hum. mol. genet.-2012-gröger-1025-36

8/13/2019 Hum. Mol. Genet.-2012-Grger-1025-36

1/12

Targeted mutation of SLC4A5 induces arterialhypertension and renal metabolic acidosis

Nicole Groger1

, Helga Vitzthum2

, Henning Frohlich1,{

, Marcus Kruger1

, Heimo Ehmke2

,Thomas Braun1,{ and Thomas Boettger1,,{

1Department of Cardiac Development and Remodelling, Max Planck Institute for Heart and Lung Research,

Ludwigstrasse 43, D-61231 Bad Nauheim, Germany and 2Institut fur Zellulare und Integrative Physiologie,

Universitatsklinikum Hamburg-Eppendorf, Martinistrae 52, 20246 Hamburg, Germany

Received October 26, 2011; Revised and Accepted November 8, 2011

The human SLC4A5gene has been identified as a hypertension susceptibility gene based on the associationof single nucleotide polymorphisms with blood pressure (BP) levels and hypertension status. The biochem-ical basis of this association is unknown particularly since no single gene variant was linked to hypertension

in humans. SLC4A5 (NBCe2, NBC4) is expressed in the collecting duct of the kidney and acts as an electro-genic ion-transporter that transports sodium and bicarbonate with a 1:2 or 1:3 stoichiometry allowing bicar-

bonate reabsorption with relatively minor concurrent sodium uptake. We have mutated the Slc4a5gene inmice, which caused a persistent increase in systolic and diastolic BP. Slc4a5mutant mice also displayeda compensated metabolic acidosis and hyporeninemic hypoaldosteronism. Analysis of kidney physiology

revealed elevated fluid intake and urine excretion and increased glomerular filtration rate. Transcriptome ana-

lysis uncovers possible compensatory mechanisms induced by SLC4A5 mutation, including upregulation ofSLC4A7 and pendrin as well as molecular mechanisms associated with hypertension. Induction of metabolicalkalosis eliminated the BP difference between wild-type and Slc4a5mutant mice. We conclude that theimpairment of the function of SLC4A5 favors development of a hypertensive state. We reason that the loss

of sodium-sparing bicarbonate reabsorption by SLC4A5 initiates a regulatory cascade consisting of compen-

satory bicarbonate reabsorption via other sodium-bicarbonate transporters (e.g. SLC4A7) at the expense of

an increased sodium uptake. This will ultimately raise BP and cause hypoaldosteronism, thus providing amechanistic explanation for the linkage of the SLC4A5 locus to hypertension in humans.

INTRODUCTION

A fine-tuned interaction of a multitude of transport processesin the kidney is mandatory for the normal regulation of thewater and electrolyte homeostasis of an organism. Dysregula-tion of transport processes in the kidney can lead to severeelectrolyte and acid-base disorders and can cause hypo- orhypertension. The Slc4 family of anion exchangers andsodium-bicarbonate transporters is involved in many essential

transport processes. Slc4 ion-transporters mediate uptake orsecretion of bicarbonate and sodium from cells depending ongradients of transported ions and on the stoichiometry of thetransport. In the kidney, the NBC4/NBCe2-related NBCe1encoded by the Slc4a4 gene has a Na+:HCO3

2 stoichiometry

of 1:3 and mediates the efflux of sodium/bicarbonate at thebasolateral membrane of proximal tubule cells essential forbicarbonate absorption of the proximal tubule (1). Loss ofthis related transporter leads to severe proximal renal metabol-ic acidosis associated with growth and mental retardation aswell as ocular and dental defects caused by defective bicar-bonate transport in humans or mice (2,3). In other cell types,NBCe1 has a different transport stoichiometry and hence canmediate the net influx of bicarbonate into cells. NBCe2, also

referred to as NBC4, is encoded by the Slc4a5 gene. NBCe2mediates electrogenic transport of sodium and bicarbonate,with 1:3 or 1:2 stoichiometry depending on the cell type(46). It has been shown that NBCe2 is located in theapical membranes of cells of the collecting duct (CD) of the

Present address: Institut fur Humangenetik, Im Neuenheimer Feld 366, 69120 Heidelberg, Germany.The authors wish it to be known that, in their opinion, the last two authors should be regarded as joint Senior Authors.

To whom correspondence should be addressed. Tel: +49 60327051115; Fax: +49 60327051104; Email: [email protected]

# The Author 2011. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

Human Molecular Genetics, 2012, Vol. 21, No. 5 10251036doi:10.1093/hmg/ddr533

Advance Access published on November 14, 2011


2/12

kidney (7). Polymorphisms in the SLC4A5gene locus are gen-etically linked to hypertension, although no clear correlationbetween specific mutations and hypertension was found(8,9). Yet, expression and functional properties of NBCe2 inthe CD are compatible with a function in bicarbonate andsodium uptake from the lumen of the CD, which clearly hasan impact on the control of blood pressure (BP).

Here, we show that NBCe2 regulates the bicarbonatehomeostasis of the animal by mediating net influx of bicarbon-ate into cells of the CD duct of the kidney. Mutation ofNBCe2in mice leads to arterial hypertension and renal metabolic acid-osis associated with hyporeninemic hypoaldosteronism, ele-vated fluid intake and excretion and an increased glomerularfiltration rate (GFR). We demonstrate that the urinary loss ofbicarbonate and the resulting metabolic acidosis are tightlylinked to the observed arterial hypertension. Treatment ofmetabolic acidosis in NBCe2 mutant mice also eliminatesthe difference in BP between Slc4a5mutant animals and wild-type (WT), indicating that the elevated BP is caused by thedisturbed bicarbonate reabsorption.

