globin gene analysis in a ghanaian population
TRANSCRIPT
![Page 1: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/1.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Globin gene Haplotype analysis in a Ghanaian population
1. Introduction
1.1 Haemoglobin: structure and function
The Haemoglobin molecule is made up of four polypeptide chains, each of which has a
single haem group consisting of an iron atom located at the centre of a porphyrin ring(Bragg
and Perutz, 1952). This molecule is spherical in structure with the Globin chains folded so that
the four haem groups lie in surface clefts equal distance and parallel from each other. The
molecule is held together in its quaternary structure by bonds between the opposite polar
chains and the structure changes as oxygen is taken up by each haem group. The structure
of haemoglobin is shown in fig 1.1 below
Fig 1.1 Quaternary structure of haemoglobin
When an Oxygen molecule binds to the haem group on one of the polypeptide subunit
chains it causes a structural change of the whole haemoglobin molecule and this allows
more oxygen molecules to bind to the three remaining subunit molecules in a summative
fashion from one of the subunits (Ogata and McConnell, 1972).
1
![Page 2: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/2.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Each molecule of haemoglobin can carry up to four molecules of oxygen when fully
oxygenated, with one oxygen molecule binding to each haem group, transporting Oxygen
from the lungs around the body. As blood travels through the arterial system and flows back
to the lungs, haemoglobin picks up Carbon Dioxide from the tissues and carries it to the
lungs. Haemoglobin also acts as a red blood cell buffer and reduces changes in pH within the
red blood cell when they are oxygenated or deoxygenated. Red blood cells contain
approximately 640 million haemoglobin molecules.
1.2 Haemoglobin gene clusters- classification and expression
The genes that code for haemoglobin in humans are found in two clusters on an α or α-like
complex on chromosome 16 and a β complex on chromosome 11 (Manning and Russell.,
2007). The α-like cluster can be found close to the end of chromosome 16 and is made up of
the functional genes α1, α2 and ζ, three pseudo genes ( genes closely resembling functional
genes but contain mutations which render them inactive):ψ ζ, ψα1 and ψα2 and ѳ, which
have no known function in haemoglobin synthesis. The α1 and 2 genes code α Globin chains
from late embryonic stage of life towards the liver and spleen are developed enough to
produce Haemoglobin and by the sixth month of pregnancy bone marrow of becomes the
main site of haemoglobin synthesis (Pallister, 2005). The ζ gene codes for an α like zeta chain
in early embryonic life and is active during the 5th week of gestation and Haemoglobin is
synthesized from erythroblasts in the gestational sac (Kunkel et al., 1955).
The β-like gene cluster is located on the short arm of chromosome 11. (Sutton et al., 1989) It
contains a single pseudo gene (ψβ), and five functional genes (€, Gγ, Aγ, δ and β) which
encode for the €, γ, δ, and β chains respectively. The γ chains are mainly coded in foetal life
by Gγ and Aγ when they combine with α chains to form foetal haemoglobin (Hb F). β Globin
gene synthesis begins after birth(Korf., pg 208., 2007). This shows therefore that locations,
types and rates of synthesis of different Haemoglobins can vary during foetal and adult life.
2
![Page 3: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/3.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
The locations of the haemoglobin genes are shown in fig 1.2 below
Fig 1.2 Location of Hb clusters on chromosome 11 and 16
Adult human haemoglobin (Hb A) consists of 2 α-Globin and 2β-globin chains of 141 and 146
amino acid chains respectively and also has a small percentage of Hb A 2 which has 2 δ-
globins and 2 α-globins.
Synthesis of globins is a complex process where transcription produces a messenger RNA
precursor; post transcriptional processing with 5’ end capping and methylation as well as the
various phases of translation, and finally the ionic interaction between the haemoglobin
chains to form mature active haemoglobin(Paul., 1976). Because of this myriad of active
processes and their complex nature, errors can occur during processing causing
haemoglobin disorders. Disorders of haemoglobin are categorised into two kinds; those
causing abnormalities of haemoglobin structure and those causing reduced Globin synthesis
(World Health Organization., 2006)
There are various kinds of structurally abnormal haemoglobins; some are clinically silent
however others have serious clinical implications that affect people who have abnormal
haemoglobin. The mutational mechanisms normally consist of point mutations but in some
3
![Page 4: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/4.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
case also include frame-shift mutations, in frame deletions, mis-pairing of homologous
sequences that lead to unequal cross-over of genes and formation of fused genes (Korf., pg
209., 2007)
1.3 Single nucleotide polymorphisms (SNP’s)
Single nucleotide polymorphisms, commonly referred to as “snips” (SNP’s) are the most
prolific type of genetic variation among people. SNP’s show a difference in a singleDNA
nucleotide, where one nucleotide is replaced by another for example, A G, C T and vice
versa in a certain stretch on a DNA strand.
SNP’s occur throughout DNA and are normally exhibited approximately every 300
nucleotides meaning there are around 10 million SNP’s occurring on the human genome.
SNP’s are usually found on DNA in between functional genes however when they occur on a
functional gene or on the regulatory region for a gene, they may cause or have a role in gene
abnormality and disease.
SNP’s usually have no effect on health and development and this explains why they occur so
frequently on the human genome. They do however sometimes provide important insight
into human health. Studies conducted have found that they may affect people’s responses to
drug metabolism (Kudzi et al., 2009), endogenous factors, and the risk of developing
diseases associated with the genome. SNP’s are also useful tools in determining hereditary
passing on of certain disease states such as obesity, diabetes, and cancer (Eftychi et al., 2004,
Herbert et al., 2006,).
1.4.1Haemoglobin Abnormalities
Hb abnormalities are inherited disorders in the Globin chains when the haem group is in the
normal state. They are mostly autosomal recessive abnormalities and common worldwide,
particularly within the malarial regions of Africa, the Mediterranean basin, the Middle East
4
![Page 5: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/5.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
and south East Asia (Modell and Darlison, 2008). It is thought that some of the heterozygous
carrier states with abnormal Hb afford protection against malaria (see Section 1.6).
When a haemoglobin abnormality causes a blood disorder it is known as a
haemoglobinopathy and the nature of the Hb abnormality will determine the clinical
significance.
Haemoglobinpathies are described as any blood disorder caused by defects in Globin gene
chain synthesis. Classified into two broad categories; those which cause a reduction in
haemoglobin synthesis (the Thalassaemias), and structural haemoglobinopathies where
haemoglobin variants cause the disorder (Sickle cell disease).
Haemoglobinopathies are the most common single gene disorders in man. They are passed on to
generation to generation and these conditions are more prevalent in populations of African, Arab,
Middle Eastern and Hispanic descent. The most common type of haemoglobinopathies are the
thalassaemias, and sickle cell anaemia.
