Gubila C Sims D Verissimo A Dominici P Ellis J GrigoriouP Johnson A McHugh M Neat F Satta A Scarcella G Serra-Pereira B Soldo A Genner M J amp Griffiths AM (2014) A tale oftwo seas contrasting patterns of population structure in the small-spotted catshark across Europe Royal Society Open Science 1(3)[140175] httpsdoiorg101098rsos140175

Publishers PDF also known as Version of recordLicense (if available)CC BYLink to published version (if available)101098rsos140175

Link to publication record in Explore Bristol ResearchPDF-document

This is the final published version of the article (version of record) It first appeared online via the Royal Societyat httprsosroyalsocietypublishingorgcontent13140175 Please refer to any applicable terms of use of thepublisher

University of Bristol - Explore Bristol ResearchGeneral rights

This document is made available in accordance with publisher policies Please cite only thepublished version using the reference above Full terms of use are availablehttpwwwbristolacukpureuser-guidesexplore-bristol-researchebr-terms

rsosroyalsocietypublishingorg

ResearchCite this article Gubili C et al 2014 A tale oftwo seas contrasting patterns of populationstructure in the small-spotted catshark acrossEurope R Soc open sci 1 140175httpdxdoiorg101098rsos140175

Received 13 July 2014Accepted 14 October 2014

Subject Areasecologygeneticsbehaviour

Keywordselasmobranch sex-biased dispersal fisheriesmanagement Scyliorhinidae lesser spotteddogfish

Author for correspondenceAndrewM Griffithse-mail andiff100googlemailcom

Electronic supplementary material is availableat httpdxdoiorg101098rsos140175 or viahttprsosroyalsocietypublishingorg

A tale of two seascontrasting patterns ofpopulation structure in thesmall-spotted catsharkacross EuropeChrysoula Gubili1 David W Sims2 Ana Veriacutessimo3

Paolo Domenici4 Jim Ellis5 Panagiotis Grigoriou6

Andrew F Johnson7 MatthewMcHugh8 Francis

Neat9 Andrea Satta4 Giuseppe Scarcella10 Baacuterbara

Serra-Pereira11 Alen Soldo12 Martin J Genner13 and

AndrewM Griffiths213

1School of Environment and Life Sciences University of Salford Salford GreaterManchester M5 4WU UK2Marine Biological Association of the United Kingdom The LaboratoryPlymouth PL1 2PB UK3CIBIO-UP Centro de Investigaccedilatildeo em Biodiversidade e Recursos GeneacuteticosCampus Agraacuterio de Vairatildeo Rua Padre Armando Quintas Vairatildeo 4485-661 Portugal4CNR-IAMC Localitagrave Sa Mardini Torregrande 09170 Italy5Centre for Environment Fisheries and Aquaclture Science (CEFAS) Pakefield RoadLowestoft Suffolk NR33 0HT UK6Cretaquarium Thalassocosmos Hellenic Centre for Marine Research (HCMR)PO Box 2214 Heraklion Crete 71003 Greece7Center for Marine Biodiversity and Conservation Scripps Institution of Oceanography0202 University of California 9500 Gilman Drive San Diego CA 92083-0202 USA8Marine and Estuarine Ecology Unit School of Biological Sciences University ofQueensland Brisbane Queensland 4072 Australia9Marine ScotlandmdashScience Marine Laboratory PO Box 101 Aberdeen AB11 9DB UK10ISMAR-CNRmdashIstituto di Scienze Marine Consiglio Nazionale delle RicercheLargo Fiera della Pesca 2 Ancona 60125 Italy11Departamento do Mar e Recursos Marinhos IPMA Instituto Portuguecircs do Mar e daAtmosfera Av Brasilia Lisboa 1449-006 Portugal12Department of Marine Studies University of Split Livanjska 5 Split 21000 Croatia13School of Biological Sciences University of Bristol Bristol Life Sciences Building 24Tyndall Avenue Bristol BS8 1TQ UK

2014 The Authors Published by the Royal Society under the terms of the Creative CommonsAttribution License httpcreativecommonsorglicensesby40 which permits unrestricteduse provided the original author and source are credited

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

2

rsosroyalsocietypublishingorgRSocopensci1140175

1 SummaryElasmobranchs represent important components of marine ecosystems but they can be vulnerable tooverexploitation This has driven investigations into the population genetic structure of large-bodiedpelagic sharks but relatively little is known of population structure in smaller demersal taxa whichare perhaps more representative of the biodiversity of the group This study explores spatial populationgenetic structure of the small-spotted catshark (Scyliorhinus canicula) across European seas The resultsshow significant genetic differences among most of the Mediterranean sample collections but nosignificant structure among Atlantic shelf areas The data suggest the Mediterranean populations arelikely to have persisted in a stable and structured environment during Pleistocene sea-level changesConversely the Northeast Atlantic populations would have experienced major changes in habitatavailability during glacial cycles driving patterns of population reduction and expansion The data alsoprovide evidence of male-biased dispersal and female philopatry over large spatial scales implyingcomplex sex-determined differences in the behaviour of elasmobranchs On the basis of this evidencewe suggest that patterns of connectivity are determined by trends of past habitat stability that providesopportunity for local adaptation in species exhibiting philopatric behaviour implying that resilience ofpopulations to fisheries and other stressors may differ across the range of species

2 IntroductionMolecular genetic markers have had a profound impact in conservation and management [1ndash3] Theyallow inferences to be made about the scale over which genetic connectivity occurs [4] the behaviouralmechanisms leading to gene flow [5] the estimation of effective population sizes [6] and how historicalprocesses have impacted on populations [7] This information has importance in terms of potential forlocal adaptation [89] but is also valuable for sustainable management and conservation of these naturalresources [10ndash13] In fisheries management genetic tools can help to identify discrete populations whichrepresent demographically independent stocks that require individual management to ensure fisheriessustainability [1014]

The effects of marine overexploitation have been clearly shown by severe declines in many sharkspecies [15] Understandably much of the work investigating genetic diversity and population structureof elasmobranchs has been focused on the large pelagic sharks that are considered particularly vulnerableto exploitation in high seas fisheries [1617] However these species represent a small fraction of thebiodiversity of the group The small-spotted catshark (Scyliorhinus canicula L 1758) is a relatively smalldemersal species belonging to one of the largest families of sharks the Scyliorhinidae It is generallyconsidered to be the most abundant catshark in European shelf seas [18] and occurs from Norway andthe British Isles south to Senegal including the Mediterranean Sea [19] It is an oviparous species thatbreeds most of the year and is relatively fecund for an elasmobranch It has remarkable variation inreproductive parameters but in British waters it has been shown to lay between 29 and 62 eggs fromNovember to July each year [1820] In the Atlantic it is often caught as by-catch in demersal fisheriesbut its commercial importance is growing particularly through its use as whelk bait [21] and it is alsosignificant for recreational fishing in some regions [22] In the Mediterranean catsharks have been fishedsince ancient times as documented by mosaics from the Roman age [23] and S canicula is still targetedfor consumption today [24] Recent studies have shown very dramatic localized reductions in abundance[25] For example in the Adriatic Sea it has been estimated that the species has declined in abundance byup to 90 since the 1940s [26]

Investigations of elasmobranch population structure focusing on wide-ranging pelagic sharks haveoften revealed genetic differentiation over broad inter- or intra-oceanic scale [2728] By contrast work oncoastal and demersal species suggests they can have more highly divided population structure whichhas implications for management and conservation [2930] Scyliorhinus canicula has a range of traitsassociated with a low dispersal potential including internal fertilization and deposition of demersaleggs In addition markndashrecapture studies suggest adults do not generally make long migrations [31]These factors could potentially lead to population genetic structure in this species a concept that hassome support from apparent differences among populations in growth rates habitatdepth preferenceand reproductive biology that could have arisen from local adaptation [2025] Indeed populationswithin the Mediterranean show such marked changes from those in the Atlantic that they havehistorically been suggested as a different subspecies [3233] Similarly a more recent study of sexualdimorphism in S canicula noted significant morphological differences in dentition between west African

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

3

rsosroyalsocietypublishingorgRSocopensci1140175

Mediterranean and west European populations indicating the west African group could represent adistinct taxon [34]

Documented sex-biased dispersal and philopatry have also been shown to have serious effectson elasmobranch population structure Female sharks generally make far greater investment inreproduction than males potentially leading to discrepancies between optimal male- and female-fitnessstrategies and generating sex-specific differences in behaviour [2735] Evidence from a growing numberof studies suggests female philopatry in sharks may be widespread [36] This is also significant as sex-biased differences in movement behaviour could potentially lead to sexual segregation in sharks and inturn affect the sustainability of marine harvesting [37]

Molecular data have the power to infer historic processes such as population expansions orcontractions locations of refugia and patterns of recolonization [38] Inferences of this type areparticularly enlightening within Northeast Atlantic marine ecosystems as organisms in this region havebeen significantly impacted by the Pleistocene glacial cycles [39] During the last glacial maximum about20 000 years ago ice sheets dominated the majority of the United Kingdom and Ireland while permanentsea ice may have extended as far south as the Bay of Biscay [4041] Therefore the distributions of marineorganisms might have been forced southwards into refugia including the Mediterranean north Africancoast and the Iberian Peninsula [42ndash44] Along the Atlantic coast there is also evidence for refugiafurther north and much closer to the ice sheets [434546] Subsequently as the ice retreated organismswere able to recolonize the more northerly regions that were previously glaciated Phylogeographicinvestigations of a variety of marine taxa have shown a division between the Mediterranean Sea andthe Atlantic although the degree and geographical scale of the biogeographic separation varies amongeven closely related species [47] Therefore it is plausible that these locations also acted as refugia for thesmall-spotted catshark

