genotyping of methicillin resistant staphylococcus...

1

Genotyping of Methicillin Resistant Staphylococcus aureus

(MRSA) from Local Hospital of Rawalpindi/Islamabad,

Pakistan

By

YASRAB ARFAT

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University, Islamabad

2013

2

Genotyping of Methicillin Resistant Staphylococcus aureus

(MRSA) from Local Hospital of Rawalpindi/Islamabad,

Pakistan

A Thesis Submitted in the Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Biochemistry

By

YASRAB ARFAT

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University, Islamabad

2013

3

CERTIFICATE

This thesis by Mr. Yasrab Arfat is accepted in its present form by the

Department of Biochemistry, Quaid-i-Azam University, Islamabad as

satisfying the thesis requirements for the degree of Doctor of Philosophy

(PhD) in Biochemistry/Molecular Biology.

External Examiner: (Dr. ____________)

External Examiner: (Dr. ____________)

Supervisor & Chairman: (Prof. Dr. S.A. Malik) Chairperson: _____________ (Prof. Dr. Bushra Mirza)

Dated: _______________

4

IN THE NAME OF ALLAH,

MOST GRACIOUS, MOST MERCIFUL

Allah Almighty initiates the creation of everything

according to His Law and then, while passing it through

various stages of development, takes it to its destined

point. And all this happens very easily. All the plans, both

in the heavens and on earth, are cast in the patterns set

by the Almighty and are therefore most sublime.

Almighty’s Law, in fact, contains extremely beautiful

combinations in itself; it has force and power as well as

rationale and wisdom.

(Al-Quran: Surrah ArRûm, Verse: 27)

5

DEDICATION

Dedicated to my beloved parents and family members

i

CONTENTS

ACKNOWLEDGEMENTS V

LIST OF ABBREVIATIONS VII

LIST OF FIGURES IX

LIST OF TABLES XIV

ABSTRACT XVI

CHAPTER 1 1

INTRODUCTION 1

Staphylococcus aureus 1

Taxonomy of Staphylococcus aureus 2

Diseases caused by Staphylococcus aureus 2

Staphylococcus aureus Pathogenicity 4

Surface proteins 4

Invasins 6

Surface factors 6

Immunological disguises 7

Membrane-damaging toxins 7

Exotoxins 8

Antibiotic Resistance in Staphylococcus aureus 8

Mechanism of Antimicrobial resistance in Staphylococcus aureus 10

Production of beta lactamase (Penicillinase) 11

Production of an altered penicillin binding protein (PBP 2’ or

PBP2a)

11

Hyperproduction of beta-lactamase or methicillinase 11

Production of modified penicillin binding protein other than PBP2a 12

The unknown mechanism exhibited by small colony variants 12

Methicillin Resistant Staphylococcus aureus 12

Factors affecting Methicillin Resistance 16

Effect of Beta lactamases genes on methicillin resistance 16

ii

Effect of Plasmids encoding Staphylococci beta-lactamase on

methicillin Resistance 16

Effects of fem and aux factors on methicillin resistance 17

Other Chromosomal loci affecting the expression of methicillin

resistance 17

External factors affecting the expression of methicillin resistance 17

Heterogeneous and homogenous resistance to methicillin 18

Treatment against Staphylococcal Infections 18

Vaccines 19

Epidemiology of MRSA 20

Phenotypic methods of strain differentiation 20

Antibiogram 20

Phage Typing 21

Immunobloting 21

Multilocus Enzyme Electrophoresis (MLEE) 21

Serotyping 22

Genome Based Methods of Typing MRSA 22

Plasmid Analysis 22

Restriction enzyme analysis of whole genomic DNA 22

Ribotyping 23

Pulse Field Gel Electrophoresis of Chromosomal DNA 23

Ribosome spacer PCR 24

SCCmec region 24

PCR Restriction Modification (RM) Typing 25

Multilocus Variable Number of Tandem Repeat analysis (MLVA) 25

SPA Sequence typing 27

Multilocus sequence typing (MLST) 29

STAR Analysis 30

Aim and Objectives of Study 30

CHAPTER 2 32

MATERIALS AND METHODS 32

iii

Isolation and identification of Staphylococcus aureus 32

Gram staining and Biochemical Tests 33

Bacterial culture and DNA Isolation 34

16S-rDNA Identification of Staphylococcus aureus 35

Mec A- gene Identification and SCCmec typing of S. aureus 36

Detection of PVL Gene 37

Determination of MRSA Lineages Using Restriction Modification

system (RM-Test) 37

Typing of Staphylococcus aureus for STAR Element 39

Multiplex PCR Based MLVA Assay 40

Calculation of VNTRs and MLVA Data analysis 42

Phylogenetic analysis 42

SPA typing 42

Multilocus sequence typing (MLST) 44

DNA Sequencing Procedure 46

DNA Ladder 47

Solutions and Buffers 47

Statistical and Sequence Analysis 49

CHAPTER 3

Results 50

Staphylococcus aureus identification by 16S-rRNA Gene 50

MRSA Identification by mecA Gene 55

Detection of Panton Valentine Leukocidin Gene in MRSA isolates

from Pakistan

61

Multilocus variable Number of Tandem Repeats Analysis (MLVA)

of MRSA Isolates from Pakistan

64

Lineage Determination by Using RM Test 81

Spa Sequence Typing of Pakistani MRSA Isolates 90

Multilocus Sequence Typing of Staphylococcus aureus 94

iv

Analysis of STAR Element of Staphylococcus aureus isolates from

Pakistan 104

CHAPTER 4 124

Discussion 124

Recommendations 132

Future Directions 133

CHAPTER 5 134

REFERENCES 134

APPENDIX-I 162

APPENDIX-II 182

v

ACKNOWLEDGEMENTS

Praise be to Thee! We do not know anything except what Thou hast made

known to us: indeed Thou art the best Knower, the Wisest (Al-Quran).

I am greatly thankful to Almighty Allah who has enabled me to undertake this task

and complete it successfully. The writing of a dissertation can be a lonely and

isolating experience, yet it is obviously not possible without the personal and

practical support of my Supervisor, parents, my friends, colleagues, lab fellows, other

associates and staff.

I am most indebted to my Supervisor Dr. Salman Akbar Malik, Professor and former

Chairman Department of Biochemistry, Faculty of Biological Sciences (FBS) Quaid-

i-Azam University (QAU), for his affectionate guidance, encouraging behavior,

constant support and advice.

I am also thankful to Dr. M. Fayaz Chaudry, former Dean FBS, Professor Dr.

Waseem Ahmed and Professor and Chairperson Dr. Bushra Mirza for their co-

operation during my research work.

My research work for this dissertation was made more efficient because of Dr.

Christopher D. Bayliss and Dr. Julie Morrissey, Department of Genetics, University

of Leicester, UK. Thus I gladly express my gratitude to Dr. Christopher D. Bayliss

and Dr. Julie Morrissey for their guidance and provision of laboratory and sequencing

facility while I was in University of Leicester, UK. I am also thankful to my lab

fellows Dr. Miranda Johnson, Dr. Juanna Purvees. Dr. Randeep Sandhu, Dr. Alex

Woodcare and Mr. Isfahan Touseef for their kind support and cooperation during my

stay in University of Leicester, UK. I am also thankful to Deleo FR, for providing me

the picture showing the position of genes associated with methicillin.

I am also thankful to my Lab fellows Dr. Waseem Shehzad Abasi, Dr. Elahi Bukhsh,

Dr. Lubna Khatoon, Dr. Imran Qadir, Ammad Farooqi, Zahid Majeed and all others

who bestowed me with their sincere and valuable suggestions.

vi

I owe to my warmest gratitude to all of my family members. I am immensely thankful

to my elder sister, brothers, Nazar Hussain, Khan Badshah and their wives for their

all around unconditional support throughout my life.

I have no words to express my feelings of gratitude to my wife, Uzma Noureen for all

of her sacrifices and untiring support. She has helped me to undertake this work and

continuously supported me in high and lows. I cannot forget to mention my son

Muhammad Ahmad Shahweiz, Muhammad Abdullah Arfat and my cute and loving

daughter Aleena Fatima for their love and freshening smiles that kept me alive. I am

also thankful to my in laws for their prayers and continued support.

I extend my sincere gratitude to my friends and colleagues Prof. Ghulab Khan, Prof.

Mehboob Hussain, Prof. Abdul Ghazafar, Prof. Najm-ul-Hassan, Dr. Ghazanfar Ali,

Dr. Salman Chishti and Dr. Peter John.

I appreciate Farooq Ahmed, Noor Habib, Amjad Ali and Tariq Mahmood at

Biochemistry Department, QAU for their support and cooperation.

I am indebted to Higher Education Commission (HEC), Government of Pakistan for

awarding me scholarship under the indigenous Ph.D. fellowship program and also

financing my foreign research training International Research Support Initiative

Program.

Finally, I extend my deepest gratitude to my respected Late Father for his inspiration

and struggle for us and my loving mother who has always prayed for my success.

Yasrab Arfat

vii

Abbreviations aroC Carbamate Kiase

aroE Shikimate Kinase

BHI Agar Brain Heart Infusion Agar

BHI Broth Brain Heart infusion Broth

Bla Beta-lactamase

Bp Base Pairs

BURST Based Upon Related Sequence Type

CA-MRSA Community Acquired Methicillin Resistant Staphylococcus aureus

CC Clonal Complex

Chp Conserved Hypothetical Region

CTAB Cetyl Trimethyl Ammonium Bromide

EDTA Ehylene Diamine Tetra Acetate

EtBr Ethidium Bromide

IgG Immunoglobulin G

GC Guanine Cytosine

glpF Glycerol Kinase

g Gram

agr Accessory Gene Regulator

gmk Guanylate Kinase

gapR Glycolytic Operon Regulator

geh Glycerol Ester Hydrolase

HA-MRSA Hospital Acquird Methicillin Resistant Staphylococcus aureus

IAA Isoamylalcohol

Ica N-glycosyl transferase

IPA Isopropanol

ml Milliliter

MLEE Multilocus Enzyme Electrophoresis

MLVA Multilocus variable number of tandem repeats analysis

MRSA Methicillin Resistant Staphylococcus aures

viii

Abbreviations MLST Multilocus Sequence Typing

MT MLVA Type

PCR Polymerase Chain Reaction

pta Phosphate Acetyl Transferase

RAPD Randomly Amplified Polymorphic DNA

REA Restriction Enzyme Analysis

RM Restriction Modification

SAR Staphyloccal Accessory Regulator

SDS Sodium Dodecyl Sulphate

S.aureus Staphylococcus aureus

S.epidermidis Staphylococcus epidermidis

SPA Staphylococcus aureus Protein A

ST Sequence Type

STAR Staphylococcus aureus repeats

UPGMA Unweighted Pair Group Method with arithmetic Mean

uvrA Exonuclease ABC subunit A

VNTR Variable Number of Tandem Repeats

TAE Tris Acetic Acid EDTA

TBE Tris Borate EDTA

TE Tris EDTA

Tpi Triose Phosphate Isomerase

TSST Toxic Shock Syndrome Toxin

ET Exofolian Toxin

VNTR Variable number of tandem repeats

Yqil Acetyl Coenzyme A Acetyl Transferase

ix

LIST OF FIGURES

Figure No. Title Page No.

1 Gram stain of Staphylococcus aureus in pustular exudates. 3

2 Sites of Infection and Diseases caused by S. aureus in Humans.

5

3 Virulence determinant of Staphylococcus aureus and their target cell in host.

9

4 Chromosome of MRSA showing position of genes associated with methicillin.

14

5 Primer binding positions and predicted product sizes. 26

6 Indicating spa gene repeats sequence and repeat IDs of spa type t253

28

7 Norgen Full Ranger 100bp DNA Ladder and Ø×174 RF DNA Hae III Ladder is shown.

48

8 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of 16S-rRNA Gene for identification of Staphylococcus aureus.

51

9 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus.

53


53


54


54


56

x

LIST OF FIGURES


14 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus.

57


59

16 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus..

60

17 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus..

60


62

19 Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing the PVL PCR Results with Pakistani MRSA isolates.

63

20 Showing MLVA results of ClfB, sdrD, spa sspa with thirty Pakistani MRSA strain.

65

21 Showing MLVA results of ClfA, sdrC, sav1078 with Pakistani MRSA strain.

67

22 Showing MLVA results of ClfB, sdrD, spa and sspa with a representative Pakistani MRSA strain P.843.

69

23 Showing MLVA results of ClfB, sdrd, spa and sspa with a representative Pakistani MRSA strain P.2285.

70

24 Showing MLVA results of ClfB, sdrD, spa and sspa with a representative Pakistani MRSA strain A. 9313.

71

25 Showing MLVA results of ClfB, sdrd, spa and sspa with a representative Pakistani MRSA strain P.1.

72

26 Minimum spanning tree of 123 Pakistani MRSA isolates derived from VNTRs for clfA, clfB, sdrD, sdrC, spa and sspa

75

xi

LIST OF FIGURES


loci using Bionumerics software.

27 Dendrogram base on clustering with respect to MLVA types of Pakistani MRSA Isolates with similarity calculated by Dice coefficient and represented by UPGMA.

79-80

28 RM tests with Pakistani Staphylococcus aureus (MRSA) isolates.

82

29 RM3 test Results with Pakistani Staphylococcus aureus (MRSA) isolates.

85


86


87

32 RM tests with Pakistani MRSA P.1286 and P.16809. 88

33 RM3 test Results with Pakistani Staphylococcus aureus MRSA isolates.

89

34 Showing spa X-region sequences of a representative MRSA isolate A.14256.

95

35 Showing spa X-region sequences of a representative MRSA isolate P.2113.

96


97

37 spa X-region sequences of a representative MRSA isolate A.13282.

98


99


100


101

41 Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of GapR Upstream non coding

109

xii

LIST OF FIGURES


Region having STAR Repeat element.

42 Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of GapR Upstream non coding Region having STAR REPEAT element.

111

43 Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of uvrA-hprK intergenic Region having STAR REPEAT element in the Representative Pakistani MRSA isolates.

118

44 Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of uvrA-hprK intergenic Region having STAR REPEAT element in the Representative Pakistani MRSA isolates.

119

45 A representative Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of ica-geh intergenic region of five strains having STAR element.

120

46 A representative Electropherogram of an ethidium bromide stained 1.5% agarose gel showing size of ica-geh intergenic region of sixteen representative strains having STAR element.

122

47 Median Joining Tree drawn by using Network 4.5 for the STAR present in the intergenic region of three loci Chp-gapR, Uvr-hprk and Ica-geh.

123

48 Showing Sequence data of arcC gene locus of S. aureus strain P.2113 in fasta format.

182

49 Showing Sequence data of aroE gene locus of S. aureus strain P.2113 in fasta format.

182

50 Showing Sequence data of glp gene locus of S. aureus strain P.2113 in fasta format.

183

51 Showing Sequence data of gmk gene locus of S. aureus strain P.2113 in fasta format.

183

52 Showing Sequence data of pta gene locus of S. aureus strain P.2113 in fasta format.

184

53 Showing Sequence data of tpi gene locus of S. aureus strain 184

xiii

LIST OF FIGURES


P.2113 in fasta format.

54 Showing Sequence data of yqil gene locus of S. aureus strain P.2113 in fasta format.

185

55 Showing Sequence data of arcC gene locus of S. aureus strain A.13282 in fasta format.

186

56 Showing Sequence data of aroE gene locus of S. aureus strain A.13282 in fasta format.

186

57 Showing Sequence data of glp gene locus of S. aureus strain A.13282 in fasta format.

187

58 Showing Sequence data of gmk gene locus of S. aureus strain A.13282 in fasta format.

187

59 Showing Sequence data of pta gene locus of S. aureus strain A.13282 in fasta format.

188

60 Showing Sequence data of pta gene locus of S. aureus strain A.13282 in fasta format.

188

61 Showing Sequence data of yqil gene locus of S. aureus strain A.13282 in fasta format.

189

62 Showing Sequence data of arcC gene locus of S. aureus strain P.1286 in fasta format.

190

63 Showing Sequence data of aroE gene locus of S. aureus strain P.1286 in fasta format.

190

64 Showing Sequence data of glp gene locus of S. aureus strain P.1286 in fasta format.

191

65 Showing Sequence data of gmk gene locus of S. aureus strain P.1286 in fasta format.

191

66 Showing Sequence data of pta gene locus of S. aureus strain P.1286 in fasta format.

192

67 Showing Sequence data of tpi gene locus of S. aureus strain P.1286 in fasta format.

192

68 Showing Sequence data of yqil gene locus of S. aureus strain P.1286 in fasta format.

193

xiv

LIST OF TABLES

Table No. Title Page No.

1 Oligonucleotide Primers used in RM typing 38

2 RM typing Product sizes for different Clonal Complexes 38

3 Oligonucleotide Primers used in Typing of Staphylococcus aureus for STAR Element.

41

4 Oligonucleotide Primers used in MLVA Typing of Staphylococcus aureus

43

5 Oligonucleotide primers used in MLST typing. 45

6 Showing the Spa sequence repeat profile obtained from Ridom spa server after sequencing of selected 26 MRSA isolates from Pakistan.

92

7 Multi locus Sequence Typing profiles and Clonal Complexes of MRSA isolates from Pakistan.

103

8 Abundance of individual STAR element repeat motifs and STAR element loci in different Staphylococcal genomes

105

9 Amplicon sizes and abundance of STAR motifs present in intergenic region of CHP-gapR, uv-hprk and ica-geh of ten sequenced S. aureus strains.

107

10 STAR element repeats of the representative sequenced Pakistani MRSA Isolates.

108

11 Amplicon sizes of CHP-gapR, Uvr-hprk and Ica-geh intergenic region containing STAR element of MRSA isolates from Pakistan.

112

12 Amplicon sizes of Chp-gapR, Uvr-hprk and Ica-geh intergenic region containing STAR element of MRSA isolates form Pakistan.’

115

13 Pakistani MRSA Isolates obtained from Hospitals of Rawalpindi/Islamabad.

162

14 Showing the amplicon sizes for the 123 Pakistani MRSA Isolates and NCTC 8325 and Mu50 (Positive control strains) obtained after Gene Scan for the clfA, clfB, sdrD,sdrC,spa sspa and sav1078 loci.

164

xv

LIST OF TABLES

Table No. Title Page No.

15 Showing the IDs of isolates, amplicon sizes, length of VNTR region present in these amplicon, total number of repeats for the 123 Pakistani MRSA isolates and NCTC 8325 and Mu50 (Positive control strains) obtained after Gene Scan for the clfA, clfB, sdrD, sdrC, spa and sspa.

168

16 Showing the Spa sequencing results with selected 26 MRSA isolates from Pakistan.

175

xvi

ABSTRACT

Methicillin resistant S. aureus (MRSA) is a versatile and dangerous human’s

pathogen and is a common cause of nosocomial and community acquired infections.

S. aureus causes several types of infections such as bacteremia, folliculitis, sepsis,

mastitis, meningitis and toxic shock syndrome and staphylococcal pneumonia. S.

aureus has developed resistance to the antibiotic ‘methicillin’ and continued spread of

methicillin-resistant S. aureus (MRSA) strains poses a significant risk to patients and

contributes to a substantial financial burden on healthcare resources. HA-MRSA

isolates usually belong to six lineages (CC1, CC5, CC8, CC22, CC30 and CC45) out

of ten dominant clonal complexes (CCs) or lineages. Various methods have been

employed to identify and characterize S. aureus strains. Phenotypic techniques have

been replaced by more robust and accurate molecular techniques. The commonly

used molecular techniques are Pulse Field Gel Electrophoresis (PFGE), Multilocus

variable number of Tandem repeat analysis (MLVA), Restriction modification tests

(RM), multilocus sequence typing (MLST) and spa typing.

Present work focuses on genotyping of clinical MRSA isolates from three tertiary

care hospital located in “Rawalpindi/Islamabad”, in order to examine the types and

phylogenetic relationship of the isolates. In order to gain the understanding of the

distribution of MRSA clones in Pakistan, where unregulated antibiotic use is

widespread and distributions of MRSA is supposed to be high, an epidemiological

relationships between 123 methicillin resistant Staphylococcus aureus strains,

isolated between 2006 and 2008 from three tertiary care hospitals of Rawalpinidi and

Islamabad, were examined using MLVA scheme, combined with RM typing, PVL

sceening, STAR element analysis, spa typing and MLST to investigate the

phylogenetic relationships of the Pakistani MRSA isolates. Six loci (clfA, clfB, sdrC,

sdrD, spa and sspa) were used in a multilocus variable number tandem repeat

analysis (MLVA). A total of 63 MTs/haplotypes were obtained by MLVA. Analysis

of restriction modification (RM) genes detected, an RM3 type, associated with CC8,

in most strains and an RM1 type, associated with CC30, in only two strains. On

xvii

further typing of selected strains by Spa typing and MLST, it was found that the

RM3/CC8 isolates were ST113-t064, ST113-t451 or ST239, with one of four spa

types, whilst the RM1/CC30 isolates were ST30-t021. Analysis of STAR element of

these strains for three loci showed their close resemblance; only the strains belonging

to CC30 showed no STAR motif in gapR upstream region, confirming their genetic

homology to other CC30 strains. Furthermore, the ST30 strains were also found

positive for PVL gene.

The present genotypic study showed that in Pakistan, the isolates belonging to clonal

complex eight (CC8) are dominant in clinical settings. They belong to ST239, ST113

or ST8. The other clonal complex found was CC30 with presence of PVL gene and

isolates belong to ST30. The use of MLVA in resource poor laboratories as a rapid

and robust method for grouping noscomial MRSA isolates into clusters for

identification of localized outbreaks is quite fruitful and MLVA may also provide an

understanding of the evolutionary processes as changes in the number of repeats at

different loci, may be indicative of which loci are prone to natural selection resulting

in higher levels of variation, thus VNTRs serve as evolutionary clock for

investigating an outbreaks and transmission events. In this study, we observed more

variation in clfA and clfB than in sdrC, sdrD, spa and sspa. We also found that a

change in repeat number was not necessarily gradual but may have occurred as a

result of large jumps. Some isolates with significant differences in repeat numbers at

single locus but being identical numbers in all other loci. Further evidence is provided

by the spa typing results, i.e. with a loss of four repeats resulting in a shift from t987

to t030 and a two repeat difference changed t021 to t275. These large jumps might be

due to deletions or insertions mediated by recombination or as result of deletions due

to slip-strand impairing during DNA replication.

Thus MRSA infections have become a challenge across the globe. The MRSA

isolates which were once endemic to Europe and America, Africa has now been

reported from Asia and thus suggesting that the MRSA isolates which once was

endemic to a certain geographical area are no more confined to those boundaries.

More over the pandemic spread of one type of MRSA clone across the globe is the

result of antibiotic resistance. Therefore a joint global effort will be effective for the

xviii

control of MRSA infection. Although this study was carried out on limited number of

isolated but it is quite useful to strengthen the MRSA data in Pakistan and to develop

the genetic profile of MRSA in Pakistan and then to link it globally. This study also

helped to under stand that, although there are only two lineages in these hospitals as

in most of other Asian countries but there is a diversity at subspecies level as some of

the isolates assumed a specific genetic profile as they evolved locally after they were

imported to this region.

The work presented in the thesis has been published in the following articles:

1- 2- Arfat Y1*, Johnson M2, Malik SA1, Morrissey J2 and Bayliss CD2 (2013).

Epidemiology of Methicillin Resistant Staphylococcus aureus (MRSA) Isolates

from Pakistan. African Journal of Microbiology Research; Vol.7 (7): 568-576.

H5 Index: 15.

2- Joanne Purvees1*, Mathew Blades2, Yasrab Arfat3, Salman A Malik1,

Christopher D Bayliss1 and Julie Morrissey1 (2012). Variation in the genomic

locations and sequence conservation of STAR elements among Staphylococcus

aureus species provides insight into DNA repeat evolution. Genomics; 13: 515.

Impact factor 4.07.

Chapter 1 Introduction

1

INTRODUCTION

Staphylococcus aureus

Staphylococci (staph) are Gram-positive spherical bacteria (1 micrometer in diameter)

that occur in microscopic clusters resembling grapes. The term Staphylococci was first

introduced by Ogston in 1881. Later in 1884, Rosenbach described two types of

Staphylococci, Staphylococcus aureus (Yellow Colony) and Staphylococcus albus

(White Colony) which is now named as Staphylococcus epidermidis. Although there are

more than twenty species have been identified but only Staphylococcus aureus and

Staphylococcus epidermidis are important in interaction with humans (Bergey’s Manual,

2001). Staphylococcus aureus colonizes mainly the nasal passages, but it may also

colonelize the skin, oral cavity and gastrointestinal tract while Staphylococcus

epidermidis is only the inhabitant of the skin (Dancer & Noble, 1991; Bannerman, 2003;

Garrity et al., 2004; Graham et al, 2006).

The cell wall of S. aureus is composed of numerous peptidoglycan layers which are

interspersed with teichoic acid and lipoteichoic acid (Giesbrecht et al., 1998). Inside the

cell wall is gelatinous periplasm prior to plasma membrane. Some strains also have a

shiny exopolysaccharide layer (Wilkinson, 1983). The genome size of different S. aureus

strains ranges from 2.820MB to 2.903MB (Baba et al., 2001; Holden et al., 2004; Gill et

al., 2005). The genome of S. aureus is co-linear and 95% of the genome consists of

coding sequences. Sequences of S. aureus can be classified into two types, the stable

sequences that are meant for long term selection and evolution, variable sequences that

are meant for acquisition virulence and resistance. The GC contents of S. aureus genome

range from 30 to 33% (Kuroda et al., 2001). Antibiotic resistance genes are present on

plasmids and other satellite structures. Virulence factors are encoded by the

staphylococcal cassette chromosome, Pathogenicity Island, plasmids and phages (Holden

et al., 2006; Baba et al., 2008). Apart from virulence factors antibiotic resistance is also

conferred by transposons (Foster, 1983; Lyon and Skurray, 1987).


2

Taxonomy of Staphylococcus aureus

The genus Staphylococcus is in the bacterial family Staphylococcaceae, which also

contains three lesser known genera, Gamella, Macrococcus and Salinicoccus. Taxonomic

classification of Staphylococcus aureus is as under as described by Kwok & Chow

(Kwok & Chow, 2003) and Garrity (Garrity et al., 2004).

Domain Bacteria

Kingdom Eubacteria

Phylum Firmicutes

Class Cocci

Order Bacillales

Family Staphylococcaceae

Genus Staphylococcus

Species aureus

The genus Staphylococcus consist of 32 species and seventeen out of the 32 are

frequently detected in clinical samples taken from human (Ryan et al., 2004).

Staphylococcus aureus forms a fairly large yellow colony on rich medium and is often

hemolytic on blood agar, however in case of toxic shock syndrome it act as non

hemolytic (Barbour, 1981; Chow et al., 1982). Staphylococci grow by aerobic respiration

or by fermentation that yields principally lactic acid, thus they are facultative anaerobes.

These bacteria are catalase-positive and oxidase-negative (Koneman et al., 1997).

Staphylococcus aureus can grow at a temperature range of 15 oC to 45 oC and tolerate as

high NaCl concentrations as 15 percent. The coagulase enzyme is produced by almost all

S. aureus strains but in the recent years coagulase negative S. aureus are also frequently

reported (Henderson and Brodie, 1963; Yoshida, 1970; Kloos & Jorgensen, 1985;

Landolo, 1990).

Diseases caused by Staphylococcus aureus

Staphylococcus aureus causes a variety of pus-forming infections and produces toxins in


3

Figure 1. Gram stain of Staphylococcus aureus in pustular exudates. (Text book of

Microbiology, Tudor, 2008)


4

humans [Fig.2] (Archer, 1998; Lowy, 1998). It also causes a variety of superficial skin

lesions (boils, styes, furuncules); serious infections (pneumonia, mastitis, phlebitis,

meningitis, urinary tract infections); and deep-seated infections (osteomyelitis and

endocarditis) (Klein et al., 2007). The major cause of hospital acquired infections of

surgical wounds and infections associated with indwelling medical devices is

Staphylococcus aureus. It also releases enterotoxins into food, thus causing food

poisoning and toxic shock syndrome by releasing super antigens into blood (Todd, 1978;

Shands et al., 1980; Dinges et al., 2000). In human, staphylococcal infections are

frequent, but mostly they remain localized at the portal of entry like hair follicle or

minute break in the skin or a surgical wound, due to normal host defense system. Some

times respiratory tract also serves as portal of entry which may lead to Staphylococcal

pneumonia. Inflammation, an elevated temperature at the site of infection, swelling,

accumulation of pus, and necrosis of tissue are host’s response to staphylococcal

infection. A fibrin clot may also form around the inflamed area, walling off the bacteria

and leukocytes, as a result a characteristic pus-filled boil, abscess or even serious skin

infections may occur, such as furuncles or impetigo and some time bone infection

osteomyelitis. Some times Staphylococcus aureus also invade the blood stream resulting

septicemia. Bacteremia may result serious consequences causing internal abscesses, other

skin lesions, or infections in the lung, kidney, heart, skeletal muscle or meningitis (del

Poso & Patel, 2007; Ashby et al., 2009).

Staphylococcus aureus Pathogenicity

Staphylococcus aureus pathogenicity is caused by many potential virulence factors.

Although the determination of role of a particular virulence factor in a disease is difficult

to identify but a correlation has been found between a particular disease and presence of a

specific virulence determinants, suggesting its role in that particular disease (Foster &

Hook, 1998). The Potential virulence factors can be classified as under:

Surface proteins

These proteins promote Staphylococcus aureus attachment to host proteins laminin,

fibronectin and form the extracellular matrix of epithelial and endothelial surfaces.


5

Figure 2. Sites of Infection and Diseases caused by S. aureus in Humans. (Text book of

Microbiology, Tudor, 2008)


6

Most strains also express a fibrin/fibrinogen binding protein (clumping factor) which

promotes attachment to blood clots and traumatized tissue. Majority of the

Staphylococcus aureus strains express both fibronectin and fibrinogen-binding proteins.

In strains that cause osteomyelitis and septic arthritis, an adhesin is present that promotes

attachment to collagen. Interaction with collagen is important in promoting bacterial

attachment to damaged tissue where the underlying layers have been exposed (Patti et al,

1994; Foster & Hook, 1998; Tung et al., 2000; Menzies, 2003).

Invasins

These extra cellular proteins promote bacterial spread in host tissues. Leukocidin, kinases

and hyaluronidase are the examples of invasions (Foster, 2005; Wang et al., 2007).

Staphylococcus aureus strains also express a plasminogen activator called staphylokinase

which lyses fibrin. Staphylokinase and plasminogen form a complex which activates

plasmin which causes dissolution of fibrin clots. Although there is no strong evidence

that staphylokinase is a virulence factor, but it seems reasonable to imagine that localized

fibrinolysis might aid in bacterial spreading (Chen et al., 2002).

Surface factors

Surface factors include capsule and protein A, which inhibit phagocytic engulfment by

the host immune cells. Most of the clinical isolates of S aureus express a surface

polysaccharide of either serotype 5 or 8 which is known as a microcapsule because it can

be visualized only by electron microscopy unlike the true capsules of some bacteria

which are readily visualized by light microscopy. Staphylococcus aureus strains isolated

from infections express high levels of the polysaccharide but loses when cultured in the

laboratory. The function of the capsule in virulence is not entirely clear but it hinders

phagocytosis in the absence of complement. Protein A is a surface protein of

Staphylococcus aureus which binds IgG molecules by their Fc region. In serum, the

bacteria will bind IgG molecules in the wrong orientation on their surface, which disrupts

opsonization and phagocytosis (Projan and Novick, 1997).


7

Immunological Disguises

These include Protein A, coagulase and clotting factor. Coagulase which is an

extracellular protein binds to prothrombin in the host to form a complex called

staphylothrombin. The protease activity of thrombin is activated in the complex, resulting

in the conversion of fibrinogen to fibrin. Coagulase test is used for identifying of S.

aureus in the clinical microbiology laboratory. But it is not clear that whether that it is a

virulence factor or not, but it is reasonable to speculate that the bacteria could protect

themselves from phagocytic and immune defenses by causing localized clotting

(Friedrich et al., 2006; Janwithayanuchit et al., 2006). Clumping factor is the fibrinogen-

binding determinant on the S. aureus cell surface. Genetic studies have shown that

coagulase and clumping factor are different entities. It has been observed that specific

mutants lacking coagulase retain clumping factor activity, while clumping factor mutants

express coagulase normally (Moreillon et al., 1995).

Membrane-Damaging Toxins

These are the proteins that lyse eukaryotic cell membranes include hemolysins,

leukotoxin, leukocidin (Patti et al., 1994). Alpha toxin is the best characterized and most

potent membrane-damaging toxin of Staphylococcus aureus. Alpha toxin is expressed as

a monomer and binds to the membrane of susceptible cells and then oligomerize to form

heptameric rings with a central pore through which cellular contents leak. Monocytes and

platelets are more vulnerable to α toxin (Bhakdi and Tranum-Jensen, 1991). ß-toxin

which damages membranes rich in lipid such as sphingomyelinase but the majority of

human isolates of Staphylococcus aureus do not express ß-toxin. Delta toxin produced by

most strains of S. aureus is a very small peptide toxin and it possesses detergent like

activity resulting in disruption of host membrane (Bladon et al., 1992). Leukocidin which

is a multicomponent protein toxin forms a hetero-oligomeric transmembrane pore

composed of four LukF and four LukS subunits, thus forming an octameric pore in the

affected membrane. Although only 2% of all of Staphylococcus aureus isolates express

leukocidin, but nearly 90% of the strains isolated from severe dermonecrotic lesions

express this toxin, which indicates that it is an important factor in necrotizing skin

infections (Gladstone and Van Heyningan, 1957, Foster, 1995).


8

Exotoxins

These proteins damage host tissues or otherwise provoke symptoms of disease (SE A-K,

TSST, and ET). There are eleven superantigen (SE A-K) are known to date for

Staphylococcal enterotoxins. New SE and SE like toxin which are heat stable are

reported. These are mostly produced in foods which are rich in proteins and

carbohydrates causing Staphylococcal food poisonings (Su and Wong, 1995; Jorrand et

al., 2001; Orwin et al., 2001). Toxic shock syndrome toxins (TSST) are released

systematically and cause toxic shock syndrome (TSS). Menstrual toxic shock syndrome

(75% cases) is caused by (TSST-1) (Murray et al., 1996). Exofoliation toxins are the

cause of scalded skin syndrome in new born babies and they are present in 5-10% of

clinical S. aureus isolates.

Antibiotic Resistance in Staphylococcus aureus

Hospital strains of S. aureus are usually resistant to a variety of different antibiotics. A

few strains are resistant to all clinically useful antibiotics except vancomycin (Chamber

and Deleo, 2009). Methicillin resistance is widespread and most methicillin-resistant

strains are also multiple drug-resistant. In addition, S. aureus exhibits resistance to

antiseptics and disinfectants, such as quaternary ammonium compounds, which may aid

its survival in the hospital environment. In the case of HA-MRSA, patients who already

have an MRSA infection or who carry the bacteria on their bodies but do not have

symptoms (are colonized) are the most common sources of transmission. MRSA

infections that occur in otherwise healthy people who have not been recently (within the

past year) hospitalized or had a medical procedure (such as dialysis, surgery, catheters)

are categorized as community-associated (CA-MRSA) infections. These infections are

usually skin infections, such as abscesses, boils, and other pus-filled lesions. About 75

percent of CA-MRSA infections are localized to skin and soft tissue and usually can be

treated effectively. However, CA-MRSA strains display enhanced virulence, spread more

rapidly and cause more severe illness than traditional HA-MRSA infections, and can

affect vital organs leading to widespread infection (sepsis), toxic shock syndrome and

pneumonia. It is not known why some healthy people develop CA-MRSA skin infections


9

Figure 3. Virulence determinant of Staphylococcus aureus and their target cell in host.

(Text book of Microbiology, Tudor, 2008)


10

that are treatable whereas others infected with the same strain develop severe, fatal

infections. Drug resistance has developed in the staphylococci within a very short time

after introduction of antibiotic penicillin in the 1940's. Penicillinase-producing

Staphylococcus aureus was first described by Kirby in 1944. Penicillin became widely

available after the end of World War II, and the prevalence of Penicillin-resistant

Staphylococcus aureus began to rise, such that by 1948, most hospital isolates were

resistant to penicillin (Barber and Dowzenko, 1948). In contrast to hospital situation in

the 1950s community strains of Staphylococcus aureus were largely susceptible to

penicillin, and penicillin remained the drug of first choice for the strains until the early

1970s (Weinstein, 1975)

Methicillin and related compounds were developed in response to the emergence of

penicillin resistance Staphylococcus aureus. Methicillin resistance in Staphylococcus

aureus was reported almost immediately after its use. Methicillin resistance in

Staphylococcus aureus was first reported in 1961 from the UK, by Jevons. MRSA was

also reported in Poland by Borowski et al ( Borowski et al., 1964), and MRSA for the

first time reported in the United States in 1968 by Barrett (Barrett et al., 1968) and in

Turkey in 1962 by Cetin & Ang (Cetin & Ang, 1962) and in India by Pal and Ghosh in

1964 (Pal and Ghosh in 1964), while the data with respect to Pakistan that when the first

case of MRSA was found, is not available but in one study by Hafiz et al has found that

the frequency of Methicillin resistant Staphylococcus aureus (MRSA) in different

hospitals was varying between 2-61% (Hafiz et al., 2002) and in another study Butt et al

has found that the frequency of MRSA among nosocomial isolates of S. aureus increased

from 39% in 1996 to 51% in 2003 (Butt et al., 2004).

