Accepted Manuscript

Loop-mediated Isothermal Amplification (LAMP) test for detection of Trypa‐

nosoma evansi strain B

Zablon K Njiru, Johnson O. Ouma, John C. Enyaru, Alan P. Dargantes

PII: S0014-4894(10)00020-2

DOI: 10.1016/j.exppara.2010.01.017

Reference: YEXPR 5916

To appear in: Experimental Parasitology

Received Date: 18 November 2009

Revised Date: 13 January 2010

Accepted Date: 18 January 2010

Please cite this article as: Njiru, Z.K., Ouma, J.O., Enyaru, J.C., Dargantes, A.P., Loop-mediated Isothermal

Amplification (LAMP) test for detection of Trypanosoma evansi strain B, Experimental Parasitology (2010), doi:

10.1016/j.exppara.2010.01.017

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers

we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and

review of the resulting proof before it is published in its final form. Please note that during the production process

errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

Loop-mediated Isothermal Amplification (LAMP) test for detection of Trypanosoma

evansi strain B

Zablon K Njirua*, Johnson O. Oumab, John C. Enyaruc, Alan P. Dargantesd,e

aDivision of Health Sciences, School of Nursing and Midwifery, Murdoch University,

Education Drive, Mandurah, WA 6210, Australia.

bTrypanosomiasis Research Centre (TRC), Kenya Agricultural Research Institute, P.O. Box

362, Kikuyu 00902, Kenya.

cDepartment of Biochemistry, Faculty of Science, Makerere University, P.O. Box 7062,

Kampala, Uganda.

dDivision of Health Sciences, School of Veterinary and Biomedical Sciences, Murdoch

University, Murdoch Drive, Perth, WA 6150, Australia.

eCollege of Veterinary Medicine, Central Mindanao University, University Town, Musuan,

Bukidnon 8710, Philippines.

*Corresponding author:

Tel: 61 08 9582 5508

Fax: 61 08 9582 5515

E-mail: Z.njiru@murdoch.edu.au

ACCEPTED MANUSCRIPT

ABSTRACT

Camel Trypanosomiasis (Surra) is mainly caused by Trypanosoma evansi strains that express

variable surface glycoprotein (VSG) RoTat 1.2. However, in Kenya a second causative strain

that does not express RoTat 1.2 VSG (Trypanosoma evansi type B) has been identified. The

prevalence of T. evansi type B largely remains unknown due to inadequate diagnostic assay.

This work reports the development of a sensitive and specific diagnostic assay capable of

detecting T. evansi type B based on the strategy of Loop-mediated Isothermal Amplification

(LAMP) of DNA. The test is rapid and amplification is achieved within 20-25 minutes at

63oC using a real time PCR machine. Restriction enzyme AluI digestion of the amplicon gave

the predicted 83 bp and 89 bp sized bands and the LAMP product melt curves showed

consistent melting temperature (Tm) of ~89oC. The assay analytical sensitivity is ~0.1

trypanosomes/ml while that of classical PCR test targeting the same gene is ~10

trypanosomes/ml. There was a 100% agreement in detection of the LAMP amplification

product in real-time, gel electrophoresis, on addition of SYBR Green I, and when using

chromatographic Lateral Flow Dipstick (LFD) format. The use of the LAMP test revealed

nine more T. evansi type B DNA samples that were not initially detected through PCR. The

robustness and higher sensitivity of the T. evansi type B LAMP assay coupled with the visual

detection of the amplification product indicate that the technique has strong potential as a

point-of-use test in surra endemic areas.

Key words: Loop-mediated Isothermal Amplification (LAMP), Trypanosoma evansi type B,

diagnosis, Lateral Flow Dipstick, Surra.

ACCEPTED MANUSCRIPT

1. Introduction

Trypanosoma evansi is undoubtedly one of the most widespread pathogenic

trypanosomes in the world, naturally infecting a variety of both wild and domestic animals.

This success is attributed to its transmissibility by biting flies. Recently, a case of T. evansi

infection in a human was confirmed in India, raising concerns of the emergence of human

infective strains in Asia (WHO, 2005; Joshi et al., 2005; Powar et al., 2006). Unlike most

pathogenic trypanosomes that have consistently maintained their endemic foci and hosts, T.

evansi has been emerging in non-endemic areas and infecting new hosts. Outbreaks have

been recorded for the first time in the endangered Himalayan bear (Muhammad et al., 2007),

a farm in metropolitan France (Desquesnes et al., 2008) and in mainland Spain (Tamarit et

al., 2009). This phenomenon can be expected to increase with the prevailing global climatic

changes that may gradually lead to increases in arthropod vectors and vector borne diseases.