Here we test for population genetic structure among populations of S canicula collected acrossEuropean seas A particular focus is made of the AtlanticndashMediterranean transition as it is oftenconsidered to be an important phylogeographic break We also use these data to test for sex-biaseddifferences in dispersal and philopatry We discuss the results in the light of published work on thebehavioural ecology of the species and highlight the conservation and management implications

3 Material and methods31 Sample collection and DNA extractionTissue samples were collected between 2007 and 2011 (with the exception of the Western English Channelcollection site see below) primarily from research cruises throughout Europe and the Mediterranean(figure 1 electronic supplementary material S1) Temporally replicated samples were collected from thesame approximate region of the Western Channel (2003 n = 45 2008 n = 26 2010 n = 39) A minority ofsamples were also collected at landing or at fish markets most notably all those from Portugal Sardiniaand Crete Genomic DNA was isolated from S canicula using the Wizard technique (Promega MadisonWI USA)

32 Microsatellite genotypingTwelve microsatellite loci Scan02 Scan03 Scan04 Scan05 Scan06 Scan09 Scan10 Scan12 Scan13Scan14 Scan15 and Scan16 [48] were amplified with the QIAGEN multiplex polymerase chain reaction(PCR) kit (QIAGEN Valencia CA USA) The protocol followed Griffiths et al [21] with the followingmodifications Fluorescent NED primers were used to ensure compatibility with ABI sequencingplatforms and loci Scan01 and Scan17 were removed from the original multiplex owing to problemsassociated with null alleles and PCR artefacts (with Scan04 and Scan10 substituted instead) Allele sizeswere determined using an ABI3500 DNA sequencer and the STRAND nucleic acid analysis software [49]

33 Mitochondrial DNA sequencingAn approximately 900 base pair (bp) section of the mitochondrial DNA (mtDNA) control region wasamplified using the newly designed primers ScyD1pF (ATGACATGGCCCACATATCC) and Scan2R(TTCTCTTCTCAAGACCGGGTA) using PCR conditions described in Griffiths et al [50] PCR productswere cleaned and sequenced by Macrogen (Korea) using the forward primer ScyD1pF which yielded a

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

4

rsosroyalsocietypublishingorgRSocopensci1140175

45deg W 30deg W 15deg W W0deg E 15deg E 30deg E 45deg E 60deg E

25deg N

30deg N

35deg N

40deg N

45deg N

50deg N

55deg N

60deg N

65deg N

70deg N

Figure 1 Sample collection locations with numbers of individuals analysed (microsatellitemitochondrial markers) Inset colour scalereflects sea depth See table 1 for location codes

shorter region that was used for subsequent analyses Resulting sequences were checked using BIOEDIT

v 709 [51] and aligned with CLUSTALX2 [52]

34 Microsatellite data summary statistics and population differentiationPatterns of temporal variation at the Western Channel site were examined by calculating pairwise FSTvalues between the sampling periods in ARLEQUIN 311 [53] MICROCHECKER [54] was used to checkfor scoring issues and the presence of null alleles Microsatellite summary statistics were calculated inCERVUS 30 [55] except the inbreeding coefficient (FIS) probability of conformity to the expectationsof HardyndashWeinberg equilibrium (HWE) and linkage disequilibrium (LD) which were calculated inGENEPOP 407 [56] Allelic richness was also estimated in FSTAT 2932 [57]

Sample collections with inappropriately small sample sizes for estimating allelic frequencies frommicrosatellite loci (ie from Tenerife n = 1 and Norway n = 4 figure 1) were removed Estimationof pairwise FST values was conducted in ARLEQUIN using 10 000 randomizations and 95 CI wereestimated across loci in GDA 10 [58] with 10 000 bootstraps Sequential Bonferroni corrections wereused to minimize type I errors [59] Within GENALEX 65 [60] Neirsquos pairwise genetic distances werecalculated using the default settings and visualized by principal coordinate analysis (PCoA) Manteltests were used to test for significant correlations between genetic distances and geographical distancesalso in GENALEX

A hierarchical analysis of molecular variance (AMOVA) was performed in ARLEQUIN to test forsignificance between groups of sample collections Data were grouped according to geographicallocation with the following hierarchy Northeast Atlantic (Scotland North Sea Bristol Channel WesternChannel Ireland and Portugal) and the Mediterranean (Mallorca Sardinia the Adriatic and Crete)

35 Microsatellite data clustering analysisThe complete microsatellite dataset was analysed in the software STRUCTURE v 234 [61] A lsquohierarchicalrsquoapproach [62] with multiple rounds of analysis was employed in order to capture the major structure

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

5

rsosroyalsocietypublishingorgRSocopensci1140175

within the data Run-lengths included a 100 000 burn-in and 1 000 000 total length with five iterationsThe model incorporating sampling locations as prior information was employed and the numbers ofclusters K varied between 1 and 12 in each run The K method of Evanno et al [63] was applied tojudge the most likely values of K In the analysis of each cluster plots of the absolute values of ln Pr(X|K)and K were generated by STRUCTURE HARVESTER [64]

36 Mitochondrial DNA summary statistics and population differentiationSummary statistics were primarily calculated using ARLEQUIN Rarefied haplotype richnessstandardized to a sample size of 22 was calculated using CONTRIB 102 [2] Genetic differences amonglocalities were estimated in ARLEQUIN using both the genetic distance-based ΦST and the frequency-based mtFST with significance of differences estimated with 10 000 permutations A hierarchical AMOVAwas performed in ARLEQUIN using the same scenarios as implemented with the nuclear markersTamura and Neirsquos [65] genetic distances were calculated between all sample collections (excepting thelone AfricanCanaries sample) using MEGA v 51 [66] and visualized using PCoA in GENALEX Manteltests were used to look for significant correlations between genetic distances and geographical distancesalso in GENALEX

37 Mitochondrial DNA haplotype network and demographic analysisA median joining network was used to investigate genealogical relationships between mtDNAhaplotypes with NETWORK 4611 [67] Tajimarsquos D [68] and Fursquos Fs [69] tests were calculated inARLEQUIN [53] with significant negative values indicative of recent population expansion Thedemographic history was also evaluated by mismatch distribution analysis Typically a populationof constant size is characterized by a multimodal distribution alternatively one that has experiencedexpansion usually shows a unimodal distribution [70] Bayesian skyline plots (BSPs) were generatedin the software package BEAST v 17 [71] and plotted using the upper 95 highest posteriordensity Generally the programme defaults were used except the HKY + Γ + I mutation modelwas selected and the Markov chain Monte Carlo (MCMC) was set between 50 and 200 millioniterations depending on length required for convergence A fixed clock was set using a divergencerate of 0361 estimated from homologous control sequences from S canicula and Scyliorhinusstellaris (AM Griffiths 2010 unpublished data) and the divergence date (22 Ma) from Sorensonet al [72] This is the closest calibration point available but it has resulted in a comparativelyslow estimate rate of divergence albeit one broadly similar to those calculated for mtDNA inother sharks (08 [73] 067 [74]) It is important to highlight the uncertainty in estimation ofthe clock rates which could have very significant effects on the phylogeographic reconstructionsin the BSP

38 Sex-biased dispersalInitially to assess differences between male and female dispersal a test comparing pairwise geneticdistances between populations for microsatellite and mitochondrial data was employed Specificallywith male-biased dispersal lower genetic distances were expected to be present in biparentally inherited(microsatellite) markers than in maternally inherited (mitochondrial) markers Following Daly-Engelet al [35] paired t-tests in R 2151 were used to compare mtFST calculated using mtDNA haplotypefrequencies and FST calculated using microsatellite allele frequencies

Tests for sex-biased dispersal based on the microsatellite data alone were conducted in FSTATSamples from Sardinia were removed from analyses as no information on sex was available Fivemethods based on differences on the inbreeding coefficient (FIS) fixation index (FST) degree ofrelatedness mean assignment indices (mAIc) and variance of the assignment indices (vAIc) betweenthe philopatric and dispersing groups were used [75] In principle unequal levels of gene flow betweenmales and females would lead to a Wahlund effect and a heterozygote deficit resulting in a higher FISin the most dispersing sex while also leading to correspondingly lower FST and relatedness valuesThe assignment index statistic indicates the probability of a genotype occurring in a populationand unequal levels of gene flow between males and females could lead to negative values of themAIc in the most dispersing sex (as the distribution is centred on zero) while also increasing thecorresponding vAIc