Mechanism of Antimicrobial resistance in Staphylococcus

aureus

Staphylococcus aureus can be resistant to beta lactams via several mechanisms, a few of

them are described here.


11

Production of beta lactamase (Penicillinase)

The production of Beta lactamase results in resistance to penicillin (Penicillin

Resistance). Beta lactams are known to bind to cell wall proteins called penicillin binding

proteins (PBPs) which polymerize the catalization and cross linking of peptidoglycan in

the bacterial cell wall (Berger-Bachi, 1997). Beta lactams are substrate analogue that

covalently bound to PBP active site serine, inactivating the enzyme (Chambers, 1997a).

Penicillin resistance in Staphylococcus aureus is mediated by the production of beta

lactamase (Richmond, 1965). A system of genes concerned with beta-lactamase

production in S. aureus has been identified. Regulatory genes include blal which code for

a repressor protein (Richmond, 1967) and blaR2 which code for a protein which act as

intracellular inducer (Cohen and Sweeney, 1968). blaZ code for beta lactamases itself.

BlaZ, blal and blaRl are found on large plasmids, but blaR2 is always chromosomal.

Beta-lactams bind to the C terminus of blaRl, resulting in signal being passed to blal,

causing it not to bind to the operator region and as a result transcription of blaZ and

blaR1 and blal increases, resulting in an increased synthesis of beta lactamase and

regulatory proteins (Dyke and Gregory, 1997).

Production of an altered penicillin binding protein (PBP 2’ or PBP2a)

The production of an altered penicillin binding protein results in resistance to all beta

lactams including methicillin in Staphylococcus aureus (Ubukata et al., 1989; Hackbarth

and chambers, 1993). The regulatory genes bla Rl and bla1 affect synthesis of PBP2a.

The altered Penicillin binding protein mecA gene coding for PBP2a, could be derived

from a fusion product of upstream region of blaZ with a normal penicillin binding protein

gene (Song et al., 1987).

Hyperproduction of beta-lactamase or methicillinase

The mechanism of resistance in border line Staphylococcus aureus is either by the

production of beta lactamase (methicillinase) with a higher affinity for methicillin

(Massida et al., 1992) or by hyper production of beta lactamase (Mc Dougal and

Thornsberry, 1986). In the case of border line Staphylococcus aureus, production of this

enzyme is inducible and the enzyme has molecular weight slightly lower than the plasmid


12

encoded penicillinase (Barg et al., 1991; Varaldo, 1993b; Massida et al., 1994). Detection

of mecA with PCR distinguishes MRSA strain from border line Staphylococcus aureus

(Bignandri et al., 1996) as does the disc diffusion if 5ug methicillin disc on agar with

0.5% NaCl and inoculated with 5x 105 organisms and incubated at 30 oC (Petersson et al.,

1999).

Production of modified penicillin binding protein other than PBP2a

S. aureus has raised resistance to methicillin by point mutations in the penicillin binding

domains of PBPs 1, 2 and 4, which results in reduction in affinity for beta-lactams

(Berger Bachi et al., 1986). These altered penicillin binding PBPs binds penicillin more

slowly and release penicillin more rapidly (Chambers et al., 1994). These binding

alterations are due to point mutations (Hachbarth et al., 1995). These strains are referred

as modified S. aureus (Berger-Bachi, 1997).

The unknown mechanism exhibited by small colony variants

Small colony variants appear as minute, colorless and slow growing colonies on agar

plates and often mistaken as coagulase negative Staphylococci (Proctor et al., 1995). It

has been observed that their production is inducible by exposure to antibiotics such as

beta lactams, gentamycin, quiniolones and cotrimoxazole (Anear and Grubb, 1973;

Pelleiter et al., 1979; Mitsuyama et al., 1997; Proctor and Peter, 1998). Most of the small

colony variants have defective electron transport chain and can not take cationic

antibiotics and show more resistance to methicillin. Their frequent isolation from patient

with persistent relapsing infection indicates that invitro resistance is clinically significant

(Proctor et al., 1994).

Methicillin Resistant Staphylococcus aureus

Methicillin Resistant Staphylococcus aureus are resistant to the action of methicillin and

related beta-lactam antibiotics (e.g. penicillin, oxacillin, amoxacillin). MRSA have

evolved resistance not only to beta-lactam antibiotics, but to several classes of antibiotics.

Although methicillin-resistant Staphylococcus aureus (MRSA) is causing infections in

hospital settings for several decades, MRSA strains have recently emerged outside the

hospital and known as community associated-MRSA (CA-MRSA) or superbug strains of


13

the organism, which now account for the majority of staphylococcal infections HA-

MRSA occurs most frequently among patients who undergo invasive medical procedures

or who have weakened immune systems and are being treated in hospitals and healthcare

facilities such as nursing homes and dialysis centers.

MRSA strains possess a 30-50kb segment of chromosomal DNA not found in MSSA

strains (Ito and Hiramatsu, 1998, Ito and Hiramatsu et al., 1999; Ito et al., 1999;

Katayama et al., 2000). The segment of DNA has various synonyms: mec determinant,

mec, staphylococcal cassette chromosome mec (SCCmec), and mec associated DNA.

SCCmec, is always located near to pur-nov-his gene cluster on Staphylococcus aureus

chromosome (Kuhl et al., 1978), and between spa (encoding protein A) and purA

(encoding for adenine requirement) (Berger-Bachi, 1997). SCC mec contains mecA, and

usually the regulatory genes mecl and mecRl. Only the presence of mecA is required for

methicillin resistance as demonstrated by cloning experiments in which cloned mecA was

introduced into a methicillin susceptible strain of S. aureus, resulting in expression of

PBP2a in the recipient strains and being resistant to methicillin (Tech et al., 1988; Inglis

et al., 1988).

MRSA strains are resistant to all beta lactam antibiotics (Penicillins, cephalosporin,

monobactams and carbapenems) due to the presence of altered PBP in cell wall known as

PBP2a which is the product of the mecA gene (Ubukata et al., 1989a). PBP2a is a 76KDa

protein with the characteristics of a membrane bound PBP, having a putative

transglycosylaze domain and the characteristic conserved motifs of a transpeptidase. It

probably acts as trans-peptidase taking over the function of other PBPs when they are

inhibited by beta lactams (Reynolds and Brown, 1985; Wu et al., 1994). PBP 2a can

substitute for the essential fuctions of the high affinity PBPs 1, 2 and in concentration of

beta-lactams that would otherwise be lethal (Chambers, 1997a)

SCCmec contains up to 100 open reading frames (Beck et al., 1986; Hiramatsu et al.,

1966; Mathew et al., 1987). MecA is always present, but mecl, and mecRl, which are

mecA regulatory genes, may or may not be present. Mecl and mecRl are located

upstream of mecA [Fig.4] and are separated from mecA by its promoter and operator

(Hiramatsu et al., 1992a; Tech et al., 1990).


14

Figure 4 Chromosome of MRSA showing position of genes associated with methicillin.

(Natalia Malanchowa & Deleo FR, 2010).


15

Transposons and insertion sequences are present, such as Tn554 located 5’ of mecA, 1-4

copies of IS431, at least one of which IS431 is located 3’ of mecA (Archer and

Niemeyer, 1994; Hiramatsu et al., 1996). Deletion rearrangement and recombination

commonly occur between mecA and IS431. IS431 is a common staphylococcal

chromosomal and plasmid insertion sequence, and it is associated with various resistance

determinants and probably explains the propensity for MRSA strains to become

multidrug resistant (Chambers, 1997).

MecA is highly conserved amongst S. aureus and co-agulase negative staphylococci (

Bech et al., 1986; Chambers, 1987; Ubukata et al., 1990; Wu et al., 1992; Arsher et al.,

1994). The following genes involved in beta-lactamase production and methicillin

resistance respectively and have sequence similarities; BlaZ and the first 300 nucleotides

of mecA, blaRl and mecRl and blal and mecl (Matsuhashi et al., 1980; Song et al., 1987).

Mecl and mecRl, regulatory genes located upstream of mecA promoter (Tech et al.,

1990; Hiramatsu et al., 1992) and possess similar molecular organization, function and

regulation to the beta lactamase regulatory genes blal and blaRl respectively (Berger-

Bachi, 1997).

It was found that strains possessing functional mecl and mecRl genes exhibit strong

suppression of mecA transcription, and require induction by methicillin to express mecA,

produce PBP2a and exhibit methicillin resistance (Ryffel et al., 1992). MRSA strains can

possess mecI and mecRI sequences yet express PBP 2a constitutively and in high

amounts. These strains usually have point mutations or deletions inactivating mecl

(Suzuki et al., 1993). Strains isolated since 1980 generally do not have deletion of

regulatory genes but do exhibit mecl polymorphism and mecA promoter mutations

(Hiramatsu et al., 1996). Intact regulatory genes strongly suppress expression of mecA.

Such strains can appear methicillin-susceptible on the bench. Insertional inactivation of

mecl and mecRl results in homogenous methicillin resistance (Ryffel et al., 1992;

Kuwahara-Arai et al., 1996; Niemeyer et al., 1996).

Genes other than mecl and mecRl affect transcription of mecA. The same mecl and

mecRl elements appear to be associated with different methicillin resistance phenotypes

in different strains of MRSA (Niemeyer et al., 1996). There is also no clear relationship


16

between the amount of PBP2a produced and whether resistance is constitutive or

inducible or homogeneous or heterogeneous. It seems likely that the mecl polymorphism

and mecA promoter mutation reflect the selective pressure of betalactams for mutants

lacking strong repressor activity, so that the amount of PBP2a produced will confer a

survival advantage. Both SCCmec and beta lactamases regulator genes control PBP 2a

production in these strains (Hackbarth and Chambers, 1993).

Factors affecting Methicillin Resistance

There are many factors that appear to affect the methicillin resistance phenotype. These

factors include the beta lactamase gene, the plasmids encoding staphylococcal beta

lactamase, fem factors, llm, agr, and other chromosomal loci.

Effect of Beta lactamases genes on methicillin resistance

Blal and blaR1, having great structural and functional similarities to mec1 and mecR1

respectively, can also regulate the expression of PBP2a (Hackbarth and Chambers, 1993;

Ubukata et al., 1989), i.e. the production of PBP 2a will be inducible. Repression by bla1

is weaker than mec1, some PBP2a is produced by the uninduced strain, and induction by

methicillin is as rapid as beta lactamase induction (Ryffel et al., 1992). It has been

postulated that as blaR2 interferes with the bla regulation, it may also interfere with the

regulation of mecA (Cohen and Sweny, 1968). If the strain lacks bla1 and blaR1, then

PBP 2a production is constitutive. The interaction between mec1, mecR1, bla1 and blaR1

are complex and it effects the expression of methicillin resistance (Berger-Bachi, 1997).

Effect of Plasmids encoding Staphylococci beta-lactamase on methicillin

Resistance

There are several ways in which the presence of the plasmid encoding staphylococcal

betalactamases may effect the expression of methicillin resistance. This plasmid may

prevent spontaneous deletion of SCCmec, thereby increasing its stability and preventing

reversion to susceptibility (Hiramatsu et al., 1990). Introduction of a beta–lactamase

plasmid into homogeneously resistant recipient can result in heterogenous resistance

(Boyce et al 1990). Mutations altering the inducibility of beta-lactamases are associated

with reduced methicillin resistance (Cohen et al., 1972). Inactivation of blaR1 reduces


17

the expression of methicillin resistance (Hackbarth et al., 1994), presumably by the

unopposed action of bla1 on mecA. Strain with functional SCCmec regulatory genes

produce little PBP2a and are poorly inducible with many beta-lactams (Kuwahara-Arai et

al., 1996).

Effects of fem and aux factors on methicillin resistance

Fem (factors essential for methicillin resistance) and aux factors are chromosomal genes

and are essential for the full expression of methicillin resistance. Fem and aux genes are

also present in MSSA strains and represent house keeping genes. Although they are

required for the full expression of methicillin resistance but they are not the part of the

complex of genes conferring methicillin resistance (Berger-Bachi, 1983; Berger-Bachi,

1997; Murakami and Tomasz, 1989).

Other Chromosomal loci affecting the expression of methicillin

resistance

Other chromosomal loci affecting the expression of methicillin resistance include llm,

autolysis genes, agr (accessory gene regulator) and sar (staphyloccal accessory regulator).

llm inactivation results in conversion of homogenious resistance to heterogenous and an

increase in autolysis (Maki et al., 1994). Increased autolysis is seen in strains

demonstrating heterogeneous methicillin resistance (Qoronflesh and Wilkinson, 1986;

Chambers and Hackbarth, 1987; Gustafson and Wilkison, 1989). The agr and sar loci

control the expression of exoprotein including virulence factors. Inactivation of either

locus in heterogenous strains resulted in a minor decrease in the number of highly

resistant cells (Pirtz et al., 1996).

External factors affecting the expression of methicillin resistance

Temperature, osmolality, light, divalent cations concentration, presence of chelating

agents and an aerobiosis all affect all affect the expression of methicillin resistance

(Matthew and Stewart, 1984; Madiraju et al., 1987). Lowering the temperature and

increasing the concentration of sodium chloride enhance the expression of methicillin


18

resistance and are recommended in routine testing (National Committee for Clinical

Standards, 1999).

Heterogeneous and homogenous resistance to methicillin

It is significant as strains of S. aureus with heterogenous resistance may be falsely

classified as methicillin susceptible in routine laboratory tests (National Committee for

clinical laboratory Standards, 2000). Heterogeneous strains typically have >99.9% of the

cells susceptible to low concentration of methicillin (the basal resistance level) with a

small minority resistant to concentration >50mg/L, as determined by population analysis

profile (Chambers, 1997). Growth in hypertonic NaCl or incubation at 30°C can result in

strain appear in homogenous (>1% of cells growing at 50mg/L) (Sabat and Wallace

1974). Addition of EDTA or incubation at 37-43°C may suppress resistance entirely. The

population analysis profile is growth phase dependent. This suggests that the changes that

confer the high level resistance are cell cycle dependent (Seligman, 1969).

MSSA strains have slow inducibility of transcription of mecA if mecR1/mec1 is intact

and fully functional (Berger-Bachi, 1997). Repression of mecA by the bla1 can convert a

highly homogenously resistant MRSA strain into heterogeneously resistant strains if

blaR1 (the beta lactamase signal transducer for staphylococcal beta lactamase) is

inactivated (Hackbarth et al., 1994). This suggests that a certain threshold for PBP2a

production is needed for the expression of methicillin resistance.

Treatment against Staphylococcal Infections

Phagocytosis is the major mechanism for combating staphylococcal infection. Antibodies

are produced which neutralize toxins and promote opsonization. However, the bacterial

capsule and protein A may interfere with phagocytosis. Biofilm growth on implants is

also impervious to phagocytes. Staphylococci may be difficult to kill after phagocytic

engulfment because they produce carotenoids and catalase which neutralize single

oxygen and superoxide, which are primary phagocytic killing mechanisms within the

phagolysosome.

Hospital acquired infection is often caused by antibiotic resistant strains (e.g. MRSA) and

can successfully treated with vancomycin or an alternative. The community associated


19

staphylococcal infections are resistant to penicillins and cephalosporins. Therefore

infections have been treated with combination therapy using sulfa drugs and minocycline

or rifampin (Bermingham et al., 2003). A relatively newer drug, Linezolid belonging to

oxazolidinons class is effective against both CA-MRSA and HA-MRSA

(Mongkolrattanothai et al., 2003). Some glycopeptides and teichoplanin and

vancomycins are also effectively used to control MRSA infections (Schentag et al.,

1998). Linezolid, quinpristin/daflopristine, daptomycin and tigecyclin are used when

therapy fails with glycopeptides such as vancomycin (Mongkolrattanothai et al., 2003).

Phage therapy is also being tested that involves infecting and destroying MRSA with

phage particles. This approach has been proven to be effective against 95% of MRSA

isolates tested (Matsuzaki et al., 2003)

Vaccines

There is no such vaccine is generally available that stimulates active immunity against

staphylococcal infections in humans however a vaccine based on fibronectin binding

protein induces protective immunity against mastitis in cattles. Vaccine therapies are

relatively new approach in combating with S. aureus bacterial infections. Monoclonal

antibodies directed towards surface components (e.g. capsular polysaccharide or surface

protein adhesions) can be used to prevent bacterial adherence and promote phagocytosis

by opsonization of bacterial cells. These monoclonal antibodies can also be given to

hospital patients to create passive immunity during surgery (Cegelski et al., 2008; Ragle

and Wardenburg, 2009).

The vaccine called StaphVAX, composed of S. aureus type 5 and 8 capsular

polysaccharides conjugated to nontoxic recombinant Pseudomonas aeruginosa exotoxin

was introduced in 2002. The vaccine was administered to 892 hemodialysis patients and

reported to be safe and immunogenic for approximately 40 weeks in patients with end-

stage renal disease. Approximately 90% of patients who received the vaccine developed

antibodies to the two capsular polysaccharides than the control group who did not receive

the vaccine. A decrease in vaccine efficiency after week 40 correlated with a decrease in

S. aureus antibodies. Although the vaccine has limited time frame in protection against S.

aureus infections but it can be useful in cases where healthy individuals come into the


20

hospital for elective surgery, such as a joint replacement, organ transplant or coronary

bypass surgery. Such patients do not require protection for the rest of their lives; what

they need is protection for a short period while they are in the hospital (Cegelski et al.,

2008, Fattom et al., 2004).

Epidemiology of MRSA

Genotyping is the process of determining the genotype of an individual by the use of

different biological assays. Genotyping helps in controlling the spread of pathogens, by

tracing the origin of outbreaks. Genotyping is also known as molecular epidemiology or

forensic microbiology. Many outbreaks of infectious diseases are usually due to exposure

to organism from a common source. It is considered that organism in the affected

individual are highly related to each other. Bacterial typing system has been developed to

confirm this hypothesis and demonstrate that isolates from epidemiologically identical

cases are identical (Tenover et al., 1992).

Bacterial typing techniques can be classified into two main groups: phenotypic methods

and molecular methods (Arbeit, 1995). Phenotypic methods involve the detection of

features expressed by the organism. They are thus limited with capacity of organism to

change the expression of underlying genes. Genotyping involve the direct study of

genomic material and consequently all bacterial strains are typeable. The major

disadvantage is the cost (Tenover et al., 1994) and difficulties with interpreting results

(Tenover et al., 1995).

Phenotypic methods of strain differentiation

Antibiogram

Antibiogram is widely used typing technique which involves the testing of isolates

against antibiotics susceptibility following the Kirby Bauer Disk Diffusion Method. The

reagents and equipment are easily available and relatively cheaper. Normally the medium

used is Muller Hinton agar containing antibiotic erythromycin, Clindamycin,

cotrimoxazole, gentamycin and ciprofloxacin disk (Blanc et al., 1994). This method is

limited by phenotypic variation and antibiotic selection pressure. The same strain may

reflect a different antibiogram due to loss or gain of antibiotic resistance plasmid or


21

transposable genetic element. Thus results are not reproducible even for the same

isolates, making the method unreliable (Costas et al., 1989; Tenover et al., 1994).

Phage Typing

Phage typing was first developed by Fisk in 1942 (Fisk, 1942) and later on this method

was described in 1961 by Blair and William (Blair and William, 1961). As phages are

host specific and there is a narrow range of viruses which can be used to produce a

typical lyses pattern for a specific strain. There is a set of 23 phages recommended for

typing Staphylococcus. MRSA strains are not type able with these and supplementary

phages are used, consisting of international set of experimental phages for MRSA

(Blumberg et al., 1992; Richardson et al., 1999). Plaques i.e. lyses region by each phage

are recorded either as a weak or strong reaction. Strong reaction is interpreted as more

than fifty plaques and used as distinguishing character of isolates while the weaker

reaction is recorded but not counted toward final typing (Parker, 1972).

In certain outbreaks many strains were untypeable. Some strains of even diverse origin

grouped into the same cluster reflecting its low discriminatory power. (Harstein et al.,

1989; Dominguez et al., 1994; Vickery et al., 1997b). The technique is technically

demanding. (Hartstein et al., 1989; Tenover et al 1994; Arbeit, 1995) and results are

often non reproducible (Rhinehart et al., 1987).

Immunobloting

Immunobloting consist of electrophoresis of proteins on polysaccharide gel, blotting the

protein on nitrocellulose, reacting this with human serum and detecting antibody with

anti human IgG (Tsang et al., 1983). The method is held to be discriminatory (Couto et

al., 1995) but the resulting bands are very difficult to interpret (Couto et al., 1995;

Maslow et al., 1993a).

Multilocus Enzyme Electrophoresis (MLEE)

Multilocus enzyme electrophoresis (MLEE) involves the extraction of S. aureus

enzymes, separated elecrophoretically and then selectively stained and detecting various

isoenzymes by mean of their mobility (Selander et al., 1986). All isolates are typeable

because multi enzymes are used but single amino acid substitution results in 80% shift of


22

electrophoresis pattern. Variation in enzyme reflects the difference in the origin of gene

loci. Thus the proportion of loci which are different can give the measure of relatedness

between two isolates and these can be categorized into electrophoresis type (Musser and

Kapur, 1992). It is moderately discriminatory for clinical isolates and most useful for

studying sets of MRSA separated both in time and place (Mulligan and Arbeit, 1991;

Blumberg et al., 1992; Goering and Winter, 1992; Maslow et al., 1993a). MLEE pattern

are easy to read but difficult to compare (Tenover et al., 1994). This technique is highly

technically demanding and labor intensive (Maslow et al., 1993a).

Serotyping

There are eleven capsular polysaccharides found in S. aureus but 85% of clinical MRSA

isolates express only two of eight capsular polysaccharides types i.e. type 5 and type 8.

So this method is of little epidemiological value due to limited diversity of capsular

polysaccharide found among MRSA (Branger et al., 1990).

Genome Based Methods of Typing MRSA

Plasmid Analysis

Plasmid analysis was the first ever molecular typing method used to type MRSA. It

involves extraction of plasmid DNA, running the digest on an agarose gel which is

stained with ethedium bromide and photographed with UV light. The resulting banding

pattern can be analyzed (McGowan et al., 1979; Pfalleret et al., 1992). It is an easy

technique to perform and explain but the major draw back is that plasmids are easily

gained and lost thus making the analysis doubtful (Tenover, 1996; Yoshida, 1997;

Weller, 2000). Most strains of MRSA are also not type able due to absence of plasmids

(Harstein et al., 1989; Zuccarelli et al., 1990; Couto et al., 1995).

Restriction enzyme analysis of whole genomic DNA

This involves the extraction of chromosomal DNA, digesting it with restriction enzyme,

subjecting the product to electrophoresis on an agarose gel and detecting the resulting

band patterns with ethidium bromide photographed with UV light. The resulting pattern

is called restriction fragment length polymorphism (RFLPs). This technique has been


23

useful in confirming MRSA outbreaks (Veneza et al., 1992). However standard

restriction enzymes result in numerous bands and interpretation is difficult. This has led

to the development of various probing techniques that yield patterns that are easier to

interpret (Goering and Winters, 1992).

Ribotyping

Ribosomal genes are present in the MRSA genome in multiple copies at several positions

and are conserved with in a species (Bush and Nitschko, 1999; Arbeit, 1999, Weller,

2000). Ribotyping is a form of RFLP analysis in which transcriptional sequence of rRNA

is amplified and PCR product is subjected to restriction enzyme analysis (Popvic et al.,

1993). Restriction enzyme EcoRI has shown more bands than other restriction enzymes

which include ClaI and HindIII (Preheim et al 1991; Blumberg et al., 1992; Prevost et

al., 1992). Multiple enzymes have been tried to achieve greater resolution but EcoRI

seemed to produce equivalent results (Richardson et al., 1994). Ribotyping of MRSA has

successfully been used in several epidemiological studies with slight variation in the use

of restriction enzymes or probes and is discriminatory and reproducible (Haley et al.,

1982; Hadorn et al., 1990; Tenover et al., 1997).

Pulse Field Gel Electrophoresis of Chromosomal DNA

Pulse Field Gel Electrophoresis (PFGE) was developed by Schwartz and Cantor require

intact chromosomal DNA. It involves isolating micro-organism, embedding them in low

melting point agarose, lysing the organism in situ, digesting the DNA with rare cutting

restriction enzyme and then using special alternating electric fields to separate the large

DNA fragments produced (Schwarz and Cantor, 1984; Haley, 1991; Maslow et al.,

1993b). It takes two to four days to prepare the DNA for PFGE (Arbeit, 1995). SmaI is

commonly used restriction enzyme as it has few restriction sites and produces relatively

large fragments of DNA (10-800kb). The interpretation of banding patterns from pulse

field gel electrophoresis is done according to the criteria set by Tenover (Tenover et al.,

1995). One genetic difference results in a 2-3 band change and isolates are regarded as

being closely related and probably part of an outbreak. Two genetic changes results in a

4-6 band difference and isolates are regarded as possibly related and possibly part of an

outbreak. If there are three or more genetic differences, a difference of seven or more


24

band occurs. Such isolates are regarded as different and not part of an out break. Tenover

et al emphasized that these criteria were applicable only to PFGE performed on a set

epidemiological related organisms. Suggested restriction enzymes for typing MRSA

includes SmaI which gives 15-20 fragments, EagI gives 15-20 bands, SstII which gives

8-22 fragments, and ApaI, which gives 30-40 fragments. NotI, AscII, RsrII, and CspI,

give too few fragments. Kpul, EcoRI, Xhol and BamHI give multiple small fragments

that run of gel (Ichiyama et al., 1991; Carles-Nurit et al., 1992; Hollis et al., 1995;

Maslow et al., 1993b; Richardson and Reith, 1993; Winter et al 1993; Dominguez et al.,

1994; Struelens et al 1995; Tenover et al., 1995).

This method is highly discriminatory and can be applied to any bacterial species (Maslow

et al., 1993b; Tenover et al., 1995). PFGE has been suggested as method of choice for

typing MRSA (Bannerman et al 1995; Goering et al., 1995). This methods is usually

quite discriminating, however another method is often necessary to subdivide some

strains (Carles and Nurit et al., 1992; Tenover et al., 1994; Couto et al., 1995) and often

unrelated strains are found to have identical banding pattern to the outbreak strains

(Fukuda et al., 1998).

Ribosome spacer PCR

Kumari et al compared ribosome spacer PCR (RS-PCR) to PFGE in typing MRSA. The

16S-23S RNA intergenic spacer region is amplified by PCR, and restriction analysis

applied to the amplicons. 180 isolates of MRSA were typed; PFGE generated 17 and RS-

PCR 13 types. PFGE detected minor variants not discriminated by RS-PCR and detected

4 unique strains not identified by PCR. RS-PCR was found useful in typing strains from a

local outbreak. They found RS-PCR was rapid, inexpensive, highly reproducible and

slightly less discriminatory as PFGE in typing MRSA (Kumari et al., 1997).

SCCmec region PCR

The SCC mec region has a hypervariable segment 3’ to mecA, analysis of which can be

used to type MRSA strains. MSSA are non typeable by this method. Nishi et al typed

methicillin-resistant S. aureus and coagulase-negative staphylococci strain by amplifying

the hypervariable region downstream of mecA, and comparing the sizes of the amplicons


25

generated (Nishi et al., 1995). 61 MRSA isolates were grouped into 5 types and 26

coagulase-negative staphylococci were grouped into 5 types with this method.

Restriction Modification (RM) Typing

Staphylococcus aureus isolates belong to one of the ten reported S. aureus lineages. Each

lineage has characteristic external surface proteins that are responsible for interaction

with host. MRSA isolates that are widely distributed in hospitals and community belong

to six predominant S. aureus lineages and they have also acquired SCCmec on mobile

genetic elements (MGEs) (Robinson & Enright, 2003; Lindsay et al., 2006). Hospital

acquired MRSA population of each geographical location have limited clones and evolve

independently. The clones of each geographical location belong to separate lineages and

can be easily discriminated using restriction modification tests. Sequences of S. aureus

hsdS, sau1hsdS1and Sau1hsdS2 are highly conserved with in S. aureus lineages but vary

between the lineages (Waldon and Lindsay, 2006). Each gene has a conserved 5’ end,

central region and occasionally 3’ end. These genes also have a highly variable region in

between and specifically designed primers, one forward and two distinct reverse primers

targeting these variable region. In this way three PCR assays were developed which could

lead to three possibilities, a large amplicon, a small amplicon or no amplification at al.

These three PCR assays were termed as RM1, RM2 and RM3 as explained in figure 5.

Thus each possibility assigns a clonal complex to an isolate. Thus RM typing is rapid

PCR base method for the determination of clonal complex of MRSA isolates (Cockfield

et al., 2007).

Multilocus Variable Number of Tandem Repeat analysis (MLVA)

Genome sequence project of Eukaryotic and prokaryotic organisms has led to the

identification of special DNA sequences that repeat across the genome (Van Belkum,

1998). These repeated sequences were termed as Variable Number of Tandem Repeat

Analysis. These repeats are unique in their length, sequences and have specific copy

number across the genome of an isolate. So the difference in the number of repeat can be

used to measure the degree of relatedness among isolates and also can be used to trace

evolutionary changes in the genome (Jafferys et al., 1992; Tautz and Schlotterer, 1994).


26

Figure 5. Primer binding positions and predicted product sizes. On the left hand

side, the expected PCR product size for each lineage is listed. On the right, the

hybridization positions of the test primers on the variant forms of the

sau1hsdS genes are shown.


27

The locus specific repeats can be amplified through PCR by using the flanking primers

(Keim et al., 2001; Farlow et al., 2001). The PCR base VNTR anaylsis technique has

been reliably used to type clinical MRSA isolates. Sabat et al used five gene loci sdr,

clfA (clumping factor A), clfB (clumping factor B), sspA, spa to type MRSA isolates and

named this VNTR analysis as Mutlilous Variable of Tandem repeat analysis. These genes

code for different surface protein and have an R region present at the 3’ end which

contains the different number of repeats. S. aureus genome has several loci which contain

VNTRs (Francois et al., 2005; Koreen et al., 2005; Malanchowa et al., 2005, Sabat et al.,

2003). It has been observed that this method is robust, cost effective and have greater

discriminatory power (Sabat et al., 2003).

SPA Sequence typing

Direct Sequencing of DNA is considered as the most objective technique. A segment of

genomic DNA is amplified with PCR and the base sequence of amplicon is determined.

A number of major advantages exist (Oliveira et al., 2001; Enright et al., 2000).

Sequencing techniques are highly reliable and all strains are typeable. The method is

faster than PFGE, there is unambiguous data interpretation simplicity of large scale

database interpretation and standardization amongst laboratories is facilitated. The

technique is still very expansive, and only lends itself to the typing of a very small

number of organisms.

SPA typing involves direct sequencing of polymorphic X region of protein A gene. Spa

was used for molecular typing of MRSA (Frenay et al., 1996; Oliveira et al., 2001;

Shopsin et al., l999). The X region of protein A gene contains different number of repeats

which are due to loss and gain of repeats by spontaneous mutation. A numeric code is

assigned to each repeat unit and size of repeat unit is 24bp. Then spa type is determined

by the arrangement of these codes. Spa sequence typing is fast and easy to perform and

easy to interpret and produces unambiguous data. This data can be compared through

ridom spa server (www.ridom.de/spaserver). Spa typing is beneficial to monitor the

transmission of MRSA isolates from one hospital to another (Harmsen et al., 2003).


28

Figure 6. Indicating spa gene repeats sequence and repeat IDs of spa type t253.


29

Multilocus sequence typing (MLST)

Enright et al has developed this method for typing S. aureus which include the

sequencing of seven house keeping genes and then compare these sequences with the

standard available sequence available at MLST data base web (www.mlst.net).Multilocus

sequence typing is considered to be equivalent to Multilocus enzyme electrophoresis.

Instead of studying the enzyme, PCR is used to amplify the regions with in the genes of

these enzymes, and analysis of these sequences used to compare different bacterial

species (Enright and Spratt, 1999; Enright et al., 2000). The gene sequences are good

indicators of evolution with in species (Feil et al., 2003). The allelic profile is obtained by

sequencing internal fragments of seven house keeping genes. These genes include

Carbamate kinase (arcC), Shikimate dehydrogenase (aroE), glycerol kinase (glpF)

guanylate kinase (gmk), phosphate dehydrogenase (pta), triosephosphate dehydrogenase

(tpi) and acetyl coenzyme A acetyltransferase (yqil). Internal fragment of 450bp to 500bp

are sequenced for the seven house keeping genes and each gene loci is assigned a specific

number on the basis of sequence. These numbers are then arranged in the form of allelic

profile which are termed as sequence type. Any new occurring allele has a different DNA

sequence and assigned a distinct new allelic number (Enright et al., 2000).

A specifically designed algorithm BURST (based on related sequence type) is used to

show the relationship with in the clonal complexes (Feil and Chen, 2000). Data is

subdivided into clonal complexes in which members have at least 5 loci in common.

Ancestral genotypes are assigned as the genotype with in the clonal complex which

defines the highest number of single locus variants. Other strains are then assigned

according to their relation with ancestral genotype. Each clonal complex is represented

by series of concentric circles with the ancestral genotype at the centre (Enright et al.,

2002; Feil et al., 2004; Robinson and Enright, 2004).

This technique is highly discriminatory. This data base is available on the internet and

people can submit there sequence data to the database for the comparison, and analysis

(Anonymous, 2000c). Thus MLST produces unambiguous results that are due to high

cost reproducible and portable across different laboratories. MLST typing is most


30

desirable method for typing but high sequencing accuracy makes this method less

adaptable (Enright and Spratt, 1999; Olivera and Bean, 1999; Peacocok et al., 2002).

STAR Analysis

Staphylococcus auerus repeats (STAR) are the repetitive element that is present in

multiple copies in the S. aureus genome. These are present in intergenic region of

Staphylococcus auerus genome. An analysis of PCR product whose size may differ in

few nucleotide or several at several loci would allow the identification and differentiation

of clinically similar isolates at sub species level. The most important feature of the STAR

element is its repeated signature sequence T(/G/A/T)TGTTGG(G/T)GCCC(C/A) which

is present in different copies. There might be some strains which do not have signature

sequence at the particular locus thus lacking STAR element where as other have at that

particular locus either one or in multiple copies. STAR element normally begins with

TGGG[A/C]GTGGGACAGAAATGAT and ends at T[G/A/T]TGTTGGGGCCCCGCC

which is an extended signature sequence. STAR element region is normally followed by

a conserved region. Variation between the strains is in the number of STAR elements and

some time accompanied with the few base pair changes in the conserved region (Cramton

et al., 2000).

Aim and Objectives of Study

The present study is carried out in order to improve evidence based medicine and

valuable health policies in Pakistan against Staphylococcus aureus infections, by looking

into the patterns and distribution MRSA strains in different hospitals of

Islamabad/Rawalpindi. Simply by understanding how and what infection causing the

people sick is important in improving community health. The aim of present work was to

collect MRSA isolates from variety of infections from hospitals of

Islamabad/Rawalpindi, Pakistan and genotype them by using the Multilocus variable

number of tandem repeat analysis as described by Sabat et al., 2003., then with RM

typing, spa typing, MLST and also screened them for the presence of PVL gene and

Staphylococcus aureus repeats (STAR) at three loci. For this purpose a total of 123

MRSA isolates were obtained from three tertiary care hospitals of Islamabad/Rawalpindi.


31

Objectives of present work include:

To investigate the prevalent infectious MRSA strains in Pakistani clinical

environments and to identify the epidemic strains.

To investigate the genetic inter-relationship of the Pakistan MRSA isolates and to

find out whether the strains are restricted with specific hospitals.

To get an insight how these isolates evolved in Pakistan and to understand the

evolutionary mechanism which resulted in the selection of these strains.

To look for the relationship of Pakistani MRSA with global MRSA strains

Finally the objective of this study was the applicability of such molecular techniques

which are less labor intensive and portable across small diagnostic laboratories, at the

same time cheap and easy to perform.

Chapter 2 Materials and Methods

32

MATERIALS AND METHODS

Staphylococcus aureus is the major human pathogen and causes nosocomial as well as

community acquired infections. Since the last decade or so there is an alarming increase

in Staphylococcus aureus infections in Pakistan. Hence an epidemiological study was

designed to investigate the MRSA isolates prevalent in the nosocomial environment of

Rawalpindi/Islamabad, Pakistan and to understand their phylogenetic relationship among

the local isolates and also with globally isolated MRSA strains.

Isolation and Identification of Staphylococcus aureus

All the 123 non duplicate Staphylococcus aureus strains enlisted in table 13 (see

appendix-I) were isolated from patients hospitalized in three tertiary Care hospitals

situated in Islamabad and Rawalpindi (Pakistan Institute of Medical sciences, KRL

Hospital Islamabad and Military Hospital, Rawalpindi). These strains were re-confirmed

through recommended biochemical (Coagulase, Catalase and DNase test) and antibiotic

sensitivity tests initially and later on 16S-rRNA gene primers and mecA gene primers

were employed in order to confirm at molecular level. Staphylococcus aurues resistance

to antibiotics “Methicillin” or “Oxacillin” was determined through Kirby-Bauer Disc

Diffusion Method (Lawrence et al., 1972). The resistant and susceptible MRSA were

recognized on the basis of standard criteria.

Oxacillin

Resistant (MRSA): < 10 mm zone size of inhibition

Intermediate (MRSA) 11-12 mm zone size of inhibition

Susceptible (MSSA) > 13 mm zone size of inhibition

Methicillin

Resistant (MRSA) < 9 mm zone size of inhibition

Intermediate (MRSA) 10-13 mm zone size of inhibition

Susceptible (MSSA) > 14 mm zone size of inhibition


33

Later on these strains were typed by using mecA typing, RM typing and MLVA typing,

STAR typing, spa typing and MLVA typing schemes. The materials and procedure

adapted for this purpose is explained below.