According to the NHS In the UK, an estimated one in 300 babies of African-Caribbean parents and
one in 60 of West African parents are born with sickle cell disease each year. An estimated 8,000-
10,000 people with sickle cell disease and 600 with β Thalassaemia live in the UK. Approximately 1
in 4 West African, 1 in 10 African-Caribbean, 1 in 50 Asian and 1 in 100 Northern Greek have sickle
cell trait (carrier state). Whilst 1 in 7 Greek, 1 in 10-20 Asian, 1 in 50 African and African-Caribbean
and 1 in 1000 English people have beta thalassaemia trait. Worldwide α thalassaemia carrier states
are commoner than ß thalassaemia carrier states(European haemoglobinopathy registry., 2003)
Sickle cell anaemia and the Thalassaemias exhibit some clinical similarities between the two
conditions. Both are expressed as a direct result of a defect in the Globin chain and patients
suffer chronic haemolysis throughout their life. Patients of both conditions may also need
chronic blood transfusions. Subsequently, patients may be at risk of iron overload that has
5
![Page 6: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/6.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
its own clinical implications (Fung et al., 2008). Thalassaemias fall into three major categories;
α-thalassaemia, β-thalassaemia and High Persistence of Foetal Haemoglobin (HPFH). There
are rare thalassaemias which fall outside of these categories, namely δβ and εδβ-
thalassaemia and Hb Lepore (Weatherall, 2001).
1.3.2 Haemoglobin variants
Different kinds of Hb variants exist caused from autosomal recessive pairing of alleles and
are mainly due to substitutions in the β-chain(refer to fig 1.2 ) Rare Hb variants such as
Haemoglobin H and Haemoglobin Barts may also come about from the extension or deletion
of the Globin chain ( Giardine et al., 2007).
The occurrence of abnormal haemoglobins varies significantly between ethnic groups
(Modell and Darlison, 2008). Haemoglobin C occurs in approximately 2-3% of people of West
African descent and most people are heterozygous for it. Homozygosis is rare and has mild
clinical symptoms. Haemoglobin E is one of the more common β globin chain variants and
is relatively common in Southeast Asia (Flatz., 1967). Amino acid substitutions along one
polypeptide chain generally create a high affinity for oxygen. The most prevalent
Haemoglobin disorder caused by an Hb variant is Haemoglobin S which causes the
potentially life threatening disorder known as sickle cell anaemia.
1.3.3 Haemoglobin S and Sickle cell anaemia
One clinical condition that can be caused by having mutations of the parts of haemoglobin
genes is sickle cell anaemia. It is one of the most common hereditary diseases in the world
and mainly affects people whose ancestry is from sub-Saharan Africa although it is also
known to affect Mediterranean, Middle Eastern and Asian populations (Cihan Öner et al.,
1992). The disease shows autosomal recessive inheritance so to have the condition you
6
![Page 7: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/7.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
must receive one recessive allele from both parents. The gene mutation causing the
formation of Hb S is: GAG GTG. This mutation results in substitution of the amino acid
valine (Val) for glutamic acid (Glu) in the sixth position of the β- Globin chain (α2 /β2 6val).
Despite being a minor change in the polypeptide sequence, it causes serious implications in
people with this mutation on their Hb gene cluster (Bunn, 1997). Sickle cell anaemia is the
most common haemoglobinopathy and usually occurs between various ethnicities in
populations that are exposed to falciparum malaria and the anopheles mosquito. The
disease was initially classified by Herrick et al in 1910 and Singer and Wells explained the
mutation causing Hb S in 1925.
Hb S in sickle cell patients manifests itself by causing sickling in red blood cells, causing them
to be rigid and take up a crescent shape. Hb S is insoluble and crystallises under low O2
partial pressure (Bunn., 1998, Lonergan et al., 2001, Higgs and Wood, 2008). Sickled Red blood
cells also interfere with oxygen transport as they are less elastic to movement inside
capillaries. Haemoglobin gives up oxygen more readily than normal haemoglobin and the
oxygen dissociation curve is shifted to the right.
Fig1.3 and fig1.4 below show the distortion of red blood cells with Hb S and the shifting of
the Oxygen Dissociation Curve among normal haemoglobins and SCA respectively.
7
![Page 8: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/8.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Fig1.3 Appearance of normal and sickled red blood cells
8
![Page 9: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/9.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Fig1.4 Oxygen Dissociation Curve for normal, sickle cell trait and sickle cell sufferers
1.3.3.2 Complications and clinical implications of sickle cell disease
Red blood cells exhibiting Hb S as explained before are sickled in shape and are inflexible
making them incapable of efficient circulation in small blood vessels, causing them to have a
life span of only 10-20 days as compared to normal healthy Red Blood Cells which live up to
120 days. Anaemia results because of this and other crises occur in sickle cell patients. Sickle
cell disease is a major public health problem in several countries particularly less
economically developed countries (LEDC’s) and gives significant morbidity and mortality in
particular with young children aged 1 to 3 years of age caused by cerebrovascular accidents
and viral infections (Leikin et al., 1989, Athale and Chintu, 1994). Blood transfusions in these
patients is sometimes necessary and can cause iron overload which damages vital organs
such as the heart, liver and spleen (Wood, 2008). Life expectancy in patients with Sickle Cell
9
![Page 10: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/10.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Disease is greatly reduced and patients rarely live past the age of 35. Moreover quality of life
in SCD patients is low as they are constantly dealing with crises and the residual effects of
anaemia and other complications. The crises that manifest themselves in SCD patients
include haemolytic anaemia, Ischaemic pain, susceptibility to bacterial infections and severe
organ dysfunction (Vichinsky et al., 1998, Frempong et al .,1988, Serjeant et al.,). Clinical
complications of SCD occur among homozygous Hb SS, or in those heterozygous for Hb S and
another abnormal haemoglobin e.g. Hb C, β+ thalassaemia or. People with Sickle Cell disease
that are homozygous (Hb SS) exhibit 90-95% Hb S in their erythrocytes (Wood et al., 1980).
Disease severity is determined by the genotype exhibited by the patient and homozygous Hb
SS is the most clinically significant and crises of Sickle cell Disease are classified as being
haemolytic, aplastic or vasco-occlusive. Vasco-occlusive crises are the most common
complication of SCD and they arise from interaction of sickled erythrocytes with White Blood
Cells, Endothelial cells, Platelets and Plasma. Capillaries and microvascular beds become
obstructed and causes problems such as leg ulcers, neuropathic and chronic pain, renal
problems and in some extreme cases stroke (Yale et al., 2000). Ischaemia also results
causing an absolute reduction of oxygen supply to some organs, joints and bones. Ischaemic
injury is recurrent and produces a distinct chronic pain syndrome (McClish et al., 2005,
Shapiro., 1989).
