H

YCXa

b

a

ARRA

KHMTI

I

ptc(

Ciotpi2

Imb

o3f

q

0d

Immunobiology 216 (2011) 200–207

Contents lists available at ScienceDirect

Immunobiology

journa l homepage: www.e lsev ier .de / imbio

elicobacter pylori-infected macrophages induce Th17 cell differentiation

uan Zhuanga,1, Yun Shia,1, Xiao-Fei Liua, Jin-Yu Zhanga, Tao Liua, Xin Fanb, Jing Luoa,hao Wua, Shu Yua, Li Chena, Ping Luoa, Gang Guoa, Zhen Liua, Bin Tanga,u-Hu Maoa,∗, Ying Guoa, Quan-Ming Zoua,∗

Department of Clinical Microbiology and Immunology, College of Medical Laboratory Science, Third Military Medical University, Chongqing 400038, PR ChinaDepartment of Biology, West Chester University of Pennsylvania, USA

r t i c l e i n f o

rticle history:eceived 15 January 2010eceived in revised form 8 April 2010ccepted 8 May 2010

a b s t r a c t

Th17 cells represent a novel subset of CD4+ T cells, which is associated with chronic inflammation. Thepresent study evaluated Th17 cell responses to Helicobacter pylori infection in mouse model and CD4+

T cell differentiation in response to H. pylori-infected macrophages. Th17 cells were observed in the H.pylori-infected gastric tissue. Co-culture of CD4+ T cells with H. pylori-infected macrophages elevated

eywords:elicobacter pyloriacrophages

h17 cellsL-17

IL-17 and IFN-� secretion, up-regulated retinoid-related orphan receptor gamma t (ROR�t) and T boxexpressed in T cells (T-bet) expression and increased the numbers of Th17 and Th1 cells. The expressionof CD40, CD80, and CD86 and the secretion of IL-6, TGF-�1, IL-23, and CCL20 were significantly increasedin H. pylori-stimulated macrophages. NF-�B pathway participated in the production of IL-6, IL-23, andCCL20 from macrophages in response to H. pylori, and inhibition of NF-�B pathway of macrophagesresulted in less Th17 cell differentiation. Taken together, these results suggest that H. pylori induces Th17

ected

cell differentiation via inf

ntroduction

Helicobacter pylori (H. pylori) is a spiral-shaped, microaero-hillic, Gram-negative bacterium that establishes persistent infec-ion in the stomach. Colonization often remains asymptomatic butan progress into gastritis, gastric ulcers, and gastric malignanciesBruce and Maaroos 2008).

H. pylori infection is associated with a marked infiltration ofD4+ T cells into the gastric mucosa, which contributes to maintain-

ng the ongoing inflammation (Lundgren et al. 2005). The studiesf CD4+ T cell responses against H. pylori were mainly focused on

he Th1/Th2 cells for decades. Extensive studies have shown that H.ylori infection results in Th1-dominant responses, and that gastricnflammation largely depends on Th1 cell responses (Eaton et al.001; Smythies et al. 2000). The discovery of Th17 cells advanced

Abbreviations: CCL20, chemokine (CC motif) ligand 20; IFN-�, interferon-�;L, interleukin; MAPKs, mitogen activated protein kinases; PMA, phorbol 12-

yristate 13-acetate; ROR�t, retinoid-related orphan receptor gamma t; T-bet, Tox expressed in T cells; TGF-�1, transforming growth factor-�1.∗ Corresponding authors at: Department of Clinical Microbiology and Immunol-gy, College of Medical Laboratory Science, Third Military Medical University, No.0, Gaotanyan Street, Chongqing 400038, PR China. Tel.: +86 023 68752315;ax: +86 023 68752315.

E-mail addresses: eaglegying@gmail.com (Y. Guo), qmzou@mail.tmmu.com.cn,mzoutmmu@yahoo.com (Q.-M. Zou).1 These authors contributed equally to the work.

171-2985/$ – see front matter © 2010 Elsevier GmbH. All rights reserved.oi:10.1016/j.imbio.2010.05.005

macrophages.© 2010 Elsevier GmbH. All rights reserved.

our understanding of CD4+ T cell responses to H. pylori infection.These cells are characterized as preferential producers of IL-17A(also known as IL-17), IL-17F, IL-21, and IL-22. In murine systems,Th17 cell differentiation depends on the presence of IL-6, TGF-�1,and CCL20, and subsequently IL-23, which promotes Th17 cell pro-liferation. Retinoid-related orphan receptor gamma t (ROR�t) isa key regulator of Th17 cell lineage differentiation (Dong 2008).Recent studies and our previous work have suggested that Th17cell responses might play a role in the pathogenesis of H. pyloriinfection (Caruso et al. 2008; Mizuno et al. 2005; Shi et al. 2010).However, the mechanism of CD4+ T cell differentiation into Th17cells during the inflammatory response to H. pylori infection hasnot been elucidated.

Macrophages are key players in the recognition and elimina-tion of bacteria. They are involved in antigen presentation and alsorelease substances that polarize innate and adaptive immunity, forinstance in modulating of the immune response to Coxiella burnetiiand Klebsiella pneumoniae infection (Benoit et al. 2008; Kostina etal. 2005). The role of macrophages in H. pylori infection has beenwidely studied, mainly focusing on phagocytosis (Schwartz andAllen 2006; Wang et al. 2009). Other studies have indicated thatmacrophages secrete the proinflammatory cytokines IL-6 (Pathak

et al. 2006), IL-8, and TNF-� (Rizwan et al. 2008) during H. pyloriinfection. However, the role of macrophages in H. pylori-associatedTh cell responses, especially in Th cell differentiation, is not yetclear. The gastritis induced by H. pylori is characterized by theinfiltration of CD4+ T cells into the stomach, and macrophages are

obiolo

m2od

ap

M

B

bui2fmrdacu

M

tsaM1k(p

I

wsbrdb(gwJ

M

ostMpswrGsac

Y. Zhuang et al. / Immun

ediators of gastritis in H. pylori infection in mice (Kaparakis et al.008). Thus, macrophages might be important for the modulationf CD4+ T cell immune responses and the development of gastritisuring H. pylori infection.

