FrEePlEaSe TaKe OnE

WwW.HaGgEn.CoM

Savory Double R RanchBeef Stewpage 6

School Bucks—Giving Back to Our Kids!page 5

Dungeness CrabMac and Four Cheesepage 7

Fall FavoritesFLAVOR

FALL 2014

Meat Lover’sSub Sandwichpage 14

2 FLAVOR FALL 2014

BaRkLeY HaGgEn 360-676-5300

2900 Woburn • Bellingham, WA

FaIrHaVeN HaGgEn 360-733-4370

1401 12th Street • Bellingham, WA

MeRiDiAn HaGgEn 360-671-3300

2814 Meridian • Bellingham, WA

SeHoMe ViLlAgE HaGgEn 360-676-1996

210 36th St • Bellingham, WA

BuRlInGtOn HaGgEn 360-814-1500

757 Haggen Drive • Burlington, WA

FeRnDaLe HaGgEn 360-380-9000

1815 Main Street • Ferndale, WA

MoUnT VeRnOn HaGgEn 360-848-6999

2601 East Division • Mount Vernon, WA

LaKe StEvEnS HaGgEn 425-377-7100

8915 Market Place NE, Suite 100Lake Stevens, WA

LaKe TaPpS HaGgEn 253-876-1700

1406 Lake Tapps Parkway EastAuburn, WA

MaRySvIlLe HaGgEn 360-530-7700

3711 88th Street NE • Marysville, WA

OlYmPiA HaGgEn 360-754-1428

1313 Cooper Point Road SWOlympia, WA

SnOhOmIsH HaGgEn 360-568-1395

1301 Avenue D • Snohomish, WA

StAnWoOd HaGgEn 360-629-4400

26603 72nd Avenue NW • Stanwood, WA

WoOdInViLlE HaGgEn 425-398-6700

17641 Garden Way NE • Woodinville, WA

GrAyS HaRbOr ToP 360-532-1830

1213 East Wishkah • Aberdeen, WA

PuYaLlUp ToP 253-841-4700

201 37th Avenue SE • Puyallup, WA

Bell eWoo d Acres

Honeycrisp Apples

A Northwest Favorite

Fresh, juicy Honeycrisp apples are here! We love the delicious taste of Honeycrisp apples. Since they’re from BelleWood Acres right here in Whatcom County, it’s like picking them from your own backyard. Grown on this side of the Cascades, the cooler weather gives them a distinct crispness that you can’t find anywhere else. Taste one bite of this incredibly juicy, sweet Honeycrisp apple and it’s sure to become your Northwest favorite.

HONEYCRISPAPPLE JUICE

Our Honeycrisp apple juice contains nothing but fresh–pressed Washington apples from Selah, Washington, so get it fast; this great–tasting juice is limited to the season’s harvest. Enjoy!

John and Dorie Belisle

Grown with care…picked for fl avor

A is for apple.And A is also for autumn—peak season to celebrate right-off-the-tree apples from Washington!

Apples are the most varied food on the planet, according to the U.S. Apple Association. While there are more than 7,500 known varieties of apples grown worldwide and about 2,500 varieties grown in the United States, Haggen is proud to offer you 20 freshly harvested Washington favorites, from Ambrosia to Tango—and 18 more varieties in between. With flavors ranging from tart to sweet, you’re sure to discover an apple or two (or more) to love.

Each apple variety’s unique characteristics means you’ll find plenty of choices for fresh eating, making sauces, pies or baking. Apples have just about as many uses as there are varieties. Curious? Just ask for a sample. Who knows, you may just find a new favorite. We’ve made it easy to help you choose—check out the flavor and usage profiles about each apple at our in-store displays.

Apples like it coldThe best way to store apples is inside a plastic bag in the crisper drawer of your refrigerator. Keep them away from cabbage, carrots, and onions since apples can absorb odor.

FALL 2014 www.haggen.com 3

Discover more Washington apple varieties in our store. Apple availability subject to weather conditions and seasonal availability.

BRAEBURNTASTE/TEXTURESlightly Tart • CrispFRESH —Very GoodPIE—ExcellentSAUCE—GoodBAKING—Very Good

CAMEOTASTE/TEXTURESweet • Slightly CrispFRESH —Very GoodPIE—Very GoodSAUCE—Very GoodBAKING—Very Good

FUJITASTE/TEXTURESweet • CrispFRESH —ExcellentPIE—GoodSAUCE—FairBAKING—Very Good

GALATASTE/TEXTURESlightly SweetSlightly CrispFRESH —ExcellentPIE—Very GoodSAUCE—FairBAKING—Very Good

GOLDEN DELICIOUSTASTE/TEXTURESweet • TenderFRESH —ExcellentPIE—ExcellentSAUCE—Very GoodBAKING—Very Good

GRANNY SMITHTASTE/TEXTURETart & SweetFirm & CrispFRESH —Very GoodPIE—ExcellentSAUCE—ExcellentBAKING—Very Good

HONEYCRISPTASTE/TEXTURESweet Tart • Extra CrispFRESH —ExcellentPIE—ExcellentSAUCE—GoodBAKING—Very Good

JONAGOLDTASTE/TEXTURESweet • Slightly CrispFRESH —ExcellentPIE—Very GoodSAUCE—FairBAKING—Excellent

Ranging in flavor from sweet to tart,tender to explosively crisp, Washington apples

are as versatile as they are unique.