RESULTS

We have generated a mouse model with mutation ofSlc4a5by deletion of the seventh coding exon (Slc4a57/7;ENSMUST00000039212; Fig. 1A). This deletion leads to aloss of an N-terminal part of the protein and truncation ofthe protein due to a frameshift in the open reading frame ofthe transcript before the putative first transmembrane domainof the NCBe2 protein (10,11). Our strategy avoided deletionof exons that might be subject to alternative splicing and pre-vents use of alternative start codons. Analysis of the regionfrom exon 6 to exon 8 in WT animals by reverse transcription

polymerase chain reaction (RT PCR) (Fig.1D) yielded onlyone single band indicating the absence of alternative splicingevents in this region of the transcript. Deletion of exon 7 inmutant animals generated a shortened transcript as revealedby RT PCR as predicted from sequence data (Fig. 1D).Sequencing of the PCR products additionally confirmed theexpected molecular changes (Supplementary Material,Fig. S1). Loss of the NBCe2 protein in Slc4a5 mutant micewas confirmed using a quantitative mass-spectroscopy-basedproteomic approach (SILAC-MS) (12,13). Protein extracts ofchoroid plexus of WT or Slc4a5

7/7 animals were mixed1:1 with choroid plexus extract of a 13C6-lysine labeledmouse (heavy mouse) as an internal reference. In the WT/

WTheavy protein mix, unlabeled and heavy peptides ofNBCe2 were equally detected, whereas in the Slc4a57/7/WTheavymix, only the reference heavy peptides were detected,indicating the loss of NBCe2 in the mutant animals (Fig. 1Eand F; Supplementary Material, Fig. S2A D). The peptideVEEGGERWSK (Supplementary Material, Fig. S2A and B)is located in the N-terminal part of the NBCe2 proteinupstream of the deletion site. Both versions of this peptide(unlabeled/heavy) were detected in the WT/WTheavy mix. Inthe Slc4a5

7/7/WTheavy mix, only the heavy peptide wasdetected, suggesting that also the N-terminal part of theNBCe2 protein is actually lost in the Slc4a5

7/7 animals.All subsequent experiments were carried out using adult

male mice with a mixed 129SV/C57Bl6 background. In allexperiments, Slc4a5

7/7 and WT mice were littermates orage-matched animals originating from comparable matingsof heterozygous parents.

Expression ofSlc4a5 was detected by in situ hybridizationemploying two independent 35S labeled probes (Fig. 2AD,Supplementary Material, Figs S3 and S4) as well as by non-

radioactive in situ hybridization combined with antibodystaining (Fig. 2E L). Strong Slc4a5 signals were found inthe medulla of the kidney, while expression in the cortexwas scattered and less intense (Fig. 2A; Supplementary Ma-terial, Fig. S3E). Comparative in situ hybridization ofSlc4a5and of markers of other tubule segments or cell typesrevealed similarities in the expression of Slc4a5 withaquaporin-2 (Fig. 2B), which is expressed in the CDs(14,15). No similarity could be observed with the expressionpattern of aquaporin-1 (Fig. 2C) expressed in the proximaltubule and thin descending limb (16,17) or with the tammhorsfall/uromodulin transcript (Fig. 2D) expressed in thethick ascending limb (18). Likewise, non-radioactive in

situ hybridization detected Slc4a5 at the cellular level in

tubules of the kidney cortex (Fig. 2E G) and the innermedulla (Fig. 2I K) in tubule segments negative for themarker of the proximal tubule aquaporin-1 (Fig. 2E and I),but co-expressed with the CD marker aquaporin-2 (Fig. 2F,H, J, L). These results are in accordance with thedetection of NBCe2 in the apical plasma membrane ofcells of the CD in the human and rat kidney (7). In addition,we detected Slc4a5 expression in the choroid plexus of thebrain (Supplementary Material, Fig. S4A and B, arrow)and in the thyroid (Supplementary Material, Fig. S4A andC, arrowhead).

Slc4a57/7 mice were characterized by a normal prenatal

development, normal weight gain (Supplementary Material,

Figure 1.Targeted mutation of the Slc4a5gene. (A) To mutate theSlc4a5gene, the seventh coding exon (ENSMUST00000039212) was removed leading to anN-terminal deletion of the protein and to a frameshift resulting in truncation of the protein before the first transmembrane domain of the ion-transport protein. AsingleloxP site was inserted in front of the seventh coding exon and a loxP-flanked neoR cassette was inserted behind the seventh coding exon ofSlc4a5. Afterhomologous recombination in ES cells, we generated mice with a floxed allele ofSlc4a5 (Slc4a5

lox). (B) Recombination of theSlc4a5locus was detected using a

southern blot with a 5 probe andBamHI digest. The mutant allele ofSlc4a5 (Slc4a57

) was recovered afterC re-recombination. (C) Southern blot analysisemploying a 5 probe and a BlpI digest was used to identify the mutant allele. (D) Reverse transcription polymerase chain reaction (RTPCR) amplifies theSlc4a5 transcript from the sixth to eighth coding exon; in the Slc4a5

7/7 animals, only the predicted smaller transcript without coding exon 7 is amplified.(EH) Quantitative mass-spectroscopy demonstrates the absence of the NBCe2 protein in Slc4a5

7/7 animals. Choroid plexus protein extracts of WT andSlc4a57/7 animals were mixed with choroid plexus protein extracts of a 13C6-lysin labeled mouse (heavy mouse) as a reference. Introduction of a13

C6-lysine in a peptide induced a 6 Da shift in the molecular mass of the peptide and two 13

C6-lysines lead to a 12 Da shift. In the WT/WTheavy mix, (E)the respective unlabeled () and labeled heavy (#) SLC4A5-specific peptides were equally detected. In the Slc4a57/7/WTheavy mix, (F) the heavy

peptide (#) was detected, whereas the unlabeled peptide () was not detected for theSlc4a57/7 animal. For further reference, respective peptide pairs belongingto aquaporin-1 protein with unchanged abundance are shown (WT/WTheavy: G; Slc4a5

7/7/WTheavy: H).

1026 Human Molecular Genetics, 2012, Vol. 21, No. 5
http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1


3/12

Human Molecular Genetics, 2012, Vol. 21, No. 5 1027


4/12

Fig. S5), adult weight (Slc4a57/7: 26.5+0.7, WT: 25.4+

0.6 g,n 21/23,P 0.129, 10 weeks old) and food consump-tion (Slc4a5

7/7: 4.4+0.2, WT: 4.3+0.2 g/day,n 21/23,P 0.359), suggesting the lack of a major dysfunction of thethyroid in Slc4a5

7/7 mice. Further examination of thethyroid morphology in 7-month-old animals (Supplementary

Material, Fig. S6A and B) and normal T4 serum level(Slc4a5

7/7: 4.2+0.2, WT: 3.9+0.2 mg/dl, n 23/20,P 0.176, Supplementary Material, Fig. S6C) ruled out thatthe mutation of NBCe2 had a major effect on thyroid function.To analyze a potential physiological role of NCBe2 in thechoroid plexus, we compared the ventricular volumes of

Figure 2.Slc4a5is expressed in the inner medulla and the outer cortex of the kidney.Slc4a5expression (A) is detected by in situhybridization using35