In this study, we found Th17 cell responses to H. pylori in micend tested whether Th17 cell differentiation can be induced by H.ylori via macrophages.

aterials and methods

acteria culture

A mouse-adapted H. pylori strain CCS9803/B5 was grown onrain–heart infusion plates containing 10% rabbit blood at 37 ◦Cnder microaerophilic conditions (5% O2, 10% CO2, 85% N2). For

nfecting cells, H. pylori was washed from the culture plates withml sterile PBS. The suspended H. pylori was centrifuged at 2500 × g

or 5 min and then resuspended in Dulbecco’s modified Eagle’sedium (DMEM) (Hyclone, Logan, UT, USA). The amount of bacte-

ia suspended in DMEM was determined by measuring the opticalensity at 600 nm (1 OD600 = 1 × 109 H. pylori/ml). DMEM served asblank control. For infecting mice, H. pylori was amplified in Bru-

ella broth with 5% fetal bovine serum with gentle shaking at 37 ◦Cnder microaerobic conditions (5% O2, 10% CO2, 85% N2).

ice and infection

SPF female BALB/c mice (6–8 weeks old) were purchased fromhe Experimental Animal Center of Third Military Medicine Univer-ity. All animal experiments were approved by the Animal Ethicalnd Experimental Committee of Third Military Medical University.ice were fasted overnight and inoculated orogastrically twice at

-day intervals with H. pylori at 5 × 108 CFU/mouse. The mice wereilled on day 35 after infection according to our previous resultsShi et al. 2010). The greater curvature of the stomach was cut toerform cryostat sections.

mmunofluorescence stain for Th17 cells in gastric tissue

Paraformaldehyde-fixed cryostat sections of gastric tissuesere washed in PBS and blocked for 30 min with 20% mouse

erum-20% goat serum in PBS. Sections were incubated with rab-it anti-mouse CD4 antibody (Ab) (Uscnlife, Wuhan, China) andat anti-mouse IL-17A Ab (R&D Systems, Minneapolis, MN, USA)iluted in 5% mouse serum–goat serum overnight at 4 ◦C. Theound Ab was detected with FITC-conjugated mouse anti-rabbit AbZhongshan Biotechnology, Beijing, China) and TRITC-conjugatedoat anti-rat Ab (Zhongshan Biotechnology). Slides were examinedith a UV epifluorescence microscope (Nikon Eclipse 80i, Tokyo,

apan).

acrophage isolation and culture

Peritoneal macrophages (PM) were prepared as described previ-usly with some modifications (Ikeda et al. 2007). Briefly, mice wereacrificed by cervical dislocation, and 10 ml of ice-cold DMEM con-aining 50 �g/ml penicillin-streptomycin (Sigma–Aldrich, St. Louis,

O, USA) was injected into abdominal cavity. Medium containingeritoneal exudates cells (PEC) was recollected and transferred toterile plastic tubes (Falcon, BD Labware, USA). The suspended cellsere centrifuged at 800 × g for 5 min at 4 ◦C, and the cells were

esuspended in DMEM with 10% fetal calf serum (FCS) (Gibco-BRL,rand Island, NY, USA). The cells (5 × 106 cells/well) were theneeded into six-well culture plates (Costar, Cambridge, MA, USA)nd allowed to adhere for 2 h at 37 ◦C with 5% CO2. Non-adherentells were removed by washing the wells with sterile PBS twice, and

gy 216 (2011) 200–207 201

the remaining monolayers were PM. Cell viability was ≥90% in allexperiments. PM and the mouse macrophage cell line RAW 264.7cells (ATCC) were maintained in DMEM with 10% FCS containing50 �g/ml penicillin-streptomycin.

Stimulating macrophages with H. pylori

Macrophages were seeded in six-well culture plates (2 × 106

cells/well) and cultured in DMEM with 10% FCS containing50 �g/ml penicillin-streptomycin at 37 ◦C with 5% CO2. Beforeinfection, each well was washed twice with 1 ml of antibiotic-freecell culture medium. The bacteria were harvested, washed withPBS and then resuspended in DMEM. The bacteria were addedto the cultured cells at a multiplicity of infection (MOI) of 50.After incubation for 6 h, the cells were collected for analysis ofcytokine mRNA expression. Unstimulated cells were used as a con-trol. A six-well culture plate of macrophages (2 × 106 cells/well)were washed three times after co-culture with H. pylori for 6 h,and the culture was continued for another 24 or 48 h. The cellculture supernatants were harvested at the indicated time pointsfor detection of cytokines and chemokines production by ELISA.Macrophages co-cultured with H. pylori for 24 h were collected forsurface marker staining. For the signal pathway inhibition experi-ment, the cells (1 × 105 cells/well) were seeded in 24-well cultureplates (Costar) and pretreated with 5 �l BAY 11-7082 (a NF-�Binhibitor), U0126 (a MEK1/2 inhibitor), SB203580 (a p38 MAPKinhibitor), and SP600125 (a JNK inhibitor) (10 �M; all from Cal-biochem, San Diego, CA, USA) for 1 h. Since all inhibitors weredissolved in dimethyl sulfoxide (DMSO, Sigma–Aldrich), the cellswere also treated with DMSO (5 �l) or culture media, which servedas controls.