Therefore development of new and improved diagnostic assays for T. evansi is a priority

The majority of the T. evansi stocks isolated in endemic regions possess the RoTat 1.2

VSG gene. Whilst no detailed studies have been done to correlate the presence of the RoTat

1.2 VSG gene and minicircle types in T. evansi, it may be assumed that most RoTat 1.2

positive isolates possess the most common T. evansi type A minicircles within their

kinetoplast DNA (Songa et al., 1990; Ou et al., 1991; Lun et al., 1992) or are natural

dyskinetoplastic (altered or lack kDNA) (Schnaufer et al., 2002). A second group of T. evansi

stocks isolated in Kenya are devoid of VSG RoTat 1.2 but possess a VSG named JN 2118Hu

(Ngaira et al., 2005). These isolates have been shown to possess a rare minicircle type B

(Borst et al., 1987; Njiru et al., 2006) and are referred to as non RoTat 1.2 (Ngaira et al.,

2005). The use of term non RoTat 1.2 in reference to VSG JN 2118Hu isolates needs to be

applied with caution since other T. evansi that are devoid of both VSG RoTat 1.2 and VSG

ACCEPTED MANUSCRIPT

JN 2118Hu are not necessarily absent. The T. evansi type B isolates reveal different

isoenzyme patterns (Gibson et al., 1983) and minisatellite and microsatellite markers (Njiru et

al., 2007a: 2007b) as compared to T. evansi type A isolates. Field studies carried out in

Kenya suggest that T. evansi type B is not only pathogenic to camels but may also be

widespread in camel keeping regions of Kenya (Ngaira et al., 2004; Njiru et al., 2006), and its

detection is likely hindered by the lack of a specific and sensitive diagnostic test.

Definitive diagnosis of surra can be achieved through demonstration of parasites by

microscopy. However, this method is inadequate due to the characteristic low parasitaemia of

T. evansi infections. Molecular tests are supposedly more sensitive but their laboratory

requirements limit application in the endemic regions. Therefore field diagnosis relies on the

established antibody detection test based on VSG RoTat 1.2, a card agglutination test for

trypanosomiasis (CATT/T. evansi) (Songa and Hamers, 1988). Unfortunately, CATT/T.

evansi cannot detect isolates devoid of RoTat 1.2 VSG such as T. evansi type B (Ngaira et al.,

2004). Moreover, the presence of antibodies in the serum does not necessarily reflect an

existing infection, as antibodies may persist for several months following recovery. Recently,

a rapid and sensitive amplification platform for DNA called Loop-mediated Isothermal

Amplification (LAMP) has been developed (Notomi et al., 2000). The strategy is robust,

specific and shows tolerance to several biological products that inhibit conventional PCR

(Yamada et al., 2006; Kaneko et al., 2007), meaning that template DNA extraction may not

be necessary. Besides, LAMP results can be visually inspected through colour change (Poon

et al., 2006; Njiru et al., 2008b) or coupling with chromatographic LFD (Nimitphak et al.,

2008) which significantly reduces the assay time.

The LAMP technique has been successfully used to develop assays for both human

ACCEPTED MANUSCRIPT

(Njiru et al., 2008a; 2008b) and animal (Thekisoe et al., 2005; 2007) trypanosomiasis. In this

study we report the development and validation of a T. evansi type B LAMP test and the

comparison of chromatographic LFD format with SYBR Green I, Gel electrophoresis and

real time monitoring methods in detection of T. evansi LAMP product.

ACCEPTED MANUSCRIPT

2. Materials and methods

2.1. Preparation of template

Well characterised trypanosome DNA samples were used in this study as shown in

Table 1. The DNA was prepared using the Qiagen DNA extraction kit (Qiagen, Victoria,

Australia) or through the method of Sambrook and Russell (2001).

2.2. Polymerase chain reaction

The PCR test reactions for RoTat 1.2 (Claes et al., 2002) and for VSG gene JN

2118Hu “T. evansi type B” (Ngaira et al., 2005) were performed according to the published

conditions. After amplification, the PCR products were analysed through electrophoresis in

1.2% agarose gels stained with SYBR® safe DNA gel stain (Invitrogen, Victoria, Australia).

2.3. Design of LAMP primers

A set of four LAMP primers (Table 2) recognising six sections of the T. evansi type

B VSG gene JN 2118Hu (accession number AJ870486) were designed using the Primer

Explorer version 3 software (http:/primerexplorer.jp/lamp3.0.0/index.html). Two additional

loop primers, loop forward (LF) and loop backward (LB) were designed manually. A biotin-

labelled probe for detection of the LAMP product using a LFD format was designed between

primer LB and B2 and labelled with fluorescein isothiocyanate (FITC) (Table 2).

