchhoff et al., 2007; Depeienne et al., 2007; Berg et al., 2007;

Torniero et al., 2007; Van der Aa et al., 2009). To date, although it was not always the basis for

ascertainment, all individuals possessing the dup7q11.23 have been diagnosed with speech delay

with more than half displaying severe language impairment. The vast majority also has some

form of developmental delay. Moderate to severe mental retardation is present only in about one

third of individuals with most displaying normal to mild mental retardation. Neurologically, two

thirds of those for which MRI analysis has been performed showed some form of brain

abnormalities including mild reduction in brain volume, simplified gyral pattern and increased

cortical thickness, although no specific defect in consistently found (Berg et al., 2007; Torniero

et al., 2007). In addition, a varying degree of autism has also been described in about one third

of individuals (Kirchhoff et al., 2007; Depeienne et al., 2007).

There appears to be a subtle, but recognizable facial phenotype that is shared by both

individuals with dup7q11.23 and previously reported individuals with supernumerary ring

chromosome 7, consisting of a high broad nose, posteriorly rotated ears, high arched palate and

91

short philtrum, thin upper lip, deep set eyes and prominent forehead (Tan-Sindhunata et al.,

2000; Chantot-Bastaraud et al., 2004; Lichtenbelt et al., 2005; Somerville et al., 2005; Van der

Aa et al., 2009).

Interestingly, one patient reported by Berg et al., (2007) had larger 3.55 Mb duplication

that shared the common proximal breakpoint but had a unique distal breakpoint. However, the

individual did not display a more severe phenotype. Although only preliminary, given that it is a

single case, this is in contrast to what is observed for similar deletions extending telomerically

from the commonly deleted WBS region. Deletions of genes distal the common WBS deletion

region are associated with a more severe phenotypic expression including severe cognitive

impairment (Ferland et al., 2006; Stock et al., 2003) and infantile spasms (Mizugishi et al., 1998;

Morimoto et al., 2003; Wu et al., 1999; Marshall et al., 2008) The more severe phenotype is

likely the result of the loss of additional dosage sensitive genes telomeric to the WBS region,

including MAGI2. It therefore appears likely that the loss of and therefore decrease in expression

of these distal genes are of greater consequence than the over expression of these genes due to

duplication.

Although the number of dup7q11.23 individuals identified is still low, a high degree of

parent to child transmission has been observed (Kriek et al., 2006; Berg et al., 2007). Unlike the

rarely reported parental transmission of WBS (Morris et al., 1993; Sadler et al., 1993; Ounap et

al., 1998), the dup7q11.23 in the identified individuals were inherited from seemingly unaffected

parents. In one report, the individual had inherited the reciprocal duplication of the common

WBS deletion from his father who presented only with a complete cutaneous III-IV syndactyly

of the hand, a condition absent in the proband but present in both of the paternal grandparents

(Kriek et al., 2006). Two individuals identified by Berg et al., (2007) had inherited the

92

duplication from their phenotypically unaffected parents. From this it has been postulated that

the phenotype may have variable penetrance, or that in some cases, one may outgrow childhood

disability (Berg et al., 2007). It was noted that in the case of one patient (patient 3) dramatic

improvement was seen in her language ability between the age of 4.5 and 5 years of age,

coincident with the treatment of her severe anxiety with the anxiolytic drug fluoxetine. This

patient had also received extensive intervention that may have resulted in her higher language

skill, raising the intriguing possibility that with the correct management many may outgrow their

childhood speech impairments.

Further evidence to support the hypothesis that increased expression of genes at 7q11.23

is responsible for the observed phenotype comes from the recently identified rare triplication of

the 7q11.23 region. Beunders et al., (2009) describe a 3-year-old boy with mental deficits and

behavioral problems that appear to be at the severe end of the spectrum seen in patients with

dup7q11.23. It was determined that he had not inherited the genomic rearrangement from either

of his parents. Upon examination, he was extremely anxious and displayed no expressive and

very little receptive language ability. He was also severely delayed in the acquisition of motor

milestones. He was unable to sit upright until 9 months of age and was not fully ambulatory

until 20 months. In addition he was extremely aggressive with destructive, self-mutilating

behavior. An array-CGH revealed that the triplicated region consisted on a 1.25 Mb region

sharing a similar distal breakpoint with the WBS commonly deleted region. Interesting, the

proximal breakpoint mapped between FZD9 and BAZ1B and so did not include FZD9 and

FKBP6 that are commonly deleted in WBS. Therefore, it is unlikely that these two genes

contribute the associated phenotype of the 7q11.23 duplication. Although rare, other

triplications have been identified including DLP1 (Xq22,), MECP2 (Xq28) as well as tetrasomy

93

3q (3q25.3-29) and all result in a more severe phenotype than is seen in the duplication including

a more severe mental disability (del Gaudio et al., 2006; Ounap et al., 2005; Wolf et al., 2005).

There has been a 22q11.2 triplication reported by Yobb et al., (2005). As with unaffected

members seen possessing the dup7q11.23, this paper also describes phenotypically normal

family members with 22q11 duplication.

These findings specify the expressive language phenotype associated with dup7q11.23

and define the precise region of chromosome 7 contributing to it as the 1.5 Mb interval

commonly deleted in WBS. The contrasting phenotypes of deletion and duplication of 7q11.23

with their accompanying changes in gene expression therefore suggest that genes within this

region may be dosage sensitive, and that either an increase or decrease in expression can have a

dramatic effect on both language development and visuo-spatial ability. The duplication/deletion

encompasses 26-28 genes, most of which can be excluded as major contributors to the WBS

phenotype, based on genotype-phenotype correlation in individuals with atypical deletions. The

identified minimal critical interval that must be deleted in classic WBS spans the region between

elastin and the common distal breakpoint, and encompasses just nine genes (Frangiskakis et al.,

1996; Tassabehji 2003; Hirota et al., 2003; Del Campo et al., 2001) and include members of the

general transcription factor 2 I (GTF2I) gene family; GTF2I and GTF2IRD1. These transcription

factors are predicted to possibly possess some functional redundancy (Hinsley et al., 2004).

Alteration of expression of a single gene in a simple case, or in a complex case of a

combination of GTF2I genes, might lead to a distinctive specific language impairment phenotype

overlapping with that observed in individuals with dup7q11.23. Although it must be considered

that it is possible that the genes responsible for the language impairment in individuals with the

94

duplication may not be the same genes responsible for the cognitive phenotype found in

individuals with deletion of the WBS region.

Another intriguing feature of the duplication of 7q11.23 that is not found in WBS is the

high percentage of parental transmission. Of the 27 patients identified to date it has been

determined that in 11 cases the duplication was inherited from a parent and in three of these

cases, no parental phenotype was noted. A high frequency of familial transmission has also been

observed in the 22q11.2 microduplication, the reciprocal on the deletion resulting in DGS/VCFS

and similarly to the 7q11.23 duplication, the clinical phenotypes seen in these individuals are

highly variable and relatively mild in comparison to those previously reported (Yobb 2005; Ou et

al., 2008).

Although the discovery of the WBS duplication provides the long sought-after reference

case for the existence of the reciprocal duplication of the WBS deletion, further identification of

new individuals with dup7q11.23 will allow for the further definition of the range of speech and

language impairments as well as behavioral abnormalities and associated clinical features. It

remains to be determined whether the duplication may also be present in completely unaffected

individuals or whether the phenotype of individuals with the 7q11.23 duplication can be

mitigated by speech therapy or may possibly be age dependent and therefore individuals may

outgrow their cognitive and language impairments.

2.8.2: The common inversion of 7q11.23 does not cause clinical symptoms:

More than 30 disorders have been identified that result from genomic rearrangement

within segmental duplications (Gimelli et al., 2003). In the majority of disorders, the clinical

95

diagnosis is determined using methods such as Giemsa staining or FISH analysis capable of

detecting only large genomic rearrangements. For example, diagnosis of WBS commonly

includes molecular testing using FISH to identify a hemizygous deletion at 7q11.23 using a

mixture of probes encompassing only the elastin and LIM kinase genes (Vysis Inc., Des Plains,

IL). Although accurate in more than 95% of cases, for the remaining individuals with a clinical

diagnosis of WBS there is no detectable chromosomal rearrangement (Lowery et al., 1995; Mari

et al., 1995; Nickerson et al., 1995). It is possible that these individuals constitute phenocopies of

WBS or have disruption of key genes at 7q11.23 and the underlying genetic variation has yet to

be identified. Individuals with atypical WBS have also been reported who present with some,

but not all, of the diagnostic features of WBS and have been found to carry partial deletions of

the WBS deletion region (Morris, 2006). Intriguingly, atypical WBS has also been reported in

individuals without identifiable deletions or other chromosome rearrangements (Morris, 1998).

These individuals may carry mutations in one or more genes from within or near the region.

Of the eleven atypical WBS patients initially reported by Osborne et al., (2001), it was

determined that three carried an inversion of the WBS region. Two of these individuals (15441-

Participant 1 in this study; 12503-Participant 2 in this study), both females and in their teenage

years, presented with aspects of WBS including a WBS-like facial features (including

strabismus) a WBS-like behavior profile and developmental delay, but no detectable deletion of

7q11.23. It was theorized that an inversion of the WBS region could provide a means by which

expression of genes within the WBS interval could be disrupted without actually being deleted;

either by direct interruption of gene located at the inversion breakpoints (Bondeson et al. 1995;

Lakich et al. 1993; Stankiewicz et al. 2001), or by alteration of gene expression due to re-

location of regulatory elements such as enhancers or repressors (Scherer et al. 1994; Niedermaier

96

et al. 2005). However, since the 7q11.23 inversion is present in a significant fraction (25%-

33%) of WBS parents (Bayés et al., 2003; Osborne et al., 2001; Hobart et al., 2010), as well as

in approximately 7% of the general population (Hobart et al., 2010) it suggests that i) there is a

difference in the inversion breakpoints between WBSinv-1 carriers and these atypical WBS

individuals and that disruption of gene function at these novel breakpoints are responsible for the

resulting atypical WBS phenotype, ii) the inversion is not fully penetrant or iii) that WBSinv-1

may be a polymorphic rearrangement that is not associated with any clinical manifestations

found in the identified atypical WBS individuals.

Evidence for a novel inversion breakpoint included a smaller NotI junction fragment

detected in patient 12503 (500kb) relative to a 600kb NotI junction fragment identified in

phenotypically normal inversion breakpoint carrier controls (Osborne et al., 2001). In the cases

of novel breakpoints and reduced penetrance, the phenotypic expression in the atypical

individuals would likely be a consequence of the same alterations in gene expression resulting

from the haploinsufficiency of dosage sensitive genes located within the commonly deleted

region. Although recent studies have included only fibroblast or transformed lymphoblast cell

lines, the expression of none of the genes; either within the commonly deleted region or genes

outside the commonly deleted region that have been shown to be altered in WBS, were found to

be altered in either of the reported WNSinv-1 containing atypical WBS individuals (Sommerville

et al., 2005; Merla et al., 2006; Tam et al., 2008). In the course of this evaluation, an individual

was also identified who was determined to be homozygous for the WBSinv-1 chromosome and,

although it is difficult to perform statistical evaluation of the expression data from a single

individual, expression of all except one of the genes examined (GTF2I) showed normal levels of

expression, when compared to individuals with normal chromosomes. Although a decrease in

97

GTF2I expression was observed in the homozygous WBSinv-1 individual, this altered

expression may likely be an artifact of the analysis of a single subject since GTF2I expression

was not altered in WBSinv-1 carriers and all other genes tested in the homozygous individual

showed expression levels similar to those of the control group. It is interesting to note that

although the WBSinv-1 homozygous individual was the parent of a child with WBS, the child‘s

deletion was determined to originate in the other parent, who was heterozygous for WBSinv-1.

This is not an unexpected result since based on the proposed mechanism by which WBSinv-1

carriers are at increased risk of producing a child possessing a WBS deletion (disruption of

meiotic pairing), it would be predicted that individuals homozygous for the inversion would

carry the same, low risk as those homozygous for the non-inverted chromosome 7. Although no

in-depth clinical or development assessment of this individual was performed, he did not display

any of the phenotypic characteristic commonly found in WBS. The identification of an

individual homozygous for WBSinv-1, who was of Asian Indian descent, may also raise the

possibility that the frequency of the WBSinv-1 chromosome may vary between different ethnic

populations, resulting in different population risks for having a child with a deletion or

duplication of the WBS region. A clear example of the impact of inversion frequency on a

genomic disorder is demonstrated in Sotos syndrome (OMIM #117550). In the Japanese

population, a common inversion on chromosome 5q35 predisposes to a 1.9 Mb deletion,

resulting in Sotos syndrome (Kurotaki et al. 2003; Visser et al. 2005). However, in non-

Japanese populations, where the presence of the inversion is rare, Sotos syndrome is most often

caused by smaller intragenic deletion or mutations affecting the expression of the NSD1 gene

(Tatton-Brown et al. 2005).

98

The normal expression of genes commonly deleted in WBS suggests it is likely then that

the inversion of the WBS region is a common polymorphism in the general population and is not

associated with any clinical manifestations found in the atypical WBS individuals. Consistent

with this, the common WBSinv-1 breakpoints have been determined to lie within the B-block

segments of the centromeric and telomeric LCRs that are in an inverted orientation with respect

to each other (Bayes et al., 2003). The B blocks contain only pseudogenes of GTF2I and NCF1

along with a copy of GTF2IRD2, a gene only sometimes deleted in WBS and consequently not

likely responsible for the WBS phenotype. Therefore WBSinv-1 is not predicted to directly

interrupt any genes that are commonly deleted in WBS. In addition, because the LCRs have

undergone extensive genomic rearrangement during primate evolution (Antonell et al. 2005), it

is unlikely that key regulatory elements for genes from the WBS deletion region are located

within the LCRs themselves. Even the expression of genes located several Mb away from the

common WBS deletion region who have been shown to be altered in individuals with the WBS

deletion were not altered in the WBSinv-1 group further demonstrated that the inversion of the

WBS region has a negligible position effect on the surrounding chromosome.

Although the initial diagnosis in Participant 1 and 2 were based on their medical records,

further evaluation by Drs. Colleen Morris and Carolyn Mervis, both of whom have had many

years of experience with both WBS patients and children with other developmental disabilities,

were unable to characterize any significant overlap between the clinical presentation in these two

WBSinv-1 carriers and that of individuals with WBS. This emphasizes the importance of

assessment by experienced clinicians and psychologists in cases where a specific diagnosis is

suspected, but an atypical phenotype is observed. Although these individuals are few in numbers,

the development of syndrome-specific matrices for facial features (Hammond et al. 2005),

99

growth parameters (Martin et al. 2007) cognitive or behavioral profiles (Mervis et al. 2000) or

for overall clinical presentation (Sugayama et al. 2007) should help less experienced clinicians

and psychologists make more accurate patient diagnosis.

The two participants initially reported as exhibiting symptoms of WBS, ultimately did

not fit any of the diagnostic criteria for WBS, suggesting that the presence of the WBSinv-1

chromosome and clinical presentation in these patients was coincidental. Therefore, CNV

analysis was used in an attempt to identify other possible chromosome anomalies that might

account for their clinical symptoms. Although no detectable alterations in copy number was

identified in Participant 2, leaving the etiology of her symptoms unknown, CNV analysis of

DNA from Participant 1 revealed a previously unreported duplication spanning a 1.3 Mb

segment within the region that is commonly duplicated in dup(22)(q11.2q11.2) syndrome

(Ensenauer et al. 2003; Yobb et al. 2005). In this patient, most of the identified chromosome

22q11.22 gain overlaps with CNVs previously identified in numerous control samples (Locke et

al. 2006; Simon-Sanchez et al. 2007; Wong et al. 2007), however, it also includes genes not

contained within known CNVs, so this genomic variant cannot be ruled out as contributing to the

phenotypic features seen in Participant 1. It should also be noted that Participant 1 exhibits

ectrodactyly due the presence of a 24 Mb inversion that disrupts the 7q21.3 region previously

associated with split hand/foot malformation (SHFM) (Scherer et al. 1994).

The dup(22)(q11.2q11.2) syndrome has a variable phenotype but there are features that

frequently associated with the common 3 Mb duplication including; velopharyngeal

insufficiency, cleft palate, hearing loss, cognitive deficits, motor delay, poor growth and

characteristic dysmorphism (Ensenauer et al. 2003; Yobb et al. 2005; Portnoi et al. 2005). The

pharyngeal malformations have been shown to be linked to duplication of TBX1, given that

100

mouse models containing a hemizygous deletion of Tbx1 causes similar abnormalities (Arnold et

al. 2006). Although phenotypic evaluation demonstrated that Participant 1 did not exhibit all the

typical features commonly associated with individuals possessing the dup(22)(q11.2q11.2), she

was also not duplicated for the region containing TBX1. She did, however, have some features

commonly associated with dup(22)(q11.2q11.2), including; bilateral mixed hearing loss,

cognitive deficits, mild motor delay, down-slanted palpebral fissures, strabismus and radioulnar

synostosis, although this last abnormality has also been associated with SHFM l (Debeer, et al.

2004). This finding provides evidence that the previously characterized dup(22)(q11.2q11.2)

syndrome is a contiguous gene duplication disorder and that gene(s) contributing to the common

features seen in Participant 1 and in dup(22)(q11.2q11.2) are contained within the 1.3 Mb

duplicated segment identified in Participant 1.

Although the inversion of the WBS region itself may be non-pathogenic it has been

clearly demonstrated that the presence of the inversion may predispose the region to an increased

frequency of chromosomal rearrangement including deletions and duplications (Osborne et al.,

2001; Bayés et al., 2003). In addition to this previously identified inversion polymorphism it has

been recently demonstrated using site-specific nucleotide and indel-type paralogous sequence

variants (PSVs) that submicroscopic CNVs enriched within the LCRs surrounding the WBS

region exists as low-frequency polymorphic variants in the general population, and that in some

cases the existence of the CNVs result from inversions within the LCR region. (Cusco et al.,

2008). The prevalence of these CNVs were found to be higher in WBS-transmitting progenitors

(4.44% for deletions and 2.22% for duplication versus approximately 1% in control and non-

transmitting progenitors) indicating that these CNVs, as with the 2Mb paracentric inversion

WNSinv-1 present in 25%-33% of WBS-transmitting progenitors, may also be susceptibility

101

factors for WBS and dup7q11.23 disorders. Deletion and duplications resulting from

recombination between the directly-oriented Cc and Cm blocks (WBS-CNV1) have been

identified as well as deletion and duplications of resulting from recombination within the medial

the telomeric B blocks (WBS-CNV2). Since the medial and telomeric B blocks in the inverted

orientations with respect to one another, deletion and duplication could have arisen after

inversion of intervening sequence. Interestingly, it was determined that the deletion breakpoint

resulting from the recombination within the centromeric and medial C blocks (WBS-CNV1 Del)

was mapped to between exons 11 and 16 of the POM121 gene in all identified cases and that the

resulting deletion would disrupt the coding POM121 and TRIM74 genes found in the

centromeric C Block.

With the recent emergence of comparative genomic hybridization and SNP array analysis

as tools for the global analysis of copy number across the entire genome, an astonishing number

of variants present in the normal population, many of which alter gene copy number and

expression have been identified (Feuk et al. 2006). Recently, SNP arrays have been used to

identify novel CNVs associated with syndromic disorders including developmental delay,

learning disability and autism (Koolen et al. 2006; Shaw-Smith et al. 2006; Sebat et al. 2007;

Autism Genome Project Consortium et al., 2007). It is likely than that in the future a more

―bottom-up‖ approach may be used to identify CNVs present in patient genomes that may be

contributing to their phenotypic presentation, rather than attributing symptoms to already

identified variants; an approach particularly valuable when diagnosing individuals with atypical

presentations of rare syndromes.

102

2.8.3: Infantile spasms (IS) is associated with deletion of MAGI2:

Infantile spasms (IS) was first described by W.J. West regarding his own son in a letter

to the editor of the journal Lancet in 1841, however little progress has been made since toward

understanding the etiology of the disease. The identification of a new locus for IS opens up new

avenues of research that will lead to an understanding of the pathophysiology of this catastrophic

epilepsy. Even though one half of IS cases are associated with some form of generalized brain

disturbance or injury (referred to as symptomatic) the remaining 50% have no known brain

malformation or neurological injury; these cases are referred to as idiopathic or cryptogenic

(Cowan, 2002). Although IS and West syndrome are often considered to be synonymous, many

reserve ―West syndrome‖ to identify children with age-dependent epileptic encephalopathy who

appear to be unaffected prior to the onset of spasms and for whom the etiology could not be

identified (Shields, 2002).

The identification of this new locus associated with IS has implications for the clinical

management of individuals with WBS and large deletions of 7q11.23-q21.1. Their long-term

prognosis is also complicated by the presence of IS which may further impact upon their

neurological development. In a Finnish study of individuals with IS, of the 214 patients

followed for up to 35 years, one third of the patients died before 35 years of age with 1/3 of these

dying within first three years of life (Rilkonen, 2003). Early pharmacological treatment is

important although often not always effective. Treatment with common anticonvulsant

medications such as pyridoxine and valporate are often unsuccessful at diminishing seizure

activities. Treatment with corticotropin (ACTH) has been reported as effective in 70% of

patients but there are serious adverse side-effects/safety issues associated with its use (Shields,

2002). A longitudinal study of treatment outcomes in these individuals to determine the extent

103

and severity of their developmental impairment and will help to establish some prognostic

guidelines for other families of newly diagnosed children with WBS and large deletions.

MAGI2 (also known as S-SCAM, synaptic scaffolding molecule) was originally

characterized as a scaffold protein interacting with N-methyl-D-aspartic acid (NMDA) receptors

at excitatory synapses (Hirao et al., 1998) but has since been shown to interact with many

different proteins pre- and post-synaptically at synapses in both excitatory and inhibitory neurons

(Deng et al., 2006). The protein contains a guanylate kinase domain, two WW domains for

protein: protein interactions (Bork and Sudol, 1994) and five PDZ domains needed to anchor

transmembrane proteins to the cytoskeleton and hold together signaling complexes (Figure 2.9)

(Ranganathan and Ross, 1997). At least two protein isoforms are known to exist in humans, with

the largest (α isoform) with an additional N-terminal PDZ domain, and a β and γ isoform (in

mice), originating from alternative translation start sites (Hirao et al., 2000). MAGI2 is known to

interact with neuroligin 2 and β-dystroglycan at inhibitory synapses in rat hippocampus (Iida et

al. 2007) but the most interesting interaction of MAGI2 is that with stargazin (Deng et al., 2006)

the protein determined to be mutated in the stargazer mouse; one of the original and best

characterized mouse models of epilepsy (Noebels et al., 1990). Mice lacking the stargazin

protein express the necessary α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)

subunits, but synapses in the stargazer mice lack functional AMPA receptors due to impaired

AMPA receptor transport through the endoplasmic reticulum and cis-Golgi compartments (Chen,

et al., 2000).

A recent mouse model lacking the longest, α isoform of Magi2 exhibited no obvious

phenotype in the heterozygous state, but although the homozygous mutant mice developed

normally prenatally and were born in the expected Mendelian ratio, they died within 24 hours of

104

birth with cultured neurons displaying altered spine morphology (Iida et al. 2007). It was noted

that the heterozygous mice did not show any ―remarkable abnormalities‖ even after 2 years of

study. It was however demonstrated using western blotting that protein expression of the α

isoform in heterozygous mice was greatly decreased indicating that the expression of MAGI2 is

dosage sensitive. However, the MAGI2 β and γ isoforms were not disrupted in these mice and

were expressed at normal levels and therefore may compensate for the loss of the α isoform. In

105

addition, our lab has shown that the predominant isoform in mouse brain is the beta isoform

(Figure 2.10). Unlike the Magi2 mouse model, all of the individuals presently studied have

deletions that would result in the decreased expression of all three isoforms of MAGI2 (Iida et

al. 2007). MAGI2 is known to interact with multiple proteins and participate in higher order

protein complexes (Hirao et al., 2000), therefore the decrease in expression of all isoforms of

MAGI2 is likely to disrupt multiple signaling pathways. There are more than 100 proteins that

are found within the post-synaptic density, the loss of many of which have been shown to disrupt

th

e proper function of the synapse. It is estimated that etiology of approximately 40% of human

epilepsy involve a genetic component (Annegers et al., 1996), however to date, mutations have

106

only been identified in a small fraction of the known genes, practically all of which are known to

code for ion channels and almost all in families exhibiting rare forms of epilepsy inherited in a

Mendelian fashion (Turnbull et al., 2005).

The association of IS in patients with hemizygosity for the post-synaptic scaffolding

protein MAGI2 provides insight on the genetic etiology of epilepsy and suggests that proteins

that regulate the trafficking, distribution or function of glutamate receptors are attractive

candidates for involvement in human epilepsy. Although the causes of epilepsy are known to be

heterogeneous in nature, the identification of a causative gene associated with at least some

forms of IS should allow the development further genetic mouse models and may eventually lead

to the development and testing of targeted, effective medications for this type of severe epilepsy,

both as an individual entity as well as in children with WBS.

107

2.9: References:

Alberti A, Romano C, Falco M, Calì F, Schinocca P, Galesi O, Spalletta A, Di Benedetto D, and

Fichera M. (2007) 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive

deficits and dysmorphic facial features. Clinical Genetics. 71:177-182.

Annegers JF, Rocca WA, and Hauser WA. (1996) Causes of epilepsy: contributions of the

Rochester epidemiology project. Mayo Clinic Proceedings. 71:570-575.

Antonell A, de Luis O, Domingo-Roura X, and Pérez-Jurado LA (2005) Evolutionary

mechanisms shaping the genomic structure of the Williams-Beuren syndrome

chromosomal region at human 7q11.23. Genome Research. 15:1179-1188.

Arnold JS, Werling U, Braunstein EM, Liao J, Nowotschin S, Edelmann W, Hebert JM, and

Morrow BE. (2006) Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS

malformations. Development. 133:977-987.

Autism Genome Project Consortium, et al. (2007) Mapping autism risk loci using genetic

linkage and chromosomal rearrangements. Nature Genetics. 39:319-28.

Baumer A, Dutly F, Balmer D, Riegel M, Tükel T, Krajewska-Walasek M, and Schinzel AA.

(1998) High level of unequal meiotic crossovers at the origin of the 22q11.2 and 7q11.23

deletions. Human Molecular Genetics. 7:887-894.

Bayés M, Magano LF, Rivera N, Flores R, and Pérez Jurado LA. (2003) Mutational mechanisms

of Williams-Beuren syndrome deletions. American Journal of Human Genetics. 73:131-

151.

Bellugi U, Marks S Bihrle A. and Sabo H. (1988) Dissociation between language and cognitive

functions in Williams syndrome. In Language Development in Exceptional Circumstances

(Bishop, D. and Mogford, K., eds ), pp. 177-189, Churchill Livingstone, London).

Berg AT, Shinnar S, Levy SR, Testa FM, Smith-Rapaport S, Beckerman B, and Ebrahimi N.

(2001) Two-year remission and subsequent relapse in children with newly diagnosed

epilepsy. Epilepsia. 42:1553-1562.

Berg JS, Brunetti-Pierri N, Peters SU, Kang SH, Fong CT, Salamone J, Freedenberg D, Hannig

VL, Prock LA, Miller DT, Raffalli P, Harris DJ, Erickson RP, Cunniff C, Clark GD, Blazo

MA, Peiffer DA, Gunderson KL, Sahoo T, Patel A, Lupski JR, Beaudet AL, and Cheung

SW. (2007) Speech delay and autism spectrum behaviors are frequently associated with

duplication of the 7q11.23 Williams-Beuren syndrome region. Genetics in Medicine.

9:427-441.

Bertrand J, Mervis CB, and Eisenberg JD. (1997) Drawing by children with Williams syndrome:

A developmental perspective. Developmental Neuropsychology. 13:41-67.

108

Beunders G, van de Kamp JM, Veenhoven RM, van Hagen JM, Nieuwint AW, and Sistermans

EA. (2009) A triplication of the Williams Beuren Syndrome region in a patient with mental

retardation, a severe expressive language delay, behavioral problems and dysmorfisms.

Journal Medical Genetics. Sept. 14. [Epub ahead of print]

Bi W, Park SS, Shaw CJ, Withers MA, Patel PI, and Lupski JR. (2003) Reciprocal crossovers

and a positional preference for strand exchange in recombination events resulting in

deletion or duplication of chromosome 17p11.2. American Journal of Human Genetics.

73:1302-1315.

Bishop DV, North T, and Donlan C. (1995) Genetic basis of specific language impairment:

evidence from a twin study. Developmental Medicine and Child Neurology. 37:56-71.

Boerkoel CF, Inoue K, Reiter LT, Warner LE, and Lupski JR. (1999) Molecular mechanisms for

CMT1A duplication and HNPP deletion. Annals of the New York Academy of Science.

883:22-35.

Bolton PF, Dennis NR, Browne CE, Thomas NS, Veltman MW, Thompson RJ, and Jacobs P.

(2001) The phenotypic manifestations of interstitial duplications of proximal 15q with

special reference to the autistic spectrum disorders. American Journal of Human Genetics.

105:675-685.

Bondeson ML, Dahl N, Malmgren H, Kleijer WJ, Tönnesen T, Carlberg BM, and Pettersson U.

(1995) Inversion of the IDS gene resulting from recombination with IDS-related sequences

is a common cause of the Hunter syndrome. Human Molecular Genetics. 4:615-621.

Bork P. and Sudol M. (1994) The WW domain: a signaling site in dystrophin? Trends in

Biochemical Science. 19:531-533.

Bruininks R, Woodcock R, Weatherman R, and Hill B. (1996) Scales of Independent Behavior-

Revised. Itasca, IL: Riverside Publishing,

Castaneda AR, Jonas RA, Mayer JE, Hanley FL, (eds). 1994. Obstruction of the left ventricular

outflow tract. Cardiac surgery of the neonate and infant. Philadelphia: W. B. Saunders.

p.327.

Chantot-Bastaraud S, Muti C, Pipiras E, Routon MC, Roubergue A, Burglen L, Siffroi JP, and

Simon-Bouy B. (2004) Clinical findings and cytogenetic analysis of small supernumerary

ring chromosomes 7: Report of two new cases. Annales de Génétique. 47:241-249.

Chen L, Chetkovich DM, Petralia RS, Sweeney NT, Kawasaki Y, Wenthold RJ, Bredt DS, and

Nicoll RA. (2000) Stargazin regulates synaptic targeting of AMPA receptors by two

distinct mechanisms. Nature. 408:936-943.

Christiansen LR, Lage JM, Wolff DJ, Pai GS, and Harley RA. (2004) Mosaic duplication

1(q11q44) in an infant with nephroblastomatosis and mineralization of extraplacental

membranes. Pediatric and Developmental Pathology. 8:115-123.



109

Conners C. (1997) Conners‘ rating scales-revised. North Tonawanda, NY: Multi-Health

Systems.

Cowan, L.D. (2002) The epidemiology of the epilepsies in children. Mental Retardation and

Developmental Disabilities Research Reviews. 8:171-181.

Courtens W, Vermeulen S, Wuyts W, Messiaen L, Wauters J, Nuytinck L, Peeters N, Storm K,

Speleman F, and Nöthen MM. (2005) An interstitial deletion of chromosome 7 at band

q21: a case report and review. American Journal of Medical Genetics A. 134A:12-23.

Curatolo P. (1996) Neurological manifestations of tuberous sclerosis complex. Child’s Nervous

System. 12:515-521.






Debeer P, Vandenbossche L, de Ravel TJ, Desloovere C, De Smet L, Huysmans C, Thoelen R,

Vermeesch J, Van de Ven WJ, and Fryns JP. (2004) Bilateral complete radioulnar

synostosis associated with ectrodactyly and sensorineural hearing loss: a variant of

SHFM1. Clinical Genetics. 65:153-155.

DeBerardinis RJ, Conforto D, Russell K, Kaplan J, Kollros PR, Zackai EH, and Emanuel BS.

(2003). Myoclonus in a patient with a deletion of the epsilon-sarcoglycan locus on

chromosome 7q21. American Journal of Medical Genetics A 121:31-36.

Del Campo M, Magano LF, Martinez Iglesias J, and Pérez-Jurado LA. (2001) Partial features of

Williams-Beuren syndrome in a family with a novel 700 kb 7q11.23 deletion. European

Journal of Human Genetics. 1(S):C055.

del Gaudio D, Fang P, Scaglia F, Ward PA, Craigen WJ, Glaze DG, Neul JL, Patel A, Lee JA,

Irons M, Berry SA, Pursley AA, Grebe TA, Freedenberg D, Martin RA, Hsich GE, Khera

JR, Friedman NR, Zoghbi HY, Eng CM, Lupski JR, Beaudet AL, Cheung SW, and Roa

BB.(2006) Increased MECP2 gene copy number as the result of genomic duplication in

neurodevelopmentally delayed males. Genetics in Medicine. 8:784-792.

Deng F, Price MG, Davis CF, Mori M, and Burgess DL. (2006) Stargazin and other

transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding

protein MAGI-2 in brain. Journal of Neuroscience. 26:7875-7884.

Depienne C, Heron D, Betancur C, Benyahia B, Trouillard O, Bouteiller D, Verloes A, LeGuern

E, Leboyer M, and Brice A. (2007) Autism, language delay and mental retardation in a

patient with 7q11 duplication. Journal of Medical Genetics. 44:452-458.

110

De Zeeuw CI, Hoogenraad CC, Goedknegt E, Hertzberg E, Neubauer A, Grosveld F, and Galjart

N. (1997) CLIP-115, a novel brain-specific cytoplasmic linker protein, mediates the

localization of dendritic lamellar bodies. Neuron. 19:1187-1199.

Dunn LE, and Dunn LE. Peabody Picture Vocabulary Test. 3rd ed. Circle Pines, MN: American

Guidance Service; 1997.

Edelmann L, Prosnitz A, Pardo S, Bhatt J, Cohen N, Lauriat T, Ouchanov L, González PJ,

Manghi ER, Bondy P, Esquivel M, Monge S, Delgado MF, Splendore A, Francke U,

Burton BK, and McInnes LA. (2007). An atypical deletion of the Williams-Beuren

syndrome interval implicates genes associated with defective visuospatial processing and

autism. Journal of Medical Genetics. 44:136-143.

Eichler EE. (2001) Recent duplication, domain accretion and the dynamic mutation of the human

genome. Trends in Genetics. 17:661-669.

Elliott C. (1990) Differential Ability Scales. San Antonio, TX: Psychological Corporation.

Ensenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, Thorland EC,

Lorentz CP, Goldstein JL, McDonald MT, Smith WE, Simon-Fayard E, Alexander AA,

Kulharya AS, Ketterling RP, Clark RD, and Jalal SM. (2003) Microduplication 22q11.2,

an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients.

American Journal of Human Genetics. 73:1027-1040.

Ferland RJ, Gaitanis JN, Apse K, Tantravahi U, Walsh CA, and Sheen VL. (2006)

Periventricular nodular heterotopia and Williams syndrome. American Journal of Medical

A, 140:1305-1311.

Feuk L, MacDonald JR, Tang T, Carson AR, Li M, Rao G, Khaja R, and Scherer SW. (2005)

Discovery of Human Inversion Polymorphisms by Comparative Analysis of Human and

Chimpanzee DNA Sequence Assemblies. PLoS Genetics. 1:e56.

Feuk L, Marshall CR, Wintle RF, and Scherer SW. (2006) Structural variants: changing the

landscape of chromosomes and design of disease studies. Human Molecular Genetics.

15:R57-R66.

Fisher SE, Lai CS, and Monaco AP. (2003) Deciphering the genetic basis of speech and

language disorders. Annual Review of Neuroscience. 26:57-80


GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg

SJ, and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired

visuospatial constructive cognition. Cell. 86:59-69.

Gibbs F. and Gibbs E, (1952) Atlas of electroencephalography in Epilepsy, volume 2. Gibbs and

Gibbs eds. (Reading MA: Addison-Wesley)

111

Gimelli G, Pujana MA, Patricelli MG, Russo S, Giardino D, Larizza L, Cheung J, Armengol L,

Schinzel A, Estivill X, and Zuffardi O. (2003) Genomic inversions of human chromosome

15q11-q13 in mothers of Angelman syndrome patients with class II (BP2/3) deletions.