CD4+ T cell differentiation

Mitomycin C (100 �g/ml; Roche, Basel, Switzerland) was addedto RAW 264.7 cells (1 × 105 cells/well in 24-well culture plates)for 1 h to inhibit their proliferation. Then the cells were washedthree times with PBS. The treated RAW 264.7 cells and PM wereincubated with H. pylori for 6 h (MOI = 50). Then the gentamycin(Sigma–Aldrich) was added to kill the bacteria for 2 h, and thenthe cells were washed with PBS three times. CD4+ T cells werepurified from the spleens of uninfected mice by magnetic sortingusing a mouse CD4+ T cell negative isolation kit (Invitrogen DynalAS, Oslo, Norway). Purified CD4+ T cells (1 × 106 cells/well) wereincubated with H. pylori-infected RAW 264.7 cells and PM (1 × 105

cells/well) for 5 days in DMEM with 10% FCS at 37 ◦C with 5% CO2.RAW 264.7 cells (or PM) and CD4+ T cells co-cultured with or with-out H. pylori served as controls. The supernatants of cell culturewere collected for detecting cytokines production by ELISA. Then,1 × 106 CD4+ T cells were collected for analyzing mRNA expressionof transcription factors and 2.5 × 105 CD4+ T cells were detectedby intracellular cytokine staining. For the signal pathway inhi-bition experiment, macrophages were pretreated with 5 �l BAY11-7082 (10 �M; Calbiochem) for 1 h before co-culture with thebacteria.

ELISA

IL-17, IFN-�, IL-6, TGF-�1, IL-23 (eBioscience, San Diego, CA,

USA), and CCL20 (R&D Systems) in the culture supernatants weremeasured with ELISA kits according to the manufacturer’s instruc-tions. Assay sensitivities were 4 pg/ml for IL-17, 0.7 pg/ml for IFN-�,4 pg/ml for IL-6, 60 pg/ml for TGF-�1, 30 pg/ml for IL-23, and0.15 pg/ml for CCL20.

202 Y. Zhuang et al. / Immunobiology 216 (2011) 200–207

Table 1Primer and probe sequences for real-time PCR analysis.

Gene Primer or probe Sequence 5′ → 3′ Reference

�2-M Forward CCTGCAGAGTTAAGCATGCCAG Harrington et al. (2005)Reverse TGCTTGATCACATGTCTCGATCCProbe CAGTGTGGAAAGGCAGAAGGCAG

IL-6 Forward GAGGATACCACTCCCAACAGACC Li et al. (2005)Reverse AAGTGCATCATCGTTGTTCATACAProbe CAGAATTGCCATTGCACAACTCTTTTCTCA

TGF-�1 Forward TGACGTCACTGGAGTTGTACGG Li et al. (2006)Reverse GGTTCATGTCATGGATGGTGCProbe TTCAGCGCTCACTGCTCTTGTGACAG

IL-23p19 Forward AGCGGGACATATGAATCTACTAAGAGA Uhlig et al. (2006)Reverse GTCCTAGTAGGGAGGTGTGAAGTTGProbe CCAGTTCTGCTTGCAAAGGATCCGC

IL-23p40 Forward GACCATCACTGTCAAAGAGTTTCTAGAT Uhlig et al. (2006)Reverse AGGAAAGTCTTGTTTTTGAAATTTTTTAAProbe CCACTCACATCTGCTGCTCCACAAGAAG

T-bet Forward ACCAGAGCGGCAAGTGGG Harrington et al. (2005)Reverse TGGACATATAAGCGGTTCCCProbe CAGTGTGGAAAGGCAGAAGGCAG

ROR�t Forward CCGCTGAGAGGGCTTCAC Ivanov et al. (2006)Reverse TGCAGGAGTAGGCCACATTACAProbe AAGGGCTTCTTCCGCCGCAGCCAGCAG

GCCACAGC

N RA qu

R

r(�w(gPfiIR9pfcsps4adtpsem

I

Sp61s

CCL20 Forward GCAReverse TCA

ote. For the probes, a FAM fluorescent reporter is coupled to the 5′ end, and a TAM

NA isolation and real-time RT-PCR

Total RNA in the cells was extracted with TRIzol reagent (Invit-ogen, Carlsbad, CA, USA) and subjected to DNase treatmentPromega, Nepean, ON, Canada) for 30 min at 37 ◦C (1 unit perg of RNA). RNA samples were reversed transcribed to cDNAith ReverTra Ace (100 U) (Toyobo, Osaka, Japan) using oligo

dT) primer (Toyobo). Real-time PCR was performed on a Rotor-ene 6000 instrument (Corbett Life Science) with the RealtimeCR Master Mix (Toyobo) according to the manufacturer’s speci-cations. Previously described primers and probes were used for

L-6, TGF-�1, IL-23p19, IL-23p40, T-bet, and ROR�t (see Table 1).eal-time PCR conditions consisted of an initial denaturation at5 ◦C for 10 min, followed by 45 cycles of a two-step thermalrofile involving 10 s at 95 ◦C for denaturation and 60 s at 60 ◦Cor combined annealing and extension. Fluorescence data wereollected during the 60 ◦C step at the end of each cycle. Expres-ion of CCL20 was measured using the SYBR green method withrimers reported (see Table 1). Thermal cycling conditions con-isted of an initial denaturation at 95 ◦C for 10 min, followed by5 cycles of denaturation at 95 ◦C for 5 s, annealing at 60 ◦C for 5 snd extension at 72 ◦C for 30 s. Fluorescence data were collecteduring the 72 ◦C step at the end of each cycle. The specificity ofhe reactions was verified by melting curve analysis after com-letion of the cycling process. Mouse �2-microglobulin (�2-M)erved as the normalizer (Harrington et al. 2005). The relative genexpression was expressed as ‘fold change’ calculated by the ��Ctethod.

ntracellular cytokine staining for CD4+ T cells

Cultured CD4+ T cells were stimulated with PMA (50 ng/ml;

igma–Aldrich) and ionomycin (1 �g/ml; Sigma–Aldrich) in theresence of Golgistop (BD Pharmingen, San Diego, CA, USA) forh. Then, the cells were washed with PBS supplemented with% of FCS and resuspended at 2.5 × 105 cells in 100 �l of PBSupplemented with 1% of FCS. The cells were stained with 10 �l