2.4. LAMP reactions

Trypanosoma evansi type B LAMP reactions of 25 µl were standardised for optimal

temperature and time using T. evansi isolate SA17 and following the Taguchi design (Cobb

and Clarkson, 1994). Briefly, the forward inner primer (FIP) and backward inner primer

(BIP) were varied from 0.8 µM to 2.4 µM, dNTPs from 1 mM to 4 mM, betaine (Sigma-

ACCEPTED MANUSCRIPT

Aldrich, St. Louis, MO USA) from 0.2 M to 0.8 M and Mg2+ from 0 to 4 mM. The final

concentrations were 2.0 µM of each of the inner primers (Biotin-labelled FIP and BIP), 0.8

µM for loop forward and backward primer (LF and LB), 0.2 µM for forward and backward

outer primers (F3 and B3), 2 mM for each deoxynucleoside triphosphate and 0.8 M betaine.

The 1X ThermoPol Reaction Buffer contained 20 mM Tris-HCl (pH8.8), 10 mM KCl, 10

mM (NH4)2SO4, 2 mM MgSO4 and 0.1% Triton X-100. The Bst DNA polymerase (Large

fragment; New England Biolabs Inc., Beverly, MA USA) was 1 µl (8 units) while SYTO-9

fluorescence dye at 3.3 µM (Molecular Probes, OR USA) was added for each real time

reaction. The template DNA was ~100 pg. The LAMP test was carried out for 1 hour at 62-

64oC using the Rotor-Gene 3000 thermocycler (Qiagen, Victoria, Australia) and terminated

by increasing the temperature to 80oC for 5 minutes. Later the standardised amplifications

conditions were tried out using a normal water bath with temperatures maintained at

approximately 62 to 64oC.

2.5. Detection and confirmation of LAMP product

Three different methods were used to analyse the LAMP product: electrophoresis in

1.5% agarose gels, visual inspection after addition of 1/10 dilution of SYBR Green I

(Invitrogen, Sydney, Australia), and by monitoring fluorescence of double stranded DNA

(dsDNA) in a Rotor-Gene 3000 thermocycler. The real-time fluorescence data was obtained

on the FAM channel (excitation at 470 nm and detection at 510 nm) (Monis et al., 2005).

Two approaches were used to confirm that the LAMP test amplified the correct target: i) 1-2

µl of the amplification product was digested with restriction enzyme AluI at 37oC for 3 h,

followed by electrophoresis in 3% agarose gel and ii) through acquisition of melt curves on

the FAM channel using 1oC steps, with a hold of 30 s, from 63oC to 96oC (Monis et al.,

2005).

ACCEPTED MANUSCRIPT

2.6. Lateral Flow Dipstick assay

Approximately 20 picomoles of the FITC labelled probe was added to the biotin

labelled LAMP products. Hybridisation was carried out at 63oC for 5 minutes after which 10

µL of the hybridised product was mixed with 100 µL of the assay buffer. The commercially

prepared LFD strips (Milenia® Genline HybriDtect) were then dipped into the mixer for 4

minutes to detect the amplicon probe hybrid.

2.7. Sensitivity and specificity of LAMP

A ten-fold serial dilution of ~100 ng of T .evansi SA17 DNA was prepared and used

to determine the assay analytical sensitivity. Different formats specifically; LFD, SYBR

Green I dye and electrophoresis were used to detect the LAMP product. To ensure

consistency and to confirm reproducibility, all sensitivity reactions were done in triplicates

using real time machine. The specificity of the test was assessed with DNA from biting flies

(Stomoxys), bovine, camels, and other pathogenic trypanosomes; T.b. brucei, T.b. gambiense,

T. evansi, T. congolense savannah, T.c. kilifi, T.c. forest, T. simiae, T.s. tsavo, T. godfreyi and

T. vivax.

2.8. Analysis of archived camel samples

A total of 549 archived genomic DNA prepared from camel blood using the QIAamp

DNA mini kit (Qiagen, Victoria, Australia) were used. The DNA was prepared as part of a T.