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

6

rsosroyalsocietypublishingorgRSocopensci1140175

Table 1 Summary statistics across all microsatellite loci n sample sizeNa number of allelesHO observed heterozygosityHE expectedheterozygosity RS allelic richness HWE probability of conformance to HardyndashWeinberg equilibrium The single sample from AfricatheCanaries is excluded from this table owing to the small sample size Allelic richness values were calculated after excluding the Norwaysample owing to the small sample size so rarefaction standardized to the level of North Sea collection (n= 25)

sample collection code n Na HO HE RS HWE

Norway NOR 4 333 06042 06161 mdash 09994

Scotland SCO 50 708 06025 06100 602 05828

North Sea NSE 25 558 06585 06250 555 09803

south Ireland IRE 50 692 06165 06306 600 00581

Bristol Channel BRI 46 617 06407 06311 557 03087

Western Channel WES 110 767 06380 06339 588 01851

Portugal POR 29 642 06353 06605 620 00756

Mallorca MAL 52 617 05706 05620 532 08064

Sardinia SAR 59 633 05793 05917 545 07946

Adriatic ADR 47 608 06373 06282 539 00681

Crete CRE 35 592 05823 05727 545 06016

4 Results41 Microsatellite data summary statistics and population differentiationNo significant differences were detected between temporal samples from the Western Channel (pairwiseFST ranged from less than 0000 to 0006 and none were significant at the 99 CI) and all individualswere grouped together into a single sample collection The mean observed heterozygosity across allpopulations was 0632 varying between 0571 (Mallorca) and 0659 (North Sea) The mean expectedheterozygosity across populations was 0615 varying between 0562 (Mallorca) and 0661 (Portugaltable 1 electronic supplementary material S2) There was no evidence of deviation from HWE aftersequential Bonferroni correction (electronic supplementary material S2) Furthermore there was noconsistent evidence of scoring issues or null alleles There were 37 (of 858 43) significant tests ofLD across sample sites at the 95 CI none of which remained significant after sequential Bonferronicorrection Mean allelic richness across loci varied between 5320 (Mallorca) and 6200 (Portugal table 1)Across all 12 loci significant genetic differentiation was observed (global FST = 0039 p lt 0001) PairwiseFST values ranged from minus0005 to 0070 and were significant for all combinations that included theMediterranean sampling sites while genetic differentiation was absent among all Northeast Atlanticpopulations after Bonferroni correction (table 2)

The PCoA plot of pairwise genetic distance between sample collections clearly separated the Atlanticand the Mediterranean but showed a greater level of division among the Mediterranean than theAtlantic sampling sites (figure 2a) There was a significant association between genetic and geographicaldistance across all samples (R2 = 0357 p = 0002 figure 3a) This was also observed within the Atlantic(R2 = 0333 p = 0047) but not within the Mediterranean (R2 = 0087 p = 0383) Hierarchical AMOVA(table 3) showed significant variation between the Atlantic and the Mediterranean groups (209)and significant variation among populations within these regions (178) although within populationgenetic variation was greatest (9613)

42 Microsatellite data clustering analysisAnalysis of the complete microsatellite dataset in STRUCTURE initially divided the individuals into twoclusters (electronic supplementary material S3) The first cluster included the samples from the Atlanticwith all individuals demonstrating admixture coefficients showing more than 80 membership to thiscluster reflecting clear common ancestry Similarly individuals from Sardinia Crete and the Adriaticalso demonstrated admixture coefficients showing more than 80 membership to a second clustersuggesting clear division between these two clusters The Mallorca samples demonstrated some degree

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

7

rsosroyalsocietypublishingorgRSocopensci1140175

Table2M

icrosatellitepairw

isediff

erentiationamong10samplinglocalitiesBelow

diagonalpairwiseF ST

values(with95CIinbrackets)Abovediagonalp-valuesValuesinboldweresignifi

cantatthe95

CIandthosemarked

withasterisks()remainedsignifi

cantaftersequentialBonferronicorrections

locality

Scotland

North

Sea

southIreland

BristolChannel

WesternChannel

Portugal

Mallorca

Sardinia

Adriatic

Crete

Scotland

mdash0024

0619

0459

0267

0001

lt0001

lt0001

lt0001

lt0001

North

Sea

0008(0031

tominus0

004)

mdash0462

0200

0348

0632

lt0001

lt0001

lt0001

lt0001

southIreland

0000

(0004tominus

0005)

0000

(0009tominus

0007)

mdash0991

1000

0095

lt0001

lt0001

lt0001

lt0001

BristolChannel

0000

(0010tominus

0006)

0002

(0011to

minus0004)

minus0005

(minus0001to

minus0007)

mdash0995

0267

lt0001

lt0001

lt0001

lt0001

WesternChannel

0001

(0010

to

minus0003)

0000

(0009to

minus0005)

minus0003

(minus0002to

minus0004)

minus0002

(minus0001to

minus0003)

mdash0447

lt0001

lt0001

lt0001

lt0001

Portugal

0014

(0039ndash0000)

minus0002(0008to

minus0009)

0005

(0013

to

minus0002)

0002

(0010

to

minus0003)

0000

(0007to

minus0003)

mdashlt0001

lt0001

lt0001

lt0001

Mallorca

0043lowast

lowastlowast

(0065ndash0021)

0028lowast

lowastlowast

(0050ndash0008)

0038lowast

lowastlowast

(0058ndash0020)

0038lowast

lowastlowast

(0056ndash0020)

0039lowast

lowastlowast

(0058ndash0021)

0046lowast

lowastlowast

(0080ndash0018)

mdashlt0001

lt0001

lt0001

Sardinia

0039lowast

lowastlowast

(0055ndash0026)

0038lowast

lowastlowast

(0065ndash0018)

0046lowast

lowastlowast

(0072ndash0027)

0044lowast

lowastlowast

(0066ndash0027)

0050lowast

lowastlowast

(0059ndash0027)

0041lowast

lowastlowast

(0075ndash0031)

0050lowast

lowastlowast

(0076ndash0026)

mdashlt0001

lt0001

Adriatic

0043lowast

lowastlowast

(0063ndash0027)

0041lowast

lowastlowast

(0050ndash0013)

0209lowast

lowastlowast

(0064ndash0022)

0039lowast

lowastlowast

(0062ndash0021)

0038lowast

lowastlowast

(0058ndash0023)

0038lowast

lowastlowast

(0061ndash0020)

0064lowast

lowastlowast

(0085ndash0047)

0025lowast

lowastlowast

(0040ndash0012)

mdashlt0001

Crete

0055lowast

lowastlowast

(0086ndash0028)

0055lowast

lowastlowast

(0079ndash0032)

0057lowast

lowastlowast

(0086ndash0028)

0050lowast

lowastlowast

(0075ndash0025)

0056lowast

lowastlowast

(0080ndash0028)

0059lowast

lowastlowast

(0102ndash0019)

0070lowast

lowastlowast

(0106ndash0037)

0056lowast

lowastlowast

(0079ndash0032)

0039lowast

lowastlowast

(0064ndash0015)

mdash

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

8

rsosroyalsocietypublishingorgRSocopensci1140175

CRE

CRECYP

ADR

MALNOR

IRENSE

WESPOR

BRISCO

SAR

ADR

SAR

MAL

NSE

SCO

BRI

coord 1

WES

POR

IRE

(a)

(b)

coor

d 2

coor

d 2

Figure 2 Principal coordinates analysis of (a) Neirsquos pairwise genetic distances between sample collections based onmicrosatellite datawhere axis 1 explains 3966 and axis 2 explains 1878 of the variation in the data and (b) Tamura amp Neirsquos pairwise genetic distancesbetween sample collections based on mtDNA data where axis 1 explains 2822 and axis 2 explains 1384 of the variation in the dataSee table 1 for location codes

of admixture between these groups exhibiting coefficients with an average 73 membership to thefirst Atlantic-dominated cluster and 27 membership to the second Mediterranean-dominated clusterSubsequent hierarchical analysis of subsets of the data identified additional clusters corresponding tosampling locations within the Mediterranean namely Crete the Adriatic Sardinia and a Mallorcancluster that also incorporated the single individual from Tenerife No evidence of genetic subdivisionwas found across the Atlantic samples

43 Mitochondrial DNA data analysis summary statistics and population differentiationThe alignment of 276 partial control region sequences comprised 412 bp 26 haplotypes and 17 variablesites (accession numbers KM873790ndashKM874065) Haplotype diversity ranged from 0589 (Crete) to 0815(Western Channel) while rarefied haplotype richness ranged from 3749 (Crete) to 8322 (Portugal)Values of nucleotide diversity were low ranging from 0002 (Cyprus Bristol Scotland Norway) to

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

9

rsosroyalsocietypublishingorgRSocopensci1140175

Table 3 Hierarchical AMOVA of microsatellite (top) and mitochondrial data (bottom)

source of total per centdata variation variation of total FCT FSC FSTmicrosatellite among seas 007716 209 002091