GGCAGAAGCAGC Lean et al. (2002)CCTTTTCACCCAGTTC

encher is coupled to the 3′ end.

with FITC-conjugated anti-CD4 Ab (RM4-5, BD Pharmingen) (1/10dilution) in the dark for 30 min at 4 ◦C. After three washes withPBS supplemented with 1% of FCS, the cells were fixed and per-meabilized with Cytofix/Cytoperm (BD Pharmingen) in the darkfor 20 min at 4 ◦C. The cells were washed twice with 1 ml of 1×Perm/Wash solution (BD Pharmingen). Then, the cells were incu-bated in the dark for 30 min at 4 ◦C with 20 �l PE-Cy7-conjugatedanti-IFN-� (XMG1.2, BD Pharmingen) and PE-conjugated anti-IL-17(TC11-18H10, BD Pharmingen) Abs diluted 1/20 in 1× Perm/Washsolution. After washing twice with 1× Perm/Wash solution, thecells were resuspended in 300 �l of PBS supplemented with 1% ofFCS. Samples were acquired on a FACSCalibur (BD Biosciences, SanJose, CA, USA) and gated on CD4+ cells. Data were analyzed usingCellQuest Pro software (BD Biosciences). Cellular debris was elim-inated from the analysis using a gate on forward and side scatter.For each sample, 3 × 104 cells were analyzed.

Flow cytometry

The following monoclonal antibodies (mAbs) were used tostain the costimulatory surface markers on macrophages: FITC-conjugated anti-CD80 (16-10A1), PE-conjugated anti-CD40 (1C10),and PE-conjugated anti-CD86 (GL1, all from eBioscience). Culturedmacrophages (2.5 × 105 cells) in 100 �l of PBS supplemented with1% of FCS were incubated with 10 �l mAbs or isotype-matchedcontrol Abs (1/10 dilution) in the dark for 30 min at 4 ◦C. Afterthree washes with PBS supplemented with 1% of FCS, the cells werefixed with 2% paraformaldehyde in PBS. Samples were acquired ona FACSCalibur (BD Biosciences) and analyzed using CellQuest Prosoftware (BD Biosciences). Cellular debris was eliminated from theanalysis using a gate on forward and side scatter. For each sample,3 × 104 cells were analyzed.

Statistical analysis

Data are expressed as means ± SD. The statistical significanceof differences between two groups was determined by the Stu-

Y. Zhuang et al. / Immunobiology 216 (2011) 200–207 203

Fig. 1. Th17 cell responses in H. pylori-infected stomach. Gastric tissues from H.pylori-infected and uninfected mice were double immunofluorescence stained withanti-CD4 (green) (A) and anti-IL-17 antibody (red) (B), and nuclei were stained withDAPI (blue) (C). A merged figure (D) of Th17 cells was also shown. Representativessi

due

R

I

aC(p

HC

flmH2dRpl

Fig. 2. H. pylori-infected macrophages increase IL-17 and IFN-� production fromCD4+ T cells. CD4+ T cells from the spleens of uninfected mice were incubated withH. pylori-infected or non-infected RAW 264.7 cells (A) or PM (B). The levels of IL-17 and IFN-� in the supernatants on day 5 were measured by ELISA (n = 5). Resultsare expressed as mean ± SD. *p < 0.05, **p < 0.01 compared with the CD4+ T cells co-

ections from H. pylori-infected and uninfected stomach are shown. Results repre-ent three independent experiments. (For interpretation of the references to colorn this figure legend, the reader is referred to the web version of the article.)

ent t-test. For multi-group data analysis, an ANOVA analysis wassed. Differences were considered as significant when p < 0.05. Allxperiments were repeated three times.

esults

nduction of Th17 cell responses in H. pylori-infected gastric tissue

To reflect the immune response in stomach, we stained IL-17nd CD4 in gastric tissue and found that large IL-17-expressingD4+ T cells were observed in H. pylori-infected lamina propriaFig. 1), suggesting that Th17 cell infiltration was induced in H.ylori-infected stomach.

. pylori-infected macrophages increase IL-17 production fromD4+ T cells

Next, we investigated whether H. pylori-induced CD4+ T cell dif-erentiation via macrophages. First, the murine macrophage celline RAW 264.7 cells were used as APCs. There was significantly

ore IL-17 and IFN-� production by CD4+ T cells incubated with. pylori-infected RAW 264.7 cells than with non-infected RAW

64.7 cells (Fig. 2A); IFN-� production changed less than IL-17 pro-uction (Fig. 2A). In addition, little cytokine secretion was seen inAW 264.7 cells and CD4+ T cells co-cultured with or without H.ylori (controls). When the experiments were repeated using iso-ated peritoneal macrophages (PM) as APCs, the results were similar

cultured with non-infected macrophages. RAW 264.7 cells (or PM) and CD4+ T cellsco-cultured with or without H. pylori served as controls. Hp: H. pylori; RAW: RAW264.7 cells.

to those using RAW 264.7 cells: H. pylori-infected PM induced moreIL-17 and IFN-� production from CD4+ T cells than non-infected PM(Fig. 2B).

H. pylori-infected macrophages induce Th17 cell differentiation

The Th cell responses were further examined by intracellularcytokine staining. The Th17 cell responses but not the Th1 cellresponses were significantly induced by H. pylori-infected RAW264.7 cells compared with non-infected RAW 264.7 cells. BothTh17 and Th1 cell responses were significantly induced by H.pylori-infected PM, and the Th17 cell responses changed moremarkedly than the Th1 cell responses (Fig. 3A). Further, mRNAwas extracted from the co-cultured CD4+ T cells, and the mRNAsexpression of ROR�t and T-bet was measured by real-time PCR.The up-regulation of ROR�t and T-bet expression was significantlygreater in CD4+ T cells co-cultured with H. pylori-infected RAW264.7 cells or PM than with non-infected RAW 264.7 cells or PM; T-bet expression changed less than ROR�t expression (Fig. 3B). Thesedata indicate that H. pylori-infected macrophages induce significantTh17 cell differentiation, and to a lesser extend Th1 cell responsesin vitro.