Gisselsson D, Höglund M, Mertens F, Johansson B, Dal Cin P, Van den Berghe H, Earnshaw

WC, Mitelman F, and Mandahl N. (1999) The structure and dynamics of ring

chromosomes in human neoplastic and non-neoplastic cells. Human Genetics. 104:315-

325.

Grant J, Valian V, and Karmiloff-Smith A. (2002) A study of relative clauses in Williams

syndrome. Journal of Child Language. 29:403-416.

Hammond P, Hutton TJ, Allanson JE, Buxton B, Campbell LE, Clayton-Smith J, Donnai D,

Karmiloff-Smith A, Metcalfe K, Murphy KC, Patton M, Pober B, Prescott K, Scambler P,

Shaw A, Smith AC, Stevens AF, Temple IK, Hennekam R, and Tassabehji M. (2005)

Discriminating power of localized three-dimensional facial morphology. American Journal

of Human Genetics. 77:999-1010.

Hinsley TA, Cunliffe P, Tipney HJ, Brass A, and Tassabehji M. (2004) Comparison of TFII-I

gene family members deleted in Williams-Beuren syndrome. Protein Science. 13:2588-

2599.

Hirao K, Hata Y, Ide N, Takeuchi M, Irie M, Yao I, Deguchi M, Toyoda A, Sudhof TC, and

Takai Y. (1998) A novel multiple PDZ domain-containing molecule interacting with N-

methyl-D-aspartate receptors and neuronal cell adhesion proteins. Journal of Biological

Chemistry. 273:21105-21110.

Hirao K, Hata Y, Yao I, Deguchi M, Kawabe H, Mizoguchi A, and Takai Y. (2000) Three

isoforms of synaptic scaffolding molecule and their characterization. Multimerization

between the isoforms and their interaction with N-methyl-D-aspartate receptors and

SAP90/PSD-95-associated protein. Journal of Biological Chemistry. 275:2966-2972.


Bellugi U, Korenberg JR. (2003) - Williams syndrome deficits in visual spatial processing

linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in Medicine. 5:311-

321.

Hobart HH, Morris CA, Mervis CB, Pani AM, Kistler DJ, Rios CM, Kimberley KW, Gregg RG,

and Bray-Ward P. (2010) Inversion of the Williams syndrome region is a common

polymorphism found more frequently in parents of children with Williams syndrome.

American Journal of Medical Genetics, Part C. 154:220-228.

Hongou K, Konishi T, Yagi S, Araki K, and Miyawaki T. (1998) Rotavirus encephalitis

mimicking afebrile benign convulsions in infants. Pediatric Neurology. 18:354-357.

Hrachovy RA. (2002) West's syndrome (infantile spasms). Clinical description and diagnosis.

Advancements in Experimental Medicine and Biology. 497:33-50.

112

Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer SW, and Lee C.

(2004) Detection of large-scale variation in the human genome. Nature Genetics. 36:949-

951.

Iida J, Ishizaki H, Okamoto-Tanaka M, Kawata A, Sumita K, Ohgake S, Sato Y, Yorifuji H,

Nukina N, Ohashi K, Mizuno K, Tsutsumi T, Mizoguchi A, Miyoshi J, Takai Y, and Hata

Y. (2007) Synaptic scaffolding molecule alpha is a scaffold to mediate N-methyl-D-

aspartate receptor-dependent RhoA activation in dendrites. Molecular Cell Biology.

27:4388-4405.

Jacobs PA, Browne C, Gregson N, Joyce C, and White H. (1992) Estimates of the frequency of

chromosome abnormalities detectable in unselected newborns using moderate levels of

banding. Journal of Medical Genetics. 29:103-108.

Kahler SG, Adhvaryu SG, Helali N, and Qumsiy MB. (1995) Microscopically visible deletion of

chromosome 7 in a child with features of Williams syndrome. American Journal of Human

Genetics. 57:A117.

Kirchhoff M, Bisgaard AM, Bryndorf T, Gerdes T. (2007) MLPA analysis for a panel of

syndromes with mental retardation reveals imbalances in 5.8% of patients with mental

retardation and dysmorphic features, including duplications of the Sotos syndrome and

Williams-Beuren syndrome regions. European Journal of Medical Genetics. 50:33-42.

Kitchiner D, Jackson M, Walsh K, Peart I, and Arnold R. (1996) Prognosis of supravalve aortic

stenosis in 81 patients in Liverpool. Heart. 75:396–402.

Korf BR, Carrazana E, and Holmes GL. (1993) Patterns of seizures observed in association with

neurofibromatosis 1. Epilepsia 34:616-620.

Koolen DA, Vissers LE, Pfundt R, de Leeuw N, Knight SJ, Regan R, Kooy RF, Reyniers E,

Romano C, Fichera M, Schinzel A, Baumer A, Anderlid BM, Schoumans J, Knoers NV,

van Kessel AG, Sistermans EA, Veltman JA, Brunner HG, de Vries BB. (2006) A new

chromosome 17q21.31 microdeletion syndrome associated with a common inversion

polymorphism. Nature Genetics. 38:999-1001.

Kriek M, White SJ, Szuhai K, Knijnenburg J, van Ommen GJ, den Dunnen JT, and Breuning

MH. (2006) Copy number variation in regions flanked (or unflanked) by duplicons among

patients with developmental delay and/or congenital malformations; detection of reciprocal

and partial Williams-Beuren duplications. European Journal of Human Genetics 14:180–

189.

Kurotaki N, Harada N, Shimokawa O, Miyake N, Kawame H, Uetake K, Makita Y, Kondoh T,

Ogata T, Hasegawa T, Nagai T, Ozaki T, Touyama M, Shenhav R, Ohashi H, Medne L,

Shiihara T, Ohtsu S, Kato Z, Okamoto N, Nishimoto J, Lev D, Miyoshi Y, Ishikiriyama S,

Sonoda T, Sakazume S, Fukushima Y, Kurosawa K, Cheng JF, Yoshiura K, Ohta T,

Kishino T, Niikawa N, and Matsumoto N. (2003) Fifty microdeletions among 112 cases of

Sotos syndrome: low copy repeats possibly mediate the common deletion. Human

Mutation. 22:378-387.

113

Lakich D, Kazazian HH Jr, Antonarakis SE, and Gitschier J. (1993) Inversions disrupting the

factor VIII gene are a common cause of severe haemophilia A. Nature Genetics. 5:236-

241.

Lai CS, Fisher SE, Hurst JA, Vargha-Khadem F, and Monaco AP. (2001) A forkhead-domain

gene is mutated in a severe speech and language disorder. Nature. 413:519-523.

Lewis BA, and Thompson LA. (1992) A study of developmental speech and language disorders

in twins. Journal of Speech and Hearing Research. 35:1086-1094.

Lichtenbelt KD, Hochstenbach R, van Dam WM, Eleveld MJ, Poot M, and Beemer FA. (2005)

Supernumerary ring chromosome 7 mosaicism: Case report, investigation of the gene

content, and delineation of the phenotype. American Journal of Medical Genetics A.

132A:93-100.

Li C. and Wong WH. (2001a) Model-based analysis of oligonucleotide arrays: model validation,

design issues and standard error application. Genome Biology. 2:RESEARCH0032.

Li C. and Wong WH. (2001b) Model-based analysis of oligonucleotide arrays: expression index

computation and outlier detection. Proceedings of the National Academy of Science (USA).

98: 31-6.

Locke DP, Sharp AJ, McCarroll SA, McGrath SD, Newman TL, Cheng Z, Schwartz S,

Albertson DG, Pinkel D, Altshuler DM, and Eichler EE. (2006) Linkage disequilibrium

and heritability of copy-number polymorphisms within duplicated regions of the human

genome. American Journal of Human Genetics. 79:275-290.

Lopes J, Vandenberghe A, Tardieu S, Ionasescu V, Lévy N, Wood N, Tachi N, Bouche P, Latour

P, Brice A, LeGuern E. (1997) Sex-dependent rearrangements resulting in CMT1A and

HNPP. Nature Genetics.17:136-137.

Lowery MC, Morris CA, Ewart A, Brothman LJ, Zhu XL, Leonard CO, Carey JC, Keating M,

and Brothman AR. (1995) Strong correlation of elastin deletions, detected by FISH, with

Williams syndrome: evaluation of 235 patients. American Journal of Human Genetics.

57:49-53.

Lupski JR. (1998) Genomic disorders: structural features of the genome can lead to DNA

rearrangements and human disease traits. Trends in Genetics 14:417-422.

MacDermot KD, Bonora E, Sykes N, Coupe AM, Lai CS, Vernes SC, Vargha-Khadem F,

McKenzie F, Smith RL, Monaco AP, and Fisher SE. (2005) Identification of FOXP2

truncation as a novel cause of developmental speech and language deficits. American

Journal of Human Genetics. 76:1074-1080.

Manguoğlu E, Berker-Karaüzüm S, Baumer A, Mihçi E, Taçoy S, Lüleci G, and Schinzel A.

(2005). A case with de novo interstitial deletion of chromosome 7q21.1-q22. Genetic.

Counselling. 16:155-159.

114

Mari A, Amati F, Mingarelli R, Giannotti A, Sebastio G, Colloridi V, Novelli G, and

Dallapiccola B. (1995) Analysis of the elastin gene in 60 patients with clinical diagnosis of

Williams syndrome. Human Genetics. 96:444-448.

Marshall CR, Young EJ, Pani AM, Freckmann ML, Lacassie Y, Howald C, Fitzgerald KK,


Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P,

Tassabehji M, Gregg RG, Scherer SW, and Osborne LR. (2008) Infantile spasms is

associated with deletion of the MAGI2 gene on chromosome 7q11.23-q21.11. American


Martin ND, Smith WR, Cole TJ, Preece MA. (2007) New height, weight and head circumference

charts for British children with Williams Syndrome. Archives of Diseases in Childhood.

92:598-601.

McDermid HE, Duncan AM, Brasch KR, Holden JJ, Magenis E, Sheehy R, Burn J, Kardon N,

Noel B, Schinzel A, et al.(1986) Characterization of the supernumerary chromosome in cat

eye syndrome. Science 232:464-48.

McElveen C, Carvajal MV, Moscatello D, Towner J, and Lacassie Y. (1995). Ectrodactyly and

proximal/intermediate interstitial deletion 7q. American Journal of Medical Genetics. 56:1-

5.


The Williams syndrome cognitive profile. Brain and Cognition. 44:604-628.

Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: Cognition, personality, and

adaptive behavior. Mental Retardation and Development Disability Research Reviews.

6:148-158.

Mervis CB, and Robinson BF. (2000) Expressive vocabulary ability of toddlers with Williams

syndrome or Down syndrome: a comparison. Developmental Neuropsychology 17:111-

126.

Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: cognition, personality, and

adaptive behavior. Mental Retardation and Development Disability Research Reviews.

6:148-158.


The Williams syndrome cognitive profile. Brain and Cogniton. 44:604-628.

Mervis, C.B. (2006) Language abilities in Williams-Beuren syndrome. In: Williams-Beuren

syndrome: Research, Evaluation, and Treatment (Morris, C.A., Lenhoff, H. and Wang, P.,

eds) pp. 159-206, Johns Hopkins University Press, Baltimore, MD.

Mervis CB, and Becerra AM. (2007) Language and communicative development in Williams

syndrome. Mental Retardation and Development Disability Research Reviews. 13:3-15.

115

Mervis CB, and Morris CA. (2007) Williams syndrome. In: Neurogenetic Developmental

Disorders: Variation of Manifestation in Childhood. (Mazzocco MMM, and Ross JL, eds)

pp. 199-262. MIT Press. Cambridge, MA.

Mizugishi K, Yamanaka K, Kuwajima K, and Kondo I. (1998) Interstitial deletion of

chromosome 7q in a patient with Williams syndrome and infantile spasms. Journal of


Morimoto M, An B, Ogami A, Shin N, Sugino Y, Sawai Y, Usuku T, Tanaka M, Hirai K,

Nishimura A, Hasegawa K, and Sugimoto T. (2003) Infantile spasms in a patient with

Williams syndrome and craniosynostosis. Epilepsia. 44:1459-1462.

Morris CA, Thomas IT, and Greenberg F. (1993) Williams syndrome: autosomal dominant

inheritance. American Journal of Medical Genetics. 47:478-481.

Morris CA. (2005) Williams Syndrome. In: Management of genetic syndromes. 2nd ed. (Cassidy

SB, Allanson JE, eds.) New York: John Wiley & Sons.

Morris CA. (2006) Genotype-phenotype correlations in Williams-Beuren syndrome. In;

Williams-Beuren syndrome. (Morris CA, Lenhoff HM, Wang PP, eds.) Baltimore: Johns

Hopkins University Press.

Nickerson E, Greenberg F, Keating MT, McCaskill C, and Shaffer LG. (1995) Deletions of the

elastin gene at 7q11.23 occur in approximately 90% of patients with Williams syndrome.


Niedermaier M, Schwabe GC, Fees S, Helmrich A, Brieske N, Seemann P, Hecht J, Seitz V,

Stricker S, Leschik G, Schrock E, Selby PB, and Mundlos S. (2005) An inversion

involving the mouse Shh locus results in brachydactyly through dysregulation of Shh

expression. Journal of Clinical Investigation. 115:900-999.

Noebels JL, Qiao X, Bronson RT, Spencer C, and Davisson MT. (1990) Stargazer: a new

neurological mutant on chromosome 15 in the mouse with prolonged cortical seizures.

Epilepsy Research. 7:129-135.

Osborne LR, Li M, Pober B, Chitayat D, Bodurtha J, Mandel A, Costa T, Grebe T, Cox S, Tsui

LC, and Scherer SW. (2001) A 1.5 million-base pair inversion polymorphism in families

with Williams-Beuren syndrome. Nature Genetics. 29:321-325.

Osborne LR, and Mervis CB. (2007) Rearrangements of the Williams-Beuren syndrome locus:

molecular basis and implications for speech and language development. Experimental

Review in Molecular Medicine. 9:1-16.

Ou Z, Berg JS, Yonath H, Enciso VB, Miller DT, Picker J, Lenzi T, Keegan CE, Sutton VR,

Belmont J, Chinault AC, Lupski JR, Cheung SW, Roeder E, and Patel A. (2008)

Microduplications of 22q11.2 are frequently inherited and are associated with variable

phenotypes. Genetics in Medicine 10:267-277.

116

Ounap K, Laidre P, Bartsch O, Rein R, and Lipping-Sitska M. (1998) Familial Williams-Beuren

syndrome. American Journal of Medical Genetics. 80:491-493.

Ounap K, Ilus T, and Bartsch O. (2005) A girl with inverted triplication of chromosome 3q25.3 -

-> q29 and multiple congenital anomalies consistent with 3q duplication syndrome.

American Journal of Medical Genetics A. 134A:434-438.

Palmini A, Andermann F, Olivier A, Tampieri D, Robitaille Y, Andermann E, and Wright G.

(1991) Focal neuronal migration disorders and intractable partial epilepsy: a study of 30

patients. Annals of Neurology. 30:741-749.

Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definit ion



Portnoï MF, Lebas F, Gruchy N, Ardalan A, Biran-Mucignat V, Malan V, Finkel L, Roger G,

Ducrocq S, Gold F, Taillemite JL, and Marlin S. (2005) 22q11.2 duplication syndrome:

two new familial cases with some overlapping features with DiGeorge/velocardiofacial

syndromes. American Journal of Medical Genetics A. 137A:47-51.

Ranganathan R, and Ross EM. (1997) - PDZ domain proteins: scaffolds for signaling complexes.

Current Biology. 7:R770–R773.

Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH,

Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, González JR, Gratacòs M, Huang J,

Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, Mei R, Montgomery L,

Nishimura K, Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, Woodwark C,

Yang F, Zhang J, Zerjal T, Zhang J, Armengol L, Conrad DF, Estivill X, Tyler-Smith C,

Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW, and Hurles ME. (2006) Global

variation in copy number in the human genome. Nature. 444;444-454.

Riikonen R . (2004) Infantile spasms: therapy and outcome. Journal of Child Neurology.

19:401-404.

Sadler LS, Robinson LK, Verdaasdonk KR, and Gingell R. (1993) The Williams syndrome:

evidence for possible autosomal dominant inheritance. American Journal of Medical

Genetics. 47:468-470.

Scherer SW, Poorkaj P, Massa H, Soder S, Allen T, Nunes M, Geshuri D, Wong E, Belloni E,

Little S, et al. (1994) Physical mapping of the split hand/split foot locus on chromosome 7

and implication in syndromic ectrodactyly. Human Molecular Genetics. 3:1345-1354.

Sebat J, Lakshmi B, Malhotra D, Troge J, Lese-Martin C, Walsh T, Yamrom B, Yoon S,

Krasnitz A, Kendall J, Leotta A, Pai D, Zhang R, Lee YH, Hicks J, Spence SJ, Lee AT,

Puura K, Lehtimäki T, Ledbetter D, Gregersen PK, Bregman J, Sutcliffe JS, Jobanputra V,

Chung W, Warburton D, King MC, Skuse D, Geschwind DH, Gilliam TC, Ye K, and

Wigler M. (2007) Strong association of de novo copy number mutations with autism.

Science. 316:445-449.



117

Sharp AJ, Mefford HC, Li K, Baker C, Skinner C, Stevenson RE, Schroer RJ, Novara F, De

Gregori M, Ciccone R, Broomer A, Casuga I, Wang Y, Xiao C, Barbacioru C, Gimelli G,

Bernardina BD, Torniero C, Giorda R, Regan R, Murday V, Mansour S, Fichera M,

Castiglia L, Failla P, Ventura M, Jiang Z, Cooper GM, Knight SJ, Romano C, Zuffardi O,

Chen C, Schwartz CE, and Eichler EE. (2008) A recurrent 15q13.3 microdeletion

syndrome associated with mental retardation and seizures. Nature Genetics. 40:322-328.

Shaw CJ, and Lupski JR. (2004) Implications of human genome architecture for rearrangement-

based disorders: the genomic basis of disease. Human Molecular Genetics. 13:R57-R64

Shaw-Smith C, Pittman AM, Willatt L, Martin H, Rickman L, Gribble S, Curley R, Cumming S,

Dunn C, Kalaitzopoulos D, Porter K, Prigmore E, Krepischi-Santos AC, Varela MC,

Koiffmann CP, Lees AJ, Rosenberg C, Firth HV, de Silva R, and Carter NP. (2006)

Microdeletion encompassing MAPT at chromosome 17q21.3 is associated with

developmental delay and learning disability. Nature Genetics. 38:1032-1037.

Shields WD. (2002) West's syndrome. Journal of Child Neurology. 17:S76-S79.

Sillanpää M, Jalava M, Kaleva O, and Shinnar S. (1998) Long-term prognosis of seizures with

onset in childhood. New England Journal of Medicine. 338:1715-1722.

Simon-Sanchez J, Scholz S, Fung HC, Matarin M, Hernandez D, Gibbs JR, Britton A, de Vrieze

FW, Peckham E, Gwinn-Hardy K, Crawley A, Keen JC, Nash J, Borgaonkar D, Hardy J,

and Singleton A. (2007) Genome-wide SNP assay reveals structural genomic variation,

extended homozygosity and cell-line induced alterations in normal individuals. Human

Molecular Genetics. 16:1-14.

Somerville MJ, Mervis CB, Young EJ, Seo EJ, del Campo M, Bamforth S, Peregrine E, Loo W,

Lilley M, Pérez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe

expressive-language delay related to duplication of the Williams-Beuren locus. New

England Journal of Medicine. 353:1694-1701.

SLI Consortium (2002) A genome-wide scan identifies two novel loci involved in specific

language impairment. American Journal of Human Genetics. 70:384-398.

SLI Consortium (2004) Highly significant linkage to the SLI1 locus in an expanded sample of

individuals affected by specific language impairment. American Journal of Human

Genetics. 74:1225-1238.

Stankiewicz P, Rujner J, Löffler C, Krüger A, Nimmakayalu M, Piłacik B, Krajewska-Walasek

M, Gutkowska A, Hansmann I, and Giannakudis I. (2001) Alagille syndrome associated

with a paracentric inversion 20p12.2p13 disrupting the JAG1 gene. American Journal of

Medical Genetics. 103:166-171.

Stankiewicz P, and Lupski JR. (2002) Genome architecture, rearrangements and genomic

disorders. Trends in Genetics. 18:74-82.

118

Stock AD, Spallone PA, Dennis TR, Netski D, Morris CA, Mervis CB, and Hobart HH. (2003)

Heat shock protein 27 gene: chromosomal and molecular location and relationship to

Williams syndrome. American Journal of Medical Genetics A. 120: 320-325.

Sugayama SM, Leone C, Chauffaille Mde L, Okay TS, and Kim CA. (2007) Williams

Syndrome: development of a new scoring system for clinical diagnosis. Clinics. 62:159-

166.

Tam E, Young EJ, Morris CA, Marshall CR, Loo W, Scherer SW, Mervis CB, Osborne LR.

(2008) The common inversion of the Williams-Beuren syndrome region at 7q11.23 does

not cause clinical symptoms‖ American Journal of Medical Genetics: Part A. 146A:1797-

1806.

Tan-Sindhunata G, Castedo S, Leegte B, Mulder I, vd Veen AY, vd Hout AH, Wiersma TJ, van

and Essen AJ. (2000) Molecular cytogenetic characterization of a small, familial

supernumerary ring chromosome 7 associated with mental retardation and an abnormal

phenotype. American Journal of Medical Genetics. 92:147-152.

Tassabehji M. (2003) Williams-Beuren syndrome: a challenge for genotype-phenotype

correlations. Human Molecular Genetics. 12:R229-R237.

Tatton-Brown K, Douglas J, Coleman K, Baujat G, Chandler K, Clarke A, Collins A, Davies S,

Faravelli F, Firth H, Garrett C, Hughes H, Kerr B, Liebelt J, Reardon W, Schaefer GB,

Splitt M, Temple IK, Waggoner D, Weaver DD, Wilson L, Cole T, Cormier-Daire V,

Irrthum A, Rahman N; and Childhood Overgrowth Collaboration (2005) Multiple

mechanisms are implicated in the generation of 5q35 microdeletions in Sotos syndrome.

Journal of Medical Genetics. 42:307-313.

Tercero MF, Cabrera López JC, Herrero MM, and Rodríguez-Quiñones F. (2005) Williams-

Beuren syndrome and West "syndrome:" causal association or contiguous gene deletion

syndrome? American Journal of Medical Genetics A. 133:213-215.

Tomblin JB, and Buckwalter PR. (1998) Heritability of poor language achievement among

twins. Journal of Speech Language and Hearing Research. 41:188-199.

Torniero C, dalla Bernardina B, Novara F, Vetro A, Ricca I, Darra F, Pramparo T, Guerrini R,

and Zuffardi O. (2007) Cortical dysplasia of the left temporal lobe might explain severe

expressive-language delay in patients with duplication of the Williams-Beuren locus.

European Journal of Human Genetics. 15:62-67.

Torniero C, Dalla Bernardina B, Novara F, Cerini R, Bonaglia C, Pramparo T, Ciccone R,

Guerrini R, and Zuffardi O. (2008) Dysmorphic features, simplified gyral pattern and

7q11.23 duplication reciprocal to the Williams-Beuren deletion. European Journal of


Turnbull J, Lohi H, Kearney JA, Rouleau GA, Delgado-Escueta AV, Meisler MH, Cossette P,

and Minassian BA. (2005) Sacred disease secrets revealed: the genetics of human epilepsy.

Human Molecular Genetics. 14(S2):2491-2500.




119

Turner DJ, Miretti M, Rajan D, Fiegler H, Carter NP, Blayney ML, Beck S, and Hurles ME.

(2008) Germline rates of de novo meiotic deletions and duplications causing several

genomic disorders. Nature Genetics. 40:90-95.

Tzschach A, Menzel C, Erdogan F, Schubert M, Hoeltzenbein M, Barbi G, Petzenhauser C,

Ropers HH, Ullmann R, and Kalscheuer V. (2007). Characterization of a 16 Mb interstitial

chromosome 7q21 deletion by tiling path array CGH. American Journal of Medical

Genetics, Part A. 143A:333-337.

Van der Aa N, Rooms L, Vandeweyer G, van den Ende J, Reyniers E, Fichera M, Romano C,

Delle Chiaie B, Mortier G, Menten B, Destrée A, Maystadt I, Männik K, Kurg A, Reimand

T, McMullan D, Oley C, Brueton L, Bongers EM, van Bon BW, Pfund R, Jacquemont S,

Ferrarini A, Martinet D, Schrander-Stumpel C, Stegmann AP, Frints SG, de Vries BB,

Ceulemans B, and Kooy RF. (2009) Fourteen new cases contribute to the characterization

of the 7q11.23 microduplication syndrome. European Journal of Human Genetics. 52:94-

100.

Velleman SL, Currier A, Lippe C, and Mervis CB. (2006) Phonological development in

Williams syndrome. In Proceedings of the International Clinical Phonetics and Linguistics

Association (31 May– 3 June 2006; Dubrovnik, Croatia) (Horga, D. and Mildner, V., eds),

147, FF Press, Zagreb, Croatia.

Visser R, Shimokawa O, Harada N, Kinoshita A, Ohta T, Niikawa N, and Matsumoto N. (2005)

Identification of a 3.0-kb major recombination hotspot in patients with Sotos syndrome

who carry a common 1.9-Mb microdeletion. American Journal of Human Genetics. 76:52-

67.

Wechsler D, (1999). Wechsler Abbreviated Scale of Intelligence. San Antonio, TX:

Psychological Corporation.

Wessel A, Pankau R, Kececioglu D, Ruschewski W, and Bursch JH. (1994) Three decades of

follow up of aortic and pulmonary vascular lesions in the Williams-Beuren syndrome.

American Journal of Medical Genetics. 52:297–301.

Williams K. Expressive Vocabulary Test. Circle Pines, MN: American Guidance Service; 1997.

Wiig EH, Secord WA, and Semel E. Clinical Evaluation of Language Fundamentals Preschool

2nd ed. Austin, TX: Psychological Corporation; 2004.

Wolf NI, Sistermans EA, Cundall M, Hobson GM, Davis-Williams AP, Palmer R, Stubbs P,

Davies S, Endziniene M, Wu Y, Chong WK, Malcolm S, Surtees R, Garbern JY, and

Woodward KJ. (2005) Three or more copies of the proteolipid protein gene PLP1 cause

severe Pelizaeus-Merzbacher disease. Brain. 128:743-751.

Wong KK, deLeeuw RJ, Dosanjh NS, Kimm LR, Cheng Z, Horsman DE, MacAulay C, Ng RT,

Brown CJ, Eichler EE, and Lam WL. (2007) A comprehensive analysis of common copy-

number variations in the human genome. American Journal of Human Genetics. 80:91-

104.

120

Wu YQ, Nickerson E, Shaffer LG, Keppler-Noreuil K, and Muilenburg A. (1999) A case of

Williams syndrome with a large, visible cytogenetic deletion. Journal of Medical Genetics.

36:928-932.

Yobb TM, Somerville MJ, Willatt L, Firth HV, Harrison K, MacKenzie J, Gallo N, Morrow BE,

Shaffer LG, Babcock M, Chernos J, Bernier F, Sprysak K, Christiansen J, Haase S, Elyas

B, Lilley M, Bamforth S, and McDermid HE. (2005) Microduplication and triplication of

22q11.2: a highly variable syndrome. American Journal of Human Genetics. 76:865-876.

121

CHAPTER III: ANALYSIS OF GTF2IRD1 MOUSE MODEL:

122


3.1.1: Contribution of the genes telomeric to elastin to the Williams-Beuren syndrome

phenotype:

The contribution of specific genes to individual aspects of a contiguous gene disorders

are often determined by identification of persons carrying atypical deletions or mutations in

individual genes within the known deleted region. In the case of WBS this has proven difficult

since the vast majority of WBS individuals carry the same deletion. However several smaller

deletions of the WBS region have been identified and these have provided some insight into the

relationship between specific phenotypic features and individual genes.

The first gene to be unequivocally linked to any aspect of the WBS phenotype was elastin

(ELN). The involvement of ELN in the cardiovascular lesions seen in over three quarters of

WBS individuals, in particular SVAS and PPS, was demonstrated in 1993 through the

identification of a family with SVAS and a chromosome translocation that disrupted the gene

(Curran et al., 1993). Studies involving patients having point mutations or intragenic deletions

in the elastin gene further supported the hypothesis that hemizygosity for ELN causes SVAS but

is otherwise not involved in any other aspects of WBS (Olson et al., 1995; Tassabehji 1997; Li et

al., 1997).

The identification of SVAS individuals with ELN deletions clearly indicated that ELN

was responsible for the vascular pathology and perhaps some connective tissue abnormalities

seen in WBS but was obviously not responsible for all of the features of WBS. In particular,

when it was shown that the WBS deletions extended beyond the ELN locus, it was concluded

that WBS was a contiguous gene deletion syndrome and that gene(s) beyond the ELN locus were

123

responsible for the remaining features of WBS. Tassabehji et al., (1999) reported a 7-year-old

girl (CS) with a 800kb deletion that shared a common proximal breakpoint found in typical WBS

patients but with a distal breakpoint within RFC2. Her standard test scores for verbal, nonverbal

and spatial scores were all in the normal range. From patient CS it was proposed that the genetic

determinants of all aspects of the WBS phenotype (except cardiovascular features) are telomeric

to RFC2.

Botta et al. (1999) identified the first individuals determined to have the full WBS

phenotype yet carry smaller deletions. Two individuals were determined to have deletions

spanning from the elastin gene to marker D7S1870, the common WBS distal breakpoint. The

two individuals included a 6 year old Italian girl and 2 year old male having common WBS

facial features including pre-orbital fullness, stellate patterning of the irises, short upturned nose,

full lips as well as cardiac abnormalities and developmental delay. In addition, the girl was

described as having a hyperactive overfriendly personality accompanied by anxiety,

characteristic of individuals with WBS. Her cognitive profile was consistent with WBS

displaying preserved language abilities alongside severe deficits in visual perception and visual

motor abilities.

Further evidence to support that genes telomeric to STX1A are responsible for the

majority of the features found in WBS came from a report by Heller et al., (2003) of a classic

case of WBS in a twin boy (healthy sister) with a deletion also spanning from ELN to GTF2I.

This individual was said to display the full WBS phenotype including cardiac abnormalities,

developmental delay, characteristic facial features and a ―very friendly nature‖. From these

findings the authors concluded that the genes from ELN to GTF2I were likely responsible for

most phenotypic aspects of WBS.

124

In 2003, the first reports were published that began to elucidate the possible contributions

of CLIP2, GTF2IRD1 and GTF2I to the WBS cognitive and behavioural phenotype. In February

2003, Karmiloff-Smith et al., reported an SVAS patient (WBS-21) with a large deletion from the

common proximal breakpoint to RFC2 yet did not have the typical facial or behavioral profile.

The breakpoints in this individual were similar to the patient CS reported by Tassabehji et al.,

(1999) and consistent with this individual, WBS-21 had a normal to above average IQ (110) and

an even cognitive profile with above average non-verbal and spatial scores, with no signs of

spatial impairment. Later in 2003, Gagliardi et al., reported a 5-year-old Italian boy with a

common proximal breakpoint but a distal breakpoint that mapped within CLIP2. Also consistent

with the previous patients reported by Karmiloff et al., and Tassabehji et al., this individual had a

higher IQ (83) than commonly observed in WBS and more importantly displayed no spatial

construction impairment.

It is evident from these identified individuals, as well as subsequent patients identified

since the commencement of this work, that deletions of the genes mapping telomerically to

RFC2, such as CLIP2, GTF2I and GTF2IRD1 likely contribute to the cognitive and behavior

aspects of WBS (Botta et al., 1999; Tassabehji et al., 1999; Gagliardi et al., 2003; Karmiloff-

Smith et al., 2003; van Hagen et al., 2007; Antonell et al., 2009; Ferrero et al., 2010). Although

it is important to identify atypical deletions of regions associated with contiguous gene deletion

syndromes to determine the phenotypic contribution made by the variably deleted genes, the

etiology is often complicated by the fact that not all genes are dosage sensitive, or that the

phenotype may result from a combinatorial effect of deleted genes and may also be dependent of

genetic background, particularly reducing the value of single individual carrying unique

deletions. In addition, in the case of WBS there is an ascertainment bias in the identification of

125

individuals with smaller deletions, with all patients to date harboring a disruption of ELN.

Controlled studies, specifically the use of animal models containing both individual and multiple

deleted genes will be a valuable tool to link specific genes with the social and emotional changes

seen in WBS.

3.1.2: The neurobiology of fear, emotion and social cognition:

A great deal of research has been done on the cognitive-linguistic aspects associated with

WBS, however the neural deficits involved in the emotional and social profile have yet to be

fully investigated. This is likely due to a tendency by clinicians and researchers to often attribute

neuropsychological features in patients with mental retardation to their deficits in cognition and

although social skills and emotional traits are often highly heritable and critical for survival, little

is known about specific genetic factors and neural mechanisms influencing human social

cognition. To a neuroscientist, WBS is an ideal disorder to study. The WBS cognitive and

behavioral phenotype is an intriguing combination of gregarious sociability, anxiety, strength in

expressive skills alongside severe deficits in learning and spatial cognition. However, even

though the genetic cause of the disorder was identified over 15 years ago as a deletion of

approximately 25 genes, the neural mechanisms underlying the WBS cognitive and behavioral

phenotype remain largely unknown.

Still in its infancy, the field of cognitive neuroscience of social and emotional behavior

continues to grow in popularity and importance. What information has been gathered has come

from fear-based learning such as classical (or Pavlovian) conditioning. Fear based learning

produces rapid, robust and enduring learning. It has been demonstrated that even a single

126

intense foot shock can produce a conditioned fear response and that the learned behavior can last

for months (Maren, 2008). Although the neural pathways are still unclear, the limbic system, an

integrated functional complex consisting of both cortical and sub-cortical regions is believed to

be involved in learning and memory as well as emotional and social behavior. Again, due to

extensive work in classical fear conditioning, the areas that appear to play a pivotal role in fear as

well as emotional and social behavior are the frontal cortex and the amygdala, which is believed

to act as a protective device that receives sensory input from various areas of the brain, including

the frontal cortex and monitors environmental events such as danger. In human studies it was

demonstrated that the activation of the amygdala occurs even when subjects are given verbal

commands that may result in danger (Phelps et al., 2001) and it has been demonstrated that

activation of the amygdala can even occur in individuals that are simply watching others

participate in fear conditioning experiments; a process referred to as observational fear

conditioning (Shin and Liberzon, 2010).

3.1.3: The unique social profile seen in WBS:

An intriguing feature of Williams syndrome is the unique social profile characterized by

hypersociability and a diminished fear of strangers. Deficits in social interaction have also been

shown to be an important early marker for autism and other related neurodevelopmental

disorders with strong genetic components. It is often difficult to study sociability in neurological

disorders since intellectual impairment often limits comparison to control groups.

Several brain regions including the frontal lobes provide inhibitory input to the amygdala

(Davidson et al., 2000) and the interaction between the orbitofrontal cortex (OFC) and the

127

amygdala is thought be crucial for making appropriate social judgments (Adolphs, 2003) with

lesions of the amygdala and the OFC associated with impairments of social functioning leading

to disinhibition (Amaral, 2002). Recent work has demonstrated that there may exist extensive

reciprocal connection between the amygdala and various regions of the brain that are thought to

regulate emotional and social behavior (Shin and Liberzon, 2010) and it is this disturbance of the

functional interaction between the OFC and amygdala in subjects with WBS that is hypothesized

to contribute to social disinhibition, reduced reactivity to social cues and an increased tendency

to approach strangers (Meyer-Lindenberg et al., 2005).

Most studies attempting to elucidate the neural basis of social behaviour have involved

non-human primates. Normally, socialization in primates is a time dependent process where

they will initially take a considerable amount of time to evaluate one another, maintain a cautious

posture and avoid coming in close proximity to one another. Once a social relationship has been

established, there is an increase in positive social interaction such as grooming. However, in

primates with bilateral lesions of the amygdala, primates engage in social actions immediately.

Interestingly this appears to be age dependent. When lesions are generated in adult non-human

primates, these animals displayed a complete loss of innate fear, increased sociability and

actively engage in immediate social interactions (Emery et al., 2001). Similarly, when bilateral

lesions of the amygdala were generated shortly after birth, these animals also displayed a

complete loss of innate fear. However when these animals were then allowed to engage in social

interactions, they displayed significant increases in fearful behaviors and engaged in significantly

fewer social interactions suggesting dissociable systems of social and non social fear (Prather et

al., 2001).

