home | molecular cancer therapeutics · web viewthe immunoprecipitation starter pack (ge healthcare...

13
Supplementary Materials and Methods Cell Proliferation Assay Cell proliferation was measured using the CellTiter 96 AQueous Non-Radioactive Cell Proliferation (MTS) Assay kit (Promega, Madison, WI), or Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Rockville, MD), according to the manufacturers’ instructions. For cell number counting, a Cellometer Auto 2000 Cell Viability Counter (Nexcelom, Lawrence, MA) was used. To evaluate the interaction between bromocriptine and docetaxel, cell viability results were calculated for the combination index (CI) using the CompuSyn program (ComboSyn Incorporated). Cell Cycle and Apoptosis Analyses For cell cycle analysis, cells were serum-starved overnight and treated for 48h with bromocriptine at the indicated concentrations. PI staining was performed prior to flow cytometry with FACSCanto II flow cytometer (BD Biosciences, Bedford, MA). For apoptosis analysis, cells were stained with an APC Annexin V Apoptosis Detection Kit (BioLegend, San Diego, CA) and measured by flow cytometry. The data were analyzed using FlowJo software (Tree Star, Inc., Ashland, OR). Gene Transfer

Upload: others

Post on 11-Nov-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Supplementary Materials and Methods

Cell Proliferation Assay

Cell proliferation was measured using the CellTiter 96 AQueous Non-Radioactive Cell

Proliferation (MTS) Assay kit (Promega, Madison, WI), or Cell Counting Kit-8 (CCK-8; Dojindo

Molecular Technologies, Inc., Rockville, MD), according to the manufacturers’ instructions. For cell

number counting, a Cellometer Auto 2000 Cell Viability Counter (Nexcelom, Lawrence, MA) was

used.  To evaluate the interaction between bromocriptine and docetaxel, cell viability results were

calculated for the combination index (CI) using the CompuSyn program (ComboSyn Incorporated).

Cell Cycle and Apoptosis Analyses

For cell cycle analysis, cells were serum-starved overnight and treated for 48h with bromocriptine

at the indicated concentrations. PI staining was performed prior to flow cytometry with FACSCanto II

flow cytometer (BD Biosciences, Bedford, MA). For apoptosis analysis, cells were stained with an

APC Annexin V Apoptosis Detection Kit (BioLegend, San Diego, CA) and measured by flow

cytometry. The data were analyzed using FlowJo software (Tree Star, Inc., Ashland, OR).

Gene Transfer

For DRD2 overexpression, 2 x 106 C4-2 cells were seeded on 6-cm plates overnight, then

transfected with pcDNA-GFP-DRD2 (Addgene, Cambridge, MA) or control plasmid using

Lipofectamine™ 2000 following the manufacturer’s instruction (Thermo Fisher Scientific, Waltham,

MA). For DRD2 depletion, a DRD2-specific short hairpin sequence (shDRD2, 5’-

CCGGCACCACCTTCAACATTGAGTTCTCGAGAACTCAATGTTGAAGGTGGTGTTTTTG - 3’)

and its scramble control (shControl) were cloned into pLKO.1 vector (Addgene), then co-transfected

with pCMV-dR8.2 and pMD2.G (addgene) into 293FT cells to generate lentivirus, which were used to

infect LNCaP cells for further puromycin selection.

Quantitative PCR

Page 2: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Total RNA was prepared with Qiagen RNeasy Kit (Valencia, CA). The first-strand cDNA was

synthesized using SuperScript® III First-Strand Synthesis System (Life Technologies). Quantitative

PCR was performed by the Stratagene Mx3005P system (Agilent technologies) using a Brilliant®

SYBR® Green QPCR Master Mix (Stratagene, Santa Clara, CA) according to the manufacturer's

instructions. The primers used in this study are listed in Table S2.

Western Blot Analysis

Total cell lysates were prepared using radioimmunoprecipitation (RIPA) buffer. Immunoblotting

analysis followed a standard procedure. Antibodies used in Western blotting are listed in Table S1.

Protein Half-Life Determination

C4-2 cells were incubated with CHX (50 μg/ml) for 1 h to inhibit further protein synthesis, and

then treated with DMSO, bromocriptine, or sulpiride first (1 h) and bromocriptine second, for 2, 4, and

6 h. Cells were harvested and lysed, and Western blotting was performed using an AR antibody. The

desired protein bands from the Western blots were quantitated and normalized by the intensity of the

corresponding tubulin controls using the ImageJ program, and the data were graphed using the

SigmaPlot program (Systat Software Inc., San Jose, CA). The protein degradation rate is expressed as

half-life (T½), the time for degradation of 50% of the protein, which is determined by an exponential

decay fitting algorithm.

Immunoprecipitation

The Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was

used according to the manufacturer's instructions. Antibodies used in the IP experiments are listed in

Table S1. The samples were further processed for western blot analysis.

