home | molecular cancer therapeutics · web viewthe immunoprecipitation starter pack (ge healthcare...
TRANSCRIPT
Supplementary Materials and Methods
Cell Proliferation Assay
Cell proliferation was measured using the CellTiter 96 AQueous Non-Radioactive Cell
Proliferation (MTS) Assay kit (Promega, Madison, WI), or Cell Counting Kit-8 (CCK-8; Dojindo
Molecular Technologies, Inc., Rockville, MD), according to the manufacturers’ instructions. For cell
number counting, a Cellometer Auto 2000 Cell Viability Counter (Nexcelom, Lawrence, MA) was
used. To evaluate the interaction between bromocriptine and docetaxel, cell viability results were
calculated for the combination index (CI) using the CompuSyn program (ComboSyn Incorporated).
Cell Cycle and Apoptosis Analyses
For cell cycle analysis, cells were serum-starved overnight and treated for 48h with bromocriptine
at the indicated concentrations. PI staining was performed prior to flow cytometry with FACSCanto II
flow cytometer (BD Biosciences, Bedford, MA). For apoptosis analysis, cells were stained with an
APC Annexin V Apoptosis Detection Kit (BioLegend, San Diego, CA) and measured by flow
cytometry. The data were analyzed using FlowJo software (Tree Star, Inc., Ashland, OR).
Gene Transfer
For DRD2 overexpression, 2 x 106 C4-2 cells were seeded on 6-cm plates overnight, then
transfected with pcDNA-GFP-DRD2 (Addgene, Cambridge, MA) or control plasmid using
Lipofectamine™ 2000 following the manufacturer’s instruction (Thermo Fisher Scientific, Waltham,
MA). For DRD2 depletion, a DRD2-specific short hairpin sequence (shDRD2, 5’-
CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTTG - 3’)
and its scramble control (shControl) were cloned into pLKO.1 vector (Addgene), then co-transfected
with pCMV-dR8.2 and pMD2.G (addgene) into 293FT cells to generate lentivirus, which were used to
infect LNCaP cells for further puromycin selection.
Quantitative PCR
Total RNA was prepared with Qiagen RNeasy Kit (Valencia, CA). The first-strand cDNA was
synthesized using SuperScript® III First-Strand Synthesis System (Life Technologies). Quantitative
PCR was performed by the Stratagene Mx3005P system (Agilent technologies) using a Brilliant®
SYBR® Green QPCR Master Mix (Stratagene, Santa Clara, CA) according to the manufacturer's
instructions. The primers used in this study are listed in Table S2.
Western Blot Analysis
Total cell lysates were prepared using radioimmunoprecipitation (RIPA) buffer. Immunoblotting
analysis followed a standard procedure. Antibodies used in Western blotting are listed in Table S1.
Protein Half-Life Determination
C4-2 cells were incubated with CHX (50 μg/ml) for 1 h to inhibit further protein synthesis, and
then treated with DMSO, bromocriptine, or sulpiride first (1 h) and bromocriptine second, for 2, 4, and
6 h. Cells were harvested and lysed, and Western blotting was performed using an AR antibody. The
desired protein bands from the Western blots were quantitated and normalized by the intensity of the
corresponding tubulin controls using the ImageJ program, and the data were graphed using the
SigmaPlot program (Systat Software Inc., San Jose, CA). The protein degradation rate is expressed as
half-life (T½), the time for degradation of 50% of the protein, which is determined by an exponential
decay fitting algorithm.
Immunoprecipitation
The Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was
used according to the manufacturer's instructions. Antibodies used in the IP experiments are listed in
Table S1. The samples were further processed for western blot analysis.