128

In mice, changes in sociability and aggression can be determined using the resident-

intruder test where individually housed male mice (residents) are exposed to novel, socially

house intruder mice. The latency and duration of a number of events including aggressive

(biting, wrestling or aggressive grooming) or social behaviours (following and sniffing of

partner) are recorded. Alterations in the resident-intruder behaviours have been previously

linked to several brain regions including the amygdala as well as disruption of the hypothalamic-

pituitary-adrenocortical (HPA) axis, the vasopressin and serotonin systems (for review see

Veenema and Neumann, 2007).

3.1.4: Increased levels of generalized anxiety and specific phobias in WBS:

Specific phobias are highly prevalent in children and adults with WBS, with reported

incidences of 53.8% and 50% respectively (Leyfer et al., 2006; Cherniske et al., 2004). These

rates are far higher than those reported for individuals with mental retardation of other etiologies

which ranges from 1.5% to 17% (Cooper et al., 1997; Myers and Pueschel, 1991; Dekker and

Koot, 2003; Emerson, 2003). In contrast to their high levels of anxiety, individuals with WBS

are highly gregarious and people-oriented, and this is reflected in the low prevalence of social

phobias. Around 12% of WBS individuals are diagnosed with generalized anxiety disorder

(GAD) (Leyfer et al., 2006; Dykens, 2003), a much lower rate of GAD is found in typically

developing children (2-4%) (Achenbach et al., 1989; Anderson et al., 1987; Bowen et al., 1990)

or in those with mental retardation of other etiologies (>2%) (Dekker and Koot, 2003; Emerson,

2003).

129

Anxiety disorders are characterized by excessive fear in response to specific object or

situation but in the absence of true danger (Shin and Liberzon, 2010) and whereas fear is a

necessary adaptive physiological and behavioral response to an actual or imminent threat,

anxiety is the response to a far more uncertain threat and can be triggered by more generalized

cues (Cannistraro and Rauch, 2003; Lang et al., 2000). In particular, that anxiety is believed to

result from a malfunction in the memory consolidation and recall mechanism. Typically, when

fearful situations are encountered, they are characterized, managed (e.g. avoidance behaviour)

and over time, forgotten through a process known as extinction or reversal learning (Shin and

Liberzon, 2010). However when these neural mechanisms are not performing properly, these

fear-inducing situations are learned but not forgotten, resulting in future anxiety and specific

phobias. Although the precise mechanism is still unclear, inhibitory neurons from the ventral

and medial subregions of the prefrontal cortex project to the lateral amygdala, which then

projects to the central amygdala and to the inhibitory neurons in the intercalated cell masses

(ICM) (Sotres-Bayon et al., 2008) negatively regulating the central amygdala and suppressing

amygdala-processed fear responses. As with fear learning, synaptic plasticity within the lateral

amygdala mediates both acquisition and extinction of future anxiety and specific phobias. This

suggests a role for the lateral amygdala as the site of plasticity underlying memory storage and

fear consolidation. Interestingly, individuals with lesions of the ventral and medial subregions of

the prefrontal cortex also show inappropriate emotional behavior even in the absence of

intellectual deficits and brain imaging studies using PET and fMRI have shown activation of the

PFC and ACC in response to photographs as well as odors and tastes (Britton et al., 2006; Zald

and Pardo, 1997; Zald et al., 1998).

130

The most common method to identify alterations in fear and anxiety in animal models is

the use of the elevated plus (or zero) maze. Originally developed by the work of Montgomery in

the late 1950s, the tests uses a rodent‘s natural aversion for open spaces and provides the test

animal with the choice of either an exposed area (open arms) or a protected area (closed arms).

The test is sensitive to both anxiolytic and anxiogenic drugs with an increase in the time spent

exploring the open arms for anxiolytic drugs and a decrease seen for anxiogenics drugs (for

review see Lister, 1987).

3.1.5: Role of serotonin in emotional behaviors:

Emotional and social behaviours are moderated by a myriad of chemical neurotransmitters.

Clinical evidence for a role for the neurotransmitters serotonin (5-HT), dopamine (DA) and

norepinephrine (NE), in the regulation of emotional behaviour was first identified in the late

1950s when marked depression was observed in individuals prescribed the antihypertensive drug

reserpine which resulted in monoamine depletion (Quetsch et al., 1959). Different

neurotransmitters are produced in cell bodies that cluster in distinctive regions of the brains.

Dopamine is produced in a number of areas including the ventral tegmental area (VTA) whose

two primary efferent fiber projections of the VTA are the mesocortical and the mesolimbic

pathways, and the substantia nigra (SN) which projects via the nigrostriatal pathway to the basal

ganglion (Smith and Kieval, 2000). The principal source of serotonin production is the raphe

nucleus that projects to all cortical regions, the amygdala, hippocampus and hypothalamus

(Gaspar et al., 2003). Norepinephrine is produced in the locus corealus and projects to all areas

of the cortex, cerebellum and spinal cord (Ramirez and Wang, 1986).

131

Serotonin is known to be a major player in the modulator of emotional behaviour and

psychotherapeutic agents targeting serotonin-induced pathways are being used in the treatment

of many psychiatric disorders including depression. Serotonin is a major player in the modulator

of emotional behaviour and in the construction of neural pathways and terminal differentiation of

neurons (Gaspar et al., 2003). During development, serotonergic neurons are among the first to

be generated being expressed on embryonic day 10 in mice and first trimester in primates. It has

also been demonstrated that many non-serotonergic neurons transiently express the genes for the

serotonin transporter (SERT) and the protein needed to package serotonin into synaptic vesicles

(VMAT2) thereby allowing these cells to store and release serotonin even though they lack the

ability to produce it (Lebrand et al., 1996). Interestingly, it has also been shown that

antidepressants promote neurogenesis in the hippocampus (Gould, 1999) and increase production

of neurotrohpins in the neocortex (Vaidya et al., 1997) and that high levels of serotonin are

produced in the brain up to about the age of five but then the levels decrease until adulthood.

However, blood levels of serotonin have been shown to remain high in a subpopulation of

autistic people (Penn, 2006). The serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA)

that is believed to reflect pre-synaptic serotonin release has been shown to be deceased in the

cerebrospinal fluid (CSF) of patients suffering from depression and that brain stem levels of

serotonin and 5-HIAA are consistently reduced in suicide victims (Arango et al., 1997). In

human studies, alterations in brain serotonin levels have been associated with aggression, and

alterations in gene expression in genes involved in the breakdown of serotonin as well as

serotonin receptors, either by mutation or promoter polymorphisms, have been linked to an

increase in the risk of suicide (Roy, 2001).

132

The generation of animal models for the elucidation of neural mechanism involved in

fear-based learning as well as sociability and emotional behaviour are necessary to create

effective treatment. Although neuropsychological conditions are rarely mediated by single

genes, deciphering the contributions made by genes whose copy number is known to be affected

in contiguous gene deletion disorder in which neural functioning is disrupted, such as in WBS,

will not only contribute to a better understanding of the associated neurological phenotype but

may also provide insight to the etiology of less understood neuropsychological disorders.

3.2: Material and Methods:

3.2.1: Generation of Gtf2ird1 mouse model:

The murine Gtf2ird1 gene was disrupted using a conventional replacement targeting

strategy. The targeting vector consisted of 2.7 kb short arm and a 5.8 kb long arm derived from

RPCI-21-510M19 PAC library (derived from 129/SvJ mice) cloned into the EcoRI and KpnI

sites respectively, of the pKSLoxPNT cloning vector (Hanks et al., 1995). The resulting vector

contained a neomycin resistant gene, (Neo) flanked by loxP sites, in the same transcriptional

orientation of Gtf2ird1 (Figure 3.1A). Integration of the linearized vector into the Gtf2ird1 gene

locus of R1 murine embryonic stem cells (Nagy et al., 1993) generated neomycin resistant clones

with the expected genomic fragments by Southern-blot and PCR analysis (Figure 3.1B). The

targeting resulted in the replacement of Gtf2ird1 exons 2, 3, 4 and part of 5 with the neomycin

resistant gene cassette transcribed by the PGK1 promoter. Mice carrying the targeted allele were

generated by aggregation of targeted cells with morula-stage embryos to obtain germ line-

transmitting chimeric mice (Nagy et al., 2002).

133

Chimeric males were mated with CD1 females to produce Gtf2ird1 heterozygously

targeted mice, and the mice were subsequently maintained on a CD1 background. Both

Gtf2ird1+/-

and Gtf2ird1-/-

mice were viable and fertile and the mutant allele was transmitted at

the expected Mendelian ratio. F1 heterozygous littermates were crossed to homozygosity in

order to generate Gtf2ird1-/-

mice. Genotyping was performed by PCR analysis of purified

genomic DNA using the forward primer mIRD1-GF (5‘-CGACCACCATAGGTTGAAGG-3‘),

in combination with the two reverse primers mIRD1-GR (5‘-TGGGGAACTGTTTGAGAAGG-

3‘) and NEO-GR (5‘-GGGGAACTTCCTGACTAGGG-3‘). A 381 bp product is generated from

the wild-type locus and a 350 bp product is generated from the targeted locus.

3.2.2: Expression analysis:

Expression analysis was carried out using total RNA extracted from dissected adult frontal

cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON). Following DNase treatment

(Turbo DNA free, Ambion), 5 g of RNA was converted to cDNA using the SuperScript™

First-Strand Synthesis System (Invitrogen Canada Inc., Burlington, ON) and random hexamer

primers Samples were diluted 1/100 with sterile water and used directly in real-time assays using

the Power SYBR Green PCR Master mix and ABI Prism 7900HT sequence detection system

(Applied Biosystems, Foster City, CA) as described previously (Somerville et al. 2005). Primers

used for expression analysis are listed in Table 3.1. All samples were run in triplicate and the

experiment was repeated twice with consistent results. Absolute quantification analysis,

normalized to control genes hydroxymethylbilane synthase (Hmbs) and succinate dehydrogenase

(Sdha). Each test gene was normalized and comparative expression ratios (%) were calculated by

134

dividing the pooled normalized values for each of the test genes in the Gtf2ird1+/-

and Gtf2ird1-/-

genotype groups by the normalized test gene values for the Gtf2ird1+/+

control group.

Table 3.1. Primers for Quantitative PCR Amplification from cDNA


mBDNF1RTe2-F GACAAGGCAACTTGGCCTAC

mBDNF1RTe2-R TCGTCAGACCTCTCGAACCT

mGTF2IRD1RTe2-F ACTGTGACATCCCCACCAAC

mGTF2IRD1RTe2-R GAGTCTAAGGCGGACACCAG

mGTF2IRD1RTe9-F CGAGGCTGTGGAAATTGTG

mGTF2IRD1RTe9-R TGTGTCGCTCCTCCAGAATC

mCYLN2RTe4-F CAACAGAGGAGGCCACAGAG

mCYLN2RTe4-R CAAGGCCAAGAAGACCAAAC

mGTF2IRTe30-F CAGGAAGATCACCATCAACC

mGTF2IRTe30-R AGATCCTCCTCATGGAGCTG

mGABRA1RTe7-F AGCCCGTTCAGTGGTTGTAG

mGABRA1RTe7-R TTCCAGAGTCAACTGTTTGTCC

mGABRB2RTe5-F CTGGGTGCCTGACACCTACT

mGABRB2RTe5-R GATGCAATCGAATCATACGG

mGABRG2RTe2-F CATGGGTGTTGACTCCAAAA

mGABRG2RTe2-R CCGATGTCAGGTCGAAGTTT

m5-HT1aF CTGGGGACGCTCATTTTCT

m5- HT1aR CCAAGGAGCCGATGAGATAG

m5- HT1bF GAGTCCGGGTCTCCTGTGTA

m5- HT1bR TAGCGGCCATGAGTTTCTTC

m5- HT2aF TGTGCCGTCTGGATTTACCT

135


m5- HT2aR TGAATGGGGTTCTGGATAGC

m5- HT2cF CATGGCAGTAAGCATGGAGA

m5- HT2cR AGTCCCACCAGCATATCAGC

mMaoaF GTGCCTGGTCTGCTCAAGAT

mMaoaR TTCAGGACTGGGGCTGTTTA

mSERT-RTe8-F GTGGTGAACTGCATGACGAG

mSERT-RTe8-R CGTCTTCGTTCCTCATCTCA

mFOSRTe4-F ATCCTTGGAGCCAGTCAAGA

mFOSRTe4-R ATGATGCCGGAAACAAGAAG

mSdhaF TGATCTTCGCTGGTGTGGATGTCA

mSdhaR CCCACCCATGTTGTAATGCACAGT

mHMBSRT-F TCCAAGAGGAGCCCAGCTA

mHMBSRT-R ATTAAGCTGCCGTGCAACA

3.2.3: General morphological analysis:

Mice were routinely examined for obvious morphological or anatomical abnormalities.

For determination of body weight all mice were weighed with the same scale with an accuracy of

+/- 0.1 grams. All adult mice were at least ten weeks of age when weighed (n=120, mean 20.7

+/- 2.6 weeks). For determination of growth curves, mice were weighed twice per week from

weaning (3 weeks) until 10 weeks at approximately the same time of day. For behavioral testing,

adult mice between 3 and 9 months of age were used. All animals were group housed with access

to food and water ad libitum and were on a 12 hr light/dark cycle throughout the experiments.

136

3.2.4: Resident intruder/olfactory function test:

Aggression was assessed using the resident-intruder test in isolated male mice, essentially

as previously described (Moy et al., 2004). Males were housed individually for at least 1 week

before assessment, which was performed over three sessions, spaced 2–3 days apart. Intruders

(C57BL/6J male mice) were individually placed in the resident home cage for a 10 min test

session and a different intruder animal was used for each resident. Animals that did not attack the

intruder were given an attack latency of 10 min. The latency, duration and number of events

were recorded as: aggressive behavior (contact between the resident and the intruder such as

biting or wrestling and aggressive grooming of partner), social interest behavior (following and

sniffing of partner) and submissive behavior (defensive freezing and active avoidance of

partner). All behavioral events were video recorded and analyzed by Observer 5.0 software

(Noldus Information Technology, Netherlands). A simple test of olfactory function in each test

animal was conducted following the resident-intruder test. This was carried out as described

previously, by measuring the time it took for each mouse to find food buried in bedding (Moy et

al., 2004). All mice were first habituated to the food (Bud‘s Best Cookies, Hoover, AL) by the

experimenter placing pieces of cookie in the home cage overnight. The next day chow was

removed from the cages and the mice were food deprived for 24 hours. The test was conducted

in a plastic cage 30 x 17 x 12 cm. The food was placed in the randomly chosen area (1 x 1 x 0.5

cm) and the entire bottom of the cage covered with litter to a depth of 2.5 cm. Mice were then

placed into the cage individually and the latency to find the food was recorded, with a maximum

time of 15 min.

3.2.5: Elevated plus maze:

137

The elevated plus-maze was used to estimate the anxious state of the mice (Rodgers and

Cole, 1994). Testing was performed as described previously (Avgustinovich et al., 2004). All

measurements were taken in a dimly lit experimental room to which the mice were acclimatized,

and the maze was thoroughly cleaned between sessions. Over a 5-min test period, the following

measures of plus-maze behavior were recorded: 1) open arm time, enclosed arm time and central

platform time as a percentage of total time; 2) open arm entries, enclosed arm entries and central

platform entries as a percentage of total entries; 3) total entries; 4) head-dips. Additionally, the

number of passages from one enclosed arm to another and the number of open arm end

explorations (scored if the mouse was in the middle-to-end of the either open arm) was

measured.

3.2.6: Cube exploration/novel object recognition test:

The cube test was used to assess trait anxiety as previously described (Avgustinovich et

al., 2000). Briefly, a small cube (3cm3) was carefully placed in the center of each home cage and

total exploration times were recorded over a 5-min test period. All measurements were taken in a

dimly lit experimental room to which the mice were acclimatized, and the novel object (cube)

was thoroughly cleaned between tests. The novel object reconition test was performed as

previously described (Chan et al., 2008). Briefly, each mouse was habituated to the box with

10 min of exploration in the absence of objects for three consecutive days (habituation session,

days 1–3). During the training session, each animal was placed in the test box, and after a 5-min

habituation period, two objects were introduced in two corners. Each animal was allowed to

explore in the box for 5 min (day 4). An animal was considered to be exploring the object when

its head was facing the object (the distance between the head and object is approximately 1 cm or

138

less) or it was touching or sniffing the object. The time spent exploring each object was recorded

by an experimenter, blinded to the identity of the treatments, using stopwatches. After training,

mice were immediately returned to their home cages. During the retention sessions, the animals

were placed back into the same box 24 h after the training session (day 5), but one of the familiar

objects used during training had been replaced with a novel object. The animals were then

allowed to explore freely for 5 min, and the time spent exploring each object was recorded as

described above. A preference index in the retention session, a ratio of the amount of time spent

exploring the novel object over the total time spent exploring both objects, was used to measure

cognitive function. In the training session, the preference index was calculated as a ratio of the

time spent exploring the object that was replaced by the novel object in the retention session over

the total exploring time.

3.2.7: Locomotor activity in the open field:

Open field activity assessments were carried out as described previously (Gerlai et al.,

1993). The activity cage consisted of a clear Perspex box with a floor made of steel bars

connected to the circuit with horizontal and vertical infrared sensors. The subject‘s behavior was

recorded using a computer event-recording program (Ethograph). Each mouse was placed

individually into the center of the activity cage and horizontal and vertical activities were

recorded over a 5-min test period.

3.2.8: Morris water maze test:

139

The Morris water maze apparatus and testing procedures were described previously

(Clapcote et al., 2005). Briefly, on the first day, each mouse was given four visible platform

trials (V). Mice were then subjected to five days of four training trials per day with the

submerged platform in the same position (hidden phase). On the sixth day, the platform was

moved to a different position, and the mice were subjected to four days of four training trials per

day (reversal phase). Behavioral variables were quantified with the aid of HVS Water 2020

(HVS Image Ltd, Twickenham, Middlesex, UK).

3.2.9: Contextual and cued fear conditioning:

Contextual and cued fear conditioning was carried out according to previously published

protocols (Clapcote et al. 2005). Briefly, a fear conditioning apparatus (MED Associates Inc,

Georgia, VT) consisted on a test chamber (25cm high X 30cm wide X 25cm deep) was cleaned

prior to testing with 70% ethanol. Freezing activity was recorded using automated fear

conditioning software (Actimetrics Software) and presented as a percentage of total time. Test

subjects (+/+ n=9 (6 males, 3 females); +/- n=20 (12 males, 8 females); -/- n=6 (3 males, 3

females)) were removed from the home cage and allowed to explore for 2 minutes. Conditioning

consisted of a single pairing of an auditory cue (3600 Hz, 80 dB) with a foot shock (1 mA

scrambled). The auditory cue was presented 2 minutes after the training session started and was

30 seconds in duration. The foot shock was delivered continuously during the last 2 seconds of

the auditory cue. The subject was removed from the chamber 30 seconds later and returned to its

home cage. Approximately 24 hours later each subject was returned to the test chamber and

monitored for 5 minutes. Two hours later, the context was altered and each subject was placed

140

into the altered chamber and allowed 3 minutes for exploration, after which the auditory tone cue

of 3 minutes was delivered.

3.2.10: Neurochemical analyses:

Adult mice were killed with a brief (0.5–0.8 s) head-focused pulse of high intensity

microwave radiation (3.5 kW, 2450 MHz), delivered by a magnetron (Stoeling Co., Chicago, IL,

USA) to rapidly and effectively fix the brain in situ. The fixed brains were regionally dissected

on ice and stored at -80ºC until analysis. Tissues were processed as described previously, divided

into aliquots of 50 uL, and stored at -80ºC or analyzed immediately (Mount et al., 2004). Tissue

pellets were retained for the determination of protein content. Six to nine individual tissue

samples were obtained for each brain region.

Levels of monoamines and metabolites, including dopamine (DA), 3,4-

dihydroxyphenylacetic acid (DOPAC), 4-hydroxy-3- methoxyphenylacetic acid (HVA),

serotonin (5-HT) and 5-hydroxyindoleacetic acid (5-HIAA), were analyzed in 20–35 uL of the

perchloric acid tissue extracts by HPLC with electrochemical detection, and isocratic reverse-

phase chromatographic conditions similar to those described previously (Cosi and Marien,

1998). Briefly, the chromatographic conditions consisted of a C18 reverse-phase column

(LiChroCART 125–4 cartridge, 12.5 cm · 4.0 mm, filled with LiChrospher 100 RP-18, 5 lm

particle size, Merck) maintained at 30oC. The mobile phase was made up of NaH2PO4 (50 mM),

disodium EDTA (0.2 mM), 1-octane sulfonic acid (15–17 mL/L; PIC -B8, Waters) and 2.0–6.0%

methanol (final pH 1/4 4.0–4.6), and was delivered at a flow rate of 1.0 mL/min using a Waters

Model 510 pump. Samples were injected automatically using a refrigerated autosampler

141

(CMA/200 Microsampler, CMA/Microdialysis AB, Stockholm; or Waters Model 717plus

Autosampler). The electrochemical detector (Waters Model 460, Antec DECADE or Antec

INTRO) was operated at a working electrode potential of + 0.65 V.

3.2.11: Rotorod analysis:

Mice were placed on a rotating bar (diameter = 3.5 cm, Economex, Columbus

Instruments, Columbus, OH) rotated at a fixed rate of 12 rpm for 5 minutes. Performance

duration was recorded when the animal, unable to stay on the rotorod, fell a short distance,

tripped a plate, and automatically stopped a timer. All mice were trained 1 day prior to testing.

Mice were tested three times a day with each trial lasting no longer a maximum of 5 minutes.

Testing was repeated daily over a five-day period. Mice that repeatedly fell off the bar within

the first 15 seconds were excluded from further testing. Latency to fall is reported as the mean of

the sum total of the three daily trials.

3.2.12: Microarray analysis:

Expression analysis was carried out using total RNA extracted from dissected adult

frontal cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON) and analyzed using

(MouseWG-6 v2.0 Expression BeadChip, Illumina, San Diego, CA) as per manufacture‘s

instructions. The data preprocessing includes three steps: background correction (done in

Beadstudio), transfer of the data to log2 scale and then normalization of the data using the

quantile normalization method (Bolstad et al. 2003). The LIMMA (linear models for microarray

data) (Smyth, 2004) method was used to identify differentially expressed genes. Briefly, it starts

142

by fitting a linear model for each spot/gene in the data, and then an empirical Bayes (EB) method

is used to moderate the standard errors for estimating the moderated t-statistics for each

spot/gene, which shrinks the standard errors towards a common value. This test is similar to an

ANOVA method for each spot/gene except that the residual standard deviations are moderated

across genes to ensure more stable inference for each gene. The moderated standard deviations

are a compromise between the individual gene-wise standard deviations and an overall pooled

standard deviation.

3.2.13: Western blotting analysis:

For Western blot analysis, 20 μg of protein per fraction were separated by SDS-PAGE on

12% gradient Bis-Tris gels. After blotting to 0.2 μm nitrocellulose membranes (Pall, Port

Washington, NY, USA), protein loading and efficacy of transfer was checked by reversible

staining with Ponceau S (not shown). Membranes were routinely blocked with 5% non-fat dry

milk powder or bovine serum albumin in TBST (TBS + 0.05% Tween). Membranes were

incubated overnight at 4°C with anti-TrpC4 rabbit polyclonal antibody (Alomone Labs,

Jerusalem, Israel) diluted1/500 in blocking solution. Membranes were washed and incubated for

one hour in horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody

(1/25000, GE Healthcare, Uppsala, Sweden). Membranes were washed and ECL (enhanced

chemiluminescence) reagents (GE Healthcare) were used for chemiluminescent detection using

Hyper Film (GE Healthcare). For re-probing, membranes were stripped in stripping solution

(100 mM 2-mercaptoethanol, 2% SDS, 60 mM Tris) for 30 min at 56°C.

143

3.2.14: Immunohistochemistry:

Sections were stained free-floating in 6-well plates loaded with 0.1 M Phosphate buffer

(PB). Unless otherwise stated the sections were incubated with shaking. Sections were rinsed

twice, 10 minutes each rinse, with PB 0.1 M and incubated with fresh 0.3% H2O2 in PB 0.1 M

for 30 minutes at room temperature. Sections were rinsed 3 10 minutes with 0.1 M PB and

blocked in blocking solution (PB 0.1 M; 0.1 % BSA; 0.2% Triton X-100; 2% serum) for 60 min

at room temperature. Sections were incubated with primary antibody (Anti-Fos: Polyclonal IgG,

Oncogene Research Products - Ab-5, Cat.# PC38) diluted in blocking solution overnight at room

temperature. Sections were rinsed 4 10 minutes with PB 0.1 M and incubated with

biotinylated secondary antibody (Biotin-SP-conjugated affiniPure Goat anti-rabbit IgG (H+L)

Jackson Immunoresearch, Cat.# 111-065-144. Recommended dilution: 1:2000), diluted in

blocking solution for 2 hours at room temperature on a shaker. Sections were rinsed 4 10

minutes in PB 0.1 M on a shaker and incubated in ABC solution (Vectastain ABC Kit - Elite

standard, Vector, PK-6100) for 1-2 hours at room temperature. Sections were rinsed 4 10

minutes with PB 0.1 M on a shaker and were developed with DAB/0.003% H2O2 solution (3,3‘-

diaminobenzidine tablets, Sigma D-5905) at room temperature. Sections were rinsed 4 10

minutes with PB 0.1 M, transferred to slides, allowed to air dry and dehydrated twice in ethanol

100% for 5 min, twice in toluene or xylene for 5 min and cover slipped with Cytoseal 280.

3.2.15: Golgi-Cox staining:

Brains were processed for Golgi-Cox impregnation using the FD RapidStain Golgi Kit

(FD Neurotechnologies) as per the manufacturer‘s instructions. Briefly, adult mice were

144

sacrificed by cervical dislocation; the brains were quickly removed and rinsed in Milli-Q water.

Brains were immersed in impregnation solution, made by mixing equal volumes of Solutions A

and B, and stored at room temperature for 2 weeks in the dark. The impregnation solution was

replaced after the first 24 hours of immersion. Brains were transferred into Solution C and

stored at 4ºC for at least 48 hours (up to 1 week) in the dark. The solution was replaced after the

first 24 hours of immersion. 100 um sections were cut on a Vibratome in PBS and transferred to

gelatin-coated microscope slides. Slides were dried at room temperature overnight. Sections

were briefly rinsed twice with distilled water and developed by incubating in a mixture of 1 part

Solution D, 1 part Solution E and 2 parts Milli-Q water for 10 minutes. The reaction was stopped

by rinsing in Milli-Q water. The sections were dehydrated in in 50%, 75% and 95% ethanol, 4

minutes each and then in 100% ethanol, four times for four minutes each. Sections were cleared

in xylene, and cover-slipped with Ctyoseal. Basal and apical spine densities were measured from

pyramidal cells of 5 mice at 3 separate 40 um lengths in each genotype (total of 15

measurements per genotype). The three measurements in each mouse were averaged and then

the mean of the five measurements was determined. Propagation of error was used to determine

the error of the mean.

3.2.16: Brain slice preparation and electrophysiology:

Brain slices were prepared as previously described (Proulx et al., 2010). Briefly, coronal

slices (400 µm thick) were obtained from the medial prefrontal cortex of Gtf2ird1-/-

mice and

their WT littermates. Mice were sacrificed by decapitation and the brains were removed and

cooled as rapidly as possible with 4°C oxygenated sucrose artificial cerebrospinal fluid (ACSF)

(254 mM sucrose was substituted for NaCl). Using the appearance of white matter and the

145

corpus callosum as anterior and posterior guides, prefrontal slices were cut from anterior to

posterior using a Dosaka Linear Slicer (SciMedia), Slices were transferred to 30°C oxygenated

ACSF (containing the following, in mM: 126 NaCl, 10 D-glucose, 24 NaHCO3, 2 CaCl2, 2

MgSO4, 3 KCl, 1.25 NaH2PO4, pH 7.4) in a prechamber (Automate Scientific) and allowed to

recover for at least 1.5 h before recordings. For whole cell recordings, slices were placed in a

modified chamber (Warner Instruments) mounted on the stage of an Olympus BX50WI

microscope. Regular ACSF was bubbled with 95% oxygen and 5% carbon dioxide and flowed

over the slice at 30°C with a rate of 3– 4 ml/min. Whole-cell patch electrodes (2–3 MΩ)

contained the following (in mM): 120 K-gluconate, 5 KCl, 2 MgCl, 4 K-ATP, 0.4 Na2-GTP, 10

Na2-phosphocreatine, and 10 HEPES buffer (adjusted to pH 7.33 with KOH). Layer V pyramidal

neurons were patched under visual control using infrared differential interference contrast

microscopy in the cingulate and prelimbic regions. When in voltage clamp, patched neurons

were maintained at the calculated equilibrium potential for chloride under these conditions (75

mV), and currents were recorded using continuous single electrode voltage-clamp mode with a

Multiclamp 700b (Molecular Devices), acquired and low-pass filtered at 3 kHz with

pClamp10.2/Digidata1440 (Molecular Devices). Preliminary concentration response experiments

in voltage-clamp (5-HT; 3 µM – 100 µM, 30 s) showed that 5-HT elicited outwards currents in

layer V pyramidal neurons, consistent with previous work in rats (Béïque et al., 2004). Currents

were measured in Clampfit by subtracting the mean outward current at the peak of the response

from the mean holding current at baseline. Drugs used in the study: t-APDC and baclofen were

obtained from Tocris bioscience (Burlington, ON, Canada), serotonin creatinine sulfate and

WAY-100635 from Sigma-Aldrich (St-Louis, MO, USA) and TTX from Alomone labs Ltd.

(Jerusalem, Israel).

146

3.2.17: Statistical analysis:

Data were expressed as mean ± SEM. Where stated, pair wise comparisons of individual

targeted genotypes to wild type controls were performed using either two-tailed Student‘s t-tests

or non-parametric Mann-Whitney ranked sum tests. Differences among means (to compare data

from more than two groups) were evaluated using non-parametric (distribution-free) Kruskal-

Wallis analysis of variance (ANOVA) test where indicated. Data analysis was performed using

Microsoft Excel and PAST (PAlaeontological STatistics) (http://folk.uio.no/ohammer/past/). For

all analyses the null hypothesis was rejected at the 0.05 level.

3.3: Results:

Data from this section has been included in the following publications:

Young EJ, Lipina TV, Tam E, Mandel A, Clapcote SJ, Bechard A, Chambers J, Mount HT,

Fletcher PJ, Roder JC, Osborne LR. (2008) Reduced fear and aggression and altered serotonin

metabolism in Gtf2ird1-targeted mice. Genes, Brain and Behaviour 7:224-34. Figures reprinted

with permission.

Gtf2ird1 gene targeting was performed by Ariane Mandel. Mouse husbandry,

maintenance and day-to-day genotyping were carried out by Elaine Tam. Some behavioural

testing (fear conditioning, Morris water maze, resident intruder test, open field, elevated plus

maze, novel object test) was carried out by Tatiana Lipina, Steve Clapcote and Alison Behcard

(Dr. John Roder‘s lab). Neurochemical measurements were carried out by John Chambers, Paul

Fletcher and Howard Mount. I performed statistical analysis of behavioral and neurochemical

data, performed growth curve analysis, microarray analysis and validation, all sectioning,

immunohistochemistry and staining.

147

Proulx E, Young EJ, Osborne LR, Lambe EK. Enhanced prefrontal serotonin 5-HT1A currents

in a mouse model of Williams-Beuren syndrome with low anxiety. Journal of

Neurodevelopmental Disorders. 2:99-108. Figures reprinted with permission.

Electrophysiology was performed by Eliane Proulx (Dr. Evelyn Lambe‘s lab). I performed

expression analysis of serotonin receptors. I was responsible for all other unpublished data in

this chapter.

3.3.1: Characterization of Gtf2ird1 mice:

Prior to my arrival in the lab, experiments were performed to target the murine Gtf2ird1

gene using a replacement-targeting vector that replaces the first three exons and part of the fourth

exon with a neomycin (NEO) cassette (Figure 3.1A). Several targeted clones were identified and

one line, D7, was used to establish a mouse Gtf2ird1 line. Real time PCR assays were performed

and confirmed the decreased expression of full-length Gtf2ird1 to 50% in Gtf2ird1+/-

mice with

no expression detected in Gtf2ird1-/-

mice (Figure 3.1C). This indicates a dose-dependent

expression pattern for Gtf2ird1 consistent with other transcription factors, (TWIST, FOXC1/2,

SOX9/10, p53, CREBBP, TBX1/3/5) haploinsufficiency of which are known to cause disease

(Seidman and Seidman, 2002).

149

However, when primers from outside the deleted region were used, expression was

detected. This transcript was determined to consist of the 5‘UTR spliced directly into exon 5.

Two possible start sites were identified downstream of the non-coding exon 1, but neither were

situated within a sequence resembling the Kozak consensus (Figure 3.2). The resulting ORF

translated from the first available ATG start codon would produce a short, out-of–frame (with

TFII-IRD1) protein terminating 120 base pairs (40 codons) downstream.

Nonsense mediate mRNA decay might be predicted to degrade this transcript. However,

qPCR results indicate that the transcript is stably expressed at a level that is approximately 25%

150

greater than the full-length transcript (Figure 3.3). Translation from the next available in-frame

ATG codon would result in an in-frame truncated protein lacking a DNA binding domain and

151

one of the GTF2I-like domains (see Figure 1.5). Based on the predicted translation potential of

the aberrantly spliced transcript no protein product is being produced from this targeted locus.

3.3.2: Phenotypic analysis of Gtf2ird1 targeted mice:

To determine if changes in expression of Gtf2ird1, as a consequence of the disruption of

the murine Gtf2ird1 gene locus, results in any phenotypic abnormalities commonly observed in

Williams-Beuren Syndrome, Gtf2ird1+/-

and Gtf2ird1-/-

mice were subjected to tests including

body weight measurement, assessment in the open field (OF), elevated plus maze (EPM),

resident intruder (RI), cued and contextual fear conditioning, accelerating rotorod (aRR), as well

as biochemical analysis of changes to neurotransmitter and gene expression levels.

3.3.3: Analysis of body weight.

One-way analysis of variance (ANOVA) test revealed that Gtf2ird1 mice showed a

significant decrease in body weight as demonstrated by analysis of both growth curve and adult

body weights (Figure 3.4A). Both Gtf2ird1+/-

(P<0.05) and Gtf2ird1-/-

(P<0.001) male mice

showed significant decreases as compared to control littermates. Body weights of female

Gtf2ird1-/-

(P <0.01) mice were significantly lower than those of wild type female mice while

those of Gtf2ird1+/-

were not significantly different. Growth retardation is a common feature of

WBS although it is unclear whether a difference exists between male and females. It was also

noted that a significantly more severe growth retardation and microcephaly is seen in WBS

individuals whose deleted chromosome maternally inherited, suggesting that an imprinted locus,

silent on the paternal chromosome and contributing to abnormal growth, may be affected by the

152

deletion (Perez Jurado et al., 1996). Since the majority of mice tested were derived from crosses

of two Gtf2ird1+/-

mice it would be difficult to determine whether the targeted allele was

inherited maternally or paternally. Similar results were also seen in growth curve analysis in

Gtf2ird1-/-

mice from 3 to 10 weeks of age (Figure 3.4B).

3.3.4: Assessment in the open field:

153

Open-field behavioral assays are commonly used to test both locomotor activity and

emotionality in mice. The open field test consists of a square or round chamber divided in

several quadrants. Once released into the chamber the spontaneous locomotor activity is

recorded. Mice will tend to avoid illuminated and open areas, favoring dark or sheltered

environments for activity. Typically, a mouse exposed to an unfamiliar situation will move

around less in the new environment, and when it does move, it will tend to stay by the walls. In

contrast, an animal that is not apprehensive will spend more time exploring the center of the

open field and will travel more distance. Increases in distance travel may also be an indication of

hyperactivity.