Celebrate Washington Apples

Core Facts:Core Facts: Apples are a healthy, convenient and delicious snack for kids and adults alike and they make a great addition to a lunch box. Apart from the fact that they taste great and are low in calories—and of course, fat free—an apple a day providesa good source of fi ber, vitamins A and C,and healthy antioxidants. Enjoy!

WACelebrating Washington Apples

This fall, as our children head back to school, we begin the school year ritual of making healthy, hearty breakfasts and planning and packing school lunches. How do we ensure that our children get the right start to the day and the nutritional boost they need at lunch to feel and learn at their best? That’s where Erin Baker’s Wholesome Baked Goods come in!Erin Baker began her baking career at the tender age of 9—a schoolgirl herself—and even back then she understood the importance of simple, wholesome, all natural ingredients. Today her Bellingham-based company, Erin Baker’s Wholesome Baked Goods, delivers delicious and nutritious cookies, brownie bites and granola to your local Haggen store. So whether it is breakfast, lunch or snack time, Erin has something great baked up for your children.“My Breakfast Cookies are what we like to call a portable bowl of oatmeal - we combine whole grain oats and only real fruit so your body gets what it needs to start the day. We are helping kids make the connection between fueling up with healthy food and having good energy and performance...”Erin is committed to encouraging healthy eating and fitness habits in children. The Erin Baker Triathlon Team has raised $75,000 for Boys & Girls Clubs across the country. Working in alliance with The Boys & Girls Clubs of Washington State, Erin also has the goal of feeding one million kids a healthy breakfast. “Every purchase of Erin Baker's products goes towards feeding kids in need...it's that simple. This means we all can take action NOW to make a difference. Showing kids what a healthy breakfast is and then giving it to them on a regular basis will effect a positive change.

“Every purchase ofErin Baker's products help support funding

for kids in need.” Erin Baker

CaRaMeL ApPlE–

Packed with luscious caramel, diced apple and whole grain oats, it’s a favorite with big and little kids alike!

PeAnUt BuTtEr–

A delicious, nutritious blend of oatmeal and all natural crunchy peanut butter pack pure energy and protein into onesmall cookie.

SOME OF OUR FAVORITESSOME OF OUR FAVORITES

Mixing

Flattening

Wholesome Baked Goodness

4 FLAVOR FALL 2014

Team� g up withErin Baker fora Healthy Start

FALL 2014 www.haggen.com 5

Purchase products like these to help support our local schoo ls.Purchase products like these to help support our local schoo ls.AnNiE’S

MaC AnD ChEeSe—

Delicious, creamy and organic, Annie’s Mac and Cheese is a kid pleaser for lunch or dinner.

AnNiE’S ChEdDaR

BuNnIeS—

100% real cheese and a crispy crunch make Annie’s wholesome Cheddar Bunnies a perfect snack anytime of the day.

AnDrOs

FrUiT Me Up—

A fun addition to school lunches. One pouch equals one serving of 100% real fruit.

BoNnE MaMaN

PrEsErVeS—

Bonne Maman homemade–style preserves are made with 100% natural ingredients and packed with lots of fruity goodness.

DrAzIl KiDs TeA—

Caffeine-free, organic teas sweetenedwith fruit juice are the secret to nutritious and delicious DrazilKids Tea.

StAcY’S

PrEtZeL ThInS— Seasoned with sea salt and baked to perfection, Stacy’s Pretzel Thins taste delicious plain or withyour favorite dip.

SiGn-uP

iS sImPlE.Visit www.haggen.com to link your Haggen CARD

At Haggen, we make it a priority to give back to the neighborhoods where our shoppers and associates live and work. The School Bucks program is just one of many ways we support local communities. Established with the aim of supporting education, Haggen is proud to note that the program raised $21,406 for 310 schools in 2013-2014. Our goal is to DOUBLE that number this year!

How can you participate in School Bucks? It’s easy! Link your Haggen CARD to your school and every time you purchase a participating School Bucks item, Haggen donates funds directly to your school. You can encourage teachers, staff, parents, grandparents, friends and other family members to link their CARDs too—the more people who register for School Bucks, the more money your school can earn! Funds can be used to purchase educational equipment and materials or support educational activities based on each school’s needs. The program runs from September 3 to May 15, so remember to link your CARD to your local school at the beginning of every school year.

Together we raised$21,406

for 310 schools in 2013-2014

School Bucks—Giving Back to Our Kids!

Visit www.haggen.com to link your Haggen CARD to your school.

BUY THIS PRODUCTTO SUPPORT YOUR SCHOOL

LoOk FoR ThE TaGs

J

J

PP

EEEE..oo

Haggen School Bucks is a winning proposition for both teachers and students providing needed funds for enrichment activities, academic materials and school-based special projects. Ph

otos

cou

rtes

y of

Bel

lingh

am P

ublic

Sch

ool F

ound

atio

n

Pick the Perfect CutSome of the best cuts of beef for oven braising,

pot roasting or slow cooking include:

Boneless Shoulder Chuck Roast

Boneless Bottom Round Roast

Eye of Round Roast

Top Round Roast

Sirloin Tip Roast

Hearty Red Wine Beef Stew Yield: about 6 cups

Cube the beef roast or brisket into thumb-sized pieces. Heat oil in large skillet over medium-high heat. Season and toss meat in corn starch. Add meat to pan and cook until all sides are nicely browned.Transfer the seared meat to your slow cooker. Deglaze the skillet with 1/4 cup of the wine, scraping the dark glaze and any crispy bits from the bottom of the pan as the wine simmers (about 10 min.). Then pour the wine over the meat.Add the vegetables and stir together in the slow cooker with seasonings and garlic.Pour the stock and the remaining wine over the beef and vegetables. The liquid should come about 3/4 of the way to the surface of the ingredients. Cover the slow cooker and cook on low for 6 to 8 hours. When finished, the beef should fall apart easily with a fork. Enjoy!