Aplastic crisis may occur in patients with SCA due to parvovirus B19 (B19 virus). Parvovirus
B19 is a DNA virus that infects and destroys erythroid cell progenitors (Setubal et al., 2000).
This crisis is usually preceded by a febrile illness in hereditary haemolytic anaemia’s,
resulting in likely Bone Marrow failure. The crisis is characterised by low Hb concentrations
and a low reticulocyte count (Setubal et al., 2000, Pattison et al., 1981). Carriers, who are
heterozygote for the gene are known as having the sickle cell trait are usually healthy,
10
![Page 11: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/11.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
although they can exhibit some symptoms when there is reduced partial pressure of oxygen,
such as vaso-occlusive episodes.
In some sub-Saharan populations the number of people carrying the sickle cell trait can
reach levels of up to 20%. This is because there is some survival benefit because there is a
connection between being a SC carrier and malaria resistance, and in these populations
malaria is one of the biggest killers.
1.4 Malaria and sickle cell disease
Malaria is a disease caused by the parasite Plasmodium falciparum and the disease is
transmitted to people through the bite of the female anopheles mosquito which thrive in
the tropical conditions of sub-Saharan Africa. The mechanism by which HbAS genotype
protects against malaria has been the subject of debate for more than 50 years. While it is
thought that it relates to the physical characteristics of HbAS erythrocytes, a number of
studies (Aidoo et al., 2009, Williams et al., 2005) suggest that sickle cell carriers may also
enhance natural immunity to plasmodium.
Studies show that mortality rate of malaria in people with Sickle cell trait is conclusively
lower than in normal individuals. Experiments involving P.falciparum in vitro have been
conducted to show the growth of the parasite in sickled RBC’s at standard partial pressure of
oxygen and a low O2 atmosphere and at low concentrations an inhibition of plasmodium
growth is shown.(Friedman, 1978) Sickled RBC’s, and those of carriers(Hb AS) provide an
unsuitable environment for the developing life cycle of the malaria parasite and this gives
evidence of the high proportion of heterozygous Hb AS people in malaria endemic areas.
11
![Page 12: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/12.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
1.5 β-Globin cluster haplotypes
There are 5 different haplotypes of the βs gene (Hanchard et al., 2007, Nagel and Ranney,
1990) causing SCA and they are named after the geographical region where they were first
identified. They are Senegal, Benin, Bantu, Cameroon and Arab-Indian (Nagel and Ranney
1990). The first four mentioned are mostly found in African populations whereas the Arab-
Indian is found in the Middle East and Asia. The Arab-Indian Haplotype and Senegal
Haplotype exhibit less clinical symptoms than the other haplotypes found in Africa. This has
been reported in studies showing clinical severity among people with different haplotypes
explained by having the post natal expression of Hb F present in people expressing these
haplotypes . The different haplotypes causing SCA can be identified by amplification of their
restriction endonuclease sites on the β-Globin cluster by using RFLP and restriction enzyme
digestion. Approximately 5% to 10% of people exhibit what are referred to as atypical βs
haplotypes (Powers and Hiti, 1993., Rahimi et al., 2007).
Haplotypes for sickle cell anaemia can be studied using techniques that can amplify and
visualise DNA fragments such as southern blotting, polymerase chain reaction,
electrophoresis and restriction enzyme digestion.
1.6Restriction fragment length polymorphism analysis
PCR- RFLP analysis is at present the best method used in the analysis of the blood samples
and is also used for diagnosis of haemoglobinopathies. Polymerase Chain Reaction amplifies
individual alleles on the dried blood samples, and restriction enzyme digestion shows the
researcher which specific allele is present in each sample (Chang et al., 1981 ).
12
![Page 13: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/13.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Restriction enzymes complimentary to the primers used in the amplification cut double
stranded DNA at specific SNP’s. Mutations destroy or alter restriction enzyme sites, allowing
polymorphisms from abnormal genes to be visualised (Sutton et al.,1989).
The Hb S gene is associated to certain DNA structures by specific restriction endonuclease
positions in the β-Globin cluster (Rahimi Z,Karimi M, Hagshenass M, Merat A 2003). PCR
products were treated by suitable enzymes and then Agarose gel electrophoresis will be
used to separate the fragments. The bands are stained with Ethidium bromide and can be
visualized by ultra violet (UV) light box ( Zago., 2001, Goncalves., 2003, Liu., 2009)
1.6 Management of Haemoglobinpathies in Ghana
Ghana is a country in West Africa spanning an area of 238,000 km and has a population of
approximately 22 million. There are over 100 ethnic groups that exist in the country and this
gives great variation in the genetic profiles. Approximately 2% of newborn babies born in
Ghana are diagnosed with sickle cell disease. Carriers of the sickle cell trait are high in
proportion as malaria is an epidemiological problem (Kleinschmidt et al.,2001).
Management of haemoglobinopathies, in particular Sickle Cell Disease is very important in
maintaining a healthy population because of its endemic status for the people of Ghana and
since sickle cell has no cure at the moment. There are different strategies that the Health
ministry in Ghana use to manage the sickle cell problem and these include public health
education, screening programs and increased monitoring of the SCD problem within the
country. However considering that Ghana is still a less economically developed country
these strategies would be met with some difficulty perhaps for lack of resources, funding
and infrastructure. (Modern Ghana 2009)
13
![Page 14: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/14.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
1.5. 1 Health education
Patients with haemoglobin disorders must be educated on how to manage their health since
they are life-long disorders where symptoms can manifest without warning. In the case of
SCD patients should be pro-active in conjunction with their physicians in matters of care,
wellbeing, diet and medication. Patients should be informed on details of the disease and be
aware of how they may avoid complications associated with it. Public health education is
also important among Ghanaian citizens concerning SCD and the health ministry have
through the years had different programs and showcases to educate people on SCD.
Genetic screening, counselling/education to young couples informing them on the
implications of having children with others who have SCD or sickle cell trait. This however
would cause some controversy as Ghana is a country of traditional values.
1.6.2 Screening programmes
People with SCD, carriers of the sickle cell trait and individuals planning on having children
with people that may have SCD or sickle cell trait should ideally go through screening
processes before having offspring. Screening should be run in all major hospitals as part of
pre-natal care and this would benefit the people of Ghana and future generations.