154

Gtf2ird1+/-

and Gtf2ird1-/-

mice displayed significant increases in locomotor activity

measured as both horizontal and vertical activity, which may be indicative of hyperactivity

(Figure 3.5A). Mice lacking Gtf2ird1 also showed decreases in fear response as measured in the

Open Field. Although there was no significant difference between wild type and Gtf2ird1+/-

mice, Gtf2ird1-/ mice spent a greater proportion of time in the central area of the open field arena

as compared to time spent near the wall and spent significantly less time freezing (Figure 3.5A).

Both hyperactivity and an altered fear response are common characteristics found in WBS

patients.

3.3.5: Gtf2ird1-/-

mice are less anxious in the elevated plus maze:

We evaluated state and trait anxiety, using the elevated plus maze and cube exploration

test respectively, and found that both were significantly reduced in the mutant mice. Gtf2ird1-/-

mice showed a significant increase in the amount of time spent in the open arms of the elevated

plus maze, compared to wild type mice (P<0.05), indicative of reduced anxiety involving

avoidable anxiety-provoking stimuli (Figure 3.6A). A similar, but not significant trend was seen

for the heterozygous mice. Pair-wise comparison also showed significant increases in total

entries (Figure 3.C; P <0.02) and head dips (Figure 3.C; P<0.03) for the Gtf2ird1-/-

mice. In the

cube exploration test, both the heterozygous and homozygous mice showed increased interest in

the cube compare to wild-type controls (Gtf2ird1+/-

; P<0.05; Gtf2ird1-/-

; P<0.001; Figure 3.6D).

155

3.3.6: Gtf2ird1-/-

mice display deficits in cued based fear conditioning:

Auditory fear conditioning utilizes a Pavlovian learning and memory paradigm to

identify alterations in hippocampus- and amygdala-based learning and memory (Schafe et al.,

2001). Fear conditioning is expressed by activity during the trial as a percentage of baseline

activity during training, with a low value being indicative of associative learning. In tests of

156

contextual and cued fear conditioning, deficits were seen for both Gtf2ird1-/-

and Gtf2ird1-/+

in

the cued but not contextual aspects of the test (Figure 3.7). Both Gtf2ird1-/-

and Gtf2ird1+/-

mice

displayed significantly higher values than wild-type mice during cued fear conditioning,

indicating less freezing in relation to the baseline values and reduced learning (P<0.02). In both

contextual and cued fear conditioning, baselines did not differ significantly between both

Gtf2ird1-targeted genotypes and wild type controls.

157

3.3.7: Resident Intruder: Gtf2ird1-/-

mice are less aggressive and engage in more social

interaction:

Mice were tested for changes in aggressive behaviour using the resident intruder paradigm.

Gtf2ird1+/-

and Gtf2ird1-/-

mice showed a significant decrease in the number of aggressive

interactions towards an unknown intruder mouse compared to wild type mice (P<0.05; Figure

3.8A). Gtf2ird1-/-

mice also showed a significant increase in the duration of time to initiate

aggression with the intruder (P<0.01; Figure 3.8B) and a reduction in the time spent engaging in

aggressive interactions with the intruder (P<0.05; Figure 3.8C). The Gtf2ird1 heterozygous mice

showed similar a trend towards less aggression for these two aspects of the test, but neither

reached statistical significance. Gtf2ird1+/-

and Gtf2ird1-/-

mice spent more time following after

the unknown intruder mouse (P<0.01; Figure 3.8D) and the Gtf2ird1-/-

mice also spent longer

sniffing the intruder (P<0.05; Figure 3.8E).

There was no significant change in tests for submissive behavior (defensive freezing and

active avoidance of partner). The interaction between the Gtf2ird1 test mice and the intruder was

not a result of deficits in olfaction in the mutants, since the time required finding unfamiliar

buried food was not significantly different between the genotypes (WT, 354 sec. +/- 84.7;

Gtf2ird1+/-

, 314.6 sec. +/- 22.7; Gtf2ird1-/-

, 279 sec. +/- 58.2).

159

3.3.8: Gtf2ird1-/-

mice have normal visuo-spatial learning and memory:

The hidden platform version of the Morris water maze test has been widely used to

examine alterations in visuo-spatial learning and memory in rats and mice (Morris, 1984; Lipp

and Wolfer, 1998). Performance in the Morris water maze depends on several mechanisms,

from attention, learning and memory, to vision and motor coordination. The cognitive processes

that underlie performance in this test are dependent on many biochemical pathways and is

thought to be dependent on the proper functioning of the hippocampus. Neither Gtf2ird1+/-

nor

Gtf2ird1-/-

mice showed significant difference in their performance compared to wild type

controls (P>0.05) during either the acquisition or the reversal phase (Figure 3.9). In probe tests,

no significant difference was observed between wild type control and Gtf2ird1 mutant mice

either for percentage of time spent in or number of crossings of the target quadrant (Figure 3.9).

160

3.3.9: Gtf2ird1-/-

mice display cerebellar structural abnormalities and muscular deficits

along with deficits in motor co-ordination on the rotorod test:

161

Structural abnormalities consisting of the loss of the parafloccular sulcus were identified

in approximately 80% of Gtf2ird1-/-

mice (Figure 3.10). It was determined that although the

overall size of the paraflocculus was not altered in Gtf2ird1-/-

mice the length of the Purkinje cell

layer, and presumably therefore the number of Purkinje cells, was significantly decreased in

Gtf2ird1-/-

mice. To determine what affect the observed variation in the structure of the

paraflocculus may have on co-ordination and motor function, testing was performed at TCP.

Grip strength analysis determined that Gtf2ird1-/-

mice showed a trend towards a strength

deficiency in the forelimbs (although not statistically significant). When a combined forelimb

and hind limb strength was measured, a significant deficit (P<0.05) was observed (Figure 3.11).

164

This deficiency was evident from the first trial day of testing and Gtf2ird1-/-

mice showed

no improvement after the second day of testing indicating that there may also be a deficit in

165

motor learning (Figure 3.12). Further test showed that Gtf2ird1-/-

mice did not have problems

with gait or balance issues. It has been previously demonstrated that Gtf2ird1 can act as a

repressor of the muscle specific Troponin I slow promoter, and therefore a loss of functional

TFII-IRD1 protein may result in the decrease of slow twitch (Type I) muscle fibers.

3.3.10: Gtf2ird1-/-

mice show altered serotonin metabolite levels in various brain regions:

Levels of the serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) were found to

be significantly elevated in the amygdala (P<0.05), frontal cortex (P<0.05) and parietal cortex

(P<0.05) (Table 3.2) of Gtf2ird1-/-

mice. Increases in 5-HIAA were also seen in the occipital

cortex and striatum in Gtf2ird1-/-

mice although these increases did not reach statistical

significance (P=0.09 and 0.065, respectively). No significant changes were seen for serotonin,

dopamine or its metabolites (DOPAC and HVA) in any of the regions tested.

166

Table 3.2. Serotonin Metabolite 5HIAA Levels are Increased in the Amygdala, Parietal

Cortex and Occipital Cortex

Genotype DA DOPAC HVA 5HT 5HIAA 5HT/5HIAA

Amygdala WT 2110±380 232±33 294±4 966±69 415±18 2.34

KO 1940±240 220±18 264±24 1120±63 509±32* 2.24

Cerebellum WT 28.3±5.3 19.0±5.0 21.8±2.4 458±51 200±13 2.31

KO 21.6±3.9 15.2±1.9 20.3±1.3 398±35 185±18 2.22

Frontal

Cortex

WT 1380±110 182±18 269±8 832±51 234±16 3.98

KO 1480±95 207±28 279 ±9 886±58 297±17* 3.04*

Occipital

Cortex

WT 97.8±15.3 21.0±3.0 32.3±7.7 830±96 321±33 2.77

KO 78.7±11.0 21.5±1.9 25.2±6.2 800±81 370±25 2.22

Parietal Cortex

WT 706±58 77.9±5.8 136±10 736±57 366±29 2.19

KO 595±89 70.4±8.0 117±13 780±45 469±41* 1.71*

Striatum WT 14520±1110 907±54 1240±58 780±33 828±46 0.988

KO 13480±776 973±78 1220±83 783±43 933±59 0.854

Values are represented as mean+/-SEM in pg/mg of tissue. P values represent the results analyzed by two-tailed

Student‘s t test, *P<0.05). DA, dopamine; DOPAC, 3,4-dihydroxyphenylacetic acid; HVA, 3-methoxytyramine;

5HT, serotonin; 5-HIAA, 5-hydroxyindoleacetic acid.

Quantitative PCR analysis was used to identify changes in the expression of serotonin-

related mouse genes including receptors; 5ht1a, 5ht1b, 5ht2a, 5ht2c and monoamine oxidase a

(Maoa) the enzyme responsible for the degradation of serotonin. Areas identified as being

having altered levels of serotonin or metabolites including amygdala, frontal and parietal

cortexes as well as the raphe nucleus. For all genes tested there were no changes in the

amygdala and the frontal cortex. In the parietal cortex, expression of the 5ht1b receptor is

reduced by 30%. In the raphe nucleus, expression of the 5ht1b receptor was increased by 30%.

Expression of the 5ht2a receptor was increased by 20% and expression of the MAOA gene was

increased by 15%. Quantitative PCR analysis was used to measure changes in c-fos expression.

Areas tested included the amygdala, frontal and parietal cortexes as well as the raphe nucleus. In

167

males mice baseline levels of c-fos was reduced by 50% in knockout mice compared to wild

type. Upon exposure to a stress-inducing environment a 60% reduction in the expression of c-

fos was identified in the frontal cortex of knockout mice relative to wild type (Figure 3.13).

3.3.11: Alterations in neuronal activity in Gtf2ird1-/-

mice:

c-Fos immunostaining was performed to look for alterations in brain activity that has

been previously associated with anxiety-related mouse models. In Gtf2ird1-/-

mice, it was

determined that after exposure to a stress-inducing environment (30 minutes in a brightly lit open

field) there was a significant decrease in the number of Fos-IR cells in the pre-limbic and infra-

limbic areas of the frontal cortex as well as the cingulate cortex extending from the frontal to the

168

retrosplenial cortex indicating that this area is less active during stress (Figure 3.14).

169

3.3.12: Serotonin elicits larger outward currents in layer V pyramidal neurons in

Gtf2ird1-/-

mice:

A neurotransmitter that is commonly altered in anxiety related mouse models is serotonin

(5-HT). It had been previously determined that serotonin metabolite levels in the frontal cortex

of Gtf2ird1-/-

were altered, therefore to elucidate the possible mechanism responsible for the

alteration in serotonin levels, patch clamps readings were performed in collaboration with Dr.

Evelyn Lambe.

Experiments were performed blind to genotype in a cohort of Gtf2ird1-/-

(n = 5) and WT

(n = 5) animals. In both groups, bath application of 5-HT (30 µM, 30 s) induced prominent

inhibitory outward currents in voltage clamp that were repeatable on a second application after

washout. The mean outward current was significantly larger in the Gtf2ird1-/-

mice (Figure 3.15

- controls: 20 ± 2.8 pA, n = 45; Gtf2ird1-/-

mice: 34 ± 4.7 pA, n = 36; two-tailed unpaired t test, P

< 0.05). There were no significant differences in the membrane properties of the neurons

between the genotypes. The average membrane potential was -88 ± 1 mV in controls (n=66 cells)

and -86 ± 1 mV in Gtf2ird1-/-

mice (n=63), input resistance was 146 ± 10 MΩ in controls (n =

66) and 144 ± 9 MΩ in Gtf2ird1-/-

(n = 63) and spike amplitude was 77

± 1 mV in controls (n = 66) and 80 ± 1 mV in Gtf2ird1-/-

(n = 63) mice. Therefore, despite

similar baseline properties, 5-HT appears to inhibit layer V output neurons of prefrontal cortex to

a greater extent in Gtf2ird1-/-

mice than wild type controls.

171

3.3.13: 5-HT-elicts direct outward currents mediated by 5-HT1A receptor in Gtf2ird1-/-

mice:

To determine if the observed changes in the outward currents were mediated directly by

5-HT receptors located on the recorded cell, 5-HT was added before and after blocking the

voltage-gated sodium channels necessary for action potential dependent neurotransmitter release

with tetrodotoxin (TTX, 2 µM, 10 min). The 5-HT-elicited outward currents were resistant to

TTX, with current amplitudes 99 ± 14% (n = 5) that of currents recorded prior to TTX

application in controls and 98 ± 10% (n = 4) in Gtf2ird1-/-

(Figure 3.16). Paired t tests revealed

that responses were not significantly different before and after TTX application in wild type (P =

NS) or Gtf2ird1-/-

animals (P = NS). These results suggest that the recorded responses are

directly mediated by 5-HT receptors on the layer V neurons.

The different subtypes of serotonin receptors are variably expressed throughout the brain

(Nichols and Nichols, 2008). However, the 5-HT1A receptor subtype is prominently expressed in

the prefrontal cortex where it mediates well-documented inhibitory influences (Araneda and

Andrade, 1991; Béïque et al., 2004; Goodfellow et al., 2009) for regulating anxiety (Gross et al.,

2002; Tauscher et al., 2001; Lanzenberger et al., 2007). The selective 5-HT1A antagonist WAY-

100635 (30 nM, 10 min) was applied to determine whether the observed 5-HT responses were

indeed mediated by the 5-HT1A receptor subtype. As shown in Figure 3.16, the outward currents

elicited by 5-HT (30 µM, 30 s) after pre-incubation with WAY-100635 (30 nM, 10 min) were

almost completely eliminated with 100 ± 0% (n = 4) suppression seen in controls and 99 ± 8% (n

= 7) suppression seen in Gtf2ird1-/-

mice. In both genotypes, matched pair t-test statistics confirm

a significant current reduction in the presence of WAY-100635 (P < 0.05). In layer V pyramidal

172

cells of controls and Gtf2ird1-/-

animals, therefore, the recorded 5-HT responses appear to be

directly mediated by 5-HT1A receptors.

173

3.3.14: Serotonin 5-HT1A outward currents are unchanged in prefrontal layer II/III in

Gtf2ird1-/-

mice:

5-HT has also been shown to exert inhibitory influences on 5-HT1A receptors within layer

II/III cells of the medial prefrontal cortex (Goodfellow et al., 2009). To determine whether these

outward currents were enhanced the Gtf2ird1-/-

mice, 5-HT responses recorded in layer II/III

cells and found to be not significantly different between Gtf2ird1-/-

and WT animals. Following

application of 5-HT (30 µM, 30 seconds), the average inhibitory current recorded in cells from

WT animals was 26 ± 3.2 pA (n = 12 cells) and 29 ± 12 pA in the Gtf2ird1-/-

(n = 9 cells) (P =

NS). Therefore, the larger inhibitory responses elicited by 5-HT in Gtf2ird1-/-

mice is specific to

layer V and not present in layer II/III.

3.3.15: Other inhibitory currents are not enhanced in layer V in Gtf2ird1-/-

mice:

5-HT1A receptors exert their influence through a Gi/o-coupled mechanism. Alterations in

the coupling of 5-HT1A receptors to their downstream effectors in Gtf2ird1-/-

mice might also

result in enhanced currents elicited by other Gi/o-coupled receptors. Layer V pyramidal neurons

are known to also express two other inhibitory Gi/o-coupled receptors: mGluR2/3 (Petralia et al.,

1996; Melendez et al., 2004) and GABAB receptors (Charles et al., 2003). However, the induced

outward currents in layer V pyramidal neurons elicited by mGluR2/3 agonist t-APDC (30 µM, 15

s) and the GABAB agonist baclofen (3 µM, 15 s) were not significantly different between

genotypes suggesting that altered receptor function in the Gtf2ird1-/-

mice may be specific to 5-

HT1A receptors (Figure 3.17). The mGluR2/3 agonist t-APDC elicited inhibitory outward currents

of 21 ± 6.0 pA in WT (n = 6) and 24 ± 7.0 pA in Gtf2ird1-/-

(n = 4) (P = NS) while baclofen

174

induced currents of 55 ± 5.8 pA in controls (n = 6) and 66 ± 8.5 pA in Gtf2ird1-/-

(n = 8) (P =

NS).

175

3.3.16: Spine density in layer V pyramidal cells in Gtf2ird1-/-

mice is unchanged:

Spines density was measured in pyramidal cells in layer V of the medial prefrontal and

somatosensory cortexes. There were no differences between genotypes observed in the spine

density of either basal or apical dendritic spines (Figure 3.18). It should be noted that no

distinction was made on the type of spine (thin, mushroom or stubby) that was recorded. No

distinction was made also in the maturation state of the spine or the shape of the spine neck. All

of these characteristics have been shown to be important to the proper functioning of the

associated synapses (Nimchinsky et al., 2002). The results indicated in Figure 3.18 demonstrate

only that the density of protrusions present of the basal and apical dendrites of neurons located in

layer V of the medial prefrontal and somatosensory cortexes in Gtf2ird1-/-

mice do not differ

significantly from that of wild type mice.

177

3.3.17: 5-HT receptor expression is unchanged in the frontal cortex of Gtf2ird1-/-

mice:

It was previously determined that the targeting of Gtf2ird1 results in alterations in

aggression and anxiety possibly resulting from increase in the levels of serotonin (5HT) and its

metabolite 5-HIAA detected in several areas of the brain including the frontal cortex (Table 3.2).

To determine the possible cause of these changes in serotonin levels, qPCR analysis was used to

detect changes in gene expression of genes involved in the metabolism, storage and transport of

serotonin including monoamine oxidase A (MAOA) that is responsible for the conversion of 5HT

to 5-HIAA. No changes were found in the expression levels serotonin receptors 5-HT1A, 5-HT2C,

MAOA, involved in the synthesis of serotonin. Slight but statistically significant alterations in

gene expression were identified for the 5ht1b and 5ht2a receptor in the raphe nucleus with 5ht1b

showing a 30% increase and 5ht2a showing a 20% increase in expression relative to wild type

control mice. The expression of multiple candidate genes whose alteration has been shown to

result in a similar phenotype, were also tested and found not significantly altered in Gtf2ird1-/-

mice. These genes included Gdi1, hRH3 (histamine receptor), BDNF as well as three subunits of

the GABAA receptors (α2, β2 and γ2) (Data not shown).

178

Table 3.3. Expression of Serotonin Receptors in Gtf2ird1-Targeted Mice.

Tissue Receptor Expression relative to WT P-Value

Raphe

Nucleus

5-HT1A 1.09 0.34

5-HT1B 1.38 0.025

5-HT2A 1.22 0.012

5-HT2C 1.19 0.16

MAOA 1.13 0.029

Amygdala

5-HT1A 0.92 0.32

5-HT1B 0.95 0.62

5-HT2A 1.09 0.37

5-HT2C 1.05 0.66

MAOA 0.93 0.050

Parietal

Cortex

5-HT1A 0.85 0.064

5-HT1B 0.74 0.027

5-HT2A 1.03 0.36

5-HT2C 1.21 0.18

MAOA 0.97 0.29

Frontal

Cortex

5-HT1A 1.13 0.26

5-HT1B 0.96 0.76

5-HT2A 1.12 0.30

5-HT2C 1.09 0.31

MAOA 0.92 0.37

179

3.3.18: Identification of stress-induced changes in gene expression in Gtf2ird1-/-

mice using

microarray analysis:

Given Gtf2ird1’s known role as a transcription factor, wild type and Gtf2ird1 knockout

mice were again exposed to a brightly lit open field for 30 minutes, and a gene expression

microarray analysis was performed. Some of the genes identified whose expression was

determined to be at least 2-fold increased or decreased are listed it Table 3.3.

Table 3.4. Microarray Results for Genes Whose Expression was Increased or Decreased

Two-Fold or Greater.

Gene ID Description Fold Change Adjusted P-Value

Increased Expression in Gtf2ird1-targeted mice (relative to wild type)

Csrp1 cysteine and glycine-rich protein 1 4.5 0.00056

Psmc3ip proteasome (prosome, macropain) 26S

subunit, ATPase 3, interacting protein 3.7 9.8x10

-9

LOC100044862 similar to Fbxl3 protein 3.1 2.8x10-9

2610528E23RIK Unknown 2.7 5.5x10-13

Prkag2 protein kinase, AMP-activated, gamma

2 2.6 0.00011

Egr2 early growth response 2 2.4 0.0025

Arc activity-regulated cytoskeleton-

associated protein 2.2 0.0016

Decreased expression in Gtf2ird1-targeted mice (relative to wild type)

Serpin1 Serine protease inhibitor 1 0.12 4.0x10-14

Ttc27 tetratricopeptide repeat domain 27 0.34 0.011

LOC677448 similar to actin, Actl8 0.35 0.005

Trpc4 Transient receptor potential cation

channel, subfamily C, member 4 0.37 2.0x10

-12

180

Gene ID Description Fold Change Adjusted P-Value

Actl6b actin-like 6B (Baf53b) 0.38 8.4x10-10

B130052F17RIK Unknown 0.41 0.038

Zfp68 Zinc finger protein 68 0.47 0.016

The expression of multiple genes was identified as being increased or decreased although

to date, only one gene (Trpc4) has been validated using quantitative PCR. It was shown that the

expression of Trpc4 was reduced by 50% in Gtf2ird1-/-

mice (Figure 3.19).

182


Williams-Beuren syndrome is a complex disorder characterized by distinctive physical,

cognitive and behavioral abnormalities including gregarious personalities, mental retardation,

learning difficulties, visuo-spatial problems, hypersensitivity to certain sounds, attention deficit,

inappropriate friendliness and lack of normal risk assessment (Mervis and Klein-Tasman, 2000;

Mervis et al., 2000). Although at least 26 genes lie within the commonly deleted region, to date

only elastin has been unequivocally implicated in any aspect of the disorder, namely the

cardiovascular abnormalities (Curran et al., 1993). This is at least partly due to the small

numbers and phenotypic variability of individuals identified with atypical deletions of the region,

thereby making genotype-phenotype correlation difficult. Since even in these individuals

multiple genes are often deleted it is not possible to definitively determine the contribution of

specific genes to the WBS phenotype. For this reason, mouse models have become a powerful

tool for the elucidation of the role of specific genes in the complex WBS phenotype. Mouse

models for multiple WBS genes exist but none appear to recapitulate the disorder providing

evidence that WBS is a contiguous gene disorder and that the resulting phenotype is likely the

consequence of the loss of multiple genes from within the WBS critical region.

In this work it has been demonstrated that alterations in the expression of Gtf2ird1 in

mice results in growth deficiency, and altered behaviors related to both innate and learned fear

that have not been reported in previous mouse models (Crackower et al. 2003; Fujiwara et al.

2006; Hoogenraad et al. 2002; Li et al. 1998; Meng et al. 2002; Tassabehji et al., 2005; van

Hagen et al., 2007; Zhao et al., 2005). These include increased sociability, decreased aggression

and natural fear response, along with deficits in learning and memory, similar to changes

183

observed in WBS, suggesting that the haploinsufficiency of GTF2IRD1 may contribute to the

physical, behavioral and cognitive deficits associated with this disorder. The distinctive

behavioral profile is one of the defining characteristics of WBS and insight into the genetic basis

of this aspect of the phenotype will be critical not only for understanding the molecular basis of

WBS, but also the possible contribution to normal human behavior.

3.4.1: Gtf2ird1+/-

and Gtf2ird1-/-

mice show mild growth retardation:

Growth deficiency has long been associated with WBS, with mean adult height

corresponding to the third percentile in both sexes (Pankau et al., 1992). Significant growth

deficiencies were observed in both males and female Gtf2ird1-deficient mice with decreases seen

for body weight (figure 3.4). Similar data was recently reported in another mouse model with a

disruption of Gtf2ird1 caused by transgene insertion, where mice homozygous for the insertion

showed weights between 9.4% and 13.9% lower than those of wild-type littermates (Tassabehji

et al., 2005). We also observed significant growth retardation in adult male Gtf2ird1+/-

mice

indicating that hemizygosity for Gtf2ird1 is sufficient for a disruption of normal growth

consistent with that seen in WBS. Similar results were also seen in a mouse deficient for another

gene from the WBS deletion, Clip2 (Cyln2) (Hoogenraad et al., 2002). Mild growth retardation

was seen in null mice for both sexes and significant growth retardation was observed in female

Clip2+/-

mice. Taken together, these results raise the possibility that the growth deficiency seen

in individuals with WBS results from the additive hemizygosity for Clip2 and Gtf2ird1 although

Clip2 levels were shown to be normal in our Gtf2ird1 mutant mice.

184

Another characteristic of WBS is the distinctive dysmorphic facial features that are

highly penetrant in all individuals with the common WBS deletion. Although initial analysis

failed to identify any differences in jaw alignment in the Gtf2ird1 homozygous mice generated in

this study, a careful quantitative analysis may be required to identify possible subtle

abnormalities that may exist. Previously craniofacial abnormalities, including a proportion of

homozygous mice that were observed to have misaligned jaws, were reported in a Gtf2ird1

mutant generated by random insertion of a c-myc transgene that deleted the first untranslated

exon of Gtf2ird1 (Tassabehji et al. 2005). In this work, a patient (HR) was also identified that

contained an atypically small deletion of the WBS region that spared GTF2I. This patient was

reported to have a milder facial dysmorphism than commonly seen in WBS. While WBS

individuals exhibit differing degrees of severity in craniofacial dysmorphology, thought to be a

result of genetic background, the milder dysmorphic features seen in HR may indicate that the

facial features characteristic of WBS may result from the loss of multiple genes within the WBS

region.

In a recently published report, bitemporal narrowing was identified in a small subset of

Gtf2ird1 gene trap mice (Enkhmandakh et al., 2009). Additionally, hydrocephaly, kyphosis and

hypoplasia of the mandible was also noted, none of which was identified in the present model. It

should be noted that the targeting of Gtf2ird1 was also different between these two models.

While the removal of the first coding exon in the present model does leave the possibility of an

alternate transcript, translation of the remaining coding sequence will likely result in a out-of-

frame nonsense protein or a truncated TFII-IRD1 missing the first I-repeat and the leucine zipper

motifs known to be essential for protein-protein interactions and DNA binding respectively

(Jackson et al., 2005). In the gene trap model, the trapping vector integrates near the 3‘ end of

185

the gene and although the rationale for this is that the resulting protein would lack the nuclear

localization signal to translocate to the nucleus, it would produce an almost full length protein

with all the functional domains necessary for protein-protein interactions. Since TFII-IRD1 is

also known to counter-regulate TFII-I (Jackson et al., 2005) and given TFII-I‘s known

cytoplasmic function (Tussié-Luna et al., 2001; Hakre et al., 2006), it is possible that the TFII-

IRD1/LacZ fusion protein produced may disrupt proper TFII-I function. Consistent with this,

the report also includes a description of a Gtf2i gene-trapped mouse model and although the two

genes are differentially expressed spatially and temporally, the resulting phenotype is highly

similar between the two models.

Craniofacial abnormalities were also observed in WBS deletion mouse model containing

overlapping deletions consisting of a proximal region (Gtf2i to Limk1) and a distal region (Limk1

to Trim50) (Li et al., 2009). Interestingly, the most striking abnormalities, including a

shortening of the skull, were seen in the mice carrying the overlapping deletion of the entire

WBS region and mice carrying a deletion of the distal portion of the region had similar but less

significant changes. However, male mice carrying a deletion of the just the proximal region

(including a hemizygous deletion of Gtf2ird1) displayed an increase in the overall length of the

skull and female mice showed no significant difference in skull length. Although the mice

studied were only hemizygously deleted for Gtf2ird1, it appears likely that it is the

haploinsufficiency of genes within the distal portion of the deletion (LIMK1 to TRIM50) that

may primarily contribute to the craniofacial abnormalities seen in individuals with WBS.

This apparent phenotypic variability may also be due to the influence of additional genes

that are involved in the pathways that regulated craniofacial development. It should be noted that

the mice generated in this study are maintained on a CD1 heterogeneous outbred genetic

186

background that most closely mimics the human population, whereas the other mouse models

were on a predominantly homogeneous inbred C57BL/6 background.

3.4.2: Changes in behavior including aggression and anxiety and sociability in Gtf2ird1-/-

mice:

Although Gtf2ird1 mouse models have previously been reported (Durkin et al., 2003:

Tassabehji et al., 2005; van Hagen et al., 2007; Enkhmandakh et al., 2009), no in-depth

cognitive or behavioral testing was performed. Given the breadth of behavioral and cognitive

impairment in WBS, the mice generated in this study were subjected to different paradigms

aimed at probing both natural behaviors and cognitive abilities in order to try to address the role

of any gene in the WBS phenotype.

Gtf2ird1-/-

mice displayed a decrease in anxiety, as evidenced by their performance in the

elevated plus maze apparatus, in an apparent direct contrast to people with WBS, the majority of

whom have either generalized anxiety disorder or simple phobias (Mervis and Klein-Tasman,

2000; Dykens, 2003). The decrease in anxiety seen in the mice was somewhat unexpected,

however, it is likely that the elevated plus maze is not testing the same physiological response as

that seen in people with WBS, who tend to have simple phobias based around specific fears,

often related to social situations or to hypersensitivity to particular sounds (Blomberg et al.,

2006). Anxiety has been described as a future oriented emotion connected to worry and dwelling,

which may not be the same as the distinct alarm signal connected to a specific object or situation

that seems to be more applicable to mouse behavior (Barlow, 2002). Alternatively, it could be

that the anxiety state of both the mice and humans are altered by hemizygosity for Gtf2ird1, but

in opposite directions.

187

Perhaps the most intriguing behavior noted in mice with disruption of Gtf2ird1 was the

significantly altered social interactions as well as changes in aggressive behavior. Both

heterozygous and homozygous mutants showed less aggression towards, and more interest in,

unfamiliar ―intruder‖ mice (Figure 3.8). People with WBS almost universally exhibit over-

friendliness with inappropriate social boundaries and frequently approach and/or initiate social

interactions with strangers (Doyle et al., 2004; Klein-Tasman and Mervis, 2003). The phenotype

seen in the Gtf2ird1-targeted mice is intriguingly reminiscent of the hypersociability and

disinhibition seen in individuals with WBS. The exact neural mechanisms regulating social

behavior are unknown, but the amygdala is known to play a primary role, since lesions of this

area of the brain in non-human primates result in impaired or inappropriate social function

(Prather et al., 2001; Amaral, 2002). Recent neuroimaging studies of people with WBS using

functional Magnetic Resonance Imaging (fMRI) revealed reduced activation of the amygdala

when processing images of threatening faces, suggesting an underlying dysfunction (Meyer-

Lindenberg et al., 2005). The molecular mechanisms governing the perception of and reaction to

danger and threatening situations have also been linked to the amygdala. Given its role as a

transcription factor it will be interesting to investigate in the Gtf2ird1 mice, genes that have been

implicated in fear and social response such as oxytocin has been firmly established as central

mediator of social behavior and stathmin, a molecule highly expressed in this region, the has

recently been implicated in both innate and learned fear (Winslow and Insel, 2002; Shumyatsky

et al., 2005) Although not altered in the microarray and expression analysis, further refinement

of the experimental design will likely be necessary to elucidate the genes that contribute to the

fear and anxiety-related phenotype.

188

The alterations in aggressive and social behavior seen in the Gtf2ird1-/-

mice suggests that

this gene plays an essential role in the regulation of aggression and normal social interaction in

rodents, possibly in pathways that influence transcription of the molecules mentioned above.

Interestingly, although almost all individuals with WBS exhibit the same cognitive profile,

individuals have been identified with smaller than normal deletions of the WBS region, leaving

genes at the distal end intact, who do not exhibit hypersociability (Tassabehji et al., 2005;

Ferrero et al., 2010). In one of these individuals, the deletion spanned all of the commonly

deleted genes except GTF2I, suggesting that in humans the WBS behavioral profile may be the

product of the combinatorial effect of hemizygosity for both GTF2IRD1 and GTF2I, or perhaps

other genes from within the commonly deleted interval.

The finding that Gtf2ird1-/-

mice exhibit low anxiety and increased interest in other mice

is highly important, especially since prior to the characterization of this mouse, no other mouse

model exhibited behaviors akin to the hypersociability seen in WBS. However, Gtf2ird1-/-

mice

exhibit decreased anxiety in tests for both social (resident intruder test) and non-social (elevated

plus maze task) anxiety, in contrast to individuals with WBS, who despite their low social

anxiety tend to display a high degree of non-social anxiety with approximately half of patients

suffering from specific phobias (Dykens, 2003; Leyfer et al., 2006). Alternatively, it is possible

that the elevated plus maze is not testing the same physiological response as that seen in people

with WBS. The representation of the novel object normally elicits fear response in animals or

neophobia. However, in this situation Gtf2ird1-/-

mice expressed an enhanced interest in the

novel object in the home cage, in part confirming their less anxious state observed in the plus-

maze. It is also possible that the lack of fear exhibited by these mice is masking any potential

189

anxiety elicited by being in the plus maze. The administration of anxiogenics before testing in

the plus maze may help distinguish between lack of fear response and reduced anxiety.

3.4.3: Gtf2ird1-/-

mice display deficits in muscle function:

Gtf2ird1 was originally identified as being able to modulate the expression of the muscle

type specific troponin 1 slow gene (O‘Mahoney et al., 1998). Mice presented in this study show

significant deficits in the fix-speed version of the rotorod test indicating a possible deficit in the

motor co-ordination (Figure 3.12). Interestingly, structural abnormalities were also identified in

the length (and presumably numbers) of the Purkinje cell layer in a large number of Gtf2ird1-/-

mice. However, results from the evaluation of grip strength (Figure 3.11) indicate that the

deficits seen in rotorod result may be due to a decrease in muscle function rather than difficulty

in motor co-ordination. When fore and hind limbs are evaluated together, Gtf2ird1-/-

mice show a

highly significant (P<0.01) decrease in grip strength (force). It is therefore possible that the poor

performance was due to the inability of the mice to grip the rotating rod due to decreased muscle

strength and not due to deficits in neurosensory motor function. Although there is not a

substantial decrease in grip strength observed in the Gtf2ird1-/-

mice (<20%), the decrease in grip

strength and deficits in rotorod performance are consistent with previously reported mouse

models of motor disorders including the R6/2 mouse model of Huntington‘s disease (Benn et al.,

2009).

These findings of changes to muscle function and motor co-ordination conflict with the

evaluation of the existing single gene Gtf2ird1 mouse model. Insertional mutant mice generated

by Durkin et al., (2001) and evaluated by van Hagen et al (2007) and were found to perform

190

better than wild type mice on the accelerating rotorod test while mice homozygously deleted for

Clip2 performed very poorly, thereby implicating Clip2 in the motor co-ordination deficits seen

in WBS. Consistent with these findings, a ―proximal deletion‖ mouse model hemizygously

deleted for the genes between Limk1 and Gtf2i (including Gtf2ird1and Clip2) was shown to

display motor deficits (Li et al., 2009). However that in the same report, a mouse carrying a

hemizygous deletion of the syntenic region of the commonly deleted WBS region in humans

(P/D) resulted in a greater deficit in motor function, indicating that genes telomeric to Limk1 may

also contribute to the motor deficits seen in WBS. It should be noted, that the mouse carrying

the deletion of the entire region was also homozygously deleted for Limk1, and since no motor

function analysis was performed on the existing single gene Limk1 knockout mouse model

(Meng et al., 2002), it cannot be ruled out that the increase in motor function deficits in P/D mice

may have resulted from the homozygous loss of Limk1. Staining of muscle sections from wild

type and Gtf2ird1-/-

mice will be necessary to look for alterations in the relative distribution of

slow and fast twitch fibers that may contribute to the deficits in muscle function observed in

Gtf2ird1-/-

mice.

As with other quantitative traits, performance on motor function tests is likely

significantly influence of various genetic factors. The genetic background of the Gtf2ird1

model presented in this study is different from those presented in previous reports. The mice in

this report are predominantly on an out-bred CD-1 background while the previously reported

mice are on inbred C57/Bl5 (Durkin et al., 2001; van Hagen et al., 2007) or a mixed C57/Bl6 –

129 background. Since genetic background has been shown to contribute to variability in motor

function (Crawley, 1999) the difference in performance on motor function task may also be

influenced by strain-specific modifier genes.