S-labeled

probes (A D) and Affymetrix QuantiGene ViewRNA technology combined with antibody staining ( EL). In the kidney, Slc4a5 expression is predominantlydetected in the inner medulla and the outer cortex (A). This expression resembles strongly the expression of aquaporin-2 (B; a marker of the CD), but is differentfrom the expression of aquaporin-1 (C; marker of proximal tubule and thin descending limb) and uromodulin (D; marker of thick ascending limb). The Quanti-Gene probe set also detectsSlc4a5RNA (red) in the kidney cortex (EG) and the inner medulla (IK) in tubule segments that are negative for aquaporin-1 (E, I,green) expression. However, expression ofSlc4a5RNA (F, G, J, K, red) is detected in tubule segments that are characterized by expression of aquaporin-2 (F, H,J, L, green). Nuclei are stained in blue. The scale bar in (A) corresponds to 3300mm in (AD) and to 52 mm in (EL).

http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1


5/12

adult Slc4a57/7 and WT brains by magnetic resonanceimaging (MRI). No difference in the volume of the ventricleswas found (Supplementary Material, Table S7), indicatingthat NBCe2 does not have a major function in fluid secretionof the choroid plexus. These data are in contrast to thereduced brain ventricle volume in a recent description of agene-trap mutant ofSlc4a5 and may be due to differencesin the gene targeting strategies, with the gene-trap insertionresulting in a potentially dominant negative SLC4A5protein of 69 kDa still containing several of the predictedtransmembrane domains (19).

Given the potential role ofSLC4A5 in human hypertension,we next examined a potential function of Slc4a5 in thekidney. Close scrutiny of the renal physiology using metabol-ic cages revealed an increased urinary volume in Slc4a57/7

mice compared with WT animals (Slc4a57/7: 0.068+0.005, WT: 0.054+0.004 ml/day g BW, n 27/29, P 0.0146; Fig.3A). Also the absolute amount of daily urine ex-cretion per animal was significantly increased (Slc4a57/7:1.8+0.13, WT: 1.4+0.1 ml/day, n 29/27, P 0.006).Accordingly, mutant mice compared with WT miceconsume more water as determined by daily weighting of

Figure 3.Metabolic acidosis and increased BP in Slc4a5mutant mice.Slc4a57/7 (filled bars) compared with WT mice (open bars) excrete more urine (A) andsuffer from renal metabolic acidosis as indicated by decreased total CO2(B; TCO2) and bicarbonate (B; HCO3

2), a negative base excess of the extracellular fluid(C, BEecf) in blood and increased urinary bicarbonate loss (D). (E) Increased BP ofSlc4a57/7 mice. BP was measured telemetrically during day and night inmutant (Slc4a57/7, filled bars) and WT mice (open bars); the upper end of the bars indicates the mean systolic, and the lower end of the bars indicates the meandiastolic BP with the respective SEM. Systolic and diastolic BP were significantly increased at day- and at nighttime in Slc4a5 mutant animals. Plasma atrialnatriuretic peptide (ANP) concentration was increased in Slc4a5

7/7 animals (F), whereas plasma renin activity (G) and the plasma aldosterone concentrationwere significantly lower in Slc4a57/7 mice (H). The GFR is increased in Slc4a57/7 animals and we observe reduced plasma creatinine levels (I). Inductionof metabolic alkalosis by feeding of bicarbonate-enriched water increases BP in WT mice only and abolishes BP differences between Slc4a57/7 animals com-

pared with WT animals (J).

http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1


6/12

drinking water bottles in the home cages (Slc4a57/7:0.240+0.015, WT: 0.198+0.012 ml/day g BW, n 11/10,

P 0.021).The osmolarity and pH of the urine was not significantly

changed in Slc4a57/7 vs. WT animals (osmolarity:

Slc4a57/7: 2460+131.9, WT: 2522+147.5 mosm, n

9/9, P

0.38; pH: Slc4a5

7/7

: 7.1+0.1, WT: 7.0+0.1,n 27/29, P 0.14). Analysis of the ionic composition ofthe urine revealed no significant changes in the concentration

of sodium, potassium, calcium, magnesium, chloride and inor-

ganic phosphate of theSlc4a57/7 mice (n 9Slc4a5

7/7/9WT animals), although the concentration of excreted proteinwas increased (Slc4a5

7/7: 660.3+45.7, WT: 504.2+41.6 mg/dl, n 9/9, P 0.0112). Due to the increasedurinary volume, we also calculated the daily secretion of elec-trolytes. This calculation revealed a slightly increased dailyelectrolyte excretion in Slc4a5 mutant mice compared withthe WT (Supplementary Material, Table S8).

Analysis of blood composition revealed no significantchange in pH (Slc4a5

7/7: 7.32+0.01, WT: 7.33+

0.01 mM,n 16/15,P 0.2); however, we observe decreasedbicarbonate concentration (Slc4a5

7/7: 17.1+0.6, WT:18.9+0.8 mM, n 16/15, P 0.03; Fig. 3B), decreasedtotal amount of carbon dioxide (TCO2; Slc4a5

7/7: 18.1+0.6, WT: 20.1+0.8 mM, n 16/15, P 0.027; Fig. 3B) anda reduced base excess of the extracellular fluid (BEecf;Slc4a5

7/7: 29.0+0.8, WT: 26.9+0.9 mM, n 16/15,P 0.041; Fig. 3C). In addition, we observed increasedurinary bicarbonate excretion in Slc4a57/7 vs. WT mice(HCO3

2; Slc4a57/7: 3.14+0.35, WT: 2.1+0.24 mEqHCO3

2/daykg BW, n 6/6, P 0.016; Fig. 3D). Takentogether, these data indicate that mutation of Slc4a5 resultsin a compensated renal metabolic acidosis.

Since the SLC4A5 genomic locus has been linked to BP

levels and hypertension status in humans, we analyzed the ar-terial BP of Slc4a57/7 mice compared with WT mice bytelemetric measurements. We noticed an increased diastolic(Slc4a5

7/7: 92.3+2.6, WT: 84.0+2.0 mmHg, n 10/12,P 0.009; Fig. 3E) and systolic (Slc4a5

7/7: 117.7+3.1,WT: 107.9+1.7 mmHg, n 10/12, P 0.004; Fig. 3E) BPat day and increased diastolic (Slc4a5

7/7: 99.4+2.2, WT:92.9+2.6 mmHg, n 10/12, P 0.039; Fig. 3E) andsystolic (Slc4a5

7/7: 125.4+2.8, WT: 117.7+2.4 mmHg,n 10/12, P 0.024; Fig.3E) BP at night.