Screening of newborns for SCD allows for early initiation of prophylactic therapy, health
management and parental education and thus results in reduced mortality. Since 1993
screening has been done firstly through the sickle cell clinic at the Komfo Anokye Teaching
Hospital, Kumasi, Ghana (Ohene-Frempong., 1995)
1.6.3 Clinical treatment of sickle cell disease
although the above strategies are useful in getting people to be more knowledgeable about
sickle cell disease for those children and adults that suffer from the disease there must be
14
![Page 15: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/15.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
treatment available to improve quality of life of patients and reduce the symptoms of the
disease. Treatments usually centre around prevention of crises.
The first method of clinically treating sickle cell anaemia are blood transfusions. Transfusions
help to improve anaemia by increasing non-sickled red cells into the circulation of the
patient. Blood transfusions must be performed chronically to children with sickle cell disease
and this may cause iron overload or transmission of bacterial and viral diseases so care must
be taken when using this strategy.
Oral penicillin is given to children with sickle cell disease from the age of 2 months old to at
least five years old to provide prophylaxis to parvovirus infections, and 1mg of folic acid per
day.
The first effective drug treatment for adults with severe sickle cell is daily doses of the anti
cancer drug Hydroxyurea (National Heart, Lung and Blood Institute 1995) . the drug reduced
the frequency of crises, acute chest syndrome and patients required fewer blood
transfusions. The precise mechanism of action of Hydroxyurea causing it to reduce these
symptoms is unknown however the drug causes an increase in HbF levels in patients.
Mild pain can be treated with heat pads and over the counter medication but more painful
crises may have to be attended to in out-patient facilities. Treatments for acute pain crises
when a patient is admitted are fluids and pain killing medication. Fluids help to prevent
dehydration caused by the anaemia, and Non steroidal anti inflammatory drugs and opioids
such as morphine, Declophenac, Hydrocodone and others are used to treat the pain.
Oxygen therapy may also be required to get sufficient oxygen back into the circulation.
Bone marrow transplants are currently being studied as a treatment or cure for people with
significant symptoms and problems derived from being a patient of sickle cell anaemia. Bone
15
![Page 16: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/16.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
marrow from the patient is replaced with healthy bone marrow from a donor who does not
suffer from the disease. This procedure however is not conducted in Ghana as most people
do not have the money to try this strategy.
1.7 Objectives and hypothesis of study
The objectives of this study were to;
Purify dried blood samples on FTA cards and Amplify DNA SNP’S using RFLP with
different primers specific for Hb gene cluster
Run amplified samples on Agarose gel using electrophoresis
Conduct restriction enzyme digest on amplified samples and run the samples again
on Agarose gel
Create a Haplotype map of Ghanaian population
The hypothesis to be tested is “overall the Ghanaian population will exhibit a higher
percentage of Cameroon, Benin and Bantu haplotypes as opposed to Senegal and Arab-
Indian haplotypes”
16
![Page 17: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/17.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
2. Methods
2.1 Method optimisation
To perform analysis of Hb haplotypes it is necessary to amplify DNA from the blood samples
obtained. Different methods can be used to purify and store DNA from whole blood. In
mammals erythrocytes do not contain a nucleus and so the DNA is extracted from plasma
and other cell types in the blood. One method of DNA purification from whole blood is
known as the Buffy coat preparation.
2.1.2Buffy coat preparation
Buffy coat is defined as a clear section of liquid in an anti-coagulated blood sample after
centrifugation of whole blood that contains most of the platelets and white blood cells. The
buffy coat is normally white in color but can also exhibit a green hue if the blood sample
contains a large amount of neutrophils (reference)
When whole blood is centrifuged it separates into its various components according to their
respective densities inside the tube it is centrifuged in. Plasma settles at the top (approx.
50% of blood), red blood cells at the bottom of the tube (45% of blood) and a clear layer of
platelets and white blood cells. The buffy coat can be used to extract DNA from whole blood
as Red Blood Cells in mammals are anucleate. Other applications of the buffy coat
preparation are the QBC(quantitative buffy coat) which is a diagnostic test used to detect
blood parasites(e.g. malaria), and in cases of low white blood cell counts the buffy coat
preparation can be used to procure a more differential blood smear to count WBC’s. A
diagrammatic representation of centrifuged whole blood is shown in fig2.1 below.
17
![Page 18: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/18.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Fig2.1 shows the separation of blood components after
centrifugation showing the Buffy coat
In this study the Buffy coat preparation was used as a method of control to check if the DNA
primers, thermal cycler and electrophoresis machine were working properly. A fresh blood
sample was obtained from a member of staff for this purpose. After the blood cell was
taken the Buffy coat preparation was conducted as per the guidelines of the QIAGEN spin
protocol for purification of DNA from blood or bodily fluids... The way the protocol was
conducted is described below in accordance with the QIAamp DNA mini and blood mini
handbook and it is described below.
2.1.3Buffy coat protocol
All centrifugation steps were carried out at room temperature, and the heating block oven
was switched on and set at 560C. Buffers and QIAGEN protease were prepared according to
instructions in the kit (QIAamp DNA mini and blood handbook pg 17).
The procedure was carried out as follows;
1. 20µl QIAGEN protease was pippeted into a 1.5 ml microcentrifuge tube
18
![Page 19: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/19.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
2. 200µl of sample was added to the microcentrifuge tube and the tube is then
vortexed to mix the constituents
3. 200µl of buffer AL is added to the sample and the tube is vortexed again to ensure
efficient cell lysis from a homogenius solution
4. Sample is then incubated at 56oC for 10 minutes
5. To remove drops from the inside of the lid of the microcentrifuge tube it is then
centrifuged briefly
6. 200µl of 100% ethanol was added to the sample, and mixed again by pulse
vortexing for 15 seconds.
7. The mixture from step 6 is then applied to a QIAamp mini spin column(in a 2ml
collection tube) without wetting the rim. The cap of the mini spin column is then
coveres and the solution centrifuged at 8000 RPM for 1 minute. The tube containing
the filtrate is then discarded and the pellet obtained. The pellet is what contains the
DNA
8. 500µl of buffer AW1 is then added to the QIAamp mini spin column, the lid of the
column is closed and the tube spun again at 8000 RPM and the filtrate is again
discarded.
the pellet obtained contains amplifiable DNA and RFLP analysis can be conducted on
the sample.
This was done in triplicate and all samples had a successful amplification showing
that the primers used, thermal cycler and electrophoresis machine were working
well. With this information the Ghanaian samples could now be done to see their
haplotype profile for the β globin gene cluster
19
![Page 20: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/20.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Different βs haplotypes are differentiated in RFLP by providing different profiles with
restriction enzymes and this is shown in Table 1.