(p= 000475)

among samples within

seas

006568 178 001818

(plt 00000)

within sample collections 354666 9613 003872

(plt 00000)

total 368950

mitochondrial DNA among seas 011329 1256 012564

(p= 001772)

among sample collections

within seas

016439 1823 020851

(plt 00000)

within sample collections 062401 6920 030796

(plt 00000)

total 090170

Table 4 Mitochondrial DNA summary statistics n number of individuals Hn number of haplotypes Hr allelic richness h haplotypediversity π nucleotide diversity sd standard deviation is in brackets D Tajimarsquos D value F Fursquos Fs value lowastplt 005 lowastlowastplt 0001lowastlowastlowastplt 0001

sample collection code n Hn Hr h (plusmnsd) π (plusmnsd) D F

Norway NOR 4 2 mdash 0667(plusmn0204) 0002(plusmn0002) 1633 054

Scotland SCO 23 5 4913 0676(plusmn0062) 0002(plusmn0002) minus0897 minus1096

North Sea NSE 25 6 574 0703(plusmn0071) 0003(plusmn0002) minus092 minus1619

south Ireland IRE 18 6 mdash 0680(plusmn0109) 0003(plusmn0002) minus0336 minus2350lowast

Bristol Channel BRI 27 5 4626 0678(plusmn0054) 0002(plusmn0002) minus076 minus0893

Western Channel WES 24 7 675 0815(plusmn0045) 0004(plusmn0003) minus031 minus137

Portugal POR 30 10 8322 0805(plusmn0050) 0004(plusmn0003) minus1157 minus4237lowastlowast

Mallorca MAL 40 8 597 0659(plusmn0070) 0003(plusmn0002) minus0528 minus2234

Sardinia SAR 22 5 5 0732(plusmn0068) 0004(plusmn0003) 1247 02

Adriatic ADR 27 5 463 0715(plusmn0047) 0003(plusmn0002) minus0563 minus0653

Crete CRE 29 4 3749 0589(plusmn0075) 0003(plusmn0002) 078 0596

Cyprus CYP 6 3 mdash 0600(plusmn0215) 0002(plusmn0002) minus1233 minus0189

all 276 26 mdash 0817(plusmn0015) 0004(plusmn0003) minus1032 minus16573lowastlowastlowast

0004 (Portugal Western Channel Sardinia table 4) Overall significant genetic differentiation wasobserved (global ΦST = 0308 p lt 0001) Pairwise ΦST values ranged from minus0146 to 0600 and weresimilar to the mtFST values (table 5) Most pairwise comparisons involving a Mediterranean populationshowed significant differentiation and non-significant results involving Norway and Cyprus shouldbe considered in the light of low sample size No significant genetic structure was found amongAtlantic collections

The PCoA plot of pairwise genetic distance showed the close clustering of the Atlantic samplecollections whereas the Mediterranean groups appear to be relatively distinct The Mallorca collection

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

10

rsosroyalsocietypublishingorgRSocopensci1140175

Table5Mitochondrialpairw

isediff

erentiationamong12samplinglocalitiesBelow

diagonalpairwise

ΦSTvaluesAbovediagonalpairw

isemtF S

TvaluesValuesinboldweresignifi

cantatthe95

CIandthosemarkedw

ithasterisks()remainedsignifi

cantaftersequentialBonferronicorrections

locality

Norway

Scotland

North

Sea

southIreland

BristolChannel

WesternChannel

Portugal

Mallorca

Sardinia

Adriatic

Crete

Cyprus

Norway

mdashminus0

145

minus0110

minus0056

minus0136

0017

minus0094

minus0059

0110

0143

0390

0314

Scotland

minus0146

mdashminus0

014

0029

minus0035

0047

minus0014

0021

0152

0186lowast

lowastlowast0370lowast

lowastlowast0306

North

Sea

minus0117

0007

mdashminus0

027

minus0013

0028

minus0001

0089

0155

0137lowast

lowastlowast0356lowast

lowastlowast0276

southIreland

minus0090

0028

minus0039

mdash0021

0029

0034

0160

0180lowast

lowastlowast0121

0371lowast

lowastlowast0284

BristolChannel

minus0143

minus0028

0007

0022

mdash0044

minus0004

0035

0153

0166lowast

lowastlowast0367lowast

lowastlowast0302

WesternChannel

minus0054

0019

0034

0033

0030

mdash0030

0134

0149lowast

lowastlowast0143lowast

lowastlowast0302lowast

lowastlowast0228

Portugal

minus0130

minus0022

0000

0012

minus0006

0017

mdash0031

0116

0145lowast

lowastlowast0303lowast

lowastlowast0232

Mallorca

minus0110

0003

0036

0054

0014

0067

0011

mdash0123

0242lowast

lowastlowast0374lowast

lowastlowast0338lowast

lowastlowast

Sardinia

0180

0297lowast

lowastlowast0246lowast

lowastlowast0240lowast

lowastlowast0280lowast

lowastlowast0275lowast

lowastlowast0249lowast

lowastlowast0187

mdash0200lowast

lowastlowast0344lowast

lowastlowast0295lowast

lowastlowast

Adriatic

0239

0326lowast

lowastlowast02226

lowastlowastlowast

0209lowast

lowastlowast0301lowast

lowastlowast0304lowast

lowastlowast0254lowast

lowastlowast0252lowast

lowastlowast0150

mdash0270lowast

lowastlowast0177

Crete

0581lowast

lowastlowast0597lowast

lowastlowast0566lowast

lowastlowast0568lowast

lowastlowast0600lowast

lowastlowast0555lowast

lowastlowast0516lowast

lowastlowast0549lowast

lowastlowast0511lowast

lowastlowast0412lowast

lowastlowastmdash

minus0054

Cyprus

0486

0491lowast

lowastlowast0424lowast

lowastlowast0428lowast

lowastlowast0495lowast

lowastlowast0400lowast

lowastlowast0352lowast

lowastlowast0425lowast

lowastlowast0392lowast

lowastlowast0283

0009

mdash

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

11

rsosroyalsocietypublishingorgRSocopensci1140175

0

0 1000 2000 3000 4000 5000 6000 7000

0

0001

0002

0003

0004

0005

0006

0007

0008

0

0005

0010

0015

0020

FST

(1ndashF

ST)

0025

0030

0035

0040

0045(a)

(b)

2000 4000distance (km)

Tam

urandash

Nei

dis

tanc

e

6000 8000

y = 2Endash07x + 00032R2 = 0129

y = 4Endash06x + 00112R2 = 03574

10 000

Figure 3 Associations between genetic and geographical distance based on (a) microsatellite data and (b) mitochondrial DNA data

remained an exception as it clustered more closely with the Atlantic (figure 2b) There was a significantassociation between genetic and geographical distance across all sample collections (R2 = 0129 p =0016 figure 3b) but not within the Atlantic (R2 = 0039 p = 0348) or within the Mediterranean (R2 =0149 p = 0167) Hierarchical AMOVA (table 3) showed significant variation between the Atlantic andthe Mediterranean groups (1256) and significant variation among populations within these regions(1823) although within population genetic variation was greatest (6920)

44 Mitochondrial DNA data analysis haplotype network and demographic analysisThe haplotype network demonstrated that two common haplotypes predominate in the Atlantic butare also present in the Mediterranean (figure 4) There was little evidence of population structure in theNortheast Atlantic as haplotypes did not appear to assort by sample location However a number ofclosely related haplotypes were unique to the eastern Mediterranean supporting the distinctiveness ofthe sample collections from this region particularly those from the eastern basin (Crete and Cyprus)

Demographic analyses showed that the Atlantic sample collections had unimodal distributions withnegative Tajimarsquos D and Fursquos F values although only F values related to southern Ireland and Portugalwere significant providing evidence of a population expansion (table 2 electronic supplementary

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

12

rsosroyalsocietypublishingorgRSocopensci1140175

Crete

Cyprus

Sardinia

Adriatic

Mallorca

Portugal

Tenerife

Bristol Channel

Western Channel

S Ireland

Scotland

Norway

mutationalstep

North Sea

Figure 4 Haplotype network of mitochondrial control region sequences The sizes of the circles in the network are proportional to thefrequency of the haplotype in the dataset and are coloured according to the sample collections Ambiguous links were broken accordingto phylogenetic relationships estimated from the consensus maximum-likelihood tree

material S4) Sample collections from Sardinia and Crete had positive D and F values and bimodaldistributions indicating demographic stability The remaining sample collections generally yielded non-significant results The BSP analysis (electronic supplementary material S5) indicates slowly decliningpopulation sizes within the Mediterranean with evidence of population growth in the past 100 000ndash500 000 years (with the exception of the Sardinian sample that shows a recent decline in effectivepopulation size) This contrasts with the Northeast Atlantic in which the samples generally demonstratea more sustained period of much greater population increase dating back over 500 000ndash1 250 000 years

45 Sex-biased dispersalThe mtFST was significantly greater than FST across the sampling area (paired t-test t = 6487 p lt 0001tables 2 and 5) consistent with male dispersal and female philopatry In direct comparisons of male andfemale microsatellite data males showed a higher FIS lower FST lower relatedness values lower mAIcand higher vAIC all consistent with male-biased dispersal However only FST and mAIc showed asignificant difference between the sexes (table 6)

5 DiscussionThis study represents the most detailed analysis of genetic variation from a species in the largest family ofsharks the Scyliorhinidae incorporating samples from a wide trans-European and Mediterranean areaThe results showed high gene flow in the Northeast Atlantic Ocean a region of connectivity between theAtlantic and the Mediterranean populations in the western part of the Mediterranean Sea and genetic

