genomics, medicine, and society american college of radiology may 13, 2003 francis s. collins, m.d.,...
TRANSCRIPT
![Page 1: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/1.jpg)
Genomics, Medicine,and Society
American College of Radiology
May 13, 2003
Francis S. Collins, M.D., Ph.D.
![Page 2: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/2.jpg)
![Page 3: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/3.jpg)
![Page 4: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/4.jpg)
![Page 5: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/5.jpg)
![Page 6: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/6.jpg)
![Page 7: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/7.jpg)
A SMALL SAMPLING OF COOL THINGS ABOUT THE GENOME
• Humans have fewer protein-coding genes than expected – less than 30,000
• Only about 5% of human DNA seems to be under strong selective pressure – but 2/3 of this is of unknown function
• Male mutation rate is twice that of females
![Page 8: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/8.jpg)
All of the original goals of the Human Genome Project have
been accomplished
What’s next?
![Page 9: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/9.jpg)
![Page 10: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/10.jpg)
Genomics to Biology
• Define the structure of human variation: the human haplotype map
• Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping,
expression analysis, proteomics, and molecular imaging• Identify all functional elements of the genome• Identify all the proteins of the cell, and their interactions• Develop a computational model of the cell
![Page 11: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/11.jpg)
Genomics to Biology
• Define the structure of human variation: the human haplotype map
• Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping,
expression analysis, proteomics, and molecular imaging• Identify all functional elements of the genome• Identify all the proteins of the cell, and their interactions• Develop a computational model of the cell
![Page 12: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/12.jpg)
Finding genes for Mendelian phenotypes has made tremendous
progress over the last 10 years
Finding genes for complex (polygenic) disorders and traits has moved much more slowly
![Page 13: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/13.jpg)
![Page 14: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/14.jpg)
Sequence from chromosome 7
GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
Three SNPs are present
![Page 15: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/15.jpg)
Whole Genome Association Approach to Common Disease
and Pharmacogenomics
• Identify all 10 million common SNPs
• Collect 1000 cases and 1000 controls
• Genotype all DNAs for all SNPs
![Page 16: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/16.jpg)
2000 DNAs x 10,000,000 SNPs
= 20,000,000,000 genotypes
![Page 17: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/17.jpg)
Sequence from chromosome 7
GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
Are the SNPs correlated with their neighbors?
![Page 18: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/18.jpg)
These three SNPs could theoretically occur in 8 different haplotypes
…C…A…A…
…C…A…G…
…C…C…A…
…C…C…G…
…T…A…A…
…T…A…G…
…T…C…A…
…T…C…G…
![Page 19: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/19.jpg)
But in practice, only two are observed
…C…A…A…
…C…A…G…
…C…C…A…
…C…C…G…
…T…A…A…
…T…A…G…
…T…C…A…
…T…C…G…
![Page 20: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/20.jpg)
~ 20,000 bp
![Page 21: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/21.jpg)
![Page 22: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/22.jpg)
A Haplotype Map of Human Variation
• Goal is to define all common haplotypes in the human genome
• Genome-wide association studies can then be done with 30 – 50 times less work
• Project is international (9 labs in 5 countries); was initiated in October 2002, using samples of African, Asian, and European origin
![Page 23: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/23.jpg)
![Page 24: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/24.jpg)
![Page 25: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/25.jpg)
Genomics to Health• Identify the genetic and environmental risk factors for all
common disease• Develop “sentinel systems” for early detection of disease and
molecular taxonomy of illness• Develop and deploy high-throughput robotic screening of
small molecules for academic researchers• Catalyze development of large human cohorts for genotype-
phenotype correlations• Elucidate the role that genomics can play in reducing health
disparities• Utilize genomics to improve health in the developing world
![Page 26: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/26.jpg)
![Page 27: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/27.jpg)
Genomics to Society• Enhance genetic privacy and protection against genetic
discrimination• Encourage appropriate patenting and licensing practices to
benefit the public• Understand the relationship of genomics, race, and
ethnicity, and bring this to bear usefully on the often contentious dialog about race
• Assess the ramifications of advances in understanding genetic factors that influence behavior
• Define boundaries of the appropriate application of genomics in the non-medical arena
![Page 28: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/28.jpg)
What will be the impact of genomics on the
practice of medicine?
![Page 29: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/29.jpg)
I think there is a world market for maybe five computers.
-- Thomas Watson
Chairman of IBM, 1943
![Page 30: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/30.jpg)
The concept is interesting and well-formed, but in order to earn better
than a ‘C’, the idea must be feasible.
-- Yale Professor evaluating Fred Smith’s student paper proposing
the FedEx company
![Page 31: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/31.jpg)
We don’t like their sound, and guitar music is on the way out.
-- Decca Records, rejecting the Beatles, 1962
![Page 32: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/32.jpg)
640K ought to be enough for anybody.
-- Bill Gates, 1981
![Page 33: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/33.jpg)
Most of the major contributing genes for diabetes, heart disease,
cancer, mental illness, Alzheimer’s and Parkinson’s disease, asthma, etc. will be identified within the
next 5 – 10 years.
![Page 34: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/34.jpg)
![Page 35: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/35.jpg)
![Page 36: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/36.jpg)
![Page 37: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/37.jpg)
![Page 38: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/38.jpg)
Pharmacogenomics: Unlocking the Human Genome for Better Drug Therapy
McLeod & Evans, Ann Rev Pharmacol Toxicol 41:101-21, 2001
All patients with same diagnosis
Treat
Remove
No response
Toxic response
Responses without
toxic side effects
![Page 39: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/39.jpg)
![Page 40: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/40.jpg)
Gleevec™ – Specifically TargetsAn Abnormal Protein, Blocking Its Ability To Cause Chronic Myeloid Leukemia
Chromosome 9;22 translocation
CML
Bcr-Abl fusion protein
Gleevec™
Bcr-Abl fusion protein
Normal
![Page 41: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/41.jpg)
2010 -- Predictive genetic tests available for a dozen conditions
-- Interventions to reduce risk available for several of these
-- Will reasonably effective legislative solutions to genetic
discrimination be in place?
BUT….
Mainstreaming of individualized preventive medicine
-- Will access be inequitable? Will health disparities persist?
-- Pharmacogenomics is standard of care for several drugs
![Page 42: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/42.jpg)
2020 -- Gene-based designer drugs available for diabetes, Alzheimer’s…
-- Gene therapy standard of care for several conditions
BUT….
Genomic therapeutic revolution in full swing
-- Intense debate underway on non-medical uses of genetics
![Page 43: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/43.jpg)
To wrest from nature the secrets which have
perplexed philosophers in all ages, to track
to their sources the causes of disease, to
correlate the vast stores of knowledge, that
they may be quickly available for the
prevention and cure of disease -- these are
our ambitions.
Sir William Osler
![Page 44: Genomics, Medicine, and Society American College of Radiology May 13, 2003 Francis S. Collins, M.D., Ph.D](https://reader036.vdocument.in/reader036/viewer/2022062500/5697bfbc1a28abf838ca156d/html5/thumbnails/44.jpg)
www.genome.gov