3-4 lbs chuck roast, cubed

Salt and pepper to taste

1 1/2 Tbsp corn starch

1 Tbsp olive oil

1-2 cups red wine

2 cups chicken stock

2 garlic cloves, minced

1 Tbsp fresh thyme, chopped

1 large yellow onion, diced

1 package precut butternut squash

3 large yellow potatoes, cubed

4 large carrots, sliced

Savory Double R Ranch Bee f Stew

Fresh Baked BreadA demi-baguette of La Panette bread fresh–made

from the Haggen bakery makes the perfect

accompaniment to a hearty stew.

Roast

ast

st

Double R RanchLoomis, WA

When it comes to comfort food, hearty stews are at the top of the list for delicious, easy-to-fix home meals that warm you from the inside out. With a 60 year tradition of raising cattle, the premium beef that comes from ranchers like the Clark family and Double R Ranch in the Okanagan is the perfect addition to your recipes to bring the fullest flavor to any savory stew. Here’s a classic red wine pot roast that’s sure to delight your taste buds. A glass of good red and a crisp baguette is all you need to complete this wonderful meal!

Haggen Chef Bryan Weener

6 FLAVOR FALL 2014

FALL 2014 www.haggen.com 7

LocalCreamy ComfortThe Pacific Northwest

is home to many good

things and cheese is no

exception. Happily, artisan

cheese making is a growing

regional enterprise and

provides the means for a

new take on an old classic,

such as this rich and

wonderful macaroni and

cheese recipe from Chef

James, featuring four of the

finest cheeses in the area.

FaCe RoCk CrEaMeRy

VaMpIrE SlAyEr GaRlIc

ChEdDaR ChEeSe

A tangy, smooth garlic cheddar that’s to die for!

WiLlAmEtTe VaLlEy

SmOkEd FoNtInA ChEeSe

A subtly nutty and delicious farmstead fontina made from organic jerseycow milk.

BeEcHeR’S

FlAgShIp HaNdMaDe ChEeSe

Beecher’s signature semi-hard cow’s milk cheese is robustand nutty.

TiLlAmOoK

MeDiUm ChEdDaR ChEeSe

Based on a century-old recipe, this cheese is rich, creamyand voted the “World’s Best Medium Cheddar!”

Bring 5 quarts of water to a boil in a large pot. Add 1 Tbsp of kosher salt and the bow tie pasta. Cook, stirring frequently, until noodles are soft but still firm (al dente). Drain the pasta and place in a large mixing bowl. While the pasta is cooking prepare the cheese sauce.Melt the butter in a large sauce pan, add the garlic and cook for a couple minutes until soft but not browned, remove pan from heat and whisk in the flour. Return to heat and cook for about 3 minutes, whisking constantly to keep from burning, then gradually add in the milk and half & half, stirring constantly until the mixture comes just to a boil. Reduce the heat and simmer, stirring often, until the sauce begins to thicken slightly (about 5 minutes).Add the shredded cheese and stir until the cheese is melted.Remove sauce from the heat and whisk in the kosher salt, Sriracha sauce, green onion and Italian parsley. Gently stir in the crab, mix the sauce with the cooked pasta and place in a lightly buttered 9 x 13 baking dish. Top with the remaining 1 cup shredded Tillamook cheddar and 1 cup of crumbled crostini crumbs. Bake in 350° oven until bubbling and hot (about 30 minutes).

1 lb farfalle (bow tie) pasta

1 Tbsp kosher salt

4 Tbsp butter

4 large cloves garlic, finely chopped

1/4 cup all purpose flour

2 cups milk

2 cups half & half

1 cup Face Rock Vampire Slayer (Garlic Cheddar) cheese, shredded

1 cup Beecher’s Flagship, shredded

1 cup Willamette Valley Smoked Fontina, shredded

2 cups Tillamook Medium Cheddar, shredded and divided (1 cup for sauce and1 cup for garnish)

2 tsp kosher salt

1 Tbsp Sriracha hot chili sauce

1/2 cup green onion, chopped

2 Tbsp Italian parsley, chopped

8 oz Dungeness crab, shrimp meat, imitation crab or chicken, chopped

1 cup Haggen crostini, crumbled

Dungeness Crab Mac and Four Cheese Yield: about 8 servings

Haggen Chef James Valentine

The GREAT PumpkinA sure sign that fall is here is the display of gorgeous orange pumpkins that welcome you into your local Haggen store. Pumpkins (or cucurbita pepo) are native to North America and the most well known member of the winter squash family. Whether displayed on a doorstep, carved as a jack-o-lantern, steamed, roasted or pureed, pumpkins have something for everyone to enjoy. And nutritionally they have lots to offer. Pumpkins are a great source of Vitamin A, Vitamin C, fiber, beta carotene, carotenoids, and potassium. Just one more healthy super food!