βs -Haplotype Result of the Restriction sites
Benin (----+)
Bantu (--+--)
Cameroon (--+++)
Senegal (-++-+)
Arab-Indian (+++-+)
Atypical (-----)(--+-+)(--- ++)
Table 1 . Details βs-haplotypes for the presence (+) or absence (-)
of restriction sites for restriction enzymes HindII ‘5 to ε, Xmn1 ´5 to Gγ, . HindIII within IVS II Gγ, HindIII within IVSII Aγ and HindII ´3 to
ψβ
2.2Materials and Method
2.2.1Subjects and sample collection
The study group consisted of adults from Ghana with unknown βs haplotypes. Ethical
approval was obtained for the project and written informed consent was given by each
participant prior to collection of the specimens. Transportation of fresh blood samples from
other countries is prohibited by UK customs and so Whatman FTA cards were utilised to
store the blood samples. FTA cards are useful as they are user-friendly (blood droplet is
simply blotted on FTA matrix and left to dry). They provide a means of storing whole blood
for long periods of time and can be kept at room temperature without the blood samples
20
![Page 21: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/21.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
going off. 30 samples were used for the analysis to give reasonable numbers for creating a
Haplotype map and statistical analysis of results obtained.
2.2.2DNA purification from FTA cards
The dried specimens are purified before amplification of DNA according to the instructions
given by Whatman and they are as follows:
Firstly, a micro-punch is used to punch a hole in the FTA filter paper to give a small circle 2
mm in diameter take from the dried blood. Each specimen is punched twice to obtain
sufficient DNA to amplify and these are placed in a PCR tube. Filter paper is used to clean
the micro-punch between samples to avoid cross contamination between the specimens.
Following this, 200µl of FTA purification reagent is added to the PCR tube and left to
incubate at room temperature for five minutes. The FTA purification reagent is then
removed taking care that all liquid is removed from the PCR tube. This step is repeated twice
to properly purify the DNA from the sample. In order to stabilize the DNA and remove any
unwanted metals ions (i.e. Fe2+ from erythrocytes), the filter paper is washed twice with
200µl of TE buffer for 5 minutes at room temperature. Finally, the cards are dried at 58 0C for
15 minutes to remove residual moisture. DNA amplification in a PCR is then performed.
FTA card sample collection is shown in the figure below
21
![Page 22: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/22.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Figure 2.1 showing FTA cards and various micro-punches that can be
used to collect samples from FTA cards (taken from
http://www.genengnews.com/media/images/product/product_327
0.jpg)
Five regions in the β-gene cluster were to be amplified by PCR according to PCR protocol (see
fig 1.3); using five different published primers (forward and reverse) specific for the β cluster
that are listed in Table 2. Following amplification, samples were run on Agarose gel, and
restriction digestion was performed and fragments were analysed Agarose gel
electrophoresis.
22
![Page 23: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/23.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Restriction
enzymes
Primers (´5 - 3')
F: Forward R:Reverse
Product
size, bp
Presence
of site, bp
1. HindII
´5 to ε
F: TCTCTGTTTGATGACAAATTC
R: AGTCATTGGTCAAGGCTGACC
760 314
446
2. Xmn1 ´5
to Gγ
F: AACTGTTGCTTTATAGGATTTT
R: AGGAGCTTATTGATAACCTCAGAC
650 450
200
3. HindIII
within IVS II Gγ
F: AGTGCTGCAAGAAGAACAACTACC
R:CTCTGCATCATGGGCAGTGAGCTC
323 235
98
4. HindIII
within IVSII Aγ
F: ATGCTGCTAATGCTTCATTAC
R: TCATGTGTGATCTCTCAGCAG
635 327
308
5. HindII ´3 to
ψβ
F: GTACTCATACTTTAAGTCCTAACT
R: TAAGCAAGATTATTTCTGGTCTCT
914 480
434
Table 2. details primers (forward and reverse), restriction enzymes and product sizes (both
before and after digestion) of the βs haplotypes (reference)
Key: F: Forward; R= reverse
2.2.3DNA amplification-PCR reaction conditions
The PCR reaction is prepared in a final volume of 50μl for each DNA sample as detailed
in Table 3.
These solutions were added to PCR tubes used for the PCR amplification.
23
![Page 24: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/24.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Reagents Volume (μl)
Master Mix 25
Nuclease free water 23
Forward primer 1
Reverse primer 1
Cards as template 2discs
Total 50
Table 3. Master Mix is supplied as 2X dNTPs, MgCl2 and reaction buffer
([pH 8.5)
The labelled tubes are placed on ice before addition of the reagents (i.e. all the reagents
should be added on ice). Fresh pipette tips must be used for each component in order to
limit cross contamination. Following addition of all reagents the reaction mixture is
centrifuged in a micro-centrifuge for 13,000 rpm for a few seconds until it is seen all
reagents are mixed into the tube. At this point is where the samples can be placed in a
thermal cycler. The thermal cycler was then programmed as detailed in Table 4. 30 cycles
are normally sufficient for amplification of DNA samples, however where DNA is limited or
of poor quality, 36 cycles are required.
Temperature Time Steps (Cycles)
24
![Page 25: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/25.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
94°C 5min1. Initial Denaturing
(x1)
94°C 60s 2. Denaturing
55°C* or 65°C† 60s
3. Annealing (x30 or x38)
72°C 90s 3. Extension
72°C 3min 5. Final Extension (x1)
Table 4. PCR cycling parameters
2.2.4Restriction enzyme digestion
Restriction endonucleases recognise and cut the DNA wherever a specific sequence is found.
These enzymes cut double stranded DNA by the creation of two breaks, one on each of the
phosphate backbones of the double stranded DNA helix, resulting in destruction of DNA
nucleotides. The PCR products were treated with suitable enzymes. The restriction enzymes
to be used include HindII ´5 to ε-Globin (5´ ε-HindII), the Xmn1 ´5 to Gγ (Gγ- Xmn1), the
HindIII sites at intervening sequence II of Gγ-Globin (Gγ-IVS II Gγ) and Aγ-Globin (Aγ- HindIII
within IVSII), the HindII site 3´ to ψβ-Globin (3´ ψβ-HindII) HindII sites in IVS 11 β Globin (β -
AvaII within IVS 11) and were used to detect βs-haplotypes. Restriction digestion was
performed by addition of reagents as detailed in Table 4
25
![Page 26: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/26.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
The following volumes of reagents were used to make up a final volume of
20µl. BSA buffer (0.02 µg/ml) is usually added when using HindII and Xmn.