191

3.4.4: Gtf2ird1-/-

mice have altered fear-based learning, but normal spatial learning and

memory:

A severe deficits in spatial memory is a defining characteristic of WBS however, it

appears that a decrease in the expression of Gtf2ird1 alone is not sufficient to produce clear

deficits in hippocampal-based learning tasks, such as contextual fear conditioning and the Morris

water maze. Gtf2ird1-/-

mice did require significantly more time to find in the hidden platform on

the first two days of testing in the water maze, however no differences were observed beyond

day 2 (Figure 3.9). There were also no differences during the reversal phase. Further evidence

that hippocampal functioning is intact in Gtf2ird1-/-

mice comes from electrophysiological

recordings from the CA1 region of the hippocampus, performed by Zhengping Jia at the Hospital

for Sick Children, which showed normal basal synaptic activity and long-term potentiation.

Gtf2ird1-/-

mice also had normal response in contextual-based learning suggesting that

hippocampal function is intact. Gtf2ird1-/-

mice did however have difficulty learning to associate

the tone with foot shock during cued-based learning tests possibly indicating that amygdala-

dependent fear learning may be impaired (Phillips and LeDoux, 1992).

To date, no single gene mouse model has been shown to result in clear spatial learning

deficits. Mice lacking Clip2 displayed impaired reversal learning but there were no differences

between genotypes during the initial hidden stages. As with the Gtf2ird1 mouse model, the

observed difference is only present in homozygous deleted mice with no significant differences

seen in the heterozygotes. It is intriguing to postulate that the visuo-spatial deficits seen in WBS

are the result of a combinatorial decrease in expression of multiple genes within the commonly

deleted region.

192

Individuals with unusual deletions of 7q11.23 supporting the role of the GTF2I gene

family in spatial learning have been recently reported. In one individual, a deletion spanning the

commonly deleted WBS region but sparing GTF2I resulted in visual spatial impairment but not

to the degree seen in people with WBS (Tassabehji et al., 2005), whereas in a second individual

a deletion that removed both GTF2IRD1 and GTF2I, but none of the other commonly deleted

genes showed weakness in visuo-spatial skills equivalent to that seen in people with WBS

(Edelmann et al., 2007). Although the cases of atypically small deletions of the WBS region are

few in numbers, there is increasing evidence that the GTF2I gene family play a critical role in the

cognitive and visual spatial deficits that are a hallmark of WBS. van Hagen et al (2007)

identified a teenage male with the common centromeric breakpoint but with a telomeric

breakpoint in RFC2, sparing CLIP2 and the GTF2I gene family. This individual displayed

superior cognitive abilities, including visual-spatial performance. Recently, two multi-

generational families have been identified with deletions spanning from VPS37D to RFC2 in one

family and CLDN3 to GTF2IRD1 in the other. In both families, GTF2I is not deleted and the

affected individuals display normal cognitve and visual spatial skills (Antonell et al., 2009). A

patient has also recently been identified by Ferrero et al., (2010) as possessing a deletion from

BAZ1B to CLIP2 and consistent with the previous families, this patient had a normal IQ and

considerably greater visual spatial abilities then that typically seen in WBS.

3.4.5: Gtf2ird1-/-

mice show altered serotonin metabolite levels in the brain:

Since it is known that neurotransmitters play a central role in fear and anxiety-related

phenotypes, an examination of neurotransmitter levels was performed. Although overall

serotonin levels were unchanged in Gtf2ird1-/-

mice relative to wild type in all areas analysed, the

193

serotonin metabolite 5HIAA was found to be increased in several brains regions including the

frontal cortex. The neurotransmitter serotonin has previously been shown to play a central role

in emotional behaviour, as evidenced by brain serotonergic abnormalities in human emotional

disorders and the therapeutic efficacy of drugs targeting this system (Ballenger, 1999).

Decreases in serotonin levels shown to cause an increase in aggressive behavior in rodents

(Vergnes et al., 1986) as well as depression in humans (Ogilvie et al., 1996). In rodents,

administration of a 5-HT1B receptor agonist was shown to reduce aggression (De Almeida et al.,

2006) while alteration of 5-HT1A and 5-HT2A receptor density and binding have also been linked

to changes in aggression (Caramaschi et al., 2007; Schiller et al., 2006). Although no changes in

the levels of serotonin receptor expression were observed in the frontal cortex of Gtf2ird1-/-

mice,

a significant increase in the levels of 5ht1b mRNA was identified in midbrain samples containing

the raphe nucleus where the protein functions as an autoreceptor (Table 3.2). It has been

demonstrated that increased 5-HT1B autoreceptor expression in the dorsal raphe nucleus results in

reduced anxiety in unstressed animals (Clark et al., 2004). Increases in the expression of 5ht2a

and MoaA mRNA‘s were also identified in midbrain samples containing the raphe nucleus.

Although these changes in gene expression have yet to be confirmed at the protein level,

alteration in the expression levels of these genes would be consistent with the phenotypic

changes seen in Gtf2ird1-/-

mice.

Interestingly, although the tissue serotonin content was not significantly increased in any

of the regions tested overall, there was a significant increase of the serotonin metabolite 5-HIAA

in the frontal and parietal cortices and the amygdala in the Gtf2ird1-/-

mice suggesting an

alteration in post-synaptic serotonin turnover rather than an overall increase in serotonin

production. It has been demonstrated through the use of pharmacological agents that the

194

elevation of mood usually involves one of three mechanisms. i) the increase of serotonin levels

through the administration of the serotonin precursor 5-hydoxytryptophan, 5-HTP, ii) the

inhibition of MAOA leading to increased amounts of stored serotonin, or iii) the blocking of the

reuptake of serotonin into the pre-synaptic nerve terminal. The increase in 5-HIAA levels

without a corresponding increase in serotonin levels indicate that the behavior phenotype seen in

Gtf2ird1-targeted mice is due to an increased release of serotonin rather than an overall increase

in serotonin production levels. Further experiments are needed to determine the mechanism by

which serotonergic pathways are altered in the Gtf2ird1-targeted mice.

3.4.6: Gtf2ird1-/-

mice show altered neuronal activity:

The changes in behavior and alterations of the serotonin levels in multiple brain regions

provide evidence that neuronal activity is affected in Gtf2ird1-/-

mice. In particular, it appears

that the frontal cortex, long known to be critical in the regulation of fear and anxiety related

behaviours, is not functioning normally. The interaction between the frontal cortex and the

amygdala is thought be crucial for making appropriate social judgments (Davidson et al., 2000)

with lesions of the OFC in humans associated with social dis-inhibition, and disturbance of the

functional interaction between the OFC and amygdala in subjects with WBS thought to be

contributing to social dis-inhibition, reduced reactivity to social cues and an increased tendency

to approach strangers (Aramal, 2002). Brain activity was assessed in the amygdala and frontal

cortex in our mouse model using the expression of the immediate-early transcription factor gene,

c-Fos, The Gtf2ird1-/-

mice showed marked differences in their level of anxiety in this test, with

a 60% reduction in the expression of c-Fos was observed in the frontal cortex of Gtf2ird1-/-

mice

relative to wild-type mice. These findings were supported by protein immunostaining, showing

195

decreases in Fos immunoreactivity (Fos-IR) in the medial prefrontal cortex, including the

prelimbic and infralimbic cortex, and the cingulate cortex (Figure 3.14). The alterations in Fos

protein expression suggest that there are significant differences in activation of the prefrontal

cortex in response to fear/stress in our mouse model relative to wild type animals, consistent with

the regionally reduced activity seen in subjects with WBS (Meyer-Lindenberg et al., 2005).

Although the decrease in neural activity correlates well with fMRI studies in human WBS

patients, the mechanism underlying this change is still unknown. Golgi-Cox staining of

pyramidal cells from the medial prefrontal and somatosensory cortexes failed to detect any

differences between genotypes in the density of basal or apical dendritic spines, indicating that

the decreases in neuronl activity detected using Fos-IR (Figure 3.18) is not the result of a

decreases in the number of synapses within these specific regions.

3.4.7: Implications of elevated 5-HT1A currents in Gtf2ird1-/-

mice:

The low anxiety, decreased aggression and high sociability phenotype exhibited by the

Gtf2ird1-/-

mice is reminiscent of behaviours observed in individuals with WBS. The alterations

in serotonin levels and decreased neuronal activity in cortical regions point to an alteration in

normal brain function but do not provide a mechanism to explain the behaviours seen in the

Gtf2ird1 -/-

mice. To investigate how the function of major output neurons in the prefrontal

cortex in mice lacking the general transcription factor Gtf2ird1 may be affected, whole cell

recordings were used to identify enhanced outward currents, upon application of serotonin, in

layer V prefrontal cortex pyramidal cells of the Gtf2ird1 -/-

mice compared to their wild-type

controls. The use of pharmacological agents such as TTX to suppress network activity and the

196

antagonist WAY-100635 demonstrated that the enhanced outward current was mediated directly

by postsynaptic 5HT1A receptors on the recorded neurons in the Gtf2ird1-/-

mice. The observed

enhancement of an inhibitory current is specific to layer V as outward currents are not enhanced

in layer II/III pyramidal neurons of the Gtf2ird1-/-

mice. The increased inhibitory current is also

specific to the 5-HT1A receptor subtype as inhibitory currents mediated by other Gi/o-coupled

mGluR2/3 and GABAB receptors in layer V pyramidal neurons remain unchanged upon

application of the agonists APDC and Baclofen respectively raising important questions about

the mechanism that underlies the enhanced 5-HT1A currents in layer V and the consequences of

this current for prefrontal functional connectivity in this mouse characterized by a low anxiety

phenotype. It has been previously demonstrated that elevated 5-HT1A receptor function is

inversely correlated with anxiety with mice lacking the 5-HT1A receptor exhibiting higher levels

of anxiety (Parks et al, 1998; Heisler et al., 1998; Ramboz et al., 1998) while decreased anxiety

is observed in mice that over express the 5-HT1A receptor (Kusserow, 2004). In preliminary

expression studies, there have been no identified changes in 5-HT1A expression levels in the

frontal cortex of Gtf2ird1-/-

mice using real-time PCR, western blotting or immunohistochemistry

although the identification of better antibodies may be necessary to verify that protein expression

levels are not altered between Gtf2ird1-/-

mice and wild-type controls.

The inhibitory effects of serotonin on layer V pyramidal neurons may have profound

effects on brain function since these cells are considered the primary output neurons of the

prefrontal cortex sending projections to the amygdala, hypothalamus and striatum, and are the

only source of cortical feedback to several key neuromodulatory nuclei including the dorsal

raphe nucleus which receives its only cortical projection from layer V pyramidal cells of the

prefrontal cortex (Gonçalves et al., 2009; Gabbott et al., 2005; Peyron et al., 1998; Vertes et al.,

197

2004). Layer V pyramidal neurons provide serotonergic neurons of the raphe with negative

feedback (Hajós et al., 1998; Celada et al., 2001; Jankowski and Sesack, 2004) and therefore,

inhibition of layer V neurons would result in an increase activity of the raphe nucleus resulting in

an increase in serotonin release in the prefrontal cortex. Consistent with this, HPLC findings in

the Gtf2ird1-/-

mice suggest that levels of the serotonin metabolite 5-HIAA are significantly

increased in the prefrontal cortex and amygdala of Gtf2ird1-/-

mice while the overall serotonin

level remains unchanged.

The dense and reciprocal connections between the prefrontal cortex and the amygdala

(Ghashghaei and Barbas, 2002; Gabbott et al., 2005) are of great interest in the investigation of

neural mechanisms underlying the WBS phenotype because of their known role in anxiety and

social cognition, with neuroimaging studies implicating the prefrontal cortex in anxiety both in

healthy individuals (Tillfors, 2001; Liotti et al., 2000; Chua et al., 1999) as well as individuals

with affective disorders (Lanzenberger, 2005; Tillfors et al., 2001; Osuch et al., 2000).

Interactions of the prefrontal cortex and amygdala have been also shown to play a critical role in

social cognition (Prather et al., 2001; Amaral, 2002; Quirk et al., 2003; Morgan et al., 1993) and

a disconnect between the prefrontal cortex and the amygdala has been identified in WBS

(Meyer-Lindenberg et al., 2005). While the cellular mechanisms underlying this disconnect

remains unknown, an increased inhibition of the prefrontal layer V pyramidal neurons may

contribute to this uncoupling.

There have been only very few transcriptional targets of the TFII-IRD1 identified, and

none in the brain (O‘Mahoney et al., 1998; Jackson et al., 2005; Polly et al., 2003). Putative

DNA binding sequences have been identified for TFII-IRD1 (Thompson et al., 2007; Lazebnik

et al., 2008), however none of the genes evaluated in this study were determined to contain

198

known TFII-IRD1 binding sequences. Gtf2ird1 is expressed throughout the developing embryo

(Palmer et al., 2007); therefore it is possible that the anxiety-related behaviors may result from

the loss of TFII-IRD1 indirectly through alterations in brain structure and function. However,

since the expression of the TFII-IRD1-LacZ fusion protein is predominantly in layer V of the

adult cortex from which single cell recordings were taken (see Fig. 4.8 in Chapter 4), this

suggests that the loss of TFII-IRD1 may exert its effect at the cellular level. Differences in 5-

HT1A outward currents observed in layer V pyramidal neurons likely do not result from enhanced

expression of the receptor since no difference in prefrontal 5-HT1A receptor mRNA was

observed.

Since the inhibitory actions of 5-HT1A receptors are mainly mediated by increasing

potassium conductance via Gi/o-protein linked inwardly rectifying potassium (GIRK) channel

activation (Innis et al., 1988; Penington et al.,, 1993), the enhanced 5-HT1A-mediated responses

could result from downstream changes such as alteration in the activation of Gi/o -protein linked

potassium channel that share common pathways with other Gi/o protein coupled receptors. If

responses mediated by these receptors were also enhanced, altered function of downstream

effectors shared by all the receptors are likely at play in mediating these larger currents. There

were no alteration in the function of two other inhibitory Gi/o-coupled receptors, the group II

metabotropic glutamate (mGluR2/3) and GABAB receptors (Innis et al., 1988; Andrade et al.,

1986), suggesting that the mechanisms underlying increased 5-HT1A-mediated inhibitory

responses are specific to the 5HT1A receptor.

There is evidence that suggests that people with WBS are hyper-sensitive to selective

serotonin reuptake inhibitors (SSRIs) commonly prescribed treatment for non-social anxiety

(Cherniske et al., 2004; Prober, 2006). Adverse effects such as further dis-inhibition have been

199

associated with even standard doses of these medicines (Cherniske et al., 2004). The down

regulation 5-HT1A autoreceptor function within the dorsal raphe upon long-term administration

of SSRIs is well-known, but recently a pronounced enhancement of the function of prefrontal 5-

HT1A receptors has also been identified (Moulin-Sallanon et al., 2009) and may provide further

insight into a possible cellular mechanism in the prefrontal cortex contributing to the behaviors

of individuals with WBS.

3.4.8: Altered stress-induced gene expression in the frontal cortex of Gtf2ird1-/-

mice:

In an effort to further identify genes whose regulation may be altered by the loss of

Gtf2ird1, an expression microarray analysis was performed on frontal cortex tissue obtained

from animals that had been exposed to a stressful environment. Multiple genes were identified

whose expression was either increased or decreased by a factor of two or greater. These

included the activity-regulated cytoskeleton-associated protein (ARC) which regulates the

function of AMPA receptors (Liu et al., 2000); Serpini1, whose protein product neurosperin, a

serine protease inhibitor, is expressed in the late stages of neurogenesis during the process of

synapse formation (Kreuger et al., 1997) and Trpc4, a member of a family of receptor-activated

non-selective calcium permeate cation channel operated by a phosphatidylinositol second

messenger system activated by G-protein coupled receptors (Freichel et al., 2001). Further

analysis including western blotting and immunohistochemistry will be necessary to determine if

the alteration determined by microarray analysis translates into changes at the protein levels.

There are commercially available antibodies for all three proteins however to date only TRPC4

has been analysed. Interestingly, although Trpc4 mRNA levels were shown by real time PCR to

be reduced about 30% in the frontal cortices of Gtf2ird1-/-

mice, western blot analysis shows that

200

more significant reduction in TRPC4 protein may exist in these mice (Figure 3.19). Trpc4 is an

ideal candidate gene for involvement in the observed phenotype of the Gtf2ird1 mouse model.

TRPC4 was originally characterised due to its structural similarities to ion channels absent in

transient receptor potential (TRP) mutants identified in Drosophila where the trp gene was

involved in the light activated depolarization of photo-receptor cells through a pathway

consisting of rhodopsin, a Gq-like G protein and phospholipase C (PLC) (Hardie and Minke,

1992). To date the majority of work elucidating the function of TRPC4 concerns its role in store-

operated Ca2+

currents in endothelium-mediated vascular smooth muscle relaxation (Freichel et

al., 2001). Initially the signalling pathways for the activation of TRPC channels was thought to

involve Gq proteins activating PLC (Lee et al., 2003) but recent studies have shown that TRPC4

can also be activated by Gi/o proteins. (Jeon et al., 2008). Since 5HT1A receptors are coupled to

PLC through Gi/o proteins, this may provide the mechanism for the alterations in 5HT1A

signalling (a Gi/o -protein coupled receptor) in Gtf2ird1-/-

mice. Expression studies have also

demonstrated that TRPC4 mRNA is highly expressed in the adult rat frontal cortex, including the

infralimbic and prelimbic cortices (Fowler et al., 2007), areas identified as having altered

neuronal activity and 5HT1A receptor activity.

Mouse models with multiple gene deletions will go some way to elucidating this and will

be very helpful in studying the interplay between different genes within the WBS deletion. The

similarity in the behavioral phenotype of the Gtf2ird1-/-

mice and people with WBS presents an

opportunity to identify downstream genes and pathways that are essential for proper

development and maintenance of certain aspects of human behavior. The Gtf2ird1 mouse model

allows us to study how the loss of one of the genes in the WBS critical region can alter

neurophysiology leading to enhanced inhibitory 5-HT currents in the prefrontal cortex. These

201

mice provide the basis for manipulations not possible in humans and may help guide future

pharmacological and functional human imaging studies in WBS and provide insight into

alternative therapeutic targets to help restore normal prefrontal excitability.

202

3.5: References:

Achenbach TM, Conners CK, Quay HC, Verhulst FC, and Howell CT. (1989) Replication of

empirically derived syndromes as a basis for taxonomy of child/adolescent

psychopathology. Journal of Abnormal Child Psychology. 17:299–323.

Adolphs, R. (2003) Cognitive neuroscience of human social behaviour. Nature Review

Neuroscience. 4:165-178.

Alberti A, Romano C, Falco M, Calì F, Schinocca P, Galesi O, Spalletta A, Di Benedetto D, and

Fichera M. (2007) 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive

deficits and dysmorphic facial features. Clinical Genetics. 71:177-182.

Amaral DG. (2002) The primate amygdala and the neurobiology of social behavior: implications

for understanding social anxiety. Biological Psychiatry. 51:11-17.

Anderson JC, Williams S, McGee R, and Silva PA. (1987) DSM-III disorders in preadolescent

children: prevalence in a large sample from the general population. Archives of General

Psychiatry. 44:69–76.

Andrade R, Malenka RC, and Nicoll RA. (1986) A G protein couples serotonin and GABAB

receptors to the same channels in hippocampus. Science. 234:1261–1265.

Araneda R, and Andrade R (1991) 5-Hydroxytryptamine2 and 5-hydroxytryptamine 1A

receptors mediate opposing responses on membrane excitability in rat association cortex.

Neuroscience. 40:399– 412.

Antonell A, Del Campo M, Magano LF, Kaufmann L, Martínez de la Iglesia J, Gallastegui F,

Flores R, Schweigmann U, Fauth C, Kotzot D, and Pérez-Jurado LA. (2009) Partial

7q11.23 deletions further implicate GTF2I and GTF2IRD1 as the main genes responsible

for the Williams-Beuren syndrome neurocognitive profile. Journal of Medical Genetics.

Nov 5. [Epub ahead of print]

Araneda R, and Andrade R. (1991) 5-Hydroxytryptamine2 and 5-hydroxytryptamine 1A

receptors mediate opposing responses on membrane excitability in rat association cortex.


Arango V, Underwood MD, and Mann JJ. (1997) Biologic alterations in the brainstem of

suicides. The Psychiatric Clinics of North America. 20:581-593.

Avgustinovich DF, Lipina TV, Bondar NP, Alekseyenko OV, and Kudryavtseva NN. (2000)

Features of the genetically defined anxiety in mice. Behavioral Genetics. 30:101-109.

Avgustinovich DF, Alekseenko OV, Bakshtanovskaia IV, Koriakina LA, Lipina TV, Tenditnik

MV, Bondar' NP, Kovalenko IL, and Kudriavtseva NN. (2004) [Dynamic changes of brain

serotonergic and dopaminergic activities during development of anxious depression:

experimental study]. Uspekhi Fiziologicheskikh Nauk. 35:19-40. (in Russian)

203

Ballenger JC. (1999) Current treatments of the anxiety disorders in adults. Biological Psychiatry.

46:1579-1594.

Barlow D. (2002) Anxiety and its disorder. The nature and treatment of anxiety and panic. The

Guildford Press, New York.

Béïque JC, Chapin-Penick EM, Mladenovic L, and Andrade R (2004) Serotonergic facilitation of

synaptic activity in the developing rat prefrontal cortex. Journal of Physiology. 556:739-

754.

Bellugi U, Bihrle A, Jernigan T, Trauner D, and Doherty S. (1990) Neuropsychological,

neurological, and neuroanatomical profile of Williams syndrome. American Journal of

Medical Genetics. 6(S):115-125.

Benn CL, Butler R, Mariner L, Nixon J, Moffitt H, Mielcarek M, Woodman B, and Bates GP.

(2009) Genetic knock-down of HDAC7 does not ameliorate disease pathogenesis in the

R6/2 mouse model of Huntington's disease. PLoS One. 4:e5747.

Bishop SJ. (2007) Neurocognitive mechanisms of anxiety: an integrative account. Trends in

Cognitive Science. 11:307-316.

Blomberg S, Rosander M, and Andersson G. (2006) Fears, hyperacusis and musicality in

Williams syndrome. Research in Developmental Disabilities. 27:668-680.

Bolstad BM, Irizarry RA, Astrand M, and Speed TP. (2003) A Comparison of Normalization

Methods for High Density Oligonucleotide Array Data Based on Bias and Variance.

Bioinformatics. 19:185-193.





Bowen RC, Offord DR, and Boyle MH. (1990) The prevalence of overanxious disorder and

separation anxiety disorder: results from the Ontario Child Health Study. Journal of the

Academy of Child and Adolescent Psychiatry. 29:753–758.

Britton JC, Phan KL, Taylor SF, Welsh RC, Berridge KC, and Liberzon I. (2006) Neural

correlates of social and nonsocial emotions: An fMRI study. NeuroImage. 31:397-409.

Budarf ML, Collins J, Gong W, Roe B, Wang Z, Bailey LC, Sellinger B, Michaud D, Driscoll

DA, and Emanuel BS. (1995) Cloning a balanced translocation associated with DiGeorge

syndrome and identification of a disrupted candidate gene. Nature Genetics. 10:269-278.

Cannistraro PA, and Rauch SL. (2003) Neural circuitry of anxiety: evidence from structural and

functional neuroimaging studies. Psychopharmacology Bulletin. 37:8–25.

Caramaschi D, de Boer SF, and Koolhaas JM. (2007) Differential role of the 5-HT1A receptor in

aggressive and non-aggressive mice: an across-strain comparison. Physiology and

Behavior. 90:590-601.

204

Celada P, Puig MV, Casanovas JM, Guillazo G, and Artigas F. (2001) Control of dorsal raphe

serotonergic neurons by the medial prefrontal cortex: Involvement of serotonin-1A,

GABA(A), and glutamate receptors. Journal of Neuroscience. 21:9917–9929.

Charles KJ, Calver AR, Jourdain S, and Pangalos MN (2003) Distribution of a GABAB-like

receptor protein in the rat central nervous system. Brain Research. 989:135–146.

Chan MH, Chiu PH, Sou JH, and Chen HH. (2008) Attenuation of ketamine-evoked behavioral

responses by mGluR5 positive modulators in mice. Psychopharmacology (Berl). 198:141-

148.

Cherniske EM, Carpenter TO, Klaiman C, Young E, Bregman J, Insogna K, Schultz RT, and

Pober BR. (2004) Multisystem study of 20 older adults with Williams syndrome. American

Journal of Medical Genetics. 131A:255-264.

Chua P, Krams M, Toni I, Passingham R, and Dolan R. (1999) A functional anatomy of

anticipatory anxiety. Neuroimage. 9:563–571.

Clapcote SJ, Lazar NL, Bechard AR, and Roder JC. (2005) Effects of the rd1 mutation and host

strain on hippocampal learning in mice. Behavioral Genetics. 35:591-601.

Clark MS, Vincow ES, Sexton TJ, and Neumaier JF. (2004) Increased expression of 5-HT1B

receptor in dorsal raphe nucleus decreases fear-potentiated startle in a stress dependent

manner. Brain Research.1007:86-97.

Cooper SA, Melville CA, and Einfeld SL. (2003) Psychiatric diagnosis, intellectual disabilities

and diagnostic criteria for psychiatric disorders for use with adults with learning

disabilities/mental retardation (DC-LD). Journal of Intellectual Disability Research. 47:3–

15.

Cosi C, and Marien M. (1998) Decreases in mouse brain NAD+ and ATP induced by 1-methyl-

4-phenyl-1, 2,3,6-tetrahydropyridine (MPTP): prevention by the poly(ADP-ribose)

polymerase inhibitor, benzamide. Brain Research. 809:58-67.

Crackower MA, Kolas NK, Noguchi J, Sarao R, Kikuchi K, Kaneko H, Kobayashi E, Kawai Y,

Kozieradzki I, Landers R, Mo R, Hui CC, Nieves E, Cohen PE, Osborne LR, Wada T,

Kunieda T, Moens PB, and Penninger JM (2003) Essential role of Fkbp6 in male fertility

and homologous chromosome pairing in meiosis. Science. 300:1291-1295.

Crawley JN. (1999) Behavioral phenotyping of transgenic and knockout mice: experimental

design and evaluation of general health, sensory functions, motor abilities, and specific

behavioral tests. Brain Research. 835:18–26.

Curran ME, Atkinson DL, Ewart AK, Morris CA, Leppert MF, and Keating MT. (1993) The

elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis.

Cell. 73:159-168.




205

Davidson RJ, Putnam KM, Larson CL. (2000) Dysfunction in the neural circuitry of emotion

regulation--a possible prelude to violence. Science. 289:591-594.

De Almeida RM, Rosa MM, Santos DM, Saft DM, Benini Q, and Miczek KA. (2006) 5-HT(1B)

receptors, ventral orbitofrontal cortex, and aggressive behavior in mice.

Psychopharmacology (Berl). 185:441-450.

Dekker MC, and Koot HM. (2003) .DSM-IV disorders in children with borderline to moderate

intellectual disability. I: prevalence and impact. Journal of American Academy of Child

and Adolescent Psychiatry. 42:915–922.

Doyle TF, Bellugi U, Korenberg JR, and Graham J. (2004) "Everybody in the world is my

friend" hypersociability in young children with Williams syndrome. American Journal of

Medical Genetics, Part A. 124A:263-273.

Durkin ME, Keck-Waggoner CL, and Popescu NC (2001) Integration of a c-myc transgene

results in disruption of the mouse Gtf2ird1 gene, the homologue of the human GTF2IRD1

gene hemizygously deleted in Williams-Beuren syndrome. Genomics. 73:20-27.

Dykens EM. (2003) Anxiety, fears, and phobias in persons with Williams syndrome.

Developmental Neuropsychology. 23:291-316.

Emerson E. (2003) Prevalence of psychiatric disorders in children and adolescents with and

without intellectual disability. Journal of Intellectual Disability Research. 47:51–58.

Edelmann L, Prosnitz A, Pardo S, Bhatt J, Cohen N, Lauriat T, Ouchanov L, González PJ,

Manghi ER, Bondy P, Esquivel M, Monge S, Delgado MF, Splendore A, Francke U,

Burton BK, and McInnes LA.. (2007) An atypical deletion of the Williams-Beuren

Syndrome interval implicates genes associated with defective visuo-spatial processing and

autism. Journal of Medical Genetics. 44:136-143.

Emery NJ, Capitanio JP, Mason WA, Machado CJ, Mendoza SP, and Amaral DG. (2001) The

effects of bilateral lesions of the amygdala on dyadic social interactions in rhesus monkeys

(Macaca mulatta). Behavioral Neuroscience. 115:515-544.

Ensenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, Thorland EC,

Lorentz CP, Goldstein JL, McDonald MT, Smith WE, Simon-Fayard E, Alexander AA,

Kulharya AS, Ketterling RP, Clark RD, and Jalal SM. (2003) Microduplication 22q11.2,

an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients.


Enkhmandakh B, Makeyev AV, Erdenechimeg L, Ruddle FH, Chimge NO, Tussie-Luna MI,

Roy AL, and Bayarsaihan D. (2009) Essential functions of the Williams-Beuren syndrome-

associated TFII-I genes in embryonic development. Proceedings of the National Academy

of Science (USA). 106:181-186.

Everett GM. And Tolman, JEP. (1959) Mode of action of Rauwolfia alkaloids and motor

activity. In: Masserman, J.H., Biological psychiatry, Vol. I. Grune and Stratton, New York-

London, pp. 75–81.




206

Ferrero GB, Howald C, Micale L, Biamino E, Augello B, Fusco C, Turturo MG, Forzano S,

Reymond A, and Merla G. (2010) An atypical 7q11.23 deletion in a normal IQ Williams-

Beuren syndrome patient. European Journal of Human Genetics. 18:33-38.

Fowler MA, Sidiropoulou K, Ozkan ED, Phillips CW, Cooper DC. (2007) Corticolimbic

expression of TRPC4 and TRPC5 channels in the rodent brain. PLoS ONE 2:e573.

Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, Biel M, Philipp S, Freise D,

Droogmans G, Hofmann F, Flockerzi V, and Nilius B. (2001) Lack of an endothelial store-

operated Ca2+ current impairs agonist-dependent vasorelaxation in TRP4-/-

mice. Nature

Cell Biology. 3:121-127.

Fujiwara T, Mishima T, Kofuji T, Chiba T, Tanaka K, Yamamoto A, and Akagawa K (2006)

Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing

synaptic plasticity. Journal of Neuroscience. 26:5767-5776.

Gabbott PL, Warner TA, Jays PR, Salway P, and Busby SJ. (2005) Prefrontal cortex in the rat:

projections to subcortical autonomic, motor, and limbic centers. Journal of Comparative

Neurology. 492:145–177.

Gaspar P, Cases O, and Maroteaux L. (2003) The developmental role of serotonin: news from

mouse molecular genetics. Nature Review Neuroscience. 4:1002-1012.

Ghashghaei HT, and Barbas H. (2002) Pathways for emotion: interactions of prefrontal and

anterior temporal pathways in the amygdala of the rhesus monkey. Neuroscience.

115:1261–1279.

Gerlai R, Friend W, Becker L, O'Hanlon D, Marks A, and Roder J. (1993) Female transgenic

mice carrying multiple copies of the human gene for S100 beta are hyperactive.

Behavioural Brain Research. 55:51-59.

Gonçalves L, Nogueira MI, Shammah-Lagnado SJ, and Metzger M. (2009) Prefrontal afferents

to the dorsal raphe nucleus in the rat. Brain Research Bulletin. 78:240–247.

Goodfellow NM, Benekareddy M, Vaidya VA, and Lambe EK. (2009) Layer II/III of the

prefrontal cortex: Inhibition by the serotonin 5-HT1A receptor in development and stress.

Journal of Neuroscience. 29:10094–10103.

Gould E (1999). Serotonin and hippocampal neurogenesis. Neuropsychopharmacology. 21:46S–

51S.

Gross C, Zhuang X, Stark K, Ramboz S, Oosting R, Kirby L, Santarelli L, Beck S, and Hen R.

(2002) Serotonin1A receptor acts during development to establish normal anxiety-like

behaviour in the adult. Nature. 416:396–400.

Hajós M, Richards CD, Székely AD, and Sharp T. (1998) An electrophysiological and

neuroanatomical study of the medial prefrontal cortical projection to the midbrain raphe

nuclei in the rat. Neuroscience. 87:95–108.

207

Hakre S, Tussie-Luna MI, Ashworth T, Novina CD, Settleman J, Sharp PA, Roy AL. (2006)

Opposing functions of TFII-I spliced isoforms in growth factor-induced gene expression.

Molecular Cell. 24:301-308.

Hanks M, Wurst W, Anson-Cartwright L, Auerbach AB, and Joyner AL (1995) Rescue of the

En-1 mutant phenotype by replacement of En-1 with En-2. Science. 269:679-682

Hardie RC, Minke B. (1992) The trp gene is essential for a light-activated Ca2+ channel in

Drosophila photoreceptors.Neuron. 8:643-651.



40:e99.

Heisler LK, Chu HM, Brennan TJ, Danao JA, Bajwa P, Parsons LH, and Tecott LH. (1998)

Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant

mice. Proceedings of the National Academy of Science (USA). 95:15049–15054.

Hodges JR. (1984) The hypothalamo-pituitary-adrenocortical system. British Journal of

Anaesthesia. 56:701-710.






Impey S, Mark M, Villacres EC, Poser S, Chavkin C, and Storm DR. (1996): Induction of CRE-

mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the

hippocampus. Neuron. 16:973-982.

Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme JC, Chan G, and Storm

DR. (1998) Cross talk between ERK and PKA is required for Ca2+ stimulation of CREB-

dependent transcription and ERK nuclear translocation. Neuron. 21:869-883.

Innis RB, Nestler EJ, and Aghajanian GK. (1988) Evidence for G protein mediation of serotonin-

and GABAB-induced hyperpolarization of rat dorsal raphe neurons. Brain Research.

459:27–36.

Jackson TA, Taylor HE, Sharma D, Desiderio S, and Danoff SK. (2005) Vascular endothelial

growth factor receptor-2: counter-regulation by the transcription factors, TFII-I and TFII-

IRD1. Journal of Biological Chemistry. 280:29856–29863.

Jankowski, MP, and Sesack, SR (2004) Prefrontal cortical projections to the rat dorsal raphe

nucleus: ultrastructural features and associations with serotonin and gamma-aminobutyric

acid neurons. Journal of Comparative Neurology. 468:518–529.

208

Jeon JP, Lee KP, Park EJ, Sung TS, Kim BJ, Jeon JH, So I. (2008) The specific activation of

TRPC4 by Gi protein subtype. Biochemical and Biophysical Research Communication.

377:538-543.

Klein-Tasman BP. and Mervis CB. (2003) Distinctive personality characteristics of 8-, 9-, and

10-year-olds with Williams syndrome. Developmental Neuropsychology. 23:269-290.

Karmiloff-Smith A, Grant J, Ewing S, Carette MJ, Metcalfe K, Donnai D, Read AP, and

Tassabehji M. (2003) Using case study comparisons to explore genotype-phenotype

correlations in Williams-Beuren syndrome. Journal of Medical Genetics. 40:136-140.

Krueger SR, Ghisu GP, Cinelli P, Gschwend TP, Osterwalder T, Wolfer DP, and Sonderegger P.

(1997) Expression of neuroserpin, an inhibitor of tissue plasminogen activator, in the

developing and adult nervous system of the mouse. Journal of Neuroscience. 17:8984-

8996.

Kumari V, Kaviani H, Raven PW, Gray JA, and Checkley SA. (2001) Enhanced startle reactions

to acoustic stimuli in patients with obsessive-compulsive disorder. American Journal of

Psychiatry. 158:134-136.

Kusserow H, Davies B, Hörtnagl H, Voigt I, Stroh T, Bert B, Deng DR, Fink H, Veh RW, and

Theuring F (2004) Reduced anxiety-related behavior in transgenic mice overexpressing

serotonin 1A receptors. Brain Research. Molecular Brain Research. 129:104–116.

Lang PJ, Davis M, and Ohman A. (2000) Fear and anxiety: animal models and human cognitive

psychophysiology. Journal of Affective Disorders. 61:137–159.

Lanzenberger RR, Mitterhauser M, Spindelegger C, Wadsak W, Klein N, Mien LK, Holik A,

Attarbaschi T, Mossaheb N, Sacher J, Geiss-Granadia T, Kletter K, Kasper S, and

Tauscher J. (2007) Reduced serotonin-1A receptor binding in social anxiety disorder.

Biological Psychiatry. 61:1081–1089.

Lazebnik MB, Tussie-Luna MI, and Roy AL. (2008) Determination and functional analysis of

the consensus binding site for TFII-I family member BEN, implicated in Williams-Beuren

syndrome. Journal of Biological Chemistry. 283:11078-11082.