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

13

rsosroyalsocietypublishingorgRSocopensci1140175

Table 6 Results of the five tests of sex bias dispersal using microsatellite markers

sex n FIS FST relatedness mAIc vAIc

male 186 00203 00202 00388 minus091583 1169206

female 253 minus00156 00321 00631 067330 1066518

p-value 00232 01610 01019 00001 00764

differences among populations across the Mediterranean basin Indications of male-biased dispersaland female philopatry were also identified supporting growing evidence of sex-based differences indispersal and behaviour in elasmobranchs [7677]

A lack of temporal variation in the Western English Channel over an 8-year sampling periodsupported the stability in population structure in this region over time which remains a key factor ininterpreting genetic data By contrast the null hypothesis of panmixia in S canicula was rejected byanalyses for both mtDNA control region sequence and nuclear microsatellite markers when consideringall the sample collections across the Northeast Atlantic and the Mediterranean This indicates thattraits associated with limited dispersal potential may have played an important role in limiting geneflow a finding that is becoming increasingly common in coastal and demersal sharks [1330] Asignificant pattern of isolation by distance (IBD) was also identified by both sets of markers primarilyrelated to significant genetic differences between the Atlantic and the Mediterranean especially easternMediterranean populations Such regional variation could also be linked to ontogenetic differences of Scanicula with length and age at sexual maturity attained earlier in the Mediterranean than in the Atlantic[202533] so that genetic and morphological differences appear to coincide

The mtDNA data identified two main groups of haplotypes the first included the highest frequencyhaplotypes central to the network that were predominantly associated with samples from the NortheastAtlantic and the Balearic Islands The second includes haplotypes unique to specimens found in centraland eastern parts of the Mediterranean (figure 4) Furthermore pairwise ΦST revealed highly significantdifferences between biogeographically distinct regions of the Mediterranean the western Mediterraneaneastern Mediterranean and Adriatic Sea Such a trend runs counter to previous studies on elasmobranchsin these waters where a lack of divergence has been found [447879] However similar patterns ofpopulation subdivision have been described by the only other investigation of S canicula [23] wherevariation within the cytochrome oxidase I gene was analysed from predominantly Mediterraneanindividuals That study did not find evidence of population structure at such a fine geographicalscale perhaps due to the relatively conservative nature of the protein coding gene region used [80]Additionally Barbieri et al [23] grouped distant areas of the Mediterranean owing to sample sizerestrictions potentially reducing the resolution of their analysis Application of microsatellite loci inthe current study also supported evidence of genetic sub-division between S canicula in the easternand western Mediterranean Indeed the results suggest differentiation at an even smaller scale betweensample collections separated by less than 500 km in the western Mediterranean (Balearic Islands andSardinia)

The pattern of highly divided population structure across the Mediterranean contrasts very sharplywith results from the Northeast Atlantic Regardless of the markers used or the analytical approachthere was no evidence of significant genetic differences between sample collections originating fromthis region Individuals from Norway and Africa demonstrated microsatellite alleles and haplotypesthat were generally common across the Atlantic suggesting little evidence of population structure evenat the most extreme latitudinal ranges considered This lack of genetic differences across the Atlanticwaters does not conform to expectations from typical life-history characteristics of small demersalelasmobranchs that suggest low dispersal potential [81] Nevertheless similar patterns of little geneticevidence of population structure have also been reported for the starry ray (Amblyraja radiata) in thenorth Atlantic over comparable scales [8182] Perhaps both of these species correspond to a more typicalpattern of marine species population structure with large effective population sizes and high gene flowwithin the Atlantic that minimize the effects of genetic drift and lead to low levels of population structurethat are difficult to detect [8384]

While nuclear and mtDNA data generally exhibited highly concordant results differing signalsof population structure were identified around Mallorca with mtDNA suggesting a close similaritywith the Atlantic group (figure 2b) and microsatellite markers indicating a more intermediate positionbetween the Atlantic and the Mediterranean groups (figure 2a) This result is consistent with the

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

14

rsosroyalsocietypublishingorgRSocopensci1140175

Balearic Islands representing an important region of secondary contact There is strong evidence thatmany marine species have invaded the western Mediterranean through the Strait of Gibraltar since thelast glacial maximum bringing previously allopatric lineages into contact [4785ndash87] The differencesin the modes of inheritance between the two marker types may also explain the differing patternsof population structure identified with the smaller effective population size of mtDNA potentiallyleading to more rapid genetic drift and the fixation of Atlantic haplotypes within the populations ofthe western Mediterranean

51 PhylogeographyThere have been long-standing hypotheses suggesting that the Strait of Gibraltar (the so-calledlsquoPillars of Herculesrsquo) or the AlmeriandashOran Front represents phylogeographic barriers that shape thebiogeographical patterns of marine AtlanticndashMediterranean organisms (reviewed in [47]) A numberof molecular studies corroborate these scenarios with genetic discontinuity between the Atlantic andthe Mediterranean populations occurring at the Strait of Gibraltar [88ndash92] However since the openingof the Strait of Gibraltar occurred at the end of the Messinian salinity crisis its status as a currentbarrier to gene flow has been questioned This study does not support a genetic discontinuity acrossthe Strait as an important zone of secondary contact between these populations is actually present inthe Balearic Sea (followed by increasing genetic distinctiveness in the more isolated and semi-enclosedregions of the eastern Mediterranean perhaps corresponding to relictual populations) Similar zonesof secondary contact between the Mediterranean and the Northeast Atlantic stocks are also observedin other fish such as the Atlantic bonito and the swordfish [9394] suggesting this may be a commonphylogeographic scenario

The Mediterranean and the Northeast Atlantic share a history of inter-connectedness and have alarge number of species in common However some evidence of contrasting demographic signatureswas detected between the Atlantic and the Mediterranean populations of S canicula The Atlanticpopulations typically showed patterns of population expansion while the Mediterranean appearedmuch more stable This could be explained by the long-term stability and the consistent existence ofsuitable habitat in the Mediterranean during the Pleistocene glacial and interglacial cycles as has beenobserved for other species [9596] Many of the Mediterranean basins are relatively deep potentiallyproviding suitable habitat for S canicula during climatically driven sea-level fluctuations allowing itspersistence [97] Recolonization of North Atlantic shelf habitats may have been rapid over the currentinterglacial cycle meaning that it would not have promoted genetic discontinuity among regionsInterestingly no evidence of northern refugia was supported by our data in contrast to other marinetaxa [43ndash459899] This lack of spatial association is also shown in the haplotype distribution wherethe two main haplotypes are shared by individuals caught along the Atlantic coast (figure 4) Togetherthese data are suggestive of a relatively sudden population expansion The apparent absence of anorthward decrease in genetic diversity (table 1) is however not generally supportive of the lsquoleadingedge hypothesisrsquo [100] where latitudinal genetic variation is reduced in recently colonized populationsowing to stochastic processes

52 Sex-biased dispersalDespite obvious congruence in patterns of population structure identified between the mtDNA andmicrosatellite data (tables 2 and 5) global testing across all populations demonstrated significantdifferences that were consistent with male-biased dispersal and female philopatry in S canicula Thissupports growing evidence of sex-based differences in dispersal and behaviour in elasmobranchs morewidely [7677] However there are limitations with the tests employed in this study In the comparisonof mtDNA and nuclear DNA markers the reduced effective population size of mtDNA leads toexpectations of greater FST values regardless of differences in sex-biased dispersal Therefore the recentapproach of Daly-Engel et al [35] was used they suggested this comparison is robust with the useof numerous polymorphic nuclear markers that provide strong statistic power to detect populationstructure [101] If population sizes are stable it will also decrease the chance that differences in mtDNAand nuclear DNA are driven purely by variation in marker effective population size [35]

In order to overcome the limitations with comparisons of mtDNA and nuclear DNA an additionalsuite of tests for sex-biased dispersal that focus on the microsatellite markers alone was conducted Thesetests have a number of assumptions including non-overlapping generations equal sample size juvenile

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

15

rsosroyalsocietypublishingorgRSocopensci1140175

dispersal and equal sex ratios [75] that are not necessarily satisfied in this case However the methodsdo provide a valuable way of interrogating the data and have been used in similar studies [102ndash104]

The apparent male-biased dispersal supports a long history of work demonstrating strong sex-baseddifferences in the behaviour of the small-spotted catshark It was the first elasmobranch species forwhich systematic analyses of unequal sex ratios in trawl catches provided clear evidence for unisexualaggregations [105106] with recent work suggesting that this is the result of sexual harassment by males[107108] Finally our results also support the commonly made association between the reproductivestrategies of sharks and marine mammals that much greater investment in reproduction by females thanmales is at the evolutionary root of these differences in behaviour [2735]

53 Conservation implicationsThe assessment and management of shark stocks is not well established in part because manycharacteristics such as dispersal or migratory behaviour are not fully understood [37] Additional factorssuch as female philopatry sexual segregation and sex-biased dispersal should be better consideredin any management regimes as spatially focused fisheries could result in the differential exploitationof sexes The results of this study clearly show the potential for S canicula to form multiple stockswithin its distributional range This has important implications for sustainable management as effectiveconservation measures may need to be implemented at the level of the demographic unit to ensure long-term stock viability in the face of exploitation [109] This is especially relevant in the case of the northernAdriatic Sea stock which appears to have undergone dramatic declines in abundance [26] but for whichrecovery may not be as simple as immigration from proximate regions