Happily, pumpkin is a versatile ingredient with a wonderful taste that we tend to associate with the cooler fall months and traditional celebrations. This fall there are plenty of pumpkin flavored options to

be found at your local Haggen.

In the Bakery: Apart from our delectable pumpkin pies—the perfect centerpiece for any Thanksgiving dessert table—you’ll find our amazing pumpkin bread and pumpkin

donuts, perfect breakfast treats or mid-afternoon snacks that are moist, delicious and perfectly spiced.

In the Produce Section: Beginning in mid-September you’ll find freshly harvested pumpkins from Honey Farms in Whatcom County and Sterino

Farms in Puyallup, both multi-generational family farm operations that are committed to using sustainable agricultural practices-and growing the finest pumpkins to be found in the Northwest. We also feature organic sugar pie pumpkins from Tilth producer Pete Dykstra at Hopewell Farm in Everson.

Pumpkin is also featured in multiple sections of your local Haggen store. So check out the many choices and add some pumpkin to your diet this fall!

Fun Fact:Fun Fact:The record for the world's heaviest pumpkin is 2,009 pounds!

Pumpkin Pie—the best part of Thanksgiving dinnerOur amazing pumpkin pies are made fresh right in our stores. You’ll find them refrigerated because they’re made with real eggs, blended into perfectly spiced pumpkin and poured into our scratch made, buttery and flaky crust made with Shepherd's grain flour.A traditional favorite!

8 FLAVOR FALL 2014

FALL 2014 www.haggen.com 9FALL 2014 www.haggen.com 9

DELICATASmaller than most winter squash, with a rich flavor and creamy texture, you don’t have to peel Delicata. Most commonly baked or roasted, but can be stuffed, steamed or sautéed.

The sweet, nutty flavor of squash lends itself well to fall menus when we crave rich and hearty tastes. Indigenous to North America, winter squash are truly versatile. They bring vibrant color to the table and taste great roasted, in soups, stews and pasta, or stuffed and baked—really the limit is the extent of your culinary creativity.

Located along the Columbia River in Oregon, Delta Farms grows a wonderful variety of winter squashes such as Acorn, Butternut, Delicata and Patty Pans. Delta Farms is Food Alliance Certified, thanks to David and Vicki Egger's commitment to

meeting the highest sustainability standards on their family-run farm. All that care in growing means that the squash they provide to Haggen stores is the some of the finest in the Pacific Northwest!

SQUASHA FALL FAVORITE!

RoastedRoastedAcorn SquashAcorn Squash

Recipe available at

www.haggen.com/recipes/squash

FaFaFaFaFaFaFaFaFaaFaFaFFaF rmrmrmrmrmrmrmrmrmrmmmmms s s ssss isissi FFFooooood d dd AlAlAlAAllilillliliananancececee CCCCCererrrrtitititt fififiiffff edededeededded, , , ttthththtttt ananannkskskmememememmmmonononononoogrgrgroototooththhhhhhh

Delta/Sauvie Island Farms

Egger Family

Health Benefits:Health Benefits: Squash is a wonderful source of beta-carotenes, magnesium, potassium, vitamin A, vitamin C and a good source of calcium and dietary fi ber. That’s a lot of good nutrition wrapped into a colorful package!

BUTTERNUTRich and sweet, this squash is perhaps the most commonly eaten and can be used in soups and sauces, but can also be baked, cooked into dishes or filled with a savory stuffing.

SWEET DUMPLINGSEvery part of the adorable Sweet Dumpling squash is edible. It’s another great choice for adding to stews and soups.

BUTTERCUPBred by a horticulturist in North Dakota as a small variety of turban squash, the Buttercup squash has a taste that is surprisingly close to the taste of a sweet potato.

CARNIVALA hybrid of the Sweet Dumpling, this beautifully variegated squash has a sweet and mellow flavor similar to butternut squash. Tastes best when roasted!

SPAGHETTIThe flesh of this squash comes out in long strands, much like spaghetti noodles—thus the name! It’s easy to cook and can be used as a side dish or as a stand-in for pasta.

ACORN SQUASHThis winter squash has a dark green skin and sweet, nutty flavored orange-yellow flesh. Great roasted, but it can also be steamed, sautéed or stuffed. Serve the squash in its rind for a beautiful effect.

10 FLAVOR FALL 2014

October is NON-GMO MonthGMOs, or Genetically Modified Organisms, are plants or animals created through the gene splicing techniques of biotechnology (or genetic engineering). This technology merges DNA from different species, creating combinations that cannot occur in nature or traditional crossbreeding.

Most GMOs have been engineered to withstand direct applications of pesticides or herbicides, or to produce an insecticide. Alfalfa, corn, potatoes, flax, rice, papaya, soy and sugar beets are some of the foods that most often contain GMOs.

Although the FDA maintains that GMOs are indeed safe for human consumption, there are many people who disagree, and many people who choose to avoid them until they’re sure they’re safe.At Haggen, we’re giving our guests the opportunity to make educated purchases based on the values that are important to them. We’ve provided tags at shelf edge to help you identify items that have been NON GMO Project Verified.The NON GMO Project is a non-profit organization committed to preserving and building sources of non-GMO products, educating consumers, and providing verified non-GMO choices. For more information, visit www.nongmoproject.org

Mary’s NON-GMO poultry was the first in the nation to be

NON-GMO Project Verified. Find Mary's air-chilled free range chicken breasts and Cornish hens in our meat department. Mary's free range and organic turkeys will be available this Thanksgiving.