Reagent Volume (µl)
PCR product 10
Restriction enzyme 1
BSA(where applicable) 0.02 µg/ml
Buffer 2
Nuclease free water 6.8
Total 20
Table 5. Volume of reagents added to the PCR tube to perform the restriction
digestion
Restriction digestion is then performed at 37 °C for two hours. After digestion, the
temperature is increased to 65 °C for 10 min so as to denature the restriction enzymes.
Digestion products are then separated on a 2% Agarose gel.
2.2.5 Gel electrophoresis
Gel electrophoresis is the easiest and most convenient method of separating DNA fragments
according to size. After restriction enzyme digestion Agarose gel electrophoresis is used to
visualize DNA fragments. DNA nucleotides have a negative charge and so can move along a
circuit when electric current is applied. DNA molecules move along the gel, which is a
polysaccharide matrix that captures DNA molecules as they move through the electric
current. Smaller DNA fragments travel further along the gel as they can travel through the
mesh-like framework of the Agarose gel.
26
![Page 27: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/27.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Different gel tanks can be utilised depending on the number of samples to be analysed, large
gels provide a better resolution of DNA fragments and it is possible to analyze more samples
on it however smaller gels run much faster.
When Ethidium bromide is added to the gel, it intercalates to the DNA fragments allowing
for UV visualization using a UV light box. DNA fragments when visualised give the
appearance as thick bands on the Agarose gel and the distance travelled gives an indication
of the size of the DNA fragment. A DNA ladder is placed in the first well of the gel to allow
sample’s DNA fragment size to be found. A visualisation of a hundred base pair and fifty
basepair ladders are shown below
figure 2.2 a 100 base pair ladder marker
Gel Electrophoresis is performed as follows:
Agarose powder is added to 1× TAE buffer to a final concentration of 2% inside a screw-top
glass conical flask. The solution is covered and then heated in the microwave, shaken every
27
![Page 28: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/28.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
so often so as to dissolve the Agarose powder, and heating is stopped when a transparent
solution with no granules is seen. Care should be taken during this step as the solution can
easily boil over in the microwave or indeed when shaking. The flask should be held at arm’s
length at all times to avoid any mishaps. To provide protection for the hands it is advised to
handle the flask with a cloth wrapped around it. The solution is left to cool in the fume
cupboard prior to addition of 1.25 µl of Ethidium Bromide. Ethidium bromide is a strong
mutagen and carcinogen and therefore must be added to the liquefied Agarose gel inside a
fume cupboard. Extra care must be taken not to inhale fumes of Ethidium Bromide or allow
it to make contact with skin. The gel is then placed in an oven for 20 minutes at 65°C to
ensure complete Agarose dissolution. The Agarose solution is then poured into a casting tray
containing a sample comb and left for half an hour to solidify at room temperature with the
cover left on. If any bubbles appear on the gel they must be pushed away or sucked out
using a disposable pipette tip. If bubbles are in the gel it will not run properly. The comb is
then removed and the gel completely immersed in 1X TAE buffer.
3µl of the DNA ladder is added to the outside well. 10ul of the sample is added to a 1.5ml
tube and mixed with 2µl loading dye. The mixture is spun briefly in a centrifuge to mix
samples and loading dye before loading into the sample wells. The lid and the power leads
are placed on the apparatus in the positive and negative terminals and the current is applied
at 50volts. Bubbling of the buffer solution is an indication that current it flowing. The gel is
left to run for approximately 40 minutes, or until the dye front had moved two thirds of the
length of the gel. Current applied may increase the temperature of the buffer and care must
be taken such that the temperature increase is not so much that the gel doesn’t run
properly. Once the gel has run the current is switched off and the gel is removed from the
28
![Page 29: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/29.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
apparatus and washed off to remove any buffer still on it. The bands are visualised on a UV
light box and photographed by Uvitec Gel Documentation System.
3. Results
29
![Page 30: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/30.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Results were obtained from the PCR products with primer 1 to see if amplification of the ε
allele from any of the dried blood samples occurred. For the amplification of the DNA from
the Ghanaian blood samples to be to be successful the Agarose gel run on the electric
current would show dark bands corresponding to the 760 bp position on the 100 base pair
ladder added in the first well of each gel ran. An expected result is shown in the figure below
which is a gel image from electrophoresis showing what an expected result would look like
under UV light.
Fig 3.1 expected results for amplification with primer 1
60% of samples tested with primer 1 produced a positive DNA amplification of the region of
the β globin gene cluster before restriction enzyme digestion. Samples that did not produce
active PCR products, or did not show a positive amplification the process of FTA card
30
![Page 31: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/31.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
purification, addition of primers and PCR was repeated with a further 15% of samples
produced a band on Agarose gel after electrophoresis of the PCR products
25% of the samples produced unexpected results i.e those where the samples did not
produce an amplification of the βs gene cluster.
After electrophoresis the samples were then treated with the restriction enzyme digestion
HindII´5 to ε with the restriction enzyme and ran through PCR to see the ratio of samples
exhibiting wild-type alleles and mutant-type alleles. Blood samples that exhibit the wild-
type allele will produce the same result as when ran on Agarose gel before digestion with a
band being shown at 446 bp along the gel. However samples that have a mutation on the
DNA fragment will show 2 bands at the 446 bp position and at the 314 bp position as well.
Samples showing bands at unexpected position can also occur and is assumed to be due to
human error or contamination of the sample and repeated. Examples of these scenarios are
shown in the figures below
31
![Page 32: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/32.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Figure 3.2 Wild type, mutant and erroneous results for restriction enzyme digestion
After digestion 82% of samples produced a negative result for presence of a mutant allele
and 18% of samples produced a positive result.
The overall results for each of the 30 samples amplification and restriction enzyme digest
was tabulated and plotted in a pie chart using Microsoft excel to show the overall ratios of
those samples which showed a (+/+), (+/-) and (-/-) results for RFLP analysis for the
32
Mutant
Wild type
erronous
![Page 33: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/33.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
restriction enzyme HindII´5 to ε and this is shown below
Fig 3.3 Overall results for RFLP with HindII ‘5 to ε
33
![Page 34: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/34.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
4. Discussion
Overall the amplification of the ε gene from the DNA of the
Ghanaian blood samples was successful and results for 30
individuals were obtained
the results produced were unexpected according to my
hypothesis as neither the Benin, Bantu or Cameroon haplotypes
normally exhibit a positive result with the restriction enzyme
HindII. 18% of samples however did have a positive result after
restriction enzyme digestion and it is assumed that these
samples either exhibited the Arab Indian haplotype, Atypical or
were of unknown haplotype.