To get more insights into the molecular changes associatedwith renal metabolic acidosis and hypertension after mutationof SLC4A5 function, we studied changes in the transcriptionalprofile of kidneys (Table 1, from n 5 Slc4a5

7/7/5 WT

animals). The activity of several genes involved in the regula-tion of acid-base balance in the kidney was changed alongwith a dysregulation of genes implicated in the regulationof BP and kidney perfusion (Table 1, Arrayexpress:Accession#E-MEXP-2692). More specifically, we observedupregulation of the anion exchanger 1 (AE1, Slc4a1), a keyprotein of bicarbonate reabsorption of the CD. This resultwas confirmed by western blot analysis, which corroborateda clear upregulation of AE1 in kidneys of mutant mice (AE1signal; Slc4a5

7/7: 169.3+27.3, WT: 100.7+8.7, n 10/10, P 0.014, Fig. 4A). In addition, we observed several

significant changes in the expression of other transportersknown to be involved in the regulation of acid-base balance,such as the sodium dicarboxylate transporter SLC13A3,the sodium/bicarbonate transporter SLC4A7 and pendrin/SLC26A4 (confirmed by qRTPCR see Fig. 4B;Supplemen-

tary Material, Table S9). Downregulation of the carbonicanhydrases 1 and 3 indicated activation of regulatory eventsaffecting acid-base balance. Furthermore, we found an upregu-lation ofCyp4a14 (20,21) and downregulation of CD36 (22),which both had been associated with the regulation of BP.However, it is possible that downregulation of CD36 is partof the response of the tubular epithelium to renal injuryinduced by the mutation of SLC4A5 (23,24). Similarly, upre-gulation of podocin (Nphs2) might represent a secondary eventlinked to the proteinuria ofSlc4a5 mutants (25). Mgll(mono-glyceride lipase) has been described to release arachidonicacid (26), suggesting that the upregulation of Mgll feeds intothe arachidonic acid CYP4 20-HETE system, which regu-lates sodium excretion and vasoconstriction (21).

It seems likely that the two major phenotypes, renal meta-bolic acidosis and arterial hypertension, which we observedin Slc4a5

7/7 mice, were caused by a common molecularmechanism. We reasoned that the loss of bicarbonatereabsorption by NBCe2 that is coupled to low sodiumuptake due to the electrogenic nature of the NBCe2 transportled to compensatory bicarbonate reabsorption via othermechanisms requiring increased sodium uptake per reabsorbedbicarbonate molecule. Such a mode of compensation willresult in increased sodium uptake and hence to increasedextracellular volume and hypertension. To further determine

Table 1. Analysis of the molecular changes caused by mutation ofSlc4a5

Probe set id FC P-va lue Ge ne Gene ti tle

1423257_at 20.10 0.0185 Cyp4a14 Cytochrome P450, family 4,subfamily a, polypeptide 14

1450391_a_at 2.51 0.0001 Mgll Monoglyceride lipase1455431_at 2.26 0.0311 Slc5a1 Sodium/glucose cotransporter,

member 11449553_at 1.68 0.0164 Nkain1 Na+/K+ transporting ATPase

interacting 11434502_x_at 1.66 0.0102 Slc4a1 Anion exchanger 11437605_at 1.60 0.0120 Nphs2 Podocin1416560_at 1.47 0.0131 Slc13a3 Sodium-dependent

dicarboxylate transporter,member 3

1435043_at 1.42 0.0078 Plcb1 Phospholipase C, beta 11459982_a_at 1.41 0.0090 Aqp6 Aquaporin 61419725_at 1.40 0.0149 Slc26a4 Pendrin1416637_at 1.28 0.0429 Slc4a2 Anion exchanger, member 21455876_at 1.23 0.0107 Slc4a7 Sodium-bicarbonate

cotransporter, member 71416193_at 0.75 0.0073 Car1 Carbonic anhydrase 11423166_at 0.69 0.0055 Cd36 CD36 antigen1460256_at 0.62 0.0341 Car3 Carbonic anhydrase 3

Kidneys were isolated from five Slc4a57/7 and five WT animals; RNAabundance was analyzed using Affymetrix GeneChips 430 2.0. The robustmulti-array average (RMA) procedure was used for the primary analysis of themicroarray data, and an unpairedt-test was performed for the analysis ofstatistical significance. Linear correlation of the two groups (Slc4a57/7 andWT) wasR

2 0.9907. Transcriptional regulation of selected transcripts is

shown in the table.

http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1


7/12

the relation between hypertension and metabolic acidosis, weinduced metabolic alkalosis in Slc4a5 mutant mice therebycompensating for the acidosis-related changes. Two hundredeighty millimolar sodium bicarbonate was added to the drink-ing water ofSlc4a5

7/7 and WT animals (27) resulting in an

increase in the urinary pH in both WT and mutant mice(urinary pH; Slc4a57/7: 8.7+0.1, WT: 8.9+0.1; n 6/6, ns). Interestingly, induction of metabolic alkalosis leads toincreased BP in WT mice and abolished the difference inthe BP ofSlc4a5 mutant compared with WT mice (diastolic

BP at day: Slc4a57/7: 92.6+3.3, WT: 94.3+3.9 mmHg,

n 8/8, P 0.373; systolic BP at day: Slc4a57/7:

116.5+4.4, WT: 119.5+5.2 mmHg, n 8/8, P 0.338;

diastolic BP at night: Slc4a57/7: 103.2+3.6, WT:

106.8+5.6 mmHg, n 8/8, P 0.300; systolic BP at night:Slc4a5

7/7: 128.8+4.5, WT: 133.0+6.7 mmHg, n 8/8,P 0.303; Fig.3J). However, experimental induction of acid-osis by addition of 280 mMammoniumchloride to the drinkingwater did not affect the hypertension induced by mutation of

NBCe2 (diastolic BP at day: Slc4a57/7: 96.6+4.2, WT:89.5+2.2 mmHg, n 4/5, P 0.077; systolic BP at day:Slc4a57/7: 123.1+2.5, WT: 110.9+2.7 mmHg, n 4/5,

P 0.0072; diastolic BP at night: Slc4a57/7: 104.5+3.0,

WT: 97.8+3.2 mmHg, n 4/5, P 0.09; systolic BP atnight: Slc4a5

7/7: 131.9+0.8, WT: 121.0+4.5 mmHg,n 4/5, P 0.036).