H. pylori modulates the expression of surface markers onmacrophages

To analyze the antigen presentation capacity of H. pylori-

infected macrophages, we examined the effects of H. pylori on theexpression of surface markers. CD80, CD86, and CD40 expression onRAW 264.7 cells and PM was up-regulated by H. pylori stimulation(Fig. 4).

204 Y. Zhuang et al. / Immunobiology 216 (2011) 200–207

Fig. 3. H. pylori-infected macrophages induce Th17 and Th1 cell responses. CD4+

T cells from the spleens of uninfected mice were incubated with H. pylori-infectedor non-infected RAW 264.7 cells and PM for 5 days. (A) The responses of Th17 andTh1 cells were analyzed by intracellular staining. CD4+ T cells cultured with H. pyloriand CD4+ T cells alone served as controls. Cells were gated on CD4+ cells. Resultsrepresent three independent experiments. (B) The expression of ROR�t or T-bet ofccCw

Hc

cm22(a2

Fig. 4. Expression of surface markers on macrophages stimulated with H. pylori.RAW 264.7 cells or PM was cultured with H. pylori at a MOI of 50. Macrophageswere surface stained with the indicated antibodies 24 h post-infection and ana-

TR

H

o-cultured CD4+ T cells was measured by real-time PCR. Results representing foldhange are expressed as mean ± SD (n = 5). *p < 0.05, **p < 0.01 compared with theD4+ T cells co-cultured with non-infected macrophages. CD4+ T cells co-culturedith or without H. pylori served as controls. Hp: H. pylori; RAW: RAW 264.7 cells.

. pylori stimulates macrophages to secrete Th17 cell-polarizingytokines and chemokines

The production of Th17 cell-polarizing cytokines andhemokines from macrophages with H. pylori stimulation waseasured. The mRNA expression of IL-6, TGF-�1, IL-23p19, IL-

3p40, and CCL20 was significantly up-regulated in both RAW64.7 cells and PM in response to H. pylori stimulation at 6 hTable 2). The production of IL-6, TGF-�1, IL-23, and CCL20 waslso up-regulated significantly in both H. pylori-infected RAW64.7 cells and PM at 6, 24, and 48 h (Table 3).

able 2eal-time PCR analysis of the expression of IL-6, TGF-�1, IL-23p19, IL-23p40, and CCL20 i

mRNA expression (fold change) IL-6 TGF-�1

RAW (6 h) Hp 250.87 ± 11.20** 238.47 ± 55.7Control 1.62 ± 0.71 1.41 ± 0.38

PM (6 h) Hp 65.14 ± 4.21** 125.02 ± 15.0Control 1.36 ± 0.41 1.21 ± 0.23

p: H. pylori; RAW: RAW 264.7 cells.* p < 0.05, compared with the cells without H. pylori stimulation.

** p < 0.01, compared with the cells without H. pylori stimulation.

lyzed by flow cytometry. Filled curves show staining with specific antibody andunfilled curves show isotype control staining. The data represent three independentexperiments. Hp: H. pylori; RAW: RAW 264.7 cells.

Signal pathways involved in H. pylori-induced cytokines andchemokines production from macrophages

Specific signal pathway inhibitors were used to examine themechanism of H. pylori-induced secretion of Th17 cell-regulatingcytokines and chemokines. The production of IL-6 by H. pylori-stimulated RAW 264.7 cells and PM was almost completelyinhibited by BAY 11-7082 (a NF-�B inhibitor) and partially inhib-ited by SP600125 (a JNK inhibitor), but was not affected by U0126(a MEK1/2 inhibitor) or SB203580 (a p38 MAPK inhibitor) (Fig. 5).The production of IL-23 by H. pylori-stimulated RAW 264.7 cellsand PM was almost completely inhibited by NF-�B inhibitor andpartially inhibited by MEK1/2 inhibitor (Fig. 5). In addition, the up-regulation of CCL20 in H. pylori-stimulated RAW 264.7 cells andPM was completely inhibited when the cells were preincubated

with NF-�B inhibitor but not with other inhibitors (Fig. 5). In thissystem, none of these signal inhibitors appeared to affect TGF-�1production (data not shown). These findings indicate that NF-�Bpathway may be related to Th17 cell differentiation since it partici-

n H. pylori-infected macrophages.

IL-23p19 IL-23p40 CCL20

1** 9.58 ± 1.81* 6.13 ± 0.72** 5.48 ± 1.3*

1.23 ± 0.54 0.87 ± 0.18 1.38 ± 0.45

8** 5.56 ± 0.99* 7.98 ± 1.28** 18.35 ± 4.91*

0.76 ± 0.27 0.73 ± 0.35 0.54 ± 0.46

Y. Zhuang et al. / Immunobiology 216 (2011) 200–207 205

Table 3ELISA analysis of the production of IL-6, TGF-�1, IL-23, and CCL20 from H. pylori-infected macrophages.