Lebrand C, Cases O, Adelbrecht C, Doye A, Alvarez C, El Mestikawy S, Seif I, Gaspar P.

(1996) Transient uptake and storage of serotonin in developing thalamic neurons. Neuron.

17:823-835.

Lee YM, Kim BJ, Kim HJ, Yang DK, Zhu MH, Lee KP, So I, and Kim KW. (2003) TRPC5 as a

candidate for the nonselective cation channel activated by muscarinic stimulation in murine

stomach. American Journal of Physiology, Gastrointestinal and Liver Physiology.

284:G604-G616.

Leyfer OT, Woodruff-Borden J, Klein-Tasman BP, Fricke JS, and Mervis CB. (2006) Prevalence

of psychiatric disorders in 4 to 16-year-olds with Williams syndrome. American Journal of

Medical Genetics. Part B, Neuropsychiatric Genetics. 141B: 615-622.

209


Keating MT (1998) Novel arterial pathology in mice and humans hemizygous for elastin.


Li HH, Roy M, Kuscuoglu U, Spencer CM, Halm B, Harrison KC, Bayle JH, Splendore A, Ding

F, Meltzer LA, Wright E, Paylor R, Deisseroth K, and Francke U. (2009) Induced

chromosome deletions cause hypersociability and other features of Williams-Beuren

syndrome in mice. EMBO Molecular Medicine. 1:50-65.

Liotti M, Mayberg HS, Brannan SK, McGinnis S, Jerabek P, and Fox PT. (2000) Differential

limbic--cortical correlates of sadness and anxiety in healthy subjects: implications for

affective disorders. Biological Psychiatry. 48:30–42.

Lipp HP, and Wolfer DP. (1998) Genetically modified mice and cognition. Current Opinion

Neurobiology. 8:272-280.

Lister RG. (1987) The use of a plus-maze to measure anxiety in the mouse.

Psychopharmacology. 92:180-185.

Liu D, Bei D, Parmar H, and Matus A. (2000) Activity-regulated, cytoskeleton-associated

protein (Arc) is essential for visceral endoderm organization during early embryogenesis.

Mechanisms of Develoment. 92:207-215.

Malenka R, and Bear M. (2004). LTP and LTD: an embarrassment of riches. Neuron. 44:5–21.

Malenka RC, and Nicoll RA. (1999) Long-term potentiation--a decade of progress? Science.

285:1870-1874.

Malinow R, Schulman H, Tsien RW. (1989) Inhibition of postsynaptic PKC or CaMKII blocks

induction but not expression of LTP. Science. 245:862-866.

Maren S. (2008) Pavlovian fear conditioning as a behavioral assay for hippocampus and

amygdala function: cautions and caveats. European Journal of Neuroscience. 28:1661-

1666.

Martin KC, Michael D, Rose JC, Barad M, Casadio A, Zhu H, and Kandel ER. (1997) MAP

kinase translocates into the nucleus of the presynaptic cell and is required for long-term

facilitation in Aplysia. Neuron. 18:889-912.

Matynia A, Kushner SA, and Silva AJ. (2002) Genetic approaches to molecular and cellular

cognition: a focus on LTP and learning and memory. Annual Review of Genetics. 36:687-

720.

Melendez RI, Gregory ML, Bardo MT, and Kalivas PW. (2004) Impoverished rearing

environment alters metabotropic glutamate receptor expression and function in the

prefrontal cortex. Neuropsychopharmacology. 29:1980–1987.

Meng Y, Zhang Y, Tregoubov V, Janus C, Cruz L, Jackson M, Lu WY, MacDonald JF, Wang

JY, Falls DL, and Jia Z (2002) Abnormal spine morphology and enhanced LTP in LIMK-1

knockout mice. Neuron. 35:121-133.







210

Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: cognition, personality, and

adaptive behavior. Mental Retardation and Developmental Disabilities Researach

Reviews. 6:148-158.


The Williams syndrome cognitive profile. Brain and Cognition. 44:604-628.

Meyer-Lindenberg A, Hariri AR, Munoz KE, Mervis CB, Mattay VS, Morris CA, and Berman

KF. (2005) Neural correlates of genetically abnormal social cognition in Williams

syndrome. Nature Neuroscience. 8:991-993.

Milner B, Squire LR, and Kandel ER. (1998) Cognitive neuroscience and the study of memory.

Neuron. 20:445-468.

Mount HT, Martel JC, Fluit P, Wu Y, Gallo-Hendrikx E, Cosi C, and Marien MR. (2004)

Progressive sensorimotor impairment is not associated with reduced dopamine and high

energy phosphate donors in a model of ataxia-telangiectasia. Journal of Neurochemistry.

88:1449-1454.

Montgomery KC. (1958) The relation between fear induced by novel stimulation and exploratory

behaviour. Journal of Comparative Physiology and Psychology. 48:254-260.

Moy SS, Nadler JJ, Perez A, Barbaro RP, Johns JM, Magnuson TR, Piven J, and Crawley JN.

(2004) Sociability and preference for social novelty in five inbred strains: an approach to

assess autistic-like behavior in mice. Genes Brain and Behavior. 3:287-302.

Morgan MA, Romanski LM, and LeDoux JE. (1993) Extinction of emotional learning:

contribution of medial prefrontal cortex. Neuroscience Letters. 163:109–113.

Morris R. (1984) Developments of a water-maze procedure for studying spatial learning in the

rat. Journal of Neuroscience Methods. 11:47-60.

Moulin-Sallanon M, Charnay Y, Ginovart N, Perret P, Lanfumey L, Hamon M, Hen R, Fagret D,

Ibáñez V, and Millet P. (2009) Acute and chronic effects of citalopram on 5-HT1A

receptor-labeling by [18F]MPPF and -coupling to receptors-G proteins. Synapse. 63:106–

116.

Moy SS, Nadler JJ, Perez A, Barbaro RP, Johns JM, Magnuson TR, Piven J, and Crawley JN.

(2004) Sociability and preference for social novelty in five inbred strains: an approach to

assess autistic-like behavior in mice. Genes Brain and Behavior. 3:287-302.

Myers BA,and Pueschel SM. (1991) Psychiatric disorders in persons with Down syndrome. The

Journal of Nervous and Mental Disease. 179:609–613.

Nagy A, Rossant J, Nagy R, Abramow-Newerly W, and Roder JC. (1993) Derivation of

completely cell culture-derived mice from early-passage embryonic stem cells.

Proceedings of the National Academy of Sciences (U S A). 90:8424-8428.

Nagy A, Gertsenstein M,. Vintersten K, and Behringer R. (2003) In: Manipulating the Mouse

Embryo. Cold Spring Harbor Laboratory Press.

211

Nichols DE, and Nichols CD (2008) Serotonin receptors. Chemical Reviews. 108:1614–1641.

Nimchinsky E, Sabatini B, and Svoboda K (2002). Structure and function of dendritic spines.

Annual Review of Physiology. 64: 313–353.

Ogilvie AD, Battersby S, Bubb VJ, Fink G, Harmar AJ, Goodwim GM, and Smith CA (1996)

Polymorphism in serotonin transporter gene associated with susceptibility to major

depression. Lancet. 347:731-733.

Olson TM, Michels VV, Urban Z, Csiszar K, Christiano AM, Driscoll DJ, Feldt RH, Boyd CD,

and Thibodeau SN. (1995) A 30 kb deletion within the elastin gene results in familial

supravalvular aortic stenosis. Human Molecular Genetics. 4:1677-1669.

O'Mahoney JV, Guven KL, Lin J, Joya JE, Robinson CS, Wade RP, and Hardeman EC. (1998)

Identification of a novel slow-muscle-fiber enhancer binding protein, MusTRD1.

Molecular and Cellular Biology. 18:6641–6652.

Osuch EA, Benson B, Geraci M, Podell D, Herscovitch P, McCann UD, and Post RM. (2000)

Regional cerebral metabolism associated with anxiety symptoms in affective disorder

patients. Biological Psychiatry. 48:1020–1023.

Palmer SJ, Tay ES, Santucci N, Cuc Bach TT, Hook J, Lemckert FA, Jamieson RV, Gunnning

PW, and Hardeman EC. (2007) Expression of Gtf2ird1, the Williams syndrome-associated

gene, during mouse development. Gene Expression Patterns. 7:396–404.

Pankau R, Partsch CJ, Gosch A, Oppermann HC, and Wessel A (1992) Statural growth in

Williams-Beuren syndrome. European Journal of Pediatircs. 151:751-755.

Parks CL, Robinson PS, Sibille E, Shenk T, and Toth M. (1998) Increased anxiety of mice

lacking the serotonin1A receptor. Proceedings of the National Academy of Sciences (USA).

95:10734–10739.

Penington NJ, Kelly JS, and Fox AP (1993) Whole-cell recordings of inwardly rectifying K+

currents activated by 5-HT1A receptors on dorsal raphe neurones of the adult rat. The

Journal of Physiology. 469:387–405.

Penn HE. (2006). Neurobiological correlates of autism: a review of recent research. Child

Neuropsychology. 12:57–79.

Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definition



Petralia RS, Wang YX, Niedzielski AS, and Wenthold RJ (1996) The metabotropic glutamate

receptors, mGluR2 and mGluR3, show unique postsynaptic, presynaptic and glial

localizations. Neuroscience. 71:949–976.

Peyron C, Petit JM, Rampon C, Jouvet M, and Luppi PH. (1998) Forebrain afferents to the rat

dorsal raphe nucleus demonstrated by retrograde and anterograde tracing methods.

Neuroscience. 82:443–468.




212

Phelps EA, O'Connor KJ, Gatenby JC, Gore JC, Grillon C, and Davis M. (2001) Activation of

the left amygdala to a cognitive representation of fear. Nature Neuroscience. 4:437-441.

Phillips RG, and LeDoux JE. (1992) Differential contribution of amygdala and hippocampus to

cued and contextual fear conditioning. Behavioural Neuroscience. 106:274-285.

Polly P, Haddadi LM, Issa LL, Subramaniam N, Palmer SJ, Tay ES, and Hardeman EC. (2003)

hMusTRD1alpha1 represses MEF2 activation of the troponin I slow enhancer. Journal of

Biological Chemistry. 278:36603–36610.

Prather MD, Lavenex P, Mauldin-Jourdain ML, Mason WA, Capitanio JP, Mendoza SP, and

Amaral DG. (2001) Increased social fear and decreased fear of objects in monkeys with

neonatal amygdala lesions. Neuroscience. 106:653-658.

Pober BR. (2006) Evidence-based medical management of adults with Williams-Beuren

Syndrome. In: Williams-Beuren Syndrome: Research, evaluation, and treatment. (Morris

CA, Lenhoff HM, Wang P, eds) Baltimore: Johns Hopkins University Press.

Proulx E, Young EJ, Osborne LR, and Lambe EK. (2010) Enhanced prefrontal serotonin 5-HT1A

currents in a mouse model of Williams-Beuren syndrome with low innate anxiety. Journal

of Neurodevelopmental Disorders. 2:99-108.

Quetsch RM, Achor RW, Litin EM, and Fauchett RL. (1959) Depressive reactions in

hypertensive patients; a comparison of those treated with Rauwolfia and those receiving no

specific antihypertensive treatment. Circulation. 19:366–375.

Quirk GJ, Likhtik E, Pelletier JG, and Paré D. (2003) Stimulation of medial prefrontal cortex

decreases the responsiveness of central amygdala output neurons. Journal of Neuroscience.

23:8800–8807.

Quirk GJ, Garcia R, and González-Lima F.2006 Prefrontal mechanisms in extinction of

conditioned fear. Biological Phsychiatry. 60:337-343.

Ramboz S, Oosting R, Amara DA, Kung HF, Blier P, Mendelsohn M, Mann JJ, Brunner D, and

Hen R. (1998) Serotonin receptor 1A knockout: an animal model of anxiety-related

disorder. Proceedings of the National Academy of Sciences (USA). 95:14476–14481.

Ramirez OA, and Wang RY. (1986) Locus coeruleus norepinephrine-containing neurons: effects

produced by acute and subchronic treatment with antipsychotic drugs and amphetamine.

Brain Research. 362:165-170.

Rascle C, Mazas O, Vaiva G, Tournan, M, Rayboi O, Goudemand M, and Thomas P. (2001)

Clinical features of latent inhibition in schizophrenia. Schizophenia Research. 51:149-161.

Rodgers RJ, and Cole JC. (1994) Anxiolytic-like effect of (S)-WAY 100135, a 5-HT1A receptor

antagonist, in the murine elevated plus-maze test. European Journal of Pharmacology.

261:321-325.



213

Rolls ET, Hornak J, Wade D, and McGrath J. (1994) Emotion-related learning in patients with

social and emotional changes associated with frontal lobe damage. Journal of Neurology,

Neurosurgery and Psychiatry. 57:1518-24.

Roy A, (2001) Genetic influences on suicide risk. Clinical Neuroscience Research. 1:324-330.

Schafe GE, Nader K, Blair HT, and LeDoux JE. (2001) Memory consolidation of Pavlovian fear

conditioning: a cellular and molecular perspective. Trends in Neuroscience. 24:540-546.

Schiller L, Donix M, Jahkel M, and Oehler J. (2006) Serotonin 1A and 2A receptor densities,

neurochemical and behavioral characteristics in two closely related mice strains after long-

term isolation. Program in Neuropsychopharmacol Biol Psychiatry. 30:492-503.

Seidman JG, and Seidman C. (2002) Transcription factor haploinsufficiency: when half a loaf is

not enough. Journal of Clinical Investigation. 109:451-455.

Shin LM, and Liberzon I. (2010) The Neurocircuitry of Fear, Stress, and Anxiety Disorders.

Neuropsychopharmacology. 35:169-191

Shumyatsky GP, Malleret G, Shin RM, Takizawa S, Tully K, Tsvetkov E, Zakharenko SS,

Joseph J, Vronskaya S, Yin D, Schubart UK, Kandel ER, and Bolshakov VY. (2005)

Stathmin, a gene enriched in the amygdala, controls both learned and innate fear. Cell.

123:697-709.

Silva AJ, Kogan JH, Frankland PW, and Kida S (1998) CREB and memory. Annual Review of


Smith Y, and Kieval JZ. (2000) Anatomy of the dopamine system in the basal ganglia. Trends in

Neuroscience. 23:S28-S33.

Smyth GK. (2004). Linear models and empirical Bayes methods for assessing differentially

expresssed in microarray experiments. Statistical Applications in Genetics and Molecular

Biology, 3, No. 1, Article 3

Sotres-Bayon F, Corcoran KA, Peters J, and Sierra-Mercado D. (2008) Neural correlates of

individual variability in fear extinction. Journal of Neuroscience. 28:12147-12149.

Steru L, Chermat R, Thierry B, and Simon P. (1985) The tail suspension test: a new method for

screening antidepressants in mice. Psychopharmacology (Berl). 85:367-370.

Sweatt JD. (1999) Toward a molecular explanation for long-term potentiation. Learning and

Memory. 6:399-416.

Tassabehji M, Hammond P, Karmiloff-Smith A, Thompson P, Thorgeirsson SS, Durkin ME,

Popescu NC, Hutton T, Metcalfe K, Rucka A, Stewart H, Read AP, Maconochie M, and

Donnai D. (2005) GTF2IRD1 in craniofacial development of humans and mice. Science.

310:1184-1187.

Tauscher J, Bagby RM, Javanmard M, Christensen BK, Kasper S, and Kapur S (2001) Inverse

relationship between serotonin 5-HT(1A) receptor binding and anxiety: a [(11)C]WAY-



214

100635 PET investigation in healthy volunteers. The American Journal of Psychiatry.

158:1326–1328.

Thompson PD, Webb M, Beckett W, Hinsley T, Jowitt T, Sharrocks AD, and Tassabehji M

(2007) GTF2IRD1 regulates transcription by binding an evolutionarily conserved DNA

motif ‗GUCE‘. FEBS Letters. 581:1233-1242.

Tillfors M, Furmark T, Marteinsdottir I, Fischer H, Pissiota A, Långström B, and Fredrikson M

(2001) Cerebral blood flow in subjects with social phobia during stressful speaking tasks: a

PET study. The American Journal of Psychiatry. 158:1220–1226.

Tussié-Luna MI, Bayarsaihan D, Ruddle FH, and Roy AL. (2001) Repression of TFII-I-

dependent transcription by nuclear exclusion. Proceedings of the National Academy of

Sciences (USA). 98:7789-7794.

Vaidya VA, Marek GJ, Aghajanian GK, and Duman RS. (1997) 5-HT2A receptor-mediated

regulation of brain-derived neurotrophic factor mRNA in the hippocampus and the

neocortex. Journal of Neuroscience. 17:2785-2795.

van Hagen JM, van der Geest JN, van der Giessen RS, Lagers-van Haselen GC, Eussen HJ, Gille

JJ, Govaerts LC, Wouters CH, de Coo IF, Hoogenraad CC, Koekkoek SK, Frens MA, van

Camp N, van der Linden A, Jansweijer MC, Thorgeirsson SS, and De Zeeuw CI. (2007)

Contribution of CYLN2 and GTF2IRD1 to neurological and cognitive symptoms in

Williams Syndrome. Neurobiology of Disease. 26:112-124.

Veenema AH and Neumann ID. (2007) Neurobiological mechanisms of aggression and stress

coping: a comparative study in mouse and rat selection lines. Brain, Behavior and

Evolution. 70:274-285.

Vergnes M, Depaulis A, and Boehrer A. (1986) Parachlorophenylalanine-induced serotonin

depletion increases offensive but not defensive aggression in male rats. Physiology and

Behavior. 36:653–658.

Vertes, R (2004) Differential projections of the infralimbic and prelimbic cortex in the rat.

Synapse. 51:32–58.

Winslow JT, and Insel TR. (2002) The social deficits of the oxytocin knockout mouse.

Neuropeptides. 36:221-229.

Zald DH, and Pardo JV. (1997) Emotion, olfaction, and the human amygdala: amygdala

activation during aversive olfactory stimulation. Proceedings of the National Academy of

Sciences (USA). 97:4119-4124.

Zald DH, Lee JT, Fluegel KW, and Pardo JV. (1998) Aversive gustatory stimulation activates

limbic circuits in humans. Brain. 121:1143-1154.

Zhao C, Aviles C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ (2005) Hippocampal and

visuo-spatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams


215

CHAPTER IV: MOUSE MODELS OF GTF2I GENE FAMILY MEMBERS:

216


4.1.1: Mouse genome engineering:

A critical advancement in the study of human disease in the last three decades has been

the development of mouse models for genetic disorders. Over 80% of mouse genes have an

orthologous counterpart in humans (Mouse Genome Sequencing Consortium et al., 2002) and

although the engineering methods used in manipulating the mouse genome are also applicable to

other systems such as rat and zebra fish (Glaser et al., 2005), it is the isolation and development

in the late 1980s of totipotential embryonic stem (ES) cell lines, derived from the inner cell mass

of the mouse blastocyst (Robertson, 1987) that has revolutionized the generation of mouse

models of human disease. Mouse ES cells have the ability to undergo diapauses, a physiological

state of dormancy found only in a few mouse strains, with very specific triggering and releasing

conditions where no development takes place as long as the embryo remains unattached to the

uterine lining (Gardner and Brook, 1997; Buehr and Smith, 2003). Mouse ES cells have higher

frequency of homologous recombination than other cultured cells likely due to rapid growth and

high DNA replication (Glaser et al., 2005). Concurrent with the establishment of ES cells lines

was the development of gene targeting techniques that have allowed for the targeting of

numerous disease-related genes (Thomas and Capecchi, 1987). Since the initial single gene

mouse models first reported in 1989 (Koller and Smithies, 1989; Zijlstra et al., 1989),

improvements in targeting techniques have allowed for varying types of mutations, such as the

introduction of point mutations, deletion and lineage-specific and inducible inactivation of

targeted genes, the generation of chromosomal translocations as well as the deletions and

duplication of larger genomic segments. The vast majority of mouse models harbor null

mutations that have been created by removal of a coding exon using homologous recombination,

217

to disrupt normal gene function. Although valuable for creating null alleles, this method

required the targeting of the desired gene in ES cells, and therefore was not useful in generating

the lineage-specific and inducible inactivation of targeted genes and was not capable of

mimicking genomic deletions that encompassed regions over 30kb in size (Gu et al., 1993;

Zhang et al., 1994). Larger deletions around a defined locus were originally generated using

radiation-induced deletions (RID). A positive/negative selection cassette containing the

thymidine kinase (TK) and neomycin (NEO) genes were first integrated at a defined genomic

location by homologous recombination and properly targeted cells were then irradiated with

gamma radiation to induce deletions. Deletions of the initially targeted locus would result in the

removal and the TK cassette thereby allowing the cells to proliferate in media containing the

nucleoside analogs of deoxyguanosine (FIAU or ganciclovir) that are phosphorylated by TK and

become incorporated into growing DNA chains, interfering with DNA synthesis and eventually

resulting in cell death (Camper et al., 1995). This method however generated deletions of

varying sizes that required further characterization to map the extent and boundaries.

More recently, large-scale genomic rearrangements have been generated using Cre

recombinase (Cre) derived from bacteriophage P1. Cre is a 38 kDa protein that does not require

cofactors for proper functioning and can be stably expressed in mammalian cells, including ES

cells (Sauer and Henderson, 1988). Cre induces the desired rearrangement through site-specific

recombination between two 34 base pair (bp) recognition sequences, referred to as loxP sites,

each consisting of an asymmetric 8 bp core sequence flanked by 13 bp palindromic sequences

(Hamilton and Abremski, 1984). When the core sequences of the loxP sites are on the same

chromosome or fragment of DNA (in cis) and in the same orientation with respect to one

another, Cre deletes the intervening DNA fragment. When the core sequences are in opposite

218

orientation the fragment is inverted (Sauer and Henderson, 1988). Provided that the ES cells

tolerate the rearrangement, germ line transmitting chimeric mice possessing large chromosomal

deletions of up to 60 cM in size can be generated using this technique (Zheng et al., 2000).

When the loxP sites are on separate chromosomes (in trans), Cre-induced recombination can be

used to generate both deletion and duplication of the sequence flanked by the loxP sites, albeit at

an efficiency that is substantially less than when the loxP sites are in the cis configuration; 10%

to 0.1% for loxP site arranged in cis versus 0.1% to 0.01% for trans configuration (Liu et al.,

1998; Zheng et al., 2000)

An improvement in the creation of mouse models with genomic rearrangements came

from the development of Cre expressing transgenic mouse lines that allowed for in vivo Cre-

induced recombination. In a technique developed by Herault et al., (1998), targeted meiotic

recombination (TAMERE) used expression of Cre under the control of the synaptonemal

complex protein 1 (Sycp1) promoter in early prophase of male spermatogenesis to greatly

increase the efficiency of Cre-induced recombination between loxP sites in the trans

configuration. This method generated deletions as well as duplications with an efficiency of

between 1% and 10%. Other examples of transgenic lines that can be used to generate Cre-

induced recombination include the ZP3-Cre transgenic mouse that expresses high levels during

oogenesis before the first meiotic division (Lewandoski et al., 1997) and the CMV-Cre line

which expresses Cre before implantation during early embryogenesis, under the control of the

cytomegalovirus promoter (Dupe et al., 1997).

Another recent development in the mouse genomic engineering is the introduction of

high-throughput ―Gene Trapping‖. Linearized gene trap vectors containing a promoter-less

reporter gene and/or selectable genetic marker flanked by an upstream 3‘ splice site (splice

219

acceptor; SA) and a downstream transcriptional termination sequence (poly-adenylation

sequence; polyA) become randomly inserted into genomic DNA (Stanford et al., 2001). If

inserted into the intron of an expressed gene, the splice acceptor site within the gene trap cassette

causes the endogenous splicing machinery to splice the exon(s) upstream of the insertion site into

the cassette (Figure 4.1). The endogenous promoter of the trapped gene thereby produces a

fusion transcript in which the upstream exons are spliced in-frame to the reporter/selectable

marker gene. Since transcription is terminated prematurely by the polyA site within the cassette,

translation of the processed fusion transcript encodes a fusion protein of the truncated and non-

functional ‗trapped‘ protein and the reporter/selectable marker. Thus, gene traps can be used to

simultaneously inactivate and allow the study of gene expression, of the trapped gene. In

addition to generating standard loss-of-function alleles, newer gene trap vectors offer a variety of

post-insertional modification strategies such as the ability to turn off the trapping mechanism

through the Cre-induced deletion of the splice acceptor site, thereby allowing the proper

transcription of the gene to be restored in a temporally or spatially dependent manner. Presently,

gene trapped embryonic cell lines from approximately one-third of known genes are available for

a nominal handling fee through the International Gene Trap Consortium (IGTC) which

represents all publicly available gene trap cell lines.

220

4.1.2: Existing Mouse models of WBS:

Although it has been a difficult task to determine precise genotype/phenotype correlation

in WBS using human studies, great insight into the possible contribution made by several genes

has come from mouse models. Knockout mouse models of WBS region genes, including Eln,

Limk1, Lat2, Clip2, Fzd9, Baz1b, Mlxipl, Stx1a, Fkbp6, Ncf1, and Gtf2ird1, and Gtf2i have been

reported and are essential for identifying the contribution of these genes to the pathology of

WBS. The generation of high-resolution physical maps of human chromosome 7q11.23 and its

syntenic region of mouse chromosome 5G have provided a valuable comparative sequence

221

resource (DeSilva et al., 2002). The syntenic WBS region in mouse has the full complement of

genes but without the LCRs that flank the human WBS region, but interestingly, the genes

commonly deleted in WBS occur in an inverted orientation in the mouse with respect to the

human sequence suggesting that human 7q11.23 underwent inversion from the ancestral

222

chromosome (Figure 4.2).

Elastin (Eln) was the first gene to be targeted in the mouse and proved to be an excellent

model for most, if not all, of the cardiovascular symptoms associated with ELN hemizygosity in

humans (Li et al., 1998a). Eln null mice died shortly after birth due to obstructive arterial disease

223

caused by uncontrolled proliferation of sub-endothelial and reorganization of smooth muscle

cells. In a subsequent study, it was determined that although there was a 50 % reduction in the

expression of elastin in Eln+/-

mice, there was a 35% increase in the number of elastic lamellae

and smooth muscle suggesting that reduced elastin expression may result in the abnormal

vascular development and obstructive vascular disease seen in WBS patients (Li et al., 1998b).

Limk1 knockout mice exhibited significant abnormalities in spine morphology a well as

synaptic function, including enhanced hippocampal long-term potentiation, indicating that

LIMK1 may be a potent regulator of actin dynamics and is important for multiple cellular

processes such as cytokinesis, endocytosis and remodelling of neurite outgrowth needed for

dendritic spine morphogenesis in the central nervous system (Meng et al., 2002). Although no

heterozygous phenotype data was reported, Limk1 knockout mice exhibited increased locomotor

activity, enhanced cued fear response during fear conditioning (CFC), as well as impaired spatial

learning during reversal trials in the water maze test (Meng et al., 2002).

Mice heterozygously deleted for Clip2 display features reminiscent of WBS, including

mild growth deficiency, brain abnormalities, hippocampal dysfunction and particular deficits in

motor coordination (Hoogenraad et al., 2002). The human CLIP2 gene encodes for the 115 kDa

brain specific cytoplasmic linker protein CLIP-115 whose functions include the regulation of the

interactions between the growing ends of microtubules and various cellular structures

(Hoogenraad et al., 1998). CLIP-115 is most abundantly expressed in cell bodies and dendrites

of neurons (De Zeeuw et al., 1997) and is thought to directly or indirectly participate in dynein

motor-mediated transport and play an important role in cell polarity (Hoogenraad et al., 2004).

Neurological and behavioural changes seen in mice lacking Clip2 and Limk1 indicate that the

regulation of the actin and microtubule cytoskeleton plays an important role in the development

224

of the distinct neurological and behavioural aspects of WBS (Hoogenraad et al., 2002, Meng et

al., 2002).

Zhao et al., (2005) reported that both Fzd9+/-

and Fzd9

-/- mice displayed increases in

precursor proliferation and apoptotic cell death resulting in decreases in the number of granule

cells in the dentate gyrus as well as increases in the number of hilar mossy fibres in the

hippocampus. Fzd9+/-

and Fzd9

-/- mice also showed a decrease in seizure threshold to the

chemoconvulsant pentylenetetrazole (PTZ); reported to be a measure of integrity of the

hippocampal circuitry. The phenotypic expression in Fzd9+/-

mice was found to be intermediate

between the wild type and the Fzd9-/-

mice however, only the Fzd9-/-

mice had severe deficits

on tests of visuo-spatial learning/memory (Zhao et al., 2005). Independently, Ranheim et al.,

(2005) reported that although their Fzd9-/-

mice showed no obvious features of the WBS

phenotype no evaluation of the heterozygous phenotype was reported. It was suggested by the

authors that Fzd9 may play a role in lymphoid development and maturation, particularly at points

where B cells undergo self-renewal prior to further differentiation (Ranheim et al., 2005).

Several mouse knockout and transgenic models have been generated for syntaxin 1A

(Stx1a) over the past several years. (Lam et al., 2005; Fujiwara et al., 2006; Ohara-Imaizumi et

al., 2007). Lam et al., (2005) used a transgenic mouse model to over-express syntaxin 1A in

pancreatic islets. Transgenic mice displayed fasting hyperglycemia and had elevated plasma

glucose levels after a glucose tolerance test, with a corresponding reduction in plasma insulin

levels. The Stx1a transgenic mouse also exhibited reduced currents through calcium channels

but the voltage-gated or ATP-sensitive potassium channels remained unchanged, suggesting that

fluctuation syntaxin 1A levels in diabetes could affect the pathological and differential regulation

of ion channels and the exocytotic machinery, which may collectively contribute to the impaired

225

insulin secretion from pancreatic islet beta cells. In Stx1a knockout mice, Ohara-Imaizumi et al.,

(2007) showed that syntaxin 1A is essential for the docking and fusing of insulin granules during

exocytosis in pancreatic β cells. Although expected to be diabetic, Stx1a-/-

mice exhibited no

marked hyperglycemia only impaired oral glucose tolerance accompanied by decreased serum

insulin levels. Studying the role of syntaxin 1A in neurotransmitter release, Fugiwara et al.,

(2006) and found that Stx1a-/-

mice had impaired consolidation and extinction of both contextual

and cued fear conditioning as well as impaired LTP in the CA1 region of the hippocampus;

although surprisingly, Stx1a-/-

mice exhibited normal spatial memory in the Morris water maze.

It should be noted that due to the targeting strategy used by Fugiwara et al, the resulting model

likely produces a truncated protein rather than a true null allele. A subsequent report by McRory

et al., (2008) showed that mice heterozygous for the targeted allele showed no deficits in leaning

and memory, anxiety or locomotor activity, although only a small number of mice were tested,

whilst homozygotes had a high frequency of embryonic lethality.

Targeted inactivation of Fkbp6, and subsequent loss of FK506 binding protein, resulted

in sex-specific infertility with Fkbp6-/-

males unable to produce normal pachytene spermatocyte

resulting from the abnormal pairing and misalignment of homologous chromosomes, non-

homologous partner switches as well as autosynapsis of X chromosome cores in meiotic

spermatocytes (Crackower et al., 2003).

A Gtf2ird1 insertional mutant was generated through integration of a c-myc

transgene that has induced a 40kb deletion including the first non-coding exon of Gtf2ird1

(Durkin et al., 2001). Although the authors stated that the ―homozygous line 166.8 animals are

viable and have no obvious defects‖, no cognitive or behavioral testing was performed. It was

226

reported that levels of Gtf2ird1 mRNA were greatly reduced but that the locus may be

hypomorphic since a small amount of mRNA was detected on northern blot.

It is evident from the lack of a complete recapitulation of the WBS phenotype in the

individual existing mouse models for the genes within the commonly deleted region that WBS is

a contiguous gene deletion disorder. Even when considered collectively, the classic features of

WBS including the cardiovascular, craniofacial and behavioral abnormalities, are not strongly

evident in the heterozygotes of the Eln, Baz1b, Clip2, myc-Gtf2ird1 and Gtf2ird1 models,

indicating that haploinsufficiency of each gene alone is not sufficient to produce a phenotype, at

least not in a mouse model, and that the resulting WBS phenotype is the result of the

combinatorial effect of the deletion of multiple genes within the commonly deleted region.

Therefore generation of mouse models containing multiple gene deletions will be critical for

gaining insight to the collective contribution that these genes make to Williams-Beuren

Syndrome.

4.2: Methods:

4.2.1: Generation of Gtf2iloxP

mouse model:

The Gtf2iloxP

line was generated by Dr. Tuncer Onay by gap repair targeting in a HPRT-

deficient cell line using the 5‘/3‘ phage library established by Alan Bradley at Baylor College of

Medicine in Houston, Texas (Zheng et al., 1999). The loxP-containing targeting vector included

a 9 kb genomic fragment containing exons 25 to the 3‘UTR of the murine Gtf2i gene (Figure

4.3). A 1.1 kb SmaI fragment was removed to create a gap in the region of homology and was

subsequently used as a probe to identify correctly targeted ES clones. The linearized targeting

227

vector was electroporated into an HPRT-deficient ES cell line. The electroporation was

conducted with a Bio-Rad GenePulser and a Gene Pulser cuvette with a 0.4-cm electrode gap at

230 V and 500 mF. Cells (in PBS) were then mixed with medium containing leukemia inhibiting

factor (LIF) and plated.

229

4.2.2: Preparation of genomic DNA:

Genomic DNA was obtained using standard methods. Briefly, cell pellets were digested

in lysis buffer (10 mM Tris, 100 mM NaCl, 10 mM EDTA, 0.5% SDS, 0.4 ug/ml Proteinase K)

Overnight at 60oC. Potassium acetate was added to final concentration of 1.2M with an equal

volume of chloroform. The solution was incubated for 20 minutes at -20°C and then centrifuged

for 5 minutes at 12000xg at room temperature. The aqueous phase was transferred to fresh tube

and the DNA precipitated with 2 volumes of 100% ethanol. DNA was pelleted at 12000 x g at

room temperature, washed with 70% ethanol, re-suspended in nuclease free water and stored at -

20°C.

4.2.3: Genomic copy number analysis using conventional and quantitative PCR:

Sub-clones initially identified as being targeted for the Gtf2i locus were screened using

conventional PCR methods using primers that spanned the short arm of the targeting vector .

Sub-clones were also screened using quantitative PCR to determine the genomic copy number of

exons from single copy regions (exon 5) and exons contained within the targeting construct

(exon 30). All samples were run in triplicate and the experiment was repeated twice with

consistent results. Real-time PCR was carried out using a 7900HT genetic analyzer (Applied

Biosystems, Foster City, CA) with 11 ul reactions, performed in triplicate, containing 5 ng of

template for 40 cycles of amplification using Power®SYBR master mix (Applied Biosystems,

Foster City, CA). Primers used in the screening of Gtf2iloxP

–targeted ES clones are listed in

Table 4.1. The DNA copy number of each gene was obtained from a calibration curve that

230

assumes the reference genome is diploid. Genomic ratios were determined by comparing

absolute copy number of the test genes to the reference gene, Hmbs.

Table 4.1. Primers Used in qPCR Screening of Gtf2iloxP

Targeted Clones


mGtf2iRT-e5F CGCCGAGATGCATAAGATG

mGtf2iRT-e5R CAGAAATAGTCCTCCACCGTTT

mGtf2iRT-e30F CAGGAAGATCACCATCAACC

mGtf2iRT-e30R AGATCCTCCTCATGGAGCTG



4.2.4: Re-deriving of parental Gtf2iloxP

G10 line:

One of these correctly targeted ES clones, 1-4-10, was aggregated at the University of

Connecticut Gene Targeting and Transgenic Facility (GTTF) producing 14 chimeras. Germ-line

transmission was verified by crossing male chimeric mice with CD-1 females. Genotyping was

performed using conventional PCR methods using primers listed in Table 4.1.