Amplification and restriction enzyme digestion for the other
four primers on the dried blood samples was not completed as
the supply of FTA TAE purification buffer in the lab ran out. At
this point more TAE buffer was ordered from the lab. When the
new purification reagents arrived amplifications with the
remaining primers were performed. However when run under
electrophoresis none of the samples produced successful
amplification. Amplification was repeated with primer 1 and
fresh blood samples and still produced a negative amplification
as shown below, with no bands being produced. This is shown
in the gel image overleaf
34
![Page 35: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/35.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
The same situation occurred with my colleagues samples and so
we decided that there was a problem with the DNA purification
reagents and so more were ordered but by time of delivery
there was no more time available in the laboratory to finish
testing the rest of the restriction enzymes.
Because of the problem with the DNA purification reagents, not
all the objectives of the study be completed and thus giving us
inconclusive results for the diagnosis of the ghanaian
population. As a direct result of this a haplotype map could not
35
![Page 36: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/36.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
be created for the ghanaian population and statistical analysis
could not be completed.
4.2 limitations and improvements
Although the study was halted by the unavailability of DNA
purification reagents i believe that the main limitation in
completing the study and evaluating whether the hypothesis to
be studied was time available. RFLP is a very reliable technique
for amplifying DNA however it is time consuming especially
when combined with purification from FTA cards. DNA
purification with FTA cards may take up to an hour to complete,
PCR cycling takes up to 3 hours, electrophoresis up to 40
minutes and restriction enzyme digestion another 2 hours to
complete. This would not be that an issue but because only
microscopic volumes of reagents are used for amplification and
restriction enzyme digestion it is hard to speculate on whether
samples have mixed in with reagents efficiently, and this can
only be seen once electrophoresis has been performed.
Any samples where mistakes or errors occurred had to be
repeated from the first steps of purification. As i only have an
undergraduate understanding pharmacology and at the
beginning of the project had previously only ever attempted
amplification of a single gene minimal genetic engineering
knowledge and so human error also contributed to my inability
36
![Page 37: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/37.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
to complete the study. As the β cluster requires amplification of
all 5 subunits to give a proper representation of haplotype
exhibited it may have been ambitious to try and complete
testing all samples within the timetabled time given to the
project.
The limitations of the project however can be overcome in
various ways. I propose that if possible that fresh blood samples
be used instead of the dried samples. This could be done by
taking blood samples from students from the university that are
of ghanian descent provided ethical approval for the study
could be attained
Conclusion
After completion of the research, laboratory work and write-up
of this project, conclusions can be drawn about the β globin
gene, sickle cell disease and its management in Ghana.
Analysis of blood samples for mutations on the β globin gene
can give researchers and medical analysts a way to diagnose
patients for sickle cell disease, its severity, epidemiology, and
the pattern of inheritance of the Hb S allele over generations.
Further studies can be conducted to compare the existence of
the various sickle cell haplotypes in different countries, the
geographic variation of the haemoglobin S allele and its genetic
epidemiology in Africa.
37
![Page 38: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/38.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
RFLP is a reliable method in testing for the existence of sickle
cell haplotypes. Successful amplification of DNA from blood
samples can be conducted as can restriction enzyme digestion
and separation of DNA fragments on Agarose gel with sufficient
resolution of different DNA fragments. However it is a time
consuming method and requires sufficient time when studying
a population to create a haplotype map. If a method could be
developed where restriction enzyme digestion could be
conducted on multiple sites and sufficient resolution on
Agarose gel after electrophoresis it would prove to make
construction of a haplotype map much easier.
Sickle cell disease continues to be a serious health problem for
the Ghanaian people. The methods utilised to deal with this
problem by the health ministry in Ghana is sufficient for the
infrastructure that exists in the country and it can be said that
the country is doing as best as it can to address the problem.
Citizens are well educated about the disease and treatments for
people with sickle cell disease are available in sickle cell clinics
and hospitals. There may however be reduced treatment
options to people in rural or isolated areas who cannot afford
medication and other treatments.
The hypothesis that the Ghanaian population would show a
higher proportion of the Benin, Cameroon, and Bantu
haplotypes was inconclusive and no other studies dealing with
38
![Page 39: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/39.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
globin gene haplotypes has been done for a Ghanaian
population before. However information from other studies
shows that neighbouring countries show that there is a high
proportion of the Benin haplotype. Further studies for a
Ghanaian population would have to be done to test the
hypothesis and create a haplotype map of the population.
39
![Page 40: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/40.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Bibliography
Aidoo M, Terlouw D J , Kolczak M S , Peter D McElroy, Feiko O Kariuki S, Nahlen B L et al
(2002 april); Protective effects of the sickle cell gene against malaria morbidity and
mortality; published online 15; cited 2009 December 08
Athale UH, Chintu C. (1994 June). Clinical analysis of mortality in hospitalized Zambian
children with sickle cell anaemia. East Afr Med J;71(6):388-91.
Bunn HF. (September 1997). Pathogenesis and treatment of sickle cell disease. N Engl J Med.
11;337(11):762-9.
Charache, S., et al (1995). Effect of hydroxyurea on the frequency of painful crises in sickle-
cell anemia. New England Journal of Medicine 332, 1317–1322
Eftychi , C., Joanna M, , Howson, M., et al (March 2004) Analysis of the Type 2 Diabetes-
Associated Single Nucleotide Polymorphisms in the Genes IRS1, KCNJ11, and PPARG2 in Type
1 Diabetes, Diabetes. 53 (3) 870-873
Flatz G (1967). Haemoglobin E; distribution and population dynamics; human genetik (3)
189-234
Friedman MJ. (1978 April) Erythrocytic mechanism of sickle cell resistance to malaria. Proc
Natl Acad Sci U S A;75(4):1994-7.
Fung EB, Harmatz P, Milet M, Ballas SK, De Castro L, et al (April 2007). Morbidity and
mortality in chronically transfused subjects with thalassemia and sickle cell disease: A report
from the multi-center study of iron overload. Am J Hematol;82(4):255-65.
Fung EB, Harmatz PR, Milet M, Coates TD, Thompson AA, Ranalli M, et al. (2008 July)
Fracture prevalence and relationship to endocrinopathy in iron overloaded patients with
sickle cell disease and thalassemia. Bone.;43(1):162-8.
40
![Page 41: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/41.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Gabriel, A. & Przybylski, J. (2010) Sickle-cell anemia: A Look at Global Haplotype
Distribution. Nature Education 3(3):2
Hanchard N, Elzein A, Trafford C, Rockett K, Pinder M, Jallow M, et al (2007). Classical sickle
beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African
and Afro-Caribbean populations. BMC Genet.;8:52.