Gram staining and Biochemical Tests

Gram staining and Biochemical tests were performed according to the National Standard

Method developed by Health Protection Agency, UK (http://www.hpa-standardmethods.

org.uk/).

Gram Staining

A single colony of the S. aureus was picked from the fresh culture plate and smeared on

the glass slide, followed by gentle heating to fix the smear. Slide was flooded with 0.5%

methyl crystal violet and left for 60 seconds. Extra stain was washed away by treating the

slide with water for 5 seconds and then flooded the slide with 1% Lugol’s iodine solution

for 60 seconds. Then slide was treated with 95-100% ethanol drop wise in order to

remove the excess iodine from the smear and again rinsed the slide with tap water for 5

seconds. Safranin (0.1%) was used as a counterstain and flooded the slide for 2 minutes.

Again slide was washed with water and dried. Appearance of deep blue or purple cocci

under light microscope was interpreted as gram-positive bacteria.

Catalase Test

The catalase test is important in distinguishing streptococci (catalase-negative) from

staphylococci, which are vigorous catalase-producers. A colony was picked from an 18-

24 hour culture and placed on a clean glass slide. One drop of 3% Hydrogen peroxide

(H2O2) was dropped on slide and observed for bubbling. S. aureus was confirmed if the

bubbles appeared immediately.

Coagulase Test

Rabbit plasma (0.5 ml) was added to a sterile glass tube. A large loop full of a pure

colony of Staphylococci was emulsified into the plasma and incubated at 37°C for 4

hours. Clot formation was checked at different time intervals; 30 minutes, 1 hour and 4


34

hours. The samples which showed absence of clot formation up to 4 hours were

rechecked after 24 hours. Clot formation confirmed the presence of Staphylococcus

aureus. No formation of clot was indicative of the presence of S. epidermidis

Deoxyribonuclease (DNase) Test

Line streak inoculation technique was used to apply a heavy inoculum on the agar and

drawn a line 3-4 cm long from the rim to the centre of the plate. In the other section of

the plate, DNase positive control strain inoculated and incubated at 37oC for 18-24 hours.

DNase activity was detected by flooding 1M Hydrochloric acid on the culture plate after

waiting for a few minutes. Excess hydrochloric acid was decanted and clear zone

formation was examined around the bacterial culture. Zone was compared with the

DNase positive control.

Bacterial culture and DNA Isolation

MRSA strains stored at -80 oC were streaked on BHI agar (Oxoid) and cultured over

night at 37oC. The colonies were visually inspected and then a single colony was picked

and inoculated in BHI Broth (Oxoid) and incubated over night (16-24hrs) in a shaking

incubator. 1.5ml of this fresh culture was taken and centrifuged at 10,000 rpm for 10

mins. The pellet was re-suspended in 250 l P-1buffer (Qiagen) and to this were added

2.5 l (100g/ml) lysostaphin, 2 l (25 mg/ml) proteinase K, mixed and 27 l 10% SDS.

Tubes were inverted 3-4 times and incubated at 37oC for 20-30 mins. Then 98 l 5M

NaCl and 81 l preheated CTAB (incubated CTAB for 20 mins at 65oC) was added.

After mixing, an equal volume of 24:1 chloroform: isoamyl alcohol was added and tubes

were centrifuged at 10,000 rpm for 10 mins. The upper layer was transferred to a fresh

tube and an equal volume of isopropanol was added prior to centrifugation at 10,000 rpm

for 10 min and resuspenion of the DNA pellet in 50 l sterile TE buffer pH8. Extracted

DNA was checked by running on 1.5% agarose gel for 45mins at 100volts.

DNA concentration (µg/µl) was determined by measuring absorbance of the sample at

260 nm wavelength and 280nm wavelength (Hoisington et al., 1994). 10 µl DNA

samples were diluted with 900 µl TE and quantified through UV spectrophotometer


35

(Series 8453, Agilant, USA). The ratio of approximately 1.8-2 was taken as pure DNA.

Following formula was used to calculate the final quantity of the DNA in the sample.

DNA (µg/µl) = [OD260 x 100 (Dilution Factor) × 50 µg/ml]/1000

16S-rDNA Identification of Staphylococcus aureus

The 16SrDNA was used for identification of Staphlococcus aureus, as it is highly

conserved between different species of bacteria. In addition to highly conserved primer

binding sites, 16S rDNA contain hypervariable regions which provide species-specific

signature sequences useful for bacterial identification. As a result, 16S rDNA has become

prevalent in medical microbiology as a rapid, accurate alternative to phenotypic methods

of bacterial identification.

The primers used for the identification of Staphylococcus aureus had been taken from

Johnson et al., 2008. The primer sequences are given as under.

16S-F: 5`-GATCCTGGGTCAGGATG-3`

16S-R: 5`-CTAGAGTTGTCAAAGGATG-3`

The expected amplicon size is 1074bps. Polymerase chain reaction was performed in 0.2

ml tubes (Axygen, USA) containing 10 μl total reaction mixture. The reaction mixture

contained 40 ng (1ul of 1:10 diluted DNA) of genomic DNA,1 μl 10X PCR buffer (MBI

Fermentas, UK), 2.4ul 25mM MgCl2, 1ul 10mM dNTPs, 0.5ul 10uM each primer

(forward and reverse), and one unit of Taq DNA polymerase and 3.6ul PCR grade water.

The reaction mixture was taken through thermocycling conditions consisting: Lid temp

105°C, 2 minutes of 94°C for template DNA denaturation followed by 30 cycles of

amplification each consisting of 3 steps: one minute at 94°C for double stranded DNA

denaturation; one minute at 56°C for primer annealing to their complementary sequences

on either side of the target sequence; and three minute at 72°C for extension of

complementary DNA strands from each primer, final 4 minutes at 74°C for Taq DNA

polymerase to synthesize any unextended strands left. PCR was performed using Triple

Master Mix Thermocycler (Eppendorf).


36

Mec A- gene Identification and SCCmec typing of Staphylococcus

aureus

mecA gene has been used for rapid identification of methicillin-resistant S. aureus

(MRSA). mecA gene was amplified using previously described primers by

Francois et al (Francois et al.,2005).

mecAF-: 5`-CATTGATCGCAACGTTCAATTT -3`

mecAR-: 5`-TGGTCTTTCTGCATTCCTGGA-3`

Polymerase chain reaction was performed in 0.2 ml tubes (Axygen, USA) containing 10

μl total reaction mixture. The reaction mixture contained 40 ng (1ul of 1:10 diluted DNA)

of genomic DNA,1 μl 10X PCR buffer (MBI Fermentas, UK), 2.4μl 25mM MgCl2, 1μl

10mM dNTPs, 1μl 5uM each primer (forward and reverse), and one unit of Taq DNA

polymerase and 2.6μl PCR grade water. The reaction mixture was taken through

thermocycling conditions consisting: Lid temp 105°C, 5 minutes of 94°C for template

DNA denaturation followed by 30 cycles of amplification each consisting of 3 steps:

Thirty seconds at 94°C for double stranded DNA denaturation; Thirty seconds at 55°C

for primer annealing to their complementary sequences on either side of the target

sequence; and thirty seconds at 72°C for extension of complementary DNA strands from

each primer, final five minutes at 72°C for Taq DNA polymerase to synthesize any

unextended strands left. PCR was performed using Triple Master Mix Thermocycler

(Eppendorf).

SCCmec typing was performed in a multiplex PCR as described by Boye et al., 2007.

Multiplex Polymerase chain reaction was performed in 0.2 ml tubes (Axygen, USA)

containing 10 μl total reaction mixture. The reaction mixture contained 2.5μl of genomic

DNA, 5 μl 10X PCR master mix ,2μl 10uM primer mix (forward and reverse), and 0.5μl

of Taq DNA polymerase. The reaction mixture was taken through thermocycling

conditions consisting: Lid temp 105°C, 4 minutes of 94°C for template DNA

denaturation followed by 30 cycles of amplification each consisting of 3 steps: Thirty

seconds at 94°C for double stranded DNA denaturation; Thirty seconds at 55°C for

primer annealing to their complementary sequences on either side of the target sequence;


37

and sixty seconds at 72°C for extension of complementary DNA strands from each

primer, final four minutes at 72°C for Taq DNA polymerase to synthesize any


(Eppendorf).

Detection of PVL Gene

The presence of Panton Valetine Leukotoxin gene was also checked by using the primers

Luk-PV-1 5’ATCATTAGGTAAAATGTCTGGACATGATCCA3’

Luk-PV-2 5’GCATCAAGTGTATTGGATAGCAAAAGC3’

The PCR reaction mixture contained 2 l (40 ng) of genomic DNA, 2.5 μl 10X PCR

buffer (MBI Fermentas, UK), 1.5 l 25mM MgCl2, 0.8μl 10mM dNTPs, 1.25 l 5uM

each primer and one unit of Taq DNA polymerase (Fermentas, UK) and 15.5 l PCR

grade water. Thermocycling conditions consisted of one cycle of 5 minutes of 94°C

followed by 30 cycles of amplification each consisting of three steps: forty-five seconds

at 94°C; forty-five seconds at 55°C and sixty-five seconds at 72°C, followed by a final

extension step of 5 minutes at 72°C. PCR was performed using a Triple Master Mix

Thermocycler (Eppendorf, USA).

Determination of MRSA Lineages Using Restriction Modification

system (RM-Test)

Restriction-modification systems (RMS) (restriction endonucleases and modification

methyltransferases) was used to determine lineages of Staphylococcus aureus obtained

from clinical material as described by Lindsay et al. (Lindsay et al., 2007). The primers

AF, AR30, AR22 were used for RM test 1, primers AF, AR45, AR1 for RM test 2 and

BF, BR8, BR5 are used for RM test3. The primer sequences are given in the Table 1 and

the expected product sizes for different RM tests are given in the table 2.


μl total reaction mixture. The reaction mixture contained 40 ng (1μl of 1:10 diluted DNA)


38

Table 1: Oligonucleotide Primers used in RM typing

RM Test Primers Sequence (5` 3`)

RM 1 AF

AR30

AR22

AGGGTTTGAAGGCGAATGGG

CAACAGAATAATTTTTTAGTTC

TCAGAGCTCAACAATGATGC

RM-2 AF

AR45

AR1

AGGGTTTGAAGGCGAATGGG

GGAGCATTATCTGGTGTTTTCC

GGGTTGCTCCTTGCATCATA

RM-3 BF

BR8

BR5

CCCAAAGGTGGAAGTGAAAA

CCAGTTGCACCATAGTAAGGGTA

TCGTCCGACTTTTGAAGATTG

Table 2: RM typing Product sizes for different Clonal Complexes.

Clonal Complex

RM-1

Size in bp

RM-2

Size in bp

RM-3

Size in bp

CC30 203 - -

CC22 990 - -

CC45 - 722 -

CC1 - 1037 680

CC8 - - 680

CC5 - - 1071


39

of genomic DNA, 1μl 10X PCR buffer (MBI Fermentas, UK), 2.4μl 25mM MgCl2, 1μl

10mM dNTPs, 1μl 5 μM each primer (forward and reverse), and one unit of Taq DNA -

Polymerase and 1.6μl PCR grade water. The reaction mixture was taken through

thermocycling condition consisting: Lid temp 105°C, 5 minutes of 94°C for template


Thirty seconds at 94°C for double stranded DNA denaturation; Thirty seconds at 55°C

for primer annealing to their complementary sequences on either side of the target

sequence; and two minutes at 72°C for extension of complementary DNA strands from

each primer, final five minutes at 72°C for Taq DNA polymerase to synthesize any


(Eppendorf).

Typing of Staphylococcus aureus for STAR Element

Staphylococcus aureus repeat (STAR) elements present in the inetrgenic region has been

used for typing of methicillin-resistant Staphylococcus. aureus (MRSA). STAR element

present in intergenic region of CHP-gapR, uvrA-hprk and ica-geh was amplified by using

primers given in the table 2.


μl total reaction mixture. The reaction mixture contained 2.5 μl of genomic DNA, 5 μl

2XPCR pre mix D, 1μl 10mM each primer (forward and reverse), and 0.5μl of Taq DNA

polymerase. The reaction mixture was taken through thermocycling conditions

consisting: Lid temp 105°C, 5 minutes of 94°C for template DNA denaturation followed

by 30 cycles of amplification each consisting of 3 steps: Thirty seconds at 94°C for

double stranded DNA denaturation; Thirty seconds at 52°C for primer annealing to their

complementary sequences on either side of the target sequence for gapR-chp, ica-geh and

62°C for uvrA-hprk and thirty seconds for gapR-chp, one minute for ica-geh, and uvrA-

hprk at 72°C for extension of complementary DNA strands from each primer, final five

minutes at 72°C for Taq DNA polymerase to synthesize any unextended strands left.

PCR was performed using Triple Master Mix Thermocycler (Eppendorf, USA).


40

Multiplex PCR Based Multilocus Variable Number of Tandem

Repeats (MLVA) Assay

Seven genes ClfA (Clumping factor A), ClfB (Clumping factor B), sdrC (Ser-Asp-rich

fibrinogen binding proteins), sdrD (Ser-Asp-rich fibrinogen binding proteins), spa, sspa and

sav1078 were selected for the multiplex PCR for MLVA typing. The fluorescent labeled

primers used are given in the table 3, ClfA, sdrC and sav1078 were multiplex separately

from ClfB, sdrD, spa, sspa.


μl total reaction mixture. The reaction mixture contained 2μl DNA (40 ng) of genomic

DNA, 2.5 μl 10X PCR buffer (MBI Fermentas, UK), 1.5μl 25mM MgCl2, 0.8μl 10mM

dNTPs, 1.5μl of 5μM each primer ClfA (forward and reverse), sdrC (forward and

reverse), sav1078 (forward and reverse) and one unit of Taq DNA polymerase and 9μl

PCR grade water. In the second PCR ClfB, sdrD, spa and sspa were multiplexed with the

same procedure as mention above.

The reaction mixture was taken through thermocycling conditions consisting: Lid temp

105°C, 5 minutes of 94°C for template DNA denaturation followed by 30 cycles of

amplification each consisting of 3 steps: thirty seconds at 94°C for double stranded DNA

denaturation; thirty seconds at 53°C for primer annealing to their complementary

sequences on either side of the target sequence; and Two minute at 72°C for extension of

complementary DNA strands from each primer, final 5 minutes at 72°C for Taq DNA

polymerase to synthesize any unextended strands left. PCR was performed using Triple

Master Mix Thermocycler (Eppendorf, USA). The amplified products were subjected to

gene scan for size analysis in ABI-sequencer.

Gene Scan Protocol

PCR products (labeled with dyes as given in table 3) were diluted 1:10 with sterile

distilled water. Then 0.5 l of diluted (1:10) sample was added to 0.5 l Liz1200 (ABI)

size standard and 9 l of formamide before heating to 95°C for 3 minutes. Samples were


41

Table 3: Oligonucleotide Primers used in Typing of Staphylococcus aureus for

STAR Element.

Gene Primer Sequence (5` 3`) Tm

gapBF

gapSR

GGGGATCCGCTAATGATAAGTAGTATTTAG

GGGGATCCGTAAATAAGGATATATCACAAC

52

52

uvrA

hprk

GGTCCTGAAGGTGGTAGTGGCGGTGG

GGCTTCGATAATCCTTCTTCACCAGCG

77.7

73.9

icaC

geh

TTATTAAGCTATGTTAAAAACACGCGGTGG

AAAGGGAGGAATTAATAATGACTGCAGACT

69.6

67.8


42

electrophoresed on an ABI DNA Sequencer. Gene scan peaks were analyzed using the

Applied Biosystem Peak Scaner software volume 1.0 to obtain the exact PCR product

size (http://www.appliedbiosystems.com/absite/us/home/supportsoftware-community/

free-ab-software. html).

Calculation of VNTRs and MLVA Data analysis

The number of tandem repeats for all loci were calculated from the standard sequenced

strains 8325 and Mu50 using the Tandem Repeats Finder Program, Version 4.03

(Benson, G. 1999; http://tandem.bu.edu/trf.html ).

PCR products from these strains were used as a reference to calculate the number of

repeats in the test strains. The formula used to calculate the number of repeats was:- size

of the PCR product minus size of the flanking region divided by the size of the repeat

unit.

Phylogenetic analysis

The number of tandem repeats obtained for all the loci for each strain were imported into

bioinformatics software program, Network 4.5 available at a public domain (http//fluxux-

engineering.com/) and also into the MLVA plug-in of Bionumeric (Applied Maths Inc),

in order to calculate a phylogenetic tree. In the trees each circle represents a specific

MLVA type (MT/genotype) and the size and color of the circle represents the number of

strains in this specific type and their source of isolation. Lines between the circles

represent variation in the number of repeats. The isolates varying at one locus are

connected by bold lines and those varying in more than one locus are connected by thin

lines while the standard strains are connected by dotted lines.

SPA typing

DNA sequence analysis of the protein A gene variable repeat region (spa typing) provides

a rapid and accurate method for typing Staphylococcus aureus isolates. The primers used

for the amplification of protein A gene variable repeat region is given in the table 4.


43

Table 4: Oligonucleotide Primers used in MLVA Typing of Staphylococcus aureus.

Gene Name Primer Sequence (5` 3`) Dye Tm (°C)

ClfA

(Clumping factor A)

F-GCATTTAATAACGGATCAGG

R-TGAATTAGGCGGAACTACAT

FAM 58.5

ClfB

(Clumping factor A)

F-ATGGTGATTCAGCAGTAAATCC

R-CATTATTTGGTGGTGTAACTCTT

vic 61.5

sdrC

(Ser-Asp-rich fibrinogen binding proteins)

F-ATGATTTCACACTTGATAATGGC

R- GCTGTTTTATGCTGATCTTTAAC

vic 61.5

sdrD

(Ser-Asp-rich fibrinogen binding proteins)

F-ATGATTTCACACTTGATAATGGC

R- TAACGTTGCGTTATTTGAGCCC

Tet 61.5

Spa

(Protein)

F-AGCACCAAAAGAGGAAGACAA

R-GTTTAACGACATGTACTCCGT

FAM 62

sspA

(Serine protease V8)

F-ATCMATTTYGCMAAYGATGACCA

R-TTGTCTGAATTATTGTTATCGCC

Ned 61.5

Sav1078

(Hypothetical Protein)

F-GTGCATAATGGCTTACGAAT

R-TGGGAGGAATTAATCATGTC

FAM 59


44

Polymerase chain reaction was performed in 0.2 ml tubes (Axygen, USA) containing

25μl total reaction mixture. The reaction mixture contained 2μl DNA (40 ng) of genomic

DNA, 2.5 μl 10X PCR buffer (MBI Fermentas, UK), 1.5μl 25mM MgCl2, 0.2μl 10mM

dNTPs, 1.5μl 5μM each primer spa(forward and reverse), one unit of Taq DNA

polymerase and 15.7μl PCR grade water. The reaction mixture was taken through

thermocycling conditions consisting: Lid temp 105°C, 5 minutes of 94°C for template


thirty seconds at 94°C for double stranded DNA denaturation; thirty seconds at 55°C for

primer annealing to their complementary sequences on either side of the target sequence;

and thirty seconds at 72°C for extension of complementary DNA strands from each

primer, final 5 minutes at 72°C for Taq DNA polymerase to synthesize any unextended

strands left. PCR was performed using Triple Master Mix Thermocycler (Eppendorf,

USA).The amplified product was checked by running on 1.5% agrose gel and then

proceeded for sequencing.

After sequencing the trace files were edited by using CLC DNA Work Bench 5.1. The

consensus sequences obtained were checked for the 24bps repeats units as given by

Korean et al., 2004. The 24 base pair repeat units were feed into the spa server and repeat

codes were identified and entered these repeat codes again into spa server and obtained

the spa types of isolated strains

Multilocus sequence typing (MLST) of Staphylococcus aureus

The Staphylococcus aureus MLST scheme uses internal fragments of the following seven

house-keeping genes: arcC (Carbamate kinase), aroE (Shikimate dehydrogenase), glp

(Glycerol kinase), gmk (Guanylate kinase), pta (Phosphate acetyltransferase), tpi

Triosephosphate isomerase), yqil (Acetyle coenzyme A acetyltransferase). The primers

for the amplification and sequencing of these gene fragments were taken from Enright et

al., 2000. The primer sequence is given in the table 5. Polymerase chain reaction was

performed in 0.2 ml tubes (Axygen, USA) containing 20μl total reaction mixture by

using 1μl chromosomal DNA (40ng), 2μl 10X PCR buffer (contains MgCl2), 1.25 μl

25mM MgCl2, 0.4μl 10mM dNTP mix, 2μl of each 2μM primer (forward and reverse),

one unit of Taq polymerase (Kappa-taq 10units/ul), distilled water 11.25μl. The reaction


45

Table 5: Oligonucleotide primers used in MLST typing.

S.NO. Gene Name PCR/Sequencing primers

1 arcC up - 5' TTG ATT CAC CAG CGC GTA TTG TC -3'

dn - 5' AGG TAT CTG CTT CAA TCA GCG -3'

2 aroE up - 5' ATC GGA AAT CCT ATT TCA CAT TC -3'

dn - 5' GGT GTT GTA TTA ATA ACG ATA TC -3'

3 glp up - 5' CTA GGA ACT GCA ATC TTA ATC C -3'

dn - 5' TGG TAA AAT CGC ATG TCC AAT TC -3'

4 gmk up - 5' ATC GTT TTA TCG GGA CCA TC -3'

dn - 5' TCA TTA ACT ACA ACG TAA TCG TA -3'

5 pta up - 5' GTT AAA ATC GTA TTA CCT GAA GG -3'

dn - 5' GAC CCT TTT GTT GAA AAG CTT AA -3'

6 tpi up - 5' TCG TTC ATT CTG AAC GTC GTG AA -3'

dn - 5' TTT GCA CCT TCT AAC AAT TGT AC -3'

7 yqi up- 5' CAG CAT ACA GGA CAC CTA TTG GC -3'

dn- 5' CGT TGA GGA ATC GAT ACT GGA AC -3'


46

mixture was taken through the thermocycling conditions consisting: Lid temp 105°C, 5

minutes of 94°C for template DNA denaturation followed by 30 cycles of amplification

each consisting of 3 steps: one minute at 94°C for double stranded DNA denaturation;

one minute at 55°C for primer annealing to their complementary sequences on either side

of the target sequence except for tpi and gmk used 50°C; and one minute at 72°C for one

minute at 55°C for primer annealing to their complementary sequences on either side of

the target sequence except for tpi and gmk used 50°C; and one minute at 72°C for

extension of complementary DNA strands from each primer, final 5 minutes at 72°C for

Taq DNA polymerase to synthesize any unextended strands left. PCR was performed

using Triple Master Mix Thermocycler (Eppendorf, USA).

The allelic profile of Staphylococcus aureus strain was obtained by sequencing internal

fragments of seven house-keeping genes. The sequence was obtained for both DNA

strands and then consensus sequences were determined by using CLC DNA work bench.

The sequences were trimmed so that they correspond exactly to the region that MLST

server uses to define the alleles. After submitting the seven sequences, got the allelic

profile of isolates with assigned Sequence type (ST).

DNA Sequencing Procedure

Took 0.5μl amplified product to be sequenced in 0.2ml PCR tube and added 1μl forward

and reverse primers in separate reactions. Then added 4μl Big Dye (1:8 diluted), 6.4μl 5x

Sequencing Buffer, 11.6μl distilled water and the reaction mixture was taken through the

thermocycling conditions consisting twenty five cycles each consisting thirty seconds at

96C, fifteen seconds at 50°C and four minutes at 60°C.

Added 2μl 2.2% SDS to 20μl reaction after doing PCR, mixed by flicking tube and spin

briefly. Heated to 98°C for 5 min, Cooled to room temperature and spin briefly. Spin the

cartridges for three minutes at 850xg (3100rpm). Transferred Cartridges to 1.5ml

eppendorf tubes and added sample. Spin the cartridges for 3 min at 850xg (3100rpm).

Retained fluid and used for sequencing. Respinned if obtained less than 16ul of reaction

volume. All the sequencing carried out in the AB sequencer (model and made), PNACLE

facility, University of Leicester, UK and trace files were edited using CLC-DNA work

bench 5.1.


47

100 bp DNA Ladder

The Norgen Full Ranger 100bp DNA Ladder [1mL of premixed DNA ladder

(0.5µg/10µL) in loading buffer (10mM EDTA, 10% glycerol, 0.015% bromophenol blue

and 0.17% SDS)] was used in horizontal gel electrophoresis in order to determine DNA

amplicon sizes. Norgen Full Ranger contains sixteen discrete fragments ranging from

100bp to 5000bp with higher intensity reference bands at 500bp and 1000bp. This Ladder

(Figure 7a) is ideal for accurate visual determination in both large and small cloning

applications.

Ø×174 RF DNA Hae III Ladder

The other marker used was Ø×174 RF DNA Hae III Ladder. Typically 2ul of the ladder

solution was used per well. The fragment sizes of this ladder are given in figure 7b.

Solutions and Buffers

1- 1.5%Agarose

Dissolved 1.5gm of agrose in 98.5ml of distilled water and heated in microwave

for 2mins,cooled down to 60 oC and then added 5ul ETBr per 100ml of agrose and

poured in gel tray and allowed to polymerize at room temperature for 30-45min.

2- 10%SDS

Took 10gm of SDS (Merk) and made the volume upto 100ml.

3- 5M NaCl

Took 292.5gm of Sodium Chloride (Merk) and made volume upto 1000ml.

4- CTAB Solution

Dissolve 4.1g NaCl (Merk) in 80mls H2O, and add 10g CTAB make up to 100mls

and warmed to 65 oC to dissolve.


48

Figure 7 (A&B)

Fig.7A Fig.7B

Norgen Full Ranger 100bp DNA Ladder is shown in Fig.7A and Ø×174 RF DNA Hae III

Ladder is shown in Fig.7B.


49

5- 10XTAE buffer

To make 1L, 48.4g Tris, 20mL of 0.5M EDTA pH 8.0, 11.42mL Glacial Acetic

Acid and added enough H2O to dissolve solids, pH with HCl to 7.6-7.8, then

bring up to final volume of 1000mL.

6- 10XTBE buffer

To make1 L, dissolved 108g Tris base, 55g Boric acid, 40mls 0.5M EDTA (pH

8.0) in enough water and made the final volume upto 1L and autoclaved for 20

min.

7- TE buffer

Took 10ml of 1M Tris-Cl, pH 7.5 and 2ml of 0.5M EDTA pH 8.0, and made the

volume upto 1L.

8- 1M Tris-Cl

Dissolved 60.57g of Tris in 0.5L water and adjusted the pH to 7.5 using HCl.

9- 0.5M EDTA

Dissolved 186.1g of EDTA in IL water by stirring and adjusted the pH to 8.0 by

using NaOH.

Statistical and Sequence Analysis

All statistical (clustering) and sequence analysis was performed using BioNumerics

(Applied Maths, Belgium) and CLC DNA (USA) respectively.

Chapter 3 Results

50

Results

Staphylococcus aureus is the major human pathogen and is the cause of various kinds of

human infection. In order to proceed for epidemiology study initial identification and

confirmation of Staphylococcus aureus is necessary. So all the 123 Staphylococcus

aureus isolates included in this study were identified and confirmed by the Gram

staining, Coagulase, Catalase & DNase tests and also for antibiotic sensitivity for

methicillin and then for 16S-rRNA gene and also for the presence of mecA gene. Then all

of the 123 isolates were subjected to the epidemiological techniques: MLVA typing, RM

typing, PVL typing, Spa, MLST and STAR analysis. The results are presented

accordingly.

Staphylococcus aureus Identification by 16S-rRNA Gene

There are different parameters used for the identification of Staphylococcus aureus. The

most reliable and commonly used to identify Staphylococcus aureus is by 16S rRNA

gene PCR. The most important potential use of 16S-rRNA gene is to provide genus and

species identification for isolates. Specifically designed 16S rRNA gene primers were

used, whose sequence is given in the material and methods section, in order to identify

the Staphylococcus aureus isolates accurately. The expected product size was 1000bps,

as calculated from the standard sequenced strain NCTC-8325 and Mu-50 by using the

software Artimis v. 9.

Pakistani Staphylococcus aureus isolates were screened for 16S-rRNA gene with specific

primers and expected product sizes of 1000bp were obtained with all the 123 isolates

(Fig. 8 to Fig. 13), confirming the isolates as Staphylococcus aureus. The

electropherogram obtained by running the PCR product in 1.5% agarose gel and after

staining with ethedium bromide is shown in the figure 8 (A, B, C). In the figure 8A from

left to right M is 100bp DNA ladder (Norgen Full Ranger), lane one to twenty contains

the standard strain NCTC8325, P.10019, K.3, P.2113, P.2112, P.2054, P.5123, P.13729,

P.18431, P.2896, P.2886, P.1896, P.5, P.10015, P.12006, P. 8431, P.10012, P10021, P.

18119 and P.1966 respectively. Similarly in the figure 8B from left to right M is 100 bps

Chapter 3 Results

51

Figure 8 (A, B, C)

Fig. 8A Fig. 8B

Fig. 8C

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of 16S-rRNA Gene for identification of Staphylococcus aureus. In the figure, M is 100 bp DNA ladder (Norgen Full Ranger); lanes 1 to 20 contain NCTC8325 [Positive control], P.10019, K.3, P.2113, P.2112, P.2054, P.5123, P.13729, P.18431, P.2896, P.2886, P.1896, P.5, P.10015, P.12006, P. 8431, P.10012, P10021, P. 18119 and P.1966 respectively. Figure 8B:- lanes 21 to 40 contain P.1, K.6, P.8, P.8487, P.17120, P.6269, P.11293, P.17121, P.13749, A.9965, P.8668, P.1297, P.16509, P.16849, P.12285, P.1129, P.1286, P.15415, P.18339, P. 8116 respectively. Figure 8C:- lane number forty one to fifty contains P.2285, P.1964, P.5119, P.11291, A.1761, A.35087, A.9313, A.9914, A.9077 and -ive control respectively.

Chapter 3 Results

52

DNA ladder (Norgen Full Ranger), lane twenty to forty contains P.1, K.6, P.8, P.8487,

P.17120, P.6269, P.11293, P.17121, P.13749, A.9965, P.8668, P.1297, P.16509, P.16849,

P.12285, P.1129, P.1286, P.15415, P.18339, P.8116 respectively.

In figure 8C from left to right M is 100bps DNA ladder (Norgen Full Ranger), lane

number forty one to fifty contains P.2285, P.1964, P.5119, P.11291, A.1761, A.35087,

A.9313, A.9914, A.9077 and -ive control respectively. All the amplified DNA fragments

were of approximately 1000bps in size, calculated after comparing with the ladder

confirming that the strains as Staphylococcus aureus.

Similar pattern of amplification was also observed for all the other isolates as indicated in

the Figure 9 to Figure 13. In the figure 9 from left to right M is 100bps DNA ladder

(Norgen Full Ranger), Lane number one to nineteen contain A.13319, A.7145, P.3, P.4,

P.7, K.8, P.8485, P.2, P.2871, P.5020, P.5114, P.1005, P.11296, P.862, P.844, P.843,

P.1843, A.8823 and negative control respectively. Similar results are given in the figure

10. In the figure 10 from left to right M is 100bps DNA ladder (Norgen Full Ranger),

lane number one to sixteen contain A.9781. A.465, A.26163, A.14254, A.15330, A.379,

A.13282, P.10013, P.1003, P.1863, P.3727, P.2887, P.6, P.8486, P.13741 and negative

control respectively. All the amplified DNA fragments were of approximately1000bps in

size, as calculated after comparing with the DNA marker confirming that these strains

were Staphylococcus aureus

Lane number one to eleven from left to right in figure 11 is showing the amplified

product of 16S-rRNA gene of Pakistani Staphylococcus aureus isolates, P.13740, K.10,

K.13, A.5054, A.13730, P.1962, P.2111, P.2255, K.11, P.12007 and negative control

respectively. M is 100bps DNA ladder (Norgen full Ranger). All the amplified DNA

fragments are of 1000bps in size, as calculated after comparing with the ladder

confirming that these strains were Staphylococcus aureus.

Figure 12 showing the amplified product of 16S rRNA gene of Pakistani Staphylococcus

aureus strains. In the figure 12 from left to right M is 100bps DNA ladder (Norgen full

Ranger), lane one to seventeen contain P.1009, P.16809, A.5053, P.3027, P.14947,

P.18176, P.1961, P.1963, P.5019, P.1123, K.12, P.2006, P.14946, P.2885, P.1864,

Chapter 3 Results

53

Figure 9

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus. In the figure from left to right M is 100bps DNA ladder (Norgen Full Ranger), Lane number one to nineteen contain A.13319, A.7145, P.3, P.4, P.7, K.8, P.8485, P.2, P.2871, P.5020, P.5114, P.1005, P.11296, P.862, P.844, P.843, P.1843, A.8823 and negative control respectively.

Figure 10

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus. In the figure from left to right M is 100bps DNA ladder (Norgen Full Ranger), lane no. one to sixteen contain A.9781. A.465, A.26163, A.14254, A.15330, A.379, A.13282, P.10013, P.1003, P.1863, P.3727, P.2887, P.6, P.8486, P.13741 and negative control respectively.

Chapter 3 Results

54

Figure 11

Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus. Lane number one to eleven from left to right in figure is showing the amplified product of 16S rRNA gene of Pakistani Staphylococcus aureus isolates, P.13740, K.10, K.13, A.5054, A.13730, P.1962, P.2111, P.2255, K11, P.12007 and negative control respectively.

Figure 12

Electropherogram of 1.5% ethidium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus. In the figure from left to right M is 100bps DNA ladder (Norgen full Ranger), lane no. one to seventeen contain P.1009, P.16809, A.5053, P.3027, P.14947, P.18176, P.1961, P.1963, P.5019, P.1123, K.12, P.2006, P.14946, P.2885, P.1864, P.13947 and negative control.

Chapter 3 Results

55

P.13947 and negative control. All the amplified DNA fragments are of

approximately1000bps in size, as calculated after comparing with the ladder confirming

that these stains were Staphylococcus aureus.

Figure 13 (A, B) showing the amplified product of 16S ribosomal DNA of Pakistani

Staphylococcus aureus strains. In the figure.13A from left to right M is 100bps DNA

ladder (Norgen full ranger), lane no. one to ten P.13714, P.14313, A.9445, A.9703,

A.9954, A.10813, A.11241, A.14075, A.14256, A.25356 and negative control

respectively. All the amplified DNA fragments are of approximately1000bps in size, as

calculated after comparing with the 100bp DNA marker, confirming the isolates as

Staphylococcus aureus.

Same is the case for the remaining isolates as shown in the figure 13B. In the figure 13B

from left to right M is 100bps DNA ladder (Norgen full ranger), lane no. one to seven

contains A.35045, P.1967, and P.1287, P.2119, P.6270, P.13731 and negative control

respectively. All the amplified DNA fragments are of approximately1000bps in size, as

calculated after comparing with the ladder confirming that these stains are


MRSA Identification by mecA Gene

The mecA gene is present in the SCCmec region. Methicillin resistant Staphylococcus

aureus is a carrier of mecA gene which makes this bacterium resistant to methicillin,

penicillin and other penicillin like antibiotics. So it is a good way to identify MRSA by

amplifying the mecA gene fragment by using PCR. It is a rapid and cheaper method for

the identification of MRSA.

The amplified product of mecA gene fragment of 38 Pakistani Staphylococcus aureus

strains are shown in the representative figure 14 (A, B, C). In the figure 14A from left to

right M1 is 100bp DNA ladder (Norgen full ranger) and M2 is the λ-ladder, lane one to

eleven contains the standard strain MRSA252, P.10019, K.3, P.2113, P.2112, P.2054,

P.5123, P.13729, P.18431, P.2896, P.2886, and in the figure 14B M is 100bp DNA ladder

(Norgen full ranger) and M2 is the λ-ladder, lane twelve to twenty four contain P.1896,

Chapter 3 Results

56

Figure 13 (A, B)

Fig. 13A Fig. 13B

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of 16S rRNA Gene for identification of Staphylococcus aureus. In the figure13A from left to right M is 100bps DNA ladder (Norgen full ranger), lane no. one to ten P.13714, P.14313, A.9445, A.9703, A.9954, A.10813, A.11241, A.14075, A.14256, A.25356 and negative control respectively. In the figure 13B from left to right M is 100bps DNA ladder (Norgen full ranger), lane no. one to seven contains A.35045, P.1967, and P.1287, P.2119, P.6270, P.13731 and negative control respectively

Chapter 3 Results

57

Figure 14 (A, B, C)

Fig. 14A Fig. 14B

Fig. 14C

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus. In the figure 14A from left to right M1 is 100bp DNA ladder (Norgen full ranger) and M2 is the λ-ladder, lane one to eleven contains the standard strain MRSA252, P.10019, K.3, P.2113, P.2112, P.2054, P.5123, P.13729, P.18431, P.2896, P.2886, and in the figure 14B M is 100bp DNA ladder (Norgen full ranger) and M2 is the λ-ladder, lane twelve to twenty four contain P.1896, P.5, P.10015, P.12006, P. 8431, P.10012, P10021, P. 18119, P.1966, P.1, K.6, P.8, P.8487 respectively and in Fig 14C from left to right M is the 100bp DNA ladder (Norgen full ranger), lane twenty five to thirty nine contain P.17120, P.6269, P.11293, P.17121, P.13749, A.9965, P.8668, P.1297, P.16509, P.16849, P.12285, P.1129, P.1286, P.15415 and negative control respectively.