evansi epidemiological study (Njiru et al., 2004), and had been stored at -20oC for six years

before use. A 2 µl of the DNA template was added to make up a 25 µL LAMP reaction

mixture and amplification was carried out as described in section 2.4

ACCEPTED MANUSCRIPT

4. Results

The results for the T. evansi LAMP test are shown in Fig. 1-4 and Table 1. The best

reaction results were obtained when the temperature was maintained at 63oC. Inclusion of

loop primers reduced the amplification time to 15-20 minutes (Fig. 1a) from 30 minutes and

showed a 100-fold increase in analytical sensitivity (Table 3). Post-amplification analysis

showed reproducible and consistent melt curves with a Tm of ~89.0oC (Fig. 1b) while Alu1

restriction enzyme digestion gave the predicted sizes of 83 bp and 89 bp. The analytical

sensitivity of T. evansi type B LAMP test was an equivalent to 0.1 trypanosome/ml as

compared to 10 tryps/ml using a classical PCR (Ngaira et al., 2005) targeting the same

sequence (Fig. 2; Table 3). Analysis of 549 archived camel samples revealed 13 infections of

T. evansi type B of which only four had previously been detected through microscopy and

PCR (Table 4). On addition of SYBR Green I fluorescence dye, the positive reactions turned

green while the negative reactions remained orange (Fig. 3a). These results are comparable

with the LFD format (Fig. 3b). There was a 100% agreement in detection of LAMP product

using gel electrophoresis, addition of SYBR Green I fluorescence dye, LFD test and in real

time monitoring. The T. evansi type B LAMP test is specific and shows no cross-reaction

with non-target DNA.

ACCEPTED MANUSCRIPT

4. Discussion

In this study we report the development of a rapid and sensitive LAMP test for

Trypanosoma evansi type B based on the amplification of VSG JN 2118Hu sequence (Ngaira

et al., 2005). The assay is specific and shows analytical sensitivity of ~0.1 tryp/ml in the

laboratory which is equivalent to parasitaemia expected in the field camels. The assay is

rapid, results being obtained within 20-25 minutes using a real time PCR machine (Fig. 1a),

and after approximately 35 minutes in a normal water bath that maintains temperature at 62-

64oC (data not shown). The increase in reaction time when using a normal water bath may be

attributed to the reduced heat transmission in water as compared to the thermocycler. The

potential usefulness of T. evansi type B LAMP test as a point of use test is demonstrated and

has the following characteristics: robustness, high sensitivity and specificity, and the ability

to inspect results visually.

The T. evansi type B LAMP test in study has been developed with the focus on

reading colour change or using a LFD format to limit post DNA manipulation, therefore it is

crucial that the assay amplifies the correct target. Theoretically, LAMP is highly specific

since amplification of the target DNA is achieved through the use of six primers targeting

eight sections of the desired DNA (Notomi et al., 2000; Nagamine et al., 2002). However, the

strategy is still prone to false positives that can result from amplicon handling and formation

of primer dimers (Njiru et al., 2008b). Additionally, the use of highly concentrated DNA of

>200 ng can inhibit LAMP amplification (Njiru et al., 2008a; Thekisoe et al., 2009). In this

study, the amplification of the desired target was unequivocally confirmed through digestion

with Alu1 enzyme which gave the predicted 83 bp and 89 bp sizes. Moreover, the acquisition

and analysis of the melt curves not only showed reproducible melt curves but also revealed

consistent Tm of ~89.0oC (Figure 1b) indicating similar sequences.

ACCEPTED MANUSCRIPT

The development of a field friendly LAMP product detection system is still in its

infancy. The use of colour inspection (SYBR Green I dye) and chromatographic LFD formats

is preferable under field conditions. Moreover these two methods showed identical detection

limits with gel electrophoresis and real time monitoring (Table 3). Additionally, the

applicability of SYBR Green I (Poon et al., 2006; Njiru et al., 2008b) and LFD in detection of

LAMP product (Kiatpathomchai et al., 2008; Nimitphak et al., 2008; Jeroenram et al., 2009)

has been demonstrated. SYBR Green I bind to double-stranded DNA and the resulting DNA-

dye-complex gives a green colour (Fig 3a). In LFD format, the FITC-labelled biotinylated

LAMP product combines with gold-labelled anti-FITC in the sample well. The triple-labelled

complex moves up and is captured by an immobilized biotin-binding protein (Test line) (Fig

3a) while the non-hybridized FITC probe binds to the gold-labelled anti-FITC to form a

double complex without biotin and is trapped at the control line (Nimitphak et al., 2008).

Despite these advances in the application SYBR Green I and LFD formats in detection of

LAMP product, their current designs have shortcomings; in that the reaction tubes have to be

opened to add the dye and the hybridising probe. This creates the potential for contamination

with the amplicon. To minimise this, a novel single step reaction format that will allow direct

mixing of the dye and reaction product after amplification or direct detection of product with

the LFD need to be designed.

The prevalence of T. evansi type B remains largely unknown. Since the first isolate

was reported (Borst et al., 1987), only eight other isolates have been reported (Ngaira et al.,

2005; Njiru et al., 2006). Analysis of the archived camel DNA samples revealed a T. evansi

type B prevalence of ~2.4%. Since DNA degradation may have occurred after six years of

storage, the prevalence of this parasite could be higher in the field than earlier reported.