Q: Do organic foods have GMOs in them?

A: The USDA’s National Organic Program prohibits foods containing GMOs as being labeled organic.

Q: How can I tell which foods don’tcontain GMOs?

A: The best way to know which foods are non-GMO is to look on the product package for the Non-GMO Verified label from the Non-GMO Project. We’re helping guests identify these with shelf-edge tags during Non-GMO Month.

Q: What is the Non-GMO Project?

A: It’s a Bellingham-based nonprofit organization committed to preserving and building sources of non-GMO products, educating consumers and providing verified non-GMO choices.It’s the ONLY 3rd-party verification for GMOs

FREQUENTLY ASKED QUESTIONS

NON GMO

CHICKEN

1010101010101010101000101010101001010001010001010 FLFLFLFLFLFLFLFLLFLFLLFLLFFLLLAVAVAVAVAVAVAVAVAVVAVAVAVAAVAVAVVAAAVAAVA OROROROORORORORORROOROROOROROOOOORRO FFFFFFFFFFFFFFFFFALALALAALALALALALALALALALAALALAAAAAA LLLLLLLLLLLLL 202020202020202002000200202020022 1414141414141414144414141411114444444

Mary and Rick

FALL 2014 www.haggen.com 11

FIRST OF THE FALL PEARS

TOSCAGROWN IN EASTERN WASHINGTON

FLAVOR—sweet, smooth,juicy and slightly exotic.

BEST USE—delicious fresh and added to salads but greatfor baking and poaching too.

PAIRINGS—Gorgonzola cheese and Pinot Gris

Lime green, ruby red, golden brown. Fall brings a beautiful, abundant selection of local pears fresh from the orchard to market. This wonderfully versatile fruit can be enjoyed fresh or cooked in a variety of ways. They pair especially well with wine and cheese and are a great fruit to feature on fall menus. Our pears come to us from wonderful growers such as Stemilt Growers in Wenatchee. Family owned since 1964, Stemilt pears are grown in the Wenatchee River Valley and the Entiat River Valley, two of the world’s best spots for growing pears thanks to the cool temperatures and high quality air drainage that the fruit needs to thrive. Stemilt grows many pear varieties, including the wonderful Tosca pear. From a nutritional standpoint, pears are an excellent source of fiber and vitamin C. They are a wonderful addition to your diet, particularly when eaten fresh. How do you know when a pear is at its peak and ready to eat? Pears ripen from the inside out, so try squeezing the neck of the pear to test for softness. Some pears change color as they ripen (Bartlett)

but others do not (Anjou) so this is not the best gauge of ripeness.

Tosca Pear Walnut Salad with Castello Blue Cheese Crumbles Recipe available at www.haggen.com/recipes/tosca-pear-walnut-salad/

ANJOUFLAVOR—juicy, subtle sweetness with hints of lemon and lime.BEST USE—works wellin most recipes forbaking, poaching, roasting, or grilling and can be used fresh in salads or enjoyed on its own.PAIRINGS—Soft Goat Cheese and Sauvignon Blanc/Brie and DemiSec Champagne

BARTLETTFLAVOR—aromatic, change from green to yellow as they ripen, sweetens and softens as it ripens going from tart and crunchy to juicy and sweet.BEST USE—traditionally known as a canning pear, Bartletts are great for snacking, fresh in a green salad or served with cheese.PAIRINGS—San Andre Triple Crème and Brut Champagne/Fontina and Merlot

yy asasasaasasas

dd d d dddddddd

COMICEFLAVOR—sweet, juicy and buttery-one of the sweetest and juiciest fruits in the pear family.BEST USE—best enjoyed fresh because their juiciness makes cooking with Comice pears challenging.PAIRINGS—Stilton and Ruby Port/Roquefort and Sauternes

BOSC FLAVOR—crunchy yet tender flesh with asweet-spiced flavor.Tan skin when ripe.BEST USE—these pears are good for baking, broiling and poaching.PAIRINGS—Aged White Cheddar and Cabernet Sauvignon/Parmigiano-Reggianoand Barbaresco

SECKEL FLAVOR—these exceptionally sweet small pears are sometimes called sugar pears.BEST USE—the petite size and wonderful sweetnessmake a Seckel pear a perfect addition to lunch boxes.PAIRINGS—Fontina and Pinot Noir/Havarti and Beaujolais

RED BARTLETT FLAVOR—classic pear flavor, floral aroma, buttery texture.BEST USE—great for snacking, salads, pies, canning and sauces.PAIRINGS—Brie and Reserve Chianti/Stilton and Tawny Port

True PEAR–fection

Pear Fact:Pears grown in Washington and Oregon represent84% of the nation’s total crop.

ggggggggg, , ,,,,,d d d d ddd dd

Tosca—A cross between a Coscia and a Bartlett that is grown extensively in Italy, Tosca pears are also organically grown in Eastern Washington and are the first pears to ripen each summer. This specialty pear is available August and September.

sososososoososossooooftftftftftftfffftffftff nenenen ssssssssss. SoSoSoSS mememeemee pepeep aabubuuuuutttttttttttttbebeebebess

Tosca Pear Walnut Sala

Kyle Matheson

Pears subject to seasonal availability.

paSS the dipPICO DE GALLO

This fresh medley of tomatoes, onions, peppers and cilantro

is the perfect complement to tortilla chips, or a garnish on your tacos. Top a bed of

lettuce and add ground beef for an easy taco salad.