Chapter 3 Results

58

P.5, P.10015, P.12006, P. 8431, P.10012, P10021, P. 18119, P.1966, P.1, K.6, P.8,

P.8487 respectively and in Fig 14C from left to right M is the 100bp DNA ladder

(Norgen full ranger), lane twenty five to thirty nine contain P.17120, P.6269, P.11293,

P.17121, P.13749, A.9965, P.8668, P.1297, P.16509, P.16849, P.12285, P.1129, P.1286,

P.15415 and negative control respectively. The amplified products obtained for all the 38

above mentioned isolates are100bps long thus confirming that these stains are methicillin

resistant Staphylococcus aureus.

Figure 15 showing the amplified product of mecA gene fragment of Pakistani

Staphylococcus aureus strains. In the figure 15A from left to right M1 and M2 are 100

base pair DNA ladder (Norgen full ranger), lane one to fourteen contains P.18339,

P.8116, P.2285, P.1964, P.5119, P.11291, A.1761, A.35087, A.9313, A.9914, A.9077,

A.14256, A.9954, and A.14075 respectively, and in the figure.15B from left to right M1 is

100 bps DNA ladder, lane fifteen to twenty eight contains A.11241, A.25356, A.10813,

A.9445, A.35045, A.9703. A.13319, A.7145, P.3, P.4, P.7 K.8, P.8485, P.2 respectively

and in the figure 15C from left to right M1 is 100 bps, lane twenty nine to thirty four

contain P.2871, P.5020, P.5114, P.1005, P.11296 and -ive control respectively. All the

amplified products are of approximately100bps long confirming isolates as methicillin

resistant Staphylococcus aureus.

Figure 16 showing the amplified product of mecA gene fragment. In the figure 16A M1

and M2 is 100 bps DNA ladder (Norgen full ranger), and from left to right, lane one to ten

contain P.862, P.844, P.843, P.1843, P.8823, .A.9781, A.465, A.26163, A.14254,

A.15330, and in the Figure16b from left to right lane eleven to fifteen contain A.379,

A.13282, P.10013, P.1003 and negatve control respectively. All the amplified products

are of approximately 100bps long confirming that these stains are methicillin resistant


Figure .17 showing the amplified product of mecA gene fragment. From left to right M1

and M2 are 100bps DNA ladders (Norgen full ranger). lane one to nineteen contain

P.1863, P.3727, P.2887, P.6, P.8486, P.13741, P.13740, K.10, -ive control, K.13, A.5054,

A.13730, P.1962, P.2111, P.2255, K.11, P.12007, P.1009, P.16809 respectively. All the

Chapter 3 Results

59

Figure 15 (A, B, C)

Fig. 15A Fig. 15B

Fig. 15C

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus. In the figure 15A, M1 and M2 are 100 base pair DNA ladder (Norgen full ranger), lane one to fourteen contains P.18339, P.8116, P.2285, P.1964, P.5119, P.11291, A.1761, A.35087, A.9313. A.9914, A.9077, A.14256, A.9954, and A.14075 respectively, and in the figure 15B from left to right M1 is 100 bps DNA ladder, lane fifteen to twenty eight contains A.11241, A.25356, A.10813, A.9445, A.35045, A.9703. A.13319, A.7145, P.3, P.4, P.7 K.8, P.8485, P.2 respectively and in the figure 15C from left to right M1 is 100 bps, lane twenty nine to thirty four contain P.2871, P.5020, P.5114, P.1005, P.11296 and -ive control respectively.

Chapter 3 Results

60

Figure 16 (A, B)

Fig. 16A Fig.16B

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus. In the figure 16A, M1 and M2 are 100 bp DNA ladder (Norgen full ranger), and from left to right, lane one to ten contain P.862, P.844, P.843, P.1843, P.8823, .A.9781, A.465, A.26163, A.14254, A.15330 and in the Figure16B from left to right lane eleven to fifteen contain A.379, A.13282, P.10013, P.1003 and negatve control respectively.

Figure 17

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus. In the figure100bps DNA ladder (Norgen full ranger), lane one to nineteen contain P.1863, P.3727, P.2887, P.6, P.8486, P.13741, P.13740, K.10, -ive control, K.13, A.5054, A.13730, P.1962, P.2111, P.2255, K.11, P.12007, P.1009, P.16809 respectively.

Chapter 3 Results

61

amplified products are of approximately100bps long confirming that these stains are

methicillin resistant Staphylococcus aureus.

Figure 18 showing the amplified product of mecA gene fragment. In the figure 18A from

left to right M is 100bps DNA ladder (Norgen full Ranger), Lane one to eleven contains

P.5053, P.1963, P.5019, P.1123, K.12, P.2006, P.14946, P.3027, P.14947, P.18176,

P.1961 respectively and in Figure 18B lane twelve to nineteen contain P.2885, P.1864,

P.13947, P.1967, P.1287, P.2119, P.6270, P.13731 and in figure 18C from left to right M

is the 100 bp DNA ladder (Norgen full Ranger) lane twenty to twenty two contains

P.13714, P.14313 and negative control respectively. All the amplified products are of

approximately100bps long confirming that these stains are methicillin resistant


Detection of Panton Valentine Leukocidin Gene in MRSA isolates from Pakistan

Panton Valentine Leukocidin is an additional exoprotein produced by only 2% of

Staphylococcus aureus isolates and belong to a toxin family known as synergy

hymenotropic toxins. Panton Valentine Lecucidin act on cell membrane in combination

with gamma haemolysin to produce a pore in the cell membrane, due this PVL is known

as the most leukocytic toxin in its family.

In the present study we screened all 123 MRSA Isolates from Pakistan for the presence of

PVL gene by the PCR. Only six isolates out of 123 showed positive result with PVL gene

detection PCR giving band size of approximately 420bp. In the figure 19 from left to

right M is the 100bp DNA ladder1 (Bio-line), lane number one to seven contain the F1

(positive control for PVL gene), A.10813, P.1286, P.16809, P.5114, P.13740. P.16849

and negative control respectively. The remaining 117 isolates did not showed

amplification; hence they were confirmed as PVL negative.

Chapter 3 Results

62

Figure 18 (A, B, C)

Fig. 18A Fig. 18B Fig. 18C

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing amplification of mecA gene for the identification of methicillin resistant Staphylococcus aureus. In the figure 18A from left to right M is 100bps DNA ladder (Norgen full Ranger), Lane one to eleven contains P.5053, P.1963, P.5019, P.1123, K.12, P.2006, P.14946, P.3027, P.14947, P.18176, P.1961 respectively and in Figure 18B lane twelve to eighteen contain P.2885, P.1864, P.13947, P.1967, P.1287, P.2119, P.6270 and in figure18C from left to right M is the 100 bp DNA ladder (Norgen full Ranger) lane nineteen to twenty two contains P.13731, P.13714, P.14313 and –ive control respectively.

Chapter 3 Results

63

Figure 19

Electropherogram of 1.5% ethedium bromide stained gel of Pakistani isolates showing the PVL PCR Results with Pakistani MRSA isolates. In the figure 19 from left to right M is the 100bp DNA ladders (Bioline), lane number one to seven contain the positive control for PVL gene F1, A.10813, P.1286, P.16809, P.5114, P.13740, P.16849 and negative control respectively.

Chapter 3 Results

64

Multilocus variable Number of Tandem Repeats Analysis

(MLVA) of MRSA Isolates from Pakistan

The identification of specific DNA sequences that repeat across the genome are termed as

variable number of tandem repeats (VNTR) and the analysis of VNTR at different loci is

known as Multilocus Variable Number of Tandem Repeats Analysis (MLVA). VNTR are

unique in their length and copy number. These repeats are present in a specific

organization and copy number with in the genome of an organism. Thus difference in the

number of repeats can be used to measure the degree of relatedness among the

individuals of a population. As these repeats are present universally, so these repeats can

be used to trace evolutionary changes in the genome.

In the present study seven loci, clfA (Clumping factor A), clfB (Clumping factor B), sdrC

(Ser-Asp-rich fibrinogen binding proteins), sdrD (Ser-Asp-rich fibrinogen binding

proteins), spa (staphylococcal protein A), sspa and sav1078 were selected for the purpose

of multiplex PCR in order to analyze Pakistani MRSA isolates on the basis of multilocus

variable number of tandem repeat (MLVA). The MVLA approach was adapted to the

analysis of these strains as a rapid and cost-effective method of establishing their

phylogenetic relationships. The choice of VNTR was based on established MLVA

protocols (Sabat et al., 2003; Francois et al., 2005, Gilbert et al., 2006). In the present

study we used the fluorescent labeled primers in order to perform capillary

electrophoresis assay on ABI gene sequencer as given in material and methods.

These primers were multiplexed in two separate PCR reactions. ClfA, sdrC and sav1078

primers were multiplexed together separately from ClfB, sdrD, spa, sspa in order to

prevent band overlap and to avoid the fake band formation. Before capillary

electrophoresis the amplified product were also checked on polyacrylamide gel stained

with ethedium bromide in order to check the amplification. Some of representative

figures are shown here.

Figure 20 (A, B) is showing multilocus variable number of tandem repeats (MLVA)

results of clfB, sdrD, spa and sspa with thirty Pakistani MRSA strains. In this figure,

Chapter 3 Results

65

Figure 20 (A, B)

Figure 20A

Figure 20B

Showing MLVA results of ClfB, sdrD, spa sspa with thirty Pakistani MRSA strain. In this figure 20A M is the 100bp DNA ladder, lane 1 to 19 are the strains NCTC 8325 (positive control), P.13729, P.15415, P.2255, P.12285, P. 18339, A.5054, P. 1962, P.13749, P.12007, P.1009, P.16809, P.3027, P.1961, P.1963, P.14946, P.1864, P.844, P.843. Similarly in the figure 20B, M is the 100bp DNA ladder (Norgen DNA Full Ranger), lane twenty to thirty one contain P.10013, P.1003, P.13741, P.1843, P.1896, P.8486, A.25356, A.465, P.2886, A.14075,A 13282 and P.1863 respectively. In each lane from top to bottom are the amplified product of ClfB, sdrD, spa and sspa respectively.

Chapter 3 Results

66

M is the 100bp DNA ladder, lane 1 to 19 contain the strains NCTC 8325 (positive

control), P.13729, P.15415, P.2255, P.12285, P. 18339, A.5054, P. 1962, P.13749,

P.12007, P.1009, P.16809, P.3027, P.1961, P.1963, P.14946, P.1864, P.844, P.843. In

each lane from top to bottom are the amplified product of clfB, sdrD, spa and sspa

respectively. The amplicon sizes of these isolates calculated after gene scan are given in

the table 14 (appendix-I). Similarly in the figure 20B, M is the 100bp DNA ladder

(Norgen DNA Full Ranger), lane twenty to thirty one contain P.10013, P.1003, P.13741,

P.1843, P.1896, P.8486, A.25356, A.465, P.2886, A.14075,A 13282 and P.1863. In each

lane from top to bottom are the amplified product of clfB, sdrD, spa and sspa

respectively. The amplified product sizes of these isolates calculated after gene scan are

given in the table 14 (appendix-I).

Similarly the results obtained with an other thirty seven Pakistani MRSA isolates in

second multiplex PCR for the clfA, sdrC, sav1078 are shown in the figure 21 (A, B). In

this figure 21A, M is the 100bp DNA ladder (Norgen DNA Full Ranger,) lane number

one to seventeen contain the strains NCTC8325, A.465, A.26163, A.14254, A.13282,

A.1964, A.5054, P.1962, P.1123, P.12007, K.12, P.1009, P.16809, P.18176, P.5019,

A.5053, P.14947 respectively. In each lane from top to bottom are the amplified product

of clfA, sdrC and sav1078 respectively. Their amplified product sizes calculated after

gene scan by using ABI Peak scan are given in the table 14 (appendix-1).

Figure 21B is showing MLVA results of clfA, sdrC, sav1078 multiplex PCR with

fourteen Pakistani MRSA strains. In this figure M is the 100 bp DNA ladder, lane

number 18 to 31 contain P1, P.9703, P.12006, P.1286, P.11241, 15330, P.1005, P.2054,

P3, A.9914, P.1967,P.13729, 13730, P.14946 respectively. In each lane from top to

bottom are the amplified product of clfA, sdrC and sav1078 respectively. Their amplified

product sizes calculated by gene scan are given in the table 14 (appendix-I).

Figure 20 and 21 shows that it is difficult to calculate the exact amplicon sizes on the gel

by comparing with the DNA ladder. Because some time the amplicon from two loci over

lap each other or the difference between them is very minute to identify them. Due to this

we used the fluorescently labeled primers and so the PCR products obtained after two

Chapter 3 Results

67

Figure 21 (A, B)

Figure 21A

Figure 21B

Showing MLVA results of ClfA, sdrC, sav1078 with Pakistani MRSA strain. In the figure 15A, M is the 100bp DNA ladder (Norgen DNA Full Ranger,) lane number one to seventeen contain the strains NCTC8325, A.465, A.26163, A.14254, A.13282, A.1964, A.5054, P.1962, P.1123, P.12007, K.12, P.1009, P.16809, P.18176, P.5019, A.5053, P.14947 respectively. Similarly Figure 15B is showing MLVA results of clfA, sdrC, sav1078 multiplex PCR with fourteen Pakistani MRSA strains. In this figure M is the 100 bp DNA ladder, lane number 18 to 31 contain P1, P.9703, P.12006, P.1286, P.11241, 15330, P.1005, P.2054, P3, A.9914, P.1967, P.13729, 13730, P.14946 respectively. In each lane from top to bottom are the amplified product of ClfA, sdrC and sav1078 respectively.

Chapter 3 Results

68

multiplex PCR were subjected to capillary electrophoresis by using the ABI DNA

sequencer along with fluorescently labeled LIZ 1200 ABI DNA ladder. The data obtained

from capillary electrophoresis in the form of peaks was analyzed by using ABI Peak

scanner V 1.0. and the amplicon sizes obtained for each locus for each isolate are

tabulated in the table 14 (appendix-I).

Figure 22 is showing MLVA results of ClfB, sdrD, spa, sspa with a representative

Pakistani MRSA strain P.843, In the figure orange peaks are of Liz1200 marker, while

from left to right black peak is of sspa, blue is of spa, mixed colored peak is of sdrD and

green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is

showing the size of amplicons in bp. The amplicon sizes are 935bp, 756bp, 276bp and

155bp for ClfB, sdrD, spa and sspa respectively.

Figure 23 is showing MLVA results of ClfB, sdrd, spa sspa with with a representative

Pakistani MRSA strain P.2285, In the figure orange peaks are of Liz1200 marker, while

from left to right black peak is of sspa, blue peak is of spa, mixed colored peak is of sdrD

and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is



Figure 24 is showing MLVA results of ClfB, sdrD, spa sspa with with a representative

Pakistani MRSA strain A. 9313, In the figure orange peaks are of Liz1200 marker, while

from left to right black peak is of sspa, blue is of spa, mixed colored peak is of sdrD and

green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is



Figure 25 is showing MLVA results of ClfB, sdrd, spa sspa with Pakistani with a

representative MRSA strain P.1. In the figure orange peaks are of Liz1200 marker, while

from left to right black peak is of sspa, blue peak is of spa, mixed colored peak is of sdrD

and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is



Chapter 3 Results

69

Figure 22

Showing MLVA results of ClfB, sdrD, spa and sspa with a representative Pakistani MRSA strain P.843, In the figure orange peaks are of Liz1200 marker, while from left to right black peak is of sspa, blue is of spa, mixed colored peak is of sdrD and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is showing the size of amplicons in bp.

Chapter 3 Results

70

Figure 23

Showing MLVA results of ClfB, sdrd, spa and sspa with a representative Pakistani MRSA strain P.2285. In the figure orange peaks are of Liz1200 marker, while from left to right black peak is of sspa, blue peak is of spa, mixed colored peak is of sdrD and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is showing the size of amplicons in bp.

Chapter 3 Results

71

Figure 24

Showing MLVA results of ClfB, sdrD, spa and sspa with a representative Pakistani MRSA strain A. 9313. In the figure orange peaks are of Liz1200 marker, while from left to right black peak is of sspa, blue is of spa, mixed colored peak is of sdrD and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is showing the size of amplicons in bp

Chapter 3 Results

72

Figure 25

Showing MLVA results of ClfB, sdrd, spa and sspa with a representative Pakistani MRSA strain P.1. In the figure orange peaks are of Liz1200 marker, while from left to right black peak is of sspa, blue peak is of spa, mixed colored peak is of sdrD and green peak is of ClfB. On y-axis in the figure is the height of peaks while x-axis is showing the size of amplicons in bp.

Chapter 3 Results

73

For the CLFA loci we got nine different kinds of amplicions in 123 Pakistani isolates

after gene scan analysis which was 1062bp (4 isolates), 1045bp (20 isolate), 1027bp (3

isolates), 953 bp (7 isolates), 900bp (52 isolates), 882bp (15 isolates), 864bp (1 isolate),

846bp (19 isolates) and 540bp (2 isolates). It means that with respect to ClfA loci there

are nine groups of isolates with similar amplicon sizes Table 14 (appendix-I).

In case of ClfB gene loci we got eight different kinds of amplicons with all of 123

Pakistani MRSA isolates. Thèse amplicon sizes were 1102bp (2 isolates), 992bp (2

isolates), 974bp (12 isolates), 935bp (51 isolates), 902bp (28 isolates) 884bp (16 isolates),

864bp (11 isolates) and 822bp (2 isolates). Thus on the basis of amplicon sizes of clfA

gene locus there were eight different groups of MRSA isolates present in Pakistani

MRSA isolates.

In case of sdrD gene locus six different types of amplicons were obtained with Pakistani

MRSA isolates. These amplicon sizes were 756bp (84 isolates), 741bp (6 isolates), 704bp

(29 isolates), 641bp (2 isolates), 595bp (1 isolate) and 501bp (1 isolate). In this only on

the basis of sdrD gene, we got six groups of isolates. Similarly incase of sdrC gene we

got seven different amplicon sizes. These were 658bp (1 isolate) 560bp (29 isolates),

548bp (72 isolates), 524bp (1), 506 (10), 481bp (5 isolates) and 324bp (5 isolates). Thus

with respect to amplicons sizes of sdrC locus, there were seven different groups of

isolates.

Similar results were found in case of spa locus. In case of spa gene, six different

amplicon sizes were obtained. These amplicon were of 276bp (62 isolates), 253bp (9

isolate), 229bp (10 isolates), 205bp (2 isolates), 181bp (32 isolates) and 157bp (8

isolates). Thus if the all Pakistani MRSA isolates were grouped only on the basis of

amplicon of spa locus, the six groups of isolates were present as given in table 14

(appendix-I).

In case of sspa gene locus we got only 155bp amplicon size with all the MRSA isolates

from Pakistan and same was the case sav1078 locus. We got 317bp amplicon with all 123

Pakistani MRSA isolates. Thus when we consider each locus for typing of isolates, only

limited number of groups were present.

Chapter 3 Results

74

As in MLVA typing a combination of different loci is used to group epidemiologically

similar isolates. So a combination of six isolates as used by Sabat et al., 2003, from these

six loci was used for converting the amplicon sizes into the repeat numbers in order to get

a broader view for phylogentical analysis. Sav1078 was not used in clustering as all the

isolates were similar in PCR product.

The fragment sizes obtained for each locus for all the isolates were converted into the

repeats number. For this purpose the sequence data for the standard strains NCTC8325

and MU50 and sequences of one of Pakistani MRSA isolate P.18431were imported into

the Tandem Repeats Finder, a Program in Bioinformatics written by Gary Benson,

Boston Version 4.0 (Benson G, 1999; http://tandem.bu.edu/trf.html). The software

identified the number of repeats present in the DNA sequences of the seven loci clfA,

clfB, sdrD, sdrC, spa, sspa and sav1078. The size of the flanking regions was assessed by

substracting the repeat containing region from the total size of the amplicon. In this way

we got the length of flaking region, length of VNTR region, and size of repeat unit from

the Tandem repeat finder version 4.0. Then this approach was used to calculate the

number of repeats present in the PCR products obtained from other MRSA isolates. Total

number of repeats was calculated by using the formula:- size of the PCR product minus

size of the flanking region divided by the size of the repeat unit. In this way we got the

number of VNTR for all the loci which are given in the table 15 (appendix-I).

Table 15 (appendix-1) is showing the IDs of isolates, then the amplicon sizes obtained by

gene scan, length of VNTR region present in these amplicons and total number of repeats

as calculated by using the formula mentioned in material and methods. In this way the

number of repeats obtained for six loci was used to generate allelic profile.

In order to draw the minimum spanning tree (Phylogenetic tree), the repeats obtained

with six loci for each isolate were feed into the Bionumeric program. The order of allelic

profile fed into the Bionumeric was clfA-clfB-sdrD-sdrc-spa-sspa. Minimum spanning

tree of 123 Pakistani MRSA isolates derived from VNTRs of clfA, clfB, sdrD, sdrC, spa

and sspa loci using Bionumerics software is shown as figure 26. In the phylogenetic tree

circle sizes are proportional to number of genotypes present in each node while the color

Chapter 3 Results

75

Blood

Catheter tip

Ear infection

Pus

Spinal

SputumStandard Strain

Tissue

Urine

Figure 26

Minimum spanning tree of 123 Pakistani MRSA isolates derived from VNTRs for clfA, clfB, sdrD, sdrC, spa and sspa loci using Bionumerics software. Circle sizes are proportional to number of MTs/haplotype/genotype in each node while the colour represents the sources of each isolate. The isolates varying by repeat at a single locus are connected with bold lines while isolates varying at two or more loci are shown connected with thin lines. Positive control strains are shown connected with dotted lines. The number on the nodes represents the type of MTs/genotype.

121212121212121212

181818181818181818

131313131313131313

151515151515151515

111111111111111111

111111111

666666666272727272727272727

141414141414141414

282828282828282828

292929292929292929

343434343434343434

212121212121212121

252525252525252525

232323232323232323

242424242424242424

191919191919191919

202020202020202020

171717171717171717

555555555

333333333

888888888

303030303030303030

222222222222222222

161616161616161616

222222222777777777

444444444999999999

353535353535353535333333333333333333

414141414141414141

444444444444444444

515151515151515151

262626262626262626

525252525252525252

555555555555555555

505050505050505050

313131313131313131

535353535353535353

474747474747474747

101010101010101010

464646464646464646

545454545454545454

484848484848484848

565656565656565656

494949494949494949

393939393939393939

424242424242424242

404040404040404040

454545454545454545

363636363636363636

383838383838383838

323232323232323232

616161616161616161

575757575757575757

595959595959595959 606060606060606060

585858585858585858

373737373737373737

434343434343434343

656565656565656565

626262626262626262

636363636363636363

646464646464646464

Chapter 3 Results

76

represents the sources isolation of each isolate. Such as yellow color represents the isolates taken

from pus and red color represents the isolates taken from catheter tip. The isolates varying by

repeat at a single locus are connected with bold lines while isolates varying at two or more loci

are shown connected with thin lines. Positive control strains are shown connected with dotted

lines. The number on the nodes represents the total number of genotypes. All the 123 MRSA

isolates clustered into the 63 MLVA type or genotypes with out applying the cut off i.e.

similarity between repeats at six loci was considered 100%. In figure 26, it is clear that these

isolates are closely linked with each other as majority of the MLVA type are connected with bold

lines and it is also clear in the figure that most of the genotypes are originating from genotype

twelve.

The allelic profile was also used to draw the dendrogram. The dendrogram obtained from the

MLVA types (genotypes) of the 123 Pakistani MRSA isolates and two standard strains is shown

in figure 27. The dendrogram construction method was UPGMA with a cluster cut-off of 80%

and a categorical distance coefficient. Strain names, source of isolate and time of isolation are

also indicated in the figure. All the 123 Pakistani MRSA were clustered into 63 genotypes at

100% similarity (with out cut off) as shown in the dendrogram. Following genotypes were

obtained after clustering. Genotype one contain three isolates P.2113, P.10021and P.13714,

Genotype 2 contains one isolate P.10019 , Genotype 3 contain one isolate P.2111, Genotype 4

contains one isolate P.6270, Genotype 5 contain two isolates P.2119 & P13749, Genotype 6

contain two isolates P.1003& P10013, Genotype 7 has one isolate P.5123, Genotype 8 has one

isolate P.10012, Genotype 9 has one isolate P.11291, Genotype 10 has one isolate P.12007,

Genotype 11 has two isolates K13, 13729 and Genotype 11 has isolates, Genotype 12 has three

isolates P.2112, P.1966 and P.13319, Genotype 13 has ten isolates P.843, P.844, P.1843, P.5020,

P.8485, P.8486, P.8487, P.11296, P.18431 and P.14254. Genotype 14 has three isolates P.6269,

P.3027 and P.17120, Genotype 15 has one isolates A.14075, Genotype 16 has one isolate

P.18119, Genotype 17 has five isolates A.9077, A.9445, A.9781, A.14256, A.25356 isolates.

Genotype 18 has three isolate K.8, A.9914 and A.15330. Genotype 19 has one isolates A.35087,

Genotype 20 has isolates P.8823, Genotype 21 has one isolates A.9954, Genotype 22 has one

isolate P.17121, Genotype 23 has one isolates P.13947, Genotype 24 has isolate P.1967,

Genotype 25 has 6 isolates P.6, P.862, P.1863, P.1864, P.1963 and 1964, Genotype 26 has one

isolates P.1961, Genotype 27 has 2 isolates P.14947 & A.7145, Genotype 28 has 2 isolates

Chapter 3 Results

77

P.2006 & P.2887, Genotype 29 has three isolates P.1962 K.10 and P.3727, Genotype 30 has

three isolates P.2885, P.2896 and P.8431, Genotype 31 has one isolate P.8, Genotype 32 has two

isolates A.9313 & A.10813, Genotype 33 has one isolates P.15415, Genotype 34 has one isolates

P.7, Genotype 35 has isolates one isolates P.10015, Genotype 36 has one isolates P.5019,

Genotype 37 has one isolates P.2255, Genotype 38 has one isolates , Genotype 39 has six

isolates P.14946, A.5053,A.5054,A.9703, A.11241 and A.13730, Genotype 40 has one isolate

isolates P.2054, Genotype 41 has one isolates P.3, Genotype 42 has one isolates P.18176,

Genotype 43 has one isolates K.12, Genotype 44 has one isolate P.1286 , Genotype 45 has one

isolates P.16809, Genotype 46 has three isolates P.11293, P.13740,P.13741, Genotype 47 has

eleven P.1129, P.1005, P.1009, P.5119, P.12285, P.2285, A.465,P.16509, P.16849, P.18339 and

A.35045 isolates, Genotype 48 has one isolates P.5114, Genotype 49 has one isolates P.1297

Genotype 50 has one isolates P.5, Genotype 51 has one isolate K.6, Genotype 52 has two K.11 &

P.13731 isolate, Genotype 53 has two isolate P.4 & P.1287, Genotype 54 has two isolate P.8668

& K.3, Genotype 55 has two isolates P.2886& P..8116, Genotype 56 has one isolate P.1896,

Genotype 57 has one isolate P.1761, Genotype 58 has one isolate P.1123, Genotype 59 has four

isolate P.1, P.12006, A.9965 and A.26163, Genotype 60 has one isolate P.2871, genotype 61 has

one isolate A.379, Genotype 62 has one isolate P.14313 and Genotype 63 has one isolate

A.13282. Thus there were 63 genotypes present in Pakistani MRSA isolates when we assigned a

different genotype or MLVA type to them if they vary by repeat at one locus from each other.

But when 80% cut off was applied, 63 genotypes clustered into 18 groups as shown in the figure-

27. For example from figure 27 at 80% cut off, the Genotype 1,2, 3 and 4 cluster together to

form a group1. Similarly Genotype 5, 6, 7, 8 clustered together to make another group 2,

Genotype 9,10 clustered together to make group 3, Genotype 11, 12 , 13, 14, 15 clustered into

group 4, Genotype 17, 18, 19, 20 clustered into group 5 , Genotype 21, 22 clustered into group 6

, Genotype 23, 24, 25, 26 cluttered into group 7 genotype , Genotype 27, 28, 29 clustered into

group 8 , Genotype 30, 31 cluster into groups 9, Genotype 33,34 clustered into groups 10,

Genotype 39, 40, 41 clustered into group 11, Genotype 44, 45 clustered into group12, Genotype

46, 47 clustered into group 13, Genotype 50 ,51 clustered into group 14, Genotype 52, 53

clustered into group 15, Genotype 54, 55 clustered into group 16, genotype 59,60 clustered into

group 17 and genotype 62, 63 clustered into group 18 while the Genotype 16, 32, 35,36,37,38,

42,43,48,49, 56, 57,58,61 did not cluster into any group after 80% cut off.

Chapter 3 Results

78

Genotype 13 and Genotype 47 are large clusters of 10 and 11 identical isolates with all these

isolates being derived from pus and from Pakistan Institute of Medical Science Hospital. This

clustering of large number of isolates is suggestive of a common source of infection. Along with

two large clusters of isolates, smaller clusters of isolates with a common source were also

detected. Thus, Genotype 17 consisted of five blood isolates, Genotype 25 of six urine isolates

and Genotype 30 of three spinal cord isolates. These isolates are indicative of clusters of MRSA

infection cases. Thus MLVA typing clustered the isolates with similar genetic make up and

similar kind of infections into same genotype as shown in figure 27.

Chapter 3 Results

79

Figure 27

Dendrogram base on clustering with respect to MLVA types of Pakistani MRSA Isolates with similarity calculated by Dice coefficient and represented by UPGMA. 63 haplotypes are shown at 100% similarity, which clustered into 18 groups when 80%cut off technique was used.

MLVA

100

80

60

40

20

MLVA

ClfA

ClfB

sdrD

sdrC

spa

sspa

37 41 30 24 9 4

37 41 30 24 9 4

37 41 30 24 9 4

40 41 30 24 9 4

36 41 30 24 9 4

35 41 30 24 9 4

36 41 30 24 8 4

36 41 30 24 8 4

37 41 30 24 8 4

37 41 30 24 8 4

40 41 30 24 8 4

34 41 30 24 8 4

37 41 30 25 9 4

37 41 30 25 6 4

40 41 30 24 10 4

40 41 30 24 10 4

37 41 30 24 10 4

37 41 30 24 10 4

37 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

34 41 30 24 10 4

46 41 30 24 10 4

46 41 30 24 10 4

46 41 30 24 10 4

36 41 30 24 10 4

34 41 30 25 10 4

45 41 30 12 10 4

45 41 30 12 10 4

45 41 30 12 10 4

45 41 30 12 10 4

45 41 30 12 10 4

45 41 30 24 10 4

45 41 30 24 10 4

45 41 30 24 10 4

45 41 30 23 10 4

45 41 30 30 10 4

37 41 30 20 10 4

36 41 30 20 10 4

45 43 30 24 10 4

45 39 30 24 10 4

45 37 30 24 10 4

45 37 30 24 10 4

45 37 30 24 10 4

45 37 30 24 10 4

45 37 30 24 10 4

45 37 30 24 10 4

35 37 30 24 10 4

37 43 30 24 10 4

37 43 30 24 10 4

37 38 30 24 10 4

37 38 30 24 10 4

37 37 30 24 10 4

37 37 30 24 10 4

37 37 30 24 10 4

n°

42

43

44

72

67

70

52

53

48

49

69

73

68

74

56

57

39

40

41

20

21

22

23

24

25

26

27

28

29

10

11

12

66

71

113

114

115

116

117

7

8

9

13

14

63

64

15

16

1

2

3

4

5

6

75

54

55

50

51

36

37

38

Strains

P.2113

P.10021

P.13714

P.10019

P.2111

P.6270

P.2119

P.13749

P.1003

P.10013

P.5123

P.10012

P.11291

P.12007

K.13

P.13729

P.2112

P.1966

A.13319

P.843

P.844

P.1843

P.5020

P.8485

P.8486

P.8487

P.11296

P.18431

A.14254

P.6269

P.3027

P.17120

A.14075

P.18119

A.9077

A.9445

A.9781

A14256

A.25356

K.8

A.9914

A.15330

A.35087

P.8823

A.9954

P.17121

P.13947

P. 1967

P.6

P.862

P.1863

P.1864

P.1963

P.1964

P.1961

P.14947

A.7145

P.2006

P.2887

P.1962

P.3727

K10

Source

Sputum

Sputum

Pus

Pus

Catheter tip

Catheter tip

Pus

Pus

Tissue fluid

Tissue fluid

Catheter tip

Sputum

Pus

Sputum

Catheter tip

Catheter tip

Sputum

Sputum

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Catheter tip

Catheter tip

Catheter tip

Catheter tip

Catheter tip

Blood

Blood

Blood

Blood

Blood

Catheter tip

Pus

Catheter tip

Pus

Pus

Catheter tip

Catheter tip

Catheter tip

Catheter tip

Urine

Urine

Urine

Urine

Urine

urine

Sputum

Pus

Pus

Tissue fluid

Tissue fluid

Sputum

Sputum

Sputum

Period

Aug,2006

July,2007

Aug,2007

July,2007

Aug,2006

Dec,2006

Aug,2006

Aug,2007

May,2006

July,2007

Oct,2006

July,2007

July,2007

July,2007

Aug,2007

Aug,2007

Aug,2006

July,2006

Jan,2008

May,2006

May,2006

June,2006

Oct,2006

April,2007

April,2007

April,2007

July,2007

Sept,2007

Jan,2008

Dec,2006

Aug,2007

Sept,2007

Jan,2008

Sept,2007

Nov,2007

Nov,2007

Dec,2007

Jan,2008

févr-08

July,2007

Dec,2007

Feb,2008

Feb,2008

May,2007

Dec.2007

Sept,2007

Aug,2007

July,2006

April,2006

May,2006

June,2006

June,2006

June,2006

July,2006

July,2006

Aug,2007

Oct,2007

Aug,2006

Aug,2006

July,2006

Aug,2006

Aug,2007

genotype

1

1

1

2

3

4

5

5

6

6

7

8

9

10

11

11

12

12

12

13

13

13

13

13

13

13

13

13

13

14

14

14

15

16

17

17

17

17

17

18

18

18

19

20

21

22

23

24

25

25

25

25

25

25

26

27

27

28

28

29

29

29

isolates

Arafat042

Arafat043

Arafat044

Arafat072

Arafat067

Arafat070

Arafat052

Arafat053

Arafat048

Arafat049

Arafat069

Arafat073

Arafat068

Arafat074

Arafat056

Arafat057

Arafat039

Arafat040

Arafat041

Arafat020

Arafat021

Arafat022

Arafat023

Arafat024

Arafat025

Arafat026

Arafat027

Arafat028

Arafat029

Arafat010

Arafat011

Arafat012

Arafat066

Arafat071

Arafat113

Arafat114

Arafat115

Arafat116

Arafat117

Arafat007

Arafat008

Arafat009

Arafat013

Arafat014

Arafat063

Arafat064

Arafat015

Arafat016

Arafat001

Arafat002

Arafat003

Arafat004

Arafat005

Arafat006

Arafat075

Arafat054

Arafat055

Arafat050

Arafat051

Arafat036

Arafat037

Arafat038

Chapter 3 Results

80

Figure 27 (Continue)

37 37 30 24 10 4

37 37 30 24 10 4

37 37 30 24 10 4

34 38 30 24 10 4

34 38 30 24 10 4

34 38 30 24 10 4

34 38 30 24 6 4

17 44 30 24 8 4

17 44 30 24 8 4

37 43 27 24 10 4

37 41 27 24 10 4

37 41 27 24 8 4

45 38 27 24 10 4

40 39 27 24 5 4

34 41 27 24 5 4

36 43 30 22 10 4

36 43 30 22 10 4

36 43 30 22 10 4

36 43 30 22 10 4

36 43 30 22 10 4

36 43 30 22 10 4

36 43 30 22 8 4

37 43 30 22 10 4

36 39 30 22 10 4

36 35 30 22 5 4

40 41 24 24 9 4

40 41 24 25 9 4

37 39 29 25 6 4

37 39 29 25 6 4

37 39 29 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

37 39 27 25 6 4

46 39 27 25 6 4

36 39 29 25 6 4

37 38 30 25 6 4

37 38 30 24 6 4

37 39 30 24 6 4

37 39 30 24 6 4

37 39 30 25 6 4

37 39 30 25 6 4

37 39 27 24 6 4

37 39 27 24 6 4

37 38 27 24 6 4

37 38 27 24 6 4

34 38 27 24 6 4

37 39 21 21 6 4

45 39 29 24 6 4

37 38 27 25 5 4

37 38 27 25 5 4

37 38 27 25 5 4

37 38 27 25 5 4

34 38 27 25 5 4

37 29 30 20 6 4

44 50 27 20 7 4

44 50 16 20 7 4

44 35 25 36 11 4

45 35 31 29 10 5

36

37

38

45

46

47

105

120

121

58

60

62

17

108

111

30

31

32

33

34

35

59

61

65

109

122

123

91

92

93

76

77

78

79

80

81

82

83

84

85

86

19

102

103

104

96

97

94

95

100

101

98

99

107

110

18

87

88

89

90

106

112

118

119

124

125

P.1962

P.3727

K10

P.2885

P.2896

P.8431

P.8

A.9313

A.10813

P.15415

P.7

P.10015

P. 5019

P.2255

P.2

P.14946

A.5053

A.5054

A.9703

A.11241

A.13730

P.2054

P.3

P.18176

K.12

P.1286

P.16809

P.11293

P.13740

P.13741

P.1129

P.1005

P.1009

P.5119

P.12285

P.2285

A.465

P.16509

P. 16849

P.18339

A.35045

P. 5114

P.1297

P.5

K.6

K.11

P.13731

P.4

P.1287

P.8668

K.3

P.2886

P.8116

P.1896

A.1761

P. 1123

P.1

P.12006

A.9965

A.26163

P.2871

A.379

P.14313

A.13282

NCTC 8325

Mu 50

Sputum

Sputum

Sputum

Spinal Card

Spinal Card

Spinal Card

Ear Infection

Pus

Sputum

Catheter tip

Pus

Sputum

Catheter tip

Pus

Pus

Sputum

Catheter tip

Catheter tip

Catheter tip

Pus

Pus

Catheter tip

Pus

Catheter tip

Pus

Sputum

Sputum

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Pus

Catheter tip

Ear Infection

Sputum

Sputum

Pus

Pus

Pus

Pus

Ear infection

Ear infection

Catheter tip

Catheter tip

Ear infection

Ear infection

Catheter tip

Pus

Pus

Pus

Pus

Sputum

Ear infection

Pus

Pus

Standard Strain

Standard Strain

July,2006

Aug,2006

Aug,2007

Aug,2006

Aug,2006

April,2007

April,2006

Nov,2007

Jan,2008

Aug,2007

April,2006

July,2007

Oct,2006

Aug,2006

April,2006

Aug,2007

Sept,2007

Sept,2007

Dec,2007

Jan,2008

Jan,2008

Aug,2006

April,2006

Sept,2007

Aug,2007

May,2006

Sept,2007

July,2007

Aug,2007

Aug,2007

May,2006

May,2006

May,2006

Oct,2006

July,2007

Aug,2006

Aug,2007

Sept,2007

Sept,2007

Sept,2007

Feb,2008

Oct,2006

May,2006

April,2006

July,2007

Aug,2007

Aug,2007

April,2006

May,2006

May,2007

July,2007

Aug,2006

Dec,2006

June,2006

Sept,2007

May,2006

April,2006

July,2007

Dec,2007

Feb,2008

Aug,2006

Aug,2007

Aug,2007

Jan,2008

29

29

29

30

30

30

31

32

32

33

34

35

36

37

38

39

39

39

39

39

39

40

41

42

43

44

45

46

46

46

47

47

47

47

47

47

47

47

47

47

47

48

49

50

51

52

52

53

53

54

54

55

55

56

57

58

59

59

59

59

60

61

62

63

64

65

Arafat036

Arafat037

Arafat038

Arafat045

Arafat046

Arafat047

Arafat105

Arafat120

Arafat121

Arafat058

Arafat060

Arafat062

Arafat017

Arafat108

Arafat111

Arafat030

Arafat031

Arafat032

Arafat033

Arafat034

Arafat035

Arafat059

Arafat061

Arafat065

Arafat109

Arafat122

Arafat123

Arafat091

Arafat092

Arafat093

Arafat076

Arafat077

Arafat078

Arafat079

Arafat080

Arafat081

Arafat082

Arafat083

Arafat084

Arafat085

Arafat086

Arafat019

Arafat102

Arafat103

Arafat104

Arafat096

Arafat097

Arafat094

Arafat095

Arafat100

Arafat101

Arafat098

Arafat099

Arafat107

Arafat110

Arafat018

Arafat087

Arafat088

Arafat089

Arafat090

Arafat106

Arafat112

Arafat118

Arafat119

Arafat124

Arafat125

Chapter 3 Results

81

Lineage Determination by Using RM Test Most Staphylococcus aureus strains belong to one of ten dominant clonal complexes

(CC) Lineages. Each clonal complex has specific external surface proteins and structures

that are responsible for interaction with the host. The restriction modification (RM) test is

a simple and reliable method for typing HA-MRSA. Restriction modification test

identifies six clonal complexes CC1, CC5, CC8, CC22, CC30 and CC45. Thus it

provides the single most important piece of information about the lineage/CC that

correlates with variation in hundreds of genes. The RM test is based on primers that target

the hsd S gene of sau1 type 1 restriction modification system. Three separate PCR

reactions with one forward and two reverse primers are used in RM test which may result

a large amplicon, a small amplicon or no amplification at all. These three PCR assays are

termed as RM1, RM2 and RM3.