To determine whether the observed hypertension inSlc4a5

7/7 mice is due to volume retention due to increased

sodium reabsorption, we determined the levels of atrial natri-

uretic peptide (ANP) in blood plasma. Indeed, ANP levels

were increased in Slc4a5 mutant mice (Slc4a57/7: 10.5+

1.6, WT: 5.3+0.5 ng/ml, n 9/10, P 0.002, Fig. 3F). If

the increased sodium retention in the kidney of Slc4a5mutant mice is actually driven by an aldosterone-independent

mechanism, plasma renin activity and systemic aldosterone

levels should be reduced as a compensatory response. To

test this conjecture, we determined plasma renin activity as

well as serum aldosterone concentration of WT and mutant

mice. The results indicate the presence of hyporeninemic

hypoaldosteronism in Slc4a5 mutant mice [renin Slc4a57/7:

63.1+9.5, WT: 93.5+9.1 ng Ang I (ml/h), n 5/7, P

0.047; aldosterone Slc4a57/7: 473.5+84.9, WT: 669.8+

60.2 pg/ml,n 11/9,P 0.044; Fig.3G and H].

Urine volume as well as ANP concentration in blood plasmawas increased in Slc4a5 mutant mice (Fig.3A and F). Deter-mination of the clearance of single bolus-injected fluoresceinisothiocyanate (FITC)-inulin reveals an increased GFR inSlc4a5 mutant mice (Slc4a5

7/7: 35.9+8.0 WT: 10.9+

2.2 ml/min

g BW, n

8/7, P

0.0046; Fig. 3I). IncreasedGFR should lead to reduced plasma creatinine concentration.Indeed, plasma creatinine concentration was reduced(Slc4a57/7: 0.146+0.02, WT: 0.233+0.03 mg/dl, n 7/8, P 0.019, Fig. 3I). In contrast, plasma concentrations ofsodium, potassium and chloride were not significantly differ-ent between WT and mutant mice (Supplementary Material,Table S10).

DISCUSSION

Perturbations in the systems that maintain homeostasis offluids and ions often result in BP dysregulation and hyperten-

sion. In some cases, increased salt reabsorption by the kidneyis caused directly by mutations in proteins involved in salthandling (28). However, in many other cases, increasedsodium retention results from the interplay of several mole-cules with minor malfunctions, which by themselves may gen-erate only subtle changes. Such a scenario makes it difficult toestablish multi-factorial traits, which rely on the combinationof several genetic variations. Clearly, a defined mutation ofa particular gene helps sometimes uncover the function ofan individual molecule within a complex regulatory network.

Several genome-wide linkage analyses have been conductedto localize genes affecting BP regulation. Among others,regions of the human chromosome 2 have been identified tocontain genes associated with increased BP (29and references

therein). One of the candidate genes at chromosome 2 thatmight contribute to hypertension is SLC4A5 based on astudy of the Family Blood Pressure Program (FBPP) inAfrican Americans (9). This work has been confirmed in asecond study using pedigrees of large mormone families (8).However, no clear correlation ofSLC4A5 mutations to hyper-tension was established (30). Here, we have employed amouse model mutant for Slc4a5 to demonstrate thatSLC4A5/NBCe2 is involved in the regulation of body fluidhomoeostasis and prevents hypertension. In previous studies,it has been shown that SLC4A5 is an electrogenic sodium-bicarbonate transporter(4,5), which mediates sodium-bicarbonate

Figure 4.Expression of molecular markers of kidney function after mutation ofSlc4a5.Expression of anion exchanger 1 (AE1) protein is increasedSlc4a57/7

animals (A). qRTPCR experiments corroborate significant upregulation of pendrin, Slc4a7as well as Cyp4a14 andMgll (B). The qRTPCR experimentsconfirm the results of the Affymetrix GeneChip analysis; please note results of additional qRTPCRs experiments in theSupplementary Material, Table S9.

http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddr533/-/DC1


8/12

reabsorption in the cells of the CD of the kidney (7). We foundthatSlc4a57/7 mice are indeed hypertensive, thus demonstrat-ing a mechanistic basis for the observations from linkage analysis.

In addition to the elevated BP, Slc4a57/7 mice displayed

a compensated metabolic acidosis which is most likely causedby the renal bicarbonate loss. Interestingly, we could eliminatethe BP difference via overcompensation of the metabolic acid-osis using bicarbonate-enriched drinking water in Slc4a57/7

and WT mice, which indicates a causal relation between thehypertension and the metabolic acidosis in Slc4a5 mutantmice. Apparently, the loss of sodium-sparing bicarbonatereabsorption by SLC4A5, which has a stoichiometry of 1:2or 1:3 for sodium:bicarbonate transport, initiates a regulatorycascade consisting of compensatory bicarbonate reabsorptionvia other sodium-bicarbonate transporters at the expense ofan increased sodium uptake which ultimately leads to anincreased sodium uptake in the kidney tubules. At the molecu-lar level, we observed an increased abundance of the Slc4a7transcripts, suggesting that this electroneutral sodium-bicarbonate transporter partially compensates for SLC4A5

function. Since SLC4A7 shows a stoichiometry of 1:1 forthe sodium:bicarbonate transport, increased activity ofSLC4A7 will lead to an increased sodium uptake. A chronic-ally increased sodium uptake also requires increased chloridereabsorption, which may explain the upregulation ofSlc26a4/pendrin.

The presence of reduced renin activity and of hypoaldoster-onism inSlc4a5mutant mice indicates that the reninangioten-sinaldosterone system is downregulated as a compensatoryresponse to the increased BP and sodium reabsorption.Increased sodium reabsorption, hypervolemia and increasedBP result in increased plasma ANP concentration, resultingin greatly elevated GFR in the Slc4a5mutant mice. The latter,in combination with the arterial hypertension, would also

explain the mild proteinuria as a consequence of glomerularhypertension.In summary, we have shown that SLC4A5 is involved in the

regulation of the acid-base balance as well as in the regulationof BP. Both functions of SLC4A5 appear to be tightly linked.Accordingly, a major physiological function of SLC4A5 mightbe to ensure bicarbonate reabsorption associated with aminimum of concurrent sodium reabsorption. Consequently,mutation of SLC4A5 causes renal metabolic acidosis, arterialhypertension and compensatory hyporeninemic hypoaldoster-onism. The greatly increased GFR may be the result of hyper-volemia and increased ANP concentration, resulting in mildproteinuria and increased fluid intake and excretion. The iden-tification of SLC4A5 as a critical component of the regulatory

machinery, which maintains ion homeostasis and BP, allows anew assessment of the role of this gene in multi-factorial traitsleading to hypertension.

MATERIALS AND METHODS

Targeting construct and mutant mice

Genomic DNA originating from 129 mice and the vectorpKO V901 containing a DTA selection cassette in theRsrII sitewere used to construct the Slc4a5 targeting vector. The 5 armwas a 3.9 kb EcoRVAvaI fragment of the Slc4a5 locus.