4.2.5: Identification and characterization of gene trap clones:

Gene trap clones derived from the parental embryonic stem cells 129P2/OlaHsd and

carrying an insertion of the gene trap vector pGT0lxf were identified from the International Gene

Trap Consortium (IGTC). The identified clones are: Gtf2ird1 - XS0608 (Sanger Institute Gene

Trap Resource - SIGTR) and Gtf2i - YTA369 (BayGenomics). Targeting was confirmed using

231

RT-PCR with primers located in the upstream exon of the trapped intron (Gtf2i: exon 3/Gtf2ird1:

exon 4) and a common primer located in the LacZ gene of the trapping cassette. PCR products

were sub-cloned into TA-cloning vectors (Invitrogen) and sequenced by The Centre of Applied

Genomics (Toronto). Genomic insertion points were identified in genomic DNA derived from

XS0608 and YTA369 ES cells using the same exon specific primers and the reverse primer

gtEn2i1R (Table 4.2). PCR products were sub-cloned into TA-cloning vectors (Invitrogen

Canada Inc., Burlington, ON) and sequenced by The Centre of Applied Genomics (Toronto).

232

Table 4.2. Primers Used in Genotyping of Gtf2iloxP

and Gene Trap Mice

Primer Name Sequence Amplicon Size (bp)

Primers Used to Confirm Targeting

mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 245bp with gtGEO-R

mGTF2IRD1e4-F AGTGCTCGGATGTGTACCTG 195bp with gtGEO-R

gtGEO-R GTTTTCCCAGTCACGACGTT

Primers Used for Genotyping

BZP1-F CGGAAGAGCGCCCAATAC 350 bp

2i-GR CTTAGCATTCCAGGCCTCTG

GTloxP71-GF TGGGAACTCTACTGCCCTTG With gtGEO-R

Cre-F ATGTCCAATTTACTGACCG 420 bp

Cre-R CGCCGCATAACCAGTGAAAC

GT-DEL-GF AAGGGGAGATGCCAGAGACT 200 bp

GT-DEL-GR GCTGATCCGGAACCCTTAAT

GT-DUP-GF CAAGCACTGGCTATGCATGT 250 bp

GT-DUP-GR GTTTTCCCAGTCACGACGTT

mGTF2Igt-GF GGGAGTGGGACCCTTAAACT 210 bp with gtEN2i1-GR

mIRD1gt-GF CCCACCCACCTTATCTGAAC 470 bp with gtEN2i1-GR

gtEN2i1-GR GGGTCTCTTTGTCAGGGTCA

4.2.6: Expression analysis of gene trap ES cells:

Expression analysis was carried out using total RNA extracted from dissected adult

frontal cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON). Following DNase

233

treatment (Turbo DNA free, Ambion), 5 g of RNA was converted to cDNA using the

SuperScript™ First-Strand Synthesis System (Invitrogen Canada Inc., Burlington, ON) and

random hexamer primers Samples were diluted 1/100 with sterile water and used directly in real-

time assays using the Power SYBR Green PCR Master mix and ABI Prism 7900HT sequence

detection system (Applied Biosystems, Foster City, CA). Primers used in the expression analysis

of gene trap clones are listed in Table 4.1. Absolute quantification analysis was used with

expression levels normalized to the control genes Hmbs and Sdha. All samples were run in

triplicate and the experiment was repeated twice with consistent results.

234

Table 4.3. Primers Used in Expression Analysis of Gene Trap Clones


mGtf2iRT-e3F TCATGGCCCAAGTAGTGATG

mGtf2iRT-e3R ATGAGGAAGGTCACCACCAT

mGtf2iRT-e4F AGAGCTGGCCAAGTCCAAG

mGtf2iRT-e4R CCTCTTTCGGTTCCAACAAC

mGtf2iRT-e5F CGCCGAGATGCATAAGATG

mGtf2iRT-e5R CAGAAATAGTCCTCCACCGTTT

mGtf2iRT-e24F CCAACAACAGCAGTCCTCAG

mGtf2iRT-e24R CTCGAGGCTTGAAGGGAAC

mGtf2iRT-e30F CAGGAAGATCACCATCAACC

mGtf2iRT-e30R AGATCCTCCTCATGGAGCTG

mGtf2iRT-e1F ACTGTGACATCCCCACCAAC

mGtf2ird1RT-e1R GAGTCTAAGGCGGACACCAG

mGtf2ird1RT-e8F CGAGGCTGTGGAAATTGTG

mGtf2ird1RT-e8R TGTGTCGCTCCTCCAGAATC



mSdhaRT-F TGATCTTCGCTGGTGTGGATGTCA

mSdhaRT-R CCCACCCATGTTGTAATGCACAGT

235

4.2.7: Generation of gene trap mice:

Clone XS0608 (Gtf2ird1) and YTA369 (Gtf2i) were used to generate mutant mice after

injection into C57BL/6 blastocysts. The resulting chimeras were bred to CD1 females (albino) to

identify germ line transmitting mice by the presence of dark fur in the offspring. Mice were

genotyped using conventional PCR methods using primers listed in Table 4.4.

Table 4.4. Primers Used to Genotype Gene Trap Mice

Primer ID Sequence Amplicon size

gtIRD1i4F 5'-CCCACCGACCTTATCTGAAC-3'; 466 bp

gtEn2i1R 5'-GGGTCTCTTTGTCAGGGTCA-3'

mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 364

gtGEO-R GTTTTCCCAGTCACGACGTT

To identify null mice as well as double heterozygous mice the resulting F1 Gtf2iGT+

and

Gtf2ird1GT+

mice, were inter-crossed.

4.2.8: Generation and characterization of Gtf2i gene family deletion mice:

To generate the intra-chromosomal deletion of Gtf2i and Gtf2ird1, mice carrying the

trapped Gtf2ird1 allele (Gtf2ird1GT+

) were crossed with Gtf2iloxP

mice that also carried the Cre

transgene under the control of the sycp1 promoter (Sycp1-Cre). ‗Trans-loxer‘ males carrying the

Gtf2ird1GT+

and Gtf2iloxP

alleles as well as the Sycp1-Cre transgene were crossed with wild type

females (Figure 4.4). Offspring were screened using conventional PCR methods with primers to

236

identify to presence of: Gtf2ird1GT+

, Gtf2iloxP

, Sycp1-Cre, as well as genomic rearrangements

resulting in a deletion or duplication (Table 4.5).

237

Table 4.5. Primers Used to Genotype Gtf2i Deletion Family Mice

Primer Sequence Amplicon size

BZP1-F CGGAAGAGCGCCCAATAC 350 bp

2i-GR CTTAGCATTCCAGGCCTCTG

gtIRD1i4F 5'-CCCACCGACCTTATCTGAAC-3'; 466


mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 364


Cre-F ATGTCCAATTTACTGACCG 420 bp

Cre-R CGCCGCATAACCAGTGAAAC

GT-DEL-GF AAGGGGAGATGCCAGAGACT 200 bp

GT-DEL-GR GCTGATCCGGAACCCTTAAT

GT-DUP-GF CAAGCACTGGCTATGCATGT 250 bp

GT-DUP-GR GTTTTCCCAGTCACGACGTT

Mice identified as carrying the desired genomic rearrangements were further

characterized using quantitative PCR to identify changes in copy number of specific exons

within Gtf2i and Gtf2ird1. All samples were run in triplicate and the experiment was repeated

twice with consistent results. Real-time PCR was carried out using a 7900HT genetic analyzer

(Applied Biosystems, Foster City, CA) with 11 ul reactions, performed in triplicate, containing 5

ng of template for 40 cycles of amplification using Power®SYBR master mix (Applied

Biosystems, Foster City, CA). Primers used to identify genomic rearrangements in Gtf2i gene

family deletion and duplication mice are listed in Table 4.6. The DNA copy number of each

exon was obtained from a calibration curve that assumes the reference genome is diploid.

238

Genomic ratios were determined by comparing absolute copy number of the test genes to the

reference gene, Hmbs.

Table 4.6. qPCR Primers Used to Identify Genomic Rearrangements in Gtf2i Gene Family

Deletion and Duplication Mice

Primer Sequence

m2iRTe5-F CGCCGAGATGCATAAGATG

m2iRTe5-R CAGAAATAGTCCTCCACCGTTT

m2iRTe24-F CCAACAACAGCAGTCCTCAG

m2iRTe24-R CTCGAGGCTTGAAGGGAAC

m2iRTe30-F CAGGAAGATCACCATCAACC

m2iRTe30-R AGATCCTCCTCATGGAGCTG

m2iRTe35-F GCTGAAAGAGGCGGGAAT

m2iRTe35-R ATCTCACTGACGGGAACACG

mGtf2ird1-RTe1-F ACTGTGACATCCCCACCAAC

mGtf2ird1-RTe1-R GAGTCTAAGGCGGACACCAG

mGtf2ird1RT-e8F CGAGGCTGTGGAAATTGTG

mGtf2ird1RT-e8R TGTGTCGCTCCTCCAGAATC



4.2.9: Determination of methylation status of loxP sites:

Bisulfite sequencing was used to determine the methylation status of cytosine residues

surrounding the loxP sites with the gene trap mice as well as the Gtf2iloxP

mice. The DNA was

extracted from the tail clippings of 3-4 week old mice using standard methods listed above.

239

DNA was processed using the EpiTeck Bisulfite Kit (Qiagen) following manufacturer‘s

instruction. Bisulfite treated DNA was amplified using standard PCR methods and primers

(Table 4.7) designed to amplify bisulfite–treated DNA (forward primer sequences did not

contain cytosine nucleotides and reverse primers did not contain Guanine nucleotides).

Amplified products were sub-cloned into TA-cloning vectors (Invitrogen Canada Inc.,

Burlington, ON) and sequenced by The Centre of Applied Genomics (Toronto).

Table 4.7. Primers Used in Bisulfite Sequencing

Primer Sequence Amplicon size

lox71-BS-F GGTTTTTTTTGGGAATTTTATTGTT 293 bp

lox71-BS-R AAAATCTAACTACTTATCCACAACCAAC

loxP-BS-F GTTTAATATTTGTATGGTTTTGGG 253 bp

loxP-BS-R AAATCCTCTAAAATCCAAATCTAC

p5‘loxP-BS-F AGTGTGTTTAGAGTTTGGGTTGTAG 230 bp

p5‘loxP-BS-R AAATATACATAAAACAAACAAAATAAC

lox71 site generated by Cre induced recombination of the lox71 and loxP sites within the gene trap cassette can be amplified using lox71-BS-F/loxP-BS-R (Amplicon size 206bp).

4.2.10: X-gal staining of the mouse cortex:

Mice were perfused with PBS containing 2mM MgCl2 (PBS+Mg) followed by freshly

made 2% PFA/0.2% glutaraldehyde in PBS+Mg. Tissues were frozen in isopentane on dry ice

and 50 uM sections were cut on a cryostat. Free-floating sections were rinsed in PBS+Mg then

fixed for 10 minutes in 2% PFA/0.2% glutaraldehyde in PBS+Mg. Sections were rinsed in

PBS+Mg several times and immersed in LacZ staining solution containing: 5mM Potassium

240

ferricyanide, 5mM potassium ferrocyanide, 0.01% sodium deoxycolate/0.02% NP40, 1mg/ml X-

Gal in PBS+Mg. Sections were incubated until sufficient staining could be observed. For TFII-

I-LacZ fusion proteins this was typically 4 hours at 37°C or overnight at room temperature. For

TFII-IRD1-LacZ fusion proteins, typically an overnight incubation at 37°C was required.

Sections were washed several times with PBS+Mg, transferred to slides, counterstained with

Eosin Y, dehydrated, and mounted in Cytoseal.

4.3: Results:


Proulx E, Young EJ, Osborne LR, Lambe EK. Enhanced prefrontal serotonin 5-HT1A currents

in a mouse model of Williams-Beuren syndrome with low anxiety. Journal of

Neurodevelopmental Disorders. 2:99-108.

I performed X-gal staining of the mouse cortex in the Gtf2ird1 gene trap mouse that was

included in the above publication.

4.3.1: Generation and characterization of Gtf2iloxP

mice:

The murine Gtf2i locus was originally targeted using the 3‘/5‘ Hprt gene cassettes

developed by Alan Bradley (Zheng et al., 1999). Two independent mouse lines, G7 and G84,

were generated. Upon analysis, It was determined that the design of the targeting vector would

not have resulted in the disruption of the Gtf2i open reading frame (ORF) since the disrupted

sequence was downstream of both the termination codon and the poly-adenylation site.

Integration of the targeting vector would however have inserted a loxP site that could then be

used as an end point for the generation of the minimal critical region deletion using Cre-induced

241

genomic re-arrangements. 168 sub clones were isolated and screened by Southern blotting with

NheI and using the isolated SmaI fragment as a probe and 24 clones were initially identified as

being properly targeted for Gtf2i. The originally targeted ES cells lines were re-screened and

several correctly targeted clones identified. Correct targeting was verified using real time PCR

and analyzing gene copy number of exon 5 (single copy) and exon 30 (duplicated) (Figure 4.5).

One of these correctly targeted ES clones, 1-4-10, was aggregated at the University of

Connecticut Gene Targeting and Transgenic Facility (GTTF) producing 14 chimeras. Germ-line

transmission was verified by crossing male chimeric mice with CD-1 females. Germ-line

transmitting chimeras were identified and used to establish Gtf2iloxP

breeding lines. Correctly

identified ES clone 1-4-10 was used to generate multiple high quality chimeric mice at the

Toronto Centre for Phenogenomics (TCP).

242

4.3.2: Identification and characterization of gene trap mice:

LoxP-containing gene trap ES clones from the international gene trap consortium (IGTC)

were identified for both Gtf2i (YTA369) and Gtf2ird1 (XS0608). The trapping cassette had

inserted in intron three of the Gtf2i gene and in intron four of the Gtf2ird1 gene. Insertion points

were identified using forward primers in the immediate upstream exon three of Gtf2i and exon

243

four of Gtf2ird1 and a reverse primer generated within the 5‘ region of the trapping cassette.

PCR products were isolated, cloned in the TA-cloning vectors (Invitrogen) and directly

sequenced. Mice were generated from Gtf2i (YTA369) and Gtf2ird1 (XS0608) ES cells by

blastocyst injections were performed at the Toronto Centre for Phenogenomics (TCP) and germ

line transmitting chimeras were identified for both lines.

4.3.3: Gtf2ird1GT+

null mice are viable, Gtf2iGT+

null mice are embryonic lethal:

For each line, mice heterozygous for the targeted allele were mated together in order to

produce mice homozygous for the targeted allele. Mice homozygous for Gtf2ird1-trapped allele

have been identified but, to date, no mice homozygous for the Gtf2i-trapped allele have been

identified. Mice heterozygous for each of the Gtf2i and Gtf2ird1-trapped allele were also

successfully intercrossed to generate mice carrying both of the trapped alleles (double

heterozygotes) (Figure 4.6). Preliminary analysis of crosses between Gtf2ird1-trapped

heterozygotes produced offspring in the expected 1:2:1 Mendelian ratio (62:126:56; χ2= 0.56,

df=2, P>0.05). Assuming that homozygosity of the trapped Gtf2i allele results in embryonic

lethality, preliminary analysis of crosses between Gtf2i-trapped heterozygotes did not produce

offspring in the expected 1:2 ratio (94:141; χ2= 4.91, df=1, P<0.05). Consistent with the loss of

homozygous Gtf2i gene trapped mice, the average litter size for the heterozygous crosses

involving Gtf2i mice were significantly less than for Gtf2ird1 mice (Gtf2ird1, 6.7 ± 0.49, n=18;

Gtf2i, 4.8 ± 0.83, n=9; t=5.70, P<0.001).

244

4.3.4: Reduced expression of “trapped” alleles:

It was determined using quantitative PCR (qPCR) that a 30% reduction in the expression

of the gene-trapped allele was detected (Gtf2ird1 exon 8 – Figure 4.7), in the brain of

heterozygous Gtf2ird1 gene trap mice. The increased expression observed using Gtf2ird1 exon 1

primers is due to the gene trap mechanism. There was no alteration in the expression of Gtf2i in

heterozygous Gtf2ird1 gene trap mice. Mice heterozygous for the Gtf2i gene trap allele display a

40-60% reduction in the expression of the targeted gene (Figure 4.7). Interestingly, a 20%

reduction in Gtf2ird1 expression was observed in heterozygous Gtf2i gene trap mice. The

reduction in gene expression also translates into a reduction in protein products TFII-I and TFII-

IRD1 in both lines (Figure 4.8).

246

4.3.5: TFII-IRD1 protein expression is predominantly in layer V of the frontal cortex:

Gene expression in the adult mouse brains of the resulting lacZ-fusion proteins from both

the Gtf2i and Gtf2ird1-trapped alleles was examined using X-Gal staining. Examination of

coronal sections from a similar location to that used for the electrophysiological recordings

showed that expression of the TFII-IRD1-LacZ fusion protein is predominantly in layer V of the

prefrontal cortex of the Gtf2ird1GT+

mice (Figure 4.9A-C). Some staining could also be seen in

layer I but was noticeably absent from layer II/III.

247

Distinct staining was also evident in the central nucleus of the thalamus (4.9D) the raphe

nucleus (4.9E), the hypothalamus (4.9F), in the Purkinje cell layer (4.9G) as well as the lateral

septum, brain stem regions and strong staining was observed in the olfactory bulbs. The

expression is relatively weak, with a long incubation time in the staining solution necessary to

develop appreciable staining. All cells possess endogenous β-galactosidase activity; however the

pH of the staining conditions used is suboptimal for endogenous activity. An area where TFII-

IRD1 expression was noticeably absent was the granule layer of the hippocampus.It should be

noted that diffuse staining was observed after staining of non-LacZ fusion expressing control

mice but that punctuate staining similar to that found in TFII-IRD1-LacZ fusion mice was not

seen in any areas with the exception of the piriform cortex where light punctuate staining was

identified.

249

4.3.6: TFII-I protein is strongly expressed throughout the brain:

TFII-I expression is strong throughout the brain (Figure 4.10). Consistent with

quantitative PCR results in previous chapters, staining for TFII-I-LacZ fusion protein required

only a short incubation time (4 hours). Of particular note is that TFII-I-LacZ is expressed in the

granule (pyramidal) cell layer of the hippocampus and dentate gyrus, including the outer

molecular layer of the dentate gyrus; the location of the basal dendrites of the pyramidal cells. In

cortical regions, TFII-I-LacZ expression was highest in cortical layers II/III and almost absent in

layer I.

250

4.3.7: Determination of methylation status of loxP sites:

It had been previously reported that the recombination efficiency of loxP sites that had

been exposed to Cre recombinase during spermatogenesis was greatly reduced (Rassoulzadegan

et al., 2002). Therefore the methylation states of the loxP sites in mice used in the generation of

the Gtf2i gene family deletion and reciprocal duplication were analyzed using bisulfate

sequencing (Figure 4.11). There were multiple cytosines that were identified to be methylated

and similar to promoter sequences, the methylation occurred at CpG dinucleotides. Surprisingly

methylation appears to have occurred even in animals that have never been exposed to Cre

recombinase. GT993 is an F1 heterozygote from one of the identified germ line transmitting

Gtf2ird1 gene trap chimeras. The gene trap cassette contains two loxP sites flanking the splice

acceptor site (―floxed‖ SA); a standard loxP and one that contains an altered 5‘ region (lox71).

Methylated CpG dinucleotides were found by bisulfite sequencing at both the loxP and lox71

sites. These sites would have been methylated before the exposure to the Scyp1-cre transgene.

GT993 was also crossed with Cre2i-11.2, a female targeted Gtf2iloxP

, Sycp1-Cre expressing

mouse, to generate the trans-loxer male GT26-11. Although all the loxP sites identified in

GT26-11 were determined to be methylated, Cre-induced recombination was observed (albeit

over a short distance) deleting the floxed splice acceptor site within the gene trapped allele

(Figure 4.11).

252

4.3.8: Identification of cre-induced genomic recombination:

Although breeding can produce double heterozygous mice, these double heterozygotes

cannot be maintained from generation to generation using this strategy. Therefore mice carrying

the trapped Gtf2ird1 allele were crossed with the previously existing Gtf2iloxP

endpoint line (1-4-

10) that also expresses the Cre recombinase gene under the male germ-line specific Sycp1

promoter (Sycp1-Cre). Four male mice (―trans-loxer‖ males) carrying the gene trap Gtf2ird1

allele (Gtf2ird1GT+

), the targeted Gtf2i-endpoint allele (Gtf2iloxP

) and the Cre recombinase

transgene (Sycp1-Cre) were mated with wild type females producing 20 litters and offspring

were screened for the presence of recombination. A recombination event generating an

approximately 200 kb deletion encompassing both of the Gtf2i and Gtf2ird1 genes (Gtf2i gene

family deletion) was identify in 1 of 238 offspring (0.42% - Table 4.8) and verified using real-

time PCR (Figure 4.12) and DNA sequencing (not shown). Since the gene trap allele contains a

floxed splice acceptor site (two loxP sites), and this may impede cre-induced recombination,

trans-loxer males carrying a single loxP site within the gene trap allele (Gtf2ird1GTΔ

) were

generated. Seven trans-loxer males were mated with wild type females producing 14 litters.

Mice carrying the deletion of Gtf2i and Gtf2ird1 or the reciprocal recombination product

resulting in the duplication of Gtf2i were identified in 7 of 128 offspring (5.5% - Table 4.8). An

approximately 50% reduction in TFII-I expression was also seen in the mouse carrying the

hemizygous deletion of the Gtf2i gene family (Figure 4.8). Determination of TFII-IRD1 levels

has yet to be verified.

253

Table 4.8. Trans-Loxer Males, Litter Sizes and Efficiency of Cre-Induced Recombination

# of mating pairs # of litters Recombination Rate

(trans) Efficiency

Trans-loxer with

intact gene-trap

allele (3 loxP

sites)

4 20 1 in 238 0.42%

Trans-loxer with

deleted gene-trap

allele (2 loxP

sites)

7 14 7 in 128 5.5%

254


Direct genotype/phenotype correlation in WBS is difficult due to the small number of

atypical deletion patients and the variable expression of many aspects of the WBS phenotype,

likely the result of genetic background within these individuals. What is clearly evident from the

existing mouse models for individual genes within the commonly deleted region is that WBS is a

contiguous gene deletion disorder and that haploinsufficiency for any one gene alone is not

sufficient to produce the full WBS phenotype. Therefore, the resulting WBS phenotype is likely

the result of the combinatorial effect of the deletion of multiple genes within the commonly

deleted region. A mouse model has recently been created that uses two overlapping Cre-induced

deletions from Gtf2i to Limk1 (proximal deletion, PD) and Limk1 to Trim50 (distal deletion, DD)

to generate a hemizygous deletion of the WBS syntenic region (chromosome 5G2) in the mouse

(P/D) (Li et al., 2009). It should be noted that in this model the deletions are contained on

separate chromosomes and therefore a mouse carrying one copy of each chromosome (P/D)

would be homozygously deleted for Limk1; inconsistent with what is seen in individuals with

WBS. Gene expression levels were reduced approximately 50% for all genes tested including

Limk1 that oddly was found also to be expressed at 10% of wild type levels in the P/D mice

although P/D mice are homozygous for the targeted Limk1 locus.

The endpoint loci are targeted using a similar gap repair strategy to the one used in this

report to target Gtf2i (Zhang et al., 1994). Using this method, it is still possible to produce full-

length transcripts, although the ORF within these transcripts will likely be disrupted by the

duplication of exons during the gap repair process. Detection of Limk1 expression in P/D mice

indicates that a transcript is still being produced although the authors do not indicate whether the

transcript generated is an intact wild-type or an aberrant transcript. Interestingly, Baz1b

255

expression was found in all deletions to be decreased by 40% even in the proximal deletion

containing two intact copies of Baz1b, suggesting a complex transcriptional regulatory system

that may contain trans-acting transcriptional mechanisms. Oddly, there are important

phenotypic aspects of WBS including hippocampal-based contextual fear conditioning; sound

sensitivity; as well as sensorimotor processing that are surprisingly absent in the complete

deletion of the WBS region (Li et al., 2009).

The generation of these large deletions of the syntenic WBS region is mice do not

provide a great deal of novel information about the contribution of specific genes within the

region to the WBS phenotype, particularly the GTF2I gene family. Studies of atypical human

deletions indicate that the GTF2I gene family members GTF2I and GTF2IRD1 are associated

with many of the cognitive and behavioral aspects of WBS (Morris et al., 2003; Gagliardi et al.

2003). The generation of mouse models individually targeted for Gtf2i and Gtf2ird1 as well as a

deletion of both Gtf2i and Gtf2ird1 would allow for the deciphering of contribution made by

these Gtf2i gene family members, individually and collectively.

Although generation of large chromosomal rearrangements in mice to recreate human

genomic diseases is an impressive technical achievement, important understanding of the

contribution of the associated genes is often better elucidated by studying smaller deletions of

specific genes. Smith-Magenis syndrome (SMS), characterized by multiple congenital

anomalies and mild mental retardation, is seen in individuals possessing a 3.7 Mb deletion of

17p11.2 (Greenberg et al., 1996; Chen et al., 1996). In Df(11)17 mice deleted for the 2 Mb

deletion of the syntenic region of the human SMS common deletion, the SMS phenotype is

largely recapitulated including craniofacial abnormalities, obesity, seizures and neurobehavioral

abnormalities (Walz et al., 2003; Walz et al., 2004). However, this model still does not provide

256

any further understanding of the contributions made by the deleted genes. Identification of

frame shift and nonsense mutations in RAI1 in 5 SMS patients and generation of Rai1+/-

mice

having a similar phenotype to Df(11)17 mice indicated that changes in the expression levels of

RAI1 is responsible the majority of the SMS phenotype. It was however noted that in these mice,

the genetic background and size of deletion of the mice strongly affected the craniofacial

phenotype indicating that modifiers exist that also govern the expression of the SMS phenotype.

Simply breeding Gtf2i and Gtf2ird1 models together could generate mice heterozygous

for Gtf2i and Gtf2ird1. However generating deletion of both genes on the same chromosome has

several advantages. Firstly, gene trap models are often hypomorphs with incomplete trapping of

the gene locus resulting only in a decrease in the expression of the trapped gene. Although the

preliminary expression analysis determined that the Gtf2i gene trap line does result in an

approximately 50% reduction in the expression of Gtf2i, the Gtf2ird1 gene trap line appears to

have a reduction of only about 30% of the regular expression of Gtf2ird1 in the heterozygotes

and a reduction of 60-70% in the homozygous mice resulting from the skipping of the gene trap

cassette (Figure 4.1). Therefore, a double heterozygous mouse would result in Gtf2ird1

expression levels that are inconsistent with 50% decrease in expression levels that are observed

in individuals with WBS (see chapter 2). Given that the existing targeted Gtf2ird1 mouse model

presented in chapter 3 expresses an aberrant transcript, the most relevant model to understand the

role of GTF2I and GTF2IRD1 in WBS would be a mouse containing an intra-chromosomal

deletion of both genes. It is interesting to note that the expression of Gtf2ird1 is affected in the

Gtf2i gene trap mice. Heterozygous Gtf2i gene trap mice showed a 20% reduction in the

expression of TFII-IRD1 (Figure 4.7). The cause of the reduced Gtf2ird1 expression is unknown

257

but given their proposed role in the co-regulation of gene expression (see Section 1.1.10 and

1.1.11), the decreased Gtf2i expression may lead to the suppression of Gtf2ird1 expression.

Recently, gene trap mouse models have also been reported for both Gtf2i and Gtf2ird1

(Enkhmandakh et al., 2009). The Gtf2i gene trap described in this paper (XE029) is similar in

targeting location (intron 3) to the gene trap clone used in the present work (YTA369) and

therefore although only limited phenotypic analysis was performed, the phenotypic effects are

predicted to be similar. Consistent with Enkhmandakh et al., no surviving Gtf2i-/-

pups were

found after genotyping of over 150 pups from an intercross of Gtf2i F1 heterozygous mice. In

the published report, development was found to be abnormal, with multiple manifestations

including brain hemorrhaging and neural tube deficits resulting in embryonic lethality of Gtf2i-/-

embryos between embryonic day 8.5 and 12.5 (Enkhmandakh et al., 2009). Similar phenotypic

results were also observed for Gtf2ird1 gene trap mice (XE465). However, unlike Enkhmandakh

et al., homozygosity for the Gtf2ird1 gene trap reported in this thesis (XS0608) did not result in

embryonic lethality. XS0608 Gtf2ird1-/-

gene trap mice are viable and do not show any of the

physical abnormalities reported by Enkhmandakh et al including microcephaly or skeletal and

craniofacial defects reported in a large number of XE465 Gtf2ird1 homozygotes. This

discrepancy is likely due to differences in the location and nature of the gene disruption between

the XE465 line and our XS0608 gene trap and targeted knockout lines. The trapping cassette in

the Gtf2ird1 gene trap reported by Enkhmandakh et al (XE465) would result in the generation of

an almost full length TFII-IRD1-LacZ fusion protein that would still contain four of the six I-

repeats and would reside exclusively in the cytoplasm instead of the predominant nuclear

localization of wild type TFII-IRD1 (See Chapter 3.4.1). Therefore the generation of an intra-

258

chromatidal deletion of both Gtf2i and Gtf2ird1 represents an improved model for the study of

the contribution made by Gtf2i and Gtf2ird1 to the WBS phenotype.

A deletion of Gtf2i and Gtf2ird1 was originally generated using traditional in vitro

techniques but we were unable to generate germ-line transmitting chimeras of the double

deletion (data not shown) likely due to the large amount of manipulation of the embryonic stem

cells during targeting and selective culturing. Therefore to avoid the problems associated with

the large amount of manipulation necessary to generate the deletion in vitro, an in vivo method

was used. The TAMARE strategy, previously used to create serial deletions within the HoxD

gene cluster (Hérault et al., 1998), was used to successfully generate a 225 kb deletion of

Gtf2ird1 and Grf2i as well as the reciprocal duplication of Gtf2i. It had been reported

(Rassoulzadegan et al., 2002) that Cre-induced recombination during spermatogenesis results in

the methylation of CpG dinucleotides within the loxP recognition site thereby rendering the site

refractory to further recombination. This finding is of great importance since the proximal

endpoint mice (Gene traps) contain a ―floxed‖ splice acceptor site. In order to generate the

deletion, the acceptor site would first be excised likely with great efficiency given the close

proximity of the loxP sites flanking the splice acceptor site. If in the process the loxP site was

methylated thereby preventing any further recombination the generation of the deletion and

reciprocal duplication would not be possible.

Although methylation of CpG dinucleotides was observed using bisulfite sequencing,

mice carrying the deleted and duplication regions were subsequently detected. Surprisingly,

unlike reports by Rassoulzadegan et al, methylation of loxP sites at this locus appears not be

dependent upon exposure to Cre recombinase since methylation of loxP sites was detected even

in the F1 offspring of chimeric gene trap mice. Methylation of CpG dinucleotides was also

259

detected in the F1 offspring (Cre2i) of distal Gtf2i endpoint mice that had been crossed to female

sycp1-Cre mice. Since it is believed that the sycp1 promoter is only active during

spermatogenesis in males, the loxP sites within Cre2i mice have also not been exposed to Cre

recombinase. Therefore, at least at this particular genomic locus, methylation of loxP sites does

not appear to hinder their ability to recombine. This may be due to the young age at which tail

biopsies were obtained in this study (three weeks), since methylation was reported previously to

increase with age from three weeks to three months (Rassoulzadegan et al., 2002).

The efficiency of in vivo recombination (0.4.2-5.5%) was at the low end of the expected

range of between 1% and 12% (Herault et al., 1998; Genoud et al., 2004). This may have been

due to the presence of the methylated loxP sites or because of the large interval (225 kb) between

the loxP sites. In addition, although the loxP sites that flank the splice acceptor sites within the

gene trap allele are separated only by 378 base pairs, the presence of multiple loxP sites results in

a ten fold decrease in the efficiency of cre-induced recombination between sister chromatids

(trans), although the deletion of the intervening 378 base pairs (cis) is highly efficient (data not

shown). If only trans-loxer containing two loxP sites (in trans) are considered, the efficiency is

consistent with previous reports.

Deletions of up to 28 Mb have been generated in vivo when the loxP sites were in the cis

configuration (Spitz et al., 2005). However, the deletion of Gtf2i/Gtf2ird1 and reciprocal

duplication of Gtf2i is the largest in vivo rearrangement reported using the TAMERE strategy

when loxP sites are in the trans configuration (Brault et al., 2006). Using a similar strategy,

further mouse models can be created either by the generation of new mouse models or the

identification of existing mouse models carrying loxP sites in the proper orientation and then

employing the TAMERE strategy to create the desired genomic rearrangements. The generation

260

of the Gtf2i/Gtf2ird1 deletion as well as the duplication of Gtf2i in this report will allow for

further elucidation of the roles that these genes play in the WBS and expressive language

impairment respectively.

The generation of a mouse model carrying a deletion of both Gtf2i and Gtf2ird1 on the

same chromosome as well as a second mouse model containing a duplication of Gtf2i is an

important technical advancement. An important step in elucidating the roles of Gtf2i and

Gtf2ird1 is to determine the temporal and spatial distribution of both genes. Fortunately the

strategy used to trap both Gtf2i and Gtf2ird1 results in the production of LacZ fusion protein that

is expressed under the control of the endogenous promoters of the trapped genes.

Consistent with the expression patterns observed in the previously generated LacZ-

Gtf2ird1 mouse model (Palmer et al., 2007), lacZ staining for TFII-IRD1 showed expression in

all regions including layer V pyramidal cells of the frontal cortex, the basolateral nucleus of the

amygdala (BLA), the dorsal raphe nucleus as well as thalamic and hypothalamic regions have all

been associated with alterations in both fear and aggression through lesion studies in both

rodents and humans (Nelson and Chiavegatto, 2000; Seiver, 2008). Layer V pyramidal cells are

the primary output neurons of the prefrontal cortex sending projections to the amygdala,

hypothalamus, and striatum and are the only source of cortical feedback to several key

neuromodulatory nuclei including the dorsal raphe nucleus which receives its only cortical

projection from layer V pyramidal cells of the prefrontal cortex (Gonçalves et al., 2009; Gabbott

et al., 2005; Peyron et al., 1998; Vertes et al., 2004). Expression of TFII-IRD1 in layer V also

correlates with TRPC4 expression that was shown by microarray analysis and western blotting to

be reduced in frontal cortexes of the targeted Gtf2ird1 mice. Consistent with previous reports

(Danoff et al., 2004; Palmer et al., 2007), significant staining was also observed in the Purkinje

261

cell layer of the cerebellum suggesting that the loss of TFII-IRD1 in the Purkinje cells may be

the underlying cause of the possible deficits in motor co-ordination seen in the Gtf2ird1 mice.

Expression levels of TFII-I were considerably higher throughout the brain relative to

TFII-IRD1 expression consistent with previous mRNA expression data (Enkhmandakh et al.,

2009). Of particular note are the regions where TFII-I and TFII-IRD1 expression differed.

Consistent with the lack of spatial memory deficits seen in Gtfi2rd1 targeted mice, very little

expression is detected in the hippocampus of Gtf2ird1 mice, whereas TFII-I is expressed strongly

in the hippocampal pyramidal cell layers as well as weaker diffuse staining in the molecular

layer of the dentate gyrus in Gtf2i gene trap mice. Given the high amount of TFII-I expression in

the hippocampus, it would be expected that the reduction of TFII-I could have a significant

impact on spatial abilities. TFII-I expression is also notably weaker in cortical layer V pyramidal

cells with cortical expression being greatest in layers 2/3, a region that shows little TFII-IRD1

expression. It has been proposed that TFII-I and TFII-IRD1 may perform opposing roles within

the same cell type, but from differences in expression levels in specific brain regions, it is clear

that each gene likely performs specific function in these regions that are independent of one

another. Comparison of the individual gene models with the double knockout will provide

important insight into the roles that these transcription factors play both individually and

collectively in WBS.

Although the ―proximal deletion‖ mouse generated by Li et al., (2009) contains a

hemizygous deletion of Gtf2i and Gtf2ird1, it also contains single copies each of Limk1 and

Clip2, both of which have also been implicated in the cognitive and behavioral aspects of WBS.

The generation of a double deletion of only Gtf2i and Gtf2ird1 will allow for the comparison of

the resulting phenotype of the existing proximal deletion mice to determine the contribution

262

made specifically by these genes to the WBS phenotype. Since the deletion of both genes were

generated on single chromosome, mice carrying the deletion of Gtf2i and Gtf2ird1 can also be

crossed with existing mouse lines carrying targeted genes of any of the remaining genes within

the commonly deleted region (e.g. Limk1 or Clip2 independently) to determine the combinatorial

effect of the loss of these genes.