Protein production (pg/ml) IL-6 TGF-�1 IL-23 CCL20

RAW (6 h) Hp 230.24 ± 8.06** 3671.05 ± 118.04** 340.23 ± 13.33** 19.89 ± 1.69**

Control 29.03 ± 4.98 131.84 ± 95.74 128.66 ± 13.99 1.56 ± 1.08

RAW (24 h) Hp 577.96 ± 24.49** 2475.04 ± 134.99** 417.55 ± 15.39** 20.68 ± 2.16**

Control 39.33 ± 23.89 73.87 ± 22.98 135.05 ± 18.56 1.30 ± 1.20

RAW (48 h) Hp 600.50 ± 21.27** 351.52 ± 62.43** 439.78 ± 14.89** 15.19 ± 0.39**

Control 36.38 ± 24.98 71.98 ± 18.92 155.42 ± 19.24 2.30 ± 0.20

PM (6 h) Hp 249.95 ± 20.75** 2764.52 ± 138.93** 527.58 ± 9.75** 16.69 ± 1.41**

Control 24.48 ± 6.14 457.49 ± 53.47 172.86 ± 9.75 2.39 ± 1.29

PM (24 h) Hp 447.98 ± 10.88** 2458.72 ± 97.09** 514.94 ± 12.19** 10.85 ± 1.26**

Control 8.95 ± 4.50 318.04 ± 117.96 164.41 ± 9.75 1.23 ± 0.74

1

H

pi

N

T

FH1(vaata

PM (48 h) Hp 443.12 ± 20.04**

Control 18.58 ± 8.11

p: H. pylori; RAW: RAW 264.7 cells.** p < 0.01, compared with the cells without H. pylori stimulation.

ates in the production of IL-6, IL-23, and CCL20 from macrophagesn response to H. pylori.

F-�B pathway is associated with Th17 cell differentiation

To further investigate whether NF-�B pathway participates inh17 cell differentiation, we re-examined CD4+ T cell differentia-

ig. 5. The signal pathways involved in cytokines and chemokines production by. pylori-stimulated macrophages. RAW 264.7 cells (A) or PM (B) were treated with0 �M BAY 11-7082 (a NF-�B inhibitor), U0126 (a MEK1/2 inhibitor), SB203580a p38 MAPK inhibitor), SP600125 (a JNK inhibitor), dimethyl sulfoxide (DMSO)ehicle, or culture media for 1 h, then co-cultured with H. pylori for 24 h. Cytokinesnd chemokines production in the supernatants were detected by ELISA. Resultsre expressed as mean ± SD (n = 5). *p < 0.05, **p < 0.01 compared with the DMSO-reated macrophages. There was no significance difference between DMSO-treatednd non-treated macrophages (media).

688.07 ± 110.09** 418.96 ± 6.09** 5.45 ± 0.28**

183.48 ± 132.31 151.11 ± 4.87 0.34 ± 0.20

tion in the presence of H. pylori-infected macrophages pretreatedwith NF-�B inhibitor (BAY 11-7082). In the presence of NF-�Binhibitor, IL-17 production from CD4+ T cell co-cultured with H.pylori-infected RAW 264.7 cells and PM was significantly decreased,whereas IFN-� production had no significant change (Fig. 6A). TheTh cells were further examined by intracellular cytokine staining.

The Th17 cells but not the Th1 cells were significantly decreasedby H. pylori-infected macrophages pretreated with NF-�B inhibitorcompared with non-treated macrophages (Fig. 6B). These dataindicate that NF-�B pathway participates in Th17 cell differenti-ation.

Fig. 6. NF-�B pathway is associated with Th17 cell differentiation. CD4+ T cellsfrom the spleens of uninfected mice were incubated with H. pylori-infected ornon-infected RAW 264.7 cells or PM pretreated with or without BAY 11-7082 for5 days. (A) The levels of IL-17 and IFN-� in the supernatants were measured byELISA. **p < 0.01 compared with the CD4+ T cells co-cultured with H.pylori-infectedmacrophages without BAY 11-7082. (B) Th17 and Th1 cell responses were detectedby intracellular staining. Cells were gated on CD4+ cells. Results represent threeindependent experiments. Hp: H. pylori; RAW: RAW 264.7 cells; BAY: BAY 11-7082.

2 obiolo

D

mOs2s

TbdcTttmomAcTgc

Tipsalraa

wtrutemicTIltciIftoeCfmHc

H�cpp

06 Y. Zhuang et al. / Immun

iscussion

H. pylori infection is characterized by a marked mucosal accu-ulation of CD4+ T cells (Lundgren et al. 2005; Sommer et al. 1998).ur previous results showed that H. pylori-infected mice exhibited

ignificant expression of IL-17 and IFN-� in gastric tissue (Shi et al.010). In this study, Th17 cells were detected in H. pylori-infectedtomach in BALB/c mice.

Macrophages, an important professional APC, may interact withh cells during infection and shape the adaptive immune responsesy releasing Th cell-polarizing cytokines (Benoit et al. 2008). Theifferentiation of Th cells is characterized by the expression of spe-ific cytokines and specific transcription factors. Co-culture of CD4+

cells with H. pylori-infected macrophages significantly enhanceshe secretion of IL-17 and the expression of Th17 cell-specificranscription factor ROR�t, which indicates a Th17 lineage commit-

ent (Dong 2008). The small secretion of IFN-� and the expressionf T-bet from CD4+ T cells co-cultured with H. pylori-infectedacrophages suggest a little development of Th1 cell responses.ccordingly, Th17 and Th1 cells were both detected in the co-ulture by intracellular cytokine staining. But the change level ofh17 cells was higher than that of Th1 cells. These findings sug-est that H. pylori-infected macrophages induce significant Th17ell differentiation, and to a lesser extend Th1 cell responses in vitro.

Extensive studies have focused on the role of dendritic cells onh1 cell responses against H. pylori (Hafsi et al. 2004). Recently,t has been reported that Th17 cell responses are promoted by H.ylori-infected dendritic cells (Khamri et al. 2010). In the presenttudy, Th17 cell responses were detected in H. pylori-infected micend induced by H. pylori-infected macrophages. The promotion ofocal differentiation of Th17 cells by macrophages has also beeneported in an acute inflammatory arthritis mouse model (Egan etl. 2008). These both suggested that Th17 cell differentiation maylso be initiated via macrophages.