Pakistani MRSA isolates (n=123) were typed with restriction modification tests. It was

observed that 121 isolates out of 123 isolates showed the amplification only with RM3

and no amplification with RM2 and RM1 test. Only two isolated showed amplification in

RM-1 test. The results are presented in figure 28 through figure 33.

This figure 28 (A, B, C) shows the amplicons obtained from three RM test with Pakistani

Staphylococcus aureus isolates. The figure 28A is showing RM1, from left to right M is

100 bp DNA ladder (Norgen Full Ranger); lanes 1 to 9 contain MRSA252 [Positive

control for RM1], NCTC8325, P.18431, A.14256, K.3, P.2113, P.2112, A.26163 and a

negative control, respectively. The figure 28B is showing RM2; lanes 1 to 9 contain

CDC-8 [Positive control for RM2], NCTC8325, P.18431, A.14256, K.3, P.2113, P.2112,

A.26163 and a negative control. Similarly figure 28c is showing RM3 results, from left to

right, lanes 1 to 9 contain NCTC8325, Mu50 [Positive controls for RM3], P.18431,

A.14256, K.3, P.2113, P.2112, A.26163 and a negative control respectively. All the

Pakistani MRSA isolates showing positive results with in an RM3 test giving a PCR

product size of 680 bp, indicative of CC8, while Mu50 has a 1071 bp amplicon size

indicative of CC5.

Chapter 3 Results

82

Figure 28 (A, B, C)


RM tests with Pakistani Staphylococcus aureus (MRSA) isolates. This figure shows the amplicons obtained from three RM test with Pakistani Staphylococcus aureus isolates:- RM1 (Fig. A); RM2 (Fig. B); and RM3 (Fig. C). Fig. A:- M, 100 bp DNA ladder (Norgen Full Ranger); lanes 1 to 9 contain MRSA252 [Positive control for RM1], NCTC8325, P.18431, A.14256, K.3, P.2113, P.2112, A.26163 and a negative control, respectively. Fig. B:- lanes 1 to 9 contain CDC-8 [Positive control for RM2], NCTC8325, P.18431, A.14256, K.3, P.2113, P.2112, A.26163 and a negative control. Panel C:- lanes 1 to 9 contain NCTC8325, Mu50 [Positive controls for RM3], P.18431, A.14256, K.3, P.2113, P.2112, A.26163 and a negative control. All the Pakistani MRSA isolates showing positive results with in an RM3 test giving a PCR product size of 680 bp, indicative of CC8, while Mu50 has a 1071 bp amplicon size indicative of CC5.

Chapter 3 Results

83

Similar kinds of results were obtained for all the other 115 MRSA isolates from Pakistan.

Two isolates out of 123 Pakistani isolates showed amplification in RM1 test, so only the

gel pictures showing the RM3 test are included in the results.

Thus Restriction modification three (RM3) results with results with fifty of the Pakistani

Staphylococcus aureus strains are shown in figure number 29 (A, B, C). In Figure 28A

from left to right, M is 100bp DNA ladder (Norgen Full Ranger), Lane one to twenty one

is showing the RM3 results with standard strain 8325-4, Mu50 and Pakistani strains

P.10019, P.2054, P.5123, P.13729, P.2896, P.2886, P.1896, P.5, P.10015, P.12006, P.

8431, P.10012, P10021, P. 18119, P.1966, P.1, K.6, P.8, P.8487, -ive control

respectively. In the figure 29B from left to right M is the 100 DNA ladder (Norgen Full

Ranger), Lane twenty two to forty two contains P.17120, P.6269, P.11293, P.17121,

P.13749, A.9965, P.8668, P.1297, P.16509, P.16849, P.12285, P.1129, P.15415, P.18339,

P.8116, P.2285, P.1964, P.5119, P.11291, A.1761, A.35087 respectively and in the figure

29C, from left to right M is the 100 bp DNA ladder A.9313, A.9914, A.9077, A.9954,

A.14075, A.11241, A.25356 A.10813, A.9445, A.35045 and negative control

respectively. All the fifty isolates from Pakistan showed amplification only with in RM3

thus confirming as CC8

Similarly the amplified product of 19 Pakistani Staphylococcus aureus isolates with RM3

test are shown in Figure. 30A. In the figure from left to right M is the 100bps DNA

ladder, lane number one to eleven contains NCTC8325, Mu50( positive control for

RM3), A.9703, A.13319, A.7145, P.3, P.4, P.7, K.8, P.8485, P.2 respectively and In the

figure 30B from left to right M is 100bps DNA ladder (Norgen Full Ranger), lane number

twelve to twenty two P.2871, P.5020, P.5114, P.1005, P.844, P.843, P.1843, A.8823

A.9781, A465, , and negative -ive control respectively.

Figure 31 (A, B, C) is showing the amplified product of RM3 with thirty three Pakistani

Staphylococcus aureus strains. In the figure 31A from left to right M is the 100bp DNA

ladder (Norgen full Ranger), Lane one to eighteen contains NCTC8325, Mu50, A.14254,

A.15330, P.11296, P.862, A.379, P.1286, A.13282, P.10013, P.16809, P.1003, P.1863,

P.3727, P.2887, P.6, P.8486, P.13741,. In the figure 31B from left to right M is the 100bp

Chapter 3 Results

84

DNA ladder (Norgen full Ranger), Lane 19 to 29 contains P.13740, K.10, K.13, A.5054,

A.13730, P.1962, P.2111, P.2255, K.11, P.12007, P.1009, respectively and In the figure

31C from left to right M is the 100bp DNA ladder, lane thirty to thirty six contain,

A.5053, P.3027, P.14947, P.18176, P.1961, P.1963, and negative control respectively.

All the strains showed amplification for RM3 except two strains, P.1286 and P.16809.

These two strains showed positive results with RM1 and negative with RM2 and RM3

(figure 32), confirming CC30.

Figure No.33A is showing the results of RM3 with Pakistani Staphylococcus aureus

strains. In the figure from left to right M is the 100bp DNA ladder (Norgen full Ranger),

lane one to ten contains NCTC 8325, Mu50, P.5019 P.1123, K.12, P.2006, P.14946,

P.2885, P.1864, P.13947 and in Figure No.19b, from left to right P.1967, P.1287,

P.13714, P.14313, P.2119, P.6270, P.13731 and negative control and negative control.

Chapter 3 Results

85

Figure 29 (A, B, C)

Fig. 29A Fig. 29B

Fig. 29C

RM3 test Results with Pakistani Staphylococcus aureus MRSA isolates. In the figure 29A, M is 100bp DNA ladder (Norgen Full Ranger), Lane one to twenty one is showing the RM3 results with standard strain 8325-4, Mu50 and Pakistani strains P.10019, P.2054, P.5123, P.13729, P.2896, P.2886, P.1896, P.5, P.10015, P.12006, P. 8431, P.10012, P10021, P. 18119, P.1966, P.1, K.6, P.8, P.8487, -ive control respectively. In the figure 29B from left to right M is the 100 DNA ladder (Norgen Full Ranger), Lane twenty two to forty two contains P.17120, P.6269, P.11293, P.17121, P.13749, A.9965, P.8668, P.1297, P.16509, P.16849, P.12285, P.1129, P.15415, P.18339, P.8116, P.2285, P.1964, P.5119, P.11291, A.1761, A.35087 respectively and in the figure 29C, from left to right M is the 100 bp DNA ladder , lane forty three to fifty three contain A.9313, A.9914, A.9077, A.9954, A.14075, A.11241, A.25356 A.10813, A.9445, A.35045 and negative control respectively. All fifty Pakistani MRSA isolates showing positive results with in an RM3 test giving a PCR product size of 680 bp, indicative of CC8, while Mu50 has a 1071 bp amplicon size indicative of CC5.

Chapter 3 Results

86

Figure 30 (A, B)

Fig. 30A Fig. 30B

RM3 test Results with Pakistani Staphylococcus aureus (MRSA) isolates. This figure shows the amplicons obtained from RM3 test with Pakistani Staphylococcus aureus isolates. In the figure 30A from left to right M is the 100bps DNA ladder, lane number one to eleven contains NCTC8325, Mu50( positive control for RM3), A.9703, A.13319, A.7145, P.3, P.4, P.7, K.8, P.8485, P.2 respectively and In the figure 30B from left to right M is 100bps DNA ladder (Norgen Full Ranger), lane number twelve to twenty two P.2871, P.5020, P.5114, P.1005, P.844, P.843, P.1843, A.8823 A.9781, A465, and negative -ive control respectively. All the Pakistani MRSA isolates showing positive results within an RM3 test giving a PCR product size of 680 bp, indicative of CC8, while Mu50 has a 1071 bp amplicon size indicative of CC5.

Chapter 3 Results

87

Figure 31(A, B, C)

Fig. 31A Fig. 31B

Fig. 31C

RM3 test Results with Pakistani Staphylococcus aureus (MRSA) isolates. In the figure 31A from left to right M is the 100bp DNA ladder (Norgen full Ranger), Lane one to eighteen contains NCTC8325, Mu50 (positive control), A.14254, A.15330, P.11296, P.862, A.379, P.1286, A.13282, P.10013, P.16809, P.1003, P.1863, P.3727, P.2887, P.6, P.8486, P.13741,. In the figure 31B from left to right M is the 100bp DNA ladder (Norgen full Ranger), Lane 19 to 29 contains P.13740, K.10, K.13, A.5054, A.13730, P.1962, P.2111, P.2255, K.11, P.12007, P.1009, respectively and In the figure 31C from left to right M is the 100bp DNA ladder, lane thirty to thirty six contain, A.5053, P.3027, P.14947, P.18176, P.1961, P.1963, and negative control respectively. All the Pakistani MRSA isolates showing positive results with in an RM3 test giving a PCR product size of 680 bp, except P.1286 & P.16809 in lane number 8 &11 respectively, are indicative of CC8, while Mu50 has a 1071 bp amplicon size indicative of CC5.

Chapter 3 Results

88

Figure 32 (A, B, C)


RM tests with Pakistani MRSA P.1286 and P.16809. This figure shows the amplicons obtained from three RM test with Pakistani Staphylococcus aureus isolates P.1286 and P.16809:- RM1 (Fig. 32A); RM2 (Fig. 32B); and RM3 (Fig. 32C). Fig. 19A:- M, 100 bp DNA ladder (Norgen Full Ranger); lanes 1 to 5 contain NCTC8325, MRSA252 [Positive control for RM1], P.1286, P.16809 and a negative control, respectively. Fig. 19B:- lanes 1 to 5 contain CDC-8 [Positive control for RM2], NCTC8325, P.1286, P.16809 and a negative control. Panel C:- lanes 1 to 5 contain NCTC8325, [Positive controls for RM3], P.18431, MRSA252,P.1286, P.16809 and a negative control. P.1286 and P.16809 showed amplification only in RM1, thus belong to CC30.

Chapter 3 Results

89

Figure 33 (A, B)

Fig. 33A Fig. 33B

M 11 12 13 14 15 16 17 18

RM3 test Results with Pakistani Staphylococcus aureus MRSA isolates. This figure shows the amplicons obtained from RM3 test with Pakistani Staphylococcus aureus isolates. In the figure 33A from left to right M is the 100bps DNA ladder, lane number one to ten contains NCTC 8325, Mu50, P.5019 P.1123, K.12, P.2006, P.14946, P.2885, P.1864, P.13947 and in figure 33B, from left to right P.1967, P.1287, P.13714, P.14313, P.2119, P.6270, P.13731 and negative control and negative control. All the Pakistani MRSA isolates showing positive results within an RM3 test giving a PCR product size of 680 bp, indicative of CC8, while Mu50 has a 1071 bp amplicon size indicative of CC5.

Chapter 3 Results

90

Spa Sequence Typing of Pakistani MRSA Isolates

Spa typing is a single locus sequencing typing technique in which variation in the tandem

repeats of protein A, encoded by the spa gene, and is used to type S. aureus isolates.

These repeats vary both in number and sequence. The spa gene harbors a number of

functionally distinct regions which includes Fc-binding region of immunoglobulin G

(IgG), X-region and C-terminus. The X-region contains a varying number of 24 bp

repeats and this polymorphic X region is used in epidemiological typing of MRSA

isolates. The X-region usually cotains 3 to 15 repeat units. Data from spa typing can be

compared globally through the Ridom Staph Type software and website (Harmsen et al.,

2003). Spa typing is portable and relatively easy and rapid to perform.

In order to understand the phylogenetic relatedness of Pakistani MRSA isolates and to

compare them globally spa sequence typing was performed on selected number of

Pakistani MRSA isolates. Twenty six MRSA isolates were selected for Spa typing after

the multilocus variable number of tandem repeat analysis which clustered 123 Pakistani

MRSA into 63 genotypes. The results obtained with 26 Pakistani MRSA isolates are

given in the table 16 (appendix-I).

Table 16 (appendix-I) is showing the strain IDS, repeat sequences, repeat IDs, Kreiswirth

IDs and spa types for 26 MRSA isolates. The 26 MRSA isolates which were spa

sequenced includes P.2113, P.18431, P.8486, P.5020, P.844, A.14254, P.17120, A.9445,

A.14256, A.15330, A.9914, K.8, P.1863, A.9313, A.10813, A.13282, P.14947, A.5053,

P.1286, P.8, P.13740, P.2285, P.1287, A.26163, P.12006 and P-1. The sequence data

obtained after sequencing on ABI sequencer was used to find the consensus sequences

using CLC DNA work bench V.5.3 and fed into ridom spa server to obtain the repeat

IDs. The repeat IDs were then used in the spa server to query the spa type. The spa types

obtained after querying are given against each of the 26 isolates. Out of the 26 MRSA

isolates twelve isolates P.18431, P.8486, P.5020, P.844, A.14254, P.17120, A.9445,

A.14256, A.15330, A.9914, K.8, P.1863 have the same spa type t064, four isolates P.8,

P.13740, P.2285, P.1287 have spa type t030, three isolates A.26163, P.12006 and P.1

belong to spa type t632, while two isolates A.10813, A.13282 belong to t275 and another

two P.14947, A.5053 belong to t987, one P.2113 belongs to t037, and another one P.1286

Chapter 3 Results

91

belongs to t021. The sequences of repeat of units obtained for each strain and total

number of repeats for each strains are also given in the table 16 (appendix-I).

Spa typing was performed on 26 isolates which also included multiple isolates from the

same MT (genotype). Five isolates P.18431, P.8486, P.5020, P.844, A.14254 were from

MT13, three isolates A.26163, P.12006, P.1 from MT59, three isolates A.15330, A.9914,

K.8 from MT18, two MTs A.9445, A.14256 from MT17 and another two A.9313,

A.10813 from MT32 and other from different MTs as shown in table 6. All isolates from

the same MT had identical spa types indicating that MLVA was grouping highly-related

strains. The separation of isolates having the same spa type into different MTs indicates

the presence of genetic diversity within a spa type as shown in table 6. There is a wide

distribution of spa types within the Pakistani hospitals. Thus, among the 16 isolates from

Hospital P, there were six spa types:- t064 (6 isolates), t030 (4 isolates), t632 (2 isolates),

t987 (2 isolates), t451 (1 isolate) and t021 (1 isolate). In Hospital A, we found four spa

types:- t064 (1 isolate), t275 (2 isolates), t632 (2 isolates) and t037 (1 isolate) and one spa

t064 (1 isolate) type from hospital K. Spa repeat IDs shows (Table 6) that these isolates

are closely related to each other. For example P.2113 belongs to t451 and P.18431 belong

to t064 both of these isolates are similar in spa sequence except that P.2113 has lost one

repeat unit r19 at position two. Similarly the isolates belonging spa t037 and t275 are

identical in spa sequence except that t037 has lost one repeat unit r24 at the end.

Similarly the isolates belonging to t987 and t021 have identical spa sequence except that

t021 has lost one repeat unit r24 at 5th position.

Figure No 34 is showing spa X-region sequences of a representative MRSA isolate

A.14256. The sequences at the top is a consensus sequence obtained after alignment and

the sequences below to consensus sequences are letter representation of forward and

reverse strands of spa X- region containing spa repeats for the isolate A.14256. The

number of spa repeats starts at position 07 and ends at 246. The total number of repeat

present are 10 and spa type found for A.14256 was t064.The repeat IDs obtained for the

strain is shown in Table 6.

Chapter 3 Results

92

Table 6: Showing the Spa sequence repeat profile obtained from Ridom spa server after

sequencing of selected 26 MRSA isolates from Pakistan.

S.No. S. aureus Isolates

Mec Type

MLVA type Spa Repeat Successions/IDs SPA type

1 P.2113 IV MT1 11-12-05-17-34-24-34-22-25 t451 2 P.18431 IV MT13 11-19-12-05-17-34-24-34-22-25 t064 3 P.8486 IV MT13 11-19-12-05-17-34-24-34-22-25 t064 4 P.5020 IV MT13 11-19-12-05-17-34-24-34-22-25 t064 5 P.844 IV MT13 11-19-12-05-17-34-24-34-22-25 t064 6 A.14254 IV MT13 11-19-12-05-17-34-24-34-22-25 t064 7 P.17120 IV MT14 11-19-12-05-17-34-24-34-22-25 t064 8 A.9445 IV MT17 11-19-12-05-17-34-24-34-22-25 t064 9 A.14256 IV MT17 11-19-12-05-17-34-24-34-22-25 t064 10 A.15330 IV MT18 11-19-12-05-17-34-24-34-22-25 t064 11 A.9914 IV MT18 11-19-12-05-17-34-24-34-22-25 t064 12 K.8 IV MT18 11-19-12-05-17-34-24-34-22-25 t064 13 P.1863 IV MT25 11-19-12-05-17-34-24-34-22-25 t064 14 A.9313 III MT32 15-12-16-02-25-17-24-24 t275

15 A.10813 III MT32 15-12-16-02-25-17-24-24 t275

16 A.13282 III MT63 15-12-16-02-25-17-24 t037

17 P.14947 III MT27 15-12-16-02-24-16-02-25-17-24 t987

18 A.5053 III MT39 15-12-16-02-24-16-02-25-17-24 t987

19 P.1286 IV MT44 15-12-16-02-16-02-25-17-24 t021 20 P.8 III MT31 15-12-16-02-24-24 t030 21 P.13740 III MT46 15-12-16-02-24-24 t030 22 P.2285 III MT47 15-12-16-02-24-24 t030 23 P.1287 III MT53 15-12-16-02-24-24 t030 24 A.26163 III MT59 8-16-02-24-24 t632 25 P.12006 III MT59 8-16-02-24-24 t632 26 P-1 III MT59 8-16-02-24-24 t632

Chapter 3 Results

93

Similarly Figure 35 is showing spa X-region sequences of another representative MRSA

isolate P.2113. The sequences at the top is a consensus sequence obtained after alignment

and the sequences below to consensus sequences are letter representation of forward and

reverse strands of spa x region containing spa repeats for the isolate P.2113. The number

of repeats starts at position 07 and ends at 222. The total number of repeat found were 9

and spa found for P.2113 was t451.

Figure 36 is showing spa X-region sequences of a representative MRSA isolate A.9313

The sequences at the top is a consensus sequence obtained after alignment and the

sequences below to consensus sequences are letter representation of forward and reverse

strands of spa X region containing spa repeats for the isolate P.9313. The number of

repeats starts at position 06 and ends at 197. The total number of repeat found were 8 and

spa type for P.9313 was t275

Figure 37 is showing spa X-region sequences of a representative MRSA isolate A.13282



strands of spa X region containing spa repeats for the isolate A.13282. The number of

repeats starts at position 08 and ends at 175. The total number of repeats found was 7 and

spa type for A.13282 was t037.

Figure 38 is showing spa X-region sequences of a representative MRSA isolate P.1286.





spa type for P.1286 was t021.

Figure 39 is showing spa X-region sequences of a representative MRSA isolate A.26163.






Chapter 3 Results

94

Figure 40 is showing spa X-region sequences of a representative MRSA isolate P.1287.




repeats starts at position 4and ends at 147. The total number of repeats found was 6 and


Multilocus Sequence Typing of Staphylococcus aureus

Multilocus Sequence Typing (MLST) involves the sequencing of internal fragment of

seven house keeping genes which includes arcC (for enzyme carbamate kinase), aroE (for

enzyme shikimate dehydrogenase), glpf (for enzyme glycerol kinase), gmk (for enzyme

guanylate kinase), pta (for enzyme phosphate acetyl transferase), tpi (for triphosphate

isomerase), yqil ( for enzyme acetyl Co enzyme A). The sequences of these internal

fragments of about 500bp are then compared with known allele at each locus to the

MLST database via MLST website (http://www.mlst.net.). In MLST data base every

isolate is described by a seven integer allelic profile that represents a specific sequence

type (ST).

In the present study MLST was carried out on 10 selected MRSA isolates P.2113 (MT1,

spa type t451), P.5020 (MT13, spa type t064), A.15330 (MT18, spa type t064), P.1863

(MT25, t064), A.9313 (MT32, spa type t275), A.13282 (MT63, spa type t037), A.5053

(MT39, spa type t987), P.1286(MT44, spa type t021), P.2285 (MT47, spa typet030) and

A.26163 (MT39, spa type t0632) which belong to different MLVA types

(MTs/genotypes) and spa types. The nucleotide sequences of all seven alleles of these

isolates were used to obtain the allelic profile from the mlst database using the mlst

website (http://www.mlst.net.). In this way the allelic profile obtained is given in the

table 7. The table number is showing the stain IDs, MLVA type, spa type, allic profile in

the order of aro-arc-glp-gmk-pta-tpi-yqil and Sequence type obtained after mlst for the

isolates and their respective clonal complexes. Four out of 10 MRSA isolates P.2113,

P.5020, A.15330, P.1863 were ST113 with allelic profile “3-3-1-1-4-62-3” while five

isolates A.9313, A.13282, A.5053, P.2285 and A.26163 belonged to ST239 having

allelic profile “2-3-1-1-4-4-3” and only one isolate P.1286 was ST30 with allelic profile

Chapter 3 Results

95

Figure No 34

Showing spa X-region sequences of a representative MRSA isolate A.14256. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa x region containing spa repeats for the isolate A.14256. The number of repeats starts at position 07 and ends at 246. The total number of repeat present are 10 and spa type found for A.14256 was t064.

Chapter 3 Results

96

Figure 35

Showing spa X-region sequences of a representative MRSA isolate P.2113. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa x region containing spa repeats for the isolate P.2113. The number of repeats starts at position 07 and ends at 222. The total number of repeat found were 9 and spa type found for P.2113 was t451.

Chapter 3 Results

97

Figure 36

Showing spa X-region sequences of a representative MRSA isolate A.9313. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa X region containing spa repeats for the isolate P.9313. The number of repeats starts at position 06 and ends at 197. The total number of repeat found was 8 and spa type for P.9313 was t275.

Chapter 3 Results

98

Figure No 37

Showing spa X-region sequences of a representative MRSA isolate A.13282. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa X region for the isolate A.13282. The number of repeats starts at position 08 and ends at 175. The total number of repeats found was 7 and spa type for A.13282 was t037.

Chapter 3 Results

99

Figure 38

Showing spa X-region sequences of a representative MRSA isolate P.1286. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa X region containing spa repeats for the isolate P.1286. The number of repeats starts at position 07 and ends at 222. The total number of repeats found was 9 and spa type for P.1286 was t021.

Chapter 3 Results

100

Figure 39

Showing spa X-region sequences of a representative MRSA isolate A.26163. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa X region containing spa repeats for the isolate P.26163. The number of repeats starts at position 11 and ends at 130. The total number of repeats found was 5 and spa type for P.26163 was t632.

Chapter 3 Results

101

Figure 40

Showing spa X-region sequences of a representative MRSA isolate P.1287. The sequences at the top is a consensus sequence obtained after alignment and the sequences below to consensus sequences are letter representation of forward and reverse strands of spa X region containing spa repeats for the isolate P.1287. The number of repeats starts at position 4 and ends at 147. The total number of repeats found was 6 and spa type for P.1287 was t030.

Chapter 3 Results

102

2-2-2-2-6-3-2. The ST113 and ST239 belong to clonal complex eight (CC8), while ST30

belong to clonal complex thirty CC30. Thus majority of Pakistani isolates belong to CC8.

The sequences of seven alleles in fasta format are shown here from figure 41to figure for

the representative strains of ST113, ST239 and ST30 while the allelic profiles of

remaining isolates are given in the table11.

Figure 48 to figure 54 (appendix-II) are showing Sequence data of arc- aro -glp-gmk-pta-

tpi-yqil, gene locus of S. aureus strain P.2113 in fasta format respectively. These

sequences are the consensus sequence obtained after the alignment of forward and

reverse strand. The allelic codes obtained for these sequence from MLST server are 3-3-

1-1-4-62-3 and thus the isolate confirmed as ST113, which belong to clonal complex

eight (CC8)

.Similarly Figure 55 to figure 61 (appendix-II) are showing the sequence data of aro-arc-

glp-gmk-pta-tpi-yqil, gene locus of S. aureus strain A.13282 in fasta format respectively.

These sequences are the consensus sequence obtained after the alignment of forward and

reverse strand. The allelic codes obtained for these sequences from MLST server were 2-

3-1-1-4-4-3 and thus isolate confirmed as ST239, which belong to clonal complex eight

(CC8)

Similarly Figure 62 to figure 68 (appendix-II) is showing Sequence data of aro-arc-glp-

gmk-pta-tpi-yqil, gene locus of S. aureus strain P.1286 in fasta format respectively. These

sequences are the consensus sequence obtained after the alignment of forward and

reverse strand. The allelic code obtained for the sequences from MLST server were 2-2-

2-2-6-3-2 and the isolate confirmed as ST30 which is a part of clonal complex thirty

(CC30). Thus the result obtained after multilocus sequence typing showed that majority

of MRA isolates from Pakistan belong to clonal complex eight with either ST113 or

ST239.

Chapter 3 Results

103

Table 7: Multi locus Sequence Typing profiles and Clonal Complexes of MRSA isolates from Pakistan.

Strain

IDs.

MLVA type

SPA type

aro arc glp gmk pta tpi yqil MLST Profile

arc-aro-glp-gmk-pta-tpi-yqil

MLST

Type

Clonal Complex

P.2113 MT1 t451 3 3 1 1 4 62 3 3-3-1-1-4-62-3 ST113 CC8

P.5020 MT13 t064 3 3 1 1 4 62 3 3-3-1-1-4-62-3 ST113 CC8

A.15330 MT18 t064 3 3 1 1 4 62 3 3-3-1-1-4-62-3 ST113 CC8

P.1863 MT25 t064 3 3 1 1 4 62 3 3-3-1-1-4-62-3 ST113 CC8

A.9313 MT32 t275 2 3 1 1 4 4 3 2-3-1-1-4-4-3 ST239 CC8

A.13282 MT63 t037 2 3 1 1 4 4 3 2-3-1-1-4-4-3 ST239 CC8

A.5053 MT39 t987 2 3 1 1 4 4 3 2-3-1-1-4-4-3 ST239 CC8

P.1286 MT44 t021 2 2 2 2 6 3 2 2-2-2-2-6-3-2 ST30 CC30

P.2285 MT47 t030 2 3 1 1 4 4 3 2-3-1-1-4-4-3 ST239 CC8

A.26163 MT59 t632 2 3 1 1 4 4 3 2-3-1-1-4-4-3 ST239 CC8

Chapter 3 Results

104

Chapter 4 Discussion

124

DISCUSSION

Methicillin resistant Staphylococcus aureus (MRSA) is the major human pathogen and is

leading cause of nosocomial infections. The distribution of MRSA clones has been

reported world wide. Staphylococcus aureus causes a variety of diseases ranging from

superficial skin infections to deep seated infections like pneumonia and septicemia etc.

Genotyping of bacterial isolates is a tool, which can be used in epidemiological studies

while epidemiology is the study of patterns of disease in populations. Genotyping is the

process of determining the genotype of an individual by the use of different biological

assays. Genotyping of MRSA is necessary in order to study its pattern of spread and

infections. It has been reported that most of outbreaks of infectious diseases are due to

exposure to organism from a common source. It is considered that organism in the

affected individuals are genotypically related to each other. Genotyping is carried out to

investigate that isolates from epidemiologically identical cases are genetically identical

(Tenover, 1992). Thus genotyping helps in controlling the spread of pathogens, by

tracing the origin of outbreaks. Genotyping is also often called as molecular

epidemiology or forensic microbiology. Many molecular methodologies have been

adapted for genotyping of MRSA each having its merits and demerits with respect to

their resolving power, portability, cost effectiveness and ease of use.

In the current epidemiological study we focused on clinical MRSA isolates from three

tertiary care hospitals located in the twin cities of Rawalpindi/Islamabad and examined

the types and phylogenetic relationship of the isolates by using MLVA typing, RM

typing, PVL screening, spa typing, Multilocus sequence typing (MLST), and STAR

analysis. A total of 123 nosocomial MRSA isolates were obtained:- 89 isolates from

hospital PIMS (P) a large tertiary care hospital in Islamabad: 7 isolates from hospital

KRL (K), a medium-size hospital in Islamabad; and 27 isolates from Military hospital

(A), a large unit in Rawalpindi. Isolates were obtained from a range of infection

types/sources such as pus, blood, Catheter tips etc and were from different individuals.

Firstly the 16rRNA gene and mecA gene PCR was used to identify and confirm isolates

as MRSA. 16S rRNA gene has specific sequences which are genus specific, thus


125

specifically designed oligonucleotide primers targeting 16rRNA genes correctly identifies

MRSA (Maes et al., 2002). All the isolates used in the current study showed amplication

with 16rRNA primers and mecA gene primers giving the expected product sizes of

1000bp and 100bp respectively, thus were confirmed as MRSA.

After initial identification of MRSA, an MVLA approach was adapted to the analysis of

these MRSA strains as a rapid and cost-effective method of establishing their

phylogenetic relationships as compared to PFGE. PCR products were analyzed using an

ABI sequencer, as this method of MLVA typing is more accurate and robust as compared

to analyzing fragments on gels due to its ability to separate PCR amplicons with small

differences in size thereby providing accurate sizes for these products. The choice of

VNTR was based on established MLVA protocol (Sabat et al., 2003; Francois et al.,

2005; Gilbert et al., 2006) and available genome sequence data

(http://www.ncbi.nlm.nih.gov/ genomes/prokes.cgi), resulting in selection of six variable

number of tandem repeat (VNTR) loci clumping factor A (clfA), clumping factor (clfB),

serine–aspartate protein (sdrC), serine–aspartate protein D (sdrD), Staphylococcal protein

A (spa) and sspa . All the isolates from Pakistan yielded PCR products with all six

VNTR loci. PCR products of the expected sizes, as predicted from analysis of genome

sequences, were obtained for the control strains NCTC 8325 and Mu50. The PCR

products sizes were then converted into repeat numbers. The length of flanking region

and number of repeats were calculated by using program Tandem Repeat Finder v.4.01

from the sequenced strains, NCTC8325 and Mu50, and from the sequences of six loci of

our isolate P.18431 and also same repeat numbers were found true in 26 isolates

sequenced for spa typing. Some VNTR loci contained large numbers of repeats, e.g. clfA

contained up to 46 repeats and clfB up to 55, while some had limited number of repeats,

sspa had four or five repeats. One VNTR loci sav1078 having repeat unit of 63bp did not

showed variation in amplicon sizes of isolates from Pakistan. All the isolates showed the

PCR product sizes of 317bp. So sav1078 was not included in the VNTR analysis for

clustering and strain typing.

In the majority of diseases caused by S. aureus, pathogenesis is multifactorial, so it is

difficult to determine precisely the role of any given factor in a particular case. So the

selection of several loci for MLVA typing was necessary. The number of repeats


126

calculated for the six loci for all the isolates were used to generate an allelic profile

(Fig.27). Isolates varying in repeats at one locus were assigned a different MT/genotype.

In this way a total of 63 MT (genotypes) were obtained for the Pakistani isolates. Two

large clusters of 10 and 11 identical isolates (MTs 13 and 47) were detected with all these

isolates being derived from pus and Hospital P. This is suggestive of a common source of

infection. The allelic profile of MT13 and MT14 was “34-41-30-24-10-4” and “37-39-27-

25-10-4”. Clusters of isolates with a common source were also detected. Thus, MT17

consisted of five blood isolates (November 2007–February 2008), MT25 of six urine

isolates (April-July 2006), MT29 of three isolates from sputum (July2006-August 2007),

MT30 of three spinal cord isolates (August 2006/April 2007) but few cluster of isolates

with different sources was also present like MT1, MT12 of three isolates each from

sputum and pus. These isolates were indicative of clusters of MRSA infection cases.

MLVA profiles were clustered into minimum spanning trees using Bionumerics in order

to show the genetic relationships among the various MLVA types (Fig.26). In the tree,

repeat numbers were treated as categories. Thus two MT differing in repeats at one locus

are clustered together and connected by bold line and two MT varying in more than one

loci are represented by light line while standard strains are shown by dotted lines. This

distribution of strains from different hospitals into the same MT suggests that there is no

association between specific strains and hospitals. This might be due to the fact that these

hospitals are not geographically isolated from each other and visits of patients between

hospitals are common resulting in frequent exchange of strains between these closely-

linked hospitals.

In order to establish the clonal relationship of these isolates to other global collections of

MRSA isolates, further analyses were carried out. Firstly we investigated the clonal

relationships of these isolates by analyzing the RM systems as described by Cockfield et

al., 2007. Staphylococcus aureus isolates belong to one of the ten reported S. aureus

lineages. MRSA isolates that are widely distributed in hospitals belong to six (CC1, CC5,

CC8, CC22, CC30 and CC45) predominant S. aureus lineages (Robinson & Enright,

2003; Lindsay et al., 2006). Clonal complex of an isolate can be confirmed by RM test.