Herbert, A., Gerry, N, P., McQueen M, B., (N/A). A Common Genetic Variant Is Associated
with Adult and Childhood Obesity. Retrieved 22nd December 2009
Herrick JB (1910). Peculiar elongated and sickle-shaped red blood corpuscles in a case of
severe anemia.. Yale J Biol Med.;74(3):179-84.
http://www.ncbi.nlm.nih.gov/About/primer/snps.html
http://www.who.int/mediacentre/factsheets/fs308/en/index.html
Korf B R., Human genetics and genomics..: 3rd Edition (2007) pg 208-212
Kudzi W , Dodoo NO A, Mills JJ (2009). Characterisation of CYP2C8, CYP2C9 and CYP2C19
polymorphisms in a Ghanaian population BMC Medical Genetics, 10(124)1471-2350-10-124.
Kunkel HG, Wallenius G. New hemoglobin in normal adult blood. Science. 1955 Aug
12;122(3163):288.
Lawrence Bragg and M. F. Perutz (July 22nd 1952). The Structure of Haemoglobin
Leikin SL, Gallagher D, Kinney TR, Sloane D, Klug P, Rida W. (September 1989) Mortality in
children and adolescents with sickle cell disease. Cooperative Study of Sickle Cell Disease.
Pediatrics.;84(3):500-8.
lewis, M ., basic agarose gel electrophoresis method. Retrieved 11th December 2009
41
![Page 42: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/42.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Manning LR, Russell JE, Padovan JC, Chait BT, Popowicz A, Manning RS, et al (Aug 2007).
Human embryonic, fetal, and adult hemoglobins have different subunit interface strengths.
Correlation with lifespan in the red cell. Protein Sci.;16(8):1641-58.
McClish DK, Penberthy LT, Bovbjerg VE, Roberts JD, et al (2005). Health related quality of life
in sickle cell patients: the PiSCES project. Health Qual Life Outcomes;3:50.
Modell B., Darlison M.(Jun 2008). Global epidemiology of haemoglobin disorders and
derived service indicators. Bull World Health Organ.;86(6):480-7.
Modern Ghana: Ghana: unknown; unknown; Sickle cell disease on the rise; 2007 February
27th 2009 November 30th; 1 screen; Available
from:http://www.modernghana.com/news/124664/1/sickle-cell-disease-on-the-rise.html
Nagel RL, Ranney HM. (October 1990). Genetic epidemiology of structural mutations of the
beta-globin gene. Semin Hematol;27(4):342-59.
Nagel RL, Ranney HM. (October 1990). Genetic epidemiology of structural mutations of the
beta-globin gene. Semin Hematol;27(4):342-59.
Ohene-Frempong K.,Weiner S.J., Sleeper L.A.,, Miller S.T., (N/A). Cerebrovascular Accidents
in Sickle Cell Disease: Rates and Risk Factors
Old JM HD. (1996). HemoglobinopathiesCommunity Clues to Mutation Detection; Method in
molecular medicine: molecular diagnosis of genetic disease. Totowa, NJ: Humana Press: In:
Elles R, ;. p. 169-83.
Oner C:, Dimovski A.J., Olivieri N.F., Schiliro G., Codrington J.F..:' et al, (1992). β s haplotypes
in various world populations; Human genetics 89:99-104
Pallister cJ. (2005).BMS EXPLAINED Haematology. London: Hodder Headline Group;.
Pattison JR, Jones SE, Hodgson J, Davis LR, White JM, Stroud CE, et al (Mar 1981). Parvovirus
infections and hypoplastic crisis in sickle-cell anaemia. Lancet. 21;1(8221):664-5.
42
![Page 43: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/43.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
Paul J., (September 1976). Haemoglobin synthesis and cell differentiation british medical
bulletin 32 (3).
Powars D, Hiti A. (November 1993) Sickle cell anemia. Beta s gene cluster haplotypes as
genetic markers for severe disease expression. Am J Dis Child;147(11):1197-202.
Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences,
Vol. 213, No. 1115 pp. 425-435
Serjeant G. R.,. Mason K .,. Topley J. M., et al (September 1981). Outbreak of aplastic crises
in sickle cell anaemia associated with parvovirus-like agent; The lancet volume 318 issue
8247, 19, Pages 595-597
Setubal S, Gabriel AH, Nascimento JP, Oliveira SA (Sep-Oct 2000). Aplastic crisis caused by
parvovirus B19 in an adult patient with sickle-cell disease. Rev Soc Bras Med Trop;33(5):477-
81.
Shapiro BS. (August 1989). The management of pain in sickle cell disease. Pediatr Clin North
Am;36(4):1029-45.
Sutton M, Bouhassira EE, Nagel RL. (September 1989). Polymerase chain reaction
amplification applied to the determination of beta-like globin gene cluster haplotypes. Am J
Hematol.;32(1):66-9.
unkown, (N/A). Real time pcr protocol manual; Promega. Retrieved 11th December 2009
Vichinsky E.P., Styles L.A., Colangelo L.H., (1997). Acute Chest Syndrome in Sickle Cell
Disease:Clinical Presentation and Course; Blood 89 (5): 1787.
Wambua S, Mwangi TW, Kortok M, Uyoga SM, et al (May 2006). The effect of alpha+-
thalassaemia on the incidence of malaria and other diseases in children living on the coast of
Kenya. PLoS Med.;3(5):e158.
43
![Page 44: Globin Gene Analysis in a Ghanaian Population](https://reader036.vdocument.in/reader036/viewer/2022062904/587f9ede1a28ab825e8b5989/html5/thumbnails/44.jpg)
HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010
weatherall DJ. (2001). The thalassaemias syndromes. oxford: blackwell science;.
Williams T N et al. An immune basis for malaria protection by the sickle cell trait; Published
online 2005 May 31. doi: 10.1371/journal.pmed.0020128. Cited [2009 December 05]
Wood JC. (2008 December). Cardiac iron across different transfusion-dependent diseases.
Blood Rev.;22 Suppl 2:S14-21.
Wood WG, Pembrey ME, Serjeant GR, (1980). Hb F synthesis in sickle cell anaemia: a
comparison of Saudi Arab cases with those of African origin. Br J Haematol.
Yale SH, Nagib N, Guthrie T. (March 2000). Approach to the vaso-occlusive crisis in adults
with sickle cell disease. Am Fam Physician 1;61(5):1349-56, 63-4.
Z. Rahimi AV-R, A. Merat, M. Haghshenass, M. Rezaei. Level of Hemoglobin F and Gg Gene
Expression in Sickle Cell Disease and Their Association with Haplotype and XmnI
Polymorphic Site in sickle cell disease
44