Undiagnosed T. evansi cases continue to perpetuate transmission in the areas of disease foci

ACCEPTED MANUSCRIPT

and form the sources of infection in new areas. In the absence of obvious clinical symptoms

that can distinguish T. evansi type A from type B infections, the development of the T. evansi

type B LAMP test in this study will contribute towards more epidemiological data for the

type B strain whilst complementing the existing tests in field diagnoses and treatments.

ACCEPTED MANUSCRIPT

Acknowledgement:

The DNA samples used for specificity studies were initially provided by Prof. Wendy

Gibson, University of Bristol, UK for RIME LAMP studies (Njiru et al., 2008a). The Asian

T. evansi DNA were part of genetic studies (Njiru et al., 2007b) and provided by Dr. Simon

Reid, Murdoch University while the KETRI DNA (currently, Kenya Agricultural Research

Institute Trypanosomiasis Research Centre (KARI-TRC)) were part of T. evansi

epidemiological study (Njiru et al., 2004). This work was funded by the Australian

Biosecurity Cooperative Research Centre (AB-CRC) project No. 1.114R, 2008 and Murdoch

University.

ACCEPTED MANUSCRIPT

References

Songa, E.B., Hamers, R., 1988. A card agglutination test (CATT) for veterinary use based on

an early VAT RoTat 1/2 of Trypanosoma evansi. Annales de la Société Belge de

Médecine Tropicale 68, 233-240.

Borst, P., Fase-Fowler, F., Gibson, W.C., 1987. Kinetoplast DNA of Trypanosoma evansi.

Molecular and Biochemical Parasitology 23, 31–38.

Claes F., Radwanska M., Urakawa, T., Majiwa, P.A., Goddeeris, B., Büscher, P., 2004.

Variable Surface Glycoprotein RoTat 1.2 PCR as a specific diagnostic tool for the

detection of Trypanosoma evansi infections. Kinetoplastid Biology and Disease

3(1):3.

Cobb, B., Clarkson, J.M., 1994. A simple procedure for optimising the polymerase chain

reaction (PCR) using modified Taguchi methods. Nucleic Acids Research 22, 3301–

3805.

Desquesnes, M., Bossard, G., Patrel, D., Herder, S., Patout, O., Lepetitcolin, E., Thevenon,

S., Berthier, D., Pavlovic, D., Brugidou, R., Jacquiet, P., Schelcher, F., Faye, B.,

Touratier, L., Cuny, G., 2008. First outbreak of Trypanosoma evansi in camels in

metropolitan France. Veterinary Records 162:750-752.

Gibson, W.C., Wilson, A.J., Moloo, S.K., 1983. Characterisation of Trypanosoma

(Trypanozoon) evansi from camels in Kenya using isoenzyme electrophoresis.

Research in Veterinary Science 34, 114–118.

Jaroenram, W., Kiatpathomchai, W., Flegel, T.W., 2009. Rapid and sensitive detection of

white spot syndrome virus by Loop-mediated Isothermal Amplification combined

with a Lateral Flow Dipstick. Molecular and Cellular Probes 23, 65-70

Joshi, P.P., Shegokar, V.R., Powar, R.M., Herder, S., Katti, R., Salkar, H.R., Dani V.S.,

Bhargava, A., Jannin, J., Truc, P., 2005. Human trypanosomiasis caused by

Trypanosoma evansi in India: The first case report. American Journal of Tropical

Medicine and Hygiene 73, 491-495.

Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated

isothermal amplification to a culture medium and biological substances. Journal of

Biochemical and Biophysical Methods 70, 499–501.

Kiatpathomchai, W., Jaroenram, W., Arunrut, N., Jitrapakdee S., Flegel, T.W., 2008. Shrimp

Taura syndrome virus detection by reverse transcription loop-mediated isothermal

amplification combined with a lateral flow dipstick. Journal of Virological Methods

ACCEPTED MANUSCRIPT

153, 214-217.

Lun ,Z.R., Brun, R., Gibson, W., 1992. Kinetoplast DNA and molecular karyotypes of

Trypanosoma evansi and Trypanosoma equiperdum from China. Molecular and

Biochemical Parasitology 50, 189-196.

Muhammad, G., Saqib, M., Sajid, M.S., Naureen, A., 2007. Trypanosoma evansi infections in

Himalayan black bears (Selenarctos thibetanus). Journal of Zoo and wildlife

Medicine 38, 97-100.