The RM test in the present study showed that 121 isolates were positive for an RM3 type

and only two strains, P.1286 and P.16809, for an RM1 type. This indicated that the


127

majority of isolates belonged to CC8, which is associated with an RM3 type and only

small number of isolates belong to CC30.

Thus CC8 is the most dominant clonal complex in Pakistan and its presence has been

reported from many other countries including UK, USA. Uganda, Germany, Sweden,

Denmark, Australia, Malaysia, India, Kuwait (Moore & Lindsay, 2002; Aires de Sousa &

de Lencastre, 2003; Perez-Roth et al, 2004 Ghebremendhin et al., 2005; Deurenberg et

al., 2007; Ghaznavi et al., 2010). The presence of this clonal complex is also reported

earlier in Pakistani hospitals (Shabir et al., 2010) and it appears that CC8 is the most

successful MRSA clonal complex in this country. The presence of CC8 MRSA has also

been reported from other Asian countries. One study in Asia detected two major lineages

with CC5 strains being dominant in Korea and Japan and CC8 in other countries (Ko et

al., 2005).

CC30 (1.6%) was the second clonal complex found in Pakistani isolates. Only 2 isolates

out of 123 belonged to CC30. This clonal complex first reported in UK and has now

spread to Australia, Belgium, Canada, Greece, Finland, Denmark, Ireland, Spain, Swede,

USA (Deurenberg et al., 2007; Donnio et al., 2007). Thus RM test correctly assigned

clonal complex to isolates which were later on confirmed by doing spa typing and MLST

on selected number of isolates.

Spa typing is a single locus sequencing typing technique in which variation in the tandem

repeats of protein A, encoded by the spa gene was used to type S. aureus isolates. These

repeats vary both in number and sequence. The spa gene harbors a number of

functionally distinct regions which includes Fc-binding region of immunoglobulin G

(IgG), X-region and C-terminus. The X-region contains a varying number of 24 bp

repeats and this polymorphic X region is used in epidemiological typing of MRSA

isolates. The X-region usually contains 3 to 15 repeat units. Data from spa typing can be

compared globally through the Ridom Staph Type software and website (Harmsen et al.,

2003). Spa typing was performed on 26 isolates which also included multiple isolates

from the same MT such as five isolates from MT13, two from MT17, three from MT18,

two isolates from MT32 and three isolates from MT59 and remaining from different MT

(table 6). All isolates from the same MT had identical spa types indicating that MLVA


128

grouped highly-related strains while the separation of isolates having the same spa type

into different MTs such as MT13, MT14, MT17, MT18 and MT25 indicates the presence

of genetic diversity within a spa type.

There was a wide distribution of spa types within these three Pakistani hospitals. Thus,

among the 16 isolates from hospital P which were spa typed, we found six spa types:-

t064 (6 isolates), t030 (4 isolates), t632 (2 isolates), t987 (2 isolates), t451 (1 isolate) and

t021 (1 isolate) and among the 9 isolates from Hospital A, we found four spa types:- t064

(1 isolate), t275 (2 isolates), t632 (2 isolates) and t037 (1 isolate) and one isolates from

KRL hospital belong to t064.

Spa-t064, spa-t030, spa-t451, spa-t021 has been reported from many countries around the

world which include Australia, Canada, China, Germany, India, Netherlands, Sweden,

Norway, UK , USA and UAE while t632 has been reported from Germany and Austria

and t987 has been reported from Norway (spa.ridom.de/).

MLST was carried out for 10 isolates representing different spa types. Out of 5 isolates

from hospital A, we found one ST113 and four ST239 while out of 5 from Hospital

PIMS, three were ST113, one was ST239 and one was ST30 (see Table 7). Thus nine

out-of-ten isolates had MLST types associated with CC8 and one with CC30. CC8

consist of 182 STs in total. The CC8 isolates from Pakistan were resolved into two

sequence types (ST), ST239 and ST113. The ST239 is a single locus variant of ST 8 and

has MLST profile “2-3-1-1-4-4-3”. The ST239 has global distribution and predominant

clone in Asia and Africa. It has been reported from many Asian countries i.e. Saudi

Arabia, Egypt, Tunisia, Singapore, Vietnam, Indonesia, Philippines, Japan, China, Sri

Lanka, India (Chongtrakool et al., 2006; Nickerson et al., 2006; Smyth et al., 2009;

Kechrid et al., 2010, Shabir et al.,2010). ST239 originated from Sweden in 1970s and

then spread around the globe in a very short time due its hybrid nature (Smyth et al.,

2009). Its presence in Pakistan is indicative of its spread in South Asian countries. The

other ST found among Pakistani isolates was ST113 which also belong to CC8 having

MLST profile of 3-3-1-1-4-62-3 and which is a single locus variant of ST8. ST 8 is a

pioneer of group 1 of STs of MLST scheme and reported from many European, Asian

and Middle East countries (Olivera et al., 2001; Enright et al., 2002; Udo et al., 2010)


129

ST30 was also found among isolates from Pakistan which belong to CC30 and has MLST

profile 2-2-2-2-6-3-2. The frequency of ST30 (1.6%) is less as compared to ST239,

ST113 and ST8 in Pakistan. ST 30 was first reported in UK and it has spread now to

Europe, Asia, America and Australia (Vandenesch et al., 2003). ST30 has 101 single

locus variants and 34 double locus variants and thus ST30 belong to CC30 which has 135

ST in total (www.mlst.net).

Thus the genotyping of MRSA isolates from three hospitals located in

Islamabad/Rawalpindi indicates the predominance of CC8 clones, particularly ST239 and

ST113. This is an extension of the observation that ST239 may account for more than

90% of hospital acquired MRSA infections in South East Asia (Feil et al., 2008) to

include Pakistan. The presence of CC8 especially ST239 has also been also been reported

from India (Arakere et al., 2005; Ko et al., 2006).

These two CC8 and CC30 have also been reported in previous studies from Pakistan.

Thus our results complement previous studies by Shabir et al., 2010 on 49 isolates from

Pakistan and Zafar et al., 2011 on 126 isolates. In our study, the majority of isolates were

found to be from CC8 with the following types being represented: - ST239, ST113 and a

few isolates belong to CC30 having sequence type 30 (ST30). Our study also

complements with two larger studies (Ko et al., 2005; Song et al., 2011) which did not

examine isolates from Pakistan but found that, with the exception of Korea and Japan,

Asian countries are dominated by CC8 strains particularly ST239. ST239 is the

Brazalian/Hnngarian clone and evolved from the highly successful and unrelated lineages

CC8 (ST8) and CC30 (ST30). The exact mechanism of DNA transfer between these

lineages is unknown but it has been considered that fusion of two isolates may have

occurred (Robinson et al., 2004; Lindsay et al., 2006). Thus ST239 with an increased

virulence is the most widely distributed clone of MRSA (Edgeworth et al., 2007).

Comparing typing efficiency of MLVA and its use in epidemiology it has been shown in

previous study that it is comparable to PFGE and even more resolution some time (Sabat

et al., 2003).

Although there is significant diversity at the micro level, as shown by variations in the

VNTRs, the majority of MRSA strains present in the hospitals of Pakistan are from CC8


130

and a limited number from CC30. The dominant STs present are ST239 with mec type-

III, and ST113 with mec type-IV with only a limited number of strains with an ST30 mec

type-IV which may be due to local clonal evolution. These results are the indicative of

clonal polymorphism which resulted to evolve ST239 and ST113 from ST8. Unlike CC8

which is predominant in Asian countries, other isolates belonged to CC30 which is

predominant in Europe and the Pacific Islands (Smith et al, Udo et al., 2008). ST30 is a

community acquired MRSA in origin. The identification of ST30 isolates with SCCmec

IV and positive for the Panton Valentine Leukocidin in Pakistan indicates its

dissemination in South East Asia as seen previously in China and Singapore (Ho et al.,

2004; Hsu et al., 2006).

After the confirmation and identification of the isolates lineages by RM typing, Spa

typing and MLST these isolated were analyzed for Staphylococcus aureus repeat (STAR)

elements present in the intergenic region of three loci i.e. between conserved hypothetical

region-gapR, uvrA-hprK and icaC-geh. STAR element contain 14bp GC rich direct

repeats of consensus sequences T(G/A/T)TGTTG(G/T)GGCCC(C/A) interspersed with

40bp of recurring sequences and the number of repeats at particular locus varies between

strains (Cramton et al., 2000).

On the basis of STAR element containing repeats present in the upstream region of gapR

the MRSA isolates from Pakistan are grouped into 4 clusters, 0 repeats (2 isolates), 1

repeat (60 isolates), 2 repeats (56), 4 repeats (5 isolates). The isolates P.1286 and P.16809

with no repeats in the gapR upstream region are similar to MRSA252 which do not have

the STAR repeat in gapR upstream region and thus there is a sequence similarity between

them. This is the confirmation that there is as similarity between the isolates in STAR

element belonging to same lineages as P.1286, P.16809 and MRSA252 belong to CC30.

The remaining isolates having 1 repeat, 2 repeat or 4 repeats in gapR upstream region

belong to clonal complex eight having variable STAR element length. While in Case of

STAR element present in the intergenic regions of uvrA-hprK, there were either two 3

repeats (100 isolates) or 2 repeats (23 isolates) were found in Pakistani MRSA isolates

and incase of ica-geh intergenic region, isolates with 1 repeat (2 isolates), 2 repeats (109

isolates), 3 repeats (12 isolates) were found. The phylogenetic tree drawn by using STAR

present in these intergenic region , resulted into seven groups that were group one contain


131

two isolates with STAR profile 0-2-1. This group included two CC30 isolates only.

Group two contain seven isolates with allelic profile 1-2-2, groups three contain thirteen

isolates with profile 2-2-2, group four contain 47 isolates with profile 1-3-2, group five

contain 42 isolates with profile 2-3-2, group six contain 7 isolates with profile 1-3-3 and

group seven contain five isolates with profile 4-3-3. Thus there is a genetic diversity at

subspecies level in the isolates belonging to CC8 as compared to CC30 as shown by the

Multilocus Variable number of tandem repeat analysis because repetitive elements can

evolve rapidly due to mismatch repair during DNA replication and can result a change in

repeat number after a single generation This is the basis of phase variation gene

regulation, resulting in subpopulations that are better adapted to environmental changes.

Mutation in tandem repeats occur 100-10,000 more frequently than point mutation (Van

Ende et al., 2000; Wis derniewski et al., 2008; Vinces et al., 2009).

Conclusion

The present genotypic study showed that in Pakistan the isolates belonging to clonal

complex eight (CC8) are dominant in clinical settings. They belong to ST239, ST113 or

ST8. The other clonal complex found was CC30 with presence of PVL gene and isolates

belong to ST30. The use of MLVA in resource poor laboratories as a rapid and robust

method for grouping noscomial MRSA isolates into clusters for identification of

localized outbreaks is quite fruitful and MLVA may also provide an understanding of the

evolutionary processes as changes in the number of repeats at different loci, may be

indicative of which loci are prone to natural selection resulting in higher levels of

variation, thus VNTRs serve as evolutionary clock for investigating an outbreaks and

transmission events. In this study, we observed more variation in clfA and clfB than in

sdrC, sdrD, spa and sspa. We also found that a change in repeat number was not

necessarily gradual but may have occurred as a result of large jumps. Some isolates with

significant differences in repeat numbers at single locus but being identical numbers in all

other loci. Further evidence is provided by the spa typing results, i.e. with a loss of four

repeats resulting in a shift from t987 to t030 and a two repeat difference changed t021 to

t275 (see Table 6). These large jumps might be due to deletions or insertions mediated by


132

recombination or as result of deletions due to slip-strand impairing during DNA

replication.

Thus MRSA infections have become a challenge across the globe. The MRSA isolates

which were once endemic to Europe and America, Africa has now been reported from

Asia and thus suggesting that the MRSA isolates which once was endemic to a certain

geographical area are no more confined to those boundaries. More over the pandemic

spread of one type of MRSA clone across the globe is the result of antibiotic resistance.

Therefore a joint global effort will be effective for the control of MRSA infection.

Although this study was carried out on limited number of isolated but it is quite useful to

strengthen the MRSA data in Pakistan and to develop the genetic profile of MRSA in

Pakistan and then to link it globally. This study also helped to under stand that although

there are only two lineages in these hospitals as in most of other Asian countries but there

is a diversity at subspecies level as some of the isolates assumed a specific genetic profile

as they evolved locally after they were imported to this region.

Recommendations

There is an urgent need of continuation of epidemiological studies of MRSA in Pakistan

in order to develop a local data base which will be helpful to determine the impact of

novel strains. We need to be vigilant to recognize MRSA strains. Surveillance need to be

coordinated at regional level and also at national level. If we do not control MRSA at

local and national level then these strains will increase exponentially. We need to update

our health care workers, especially physicians, microbiologists, infection control

practioners and bureaucrats managing health care about MRSA emergence and clonal

spread. These people also need to be aware of changing epidemiology of existing MRSA

strains and also about the emergence of novel strains of MRSA in Pakistan. It is essential

for the doctors to check the Staphylococcus aureus properly for antibiotic resistance

before doing treatment. It is also necessary to educate the public about MRSA infections

and also about the importance of hygienic measures which will help to reduce the MRSA

infections.


133

Future Directions

There is a need to perform multicentre studies all around the Pakistan with same

genotyping tools such as MLVA, spa and MLST in order to delineate the prevalence and

epidemiology of MRSA. Thus a data bank regarding MRSA infection, prevalence, mode

of transmissions, genotypes, clonal complexes and novelty can be prepared and can be

used for updating Health Care Policies.

Chapter 5 References

134

References

Aires de Sousa M, Bartzavali C, Spiliopoulou I, Sanches IS, Crisostomo MI, de

Lencastre H (2003). Two International methicillin resistant Staphylococcus aureus

clones endemic in a University hospital in Patras, Greec; E J Clin Microbiol; 41(5):

2027-2032.

Annear DI, Grubb WB (1973). Stimulation of small-colony variants of Staphylococcus

aureus by penicillins and cephalosporins. Lancet; 1:664-665.

Anonymous. (2000). Staphylococcus aureus. http://mlst.zoo.ox.ac.uk/nlst-info/staph/

staph-info.htm.

Arakere G, Nadig S, Swedberg G, Macaden R, Amatnath SK, Raghunath D (2005).

Genotyping of Methicillin Resistant Staphylococcus aureus Strains from two

Hospitals in Banglore, South India. J Clin Microbiol; 43(7): 3198-3202.

Arbeit RD (1995). Laboratory procedures for the epidemiologic analysis of

microorganisms. In: Murray P R, Baron EJ, Pfaller MA, Tenover FC, Yolken RH

editors. Manual of Clinical Microbiology 6th Edition, American Society for

Microbiology, Washington, DC; 190-208.

Arbeit RD (1999). Laboratory procedures for the epidemiologic analysis of micro

organism. In: Murray PM, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, Manual

of Clinical Microbiology, Washington, ASM Press.

Archer GL (1998). Staphylococcus aureus: a well armed pathogen. Clin Infect Dis;

26:1179-1181.

Archer GL, Niemeyer DM (1994). Origin and evolution of DNA associated with

resistance to methicillin in staphylococci. Trends in Microbiology; 2:343-347.

Arsher GL, Niemeyer DM, Thanassi JA, Pucci MJ (1994). Dissemination among

staphylococci of DNA sequences associated with methicillin resistance.

Antimicrobial Agents & Chemotherapy; 18:447-54.


135

Ashby DR, Power A, Singh S, Choi P, Taube DH, Duncan ND, Cairns, TD (2009).

Bacteraemia Associated with Tunneled Hemodialysis Catheters: Outcome after

Attempted Salvage. Clin J Am Soc Nephrol; 4(10): 1601-1605.

Aucken HM, Ganner M, Murchan S, Cookson BD, Johnson AP (2002). A new UK strain

of epidemic methicillin-resistant Staphylococcus aureus (EMRSA-17) resistant to

multiple antibiotics. J Antimicrob Chemothe; 50: 171-175.

Baba T, Bae T, Schneewind O, Takeuchi F, Hiramatsu K (2008). Genome sequences of

Staphylococcus aureus strain Newman and comparative Analysis of Staphylococcal

Genome Polymorphism and Evolution of two Major Pathogenicity Islands. Journal

of Bacteriology; 190(1): 300-310.

Baba T, Kuroda M, Ohta T, Yuzawa H, Kobayashi I, Cui L, Oguchi A, Aoki K, Nagai

Y, Lian J et al, (2001). Whole genome Sequencing of Methicillin resistant

Staphylococcus aureus. Lance; 357(9264): 1225-40.

Bannerman TL, (2003). Staphylococcus aureus and other catalase positive cocci that

grow aerobically. In: P. R. Murray, EJ. Baron, J. H. Jorgensen, M. A. Pfaller, and R

H. Yolken (ed.), Manual of clinical microbiology, 8th ed. ASM Press, Washington,

DC; 384-404.

Bannerman TL, Hancock GA, Tenover FC, Miller JM (1995). Pulse-fielde gel

electrophoresis as a replacement for bacteriophage typing of Staphylococcus

aureus. Jounal of Clinical Microbiology; 33: 551-555

Barber M, Dowzenko MR (1948). Infection by penicillin-resistant staphylococci. Lancet;

1: 641-4

Barbour AG (1981). Vaginal Isolates of Staphylococcus aureus associated with toxic

shock syndrome. Infect Immun; 33: 442-449.

Barg N, Chambers H, Kernodle D (1991). Borderline susceptibility to antistaphylococcal

penicillins is not conferred exclusively by the hyperproduction of beta-lactamase.

Antimicrobial Agents & Chemotherapy; 35: 1975-9.


136

Barrett FF, McGehee RFJ, Finland M (1968). Methicillin-resistant Staphylococcus aureus

at Boston City Hospital. Bacteriologic and epidemiologic observations New England

Journal of Medicine; 279: 441-8.

Beck WD, Berger-Bachi B, Kayser FH (1986). Additional DNA in methicillin-resistant

Staphylococcus aureus and molecular cloning of mec-specific DNA. Journal of

Bacteriology; 165: 373-8.

Berger-Bachi B (1997). Resistance to ß-lactam antibiotics. Resistance not medicated by ß-

lactamase (methicillin resistance). In: Crossley KB and Archer GL, editors The

staphylococci in human disease. 1st Edition. Churchill Livingstone, New York; 158-

74.

Benson G (1999). Tandem repeat finder a program to analyze DNA sequences. Nucleic

Acids Res; 27(2): 573-580.

Berger-Bachi B, Strassle A, Kayser FH (1986). Characterization of an isogenic set of

methicillin-resistant and susceptible mutants of Staphylococcus aureus. Eur J Clin

Microbiol; 5: 697-701.

Berger-Bachi B (1983). Insertional inactivation of staphylococcal methicillin resistance by

Tn551. Journal of Bacteriology; 154: 479-87.

Birmingham MC, Rayner CR, Meagher AK, Flavin SM, Batts DH, Schentag JJ (2003).

Linezolid for the treatment of multidrug resistant, gram positive infections:

experience from a compassionate use program. Clin Infect Dis; 36(2) 159-168.

Bignardi GE, Woodford N, Chapman A, Johnson AP, Speller DC (1996). Detection of the

mecA gene and phenotypic detection of resistance in Staphylococcus aureus isolates

with borderline or low-level methicillin resistancEJournal of Antimicrobial

Chemotherapy; 37: 53-63.

Bhakdi S, and Tranum-Jensen (1991). Alpha toxin of Staphylococcus aureus. Microbiol

Rev; 55(4): 733-751

Bladon CM, Bladon P, Parkinson JA (1992). Delta toxin and analogues as peptide models

for protein ion channels. Biochem. Soc. Trans; 20(4): 862-864.


137

Blair JE, Williams REO (1961). Phage typing of staphylococci. Bull WHO; 24:771-8.

Blanc DS, Lugeon C, Wenger A, Siegrist HH, Francoili P (1994). Quantitative

Antibiogram Typing Using Inhibition Zone Diameters Compared with Ribotyping

for epidemiological validation of pulse field gel electrophoresis. J Clin Microbiol;

30: 362-369.

Blumberg HM, Rimland D, Kiehlbauch JA, Terry PM, Wachsmuth LK (1992).

Epidemiologic typing of Staphylococcus aureus by DNA restriction fragment

length polymorphism of rRNA genes: elucidation of the clinical nature of a group

of Bacteriophages-non typeable, ciprofloxacin resistant, methicillin susceptible S.

aureus isolates. J Clin Microbio; 30: 362-369.

Borowski J, Kamienska K, Rutecka I (1964). Staphylococci resistant to methicillin. Med

J; 1: 983.

Boyce JM, Medeiros AA, Papa EF, O’Gara CJ (1990). Induction of beta-lactamase and

methicillin resistance in unusual strains of methicillin-resistant Staphylococcus

aureus. Journal of Antimicrobial Chemotherapy. 25:73-81.

Boye K, Bartels MD, Anderson IS, Meller JA; Wesh H (2007). A new multiplex PCR for

screeing of methicillin resistant Staphylococcus aureus SCCmec types I-V. Clin

Microbiol Infect; 13: 725-727.

Branger C, Goullet P, Boutonnier A, Fournier JM (1990). Correlation between esterase

electrophorectic types and capsular polysaccharide types 5 and 8 among methicillin-

susceptible and methicillin-resistant Staphylococcus aureus. Journal of Clinical

Microbiology; 28: 150-1.

Busch U, Nitschko H (1999). Methods for the differentiation of microorganism. J

Chromatogr Biomed Sci Appl; 722: 263-278.

Carles-Nurit MJ, Christophle B, Broche S, Gouby A, Bouziges NRM (1992). DNA

polymorphisms in methicillin-susceptible and methicillin-resistant strains of

Staphylococcus aureus. Journal of Clinical Microbiology; 30: 2092-6

Cegelski L, Marshall GR, Eldridge GR, Hultgren S J (2008). The biology and future

prospects of antivirulence therapies. Nat Rev Microbiol; 6(1): 17-27.


138

Cetin ET, Ang O (1962). Staphylococci resistant to methicillin (Calbenin). Brit Med J; 2:

51.

Chamber HF and Deleo FR (2009). Waves of Resistance Staphylococcus aureus in the

antibiotic Era. Nat. Rew. Microbio; 7(9): 629-641.

Chambers HF (1997). Methicillin resistance in Staphylococci: molecular and biochemical

basis and clinical implications. Clin Microbiol Rev; 10(4): 781-791.

Chambers HF, Sachdeva MJ, Hackbarth CJ (1994). Kinetics of penicillin binding

topenicillin-binding proteins of Staphylococcus aureus. Biochemical Journa; 301:

139-44.

Chambers HF, Hackbarth CJ (1987). Effect of NaCl and nafcillin on penicillin-binding

protein 2a and heterogeneous expression of methicillin resistance in Staphylococcus

aureus. Antimicrobial Agents & Chemotherapy; 31:1982-8.

Chambers HF (1987). Coagulase-negative staphylococci resistant to beta-lactam

antibiotics in vivo produce penicillin-binding protein 2a. Antimicrobial Agents &

Chemotherapy; 31: 1919-24

Chen Y, Gang Song G, Jiang F, Feng L, Zhang X, Ding Y, Bartlam M, Yang A, Ma X,

Ye S, Liu Y, Tang H and Rao Z (2002). Crystal structure of a staphylokinase

variant; A model for reduced antigenicity. Eur J Biochem. 269(2): 705-711.

Chongtrakool P, Ito I, Ma X, Kondo Y, Trakulsomboon S, Tiensasitorn, C, Jamklang M,

Chavalit, T, Song JH and Hiramatsu K. (2006). Staphylococcal cassette

chromosome mec (SCCmec) typing of methicillin resistant Staphylococcusl aureus

strains isolated in 11 Asian countries: a proposal for a new nomenclature for

SCCmec elements. Antimicrob Agents Chemother; 50: 1001-1012

Chow AW, Gribble, MJ, Barlet KH (1982). Hemolytic activity of Staphylococcus aureus

associated with toxic shock syndrome. EJ Infect Dis; 146:98.

Cockfield JD, Pathak S, Edgeworth JD, Lindsay JA (2007). Rapid determination of

hospital-acquire methicillin resistant Staphylococcus aureus lineages. J Med

Microbiol; 56: 614-619.


139

Cohen S, Gibson CJ, Sweeney HM (1972). Phenotypic suppression of methicillin

resistance in Staphylococcus aureus by mutant noninducible penicillinase plasmids.

Journal of Bacteriology; 112: 682-9

Cohen S, Sweeney HM (1968). Constitutive penicillinase formation in Staphylococcus

aureus owing to a mutation unlinked to the penicillinase plasmid. J Bacteriol; 95:

1368-74.

Costas M, Cookon BD, Talsania HG, Owen RJ (1989). Numerical analysis of

electrophoretic protein pattern of methicillin resistant strains of Staphylococcus

aureus. J Cln Microbiol; 27: 2574-2581.

Couto I, Melo-Cristino J, Fernandes ML, Garcia T, Serrano NSM, Torres-Pereira A,

Sanches I S, de Lencastre H (1995). Unusually large number of methicillin-resistant

Staphylococcus aureus clones in a Portuguese hospital. Journal of Clinical


Cramton SE, Schnell NF, Gotz F, Bruckner R (2000). Identification of new repetitive

element in Staphylococcus aureus. Infection and immunity; 68: 2344-2348.

Dancer SJ, Noble WC (1991). Nasal, axillary, and perineal carriage of Staphylococcus

aureus among women: Identification of strains producing epidermolytic toxin. J

Clin Pathol; 44: 681-684.

De Lencastre H, Severina E, Milch H, Konkoly TM & Tomasz A (1997). Wide

geographic distribution of a unique methicillin resistant Staphylococcus aureus

clone in Hungarian hospitals. Clin Microbiol Infect 3; 289-296.

De Sousa MA and de Lencastre H (2003). Evolution of sporadic Isolates of methicillin

resistant Staphylococcus aureus (MRSA) in hospitals and their similarities to

community–acquired MRSA. J Clin Microbiol; 41: 3806-3815.

De Souza MA, Sanches IS, Ferro ML, Vaz M.J, Saraiva Z, Tendeiro T, Serra J, de

Lencastre H (1998). Intercontinental spread of a multidrug-resistant methicillin-

methicillin resistant Staphylococcus aureus clon. E J Clin Microbiol; 36: 2590-

2596.


140

del Pozo JL, and Patel R (2007). The challenge of treating biofilm-associated bacterial

infections. Clin Pharmacol Ther; 82: 204-209.

Deurenberg RH, Vink C, Kalenic, S, Friedrich AW, Bruggemann CA, Stobberingh EE,

(2007). The molecular evolution of methicillin resistant Staphylococcus aureus.

Clin Microbiol Infect; 13 (3): 222-235.

Dinges MM, Orwin PM, Schlievert PM (2000). Exotoxins of Staphylococus aureus.

Clin. Microbiol. Rev ; 13: 16-34.

Dominguez MA, de Lencastre H, Linares J, Tomasz A (1994). Spread and maintenance of

a dominant methicillin-resistant Staphylococcus aureus (MRSA) clone during an

outbreak of MRSA disease in a Spanish hospital. Journal of Clinical Microbiology;

32: 2081-7.

Donnio P, Fevrier F, Bifani P, Dehem M, Kervnce C, Wilhelm N, Gautier-Lerestif A,

Lafforgue N, Cormier M (2007). The MR-MSSA Study Group of the College de

Bacteriologie-Virologie-Hygiene des Hospitaux de France and Coustumier, A.

Molecular and epidemiological evidence for the spread of Multiresistant Methicillin

Susceptble Staphylococcus aureus strains in Hospitals. Antimicrobiol agents

Chemotherapy; 51(12): 4342-4350

Dyke K, Gregory P (1997). Resistance to ß-lactam antibiotics. Resistance mediated by ß-

lactamase. In: Crossley K. B. and Archer G. L, editors. The staphylococci in human

diseases. 1st Edition, Churchill Livingstone, New York; 139-157.

Edgeworth JD, Yadegarate G, Pathak D, Batra R, Cockfield JD, Wyncol Beale R and

Lindsay JA (2007). An outbreak in an intensive care unit of a strain of methicillin

resistant Staphylococcus aureus sequence type 239 associated with an increased

rate of vascular access device-related bacteremia. Clin Infect Dis; 44: 493-501.

Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H and Spratt BG (2002). The

evolutionary history of methicillin resistant Staphylococcus aureus (MRSA). Proc

Natl Acad Sci USA; 99: 7687-7692.


141

Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG (2000). Multilocus sequence

typing for characterization of methicillin-resistant and methicillin-susceptible clones

of Staphylococcus aureus. Journal of Clinical Microbiology; 38: 1008-15.

Enright MC and Spratt BG (1999). Multilocus sequence typing. Trends Microbiol; 7:

482-487.

Fattom AI, Horwith G, Fuller S, Propst M, Naso R (2004). Development of StaphVAX, a

polysaccharide conjugate vaccine against S. aureus infection: from the lab bench to

phase III clinical trials. Vaccine.; 22(7): 880-7.

Feil EJ, Chan M-S. (2000) README- The BURST algorith (based upon related sequence

types). http://microbiology.ceid.ox.ac.uk /BURST /BURSTREADME.htm

Feil EJ, Cooper JE, Grundmann H, Robinson DA, Enright MC, Berendt T, Peacock SJ,

Smith, JM, Murphy M, Spratt BG, Moree CE. and Day NP (2003). How Clonal is

Staphylococcus aureus? J. Bacteriology; 185(11): 3307-3316.

Feil EJ, Li, BC, Aanensen DM, Hanage, WP and Spratt BG. (2004). eBURST:

Interferring Pattern of Evolutionary Descent among Cluster of Related Bacterial

Genotypes from Multilocus Sequence typing Data. Journal of Bacteriology;

1869(5): 1518-1530.

Feil EJ, Nickerson, EK, Chantratita N, Wuthiekanun V, Srisomang P, Cousins R, Pan W,

Zhang G, Xu B, Day NP, Peacock SJ (2008). Rapid detection of the pandemic

methicillin resistant Staphylococcus aureus clone ST239, a dominant strain in Asian

hospitals. J Clin Microbiol; 46(4): 1520-1522.

Fisk RT (1942). Journal of Infectious Diseases; 71:153-60

Foster TJ (2005). Immune evasion by Staphylococci. Nat Rev Microbiol; 3948-958.

Foster TJ and Hook M (1998). Surface protein adhesion of Staphylococcus aureus.

Trends Microbiol; 6:484-488

Foster TJ (1983). Plasmid determined resistance to antimicrobial drugs and toxic metal

ions in bacteria. Microbiol Rev ; 47(3): 361-409.


142

Francois P, Huyghe A, Charbonnier Y et al (2005). Use of an automated multilocus

variable of tandem repeat based method for rapid and high throughput genotyping

of Staphylococcus aureus isolates. J Clin Microbiol; 43: 3346-3355.

Friedrich R, Panizzi P, Kawaabata S, Bode W, Bock PE, Fuenntes-Prior P (2006).

Structural basis for reduced Staphylocoagulase-mediated bovine prothrombin

activation. J Biol Chem; 281:1188-1195.

Fukuda H, Hori S, Hiramatsu K (1998). Antibacterial activity of gatifloxacin (AM-1155

CG5501, BMS- 206584), a newly developed fluoroquinolone, against sequentially

acquired quinolone-resistant mutants and the norA transformant of Staphylococcus

aureus. Antimicrobial Agents & Chemotherapy; 42: 1917-22.

Garrity GM, Bell JA and Lilburn TG (2004). Taxonomic outline of the prokaryotes. In:

Berey’s manual of systematic bacteriology, 2nd ed. Release 5.0. Springer-Verlag,

New York, N.Y.

Garrity GM, Boone DR, Castenholz, RW (2001). Bergey’s Manual of Systematic

Bacteriology, 2nd ed, Springer-Verlag, New York, N.Y.

Ghaznavi-Rad E, Shamsudin MN, Sekawi Z Lew Yun Khoon LY, Aziz MN, Rukman

Awang Hamat, RA, Othman N, Chong PP, van Belkum A, Ghasemzadeh-

Moghaddam, H. and Neela, V (2010). Predominance and Emergence of clones of

ospital- Acquired Methicillin- Resistant Staphylococcus aureus in Malaysia. J Clinc

Microbio; 48(3): 867-872.

Ghebremendhin B, Konig W & Konig B (2005). Heterogeneity of methicillin resistant

Staphylococcus aureus strains at a German University Hospital during a 1-year

period. Eur J Clin Micriobiol Infect Dis; 24: 388-398.

Giesbrecht P, Kersten T, Maidhof H and Wecke J (1998). Staphylococcal cell wall,

morphogenesis and fatal variations in the presence of pencillin. Microbiol Mol Biol

Rev; 62(4): 1371-1414.

Gilbert FB, Fromageau A, Gellineau L, Poutrel B (2006). Differentiation of bovine

Staphylococcus aureus isolates by use of polymorphic tandem repeat typing. J Vet

Microbiol ;117: 297-203.


143

Gill SR, Founts DE, Archer GL, Mongodis EF, Deboy R T, Ravel J, Paulsen IT, Kolonay

JF, Brinkac L, Beanan M, Dodson RJ, Daughtery, SC,, Madupu R, Angiuoli SV,

Durkin AS, Haft DH, Vamathevan J, Khouri H, Utterback T, Lee C, Dimitrov G,

Jiang L, Qin H, Weidman J, Tran K, Kang K, Hance IR, Nelson KE and Fraser CM

(2005). Insights on evolution of virulence and resistance from the complete genome

analysis of an early methicillin resistant Staphylococcus aureus strain and biofilm

producing methicillin resistant Staphylococcus epidermidis strain. J bacteril;

187(7): 2426-2438.

Gladstone GP, Van Heyningen WE (1957). Staphylococcal leuocidins. Brit J Exp Pathol

38: 127-137.

Goering RV, Winters MA (1992). Rapid method for epidemiological evaluation of gram

positive cocci by field inversion gel electrophoresis. Journal of Clinical


Goering RV, Fey PD, Goldstein FW (1992). Usefulness of pulsed-field gel electrophoresis

in the epidemiological analysis of Staphylococcus aureus isolates with decreased

susceptibility to teicoplanin. European Journal of Clinical Microbiology & Infectious

Diseases; 14: 3-5

Graham PL, Lin SX, Larson EL (2006). A U.S. Population Based Survey of

Staphylococcus aureus colonization. Ann Intern Med; 144: 318-325.

Gustafson JE, Wilkinson BJ (1989). Lower autolytic activity in a homogeneous

methicillin-resistant Staphylococcus aureus strain compared to derived

heterogeneous-resistant and susceptible strains. FEMS Microbiology Letters; 50:

107-11.

Hackbarth CJ, Mick C, Chambers HF (1994). Altered production of penicillin-binding

protein 2a can affect phenotypic expression of methicillin resistance in

Staphylococcus aureus. Antimicrobial Agents & Chemotherapy; 38: 2568-71.

Hackbarth CJ, Chambers HF (1993). blaI and blaR1 regulate beta-lactamase and PBP 2a

production in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents &

Chemotherapy; 37: 1144-9.


144

Hackbarth CJ, Kocagoz T, Kocagoz S, Chambers HF (1995). Point mutations in

Staphylococcus aureus PBP 2 gene affect penicillin-binding kinetics and are

associated with resistance. Antimicrobial Agents & Chemotherapy; 39: 103-6.

Hadorn K, Lenz W, Kayser FH Shalit I, Krasemann C (1990). Use of a ribosomal RNA

gene probe for the epidemiological study of methicillin and ciprofloxacin resistant

Staphylococcus aureus. Eur J Clin Micribiol Infect Dis; 9: 649-653.

Hafiz S, Hafiz AN, Ali L, Chughtai AS, Memon B, Ahmed A, Hussain S, Sarwar G,

Mughal T, Siddiqui SJ, Awan A, Zaki K and Fareed A (2002). Methicillin resistant

Staphylococcus aureus. a multicentre study. J Pak Med Assoc; 52(7): 312-315.

Haley RW (1991). Methicillin-resistant Staphylococcus aureus - Do we have to live with

it? Annals of Internal Medicine; 114: 162-4.

Haley RW, Hightower AW, Khabbaz RF et al (1982). The emergence of methicillin-

resistant Staphylococcus aureus infections in United States hospitals. Possible role

of the house staff-patient transfer circuit. Annals of Internal Medicine. 97:297-308.

Harmsen D, Claus H, Witte W, Rothganger J, Claus H, Turnwald D & Vogel U. (2003).

Typing of methicillin resistant Staphylococcus aureus in a university hospital

setting by using novel software for spa repeat determination and database

management. J Clin Microbiol; 41: 5442–5448.

Hartstein AI, Morthland VH, Eng S, Archer GL, Schoenknecht FD, Rashad AL (1989).

Restriction enzyme analysis of plasmid DNA and bacteriophage typing of paired

Staphylococcus aureus blood culture isolates. Journal of Clinical Microbiology; 27:

1874-9.

Hederson A and Brodie J (1963). Investigation on Staphylococcal coagulase. Br J Exp

Pathol; 44: 524-528.

Hiramatsu K, Konodo N, Ito T (1996). Genetic basis for molecular epidemiology of

MRSA. J Infect Chemothe; 2: 117-29.

Hiramatsu K, Asada K, Suzuki E, Okonogi K, Yokota T (1992). Molecular cloning and

nucleotide sequence determination of the regulator region of mecA gene in

methicillin-resistant Staphylococcus aureus (MRSA). FEBS Letters; 298: 133-6.