Depending on the translational start site used, the seventhcoding or alternatively the ninth coding exon of Slc4a5(exon-acc#ENSMUSE00000615286) and its flanking sequenceswas amplified from 129SV genomic DNA using primers (GCA-CAGAACCTGAGCTAATTTCCAG,CCTGAGTTCCCTGGTGCACAGCAG) and was inserted into the SmaI site of the two

loxP sites containing pBS246 vector (Invitrogen) containing a

neomycin resistance cassette in the EcoRV site between theloxP sites. A third loxP site was inserted into a KpnI site ofpBS246 between the exon-containing genomic DNA and theneomycin resistance cassette using oligonuleotides (GGGA-TAACTTCGTATAATGTATGCTATACGAAGTTATAAGCTTGTAC, AAGCTTATAACTTCGTATAGCATACATTATACGAAGTTATCCCGATC). The 3 sequence of the targetingvector was a 3.1 kb fragment reaching from CTCTAATTTA-GAAGCACTATCCAG to GATATCACACAGGGACAAGGCCATG. MPI II mouse embryonic stem cells (31) were electro-porated with theNotI-linearized vector, recombinant clones wereisolated and mouse lines were established from two independentES-cell clones. The seventh exon and the neomycinR cassette

were removed from the genome by breeding the mice to theMeu-Cre 40 mouse line (32). Loss of the seventh exon ofSlc4a5leads to a frameshift mutation of SLC4A5 and truncationof the NBCe2 protein before the first transmembrane domain.ES cells were analyzed for homologous recombination using asouthern blot with BamHI and a 5 probe amplified by PCR(GGTTCTGTATCTGTCTCCAGGTATG, CCAACAGCTAG-CAAAAGAGCATCC; WT: 11.25 kb, recombined: 7.8 kb).After Cre-recombination, a southern blot using BlpI andthe 5 probe was used to identify the mutant allele ofSlc4a5 (Slc4a57/7) and to genotype the mice (WT: 7.2 kb,Slc4a57/7: 6.7 kb; Fig. 1A and C). The frameshift mutationof the Slc4a5mRNA was confirmed by RTPCR (CCAACGTGCTCGTGGGCGAGGTGGA, CCTCTTGTCAGCTGAGGG

AACTTTC; Fig.1C). The resulting animals were backcrossedto C57Bl6 for at least two generations. Litter mates originatingfrom heterozygous breedings or age-matched animals originatingfrom comparable heterozygous breedings were used for allexperiments. Two- to 6-month-old male animals were used forall experiments. All animal work was approved by the animalexperiment committee of the federal state of Hessen, Germany.

Mass-spectroscopy-based proteomics

Choroid plexus was isolated from WT and Slc4a57/7

animals as well as from an animal that was labeled with a13C6-lysine-substituted version of lysine (SILAC mouse,heavy mouse) as an internal reference. Protein extracts

were prepared in buffer containing 4% sodium dodecylsulfate (SDS), 100 mM Tris/HCl, pH 7.6, 0.1 M DTT. Proteinextracts of WT or Slc4a5

7/7 mice were mixed 1:1 withthe protein extract of the labeled animal. The quantitativemass spectrometry has been described earlier (13). In brief,after sodium dodecyl sulfate polyacrylamide gel electrophor-esis (SDS PAGE) and coomassie staining gel, bands wereexcised and subjected to LysC digestion as described and con-centrated and desalted using STAGE tips (33). Samples weremeasured by nano-LC-MS/MS using a nanoflow high-per-formance liquid chromatography system (Proxeon) coupledonline to a nanoelectrospray ion source (Proxeon) and



9/12

LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scien-tific). Peptides were separated on a 20 cm C18-reversed phasecolumn (75mm diameter) packed in house with Reprosil(ReproSil-Pur C18-AQ 3 mm, Dr Maisch). We used 150 mingradient from 4 to 60% acetonitrile in 0.5% acetic acid at aflow of 250 nl/min. The LTQ-Orbitrap Velos was operatedin the data-dependent mode to automatically measure MSand MS/MS spectra. The following parameters were used:full scan (mass range m/z 300 2000) was recorded in theOrbitrap analyzer with a resolution R 60 000 followed bythe sequential isolation and fragmentation of the 15 mostintense ions from each scan (34). RAW (raw data file, containsminimally processed data) spectra were analyzed with theMaxQuant Software package (Version 1.2.0.18) based on theAndromeda search algorithm (35,36). The InternationalProtein Index (IPI) database (Version 3.64 mouse) was usedfor peptide identification. False discovery rates (, 1%) werecontrolled by searching in a concatenated database consistingof the reverse versions of the original protein sequences.

In situ hybridization

For radioactive in situ hybridization, probes were amplifiedand cloned into the pGEM-T vector (Promega). The templatesfor probe transcription were: Slc4a5 (409 bp; GCAGATA-GAGGATGGACTTCTGCGA, GGCAGACTGGACAAGAC-GAACAAAT; second probe: 333 bp: GGGGGATGCCACAGACAACTAC, TTGATGGCGTCGTAGATGAAGAT),aquaporin-1 (810 bp; ATGGCCAGTGAAATCAAGAAGAAGC, CTATTTGGGCTTCATCTCCACCCTG), aquaporin-2(663 bp; ATGTGGGAACTCCGGTCCATAGCGT, GGTAGTTGTAGAGGAGGGAACCGAT), Slc4a1 (960 bp; TGACGCTACGAAAGTTCAAGAACAG, CGTCATATTCATCCAGGCCATTCTC), uromodulin (980 bp; AGTGTAAACAGGAC

TCCAACATCA, TCATTGAACCATGAAGATCAAAGTG).Two hundred fifty nanograms of purified DNA template wasin vitro transcribed to generate

35S UTP labeled probesusing MAXIscript T7/Sp6- Kits (Ambion) according to themanufacturers instructions. Ten microliters of 1 M DTT,10 ml of 3 M NaoAC, 5 ml of tRNA (10 mg/ml) and 45 ml ofH2O were added after the labeling reaction, and the probewas purified using G50 Quick Spin Columns (Roche). RNAprobes were precipitated, resolved in 50 ml 100 mM DTTand 50 ml formamide was added. Twelve micrometer cryosec-tions were thawed at room temperature (RT) for 2 min andfixed with 4% PFA/PBS for 10 min. Sections were washedwith phosphate-buffered saline (PBS) and treated for 10 minwith acetylation buffer [0.1 M triethanolamine (Sigma), 0.9%