Monis, P.T., Giglio, S., Saint, C.P., 2005. Comparison of SYTO9 and SYBR Green I for real-

time polymerase chain and investigation of the effect of dye concentration on

amplification and DNA melting curve analysis. Analytical Biochemistry 30, 24–34.

Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal

amplification using loop primers. Molecular and Cellular Probes 16, 223–229.

Ngaira, J.M., Njagi, E.N., Ngeranwa, J.J., Olembo, N.K., 2004. PCR amplification of RoTat

1.2 VSG gene in Trypanosoma evansi isolates in Kenya. Veterinary Parasitolgy 120,

23-33.

Ngaira J.M, Olembo, N.K., Njagi, E.N., Ngeranwa, J.J., 2005. The detection of non-RoTat

1.2 Trypanosoma evansi. Experimental Parasitology 110, 30-38.

Nimitphak, T., Kiatpathomchai, W., Flegel, T.W., 2008. Shrimp hepatopancreatic parvovirus

detection by combining loop-mediated isothermal amplification with a lateral flow

dipstick. Journal of Virological Methods 154, 56-60.

Njiru, Z.K., Constantine, C.C., Ndung'u, J.M., Robertson, I., Okaye, S., Thompson, R.C.,

Reid SA., 2004. Detection of Trypanosoma evansi in camels using PCR and CATT/T.

evansi tests in Kenya. Veterinary Parasitology 124,187-199.

Njiru, Z.K., Constantine, C.C., Masiga, D.K., Reid, S.A., Thompson, R.C., Gibson, W.C.,

2006. Characterization of Trypanosoma evansi type B. Infection, Genetics and

Evolution 6, 292-300

Njiru, Z.K., Constantine, C.C., Gitonga, P.K., Thompson, R.C., Reid, S.A., 2007a. Genetic

variability of Trypanosoma evansi isolates detected by inter-simple sequence repeat

anchored-PCR and microsatellite. Veterinary Parasitology 147, 51-60

Njiru, Z.K., Constantine, C.C., 2007b. Population sub-structuring among Trypanosoma

evansi stocks. Parasitology Research 101, 1215-24.

Njiru, Z.K., Mikosza, A.S., Matovu, E., Enyaru, J.C., Ouma, J.O., Kibona, S.N., Thompson,

R.C., Ndung'u, J.M., 2008a. African trypanosomiasis: sensitive and rapid detection of

the sub-genus Trypanozoon by loop-mediated isothermal amplification (LAMP) of

ACCEPTED MANUSCRIPT

parasite DNA. International journal for Parasitology 38, 589-99.

Njiru, Z.K., Mikosza, A.S., Armstrong, T., Enyaru, J.C., Ndung'u, J.M., Thompson, A.R.,

2008b. Loop-Mediated Isothermal Amplification (LAMP) Method for Rapid

Detection of Trypanosoma brucei rhodesiense. PLoS Neglected Tropical Diseases 2,

e147.

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, Amino, N., Hase, T.,

2000. Loop-mediated isothermal amplification of DNA. Nucleic Acid Research 28,

E63.

Ou, Y.C., Giroud, C., Baltz, T., 1991. Kinetoplast DNA analysis of four Trypanosoma evansi

strains. Molecular and Biochemical Parasitology. 46, 97–102.

Poon, L.L., Wong, B.W., Ma, E.H., Chan, K.H., Chow, L.M., Abeyewickreme, W.,

Tangpukdee, N., Yuen, K.Y., Guan, Y., Looareesuwan, S., Peiris, J.S., 2006.

Sensitive and inexpensive molecular test for falciparum malaria: detecting

Plasmodium falciparum DNA directly from heat-treated blood by loop-mediated

isothermal amplification. Clinical Chemistry. 52, 303–306.

Powar, R.M., Shegokar, V.R., Joshi, P.P., Dani, V.S., Tankhiwale, N.S., Truc, P., Jannin, J.,

Bhargava, A., 2006. A rare case of human trypanosomiasis caused by Trypanosoma

evansi Indian Journal of Medical Microbiology 24, 72-74.

Sambrook and Russell, 2001 J. Sambrook and D.W. Russell, Molecular Cloning (third ed.),

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US (2001).

Schnaufer, A., Domingo, G.J., Stuart, K., 2002. Natural and induced dyskinetoplastic

trypanosomatids: how to live without mitochondrial DNA. International Journal for

Parasitology. 32, 1071-1084.

Songa, E.B., Paindavoine, P., Wittouck, E., Viseshakul, N., Muldermans, S., Steinert, M.,

Hamers, R., 1990. Evidence for kinetoplast and nuclear DNA homogeneity in

Trypanosoma evansi isolates. Molecular and Biochemical Parasitology 43, 167-79.