Supplementary Tables
Table S1. Antibodies used in Western Blotting, Immunoprecipitation and IHC studies
Antibody Catalog Number Source-Actin #4970 Cell Signaling Technology (Danvers, MA)Akt #9272 Cell Signaling Technologyp-Akt (Ser473) #4060 Cell Signaling TechnologyAR (441) for IP) sc-7305 Santa Cruz BiotechnologyAR (N-20) (for immunoblot and IHC)
sc-816 Santa Cruz Biotechnology
p-AR(Ser650) PA5-37479 Life TechnologiesCaspase-3 #9662 Cell Signaling TechnologyCD31 ab28364 Abcam (Cambridge, MA)c-Myc sc-40 Santa Cruz BiotechnologyCREB-1 sc-240 Santa Cruz Biotechnologyp-CREB (Ser133) #9198 Cell SignalingD2DR sc-5303 Santa Cruz BiotechnologyE2F-1 sc-56661 Santa Cruz BiotechnologyERK1/2 sc-135900 Santa Cruz Biotechnologyp-ERK1/2 sc-7383 Santa Cruz BiotechnologyGFP sc-9996 Santa Cruz BiotechnologyHsp90α/β sc-13119 Santa Cruz BiotechnologyMDM2 sc-965 Santa Cruz Biotechnologyp-MDM2(Ser166) #3521 Cell Signaling TechnologyNormal IgG sc-2025 Santa Cruz Biotechnologyp21 #556430 BD Medical Technologyp27 Kip1 #2552 Cell Signaling Technologyp53 sc-126 Santa Cruz BiotechnologyPARP #9542 Cell Signaling TechnologyUbiquitin BML-PW8810 Enzo Life Sciences, Inc (Ann Arbor, MI)SKP2 32-3300 Life TechnologiesStat3 #4904 Cell Signaling Technologyp-Stat3(Ser727) #9134 Cell Signaling TechnologySurvivin NB500-201 Novus Biologicals (Littleton, CO)-Tubulin sc-5286 Santa Cruz BiotechnologyVEGF sc-7269 Santa Cruz Biotechnology
Table S2. Sequences of primers used for real-time PCR analysis
Gene Forward Primer Reverse PrimerAR CCTGGCTTCCGCAACTTACAC GGACTTGTGCATGCGGTACTCASurvivin TGCCCCGACGTTGCC CAGTTCTTGAATGTAGAGATGCGGTGAPDH CGAGATCCCTCCAAAATCAA TTCACACCCATGACGAACAT
Table S3. Combination index (CI) of bromocriptine and docetaxel treatment in C4-2 cells
Combination: Bromocriptine first, docetaxel secondDocetaxel (nM) Bromocriptine (µM) Effect CI0.2 2.5 0.26178 0.897230.2 5.0 0.36706 0.930270.2 10.0 0.49386 0.939530.4 2.5 0.28846 0.819620.4 5.0 0.40228 0.811730.4 10.0 0.49386 0.969310.8 2.5 0.31638 0.806340.8 5.0 0.44531 0.722990.8 10.0 0.54437 0.803491.6 2.5 0.33345 0.940001.6 5.0 0.48391 0.724641.6 10.0 0.55291 0.869153.2 2.5 0.41348 0.961853.2 5.0 0.50560 0.887483.2 10.0 0.55575 1.05312
Combination: Docetaxel first, bromocriptine secondDocetaxel (nM) Bromocriptine (µM) Effect CI0.2 2.5 0.13778 1.217920.2 5.0 0.37931 0.769260.2 10.0 0.44054 1.165900.4 2.5 0.18087 1.269890.4 5.0 0.41616 0.811550.4 10.0 0.47711 1.150450.8 2.5 0.29766 1.151750.8 5.0 0.51212 0.793230.8 10.0 0.56301 1.051221.6 2.5 0.54330 0.857241.6 5.0 0.67711 0.685631.6 10.0 0.71779 0.820603.2 2.5 0.71566 0.849543.2 5.0 0.84819 0.523213.2 10.0 0.87201 0.56255
Supplementary Figure Legends
Figure S1. Quantitative PCR analysis of mRNA expression of AR and survivin in C4-2 cells
treated with varying concentrations of bromocriptine (24 h).
Figure S2. Body weights of athymic nude mice bearing C4-2-Luc tumors and treated with the
vehicle control, docetaxel, bromocriptine and the combination. *: p < 0.05.
Figure S3. Western blot analysis of p-AR (Ser650) expression in C4-2 cells treated with
bromocriptine for varying times.