The differentiation of Th17 cells in response to such infectionas further investigated. Efficient activation of T cells requires

hree signals: the binding of peptide–MHC complexes to T celleceptor; the costimulatory signals provided by a set of costim-latory molecules expressed by APCs; and cytokine secretion fromhe APC. In this study, we found that H. pylori up-regulated thexpression of costimulatory molecules CD80, CD86, and CD40 onacrophages. The up-regulation of these markers on macrophages

n response to H. pylori might participate in the induction of Th17ell differentiation. It has been shown that the differentiation ofh17 cells in mice is potently induced by synergistic activation byL-6 and TGF-�1, and that IL-23 plays a fundamental role in stabi-izing the phenotypic features of the Th17 lineage (Dong 2008). Inhe present study, H. pylori stimulation increased the production ofytokines such as IL-6, TGF-�1, and IL-23 from macrophages, creat-ng a cytokine milieu that facilitates the polarization of Th17 cells.n addition, the chemokines production from APC is also importantor Th cell recruitment and differentiation. Th17 cells express CCR6,he unique receptor for CCL20. Recent studies on animal modelsf rheumatoid arthritis have shown that recruitment of CCR6-xpressing Th17 cells to inflamed tissues could be mediated byCL20 (Hirota et al. 2007). In the present study, CCL20 productionrom H. pylori-stimulated macrophages was also increased, which

ight play a role in the Th17 cell differentiation. Taken together,. pylori might induce macrophages to secrete the cytokines andhemokines that regulate Th17 cell differentiation.

Our results indicate that IL-6, IL-23, and CCL20 expression by

. pylori-stimulated macrophages was mainly regulated by NF-B pathway, which was consistent with previous reports on otherells (Pathak et al. 2006; Tomimori et al. 2007). One of the MAPKathways (which consist of MEK1/2, p38 MAPK, JNK, and MEK5athways) were also found to be involved in the IL-6 (JNK pathway)

gy 216 (2011) 200–207

and IL-23 (MEK1/2 pathway) expression by macrophages stimu-lated with H. pylori. Furthermore, H. pylori-infected macrophagespretreated with NF-�B inhibitor had a weak capacity of induc-tion of Th17 cell differentiation. These findings indicate that NF-�Bpathway participates in Th17 cell differentiation possibly by regu-lating the production of IL-6, IL-23, and CCL20 from macrophages inresponse to H. pylori, and that NF-�B pathway may be the upstreampathway regulating Th17 cell differentiation.

In summary, H. pylori infection induced Th17 cell responsesin BALB/c mice and polarized mainly Th17 cell differentiation viamacrophages in vitro. Further studies are needed to investigatewhether other cells such as epithelial cells contribute to the devel-opment of Th17 cell responses. More complete understanding ofthe development, regulation, and function of Th17 cell responsesduring H. pylori infection may help to elucidate the nature of gastricdiseases induced by H. pylori.

Acknowledgements

This work was supported by grant of National Natural ScienceFoundation of China (30801044), National Basic Research Programof China (973 Program, No 2009CB522606), and Chongqing Scienceand Technology Commission (CSTC, 2007BB5034). The authors arethankful to Xin Li for technique assistant to perform FCM.

References

Benoit, M., Desnues, B., Mege, J.L., 2008. Macrophage polarization in bacterial infec-tions. J. Immunol. 181, 3733–3739.

Bruce, M.G., Maaroos, H.I., 2008. Epidemiology of Helicobacter pylori infection. Heli-cobacter 13 (Suppl. 1), 1–6.

Caruso, R., Fina, D., Paoluzi, O.A., Del Vecchio Blanco, G., Stolfi, C., Rizzo, A., Caprioli,F., Sarra, M., Andrei, F., Fantini, M.C., MacDonald, T.T., Pallone, F., Monteleone,G., 2008. IL-23-mediated regulation of IL-17 production in Helicobacter pylori-infected gastric mucosa. Eur. J. Immunol. 38, 470–478.

Dong, C., 2008. TH17 cells in development: an updated view of their molecularidentity and genetic programming. Nat. Rev. Immunol. 8, 337–348.

Eaton, K.A., Mefford, M., Thevenot, T., 2001. The role of T cell subsets and cytokinesin the pathogenesis of Helicobacter pylori gastritis in mice. J. Immunol. 166,7456–7461.

Egan, P.J., van Nieuwenhuijze, A., Campbell, I.K., Wicks, I.P., 2008. Promotion of thelocal differentiation of murine Th17 cells by synovial macrophages during acuteinflammatory arthritis. Arthritis. Rheum. 58, 3720–3729.

Hafsi, N., Voland, P., Schwendy, S., Rad, R., Reindl, W., Gerhard, M., Prinz, C., 2004.Human dendritic cells respond to Helicobacter pylori, promoting NK cell andTh1-effector responses in vitro. J. Immunol. 173, 1249–1257.

Harrington, L.E., Hatton, R.D., Mangan, P.R., Turner, H., Murphy, T.L., Murphy, K.M.,Weaver, C.T., 2005. Interleukin 17-producing CD4+ effector T cells develop viaa lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6,1123–1132.

Hirota, K., Yoshitomi, H., Hashimoto, M., Maeda, S., Teradaira, S., Sugimoto, N., Yam-aguchi, T., Nomura, T., Ito, H., Nakamura, T., Sakaguchi, N., Sakaguchi, S., 2007.Preferential recruitment of CCR6-expressing Th17 cells to inflamed joints viaCCL20 in rheumatoid arthritis and its animal model. J. Exp. Med. 204, 2803–2812.

Ikeda, Y., Murakami, A., Fujimura, Y., Tachibana, H., Yamada, K., Masuda, D., Hirano,K., Yamashita, S., Ohigashi, H., 2007. Aggregated ursolic acid, a natural triter-penoid, induces IL-1beta release from murine peritoneal macrophages: role ofCD36. J. Immunol. 178, 4854–4864.

Ivanov, I.I., McKenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua,D.J., Littman, D.R., 2006. The orphan nuclear receptor ROR gamma t directsthe differentiation program of proinflammatory IL-17+ T helper cells. Cell 126,1121–1133.