Tamarit , A., Gutierrez, C., Arroyo, R., Jimenez, V., Zagala´, G., Bosch, I., Sirvent, J.,

Alberola, J., Alonso, I., Caballero, C., 2009. Trypanosoma evansi infection in

mainland Spain. Veterinary Parasitology. Published online, Oct 72009.

Thekisoe, O.M, Inoue, N., Kuboki, N., Tuntasuvan, D., Bunnoy, W., Borisutsuwan, S.,

Igarashi, I., Sugimoto, C., 2005. Evaluation of loop-mediated isothermal amplification

(LAMP), PCR and parasitological tests for detection of Trypanosoma evansi in

experimentally infected pigs. Veterinary Parasitology 130, 327-330.

Thekisoe, O.M., Kuboki, N., Nambota, A., Fujisaki, K., Sugimoto, C., Igarashi, I., Yasuda, J.,

ACCEPTED MANUSCRIPT

Inoue, N., 2007. Species-specific loop mediated isothermal amplification (LAMP) for

diagnosis of trypanosomosis. Acta Tropica 102, 182–189.

Thekisoe O.M., Rambritch, N.E., Nakao, R, Bazie, R.S., Mbati, P., Namangala, B., Malele,

I., Skilton, R.A., Jongejan, F., Sugimoto, C., Kawazu, S.I., Inoue, N., 2009. Loop-

mediated isothermal amplification (LAMP) assays for detection of Theileria parva

infections targeting the PIM and p150 genes. International Journal for Parasitology.

Published on 2009 Aug 3.

Yamada, Y., Itoh, M., Yoshida, M., 2006. Sensitive and rapid diagnosis of human parvovirus

B19 infection by Loop-Mediated Isothermal Amplification. British Journal of

Dermatology 155: 50–55.

WHO, 2005. A new form of human trypanosomiasis in India. Description of the first human

case in the world caused by Trypanosoma evansi. The Weekly Epidemiological

Records 80, 62–63.

ACCEPTED MANUSCRIPT

Fig. 1a. The real time amplification of Trypanosoma evansi type B isolates SA17, KETRI

2479, SA201 and SA54 using Roto-Gene 3000 thermocycler and (b) the post amplification

acquisition of melting curves. The melt curves were acquired after amplification for ~35

minutes and showed a melting temperature of ~89.0oC (arrow) which was an indication of

similar sequences. The DNA concentration for SA17 was ~100pg.

Fig. 2a. The analytical sensitivity of JN1 &JN2 PCR test and the (b) LAMP assay targeting

the VSG JN2118Hu and using DNA lysate from T. evansi isolates SA17. The positive PCR

reactions show a 273 bp amplicon while LAMP produces a characteristic ladder of multiple

bands on an agarose gel indicating stem-loop DNA with inverted repeats of the target

sequence. The reactions were done in triplicates and showed detection limit of ~10 tryps/ml

(dilution 10-5) and ~0.1 tryp/ml (dilution 10-7) for PCR and LAMP respectively. M, 100 bp

marker, 10-1 – 10-7 dilutions and NC, negative control

Fig. 3a. The analysis of some archived DNA samples using the T. evansi type B LAMP

assay. The positive samples turned green with addition of 1 µl of 1:10 dilution of SYBR

Green I while the negative ones remain orange. (b) Comparable results were obtained using

the chromatographic lateral flow dipstick format. Sample 1 (SA10), 2 (SA84), 3 (SA60), 4

(SA218), 5 (SA237), C, SA17-positive control and NC-negative control.