NaCl, 2.5 ml/l acetic anhydrate], washed with PBS and dehy-drated via ascending ethanol series. Sections were air-driedand treated with pre-hybridization solution at RT for 2 h[50% formamide, 0.75 M NaCl, 25 mM PIPES, 25 mM EDTA(pH 6.8), 0.1% ficoll, 0.1% polyvinylpyrrolidon, 0.1% BSA,0.2% SDS, 10 mM DTT, 0.25 mg/ml salmon sperm-DNA,0.25 mg/ml yeast tRNA). 1 10

6 cpm of probe was dilutedin 130 ml of hybridization buffer [50% formamide, 0.75 MNaCl, 25 mM piperazine-N,N-bis(2-ethanesulfonic acid)[PIPES], 25 mM ethylenediaminetetraacetic acid (EDTA)(pH 6.8), 0.1% ficoll, 0.1% polyvinylpyrrolidon, 0.1%bovine serum albumin (BSA), 0.2% SDS, 20 mM DTT,

0.25 mg/ml salmon sperm-DNA, 0.25 mg/ml yeast tRNAand 10% dextrane sulfate]. Sections were covered with thediluted probe, cover slips were applied and slides were incu-bated in a humid chamber at 558C overnight. After incubationslides were washed with once for 20 min in 4 SSC at RT,thrice for 15 min in 4 SSC containing 0.4 M DTT and incu-bated in RNAse A buffer (0.5 M NaCl, 10 mM Tris, pH 7.5,1 mM EDTA, pH 8, 500 ml Rnase A 0.02 mg/ml) for 30 minat 378C. Thereafter, slides were rinsed with 2 SSC contain-ing 0.4 M DTT for 15 min, and then with 1 SSC for 15 min.Slides were dehydrated using an ascending ethanol series, air-dried and covered with an X-ray film (KODAK BioMax MRFilm) for 3 to 14 days.

Non-radioactive in situ hybridization was performed usingthe QuantiGene ViewRNA FFPE Assay (Affymetrix/Panomics) according to the manufacturers instructions. Aprobe set was designed by Affymetrix corresponding to thebases 509 1553 of ENSMUST00000113900. In brief,freshly dissected tissue was fixed in 10% neutral-bufferedformaline for 24 h at RT. Tissues were embedded into paraffin

using an alcohol series. Five micrometer sections weremounted onto Histobondw slides. Slides were processedstrictly following the QuantiGene protocol. Pre-hybridizationconditions were found to be optimal with 10 min of boilingin pre-treatment solution and 20 min of Protease QF digestion.After hybridization, washing, pre-amplifier hybridization,amplifier hybridization and alkaline phosphatase reaction,sections were washed thrice for 5 min in PBS, blocked for1 h and incubated with an anti-aquaporin-1 antibody (AlphaDiagnostics#AQP11-A, 1:100) or an anti-aquaporin-2 anti-body [(37); 1:100] in blocking buffer containing 2%BSA and 0.5% NP-40 in PBS. After overnight incubation, at48C, sections were washed 3 5 min in PBS and ananti-rabbit-Cy2 antibody (Dianova#711-225-152) was applied

1:100 in blocking solution 2 h at RT. Slides were washed inPBS containing DAPI 1:1000 and embedded in Fluromount(Fluka). Images were acquired using a Zeiss Z1 Imager.

Histology

Tissue samples were perfused and fixed with 4% paraformal-dehyde, dehydrated and embedded in paraffin. Sections werestained with hematoxylin and eosin and examined for histo-logical changes by light microscopy.

Metabolic cages, blood gas and electrolyte analysis

Mice were kept in metabolic cages (Techniplast). Urine and

feces were collected over 24 h periods after initial customiza-tion of the cage. Urine electrolyte composition and osmolaritywas determined by IDEXX (Ludwigsburg, Germany). Bloodwas collected from unrestrained mice by decapitation. Bloodcomposition was determined using the i-STATw Systemwith EG6+ Cartridges (Abott). Plasma electrolytes weredetermined using Spotchem EL SE-1520 (Axonlab) afterretro-orbital blood collection under isoflurane anesthesia.Urinary bicarbonate was determined using a titration method(38). Urine samples were collected for 24 h and volume wasdetermined. For titration of bicarbonate, the pH of urine wasdetermined at 378C and 1 ml of 0.1 N HCl was added to



10/12

1 ml of sample. Samples were heated for 10 min in a 1008Cwater bath; thereafter, samples were cooled to RT. Thevolume of 0.1 N NaOH needed to reach the initial pH wasdetermined at 378C. One milliliter of distilled water was mea-sured as a blank. The concentration of bicarbonate was calcu-lated: urinary HCO3

2 [mEql/l] ((volume 0.1 N NaOH sample[ml] volume 0.1 N NaOH

blank[ml])/1 ml sample) 0.1

mEq/ml 1000 ml/l.

Blood pressure measurement

Blood pressure (BP) of mice was determined using DSITA11PA-C10 implantable telemetric transmitters. The cath-eter of the transmitter was inserted into the left carotidartery of the mice. Data were recorded every 30 min for120 s for 7 days. First recordings were done 7 days after im-plantation of transmitter. Data were sampled with DataquestA.R.T. 4.0 with a sample rate of 500 Hz and with a filtercut-off of 100 Hz. Data reduction was performed by DataquestA.R.T. 4.0 by calculating the reduced mean for the sampled

signals. Recorded parameters were diastolic, systolic, pulsepressure, activity and heart rate. The mean of these valueswas calculated for day- and nighttime. These mean values ofthe individual animals were used for the statistical analysisusing thet-test with GraphPad Prism 5.0. To induce metabolicalkalosis, animals were provided with drinking water supple-mented with 280 mM bicarbonate (27). Effectiveness of thistreatment was ascertained by analysis of urinary pH. Toinduce metabolic acidosis, animals were provided with drink-ing water supplemented 2% sucrose and 280 mM ammoniumchloride (39,40). Mice were treated at least 2 days beforestart of BP recording.