BACON CHEDDAR RANCHThis creamy cheesy dip is loadedwith flavor! Bacon and cheddar throughout make it the perfect

topping for a burger or dip with chips.

ARTICHOKE PARMESANAbsolutely fabulous artichoke

Parmesan dip —nothing better! You will amaze and delight your friends and family with this rich and savory

dip that is best served hot.

fresh madeesh ma

Primizie CrispbreadWhile on a culinary tour of Italy, founders Mark and Lisa discovered an old world bread recipe that, when “crisped,” became the basis for their delicious handmade crispbread. They began serving it in their Primizie Osteria Café but couldn’t keep up with demand and thus Primizie Handmade Snack Crisps was born. These delicious, all natural and versatile crispbreads are perfect for dipping and topping. Flavor combinations feature Smoked Dutch Gouda & Garlic, Italian 7-Herb andNew Mexican Chimayo Chili & Lime. Delicioso!

A stroll through the chip section at your local Haggen can really impress you with the variety of chips to choose from when it comes to selecting something to accompany your favorite dip. In fact we carry more than 100 different natural varieties. See page 13 for some of our new favorite chips and snack foods!

Natural ChipsNatural ChipsJ

More than 100 varieties of natural chips to choo se from12 FLAVOR FALL 2014

FALL 2014 www.haggen.com 13

San Juan SalsaArlington, WA

Okie Joe’s SalsaOkie Joe’s Salsa is the result of a passion to create a salsa that’s second to none. This Lake Stevens family–owned business uses no sugar or vinegar, just delicious fresh ingredients with a unique blend of bold spices that’s great for dipping chips—or adding extra flavor to casseroles. Available in mild, medium, hot or try their Coconut Lime or Chipotle Habanero salsa for a truly unique and tropical flavor experience!

San Juan Salsa Co.San Juan Salsa Co. started in Friday Harbor in the 1980s and today is a familiar find in Haggen stores across the region. This locally produced salsa is made from vine ripened tomatoes that are seasoned and cooked to perfection and available in mild, medium and hot. The company also makes a delicious traditional salsa using raw vegetables, herbs and seasoning to create a flavor-packed fresh salsa that is superb for chip dipping.

Deanna Godsey • Okie Joe’s SalsaLake Stevens, WA

San Juan Salsa Co. Tortilla ChipsThese delicious, all natural, gluten free tortilla chips made in Arlington, Washington are available in yellow corn and white corn. They pair perfectly with San Juan Salsa Co.’s all natural salsas.

POP! Gourmet PopcornFeatured on the O! List and Good Morning America this all natural, non-GMO, gourmet popcorn from Kent, WA comes in amazing and award–winning flavors such as Sriracha Hot Chili Sauce, Chocolate Caramel, White Cheddar Jalapeno, and Rogue Blue.

Beanitos Bean ChipsA chip that tastes great and is good for you too, Beanitos chips are made from nutritious beans—white, black, and pinto—and and are a source of both fiber and protein. Available in a variety of flavors, including Original Black Bean, Simply Pinto Bean, Chipotle BBQ and Better Cheddar.

Paqui Tortilla Chips“Paqui” is the Aztec word for happy and that’s just how you’ll feel when you taste these fantastic tortilla chips made with the finest corn. Available in Original Delights, Cowboy Ranch, Very Verde Good, and Grilled Habanero ,the hottest chip we carry.

Snack Factory Pretzel CrispsYou're invited to “rethink your pretzel”! These enigmatic crisps are light, versatile (plain or with dips), and most importantly, wonderfully tasty. Try them in a variety of flavors including Original, Garlic Parmesan, Buffalo Wing, Honey Mustard & Onion and Everything.

Skinny Pop PopcornPerfect popcorn kernels are the key to this all natural snack that’s GMO, gluten and preservative-free. This “No Artificial Anything” snack is a guilt free delight to enjoy in Original, Black Pepper or Ultra Lite White Cheddar.

Simply 7 Quinoa & Lentil ChipsWith 8+ grams of protein per serving, Simply 7 Quinoa Chips are one healthy snack! The Lentil Chips are another healthy choice that’s packed with great nutrition and great flavor. Try Quinoa Barbeque, Quinoa Cheddar, Lentil Sea Salt or Lentil Creamy Dill. Simply delicious!

Natural Chip SelectionsNatural Chip Selections

Watching the game, whether it’s in a stadium or in front of abig screen TV, can build up an appetite, which explains how the traditionof tailgating—and now homegating—was born. Whether you plan on a barbecue off the back of your pick-up or a low-key spread on the dining room table, the key to fun, stress-free tailgate entertaining is planning ahead. Get the prep done in advance so food is ready and laid out for you and your guests to enjoy during the game. Simple, easy finger foods work especially well—think chips and dips, fresh fruit, and sliced meats and cheese with an assortment of bread. Another fun tailgating idea is gourmet sub sandwiches, and the Meat Lover’s Sub Sandwich (recipe below)is a great combination.Eat, drink, and be merry as you gather with family and friends to cheer on the home team hero!

ONLY AT

The Di Lusso Deli Company has been in the business of producing premium deli meats and cheeses since 1919—a 90+ year tradition of excellence and quality that is evident in every bite. Handmade and aged in the cheese capital of Wisconsin, the sliced cheeses are smooth, creamy and delicious, while Di Lusso meats are lean, moist, minimally processed, free of fillers, nitrates, MSG and gluten, and packed with amazing flavor that you’ll taste in such favorites as Seasoned Roast Beef, Pastrami, Smoked Ham, Golden Brown Turkey and Sundried Tomato Turkey Breast.