Ethics statement All sampling procedures were approved by the Marine Biological Association Ethical ReviewCommittee and were licenced by the UK Home Office under the Animals (Scientific Procedures) Act 1986Data accessibility DNA sequences generated in this study have Genbank accessions KM873790ndashKM874065Acknowledgements We are grateful to all those who helped with sample collection including the MEDITS surveyprogramme the Department of Fisheries and Marine Research (DFMR) of Cyprus and the Irish discard samplingprogramme Sampling was also supported by Steve Cotrell Samuel Igleacutesias Arve Lynghammar Toby Rapp andCatarina Maia For genotyping we thank Jane Coghill of the University of Bristol Genomics Facility We also thankPeter Dohmen and Niels Breve for comments AMG conceived the study coordinated the sample collection carriedout the molecular work conducted the data analysis and drafted the manuscript CG conducted the data analysis anddrafted the manuscript MJG helped conceive the study and draft the manuscript AV conducted the data analysisand helped draft the manuscript DWS helped conceive the study PD JE PG AFJ MM FN AS GS BSPand AS provided samples and helped revise the manuscript All authors gave final approval for publicationFunding statement This work was funded by the UK Natural Environment Research Council (NERC) Oceans 2025Strategic Research Programme Theme 6 (Science for Sustainable Marine Resources) AV was funded by Fundaccedilatildeopara a Ciecircncia e Tecnologia (SFRHBPD774872011)

References1 Moritz C 1994 Defining lsquoevolutionarily significant

unitsrsquo for conservation Trends Ecol Evol 9373ndash375 (doi1010160169-5347(94)90057-4)

2 Petit RJ Mousadik AE Pons O 1998 Identifyingpopulations for conservation on the basis ofgenetic markers Conserv Biol 12 844ndash855(doi101046j1523-1739199896489x)

3 Hedrick PW 2001 Conservation genetics where arewe now Trends Ecol Evol 16 629ndash636(doi101016S0169-5347(01)02282-0)

4 Monsen KJ Blouin MS 2003 Genetic structure in amontane ranid frog restricted gene flow andnuclearndashmitochondrial discordanceMol Ecol 123275ndash3286 (doi101046j1365-294X200302001x)

5 Palstra FP OrsquoConnell MF Ruzzante DE 2007Population structure and gene flow reversals inAtlantic salmon (Salmo salar) over contemporaryand long-term temporal scales effects ofpopulation size and life historyMol Ecol 164504ndash4522 (doi101111j1365-294X200703541x)

6 Nunney L Elam DR 1994 Estimating the effectivepopulation size of conserved populations ConservBiol 8 175ndash184 (doi101046j1523-1739199408010175x)

7 Smith BT Escalante P Bantildeos BEHNavarro-Siguumlenza AG Rohwer S Klicka J 2011 Therole of historical and contemporary processes onphylogeographic structure and genetic diversity inthe Northern Cardinal Cardinalis cardinalis BMCEvol Biol 11 136 (doi1011861471-2148-11-136)

8 Hansen MM Ruzzante DE Nielsen EE BekkevoldD Mensberg KLD 2002 Long-term effectivepopulation sizes temporal stability of geneticcomposition and potential for local adaptation inanadromous brown trout (Salmo trutta)populationsMol Ecol 11 2523ndash2535(doi101046j1365-294X200201634x)

9 Hemmer-Hansen J Nielsen EE Frydenberg JLoeschcke V 2007 Adaptive divergence in a highgene flow environment Hsc70 variation in the

European flounder (Platichthys flesus L) Heredity99 592ndash600 (doi101038sjhdy6801055)

10 Carvalho GR Hauser L 1995Molecular genetics andthe stock concept in fisheries pp 55ndash79 DordrechtThe Netherlands Springer

11 Swart MKJ Ferguson JWH 1997 Conservationimplications of genetic differentiation in southernAfrican populations of black rhinoceros (Dicerosbicornis) Conserv Biol 11 79ndash83(doi101046j1523-1739199795180x)

12 Fernando P Polet G Foead N Ng LS Pastorini JMelnick DJ 2006 Genetic diversity phylogeny andconservation of the Javan rhinoceros (Rhinocerossondaicus) Conserv Genet 7 439ndash448(doi101007s10592-006-9139-4)

13 Stow A Zenger K Briscoe D Gillings MPeddemors V Otway N Harcourt R 2006Isolation and genetic diversity of endangeredgrey nurse shark (Carcharias taurus) populationsBiol Lett 2 308ndash311 (doi101098rsbl20060441)

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

16

rsosroyalsocietypublishingorgRSocopensci1140175

14 Booke HE 1999 The stock concept revisited

perspectives on its history in fisheries Fish Res43 9ndash11 (doi101016S0165-7836(99)00063-6)

15 Baum JK Myers RA Kehler DG Worm B Harley SJDoherty PA 2003 Collapse and conservation ofshark populations in the Northwest AtlanticScience 299 389ndash392 (doi101126science1079777)

16 Dulvy NK et al 2008 You can swim but you canrsquothide the global status and conservation of oceanicpelagic sharks and rays Aquat Conserv MarFreshw Ecosyst 18 459ndash482 (doi101002aqc975)

17 Dulvy NK et al 2014 Extinction risk andconservation of the worldrsquos sharks and rays eLife 3e00590 (doi107554eLife00590)

18 Ellis JR Shackley SE 1997 The reproductive biologyof Scyliorhinus canicula in the Bristol Channel UKJ Fish Biol 51 361ndash372(doi101111j1095-86491997tb01672x)

19 Compagno LJV Dando M Fowler S 2005 Sharks ofthe world London UK HarperCollins

20 Pawson MG Ellis JR 2005 Stock identity ofelasmobranchs in the Northeast Atlantic inrelation to assessment and management JNorthwest Atl Fish Sci 35 173ndash193(doi102960Jv35m480)

21 Griffiths AM Jacoby DMP Casane D McHugh MCroft DP Genner MJ Sims DW 2012 First analysis ofmultiple paternity in an oviparous shark speciesthe small-spotted catshark (Scyliorhinus caniculaL) J Hered 103 166ndash173(doi101093jheredesr112)

22 Baeta F Batista M Maia A Costa MJ Cabral H 2010Elasmobranch bycatch in a trammel net fishery inthe Portuguese west coast Fish Res 102 123ndash129(doi101016jfishres200910016)

23 Barbieri M Maltagliati F Roldaacuten MI Castelli A2014 Molecular contribution to stock identificationin the small-spotted catshark Scyliorhinuscanicula (Chondrichthyes Scyliorhinidae) FishRes 154 11ndash16 (doi101016jfishres201401021)

24 Capapeacute C 2008 Biological observations on thesmallspotted catshark Scyliorhinus canicula(Chondrichthyes Scyliorhinidae) off theLanguedocian coast (southern France northernMediterranean) Pan Am J Aquat Sci 3282ndash289

25 Capapeacute C Mnasri-Sioudi N El Kamel-Moutalibi OBoumaiumlza M Amor MB Reynaud C 2014Production maturity reproductive cycle andfecundity of small-spotted catshark Scyliorhinuscanicula (Chondrichthyes Scyliorhinidae) from thenorthern coast of Tunisia (Central Mediterranean)J Ichthyol 54 111ndash126 (doi101134S0032945214010020)

26 Barausse A Correale V Curkovic A Finotto LRiginella E Visentin E Mazzoldi C 2014 The role offisheries and the environment in driving thedecline of elasmobranchs in the northern AdriaticSea ICES J Mar Sci 71 1593ndash1603 (doi101093icesjmsfst222)

27 Pardini AT et al 2001 Sex-biased dispersal of greatwhite sharks Nature 412 139ndash140(doi10103835084125)

28 Schmidt JV Schmidt CL Ozer F Ernst RE FeldheimKA Ashley MV Levine M 2009 Low geneticdifferentiation across three major oceanpopulations of the whale shark Rhincodon typusPLoS ONE 4 e4988 (doi101371journalpone0004988)

29 Keeney DB Heist EJ 2006 Worldwidephylogeography of the blacktip shark(Carcharhinus limbatus) inferred frommitochondrial DNA reveals isolation of westernAtlantic populations coupled with recent PacificdispersalMol Ecol 15 3669ndash3679(doi101111j1365-294X200603036x)

30 Ovenden JR Kashiwagi T Broderick D Giles JSalini J 2009 The extent of population geneticsubdivision differs among four co-distributedshark species in the Indo-Australian archipelagoBMC Evol Biol 9 40 (doi1011861471-2148-9-40)

31 Rodriacuteguez-Cabello C Saacutenchez F Fernaacutendez AOlaso I 2004 Is the lesser spotted dogfish(Scyliorhinus canicula) population from theCantabrian Sea a unique stock Fish Res 6957ndash71 (doi101016jfishres200404002)

32 Giltay L 1928 A propos de Scyliorhinus duhamelii(Garman 1913) et de Scyliorhinus canicula (L1758) Ann Soc R Zool Bel 59 13ndash19

33 Compagno LJV 1984 Sharks of the world anannotated and illustrated guide of shark speciesknown to date Part 2 Carcharhiniformes FAOFisheries Synopsis 125 4 251ndash655