145

Hiramatsu K, Suzuki E, Takayama H, Katayama Y, Yokota T (1990). Role of

penicillinase plasmids in the stability of the mecA gene in methicillin-resistant

Staphylococcus aureus. Antimicrobial Agents & Chemotherapy; 34: 600-4.

Ho PL, Tse CW, Gannon MC, Chow KH, Ng, TK (2004). Community-acquired

methicillin resistant Staphylococcus aureus arrives in Hong Kong. J Antimicrob

Chemother; 54(4): 845-846.

Holden MT, Feil FJ, Lindsay JA (2004). Complete genome of two clinical

Staphylococcus aureus strains: evidence for rapid evolution of virulence and drug

resistance. Proc Natl Acad Sci, USA; 101: 9786-9791.

Hollis RJ, Barr JL, Doebbeling BN, Pfaller MA, Wenzel RP. (1995). Familial carriage of

methicillin-resistant Staphylococcus aureus and subsequent infection in a premature

neonate. Clinical Infectious Diseases; 21: 328-32.

Hsu LY, Koh YL, Clebicka NL, Tan TY, Krishan P, Lin RT, Tee N, Barkham T, Koh

TH, (2006). Establisment of ST30as the pre dominant clonal type amongst

community-associated methicillin resistant Stapylococcus aureus isolates in

Singapor. E J Clin Microbiol; 44(3): 8719-8726.

Ichiyama S, Ohta M, Shimokata K, Kato N, Takeuchi J. (1991). Genomic DNA

fingerprinting by pulsed-field gel electrophoresis as an epidemiological marker for

study of nosocomial infections cuased by methicillin-resistant Staphylococcus

aureus. Journal of Clinical Microbiology; 29: 2690-5.

Inglis B, Matthews PR, Stewart PR. (1988). The expression in Staphylococcus aureus of

cloned DNA encoding methicillin resistanc. E Journal of General Microbiology.

134:1465-9.

Ito T, Katayama Y, Hiramatsu K. (1999) Cloning and nucleotide sequence determination

of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315.

Antimicrobial Agents & Chemotherapy.43:1449-58.

Ito T, Katayama Y, Hiramatsu K. (1998). Acquisition of methicillin resistance and

progression of multiantibiotic resistance in methicillin-resistant Staphylococcus

aureus. Medical Journal; 39: 526-33.


146

Jefferys AJ, Wilson V and Thein SL (1992). Hypervarable minisatellite region in human

DNA. Biotechnology; 24: 467-472.

Janwithayanuchit I, Ngam-ululert S, Paungmoung P and Rangsipanuratn W (2006).

Epidemiologic study of methicillin resistant Staphylococcus aureus by coagulase

gene polymorphism, Science Asia; 32: 127-132

Jevons MP (1961). Celbenin resistant Staphylococci. Brit Med J; 1: 124-125.

Jarraud S, Peyrat MA, Lim, A, Tristan A, Bes M, Mougel C, Etienne J, Vandenesch F,

Booeville M and Lina G (2001). Egc, a highly prevalent operon of enterotoxin

gene, forms a putative nursery of superantigens in Staphylococcus aureus. J

Immunol; 166: 669-677.

Katayama Y, Ito T, Hiramatsu K (2000). A new class of genetic element, Staphylococcus

cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus.

Antimicrobial Agents & Chemotherapy; 44: 154955.

Kechrid A, Perez-Vazquez M, Smaoui H, Hariga D, Rodriguez-Banos M, Vindel A,

Baquero, F, Canton R, Delcampo R (2010). Molecular analysis of community-

acquired methicillin-susceptible and resistance Staphylococcus aureus isolates

recovered from bacteraemic and osteomyelitis infections in children from Tunisia.

Clin Microbiol Infect; Sep7doci:10.1111/j.1469-0691.

Farlow J, Smith KL, Wong J, Abrams M, Lyrle M and Keim P (2001). Francisella

tularensis strain typing sing multiple locus, variable number tandem repeat

analysis. J Clin Microbiol; 39: 3186-3192.

Keim T, Oh PI & Simor AE (2001). The economic impact of methicillin-resistant

Staphylococcus aureus in Canadian hospitals. Infect. Control. Hosp. Epidemiol; 22:

99-104.

Kiethlbauch J A, Hannet GE, Salfinger M, Archinal W. Monserrat and Carlyn C (2000).

Use of the National Committee for clinical laboratory Standards for Disc diffusion

Susceptibility Testing in New York State Laboratories. J Clin Microbiol; 38(9):

3341-3346.


147

Kirby WWW (1944). Extraction of a highly potent penicillin inactivator from penicillin

resistant staphylococci. Science; 99: 452-3.

Klein E, Smith DL and Laxminarayam R (2007). Hospitalizations and deaths caused by

methicillin resistant Staphylococcus aureus, United States, 1999-2005. Emerg.

Infect.Dis; 13: 1840-1846.

Kloos WE and Jorgensen JH (1985). Staphylococci, In Lennette, EH, Balws A, Hausler

W J Jr and Shadomy H J (ed.), Manual of clinical microbiology, 4th ed. Amercian

Society for Microbiology, Washington, DC; 143-153.

Ko KS, Park S, Peck KR, Shin EJ, Oh, WS, Lee, NY & Song JH (2006). Molecular

Characterization methicillin resistant Staphylococcus aureus spread by neonates

transferred from primary Obstetrics clinics to a tertiary care hospital in Korea.

Infect Control Hosp Epidemiol; 27(6): 593-597.

Ko KS, LeeY, Suh JY, Oh WS, Peck KR, Lee NY & Song JH (2005). Distribution of

Major Genotypes among Methicillin Resistant Staphylococcus aureus in Asian

Countries. J Clin Microbiol; 43(1): 421-426.

Koneman WE, Allen, SD, Janda, WM and Schreckenberger PC (1997). Gram positive

bacteria. In: Koneman, E. W, Stephen, D, Allen, Janda WM and Schreckenberger

PC eds. Color Atlas and Textbook of Diagnostic Microbiology, New York:

Lippincot, Willam and Wilkin; P.539-579.

Koreen L, Srinivas V, Ramaswamy Graviss EA, Naidich S. Musser JM and Kreiswirth

BN (2005). Spa Typing methods for discriminating among Staphylococcus aureus

Isolates : Implicatiom for the use of a single Marker To Detect Genetic Micro and

Macrovariation. J Clin Microbiol; 42(2): 792-799.

Kuhl SA, Pattee PA, Baldwin JN (1978). Chromosomal map location of the methicillin

resistance determinant in Staphylococcus aureus. Journal of Bacteriology; 135:460-

5.

Kumari DN, Keer V, Hawkey PM, Parnell P, Joseph N, Richardson JF and Cookson B

(1997). Comparison and application of ribosomal spacer DNA amplicon


148

polymorphisms and pulsefield gel electrophoresis for differentiation of methicillin

resistant Staphylococcus aureus strains. J Clin Microbiol; 35: 881-885.

Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, Kobayashi I, Cui L, Oguchi A, Aoki

K, Nagai Y, Lian J, Ito T , Kanamori M, Matsumaru H, Maruyama A, Murakami H,

Hosoyama A, Mizutani-Ui Y, Takahashi NK, Sawano T, Inoue R, Kaito C,

Sekimizu K, Hirakawa H, Kuhara S, Goto S, Yabuzaki J, Kanehisa M, Yamashita

A, Oshima K, Furuya K, Yoshino C, Shiba T, Hattori M, Ogasawara N, Hayashi H,

Hiramatsu K (2001). Whole genome sequencing of meticillin-resistant

Staphylococcus aureus. Lancet; 357: 1225-40.

Kuwahara-Arai K, Kondo N, Hori S, Tateda-Suzuki E, Hiramatsu K (1996). Suppression

of methicillin resistance in a mecA-containing pre-methicillin-resistant

Staphylococcus aureus strain is caused by the mecI-mediated repression of PBP 2’

production. Antimicrobial Agents & Chemotherapy. 40: 2680-5.

Kwok AY and Chow AW (2003). Phylogenetic study of Staphylococcus and

Macrococcus species based on partial hsp60 gene sequences. Int. J. Syst Evol

Mecrobiol; 53: 87-92.

Landolo JJ (1990). The genetics of Staphylococcal toxins and virulence factors. In: I. C.

Gunsalus (ed.), The bacteria, vol. XI. Academic Press, New York; 399-426.

Lawrence DW, Barry AL, Toole RO, and Sherris JC (1972). Reliability of the Kirby-

Bauer Disc Diffusion Method for Detecting Methicillin-Resistant Strains of

Staphylococcus aureus. Appl Microbiol; 24(2): 240–247.

Lindsay JA, Moore CE, Day N, Peacock SJ, Witney AA, Stabler RA, Hussain SE,

Butcher PD and Hinds J (2006). Microarrays reveal that each of the ten dominant

lineages of Staphylococcus aureus has a unique combination of surface associated

and regulatory genes. J bacterial; 188: 669-676.

Lowy FD (1998). Staphylococcus aureus infections. N. Engl. J. Med; 32, 339-520.

Lyon BR, Skurray R (1987). Antimicrobial resistance of Staphylococcus aureus: genetic

basis. Microbiological Reviews; 51:88-134.


149

Madiraju MV, Brunner DP, Wilkinson BJ (1987). Effects of temperature, NaCl, and

methicillin on penicillin-binding proteins, growth, peptidoglycan synthesis, and

autolysis in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents &

Chemotherapy; 31:1727-33.

Maes N, Magdalena J, Rottiers S, De Dheldre Y, and Struelens MJ (2002). Evaluation of

triplex PCR Assay to Discriminate Staphylococcus aureus from Coagulase

Negative Staphylococci and Dtermine Methicillin Resistance from Blood Cultur. E

J Clin Microbiol; 40(4): 1514-1517.

Malanchowa N and Deleo FR (2010). Mobile genetic element of Staphylococcus aureus.

Cell Mol Life Sci; 67: 3057-3071.

Malanchowa N, Sabat A, Gniadkowski M, Kryszton-Russjan, Emple J, Jacek

Miedzobrodzki J, Kosowska-Shick, K, Appelbaum, PC, Hryniewicz W (2005).

Comparison of Multiple Locus Variable Number of Tandem Analysis with pulse

field gel electrophoresis, spa typing and Multilocus Sequence Typing for Clonal

Characterization of Staphylococcus aureus Isolates. J Clin Microbiol; 43(7): 3095-

3100.

Maslow JN, Mulligan ME, Arbeit RD (1993a). Molecular epidemiology: application of

contemporary techniques to the typing of microorganisms. Clinical Infectious

Diseases; 17: 153-164.

Maslow JN, Slutsky AM, Arbeit RD (1993b). Application of pulsed-field gel

electrophoresis to molecular epidemiology. In: DH Persing, TF Smith, FC Tenover,

and TJ White, editors. Diagnostic molecular microbiology - principles and

applications. 1st Edition. American Society for Microbiology, Washington DC; 563-

72.

Massidda O, Montanari MP, Mingoia M, Varaldo PE (1994). Cloning and expression of

the penicillinase from a borderline methicillin-susceptible Staphylococcus aureus

strain in Escherichia coli. FEMS Microbiology Letters; 119: 263-70.


150

Massidda O, Montanari MP, Varaldo PE (1992). Evidence for a methicillin-hydrolysing

beta-lactamase in Staphylococcus aureus strains with borderline susceptibility to this

drug. FEMS Microbiology Letters; 71: 223-7.

Matthews PR, Reed KC, Stewart PR (1987). The cloning of chromosomal DNA

associated with methicillin and other resistances in Staphylococcus aureus. J Gen

Microbiol; 133: 1919-29.

Matsuzaki S, Yasuda M, Nishikawa H, Kuroda M, Ujihara T, Shuin ShenY, Jin Z, Fuji

Moto S, Nasimuzzaman MD, Wakiguchi H, Sugihara S, Sugiura T, Koda S,

Muuraoka A and Imai S (2003). Expermental protection of mice against lethal

Staphylococcus aureus infection by novel bacteriophage Phi MR11. J. Infect. Dis.

187(4): 613-624.

Matsuhashi M, Song MD, Ishino F, Wachi M, Doi M, Inoue M, Ubukata K Yamashita N,

Konno M (1980). Molecular cloning of the gene of a penicillin-binding protein

supposed to cause high resistance to beta-lactam antibiotics in Staphylococcus

aureus. Journal of Bacteriology; 167: 975-80.

Matthews PR, Stewart PR. (1984). Resistance heterogeneity in methicillin-resistant

Staphylococcus aureus. FEMS Microbiology Letters; 22: 161-6.

Mc Dougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK & Tenover FC

(2003). Pulse field gel electrophoresistyping of oxicillin-resistant Staphylococcus

aureus isolates from the United States; establishing a national database. EJ Clin

Microbiol; 41: 5113-5120.

McDougal LK, Thornsberry C (1986). The role of beta-lactamase in staphylococcal

resistance to penicillinase-resistant penicillins and cephalosporins. Journal of

Clinical Microbiology; 23: 832-9.

McGowan JE. Terry PM, Huang TSR, Linstrom Houk C and Davis J (1979). Nosocomial

infection with gentamycin resistant Staphylococcus aureus. Plasmid analysis as an

epidemiologic tool. J Infect Dis; 140: 864-872.

Menzies BE (2003). The role of fibronectin binding proteins in the pathogenesis of

Staphylococcus aureus infections. Curr Opin Infect Dis; 16: 225-229.


151

Mitsuyama J, Yamada H, Maehana J, Fukuda Y, Kurose S, Minami S, Todo Y, Watanabe

Y, Narita H (1997). Characteristics of quinolone-induced small colony variants in

Staphylococcus aureus. Journal of Antimicrobial Chemotherapy; 39: 697-705.

Mongkolrattanothai K, Boyle S, Kahana MD and Daum RS (2003). Severe

Staphylococcal infections caused by clonally related community associated

methicillin susceptible and methicillin resistant isolates. Clin Infect Dis; 37(8):

1050-1058.

Moore PC and Lindsay JA (2002). Molecular characterization of the dominant UK

methicillin resistant Staphylococcus aureus strains, EMRSA-15 and EMRSA-16. J

Med Microbiol 51: 516-521.

Moreillon P, Entenza JM, Francioli P, Mcdevitt D, Foster TJ, Ois PF; Vaudaux, P.

(1995). Role of Staphylococcus aureus Coagulase and Clumping factor in

Pathogenesis of experimental Endocardititis. Infection and Immunity; 63(12): 4738-

4743.

Mulligan ME and Arbeit RD (1991). Epidemiology and clinical Utility of typing systems

for differentiating among strains of methicillin resistant Staphylococcus aureus.

Infect Cont Hosp Epidemiol; 12: 20-28.

Murakami, K, Tomasz A. (1989). Involvement of multiple genetic determinants in high-

level methicillin resistance in Staphylococcus aureus. Journal of Bacteriology; 171:

874-9.

Murray DL, Cathleen A, Earhart CA, Mitchell DT, Douglas H, Ohlendorf DH, Novick

RP, and Schlievert PM (1996). Localization of Biologically Important Regions on

Toxic Shock Syndrome Toxin 1. Infect. Immunity; 64(1): 371-374.

Musser and Kapur V (1992). Clonal analyis of methicillin resistant Staphylococcus

aureus strains from intercontinental sources: association of the mec gene

Staphylococcus aureus and with divergent phylogenetic lineages implies

dissemination by horizontal transfer and recombination. J Clin Microbiol; 30:

2058-2063.


152

National Committee for Clinical Laboratory Standards (1999). Methods for determining

bactericidal activity of antimicrobial agents; approved guideline. Wayne,

Pennsylvania, USA: NCCLS Document M26-A.

Nickerson EK, Wuthiekanun V, Day NP, Chaowagul W and Peacock SJ (2006).

Methicillin resistant Staphylococcus aureus in rural Asia. Lancet Infect Dis; 6:70-

71.

Niemeyer DM, Pucci MJ, Thanassi JA, Sharma VK, Archer GL (1996). Role of mecA

transcriptional regulation in the phenotypic expression of methicillin resistance in

Staphylococcus aureus. Journal of Bacteriology; 178: 5464-71.

Nishi J, Miyanohara H, Nakajima T, Kitajima I, Yoshinaga MMI, Miyata K (1995).

Molecular typing of the methicillin resistance determinant (mec) of clinical strains of

Staphylococcus based on mec hypervariable region length polymorphisms. Journal

of Laboratory & Clinical Medicine; 126: 29-35

Ogston A (1881). Report upon Mmicro organisms in surgical diseases. Brit Med J; 1:

369-375

Oliveira DC, Crisostomo I, Santos-Sanches I, Major P, Alves CR, Aires-de -Sousa M,

Thege MK, de Lencastre H. (2001). Comparison of DNA sequencing of the protein

A gene polymorphic region with other molecular typing techniques for typing two

epidemiologically diverse collections of methicillin-resistant Staphylococcus aureus.

Journal of Clinical Microbiology; 39: 574-80.

Olive DM and Bean P (1999). Priciple and application s of methods for DNA based

typing of microbial organisms. J Clin Microbio; l37(6): 1661-1669.

Orwin PM, Leung DYM, Donahue HL, Novick RP, Schlievert PM (2001). Biochemical

and Biological Properties of Staphylococcal Enterotoxin K. Infect Immunity; 69(1):

360-366.

Pal SC, Ghosh Ray B (1964). Methicillin resistant staphylococci. J Indian Med Ass;

42:512.

Parker MT (1972). Phage typing of Staphylococcus aureus. In Norris JR, Ribbons DW,

eds. Methods in microbiology, London Academic Press; 1-28.


153

Patti JM, Allen BL, McGavin MJ and Hooke M (1994). MSCRAMM-mediated

adherence of micro organism to host tissue. Annu Rev Microbiol; 48: 585-617.

Peacocok SJ, Silva GD, Justice A, Cowland A, Moore CE, Winearls CG and Day NP

(2002). Comparason of mutlilocus sequence typing and pulsefield gel

electrophoresis as tools for typing Staphylococcus aureus isolates in

microepidemiological settings. J Clin Microbiol; 40(10): 3764-3770.

Pelletier LL, Richardson M, Feist M (1979).Virulent gentamicin-induced small colony

variants of Staphylococcus aureus. Journal of Laboratory & Clinical Medicine; 94:

324-34.

Piriz DS, Kayser FH, Berger-Bachi B (2004). Impact of sar and agr on methicillin

resistance in Staphylococcus aureus. FEMS Microbiology Letters; 141: 255-60.

Petersson AC, Kamme C, Miorner H (1999). Disk with high oxacillin content

discriminates between methicillin-resistant and borderline methicillin- susceptible

Staphylococcus aureus strains in disk diffusion assays using a low salt concentration.


Pfaller M, Hollis RJ, Bale MJ (1992). Plasmid Fingerprinting of Staphylococci. In: HD

Isenberg, editors. Clinical Microbiology Procedures Handbook. 1st Edition

American Society for Microbiology, Washington DC; 10.3.1-10.3.6.

Piriz DS, Kayser FH, Berger-Bachi B (1996). Impact of sar and agr on methicillin

resistance in Staphylococcus aureus. FEMS Microbiology Letters; 141: 255-60.

Popovic T, Bopp CA, Olsvik O, Kiehlbauch JA (1993). Ribotyping in molecular

epidemiology. In: DH Persing, TF Smith, FC Tenover, and TJ White, editors.

Diagnostic molcular microbiology-principles and applications. 1st Edition,

Washington, DC. American Society for Microbiology; 573-83.

Preheim L, Pitcher D, Owen R and Cookson B (1991). Typing of methicillin resistant and

susceptible Staphylococcus aureus strains by ribosomal RNA gene restriction

pattern using a biotinylated probe. Eur. J. Clin Microbiol Infect Dis; 10: 428-436.


154

Prevost G, Jaulhac B and Piemont Y (1992). DNA fingerprinting by pulsefield gel

electrophoresis is more effective than ribotyping in distinguishing among

methicillin resistant Staphylococcus aureus isolates. J Clin Microbiol; 30: 967-973.

Proctor RA and Peter G (1998). Small colony variants in Staphylococcal infections:

Diagnostic and therapeutic implications. Clin. Infect. Dis; (27): 419-422.

Proctor RA, Balwit JM, Vesga O (1994). Variant subpopulations of Staphylococcus

aureus as cause of persistent and recurrent infections. Infectious Agents & Disease;

3: 302-12.

Proctor RA, van Langevelde P, Kristajansson M, Maslow JN and Arbeit RD et al (1995).

Persistant and relapsing infections associated with small colony variants of

Staphylococcus aureus. Clin Infect Dis; (20): 95-102.

Projan SJ and Novick RP (1997). The molecular basis of pathogenecity. In Crossley KB,

Archer GL, editors. The Staphylococci in human disease. Churchill Livingstone;

New York; 55-81.

Qoronflesh MW and Wilkinson BJ (1986). Effect off methicillin resistant and methicillin

susceptible Staphylococcus aureus in the presence of beta lactams on peptidoglycan

structure and susceptibility to lytic enzymes. Anti microbial agents and chemothery;

43: 94-9.

Ragle BE and Wardenburg JB (2009). Anti-Alpha- Hemolysin Monoclonal Antibiodies

Mediate Protection against Staphylococcud aureus Pneumonia Infect Immun; 77(7):

2712-2718.

Reynolds PE, Brown DF (1985). Penicillin-binding proteins of beta-lactam-resistant

strains of Staphylococcus aureus. Effect of growth conditions. FEBS Letters; 192:

28-32.

Rhinehart E, Shlaes DM, Keys TF, Serkey J, Kerkley B, Kim C, Currie-McCumber CA,

Hall G. (1987). Nosocomial clonal dissemination of methicillin resitant

Staphylococcus aureus: elucidation by plasmid analysis. Archives of Internal

Medicine; 147: 521-4.


155

Richardson JF, Aparicio P, Marples RR and Cookson BD (1994). Ribotyping of

Staphylococcus aureus: an assessment using well defined strains. Epidemiol. Infect;

112: 93-101.

Richardson JF and Reith S (1993). Characterization of a strain of methicillin resistant

Staphylococcud aureus (EMRSA-15) by conventional and molecular methods. J

Hosp Infect; 25: 45-52

Richmond MH (1965). Wild-type variants of exopenicillinase from Staphylococcus

aureus. Biochem J; 94: 584.

Richmond MH (1967). A second regulatory region involved in penicillinase synthesis in

Staphylococcus aureus. J Mol Bio; 26: 357-60.

Robinson, DA and Enright, MC (2004). Multilocus sequence typing and the evolution of

methicillin resistant Staphylococcus aureus. Clin Microbiol Infect; 10(2): 92-97.

Robinson DA & Enright MC (2003). Evolutionary mode of emergence of methicillin

resistant Staphylococcus aureus. Antimicrob Agent Chemother; 47: 3926-3934.

Rosenbach FJ (1884). Mickro Organismen bei den. In: Wund-Infections. Krankheiten de

Menschen JF, Bergmen, ed. Wiesbaden, Germany; 1-122.

Roth E.P, Diaz F.L, Batista N, Moreno A. & Alvarez S.M. (2004) Tracking methicillin

resistant Staphylococcus aureus in clones during a 5 year period (1998 to 2002) in

Spanish Hospital. J Clin Microbiol; 42: 4649-4656.

Ryan KJ (2004). Staphylococci. In: Sherris Medical Microbiology. Eds: Ryan KJ and

Ray CG, 4th Ed. McGraw Hill. New York; 261-271.

Ryffel C, Kayser FH, Berger-Bachi B (1992). Correlation between regulation of mecA

transcription and expression of methicillin resistance in staphylococci. Antimicrobial

Agents & Chemotherapy; 36: 25-31.

Sabat A, Russjan JK, Strzalka W, Fillipek R, Kosowska K, Hryniewz W, Travis J &

Potempa J (2003). New methods for typing Staphylococcus aureus strains:

multiple-locus variable number tandem repeat analysis of polymorphism and

genetic relationship of clinical isolates. J Clin Microbiol; 41: 1801-1804.


156

Schentag JJ, Hyatt JM, Carr JR, Paladino JA, Birmingham MC, Zimmer GS and Cumbo

TJ (1998). Genesis of methicillin resistant Staphylococcus aureus, how treatment of

MRSA infections has selected for vancomycin-resistant Enterococcus faecium, and

the importace of antibiotic management and infection control. Clin Infect Dis;

26(5): 1204-1214.

Schwartz DC and Cantor CR (1984). Separation of yeast chromosome sized DNAs by

pulse field gradient gel electrophoresis. Cel; 37: 67-75.

Selander RK, Caugant DA, Ochman H, Musser J, Gilmour, MN and Whittam TS (1986).

Methods of multilocus enzyme electrophoresis for bacterial population genetics and

systematics. Appl Env Microbiol; 51: 873-883.

Seligman SJ (1969). Phenotypic variability in penicillin resistance in a methicillin-

resistant strain of Staphylococcus aureus. Antimicrobial Agents & Chemotherapy, 9:

90-3.

Shabir S, Hardy KJ, Abbassi WS, McMurray CL, Malik SA, Wattal C, Hawkey PM

(2010). Epidemiological typing of methicillin-resistant Staphylococcus aureus

isolates from Pakistan and India. J Med Micobiol; 59: 330-337.

Shands KN, Schmid, GP, Dan BB, Blum D, Guidotti RJ, Hargrett, NT, Anderson RL, Hil

DL, Broome CV, Band JD and Fraser DW (1980) Toxic shock syndrome in

menstruating women-its association with tampon use and Staphylococcus aureus

and the clinical features in 52 cases. N Engl J Med; 303: 1436-1442.

Shopsin B, Gomes M, Montgomery SO, Smith DH, Waddington M, Dodge DE, Bost

DA, Riehman M, Naidich S, Kreiswirth BN (1999). Evaluation of protein A gene

polymorphic region DNA sequencing for typing of Staphylococcus aureu strains.


Smyth DS, McDougal LK, Gran FW, Manoharan A, Enright MC, Song JH, de Lencastr

H and Robinson DA (2009). Population Structure of hybrid clonal Group of

Methicillin-Resistant Staphylococcus aureus ST239-MRSA-III. PLoS One; 5(1):

8582.


157

Song JH, Hsueh PR, Chung DR et al (2011). Spread of methicillin-resistant

Staphylococcus aureus between the community and the hospitals in Asian

countries: an ANSORP study. J Antimicrob Chemother; 66: 1061-1069.

Song MD, Wachi M, Doi M, Ishino F, Matsuhashi M. (1987). Evolution of an inducible

penicillin-target protein in methicillin-resistant Staphylococcus aureus by gene

fusion. FEBS Letters; 221: 167-71.

Speller DC, Johnson AP, James D, Marples R, Charlett A, George RC (1997). Resistance

to methicillin and other antibiotics in isolates of Staphylococcus aureus from blood

and cerebrospinal fluid. England and Wales, 1989-95. Lancet; 350(9074), 323-325.

Steinberg JP, Clark CC, Hackman BO (1996). Nosocomial and community-acquired

Staphylococcus aureus bacteramias from 1980 to 1993: Impact of Intravascular

devices and methicillin resistance. Clin Infect Dis; 23(2): 255-259.

Struelens MJ, Nonhoff C, van der AP, Mertens R, Serruys E (1995). Evaluation of Rapid

ATB Staph for 5-hour antimicrobial susceptibility testing of Staphylococcus aureus.

Groupement pour le Depistage, L’Etude et la Prevention des Infections

Hospitalieres-Groep ter Opsporing, Studie en Preventie van Infecties in de

Ziekenhuizen. Journal of Clinical Microbiology; 33:2395-9.

Su YC and Wong AC (1995). Identification and purification of a new Staphylococcal

enterotoxin. H Appl Environ Microbiol; 61: 1438-1443.

Suzuki E, Kuwahara-Arai K, Richardson JF, Hiramatsu, K, (1993) Distribution of mec

regulator genes in methicillin-resistant Staphylococcus clinical strains. Antimicrobial

Agents & Chemotherapy 37:1219-26.

Tandem repeat finder V.4.03. http://tandem.bu.edu/trf.html.

Tautz D and Schlotterer C (1994). Simple sequences. Curr Opin Genet Dev; 4: 832-837

Tesch W, Strassle A, Berger Bachi B, O’ Hara D, Reynolds P, Kasyer FH (1988).

Cloning and expression of methicillin resistance from Staphylococcus epidermidis

in Staphylococcus carnosus. Antimicrobial Agents and Chemotherpy; 32: 1494-9.


158

Tesch W, Ryffel C, Strassle A, Kasyer FH, Berger Bachi B. (1990). Evidence of a novel

Staphylococcal mecA encoded element (mecR) controlling expression of pencillin-

binding protein 2‘. Antimicrobial agent and chemotherpy; 32: 1494-9

Tenover FC, Arbeit RD and Goering RV (1997). How to select and interpret molecular

strain typing methods for epidemiological studies of bacterial infections: a review

for the healthcare epidemiologist. Infect. Control Hosp. Epidemiol.18:426-438.

Tenover FC, Arbeit, RD, Gering RV, Patricia A, Mickelsen, PA, Murray BE, Persing DH

and Swaminnathan B (1995). Interpreting chromosomal DNA restriction pattern

produced by pulsed-field gel electrophoresis: criteria for the bacterial strain typing.

J Clin Microbiol; 33: 2233-2239.

Tenover FC, Arbei, RD, Archer G, Biddle J, Byrne S, Goering R, Hancock S, Hebert GA,

Hill N, Hollis R, Jarvis WR, Kreiswirth B, Eisner W, Maslow J, McDougal lK,

Miller JM, Mulligen M and Pfaller MA (1994). Comparason of traditional and

molecular methods of typing of isolates of Staphylococcus aureus. J Microbiol; 32:

407-415

Tenover FC (1992). Introduction to molecular biology techniques. In: HD Isenberg,

editors. Clinical Microbiology Procedures Handbook. 1st Edition. American Society

for Microbiology, Washington, DC; 10.1.1 -10.1.5.

Tudor K (2008): http://www.text bookofbacteriobiology.net

Todd J, Fishaut M, Kapral F and Welch T. (1978). Toxic Shock Syndrome Associated

with phage group-I Staphylococci. Lancet II; 1116-1118.

Tsang VC, Peralta JM, Simons AR (1983). Enzyme-linked immunoelectrotransfer blot

techniques (EITB) for studying the specificities of antigens and antibodies separated

by electrophoresis. Methods Enzymol; 92: 377-91.

Tung H, Guss B, Hellman U, Persson L, Rubin K and Ryden C (2000). A bone

sialoprotein-binding protein from Staphylococcus aureus: a member of the

Staphylococcal Sdr family. Biochem J; 345: 611-619.

Ubukata K, Nonoguchi R, Song MD, Matsuhashi M, Konno M (1990). Homology of

mecA gene in methicillin-resistant Staphylococcus haemolyticus and Staphylococcus


159

simulans to that of Staphylococcus aureus. Antimicrobial Agents & Chemotherapy;

34: 170-2.

Ubukata K, Nonoguchi R, Matsuhashi M, Konno M (1989). Expression and inducibility in

Staphylococcus aureus of the mecA gene, which encodes a methicillin- resistant S.

aureus-specific penicillin-binding protein. Journal of Bacteriology; 171: 2882-5.

Udo EE and Sarkhoo, E (2010). Genetic analysis of high-level mupirocin resistance in

the ST80 clone of community associated methicillin resistant Staphylococcus

aureus. J Med Microbiol; 59: 193-199.

Van Belkum, A, van Leeuwen, Wukmann, ME, Cookson B, Forey F, Etienne J, Goering

R, Tenover F, Steward C, O’Brien F, Grubb W, Tessios P, Legakis N, Morvan A,

El Solh N, de Ryck R, Struelens M, Salmenlinna S, Vuopio-Varkila J, Kooistra M,

Talens A, Whitte W and Verburgh H (1998). Assessment of resolution and

interceter reproducibity of results of genotyping Staphylococcus aureus by

pulsefield gel electrophoresis of SmaI macrorestriction fragments: a multicentre

Study. J Clin Microbiol; 36(6): 1653-1659.

Van der Ende A, Hopman CT and Dankert J (2000). Multiple mechanism of phase

variation of PorA in Neisseria meningitis. Infection and immunity; 68: 8307-12.

Vandenesch F, Naimi T, Enright M, Lina G, Nimmo G, Heffernan H, Liassine N, Bes M,

Greenland T, Reverdy ME and Etiene J (2003). Community acquired methicillin

resistant Staphylococcus aureus carrying Panton Valentine leukocidin genes. World

wide emergence. Emerg Macrolides Drugs; 51: 20-30.

Varaldo PE (1993). The borderline methicillin-susceptible’ Staphylococcus aureus.

Journal of Antimicrobial Chemotherapy; 31: 1-4.

Venezia RA, Harris V, Miller C, Peck H, San Antonio M. (1992). Investigation of an

outbreak of methicillin-resistant Staphylococcus aureus in patients with skin disease

using DNA restriction patterns. Infection Control & Hospital Epidemiology; 13:

472-6.

Vickery A (1997). Lack of plasmids in Australian MRSA isolates. Personal

Communication Gosbell IB; 1997b.


160

Vinces MD, Leggendre M, Caldara M, Hagihara M and Verstrepen KJ (2009). Unstable

tandem repeats in promoters confer transcriptional evolvability. Science; 324: 1413-

6.

Waldron DE and Lindsay JA (2006). SauI: a novel lineage specific type-I restriction

modification system that blocks horizontal gene transfer into Staphylococcus aureus

and between S. aureus isolates of different lineages. J Bacteriol. 188: 5578-5585.

Wang R, Braughton KR, Kretschmer D, Batch TH, Queck SY, LiM, Kennedy AD,

Dorward, DW, Klebanoff SJ, Peschel A, Deleo FR, Otto M (2007). Identification of

novel cyclolytic peptides as key virulence determinants for the community

associated MRSA. Nat. Med; 13: 1510-1514.

Weinstein L (1975). The penicillins. (In: L Goodman and A Gilman, editors. The

pharmacological basis of therapeutics, New York: Macmillan; 1153.

Weller TM (2000). Methicillin resistant Staphylococcus aureus typing methods: which

should be the international standard? J Hosp Infect; 44: 160-172.

Wilkinson BJ, Nadakavukaren MJ (1983). Methicillin-resistant septal peptidoglycan

synthesis in a methicillin-resistant Staphylococcus aureus strain. Antimicrobial

Agents & Chemotherapy; 23: 610-3.

Winters MA, Goering RV, Boon SE, Morin R, Sorensen M, Snyder L (1993). Comparing

plasmid typing with chromosomal analysis by field inversion gel electrophoresis.

Med Microbiol Lett; 2: 33-41.

Wisniewski-Dye F and Vial L (2008). Phase and antigenic variation mediated by genome

modification. Antonie van Leevanhock; 94: 496-915.

Wu CY, Hoskins J, Blaszczak LC, Preston DA, Skatrud PL (1992). Construction of a

water-soluble form of penicillin-binding protein 2a from a methicillin- resistant

Staphylococcus aureus isolate. Antimicrobial Agents & Chemotherapy; 36: 533-9.

Wu CY, Alborn W, Flokowitsch J.E, Hoskins J, Unal S, Blaszczak LC, Preston DA,

Skatrud P L (1994). Site-directed mutagenesis of the mecA gene from a methicillin-

resistant strain of Staphylococcus aureus. Journal of Bacteriology; 176: 443-9.


161

Yamaguchi T, Murakami K (1994). Cloning and characterization of a gene affecting the

methicillin resistance level and the autolysis rate in Staphylococcus aureus. Journal

of Bacteriology; 176: 4993-5000.

Yoshida T, Kondo N, Hanifah YA, Hiramatsu K (1997). Combined use of ribotyping,

PFGE and IS431 typing in the discrimination of nosocomial strains of methicillin

resistant Staphylococcus aureus from human sources. Infect Immunol 41: 687-695.

Yoshida K (1970). Biological and immunological properties of encapsulated strains of

Staphylococcus aureus from human sources. Infect. Immun; 28: 528-532.

Zafar M, Stone S, Ibrahim Z, Khan HE, Hasan R, Wain J & Bamford K (2011). Prevalent

genotypyes of methicillin resistant Staphylococcus aureus: report from Pakistan. J

Med Microbiol; 60: 56-62.

Zuccarelli AJ, Roy I, Harding GP, Couperus JJ (1990). Diversity and stability of

restriction enzyme profiles of plasmid DNA from methicillin-resistant

Staphylococcus aureus. Journal of Clinical Microbiology; 28: 97-102.


162

Appendix- I

Table 13: Pakistani MRSA Isolates obtained from Hospitals of Rawalpindi/Islamabad.