In addition, analysis of the vocalization patterns in Gtf2i duplication mice will determine

whether the severe expressive language delay seen in individuals with the 7q11.23 duplication

results from increased Gtf2i expression. Initial analyses identified region-specific expression of

both TFII-I and TFII-IRD1 in adult brain and these can be extended to include detailed map of

expression in adults and during development. Since antibodies specific for TFII-IRD1 are not

available, LacZ/TFII-IRD1 fusion protein produced by the Gtf2ird1 gene trap mouse model will

allow for the study of the expression of TFII-IRD1 including the co-localization of TFII-IRD1

with prospective candidate genes.

263

4.5: References:

Aasland R, Gibson TJ, and Stewart AF. (1995) The PHD finger: implications for chromatin-

mediated transcriptional regulation. Trends in Biochemical Sciences. 20:56-59.

Ashe A, Morgan DK, Whitelaw NC, Bruxner TJ, Vickaryous NK, Cox LL, Butterfield NC,

Wicking C, Blewitt ME, Wilkins SJ, Anderson GJ, Cox TC, and Whitelaw E. (2008) A

genome-wide screen for modifiers of transgene variegation identifies genes with critical

roles in development. Genome Biology. 9:R182.

Buehr M, and Smith A. (2003) Genesis of embryonic stem cells. Philosophical Transactions of

the Royal Society B. 358:1397-1402.

Brault V, Pereira P, Duchon A, and Hérault Y. (2006) Modeling chromosomes in mouse to

explore the function of genes, genomic disorders, and chromosomal organization. PLoS

Genetics. 2:e86.

Camper SA, Saunders TL, Kendall SK, Keri RA, Seasholtz AF, Gordon DF, Birkmeier TS,

Keegan CE, Karolyi IJ, Roller ML, et al. (1995) Implementing transgenic and embryonic

stem cell technology to study gene expression, cell-cell interactions and gene function.

Biology of Reproduction. 52:246-257.

Chen KS, Potocki L, and Lupksi JR. (1996) The Smith-Magenis syndrome [del(17)p11.2]:

Clinical review and molecular advances. Mental Retardation and Developmental

Disabilities Research Reviews. 2:122-129.

Crackower MA, Kolas NK, Noguchi J, Sarao R, Kikuchi K, Kaneko H, Kobayashi E, Kawai Y,

Kozieradzki I, Landers R, Mo R, Hui CC, Nieves E, Cohen PE, Osborne LR, Wada T,

Kunieda T, Moens PB, and Penninger JM. (2003) Essential role of Fkbp6 in male fertility

and homologous chromosome pairing in meiosis. Science. 300:1291-1295.









De Zeeuw CI, Hoogenraad CC, Goedknegt E, Hertzberg E, Neubauer A, Grosveld F, and Galjart

N. (1997) CLIP-115, a novel brain-specific cytoplasmic linker protein, mediates the

localization of dendritic lamellar bodies. Neuron. 19:1187-1199.



264

Dupé V, Davenne M, Brocard J, Dollé P, Mark M, Dierich A, Chambon P, and Rijli FM. (1997)

In vivo functional analysis of the Hoxa-1 3' retinoic acid response element (3'RARE).

Development. 124:399-410.

Durkin ME, Keck-Waggoner CL, Popescu NC, and Thorgeirsson SS. (2001) Integration of a c-

myc transgene results in disruption of the mouse Gtf2ird1 gene, the homologue of the

human GTF2IRD1 gene hemizygously deleted in Williams-Beuren syndrome. Genomics.

73:20-27.



associated TFII-I genes in embryonic development. Proceedings of the National Acaademy

of Sciences (USA). 106:181-186.

Fujiki R, Kim MS, Sasaki Y, Yoshimura K, Kitagawa H, and Kato S. (2005) Ligand-induced

transrepression by VDR through association of WSTF with acetylated histones. EMBO

Journal. 24:3881-3894.

Fujiwara T, Mishima T, Kofuji T, Chiba T, Tanaka K, Yamamoto A, and Akagawa K. (2006)

Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing

synaptic plasticity. Journal of Neuroscience. 26:5767-5776.

Gabbott PL, Warner T, Jays PR, Salway P, and Busby S. (2005) Prefrontal cortex in the rat:

projections to subcortical autonomic, motor, and limbic centers. Journal of Comparative

Neurology. 492:145–177.



of Medical Genetics. 40: 526-530.

Gallin JI, and Malech HL. (1990) Update on chronic granulomatous diseases of childhood.

Immunotherapy and potential for gene therapy. Journal of the American Medical.

Association. 263:1533-1537.

Gardner RL, and Brook FA. (1997) Reflections on the biology of embryonic stem (ES) cells.

International Journal of Developmental Biology. 41:235-243.

Genoud N, Behrens A, Miele G, Robay D, Heppner FL, Freigang S, and Aguzzi A. (2004)

Disruption of Doppel prevents neurodegeneration in mice with extensive Prnp deletions.

Proceedings of the National Academy of Sciences (USA). 101:4198-4203.

Glaser S, Anastassiadis K, and Stewart AF. (2005) Current issues in mouse genome engineering.

Nature Genetics. 37:1187-1193.

Gonçalves L, Nogueira MI, Shammah-Lagnado SJ, and Metzger M. (2009) Prefrontal afferents

to the dorsal raphe nucleus in the rat. Brain Research Bulletin. 78:240–247.

Greenberg F, Lewis RA, Potocki L, Glaze D, Parke J, Killian J, Murphy MA, Williamson D,

Brown F, Dutton R, McCluggage C, Friedman E, Sulek M, and Lupski JR. (1996) Multi-



265

disciplinary clinical study of Smith-Magenis syndrome (deletion 17p11.2) American

Journal of Medical Genetics. 62:247-254.

Gu H, Zou YR, and Rajewsky K. (1993) Independent control of immunoglobulin switch

recombination at individual switch regions evidenced through Cre-loxP-mediated gene

targeting. Cell. 73:1155-1164.

Gu H, Marth JD, Orban PC, Mossmann H, and Rajewsky K. (1994) Deletion of a DNA

polymerase beta gene segment in T cells using cell type-specific gene targeting. Science.

265:103-106.

Hamilton DL, and Abremski K. (1984) Site-specific recombination by the bacteriophage P1 lox-

Cre system. Cre-mediated synapsis of two lox sites. Journal of Molecular Biology.

178:481-486.

Harbord M, Novelli M, Canas B, Power D, Davis C, Godovac-Zimmermann J, Roes J, and Segal

AW. (2002) Ym1 is a neutrophil granule protein that crystallizes in p47phox-deficient

mice. Journal of Biologic al Chemistry. 277:5468-5475.

Hérault Y, Rassoulzadegan M, Cuzin F, and Duboule D. (1998) Engineering chromosomes in

mice through targeted meiotic recombination (TAMERE). Nature Genetics. 20:381-384.

Hoogenraad CC, Eussen BH, Langeveld A, van Haperen R, Winterberg S, Wouters CH,

Grosveld F, De Zeeuw CI, and Galjart N. (1998) The murine CYLN2 gene: genomic

organization, chromosome localization, and comparison to the human gene that is located

within the 7q11.23 Williams syndrome critical region. Genomics. 53:348-358.






Hoogenraad CC, Akhmanova A, Galjart N, and De Zeeuw CI (2004) LIMK1 and CLIP-115:

linking cytoskeletal defects to Williams syndrome. Bioessays. 26:141-150.

Hultqvist M, Olofsson P, Holmberg J, Bäckström BT, Tordsson J, and Holmdahl R. (2004)

Enhanced autoimmunity, arthritis, and encephalomyelitis in mice with a reduced oxidative

burst due to a mutation in the Ncf1 gene. Proceedings of the National Academy of Sciences

(USA). 101:12646-12651.

Iizuka K, Bruick RK, Liang G, Horton JD, and Uyeda K. (2004) Deficiency of carbohydrate

response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis.

Proceedings of the National Academy of Sciences (USA). 101:7281-7286.

Jackson SH, Gallin JI, and Holland SM. (1995) The p47phox mouse knock-out model of chronic

granulomatous disease. Journal of Experimental Medicine. 182:751-758.







266

Janssen E, Zhu M, Zhang W, Koonpaew S, and Zhang W. (2003) LAB: a new membrane-

associated adaptor molecule in B cell activation. Nature Immunology. 4:117-123.

Koller BH, and Smithies O. (1989) Inactivating the beta 2-microglobulin locus in mouse

embryonic stem cells by homologous recombination. Proceedings of the National Academy

of Sciences (USA). 86:8932-8935.

Lam PP, Leung YM, Sheu L, Ellis J, Tsushima RG, Osborne LR, and Gaisano HY. (2005)

Transgenic mouse overexpressing syntaxin-1A as a diabetes model. Diabetes. 54:2744-

2754.

Lewandoski M, Wassarman KM, and Martin GR. (1997) Zp3-cre, a transgenic mouse line for the

activation or inactivation of loxP-flanked target genes specifically in the female germ line.

Current Biology. 7:148-151.

Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E, and Keating

MT. (1998a) Elastin is an essential determinant of arterial morphogenesis. Nature.

393:276-280.


Keating MT (1998b) Novel arterial pathology in mice and humans hemizygous for elastin.


Liu P, Zhang H, McLellan A, Vogel H, and Bradley A. (1998) Embryonic lethality and

tumorigenesis caused by segmental aneuploidy on mouse chromosome 11. Genetics.

150:1155-1168.

McRory JE, Rehak R, Simms B, Doering CJ, Chen L, Hermosilla T, Duke C, Dyck R, and

Zamponi GW. (2008) Syntaxin 1A is required for normal in utero development.

Biochemical and Biophysical Research Communications. 375:372-377.

Meng Y, Zhang Y, Tregoubov V, Janus C, Cruz L, Jackson M, Lu WY, MacDonald JF, Wang

JY, Falls DL, and Jia Z. (2002) Abnormal Spine Morphology and Enhanced LTP in LIMK-

1 Knockout Mice. Neuron. 35:121-133.





American Journal of Medical Genetics A. 123A:45-59.

Mouse Genome Sequencing Consortium, Waterston RH, Lindblad-Toh K, Birney et al., (2002)

Initial sequencing and comparative analysis of the mouse genome. Nature. 420:520-562.

Nelson RJ, and Chiavegatto S. (2000) Aggression in Knockout Mice. ILAR Journal. 41:153-

162.

Ohara-Imaizumi M, Fujiwara T, Nakamichi Y, Okamura T, Akimoto Y, Kawai J, Matsushima S,

Kawakami H, Watanabe T, Akagawa K, and Nagamatsu S. (2007) Imaging analysis

267

reveals mechanistic differences between first- and second-phase insulin exocytosis. The

Journal of Cell Biology. 177:695-705.

Palmer SJ, Tay ES, Santucci N, Cuc Bach TT, Hook J, Lemckert FA, Jamieson RV, Gunnning

PW, and Hardeman EC. (2007) Expression of Gtf2ird1, the Williams syndrome-associated

gene, during mouse development. Gene Expression Patterns. 7:396–404.

Peyron C, Petit JM, Rampon C, Jouvet M, and Luppi PH. (1998) Forebrain afferents to the rat

dorsal raphe nucleus demonstrated by retrograde and anterograde tracing methods.

Neuroscience. 82:443–468.

Ranheim EA, Kwan HC, Reya T, Wang YK, Weissman IL, and Francke U. (2005) Frizzled 9

knock-out mice have abnormal B-cell development. Blood. 105:2487-2494.

Rassoulzadegan M, Magliano M, and Cuzin F. (2002) Transvection effects involving DNA

methylation during meiosis in the mouse. EMBO Journal. 21: 440-50.

Robertson EJ. (1986) in: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach.

IRL Press. Oxford/Washington DC.

Sauer B, and Henderson N. (1988) Site-specific DNA recombination in mammalian cells by the

Cre recombinase of bacteriophage P1. Proceedings of the National Academy of Sciences

(USA). 85:5166-5170.

Siever LJ. (2008) Neurobiology of Aggression and Violence. Americal Journal of Psychiatry.

165:429-442.

Spitz F, Herkenne C, Morris MA, and Duboule D. (2005) Inversion-induced disruption of the

Hoxd cluster leads to the partition of regulatory landscapes. Nature Genetics. 37:889-893.

Stanford WL, Cohn JB, and Cordes SP (2001) Gene Trap Mutagenesis past, present & beyond.

Nature Reviews Genetics. 2:756–768.

Thomas KR, and Capecchi MR. (1987) Site-directed mutagenesis by gene targeting in mouse

embryo-derived stem cells. Cell. 51:503-512.

Tkaczyk C, Horejsi V, Iwaki S, Draber P, Samelson LE, Satterthwaite AB, Nahm DH, Metcalfe

DD, and Gilfillan AM. (2004) NTAL phosphorylation is a pivotal link between the

signaling cascades leading to human mast cell degranulation following Kit activation and

Fc epsilon RI aggregation. Blood. 104:207-214.

Tsien JZ, Huerta PT, and Tonegawa S. (1996) The essential role of hippocampal CA1 NMDA

receptor-dependent synaptic plasticity in spatial memory. Cell. 87:1327-1338.

Uyeda K, Yamashita H, and Kawaguchi T. (2002) Carbohydrate responsive element-binding

protein (ChREBP): a key regulator of glucose metabolism and fat storage. Biochemical

Pharmacology. 63:2075-2080.

Vertes R. (2004) Differential projections of the infralimbic and prelimbic cortex in the rat.

Synapse. 51:32–58.



http://www.ncbi.nlm.nih.gov/pubmed/2822260

http://www.ncbi.nlm.nih.gov/pubmed/2822260

268

Volná P, Lebduska P, Dráberová L, Símová S, Heneberg P, Boubelík M, Bugajev V, Malissen B,

Wilson BS, Horejsí V, Malissen M, and Dráber P. (2004) Negative regulation of mast cell

signaling and function by the adaptor LAB/NTAL. Journal of Experimental Medicine.

200:1001-1013.

Walther MM, Malech H, Berman A, Choyke P, Venzon DJ, Linehan WM, and Gallin JI. (1992)

The urological manifestations of chronic granulomatous disease. Journal of Urology.

147:1314-1318.

Walz K, Caratini-Rivera S, Bi W, Fonseca P, Mansouri DL, Lynch J, Vogel H, Noebels JL,

Bradley A, and Lupski JR. (2003) Modeling del(17)(p11.2p11.2) and dup(17)(p11.2p11.2)

contiguous gene syndromes by chromosome engineering in mice: phenotypic

consequences of gene dosage imbalance. Molecular Cell Biology. 23:3646-3655.

Walz K, Spencer C, Kaasik K, Lee CC, Lupski JR, and Paylor R. (2004) Behavioral

characterization of mouse models for Smith-Magenis syndrome and dup(17)(p11.2p11.2).


Yoshimura K, Kitagawa H, Fujiki R, Tanabe M, Takezawa S, Takada I, Yamaoka I, Yonezawa

M, Kondo T, Furutani Y, Yagi H, Yoshinaga S, Masuda T, Fukuda T, Yamamoto Y,

Ebihara K, Li DY, Matsuoka R, Takeuchi JK, Matsumoto T, and Kato S. (2009) Distinct

function of 2 chromatin remodeling complexes that share a common subunit, Williams

syndrome transcription factor (WSTF). Proceedings of the National Academy of Sciences

(U S A). 106:9280-9285.

Zeng L, and Zhou MM. (2002) Bromodomain: an acetyl-lysine binding domain. FEBS Letters.

513:124–128.

Zhang H, Hasty P, and Bradley A. (1994) Targeting frequency for deletion vectors in embryonic

stem cells. Molecular Cell Biology. 14:2404-2410.

Zhao C, Avilés C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ. (2005) Hippocampal and

visuo-spatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams


Zheng B, Mills AA, and Bradley A. (1999) A system for rapid generation of coat color-tagged

knockouts and defined chromosomal rearrangements in mice. Nucleic Acids Research.

27:2354–2360.

Zheng B, Sage M, Sheppeard EA, Jurecic V, and Bradley A. (2000) Engineering mouse

chromosomes with Cre-loxP: range, efficiency, and somatic applications. Molecular Cell

Biology. 20:648-655.

Zijlstra M, Li E, Sajjadi F, Subramani S, and Jaenisch R. (1989) Germ-line transmission of a

disrupted beta 2-microglobulin gene produced by homologous recombination in embryonic

stem cells. Nature. 342:435-438.

.

269

CHAPTER V: SUMMARY AND FUTURE DIRECTION:

270

5.1: Introduction:

5.1.1: Summary:

Williams-Beuren syndrome (WBS) is a rare autosomal dominant disorder presenting with

a unique spectrum of physical and behavioral features caused by a deletion within the 7q11.23

region that occurs at a frequency of 1/7500 to 1/20,000 (Greenberg, 1990; Pober and Dykens,

1996; Stromme et al., 2002). The human 7q11.23 region is prone to genomic rearrangements

due to the presence of large low copy repeats (LCR) that flank the commonly deleted WBS

region. Although the vast majority of individuals with WBS possess a common 1.5 Mb deletion

within the 7q11.23 locus, other chromosomal rearrangements including larger and smaller

deletions as well as duplications and inversions have also been identified, each exhibiting their

own unique phenotypes (Botta et al., 1999; Fragiskakis et al., 1996; Gagliardi et al., 2003; Heller

et al., 2003; Hirota et al., 2003 Morris et al., 2003; Tassabehji et al., 1999, 2005; Blyth et al.,

2008; Osborne et al., 2001; Somerville et al., 2005).

The present work has combined both identification and evaluation of human patients and

the generation of specific mouse models in an attempt to further elucidate the features associated

with the various genomic rearrangements of 7q11.23. In humans, large genomic rearrangements

including deletions encompassing MAGI2 and duplication of the 1.5 Mb commonly deleted

WBS region were found to be associated with infantile spasms and severe expressive language

delay respectively (Marshall et al., 2008; Somerville et al., 2005).

Individuals possessing atypical WBS deletion have implicated genes at the telomeric end

of the commonly deleted WBS region including the transcription factors GTF2I and GTF2IRD1

with involvement in the cognitive and behavioral aspects of WBS (Tassabehji et al., 2005). In

271

mice, the generation and characterization of a Gtf2ird1 mouse model for has identified a role for

this gene in behavioral features of WBS as well as reveling alterations in serotonergic function

and possible alterations in the expression of store-operated calcium channels that may underlie

the observed phenotype. The generation of additional mouse models including a gene trapped

Gtf2i knockout, an intra-chromatidal deletion of both Gtf2i and Gtf2ird1 as well as a duplication

of Gtf2i will allow for a greater understanding a the contribution these genes make to their

associated 7q11.23 chromosomal rearrangements.

5.1.2: Genomic rearrangements of the human 7q11.23-21.11 region:

Although language impairment is thought to be caused by the interaction of multiple

genes on different chromosomes, the identification of genomic duplications of the 7q11.23

region contributing to language impairment in this work implicates a specific location on

chromosome 7 providing a launching point for a greater understanding of the underlying genes

necessary for human speech and language. As was so essential in the deciphering of contribution

of genes to the WBS phenotype, further identification of additional patients for the common

duplication as well as atypical 7q11.23 duplications will be necessary to identify the genes

whose altered expression contributes to the language impairments seen in individuals with the

7q11.23 duplication. It has not yet been determined whether people with 7q11.23 duplication,

have a similar motor impairment to the developmental verbal dyspraxia seen in individuals

carrying heterozygous FOXP2 mutations (Lai et al., 2001; MacDermot et al., 2005), but careful

evaluation of multiple affected individuals by speech and language pathologists will help to

answer this question.

272

It is evident from the growing number of cases of 7q11.23 duplication, that like WBS, the

duplication of 7q11.23 results in a truly syndromic disorder, with other aspects distinct from

speech and language that are shared with both disorders although in a dissimilar and often

opposite manner including distinctive facial features and behavioral problems. The stark

differences in speech and cognitive abilities between children with WBS and those with the

duplication of the 7q11.23 region suggest that one or more genes in the WBS region are dosage

sensitive and that these genes, in association with other genes and the environment, are important

for speech and cognitive development.

The association of MAGI2 with infantile spasms also provides a critical starting point for

elucidating the underlying neuropathology of this disorder. However, further investigation is

necessary to confirm that the loss of MAGI2 function is indeed responsible for the observed

phenotype. Since to date, only individuals carrying large deletions encompassing MAGI2 have

been found to be unequivocally associated with IS. It is possible that it is the loss of a regulatory

element affecting the expression of a distant gene and not a decrease in MAGI2 expression that is

responsible for this rare epileptic disorder. The identification of patients with isolated IS,

carrying point mutations within MAGI2 will be necessary to confirm MAGI2‘s role in IS.

Although a mouse model does exist for Magi2, the targeting resulted in the disruption of

only the α isoform leaving the predominant neuronal isoform (β) intact (Iida et al 2007).

Therefore generation of a mouse model possessing a disruption of all three isoforms present in

mice is also necessary to properly evaluate to the role of MAGI2 in IS, and will provide a useful

tool for the study of both the pathophysiology and the efficacy of new medications.

273

5.1.3: Targeting of Gtf2ird1 results in increased sociability, reduced fear and aggression,

altered serotonin metabolism and deficits in motor function/co-ordination:

Analysis of individuals possessing atypical deletions encompassing the Gtf2i gene family

members GTF2I and GTF2IRD1 had implicated these genes in the behavioral aspects of WBS.

However, prior to this work only limited behavioral or cognitive analysis had been performed on

the existing Gtf2ird1 mouse model (Durkin et al., 2001; van Hagen et al., 2007; Tassabehji et al.,

2005). Gtf2ird1-/-

mice exhibited a phenotype that is reminiscent of individuals with WBS

including increases in sociability and a decrease in the natural fear response as well as

abnormalities in motor function. It was subsequently determined that neuronal activation and

serotonin levels were altered in regions previously shown to be associated with these behaviors

including the frontal cortex and the amygdala. Microarray analysis also on frontal cortex

identified a decrease in the expression of the transient receptor potential cation channel,

subfamily C, member 4, also known as TRPC4, a receptor-activated non-selective calcium

permeant cation channel operated by a phosphatidylinositol second messenger system activated

by receptor tyrosine kinases or G-protein coupled receptors (Schaefer et al., 2002).

The identification of Gtf2ird1‘s possible involvement in the motor co-ordination

abnormalities also provides an important starting point to elucidate the underlying causes of the

visual-motor integration deficits identified in individuals with WBS (Frangiskakis et al 1996).

Given TFII-IRD1‘s known association with the troponin 1 slow promoter, histological evaluation

will be necessary to determine if the decrease in Gtf2ird1 expression has altered the specific fibre

types in the skeletal muscle of Gtf2ird1-/-

mice and whether this alteration is responsible for the

observed deficits in motor co-ordination and muscle strength.

274

5.1.4: Generation of gene trap and deletion mouse models for the Gtf2i gene family:

Atypical deletions in humans have been identified implication the genes telomeric to

elastin in the major features of WBS, theses individual and their associated deletions are few in

number and variable in size making it difficult to precisely assign specific features of WBS with

individual genes. Even collectively, the previous generation of animal models for several genes

deleted in WBS has not recapitulated the human phenotype and a recently generated mouse

model containing large overlapping deletion of the commonly deleted WBS region (Li et al.,

2009) has failed to shed any novel insight into the contribution made by the genes, particularly

those telomeric to the elastin gene that are thought to be the major contributors to the WBS

phenotype. This may reflect the differences between men and mice, but it may also reflect strain

background since the non-deleted paralogous genes in the proximal (PD) and distal (DD)

deletion mice originated from a C57BL/6 background while in the double deletion (P/D) mice,

generated to mimic to commonly deleted WBS region, the non-deleted paralogous genes

originate from a 129/Sv/Ev background. Differences in strain background has been shown to

result in variability in the phenotypic expression [e.g. craniofacial (Tassabehji et al., 2005;

Enkhmandakh et al., 2009)] this could explain why the deletion mouse lines are not additive,

although a combinatorial effect also cannot be ruled out.

To elucidate the contribution to the WBS phenotype made by the commonly deleted

Gtf2i gene family members, individual models targeted for Gtf2i and Gtf2ird1 were generated.

In vivo Cre-induced recombination was used to create a 200 kb intra-chromatidal deletion of both

Gtf2i and Gtf2ird1 as well as the reciprocal duplication of Gtf2i. Analysis of the newly

generated models will parallel that of the existing targeted Gtf2ird1 mouse model including

identification of possible changes in sociability and aggression. Importantly, deficits in spatial

275

memory abilities, a trait characteristic of individuals with WBS that have been not been clearly

identified in existing WBS mouse models, may be identified in Gtf2i mice. More interestingly,

phenotypes may exist only in the double deletion that are absent in the single gene targeted mice

indicating that the phenotype results from a combinatorial loss of both Gtf2i gene family

members.

5.1.5: Future directions:

This work has provided a valuable insight into deciphering the role of the Gtf2i gene family

members in the etiology of WBS and in particular the importance of the use of genetically

engineered mouse mutants as a valuable tools to elucidate the genetic control of behaviour in

studying human disorders. Although human patients containing atypical deletions have provided

significant information about the genotype-phenotype correlations in WBS, these patients are too

few in numbers. Modeling of human disorders in mice has several advantages. There are

powerful techniques that exist for the manipulation of the mouse genome including the creation

of developmental stage- or tissue specific genetic alterations and access to tissue and embryonic

time points that are not possible in humans.

Although the efficiency of Cre-induced recombination reported in this work was at the

lower end of the reported range, the technical success in generating the double deletion of Gtf2i

and Gtf2ird1 also opens the door for the creation of further multiple gene deletions using a

similar strategy. Mice, either gene trap or those that have been targeted by other investigators,

which contain loxP sites in the proper orientation, can be used to produce successively larger

deletions/duplications within the commonly deleted region. In addition, these mice can

276

themselves be bred together to produce variable deletions such as a deletion of Limk1 to Clip2 as

well as the reciprocal duplication of Eif4h, Lat2 and Rfc2.

A further benefit of in vivo Cre recombination is that the desired rearrangement can be

generated in a temporal or spatial-specific manner using a Cre transgene whose expression is

controlled by promoters active only in specific tissues or at a specified time during development.

Examples of spatially controlled gene deletions include the deletion of functional N-methyl-D-

asparate receptor 1 (NMDAR1) gene that was deleted using the forebrain-specific calcium

calmodulin dependent kinase IIa (CaMKIIα) gene promoter to drive Cre expression (Tsien et al.,

1996). Using this mechanism the deletion can be generated not only within specific cell types

but also at a specific time in development. It will be interesting to determine if the loss TFII-I

and TFII-IRD1 after a specific time point, for example birth, results is a similar phenotype as a

mouse constitutively lacking Gtf2i and Gtf2ird1. Since the splice acceptor site that directs the

gene trap mechanism is flanked by loxP sites, Cre-induced recombination will remove the splice

acceptor site thereby inactivating the trapping mechanism and allowing for restored expression

of the previously trapped gene. It therefore is possible to restore function of the trapped Gtf2i

and Gtf2ird1 genes in a spatial and/or temporal manner. This is of critical importance to the

possible treatment of WBS individuals. For example, amelioration of the phenotype in the adult

mice if the expression of trapped genes is restored in the early postnatal period would indicate

that therapeutic intervention at this early stage in humans might improve some of the negative

behavioral and cognitive aspects of the WBS phenotype. Therapeutic intervention has recently

been demonstrated involving a mouse model involving the elastin gene, known to be responsible

for the cardiac abnormalities seen in WBS. The cardiovascular abnormalities found in Eln-

targeted mice could be alleviated by the introduction of a human ELN transgene (Hirano et al.,

277

2007) providing evidence that pharmaceutical therapies aimed at restoring normal vessel

function may reduce the hypertension, smooth muscle cell proliferation and vascular stenosis

that are the main causes of mortality in WBS. The mouse models generated in this work will

provide the basis for manipulations, including access to prenatal and perinatal phenotypic

characterization that are not possible in human subjects and should prove a valuable model for

this truly intriguing human disorder.

278

5.2: References:

Antonell A, Del Campo M, Magano LF, Kaufmann L, Martínez de la Iglesia J, Gallastegui F,

Flores R, Schweigmann U, Fauth C, Kotzot D, and Pérez-Jurado LA. (2009) Partial

7q11.23 deletions further implicate GTF2I and GTF2IRD1 as the main genes responsible

for the Williams-Beuren syndrome neurocognitive profile. Journal of Medical Genetics.

47:312-320.

Beunders G, van de Kamp JM, Veenhoven RM, van Hagen JM, Nieuwint AW, and Sistermans

EA. (2009) A triplication of the Williams Beuren Syndrome region in a patient with

mental retardation, a severe expressive language delay, behavioral problems and

dysmorfisms. Journal of Medical Genetics. 47:271-275.

Blyth M, Beal S, Huang S, Crolla J, and Foulds N. (2008) A novel 2.43 Mb deletion of 7q11.22-

q11.23. American Journal of Medical Genetics A 146A:3206-3210.





Durkin ME, Keck-Waggoner CL, Popescu NC, and Thorgeirsson SS. (2001) Integration of a c-

myc transgene results in disruption of the mouse Gtf2ird1 gene, the homologue of the

human GTF2IRD1 gene hemizygously deleted in Williams-Beuren syndrome. Genomics.

73:20-27.



associated TFII-I genes in embryonic development. Proceedings of the National Academy

of Science (USA). 106:181-186.


GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg SJ,

and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired visuo-spatial

constructive cognition. Cell. 86:59-69.




Greenberg F. (1990) Williams syndrome professional symposium. American Journal of Medical

Genetics. 6(S):85-88.



40:e99.

279

Hirano E, Knutsen RH, Sugitani H, Ciliberto CH, and Mecham RP. (2007) Functional rescue of

elastin insufficiency in mice by the human elastin gene: implications for mouse models of

human disease. Circulation Research. 101:523-531.


Bellugi U, and Korenberg JR. (2003) Williams syndrome deficits in visual spatial

processing linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in

Medicine. 5:311–321.

Iida J, Ishizaki H, Okamoto-Tanaka M, Kawata A, Sumita K, Ohgake S, Sato Y, Yorifuji H,

Nukina N, Ohashi K, Mizuno K, Tsutsumi T, Mizoguchi A, Miyoshi J, Takai Y, and Hata

Y. (2007) Synaptic scaffolding molecule alpha is a scaffold to mediate N-methyl-D-

aspartate receptor-dependent RhoA activation in dendrites. Molecular Cell Biology.

27:4388-4405.

Lai CS, Fisher SE, Hurst JA, Vargha-Khadem F, and Monaco AP. (2001) A forkhead-domain

gene is mutated in a severe speech and language disorder. Nature. 413:519-523.

Li HH, Roy M, Kuscuoglu U, Spencer CM, Halm B, Harrison KC, Bayle JH, Splendore A, Ding

F, Meltzer LA, Wright E, Paylor R, Deisseroth K, and Francke U. (2009) Induced

chromosome deletions cause hypersociability and other features of Williams-Beuren

syndrome in mice. EMBO Molecular Medicine. 1:50-65.

MacDermot KD, Bonora E, Sykes N, Coupe AM, Lai CS, Vernes SC, Vargha-Khadem F,

McKenzie F, Smith RL, Monaco AP, and Fisher SE. (2005) Identification of FOXP2

truncation as a novel cause of developmental speech and language deficits. American


Marshall CR, Young EJ, Pani AM, Freckmann ML, Lacassie Y, Howald C, Fitzgerald KK,


Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P,

Tassabehji M, Gregg RG, Scherer SW, and Osborne LR. (2008) Infantile spasms is

associated with deletion of the MAGI2 gene on chromosome 7q11.23-q21.11. American






American Journal of Medical Genetics, Part A. 123A:45-59.

Morris C, Mervis C, Velleman S, John A, Currier A, Rios C, Kimberley K, and Crawford N.

(2009) Phenotypic comparison of Williams syndrome and its reciprocal duplication

syndrome reveals significant differences in dysmorphic features, speech, cognitive ability,

and type of anxiety. ASHG General Meeting. abstract #2568.

280

Osborne LR, Li M, Pober B, Chitayat D, Bodurtha J, Mandel A, Costa T, Grebe T, Cox S, Tsui

LC, and Scherer SW. (2001) A 1.5 million-base pair inversion polymorphism in families

with Williams-Beuren syndrome. Nature Genetics. 29:321-325.

Pober BR, and Dykens EM. (1996) Williams syndrome: An overview of medical, cognitive and

behavioral features. Child and Adolescent Psychiatric Clinics of North America. 5:929-943.

Schaefer M, Plant TD, Stresow N, Albrecht N and Schultz G. (2002) Functional differences

between TRPC4 splice variants. Journal of Biological Chemistry. 277:3752-3759.

Somerville MJ, Mervis CB, Young EJ, Seo EJ, del Campo M, Bamforth S, Peregrine E, Loo W,

Lilley M, Pérez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe

expressive-language delay related to duplication of the Williams-Beuren locus. New

England Journal of Medicine. 353:1694-1701.

Stromme P, Bjornstad PG, and Ramstad K. (2002) Prevalence estimation of Williams syndrome.

Journal of Child Neurology. 17:269–271.

Tassabehji M, Metcalfe K, Karmiloff-Smith A, Carette MJ, Grant J, Dennis N, Reardon W, Splitt

M, Read AP, and Donnai D. (1999) Williams syndrome: use of chromosomal

microdeletions as a tool to dissect cognitive and physical phenotypes. American Journal of


Tassabehji M, Hammond P, Karmiloff-Smith A, Thompson P, Thorgeirsson SS, Durkin ME,

Popescu NC, Hutton T, Metcalfe K, Rucka A, Stewart H, Read AP, Maconochie M, and

Donnai D. (2005) GTF2IRD1 in craniofacial development of humans and mice. Science.

310:1184-1187.

Torniero C, Dalla Bernardina B, Novara F, Cerini R, Bonaglia C, Pramparo T, Ciccone R,

Guerrini R, and Zuffardi O. (2008) Dysmorphic features, simplified gyral pattern and

7q11.23 duplication reciprocal to the Williams-Beuren deletion. European Journal of


Tsien JZ, Huerta PT, and Tonegawa S. (1996) The essential role of hippocampal CA1 NMDA

receptor-dependent synaptic plasticity in spatial memory. Cell. 87:1327-1338.

Van der Aa N, Rooms L, Vandeweyer G, van den Ende J, Reyniers E, Fichera M, Romano C,

Delle Chiaie B, Mortier G, Menten B, Destrée A, Maystadt I, Männik K, Kurg A, Reimand

T, McMullan D, Oley C, Brueton L, Bongers EM, van Bon BW, Pfund R, Jacquemont S,

Ferrarini A, Martinet D, Schrander-Stumpel C, Stegmann AP, Frints SG, de Vries BB,

Ceulemans B, and Kooy RF. (2009) Fourteen new cases contribute to the characterization

of the 7q11.23 microduplication syndrome. European Journal of Human Genetics. 52:94-

100.

van Hagen JM, van der Geest JN, van der Giessen RS, Lagers-van Haselen GC, Eussen HJ, Gille

JJ, Govaerts LC, Wouters CH, de Coo IF, Hoogenraad CC, Koekkoek SK, Frens MA, van

Camp N, van der Linden A, Jansweijer MC, Thorgeirsson SS, and De Zeeuw CI. (2007)

281

Contribution of CYLN2 and GTF2IRD1 to neurological and cognitive symptoms in

Williams Syndrome. Neurobiology of Disease. 26:112-124.

282

REWARDS OF A SCIENTIST:

This quote appears on the last page of AJ Beuren‘s original article describing WBS. (Circulation,

Volume 26, Page 1240, December 1962)

―Though the scientific explorer has no prospect of becoming rich in the worldly sense, as a result

of his labors, he certainly enjoys a rich life. The enthralling pleasures of discovery, the

opportunity to do what he would rather do than anything else in the world...the freedom for study

and investigation, the world-wide friendships…the assurance that his efforts in teaching and

seeking have social value…all these satisfactions are his. No man could ask for better

recompense.‖

-WALTER B. CANNON, M.D. The Way of An Investigator. New York, W. W. Norton &

Company, Inc., 1945, p. 214.

genomic rearrangements of the 7q11-21 region and … · 2011-04-18 · 1.1.4: williams-beuren...

Documents