34 Litvinov FF 2003 Sexual dimorphism as an index ofthe isolation of West African populations of thecatshark S canicula J Ichthyol 43 81ndash85

35 Daly-Engel TS Seraphin KD Holland KN Coffey JPNance HA Toonen RJ Bowen BW 2012 Globalphylogeography with mixed-marker analysisreveals male-mediated dispersal in theendangered scalloped hammerhead shark(Sphyrna lewini) PLoS ONE 7 e29986(doi101371journalpone0029986)

36 Hueter RE Heupel MR Heist EJ Keeney DB 2005Evidence of philopatry in sharks and implicationsfor the management of shark fisheries JNorthwest Atl Fish Sci 35 239ndash247

37 Mucientes GR Queiroz N Sousa LL Tarroso P SimsDW 2009 Sexual segregation of pelagic sharks andthe potential threat from fisheries Biol Lett 5156ndash159 (doi101098rsbl20080761)

38 Avise JC Arnold J Ball RM Bermingham E Lamb TNeigel JE Reeb CA Saunders NC 1987 Intraspecificphylogeography the mitochondrial DNA bridgebetween population genetics and systematicsAnn Rev Ecol Syst 18 489ndash522(doi101146annurevecolsys181489)

39 Hewitt GM 1999 Post-glacial re-colonization ofEuropean biota Biol J Lin Soc 68 87ndash112(doi101111j1095-83121999tb01160x)

40 Murton JB Lautridou JP 2003 Recent advances inthe understanding of Quaternary periglacialfeatures of the English Channel coastlands J QuatSci 18 301ndash307 (doi101002jqs748)

41 Svendsen JI et al 2004 Late quaternary ice sheethistory of northern Eurasia Quat Sci Rev 231229ndash1271 (doi101016jquascirev200312008)

42 Consuegra S Garciacutea de Leaacuteniz C Serdio AGonzaacutelez Morales M Straus LG Knox D Verspoor E2002 Mitochondrial DNA variation in Pleistoceneand modern Atlantic salmon from the Iberianglacial refugiumMol Ecol 11 2037ndash2048(doi101046j1365-294X200201592x)

43 Provan J Wattier RA Maggs CA 2005Phylogeographic analysis of the red seaweedPalmaria palmata reveals a Pleistocene marineglacial refugium in the English ChannelMol Ecol14 793ndash803 (doi101111j1365-294X200502447x)

44 Chevolot M Hoarau G Rijnsdorp AD StamWTOlsen JL 2006 Phylogeography and populationstructure of thornback rays (Raja clavata LRajidae)Mol Ecol 15 3693ndash3705(doi101111j1365-294X200603043x)

45 Olsen JL Zechman FW Hoarau G Coyer JA StamWT Valero M Aberg P 2010 The phylogeographicarchitecture of the fucoid seaweed Ascophyllumnodosum an intertidal lsquomarine treersquo and survivorof more than one glacialndashinterglacial cycleJ Biogeogr 37 842ndash856(doi101111j1365-2699200902262x)

46 Finnegan AK Griffiths AM King RAMachado-Schiaffino G Porcher JP Garcia-VazquezE Bright D Stevens JR 2013 Use of multiplemarkers demonstrates a cryptic western refugiumand postglacial colonisation routes of Atlanticsalmon (Salmo salar L) in northwest EuropeHeredity 111 34ndash43 (doi101038hdy201317)

47 Patarnello T Volckaert FA Castilho R 2007 Pillarsof Hercules is the AtlanticndashMediterraneantransition a phylogeographical breakMol Ecol16 4426ndash4444 (doi101111j1365-294X200703477x)

48 Griffiths AM Casane A McHugh M Wearmouth VJSims DW Genner MJ 2011 Characterisation ofpolymorphic microsatellite loci in thesmall-spotted catshark (Scyliorhinus canicula L)Conserv Genet Resour 3 705ndash709 (doi101007s12686-011-9438-z)

49 Toonen RJ Hughes S 2001 Increased throughputfor fragment analysis on ABI Prism 377 automatedsequencer using a Membrane Comb and STRandSoftware Biotechniques 31 1320ndash1324

50 Griffiths AM et al 2010 Molecular markers revealspatially segregated cryptic species in a criticallyendangered fish the common skate (Dipturusbatis) Proc R Soc B 277 1497ndash1503(doi101098rspb20092111)

51 Hall TA 1999 BioEdit a user-friendly biologicalsequence alignment editor and analysis programfor Windows 9598NT Nucleic Acids Symp Ser 4195ndash98

52 Larkin MA et al 2007 Clustal W and Clustal Xversion 20 Bioinformatics 23 2947ndash2948(doi101093bioinformaticsbtm404)

53 Excoffier L Laval G Schneider S 2005 Arlequin ver30 an integrated software package for populationgenetics data analysis Evol Bioinform Online 147ndash50

54 Van Oosterhout C Hutchinson WF Wills DPMShipley P 2004 MICROCHECKER software foridentifying and correcting genotyping errors inmicrosatellite dataMol Ecol Notes 4 535ndash538(doi101111j1471-8286200400684x)

55 Kalinowski ST Taper ML Marshall TC 2007Revising how the computer program CERVUSaccommodates genotyping error increases successin paternity assignmentMol Ecol 16 1099ndash1106(doi101111j1365-294X200703089x)

56 Rousset F 2008 GENEPOP rsquo 007 a completere-implementation of the GENEPOP software forWindows and LinuxMol Ecol Res 8 103ndash106(doi101111j1471-8286200701931x)

57 Goudet J 2002 FSTAT a program to estimate andtest gene diversities and fixation indices(version 293) httpwww2unilchpopgensoftwaresfstathtm (accessed 20December 13)

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

17

rsosroyalsocietypublishingorgRSocopensci1140175

58 Lewis PO Zaykin D 2001 Genetic Data Analysis

Computer program for the analysis of allelic dataVersion 10 (d16c) httphydrodictyoneebuconnedupeopleplewissoftwarephp

59 Rice WR 1989 Analyzing tables of statistical testsEvolution 43 223ndash225 (doi1023072409177)

60 Peakall R Smouse PE 2012 GenAlEx 65 geneticanalysis in Excel Population genetic software forteaching and researchmdashan update Bioinformatics28 2537ndash2539 (doi101093bioinformaticsbts460)

61 Pritchard JK Stephens M Donnelly P 2000Inference of population structure using multilocusgenotype data Genetics 155 945ndash959

62 Vaumlhauml J-P Erkinaro J Niemelauml E Primmer CR 2007Life-history and habitat features influence thewithin-river genetic structure of Atlantic salmonMol Ecol 16 2638ndash2654(doi101111j1365-294X200703329x)

63 Evanno G Regnaut S Goudet J 2005 Detecting thenumber of clusters of individuals using thesoftware STRUCTURE a simulation studyMol Ecol14 2611ndash2620(doi101111j1365-294X200502553x)

64 Earl DA vonHoldt BM 2012 STRUCTURE HARVESTER awebsite and program for visualizing STRUCTUREoutput and implementing the Evanno methodConserv Genet Resour 4 359ndash361(doi101007s12686-011-9548-7)

65 Tamura K Nei M 1993 Estimation of the number ofnucleotide substitutions in the control region ofmitochondrial DNA in humans and chimpanzeesMol Biol Evol 10 512ndash526

66 Tamura K Stecher G Peterson D Filipski A KumarS 2013 MEGA6 molecular evolutionary geneticsanalysis version 60Mol Biol Evol 30 2725ndash2729(doi101093molbevmst197)

67 Bandelt HJ Forster P Roumlhl A 1999 Median-joiningnetworks for inferring intraspecific phylogeniesMol Biol Evol 16 37ndash48 (doi101093oxfordjournalsmolbeva026036)

68 Tajima F 1989 Statistical method for testing theneutral mutation hypothesis by DNApolymorphism Genetics 123 585ndash595

69 Fu YX 1997 Statistical tests of neutrality ofmutations against population growth hitchhikingand background selection Genetics 147 915ndash925

70 Rogers AR Harpending H 1992 Population growthmakes waves in the distribution of pairwisegenetic differencesMol Biol Evol 9 552ndash569

71 Drummond AJ Rambaut A 2007 BEAST Bayesianevolutionary analysis by sampling trees BMC EvolBiol 7 214 (doi1011861471-2148-7-214)

72 Sorenson L Santini F ALfaro ME 2014 The effect ofhabitat on modern shark diversification J EvolBiol 27 1536ndash1548 (doi101111jeb12405)

73 Duncan KM Martin AP Bowen BW De Couet HG2006 Global phylogeography of the scallopedhammerhead shark (Sphyrna lewini)Mol Ecol 152239ndash2251 (doi101111j1365-294X200602933x)

74 Schultz JK Feldheim KA Gruber SH Ashley MVMcGovern TM Bowen BW 2008 Globalphylogeography and seascape genetics of thelemon sharks (genus Negaprion)Mol Ecol 175336ndash5348 (doi101111j1365-294X200804000x)

75 Goudet J Perrin N Waser P 2002 Tests forsex-biased dispersal using bi-parentally inheritedgenetic markersMol Ecol 11 1103ndash1114(doi101046j1365-294X200201496x)