Our Haggen Deli carries a full line ofDi Lusso’s delicious premium deli meats, cheeses andcondiments that aregreat for sandwichesand party plattersand make entertaininga breeze.

TURKEYPASTRAMI

HAM

1 La Panette baguette

1/2 cup Di Lusso chipotle mustard

4 slices Di Lusso provolone, cut in half

8 oz Di Lusso pastrami

8 oz Di Lusso smoked ham

8 oz Di Lusso golden brown turkey

4 slices Di Lusso cheddar

4 roma tomatoes

1/2 medium red onion, sliced

4 oz arugula

Slice La Panette bread in half lengthwise. Spread 1/4 cup of chipotle mustard on each half, followed by the provolone, pastrami, ham, turkey, cheddar, tomatoes, red onion, and arugula.

Beer is integral to the tailgating experience. Here in the Pacifi c Northwest, with the plethora of microbrewerieswe are blessed tohave, you’ll fi ndlots of interestingcraft beers totoast the teamwith, includingPyramid Brews.

Meat Lover’s Sub Sandwich 8 Servings

HOME TOWN HEROHOME TOWN HEROFresh BakedFresh Baked

La Panette BaguetteLa Panette BaguetteMade fresh in our bakery!

Haggen Chef James Valentine

adadadaddadada itititititittioioiooionnnnnnnbbbb bbbbbbbbb ffffffffffff thththth bbbbbb kkkk

ere in the Pacifi cth the ppletlethorhora oa off esd toondtingg

mgs.

Master Brewer

Kim Brousco

14 FLAVOR FALL 2014

FALL 2014 www.haggen.com 15

PREMIUM HAIR, FACE AND BODY CAREPREMIUM HAIR, FACE AND BODY CARE

construction projects, a bicycles for education program, and a reforestation program. As one young girl noted, before she received her bike she had to get up at 3 am to complete her chores and walk to school. She was always late. Now with her bike she is able to sleep more and arrive at school on time. It’s just one small example of the life-changing impact that Alaffia is having in Togo.

Here at home, the Olympia-based company is growing and providing good employment opportunities for local residents. Alaffia clearly demonstrates the pride and profitability that comes with developing a sustainable business based on traditional knowledge and responsible care for communities.Great products are the result of this inspiring transcontinental cooperation. Haggen is excited to feature Alaffia’s full line of all natural, fair trade certified skin and hair care products

in our stores, including their traditional African Black Soap, Shea and Honey Nourishing Shampoo, and Baobab Oil Facial Serum. You’ll find the nourishing and moisturizing ingredients in all Alaffia products bring a healthy glow to skin and hair alike. In addition to their beauty products, Alaffia also markets colorful, durable hand-woven baskets that are perfect for regular shopping trips and BYOB (bring your own basket)!

“Alaffia” is a traditional greeting in the African nation of Togo that means peace, health and well-being.Sustainable business is about supporting our communities. In the case of Alaffia, communities in Washington and Togo are being supported by this amazing business that is based on African handcrafted shea butter and traditional knowledge and skills that have been passed from generation to generation.Alaffia is planting a seed to grow “empowerment, equality and beauty.” It’s a seed that is rooted in the love that flourished when Rose Hyde was sent to Togo by the Peace Corps and met Olowo-n’djo Tchala. They married, started a family and moved to Olympia, where their mutual commitment to “good” business inspired them to start Alaffia in 2004.Olowo-n’djo grew up in Togo, where his mother was a farmer, as are the majority of people in Togo. He remembers that as he was growing up the message from his mother was always that he “must do good.” It’s a message he took to heart and Alaffia has allowed him to bring her advice to life. Today the company empowers more than 500 women who are part of Togo-based cooperatives. The ripple effects are impacting and improving the lives of thousands more through community programs

Olowo-n'djo Tchala & Rose Hyde

J

Selection varies by store.

arararararrririrrririiveveeeeeveveve aaaaaaaaattt t tt scscsccscscscscschohohhohohohohohohooololoololo ooooonnnn n titititiimemememeemeem ... . ItItIItItItItItt ssss jjjjjjususuuusust t ononeeimimimimimimmimmmiimimpapapapapappppapapppaaapapactctttttctctctctctccccctcccccctt ttttttttttthhhhahahahhhhahahhahahahaaaaaahhahattttttt t ttttt AlAlAlAlAllAlAlAlAlAlllAlAlAlAlAA ffafafaaafafaafaafafaafafffffifififffifififififfffff aaaaaaaaaa isisiisisiiisiisisissssi hhhhhhhhhhhhhavavavavaaaaavavaavavininnininininiininggggg g gggg iniinininininn TTTTTTTTTTTTogogogogoogooogggggggggoo