S. No. S. aureus

Isolates

Clinical Source S. No. S. aureus

Isolates

Clinical Source

1 P.1 Pus 30 P.2006 Tissue Fluid

2 P.2 Pus 31 P.2054 Catheter tip


4 P.4 Pus 33 P.2112 Sputum

5 P.5 Sputum 34 P.2113 Sputum

6 P.6 Urine 35 P.2119 Pus

7 P.7 Pus 36 P.2255 Pus

8 P.8 Ear Infection 37 P.2285 Pus

9 P.843 Pus 38 P.2871 Sputum

10 P.844 Pus 39 P.2885 Spinal Card

11 P.862 Urine 40 P.2886 Catheter tip

12 P.1003 Tissue fluid 41 P.2887 Tissue Fluid

13 P.1005 Pus 42 P.2896 Spinal card

14 P.1009 Pus 43 P.3027 Catheter tips

15 P.1123 Catheter tip 44 P.3727 Sputum


17 P.1286 Sputum 46 P.5020 Pus






23 P.1896 Ear Infection 52 P.8116 Catheter tip

24 P.1961 Sputum 53 P.8431 Spinal Card

25 P.1962 Sputum 54 P.8485 Pus

26 P.1963 Urine 55 P.8486 Pus

27 P.1964 Urine 56 P.8487 Pus

28 P.1966 Sputum 57 P.8668 Ear Infection

29 P.1967 Catheter tip 58 P.8823 Pus


163

Table 13 (Continue)

S. No. S. aureus

Isolates


Isolates

Clinical Source

59 P.10012 Sputum 89 P.18431 Pus

60 P.10013 Tissue Fluid 90 K.3 Ear Infection

61 P.10015 Sputum 91 K.6 Sputum

62 P.10019 Pus 92 K.8 Catheter tip



65 P.11293 Pus 93 K.10 Sputum

66 P.11296 Pus 94 K.11 Pus

67 P.12006 Pus 95 K.12 Pus

68 P.12007 Sputum 96 K.13 Catheter tip

69 P.12285 Pus 97 A.379 Ear Infection

70 P.13714 Pus 98 A.465 Pus

71 P.13729 Catheter Tip 99 A.1761 Ear Infection

72 P.13731 Pus 100 A.5053 Catheter tips

73 P.13740 Pus 101 A.5054 Catheter tip

74 P.13741 Pus 102 A.7145 Pus

75 P.13749 Pus 103 A.9077 Blood

76 P.13947 Catheter tip 104 A.9313 Pus

77 P.14313 Pus 105 A.9445 Blood

78 P.14946 Sputum 106 A.9703 Catheter tip

79 P.14947 Pus 107 A.9781 Blood



82 P.16809 Sputum 110 A.9965 Pus

83 P.16849 Pus 111 A.10813 Pus







164

Table 14: Showing the amplicon sizes for the 123 Pakistani MRSA Isolates and NCTC 8325 and Mu50 (Positive control strains) obtained after Gene Scan for the clfA, clfB, sdrD,sdrC,spa sspa and sav1078 loci.

S.No. Strains IDs

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

1 NCTC 8325

1027 822 659 762 300 155 317

2 Mu-50 1050 822 768 634 276 174 317

3 P.1 900 884 704 560 157 155 317

4 P.2 846 935 704 548 157 155 317

5 P.3 900 974 756 506 276 155 317

6 P.4 900 902 756 560 181 155 317

7 P.5 900 884 756 560 181 155 317

8 P.6 1045 864 756 548 276 155 317

9 P.7 900 935 704 548 276 155 317

10 P.8 846 884 756 548 181 155 317

11 P.843 846 935 756 548 276 155 317

12 P.844 846 935 756 548 276 155 317

13 P.862 1045 864 756 548 276 155 317

14 P.1003 900 935 756 548 229 155 317

15 P.1005 900 902 704 560 181 155 317

16 P.1009 900 902 704 560 181 155 317

17 P.1123 1045 902 741 548 181 155 317

18 P.1129 900 902 704 560 181 155 317

19 P.1286 953 935 641 548 253 155 317

20 P.1287 900 902 741 560 181 155 317

21 P.1297 882 902 741 560 181 155 317

22 P.1843 846 935 756 548 276 155 317

23 P.1863 1045 864 756 548 276 155 317

24 P.1864 1045 864 756 548 276 155 317

25 P.1896 846 884 704 548 181 155 317

26 P.1961 864 864 756 548 276 155 317

27 P.1962 900 864 756 548 276 155 317bp

28 P.1963 1045 864 756 548 276 155 317

29 P.1964 1045 864 756 548 276 155 317

30 P.1966 900 935 756 548 276 155 317

31 P.1967 1045 902 756 548 276 155 317


165

Table 14 (Continue)

S.No. Strains IDs

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

32 P.2006 900 864 756 548 276 155 317

33 P.2054 882 974 756 506 229 155 317

34 P.2111 882 935 756 548 253 155 317

35 P.2112 900 935 756 548 276 155 317

36 P.2113 900 935 756 548 253 155 317

37 P.2119 882 935 756 548 229 155 317

38 P.2255 953 902 704 548 157 155 317

39 P.2285 900 902 704 560 181 155 317

40 P.2871 846 884 704 560 157 155 317

41 P.2885 846 884 756 548 276 155 317

42 P.2886 900 884 704 548 181 155 317

43 P.2887 900 884 756 548 276 155 317

44 P.2896 846 884 756 548 276 155 317

45 P.3027 1062 935 756 548 276 155 317

46 P.3727 900 864 756 548 276 155 317

47 P.5019 1045 884 704 548 276 155 317

48 P.5020 846 935 756 548 276 155 317

49 P.5114 1062 902 704 560 181 155 317

50 P.5119 900 902 704 560 181 155 317

51 P.5123 953 935 756 548 229 155 317

52 P.6269 1062 935 756 548 276 155 317

53 P.6270 864 935 756 548 253 155 317

54 P.8116 900 884 704 548 181 155 317

55 P.8431 846 884 756 548 276 155 317

56 P.8485 846 935 756 548 276 155 317

57 P.8486 846 935 756 548 276 155 317

58 P.8487 846 935 756 548 276 155 317

59 P.8668 900 902 704 548 181 155 317

60 P.8823 1045 935 756 658 276 155 317

61 P.10012 846 935 756 548 229 155 317

62 P.10013 900 935 756 548 229 155 317


166

Table 14 (Continue)

S.No. Strains ID

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

63 P.10015 900 935 704 548 229 155 317

64 P.10019 953 935 756 548 253 155 317

65 P.10021 900 935 756 548 253 155 317

66 P.11291 900 935 756 560 253 155 317

67 P.11293 900 902 741 560 181 155 317

68 P.11296 846 935 756 548 276 155 317

69 P.12006 900 884 704 560 157 155 317

70 P.12007 900 935 756 560 181 155 317

71 P.12285 900 902 704 560 181 155 317

72 P.13714 900 935 756 548 253 155 317

73 P.13729 953 935 756 548 276 155 317

74 P.13731 900 902 756 548 181 155 317

75 P.13740 900 902 741 560 181 155 317

76 P.13741 900 902 741 560 181 155 317

77 P.13749 882 935 756 548 229 155 317

78 P.13947 1045 974 756 548 276 155 317

79 P.14946 882 974 756 506 276 155 317

80 P.14313 1027 1102 704 481 205 155 317

81 P.14947 900 974 756 548 276 155 317

82 P.15415 900 974 704 548 276 155 317

83 P.16509 900 902 704 560 181 155 317

84 P.16809 953 935 641 560 253 155 317

85 P.16849 900 902 704 560 181 155 317

86 P.17120 1062 935 756 548 276 155 317

87 P.17121 882 935 756 481 276 155 317

88 P.18119 846 935 756 560 276 155 317

89 P.18176 882 902 756 506 276 155 317

90 P.18339 900 902 704 560 181 155 317

91 P.18431 846 935 756 548 276 155 317

92 K.3 900 902 704 548 181 155 317

93 K.6 900 884 756 548 181 155 317


167

Table 14 (Continue)

S.No. Strains ID

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

94 K.8 1045 935 756 548 276 155 317

95 K.10 900 864 756 548 276 155 317

96 K.11 900 902 756 548 181 155 317

97 K.12 882 822 756 506 157 155 317

98 K.13 953 935 756 548 276 155 317

99 A.379 900 902 756 481 181 155 317

100 A.465 900 902 704 560 181 155 317

101 A.1761 900 902 595 560 181 155 317 102 A.5053 882 974 756 506 276 155 317

103 A.5054 882 974 756 506 276 155 317

104 A.7145 900 974 756 548 276 155 317 105 A.9077 1045 935 756 324 276 155 317 106 A.9313 540 992 756 548 229 155 317 107 A.9445 1045 935 756 324 276 155 317 108 A.9703 882 974 756 506 276 155 317 109 A.9781 1045 935 756 324 276 155 317

110 A.9914 1045 935 756 548 276 155 317 111 A.9954 900 935 756 481 276 155 317 112 A.9965 900 884 704 560 157 155 317

113 A.10813 540 992 756 548 229 155 317 114 A.11241 882 974 756 506 276 155 317 115 A.13282 1027 1102 501 481 205 155 317

116 A.13319 900 935 756 548 276 155 317 117 A.13730 882 974 756 506 276 155 317

118 A.14075 882 935 756 548 276 155 317 119 A.14254 846 935 756 548 276 155 317

120 A.14256 1045 935 756 324 276 155 317 121 A.15330 1045 935 756 548 276 155 317

122 A.25356 1045 935 756 324 276 155 317 123 A.26163 900 884 704 560 157 155 317

124 A.35045 900 902 704 560 181 155 317 125 A.35087 1045 935 756 524 276 155 317


168


169


170


171


172


173


174


175

Table 16: Showing the Spa sequencing results with selected 26 MRSA isolates from Pakistan.

S. No. Strain

ID

Repeat Sequences Repeat IDs

Kreiswirth IDs SPA type

1 P.2113 1- GAGGAAGACAATAACAAGCCTGGC

2- AAAGAAGACAACAACAAGCCTGGT

3- AAAGAAGACAACAAAAAGCCTGGC

4- AAAGAAGACGGCAACAAGCCTGGT

5- AAAGAAGACAACAAAAAACCTGGT

6- AAAGAAGATGGCAACAAGCCTGGT


8- AAAGAAGACGGCAACAAGCCTGGC

9- AAAGAAGATGGCAACAAACCTGGT

r11

r12

r05

r17

r34

r24

r34

r22

r25

YGCMBQBLO t451

2. P.18431 1- GAGGAAGACAATAACAAGCCTGGC

2- AAAGAAGACAATAACAAGCCTGGC









r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064





r11

r19

r12

r05

YHGCMBQBLO t064


176

Table 16 (Continue)

S.No. Strain

ID









r17

r34

r24

r34

r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064

6 A.14254 1- GAGGAAGACAATAACAAGCCTGGC










r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064







r11

r19

r12

r05

r17

r34

YHGCMBQBLO t064


177

Table 16 (Continue)

S.No. Strain

ID







r24

r34

r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064









r11

r19

r12

r05

r17

r34

r24

r34

YHGCMBQBLO t064


178

Table 16 (Continue)

S.No. Strain

ID




10- AAAGAAGATGGCAACAAACCTGGT r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064

12 K.8 1- GAGGAAGACAATAACAAGCCTGGC










r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064


179

Table 16 (Continue)

S. No. Strain

ID



14 A.9313

1- GAGGAAGACAACAACAAGCCTGGC


3- AAAGAAGACGGCAACAAACCTGGT

4- AAAGAAGACAACAAAAAACCTGGC





r15

r12

r16

r02

r25

r17

r24

r24

WGKAOMQQ t275

15 P.10813









r15

r12

r16

r02

r25

r17

r24

r24

WGKAOMQQ t275

16 A.13282








r15

r12

r16

r02

r25

r17

r24

WGKAOMQ t037

17 P.14947 1-GAGGAAGACAACAACAAGCCTGGC










r15

r12

r16

r02

r24

r16

r02

r25

r17

r24

WGKAQKAOMQ t987


180

Table 16 (Continue)

S. No. Strain

ID



18 A.5053 1-GAGGAAGACAACAACAAGCCTGGC










r15

r12

r16

r02

r24

r16

r02

r25

r17

r24

WGKAQKAOMQ t987

19 P.1286










r15

r12

r16

r02

r16

r02

r25

r17

r24

WGKAKAOMQ t021

20 P.8 1- GAGGAAGACAACAACAAGCCTGGC






r15

r12

r16

r02

r24

r24

WGKAQQ t030







r15

r12

r16

r02

r24

r24

WGKAQQ t030


181

Table 16 (Continue)

S.No. Strain

ID





3-AAAGAAGACGGCAACAAACCTGGT

4-AAAGAAGACAACAAAAAACCTGGC


6-AAAGAAGATGGCAACAAGCCTGGT

r15

r12

r16

r02

r24

r24

WGKAQQ t030







r15

r12

r16

r02

r24

r24

WGKAQQ t030

24 A.26163

1- GAGGAAGACAACAACAAGCCTGGT





r08

r16

r02

r24

r24

XKAQQ t632

25 P.12006






r08

r16

r02

r24

r24

XKAQQ t632

26 P.1






r08

r16

r02

r24

r24

XKAQQ t632


182

Figure 48

Showing Sequence data of arcC gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.

Figure 49

Showing Sequence data of aroE gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.


183

Figure 50

Showing Sequence data of glp gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.

Figure 51

Showing Sequence data of gmk gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.


184

Figure 52

Showing Sequence data of pta gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 4.

Figure 53

Showing Sequence data of tpi gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 62.


185

Figure 54

Showing Sequence data of yqil gene locus of S. aureus strain P.2113 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.


186

Figure 55

Showing Sequence data of arcC gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 2.

Figure 56

Showing Sequence data of aroE gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.


187

Figure 57

Showing Sequence data of glp gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.

Figure 58

Showing Sequence data of gmk gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.


188

Figure 59

Showing Sequence data of pta gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 4.

Figure 60

Showing Sequence data of tpi gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 4.


189

Figure 61

Showing Sequence data of yqil gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.


190

Figure 62


Figure 63



191

Figure 64


Figure 65



192

Figure 66


Figure 67



193

Figure 68


Appendix-I

162

Appendix- I

Table 13: Pakistani MRSA Isolates obtained from Hospitals of Rawalpindi/Islamabad.

S. No. S. aureus

Isolates


Isolates

Clinical Source

1 P.1 Pus 30 P.2006 Tissue Fluid



4 P.4 Pus 33 P.2112 Sputum

5 P.5 Sputum 34 P.2113 Sputum

6 P.6 Urine 35 P.2119 Pus

7 P.7 Pus 36 P.2255 Pus


9 P.843 Pus 38 P.2871 Sputum

10 P.844 Pus 39 P.2885 Spinal Card


12 P.1003 Tissue fluid 41 P.2887 Tissue Fluid

13 P.1005 Pus 42 P.2896 Spinal card

14 P.1009 Pus 43 P.3027 Catheter tips

15 P.1123 Catheter tip 44 P.3727 Sputum


17 P.1286 Sputum 46 P.5020 Pus






23 P.1896 Ear Infection 52 P.8116 Catheter tip

24 P.1961 Sputum 53 P.8431 Spinal Card

25 P.1962 Sputum 54 P.8485 Pus

26 P.1963 Urine 55 P.8486 Pus

27 P.1964 Urine 56 P.8487 Pus

28 P.1966 Sputum 57 P.8668 Ear Infection

29 P.1967 Catheter tip 58 P.8823 Pus

Appendix-I

163

Table 13 (Continue)

S. No. S. aureus

Isolates


Isolates

Clinical Source

59 P.10012 Sputum 89 P.18431 Pus

60 P.10013 Tissue Fluid 90 K.3 Ear Infection





65 P.11293 Pus 93 K.10 Sputum

66 P.11296 Pus 94 K.11 Pus

67 P.12006 Pus 95 K.12 Pus

68 P.12007 Sputum 96 K.13 Catheter tip

69 P.12285 Pus 97 A.379 Ear Infection

70 P.13714 Pus 98 A.465 Pus

71 P.13729 Catheter Tip 99 A.1761 Ear Infection

72 P.13731 Pus 100 A.5053 Catheter tips


74 P.13741 Pus 102 A.7145 Pus

75 P.13749 Pus 103 A.9077 Blood


77 P.14313 Pus 105 A.9445 Blood

78 P.14946 Sputum 106 A.9703 Catheter tip

79 P.14947 Pus 107 A.9781 Blood



82 P.16809 Sputum 110 A.9965 Pus

83 P.16849 Pus 111 A.10813 Pus






Appendix-I

164

Table 14: Showing the amplicon sizes for the 123 Pakistani MRSA Isolates and NCTC 8325 and Mu50 (Positive control strains) obtained after Gene Scan for the clfA, clfB, sdrD,sdrC,spa sspa and sav1078 loci.

S.No. Strains IDs

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

1 NCTC 8325

1027 822 659 762 300 155 317

2 Mu-50 1050 822 768 634 276 174 317

3 P.1 900 884 704 560 157 155 317

4 P.2 846 935 704 548 157 155 317

5 P.3 900 974 756 506 276 155 317

6 P.4 900 902 756 560 181 155 317

7 P.5 900 884 756 560 181 155 317

8 P.6 1045 864 756 548 276 155 317

9 P.7 900 935 704 548 276 155 317

10 P.8 846 884 756 548 181 155 317

11 P.843 846 935 756 548 276 155 317

12 P.844 846 935 756 548 276 155 317

13 P.862 1045 864 756 548 276 155 317

14 P.1003 900 935 756 548 229 155 317

15 P.1005 900 902 704 560 181 155 317

16 P.1009 900 902 704 560 181 155 317

17 P.1123 1045 902 741 548 181 155 317

18 P.1129 900 902 704 560 181 155 317

19 P.1286 953 935 641 548 253 155 317

20 P.1287 900 902 741 560 181 155 317

21 P.1297 882 902 741 560 181 155 317

22 P.1843 846 935 756 548 276 155 317

23 P.1863 1045 864 756 548 276 155 317

24 P.1864 1045 864 756 548 276 155 317

25 P.1896 846 884 704 548 181 155 317

26 P.1961 864 864 756 548 276 155 317

27 P.1962 900 864 756 548 276 155 317

28 P.1963 1045 864 756 548 276 155 317

29 P.1964 1045 864 756 548 276 155 317

30 P.1966 900 935 756 548 276 155 317

31 P.1967 1045 902 756 548 276 155 317

Appendix-I

165

Table 14 (Continue)

S.No. Strains IDs

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

32 P.2006 900 864 756 548 276 155 317

33 P.2054 882 974 756 506 229 155 317

34 P.2111 882 935 756 548 253 155 317

35 P.2112 900 935 756 548 276 155 317

36 P.2113 900 935 756 548 253 155 317

37 P.2119 882 935 756 548 229 155 317

38 P.2255 953 902 704 548 157 155 317

39 P.2285 900 902 704 560 181 155 317

40 P.2871 846 884 704 560 157 155 317

41 P.2885 846 884 756 548 276 155 317

42 P.2886 900 884 704 548 181 155 317

43 P.2887 900 884 756 548 276 155 317

44 P.2896 846 884 756 548 276 155 317

45 P.3027 1062 935 756 548 276 155 317

46 P.3727 900 864 756 548 276 155 317

47 P.5019 1045 884 704 548 276 155 317

48 P.5020 846 935 756 548 276 155 317

49 P.5114 1062 902 704 560 181 155 317

50 P.5119 900 902 704 560 181 155 317

51 P.5123 953 935 756 548 229 155 317

52 P.6269 1062 935 756 548 276 155 317

53 P.6270 864 935 756 548 253 155 317

54 P.8116 900 884 704 548 181 155 317

55 P.8431 846 884 756 548 276 155 317

56 P.8485 846 935 756 548 276 155 317

57 P.8486 846 935 756 548 276 155 317

58 P.8487 846 935 756 548 276 155 317

59 P.8668 900 902 704 548 181 155 317

60 P.8823 1045 935 756 658 276 155 317

61 P.10012 846 935 756 548 229 155 317

62 P.10013 900 935 756 548 229 155 317

Appendix-I

166

Table 14 (Continue)

S.No. Strains ID

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

63 P.10015 900 935 704 548 229 155 317

64 P.10019 953 935 756 548 253 155 317

65 P.10021 900 935 756 548 253 155 317

66 P.11291 900 935 756 560 253 155 317

67 P.11293 900 902 741 560 181 155 317

68 P.11296 846 935 756 548 276 155 317

69 P.12006 900 884 704 560 157 155 317

70 P.12007 900 935 756 560 181 155 317

71 P.12285 900 902 704 560 181 155 317

72 P.13714 900 935 756 548 253 155 317

73 P.13729 953 935 756 548 276 155 317

74 P.13731 900 902 756 548 181 155 317

75 P.13740 900 902 741 560 181 155 317

76 P.13741 900 902 741 560 181 155 317

77 P.13749 882 935 756 548 229 155 317

78 P.13947 1045 974 756 548 276 155 317

79 P.14946 882 974 756 506 276 155 317

80 P.14313 1027 1102 704 481 205 155 317

81 P.14947 900 974 756 548 276 155 317

82 P.15415 900 974 704 548 276 155 317

83 P.16509 900 902 704 560 181 155 317

84 P.16809 953 935 641 560 253 155 317

85 P.16849 900 902 704 560 181 155 317

86 P.17120 1062 935 756 548 276 155 317

87 P.17121 882 935 756 481 276 155 317

88 P.18119 846 935 756 560 276 155 317

89 P.18176 882 902 756 506 276 155 317

90 P.18339 900 902 704 560 181 155 317

91 P.18431 846 935 756 548 276 155 317

92 K.3 900 902 704 548 181 155 317

93 K.6 900 884 756 548 181 155 317

Appendix-I

167

Table 14 (Continue)

S.No. Strains ID

ClfA band size

ClfB band size

sdrD band size

sdrC band size

spa band size

Sspa band size

Sav1078 band size

94 K.8 1045 935 756 548 276 155 317

95 K.10 900 864 756 548 276 155 317

96 K.11 900 902 756 548 181 155 317

97 K.12 882 822 756 506 157 155 317

98 K.13 953 935 756 548 276 155 317

99 A.379 900 902 756 481 181 155 317

100 A.465 900 902 704 560 181 155 317

101 A.1761 900 902 595 560 181 155 317 102 A.5053 882 974 756 506 276 155 317

103 A.5054 882 974 756 506 276 155 317

104 A.7145 900 974 756 548 276 155 317 105 A.9077 1045 935 756 324 276 155 317 106 A.9313 540 992 756 548 229 155 317 107 A.9445 1045 935 756 324 276 155 317 108 A.9703 882 974 756 506 276 155 317 109 A.9781 1045 935 756 324 276 155 317

110 A.9914 1045 935 756 548 276 155 317 111 A.9954 900 935 756 481 276 155 317 112 A.9965 900 884 704 560 157 155 317

113 A.10813 540 992 756 548 229 155 317 114 A.11241 882 974 756 506 276 155 317 115 A.13282 1027 1102 501 481 205 155 317

116 A.13319 900 935 756 548 276 155 317 117 A.13730 882 974 756 506 276 155 317

118 A.14075 882 935 756 548 276 155 317 119 A.14254 846 935 756 548 276 155 317

120 A.14256 1045 935 756 324 276 155 317 121 A.15330 1045 935 756 548 276 155 317

122 A.25356 1045 935 756 324 276 155 317 123 A.26163 900 884 704 560 157 155 317

124 A.35045 900 902 704 560 181 155 317 125 A.35087 1045 935 756 524 276 155 317

Appendix-I

168

Table 15: Showing the IDs of isolates, amplicon sizes, length of VNTR region present in these amplicon, total number of repeats for the 123 Pakistani

MRSA isolates and NCTC 8325 and Mu50 (Positive control strains) obtained after Gene Scan for the clfA, clfB, sdrD, sdrC, spa and sspa.

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

1 NCTC 8325

1027 792 44 822 630 35 659 450 25 762 648 36 300 264 11 155 72 4

2 Mu-50 1050 815 45 822 630 35 768 558 31 634 522 29 276 240 10 174 91 5

3 P.1 900 665 37 884 688 38 704 486 27 560 450 25 157 121 5 155 72 4

4 P.2 846 611 34 935 739 41 704 486 27 548 432 24 157 121 5 155 72 4

5 P.3 900 665 37 974 778 43 756 540 30 506 396 22 276 240 10 155 72 4

6 P.4 900 665 37 902 706 39 756 540 30 560 450 25 181 145 6 155 72 4

7 P.5 900 665 37 884 688 38 756 540 30 560 450 25 181 145 6 155 72 4

8 P.6 1045 810 45 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

9 P.7 900 665 37 935 739 41 704 486 27 548 432 24 276 240 10 155 72 4

10 P.8 846 611 34 884 688 38 756 540 30 548 432 24 181 145 6 155 72 4

11 P.843 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

12 P.844 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

13 P.862 1045 810 45 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

14 P.1003 900 665 37 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

15 P.1005 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

16 P.1009 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

17 P.1123 1045 810 45 902 706 39 741 540 30 548 432 24 181 145 6 155 72 4

Appendix-I

169

Table 15 (Continue)

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

18 P.1129 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

19 P.1286 953 718 40 935 742 41 641 432 24 548 432 24 253 217 9 155 72 4

20 P.1287 900 665 37 902 706 39 741 540 30 560 450 25 181 145 6 155 72 4

21 P.1297 882 647 36 902 706 39 741 522 29 560 450 25 181 145 6 155 72 4

22 P.1843 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

23 P.1863 1045 810 45 866 670 37 756 540 30 548 432 24 276 240 10 155 72 4

24 P.1864 1045 810 45 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

25 P.1896 846 611 34 884 688 38 704 486 27 548 432 24 181 145 6 155 72 4

26 P.1961 864 629 35 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

27 P.1962 900 665 37 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

28 P.1963 1045 810 45 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

29 P.1964 1045 810 45 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

30 P.1966 900 665 37 935 739 41 756 540 30 548 432 24 277 241 10 155 72 4

31 P.1967 1045 810 45 904 708 39 756 540 30 548 432 24 276 240 10 155 72 4

32 P.2006 900 665 37 864 668 38 756 540 30 548 432 24 276 240 10 155 72 4

33 P.2054 882 647 36 974 779 43 756 540 30 506 396 22 229 193 8 155 72 4

34 P.2111 882 647 36 935 739 41 756 540 30 548 432 24 253 217 9 155 72 4

35 P.2112 900 665 37 935 739 41 756 540 30 548 432 24 277 241 10 155 72 4

36 P.2113 900 665 37 935 739 41 756 540 30 548 432 24 253 217 9 155 72 4

Appendix-I

170

Table 15 (Continue)

S. No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

37 P.2119 882 647 36 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

38 P.2255 953 718 40 902 706 39 704 486 27 548 432 24 157 121 5 155 72 4

39 P.2285 900 665 37 902 706 39 705 486 27 560 448 25 181 145 6 155 72 4

40 P.2871 846 611 34 884 688 38 704 486 27 560 450 25 157 121 5 155 72 4

41 P.2885 846 611 34 884 688 38 756 540 30 548 432 24 276 240 10 155 72 4

42 P.2886 900 665 37 884 688 38 704 486 27 548 432 24 181 145 6 155 72 4

43 P.2887 900 665 37 884 688 38 756 540 30 548 432 24 276 240 10 155 72 4

44 P.2896 846 611 34 884 688 38 756 540 30 548 432 24 277 241 10 155 72 4

45 P.3027 1062 827 46 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

46 P.3727 900 665 37 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

47 P.5019 1045 810 45 884 688 38 704 486 27 548 432 24 276 240 10 155 72 4

48 P.5020 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

49 P.5114 1062 827 46 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

50 P.5119 900 665 37 902 706 39 705 486 27 561 450 25 181 145 6 155 72 4

51 P.5123 953 718 40 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

52 P.6269 1062 827 46 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

53 P.6270 864 629 35 935 739 41 756 540 30 548 432 24 253 217 9 155 72 4

54 P.8116 902 667 37 882 686 38 705 486 27 541 432 24 181 145 6 155 72 4

Appendix-I

171

Table 15 (Continue)

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

55 P.8431 846 611 34 884 688 38 756 540 30 548 432 24 276 240 10 155 72 4

56 P.8485 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

57 P.8486 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

58 P.8487 846 611 34 935 739 41 756 540 30 548 432 24 277 241 10 155 72 4

59 P.8668 900 665 37 902 706 39 704 486 27 548 432 24 181 145 6 155 72 4

60 P.8823 1045 810 45 935 739 41 756 540 30 658 540 30 276 240 10 155 72 4

61 P.10012 846 611 34 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

62 P.10013 900 665 37 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

63 P.10015 900 665 37 935 739 41 704 540 30 548 432 24 229 193 8 155 72 4

64 P.10019 953 719 40 935 739 41 756 547 30 548 432 24 253 217 9 155 72 4

65 P.10021 900 665 37 935 739 41 756 540 30 548 432 24 253 217 9 155 72 4

66 P.11291 900 665 37 935 739 41 756 540 30 560 450 25 253 217 9 155 72 4

67 P.11293 900 665 37 902 706 39 741 522 29 560 450 25 181 145 6 155 72 4

68 P.11296 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

69 P.12006 900 665 37 884 688 38 704 540 30 560 450 25 157 121 5 155 72 4

70 P.12007 900 665 37 935 739 41 756 540 30 560 450 25 181 145 6 155 72 4

71 P.12285 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

72 P.13714 900 665 37 935 739 41 756 540 30 548 432 24 253 217 9 155 72 4

Appendix-I

172

Table 15 (Continue)

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

73 P.13729 953 719 40 935 739 41 756 540 30 548 432 24 277 241 10 155 72 4

74 P.13731 900 665 37 902 706 39 756 540 30 548 432 24 181 145 6 155 72 4

75 P.13749 882 642 36 935 739 41 756 540 30 548 432 24 229 193 8 155 72 4

76 P.13947 1045 810 45 974 778 43 756 540 30 548 432 24 276 240 10 155 72 4

77 P.14313 1027 792 44 1102 906 50 704 486 27 481 360 20 205 169 7 155 72 4

78 P.13740 900 665 37 902 706 39 741 540 30 560 450 25 181 145 6 155 72 4

79 P.13741 900 665 37 902 706 39 741 540 30 560 450 25 181 145 6 155 72 4

80 P.14946 882 647 36 974 778 43 756 540 30 505 396 22 276 240 10 155 72 4

81 P.14947 900 665 37 974 778 43 756 540 30 548 432 24 276 240 10 155 72 4

82 P.15415 900 665 37 974 778 43 704 486 27 548 432 24 276 240 10 155 72 4

83 P.16509 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

84 P.16809 953 718 40 935 742 41 641 432 24 560 450 25 253 217 9 155 72 4

85 P.16849 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

86 P.17120 1062 827 46 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

87 P.17121 882 641 36 935 739 41 756 540 30 480 360 20 276 240 10 155 72 4

88 P.18119 846 611 34 935 739 41 756 540 30 560 450 25 277 241 10 155 72 4

89 P.18176 882 647 36 902 706 39 756 540 30 505 396 22 276 240 10 155 72 4

90 P.18339 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

91 P.18431 846 611 34 935 739 41 756 540 30 548 432 24 277 241 10 155 72 4

Appendix-I

173

Table 15 (Continue)

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

92 K.3 900 665 37 902 706 39 704 495 27 548 432 24 181 145 6 155 72 4

93 K.6 900 665 37 884 688 38 756 540 30 548 432 24 181 145 6 155 72 4

94 K.8 1045 810 45 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

95 K.10 900 665 37 864 668 37 756 540 30 548 432 24 276 240 10 155 72 4

96 K11 900 665 37 902 706 39 756 540 30 548 432 24 181 145 6 155 72 4

97 K.12 882 647 36 822 626 35 756 540 30 506 396 22 157 121 5 155 72 4

98 K.13 953 718 40 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

99 A.379 900 665 37 902 706 39 756 540 30 481 360 20 181 145 6 155 72 4

100 A.465 900 665 37 902 706 39 698 486 27 560 450 25 181 145 6 155 72 4

101 A.1761 900 665 37 902 706 39 595 378 21 560 450 25 181 145 6 155 72 4

102 A.5053 882 647 36 974 779 43 756 540 30 505 396 22 276 240 10 155 72 4

103 A.5054 882 647 36 974 778 43 756 540 30 505 396 22 276 240 10 155 72 4

104 A.7145 900 665 37 974 778 43 756 540 30 548 432 24 276 240 10 155 72 4

105 A.9077 1045 810 45 935 739 41 756 540 30 324 216 12 276 240 10 155 72 4

106 A.9313 540 305 17 992 796 44 756 540 30 542 432 24 229 193 8 155 72 4

107 A.9445 1045 810 45 935 739 41 756 540 30 324 216 12 276 240 10 155 72 4

108 A.9703 882 647 36 974 778 43 756 540 30 506 396 22 276 240 10 155 72 4

109 A.9781 1045 810 45 935 739 41 756 540 30 324 216 12 276 240 10 155 72 4

110 A.9914 1045 810 45 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

Appendix-I

174

Table 15 (Continue)

S.

No.

Strains ID

ClfA band size

Rep. size

Rep. Nos.

ClfB band size

Rep. size

Rep. Nos.

sdrD band size

Rep. size

Rep. Nos.

sdrC band size

Rep. size

Rep. Nos.

spa band size

Rep. size

Rep. Nos.

sspa band size

Rep. size

Rep.Nos.

111 A.9954 900 665 37 935 739 41 756 540 30 481 360 20 276 240 10 155 72 4

112 A.9965 900 665 37 884 688 38 704 486 27 560 450 25 157 121 5 155 72 4

113 A.10813 540 305 17 992 796 44 756 540 30 542 432 24 229 193 8 155 72 4

114 A.11241 882 647 36 974 778 43 756 540 30 506 396 22 276 240 10 155 72 4

115 A.13282 1026 791 44 1102 905 50 501 288 16 481 360 20 205 169 7 155 72 4

116 A.13319 900 665 37 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

117 A.13730 882 647 36 974 778 43 756 540 30 505 396 22 276 240 10 155 72 4

118 A.14075 882 647 36 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

119 A.14254 846 611 34 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

120 A.14256 1045 810 45 935 739 41 756 540 30 324 216 12 276 240 10 155 72 4

121 A.15330 1045 810 45 935 739 41 756 540 30 548 432 24 276 240 10 155 72 4

122 A.25356 1045 810 45 935 739 41 756 540 30 324 216 12 276 240 10 155 72 4

123 A.26163 900 665 37 884 688 38 704 486 27 560 450 25 157 121 5 155 72 4

124 A.35045 900 665 37 902 706 39 704 486 27 560 450 25 181 145 6 155 72 4

125 A.35087 1045 810 45 935 741 41 756 540 30 523 414 23 276 240 10 155 72 4

Appendix-I

175

Table 16: Showing the Spa sequencing results with selected 26 MRSA isolates from Pakistan.

S. No. Strain

ID












r11

r12

r05

r17

r34

r24

r34

r22

r25

YGCMBQBLO t451











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064





r11

r19

r12

r05

YHGCMBQBLO t064

Appendix-I

176

Table 16 (Continue)

S.No. Strain

ID









r17

r34

r24

r34

r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064







r11

r19

r12

r05

r17

r34

YHGCMBQBLO t064

Appendix-I

177

Table 16 (Continue)

S.No. Strain

ID







r24

r34

r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064









r11

r19

r12

r05

r17

r34

r24

r34

YHGCMBQBLO t064

Appendix-I

178

Table 16 (Continue)

S.No. Strain

ID




10- AAAGAAGATGGCAACAAACCTGGT r22

r25











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064

12 K.8 1- GAGGAAGACAATAACAAGCCTGGC










r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064











r11

r19

r12

r05

r17

r34

r24

r34

r22

r25

YHGCMBQBLO t064

Appendix-I

179

Table 16 (Continue)

S. No. Strain

ID



14 A.9313









r15

r12

r16

r02

r25

r17

r24

r24

WGKAOMQQ t275

15 P.10813









r15

r12

r16

r02

r25

r17

r24

r24

WGKAOMQQ t275

16 A.13282








r15

r12

r16

r02

r25

r17

r24

WGKAOMQ t037

17 P.14947 1-GAGGAAGACAACAACAAGCCTGGC










r15

r12

r16

r02

r24

r16

r02

r25

r17

r24

WGKAQKAOMQ t987

Appendix-I

180

Table 16 (Continue)

S. No. Strain

ID



18 A.5053 1-GAGGAAGACAACAACAAGCCTGGC










r15

r12

r16

r02

r24

r16

r02

r25

r17

r24

WGKAQKAOMQ t987

19 P.1286










r15

r12

r16

r02

r16

r02

r25

r17

r24

WGKAKAOMQ t021







r15

r12

r16

r02

r24

r24

WGKAQQ t030







r15

r12

r16

r02

r24

r24

WGKAQQ t030

Appendix-I

181

Table 16 (Continue)

S.No. Strain

ID





3-AAAGAAGACGGCAACAAACCTGGT

4-AAAGAAGACAACAAAAAACCTGGC


6-AAAGAAGATGGCAACAAGCCTGGT

r15

r12

r16

r02

r24

r24

WGKAQQ t030







r15

r12

r16

r02

r24

r24

WGKAQQ t030

24 A.26163






r08

r16

r02

r24

r24

XKAQQ t632

25 P.12006






r08

r16

r02

r24

r24

XKAQQ t632

26 P.1






r08

r16

r02

r24

r24

XKAQQ t632

Appendix-II

182

Figure 48


Figure 49


Appendix-II

183

Figure 50


Figure 51


Appendix-II

184

Figure 52


Figure 53


Appendix-II

185

Figure 54


Appendix-II

186

Figure 55

Showing Sequence data of arcC gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 2.

Figure 56

Showing Sequence data of aroE gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.

Appendix-II

187

Figure 57

Showing Sequence data of glp gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.

Figure 58

Showing Sequence data of gmk gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 1.

Appendix-II

188

Figure 59

Showing Sequence data of pta gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 4.

Figure 60

Showing Sequence data of tpi gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 4.

Appendix-II

189

Figure 61

Showing Sequence data of yqil gene locus of S. aureus strain A.13282 in fasta format. This sequence is consensus sequence obtained after the alignment of forward and reverse strand. The allelic code obtained for this sequence from MLST server is 3.

Appendix-II

190

Figure 62


Figure 63


Appendix-II

191

Figure 64


Figure 65


Appendix-II

192

Figure 66


Figure 67


Appendix-II

193

Figure 68


genotyping of methicillin resistant staphylococcus...

Documents