76 DiBattista JD Feldheim KA Thibert-Plante XGruber SH Hendry AP 2008 A genetic assessment

of polyandry and breeding site fidelity in lemonsharksMol Ecol 17 3337ndash3351(doi101111j1365-294X200803833x)

77 Gubili C et al 2012 Application of moleculargenetics for conservation of the great white sharkCarcharodon carcharias L 1758 In Globalperspectives on the biology and life history of thegreat white shark (ed Michael L Domeier)pp 357ndash380 Boca Raton FL CRC Press

78 Hoelzel R Shivji MS Magnussen J Francis MP2006 Low worldwide genetic diversity in thebasking shark (Cetorhinus maximus) Biol Lett 2639ndash642 (doi101098rsbl20060513)

79 Gubili C Bilgin R Kalkan E Uumlnsal Karhan S JonesCS Sims DW Kabasakal H Martin AP Noble LR2011 Antipodean white sharks on a Mediterraneanwalkabout Historical dispersal leads to geneticdiscontinuity and an endangered anomalouspopulation Proc R Soc B 278 1679ndash1686(doi101098rspb20101856)

80 Hajibabaei M Singer GAC Hickey DA 2006Benchmarking DNA barcodes an assessmentusing available primate sequences Genome 49851ndash854 (doi101139G06-025)

81 Chevolot M Wolfs PHJ Paacutelsson J Rijnsdorp ADStamWT Olsen JL 2007 Population structure andhistorical demography of the thorny skate(Amblyraja radiata Rajidae) in the North AtlanticMar Biol 151 1275ndash1286 (doi101007s00227-006-0556-1)

82 Lynghammar A Christiansen JS Griffiths AMFevolden S-E Hop H Bakken T 2014 DNAbarcoding of the northern Northeast Atlanticskates (Chondrichthyes Rajidae) with remarks onthe widely distributed starry ray Zool Scr 43458ndash495 (doi101111zsc12064)

83 Palumbi SR 2003 Population geneticsdemographic connectivity and the design ofmarine reserves Ecol Appl 13 S146ndashS158(doi1018901051-0761(2003)013[0146PGDCAT]20CO2)

84 Mariani S et al 2005 North Sea herring populationstructure revealed by microsatellite analysisMEPS303 245ndash247 (doi103354meps303245)

85 Alberto F Massa S Manent P Diaz-Almela EArnaud-Haond S Duarte CM Serratildeo E 2008Genetic differentiation and secondary contactzone in the seagrass Cymodocea nodosa across theMediterraneanndashAtlantic transition region JBiogeogr 35 1279ndash1294(doi101111j1365-2699200701876x)

86 Borrero-Peacuterrez GH Gonzaacutelez-Wanguumlemert MMarcos C Peacuterez-Ruzafa A 2011 Phylogeography ofthe Atlanto-Mediterranean sea cucumberHolothuria (Holothuria)mammata the combinedeffects of historical processes and currentoceanographical patternMol Ecol 20 1964ndash1975(doi101111j1365-294X201105068x)

87 Kettle AJ Morales-Muntildeiz A Roselloacute-Izquierdo EHeinrich D Voslashllestad LA 2011 Refugia of marinefish in the northeast Atlantic during the last glacialmaximum concordant assessment fromarchaeozoology and palaeotemperaturereconstructions Clim Past 7 181ndash201(doi105194cp-7-181-2011)

88 Ladoukakis ED Saavedra C Magoulas A Zouros E2002 Mitochondrial DNA variation in a specieswith two mitochondrial genomes the case ofMytilus galloprovincialis from the Atlantic theMediterranean and the Black SeaMol Ecol

11 755ndash769 (doi101046j1365-294X200201473x)

89 Olsen JL et al 2004 North Atlantic phylogeographyand large-scale population differentiation of theseagrass Zostera marina LMol Ecol 13 1923ndash1941(doi101111j1365-294X200402205x)

90 Cimmaruta R Bondanelli P Nascetti G 2005Genetic structure and environmentalheterogeneity in the European hake (Merlucciusmerluccius)Mol Ecol 14 2577ndash2591(doi101111j1365-294X200502595x)

91 Magoulas A Castilho R Caetano S Marcato SPatarnello T 2006 Mitochondrial DNA reveals amosaic pattern of phylogeographical structure inAtlantic and Mediterranean populations ofanchovy (Engraulis encrasicolus)Mol PhylogenetEvol 3 734ndash746 (doi101016jympev200601016)

92 Griffiths AM Sims DW Johnson A Lynghammar AMcHugh M Bakken T Genner MJ 2011 Levels ofconnectivity between longnose skate (Dipturusoxyrinchus) in the Mediterranean Sea and thenorth-eastern Atlantic Ocean Conserv Genet 12577ndash582 (doi101007s10592-010-0127-3)

93 Vintildeas J Alvarado Bremer JR Pla C 2004Phylogeography of the Atlantic bonito (Sardasarda) in the northern Mediterranean thecombined effects of historical vicariancepopulation expansion secondary invasionand isolation by distanceMol Phylogenet Evol 3332ndash42 (doi101016jympev200404009)

94 Bremer JRA Vinatildes J Mejuto J Ely B Pla C 2005Comparative phylogeography of Atlantic bluefintuna and swordfish the combined effects ofvicariance secondary contact introgression andpopulation expansion on the regional phylogeniesof two highly migratory pelagic fishesMolPhylogenet Evol 36 169ndash187(doi101016jympev200412011)

95 Domingues VS Bucciarelli G Almada VC BernardiG 2005 Historical colonization and demography ofthe Mediterranean damselfish Chromis chromisMol Ecol 14 4051ndash4063(doi101111j1365-294X200502723x)

96 Domingues VS Stefanni S Brito A Santos RSAlmada VC 2008 Phylogeography anddemography of the Blenniid Parablenniusparvicornis and its sister species P sanguinolentusfrom the northeastern Atlantic Ocean and thewestern Mediterranean SeaMol Phylogenet Evol46 397ndash402 (doi101016jympev200705022)

97 Sbaffi L Wezel FC Kallel N Paterne M Cacho IZiveri P Shackleton N 2001 Response of thepelagic environment to palaeoclimatic changes inthe central Mediterranean Sea during the LateQuaternaryMar Geol 178 39ndash62(doi101016S0025-3227(01)00185-2)

98 Hoarau G Coyer JA Veldsink JH StamWT Olsen JL2007 Glacial refugia and recolonization pathwaysin the brown seaweed Fucus serratus Mol Ecol 163606ndash3616 (doi101111j1365-294X200703408x)

99 Panova M Blakeslee AMH Miller AW Maumlkinen TRuiz GM Johannesson K Andreacute C 2011 Glacialhistory of the North Atlantic marine snail Littorinasaxatilis inferred from distribution ofmitochondrial DNA lineages PLoS ONE 6 e17511(doi101371journalpone0017511)

100 Soltis DE Gitzendanner MA Strenge DD Soltis PS1997 Chloroplast DNA intraspecificphylogeography of plants from the Pacific

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from

18

rsosroyalsocietypublishingorgRSocopensci1140175

Northwest of North America Plant Syst Evol 206353ndash373 (doi101007BF00987957)

101 Larsson LC Charlier J Laikre L Ryman N 2009Statistical power for detecting geneticdivergence-organelle versus nuclear markersConserv Genet 10 1255ndash1264(doi101007s10592-008-9693-z)

102 Natoli A Birkun A Aguilar A Lopez A Hoelzel AR2005 Habitat structure and the dispersal of maleand female bottlenose dolphins (Tursiopstruncatus) Proc R Soc B 272 1217ndash1226(doi101098rspb20053076)

103 Arnold BD 2007 Population structure andsex-biased dispersal in the forest dwellingvespertilionid batMyotis septentrionalis Am

Midland Nat 157 374ndash384(doi1016740003-0031(2007)157[374PSASDI]20CO2)

104 Consuegra S de Leaacuteniz CG 2007 Fluctuating sexratios but no sex-biased dispersal in apromiscuous fish Evol Ecol 21 229ndash245(doi101007s10682-006-9001-7)

105 Ford E 1921 A contribution to our knowledge of thelife-histories of the dogfishes landed at PlymouthJ Mar Biol Assoc UK 12 468ndash505(doi101017S0025315400006317)

106 Steven GA 1932 Rays and skates of Devon andCornwall II A study of the fishery with notes onthe occurrence migrations and habits of thespecies J Mar Biol Assoc UK 18 1ndash33(doi101017S0025315400051274)

107 Sims DW Nash JP Morritt D 2001 Movementsand activity of male and female dogfish in atidal sea lough alternative behavioural strategiesand apparent sexual segregationMar Biol 1391165ndash1175 (doi101007s002270100666)

108 Wearmouth VJ Southall EJ Morritt D ThompsonRC Cuthill IC Partridge JC Sims DW 2012Year-round sexual harassment as a behavioralmediator of vertebrate population dynamics EcolMonogr 82 351ndash366 (doi10189011-20521)

109 Ward RD 2000 Genetics in fisheries managementHydrobiologia 420 191ndash201(doi101023A1003928327503)

on October 18 2017httprsosroyalsocietypublishingorgDownloaded from