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

Table 1. Trypanosome isolates used in the study

Isolates ID Host Origin Year of

Isolation

Minicircle type RoTat 1.2

PCRd

Non RoTat

1.2 PCRe

LAMP

test

T. evansi KETRI 2479a,b

Camel Ngurunit, Kenya 1980 B - + +

T. evansi SA17b Camel Isiolo, Kenya 2003 B - + +

T. evansi SA201a Camel Samburu, Kenya 2003 B - + +

T. evansi K16a Camel Unknown 1980 B - + +

T. evansi SA78a Camel Isiolo, Kenya 2002 A + - -

T. evansi SA263a Camel Samburu, Kenya 2003 A + - -

T. evansi KETRI 2472a Camel Sudan unknown A + - -

T. evansi KETRI 2426a Camel Ukunda 1978 A + - -

T. evansi KETRI 3093a Horse Columbia 1979 A + - -

T. evansi KETRI 2439a Camel Kulal, Kenya 1979 A + - -

T. evansi B461a Buffalo S. Kalimantan, Indonesia 1992 A + - -

T. evansi A9a Buffalo Mindanao, Phillipines 2000 A + - -

T. brucei KETRI 1377a,b

Camel Garissa, Kenya 1968 Heterogeneous - - -

T. brucei KETRI 2416a Camel Garissa, Kenya 1968 Heterogeneous - - -

T. brucei K0a Camel Northern, Kenya 1979 nd - - -

T. brucei KETRI 1736a Bovine Kenya Unknown nd - - -

T. b. rhodesiense TMRS JMc Human Kasulu, Tanzania 2001 n/a n/a n/a -

T. b. gambiense NW2c Human Uganda 1992 n/a n/a n/a -

T. congolense forest Cam 22c Goat Mbetta, Cameroon 1984 n/a n/a n/a -

T. c. kilifi WG5c Sheep Kenya 1980 n/a n/a n/a -

T. c. savannah KETRI 1869c - - - n/a n/a n/a -

T. simiae Ken 4c Fly Keneba, The Gambia 1988 n/a n/a n/a -

T. simiae tsavo KETRI 1864c Fly Kenya - n/a n/a n/a -

T. godfreyi Ken 7c Fly Kenya - n/a n/a n/a -

T. vivax Y58c - Nigeria - n/a n/a n/a -

n/a = not applicable: nd = not done: ID = identification code: (+) = positive and (-) = negative:

aNjiru et al., 2006;

bNjiru et al., 2007b;

cNjiru et al., 2008b; dClaes et al., 2004;

eNgaira et al., 2005

ACCEPTED MANUSCRIPT

Table 2. Nucleotide sequences for T. evansi type B LAMP primers

Primer name Primer type Sequence (5’ – 3’) Length Amplicon size† Target seq

TeB-F3 F3 CCAATCAAAGACGAGCGG 18 171 VSG JN 2118Hu

TeB-B3 B3 TGGTTTGTGAGGCCGCAG 18

TeB-biotin FIP FIP (F1c + F2) CGGATGCATCGGTGATGCAATCACTACTGCATCAAGGGAAGC 42

TeB-BIP BIP (B1c + B2) ATCCAGCACCTCGGAACAGCTCTCGGCAACCAGATCGG 38

TeB-LF LF GTTCACGTGCCTCCGCTTC 19

TeB-LB LB ACGTAGCGGGAAAATACGC 19

TeB-FITC Probe CTATCCTAAAAGAAGCTGGAG 21

†The length between F2 and B2 is 171 bp

ACCEPTED MANUSCRIPT

Table 3. Analytical sensitivity of different tests formats for the T. evansi type B loop-

mediated isothermal amplification test and compared with PCR test specific for T. evansi

type B.

Ten-fold dilutiona

Test Target sequence

Expected specificity

Amplicon detection

10-1

10-2

10-3

10-4

10-5

10-6

10-7

10-8

Reference

LAMP

test

(WL)

VSG JN

2118Hub

T. evansi

type B

SYBR Green

Ic

+ + + + + + + - This

study

LAMP

test

(WL)

VSG JN

2118Hu

T. evansi

type B

LFD + + + + + + + - This

study

LAMP

test

(NL)

VSG JN

2118Hu

T. evansi

type B

SYBR Green

I

+ + + + + - - - This

study

JN1 &

JN2

VSG JN

2118Hu

T. evansi

type B

gel

electrophores

is

+ + + + + - - - Ngaira et

al., 2005

EVAB

1 & 2

Minicircl

e

T. evansi

type B

gel

electrophores

is

+ + + - - - - - Njiru et

al., 2006

WL = with loop primers included

NL = without loop primers

LFD = Lateral Flow Dipstick a10-1 = (~1.0 x 105 tryps/ml), 10-2 = (~1.0 x104 tryps/ml) and 10-7 = (~0.1 tryp/ml) b = (Ngaira et al., 2005) cReal time monitoring showed identical detection levels

ACCEPTED MANUSCRIPT

Table 4. Detection of T. evansi type B DNA from archived camel samples using

parasitological, PCR and LAMP technique.

Assay type

District No. of samplesa MHCTb

Positive (%)

JN1&JN2c

Positive (%)

T. evansi type B

LAMP

Positive (%)

Isiolo 153 2 (1.3) 3 (1.9) 7 (4.5)

Samburu 161 1 (0.7) 1 (0.7) 4 (2.8)

Laikipia

(Nanyuki)

235 - - 2 (0.8)

549 13 (2.4)d

aMolecular and serological results reported in Njiru et al (2004)

bMicro-haematocrit centrifugation technique

cNon-RoTat 1.2 PCR test (Ngaira et al., 2005)

dAll MHCT and JN1/JN2 positive samples were also positive with LAMP