Page 3: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Supplementary Tables

Table S1. Antibodies used in Western Blotting, Immunoprecipitation and IHC studies

Antibody Catalog Number Source-Actin #4970 Cell Signaling Technology (Danvers, MA)Akt #9272 Cell Signaling Technologyp-Akt (Ser473) #4060 Cell Signaling TechnologyAR (441) for IP) sc-7305 Santa Cruz BiotechnologyAR (N-20) (for immunoblot and IHC)

sc-816 Santa Cruz Biotechnology

p-AR(Ser650) PA5-37479 Life TechnologiesCaspase-3 #9662 Cell Signaling TechnologyCD31 ab28364 Abcam (Cambridge, MA)c-Myc sc-40 Santa Cruz BiotechnologyCREB-1 sc-240 Santa Cruz Biotechnologyp-CREB (Ser133) #9198 Cell SignalingD2DR sc-5303 Santa Cruz BiotechnologyE2F-1 sc-56661 Santa Cruz BiotechnologyERK1/2 sc-135900 Santa Cruz Biotechnologyp-ERK1/2 sc-7383 Santa Cruz BiotechnologyGFP sc-9996 Santa Cruz BiotechnologyHsp90α/β sc-13119 Santa Cruz BiotechnologyMDM2 sc-965 Santa Cruz Biotechnologyp-MDM2(Ser166) #3521 Cell Signaling TechnologyNormal IgG sc-2025 Santa Cruz Biotechnologyp21 #556430 BD Medical Technologyp27 Kip1 #2552 Cell Signaling Technologyp53 sc-126 Santa Cruz BiotechnologyPARP #9542 Cell Signaling TechnologyUbiquitin BML-PW8810 Enzo Life Sciences, Inc (Ann Arbor, MI)SKP2 32-3300 Life TechnologiesStat3 #4904 Cell Signaling Technologyp-Stat3(Ser727) #9134 Cell Signaling TechnologySurvivin NB500-201 Novus Biologicals (Littleton, CO)-Tubulin sc-5286 Santa Cruz BiotechnologyVEGF sc-7269 Santa Cruz Biotechnology

Page 4: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Table S2. Sequences of primers used for real-time PCR analysis

Gene Forward Primer Reverse PrimerAR CCTGGCTTCCGCAACTTACAC GGACTTGTGCATGCGGTACTCASurvivin TGCCCCGACGTTGCC CAGTTCTTGAATGTAGAGATGCGGTGAPDH CGAGATCCCTCCAAAATCAA TTCACACCCATGACGAACAT

Page 5: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Table S3. Combination index (CI) of bromocriptine and docetaxel treatment in C4-2 cells

Combination: Bromocriptine first, docetaxel secondDocetaxel (nM) Bromocriptine (µM) Effect CI0.2      2.5      0.26178      0.897230.2      5.0      0.36706      0.930270.2      10.0      0.49386      0.939530.4      2.5      0.28846      0.819620.4      5.0      0.40228      0.811730.4      10.0      0.49386      0.969310.8      2.5      0.31638      0.806340.8      5.0      0.44531      0.722990.8      10.0      0.54437      0.803491.6      2.5      0.33345      0.940001.6      5.0      0.48391      0.724641.6      10.0      0.55291      0.869153.2      2.5      0.41348      0.961853.2      5.0      0.50560      0.887483.2      10.0      0.55575      1.05312

Combination: Docetaxel first, bromocriptine secondDocetaxel (nM) Bromocriptine (µM) Effect CI0.2      2.5      0.13778      1.217920.2      5.0      0.37931      0.769260.2      10.0      0.44054      1.165900.4      2.5      0.18087      1.269890.4      5.0      0.41616      0.811550.4      10.0      0.47711      1.150450.8      2.5      0.29766      1.151750.8      5.0      0.51212      0.793230.8      10.0      0.56301      1.051221.6      2.5      0.54330      0.857241.6      5.0      0.67711      0.685631.6      10.0      0.71779      0.820603.2      2.5      0.71566      0.849543.2      5.0      0.84819      0.523213.2      10.0      0.87201      0.56255

Page 6: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions

Supplementary Figure Legends

Figure S1. Quantitative PCR analysis of mRNA expression of AR and survivin in C4-2 cells

treated with varying concentrations of bromocriptine (24 h).

Figure S2. Body weights of athymic nude mice bearing C4-2-Luc tumors and treated with the

vehicle control, docetaxel, bromocriptine and the combination. *: p < 0.05.

Figure S3. Western blot analysis of p-AR (Ser650) expression in C4-2 cells treated with

bromocriptine for varying times.

Page 7: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions
Page 8: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions
Page 9: Home | Molecular Cancer Therapeutics · Web viewThe Immunoprecipitation Starter Pack (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) was used according to the manufacturer's instructions