HHHeeeeHHeHHHH rererereeeerreeereccccoooocooc mmmmmmeeememmmmmmemmppppprrrerrrrerereeerrr sssssisidddttthhhhhhthhttt eeeeee e eeeewwwwwwwiwiiiiiwwwwww ttthththhhhthhhttbbbbbabaaaaaabbaaaaaaaaaaaaaabasssseeesseeeesessserrrererereeeererereer ssssspsppppppsssppppppsspppGGGGGrrrrGrrrGrGrGGGGreeeeeaeaeaaaeaaaaeaaaaiiininnnnnii ssssspsppppssppppppHHHHHHaHaaaaaaHHaaHH ggggggggggggffffuuuuuffufuufufuuff llllllllllllllllllcccceceeeeeecccceeeceeceeeerrrtrttrtrtrrtrrrtttrtrttr iiiiiiiiiii

ininininiininininnnn oooooooooooooooururururrururr sssssssssstotoototooototoorerererereeerererereesssssssssss,s,s,,,, iiiiiiiiiincncncncnncncn lllulululluluuuuululuuuululuuluuudddddididddddiddidididdidididiiddddd ngngngngngngngngngnggnggggggggg ttttttttttttttttttttttthhhhehehehhhhheheheheeheeeeeeeeheheheeheiririiririirirriririrririrrr ttttttttttttttrararararaaaraarrarararararaaaraaaraaaadddddddididididididddididididididddidididiiddddditttitititititiitititiitittttitiiiititiooooooooooooHHHHHHHoHoHoHoHHHHHHHoHoHHoH nenenenneennenenneyyyyy NNNoNoNNNoNoururrururiiiisisisisiisisiishihihihihihihiihihingngngngngng SSSSSSSSSSSSSSSSSSSSSSSSSSSSShhhhhahahahhhhahhhhahahaampmpmpmpmmpmpmpmpmpmpppooooooooooooooooooooo ananannnnanannnnnndddddddddddddddd BBaBaBaBaBaBaaBaaBaaaooooo

bbbbasasasassassededddddddededdde oooooonnnnnnn n n AfAfAfAfAfAfffffffriririririrr cacacacacacannnnnnnnnnn n n n haahahaaahahaaandnddndndndndcrrrcrcrrrcrcrafaffffafafafaaaafafafaaffteteteteeeeeteteeeeeeddddd d d shshshshshshs eaeaeaeaaeaeae ndndndndnnddndnnnnndddddddddddn sssssskkikikikkikkkkkikikillllllllllllllllllllllllllllsssss s ththtthththththh ttatatatataaatat hhhhhhhhavavavavavava eeeeee e bbbebebbebebebeeneneeeneenenen pppppppasasssasassasaaaasassesessseeeseseseeeeseseseeeedddddddddddd d fffffrfrfrrffrfrrrfrfromommomommooooooomoomo

gggrgrgrgrgrrrgrgrrrrggggggrrroooooowowowwwwwwwwwoowoooowoooowwooowwowwww uuuutututututtttuuututuuutttu yyyyy.y.y.yyyyyyyyyyy ”””””””””llllololoooollllllollolovvvvvveveeeeevevevv wwwwwwwwwwwwwwwwwwaaaaasaassssaaaasssa aaaaanannnnnannnnaaaaa ddd dddddrrrriririiirrririrrrrrrrr eeededddddeee ,, ,

mmmmmmmmmmppppppipiiippippiiiippiaaaaa,a,,,aaaa ttt t tttttt tttotooooootttt ssssssssssttttataaaaaattatataaataatatattaatttarrrrtrtttrrttr

hhheheeeeehheehhhhhhh rrrereeeeerer ththttththhhhhhhhhthhhthththtthe e e eeeeeeeeee

mmmmmmmememmmmmmmmememeemeeeemeeeeemembebebebebebebebeebebeebebebebeebbebebbbebbersrsrsrsrsrrsrssrrsrssrss ttttttttttttthhhhahahahaaahahahahahahaahahahah tttttttttttttttt t asaasasaaaasasasasassasasassa hhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeee e e wawawawawwwawawwwawawawawawawwww sssssssss ss grgrggggrgrgggrgrgg owowowwwowowwwowwwwwwowowowwwo iiiinininininnnininninnnninnnnnnininnnninngggggggggggggg g gg ggggggg upupupuupuupuupuupuuuuupupupuuup ll hhhhhh hhhhh “““““““ ddddd dddddd ””””””””” IIIII ’’’’’

Sustainable business is about supporting our comm unities.

WhAt rEaLlY pUmPeD mE wAs

wHeN yOu aMpEd uP oRgAnIc!

-JaNeLlE, BeLlInGhAm

Haggen loves you back! Thank you for supporting us for 81 years.

GhAm

I Haggen

Everything is good AND fresh—always! -Vivian, Ferndale

Haggen has the freshest seafood anywhere. -Greg, Woodinville

I love to see familiar faces inmy neighborhood Haggen. -JJ, Oregon City

I love the products from local ranchers and producers. -Cathleen, Mount Vernon

Haggen does so much for the community. There’s a big sense of family. -Juliana, Bellingham

Lots of non-GMO products! -Mark, Lake Stevens

The Haggen staff goes above and beyond and out of their way. -Stephanie, Bellingham

We love how open the

Wine department is. It’s

easier to shop.

-Wilma, Woodinville

I love Haggen’s bakery and the pharmacy. Awesome people work there! -Charlene, Bellingham

Haggen has everything I

need in one store.

-Diane, Lake Stevens

It’s more than just buying groceries. We see friends and neighbors shopping and working at Haggen. It’s a great feeling. -Alex, Bellingham

I love Haggen for being a good neighbor. -Mathew, Lake Stevens

Our family has used the pharmacy for years. They’re very professional. -Gary, Bellingham

©2014 Haggen, Inc. • HB