Kaparakis, M., Walduck, A.K., Price, J.D., Pedersen, J.S., van Rooijen, N., Pearse,M.J., Wijburg, O.L., Strugnell, R.A., 2008. Macrophages are mediators of gastri-tis in acute Helicobacter pylori infection in C57BL/6 mice. Infect. Immun. 76,2235–2239.

Khamri, W., Walker, M.M., Clark, P., Atherton, J.C., Thursz, M.R., Bamford, K.B., Lech-ler, R.I., Lombardi, G., 2010. Helicobacter pylori stimulates dendritic cells toinduce interleukin-17 expression from CD4+ T lymphocytes. Infect. Immun. 78,845–853.

Kostina, E., Ofek, I., Crouch, E., Friedman, R., Sirota, L., Klinger, G., Sahly, H., Keisari,Y., 2005. Noncapsulated Klebsiella pneumoniae bearing mannose-containing O

antigens is rapidly eradicated from mouse lung and triggers cytokine produc-tion by macrophages following opsonization with surfactant protein D. Infect.Immun. 73, 8282–8290.

Lean, J.M., Murphy, C., Fuller, K., Chambers, T.J., 2002. CCL9/MIP-1gamma and itsreceptor CCR1 are the major chemokine ligand/receptor species expressed byosteoclasts. J. Cell. Biochem. 87, 386–393.

obiolo

L

L

L

M

P

R

Uhlig, H.H., McKenzie, B.S., Hue, S., Thompson, C., Joyce-Shaikh, B., Stepankova, R.,

Y. Zhuang et al. / Immun

i, Y., Gerbod-Giannone, M.C., Seitz, H., Cui, D., Thorp, E., Tall, A.R., Matsushima, G.K.,Tabas, I., 2006. Cholesterol-induced apoptotic macrophages elicit an inflamma-tory response in phagocytes, which is partially attenuated by the Mer receptor.J. Biol. Chem. 281, 6707–6717.

i, Y., Schwabe, R.F., DeVries-Seimon, T., Yao, P.M., Gerbod-Giannone, M.C., Tall,A.R., Davis, R.J., Flavell, R., Brenner, D.A., Tabas, I., 2005. Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-alpha andinterleukin-6: model of NF-kappaB- and map kinase-dependent inflammationin advanced atherosclerosis. J. Biol. Chem. 280, 21763–21772.

undgren, A., Trollmo, C., Edebo, A., Svennerholm, A.M., Lundin, B.S., 2005. Helicobac-ter pylori-specific CD4+ T cells home to and accumulate in the human Helicobacterpylori-infected gastric mucosa. Infect. Immun. 73, 5612–5619.

izuno, T., Ando, T., Nobata, K., Tsuzuki, T., Maeda, O., Watanabe, O., Minami, M., Ina,K., Kusugami, K., Peek, R.M., Goto, H., 2005. Interleukin-17 levels in Helicobacterpylori-infected gastric mucosa and pathologic sequelae of colonization. World J.Gastroenterol. 11, 6305–6311.

athak, S.K., Basu, S., Bhattacharyya, A., Pathak, S., Banerjee, A., Basu, J., Kundu, M.,2006. TLR4-dependent NF-kappaB activation and mitogen- and stress-activatedprotein kinase 1-triggered phosphorylation events are central to Helicobacter

pylori peptidyl prolyl cis-, trans-isomerase (HP0175)-mediated induction of IL-6release from macrophages. J. Immunol. 177, 7950–7958.

izwan, M., Alvi, A., Ahmed, N., 2008. Novel protein antigen (JHP940) from thegenomic plasticity region of Helicobacter pylori induces tumor necrosis factoralpha and interleukin-8 secretion by human macrophages. J. Bacteriol. 190,1146–1151.

gy 216 (2011) 200–207 207

Schwartz, J.T., Allen, L.A., 2006. Role of urease in megasome formation and Helicobac-ter pylori survival in macrophages. J. Leukoc. Biol. 79, 1214–1225.

Shi, Y., Liu, X.F., Zhuang, Y., Zhang, J.Y., Liu, T., Yin, Z., Wu, C., Mao, X.H., Jia, K.R., Wang,F.J., Guo, H., Flavell, R.A., Zhao, Z., Liu, K.Y., Xiao, B., Guo, Y., Zhang, W.J., Zhou, W.Y.,Guo, G., Zou, Q.M., 2010. Helicobacter pylori-induced Th17 responses modulateTh1 cell responses, benefit bacterial growth and contribute to pathology in mice.J. Immunol. 184, 5121–5129.

Smythies, L.E., Waites, K.B., Lindsey, J.R., Harris, P.R., Ghiara, P., Smith, P.D., 2000.Helicobacter pylori-induced mucosal inflammation is Th1 mediated and exac-erbated in IL-4, but not IFN-gamma, gene-deficient mice. J. Immunol. 165,1022–1029.

Sommer, F., Faller, G., Konturek, P., Kirchner, T., Hahn, E.G., Zeus, J., Rollinghoff,M., Lohoff, M., 1998. Antrum- and corpus mucosa-infiltrating CD4+ lympho-cytes in Helicobacter pylori gastritis display a Th1 phenotype. Infect. Immun. 66,5543–5546.

Tomimori, K., Uema, E., Teruya, H., Ishikawa, C., Okudaira, T., Senba, M., Yamamoto,K., Matsuyama, T., Kinjo, F., Fujita, J., Mori, N., 2007. Helicobacter pylori inducesCCL20 expression. Infect. Immun. 75, 5223–5232.

Robinson, N., Buonocore, S., Tlaskalova-Hogenova, H., Cua, D.J., Powrie, F., 2006.Differential activity of IL-12 and IL-23 in mucosal and systemic innate immunepathology. Immunity 25, 309–318.

Wang, Y.H., Wu, J.J., Lei, H.Y., 2009. The autophagic induction in Helicobacter pylori-infected macrophage. Exp. Biol. Med. (Maywood) 234, 171–180.