Analysis of transcriptional changes

RNA was isolated from PBS-perfused kidneys using theTRIZOL method (Invitrogen). RNA quality was analyzedwith the Agilent 2100 Bioanalyzer using the RNA 6000Nano Kit (Agilent Technologies). For mRNA expression ana-lysis, the Affymetrix GeneChip Mouse Genome 430 2.0 Arraywas employed using the one-cycle target labeling protocol(Affymetrix). Data were analyzed by the robust multichip ana-lysis algorithm using the Affymetrix Expression Console.Threshold tests for all arrays were within the bounds accordingto criteria of the Affymetrix Expression Console. Annotationand statistical analyses were performed with the ArraystarTM

3.0 software (DNASTAR) using log2 transformed data. An un-pairedt-test without further correction was used for statistical

analysis. Fold change was calculated based on the median ofsignal intensity of the groups. Linear correlation was R

2

0.9907 between combined WT and mutant mice data sets, in-dicating high correlation between the two data sets. Minimuminformation about a microarray experiment (MIAME) criteriawere met (41). The microarray data sets of this study are pub-licly available at ArrayExpress at EMBL-EBI (http://www.ebi.ac.uk/arrayexpress/) with the Acc#E-MEXP-2692. To val-idate GeneChip results, RTPCR experiments were performedusing TaqManw Gene Expression Assays with a StepOnePlusPCR system (Applied Biosystems). RNA was isolated fromkidneys of Slc4a5 mutant and WT animals (n 5/5 for

Pendrin, Cyp4a14, Mgll; n 17/15 for Slc4a7, Slc4a8)using the TRIZOL method. One microgram of RNA wasreverse transcribed with Superscript II using the oligo(dT)protocol (Invitrogen). cDNA was diluted 1:100 for theTaqManw gene expression assays protocol (Applied Biosys-tems). All assays were done as duplex reactions withGAPDH (VIC-dye labeled; Applied Biosystems,Assay#4352339E) as an endogenous reference. Assay IDs(FAM-dye labeled) for Pendrin, Slc4a7, Slc4a8, Cyp4a14,

Plcb1 and Mgll were Mm00442308_m1, Mm013109072_m1, Mm00491397_m1, Mm00484132_m1, Mm00479987_m1 and Mm00449274_m1, respectively. The [delta][delta]Ct method was used to calculate relative expression ofthe analyzed transcripts; all [delta][delta]Ct values werereferred to the mean of [delta]Ct WT values. Statisticalanalysis was performed using the Studentst-test with Graph-Pad Prism 5.0 (GraphPad Software, San Diego, CA, USA).

Western blot

Proteins extracted from kidneys of Slc4a5 mutant and WTanimals were homogenized in lysis buffer containing 18 mMTris-Cl, pH 6.8, 4.5 mM EDTA, 125 mM NaCl and completeproteinase inhibitor cocktail (Roche). Cell debris was removedby centrifugation at 1000gfor 5 min, and the membrane frac-tion of the lysate was collected by centrifugation for 30 min at1 35 000g. The pellet was resuspended in 100 ml of samplebuffer containing 45 mM Tris, pH 6.8, 4.5 mM EDTA, 1.8%SDS and complete proteinase inhibitor. Protein concentra-tion was determined using the DC assay kit (Biorad). Tenmicrograms of protein lysates were separated on 4 12%SDSPAGE gradient gels and transferred onto nitrocellulosemembranes (Invitrogen). Proteins were visualized byPonceau S (Merck) staining. We used a polyclonal antibody

against AE1 from Milllipore (1:100; AB3500P), and the sec-ondary antibody was from Pierce: goat anti-rabbit HRP(1:1000, #1858415). HRP was detected using SuperSignalWest Femto detection solutions (Perbio Science). Signalswere recorded and analyzed with a Biorad Versadoc Systemand Quantity One Software and were normalized against thePonceau S staining of the nitrocellulose membrane. Studentst-test was performed using GraphPad Prism 5.0.

Glomerular filtration rate

For the determination of the GFR, we used the methoddescribed by Qi et al . (42). In brief, 5% FITC inulin(Sigma#F3272-1) in 0.9% NaCl solution was dialyzed

(1 kDa cut-off) overnight against 0.9% saline and filter steri-lized. WT and Slc4a5 mutant mice were injected with3.74 mg FITC-inulin/g body weight into the tail vein.Twenty-five microliter blood was collected from the tailvein 3, 7, 10, 15, 30, 55 and 75 min after injection. Bloodplasma was prepared using Microvettenw CD300 LH (Sar-stedt) at 2000gfor 10 min. Ten microliter plasma was mixedwith 40 ml of 500 mM HEPES, pH 7.4 and stored at 48C.Fluorescence of the samples was determined using a MithrasLB940 fluorescence reader (Berthold Technologies) with exci-tation at 485 nm and determination of emission at 538 nm.Fluorescence of the injected amount FITC inulin was



11/12

determined using an appropriate FITC-inulin/mouse serumreference. For calculation of GFR, we used the one-compartment model as described earlier (42). Log2 values ofplasma fluorescence were plotted vs. time using GraphPadPrism 5.0 (GraphPad Software) to determine the eliminationrate constant (Ke). The volume of distribution (Vd) was deter-mined by the equation

Vd total amount of injected fluores-

cence units/plasma fluorescence. The GFR was calculatedusing the equation: GFR Vd Ke (42).

Determination of renin, aldosterone, creaninineand ANP concentrations

For the determination of renin activity in blood plasma, micewere accustomed to anesthesia handling for 10 days, and 60 mlblood was collected from the retro-orbital sinus into tubes con-taining 5 ml Na-EDTA (0.5 M). Plasma was stored at 2208C.Diluted plasma samples were incubated in a total volume of100 ml containing 22 ml substrate (plasma taken from nephrec-tomized rats). After samples were incubated either at 37 or

48C for 90 min, release of angiotensin I was determinedusing a RIA (Byk & DiaSorin Diagnostics). Specific Ang I for-mation (378C values) was corrected by subtraction of unspe-cific interference (48C values). Blood serum aldosterone wasdetermined after blood collection by decapitation of unre-strained animals. Serum was isolated by centrifugation(4000g; 5 min) and used for the aldosterone RIA (DiganosticSystems Laboratories, Inc). After retro-orbital blood collection(500 ml) from anesthetized mice into K-EDTA and aprotinincontaining tubes, the plasma ANP concentration was deter-mined with an EIA kit (Phoenix Pharmaceuticals, Inc.).Plasma creatinine concentrations were determined by animproved Jaffe method using the Quantichrome CreatinineAssay Kit (BioAssay Systems).

ACKNOWLEDGEMENTS

We thank Sylvia Thomas, Katja Kolditz and AstridWietelmann for technical assistance. We thank Dr R. Fentonfor supplying the anti-Aqp-2 antibody.

Conflict of Interest statement. None declared.

FUNDING

The work was supported by the Deutsche Forschungsge-meinschaft with a grant to Thomas Boettger (grant number:BO1970/1); by the Max-Planck-Society and the Excellence

Cluster Cardio-Pulmonary System (ECCPS).

REFERENCES

1. Soleimani, M., Grassi, S.M. and Aronson, P.S. (1987) Stoichiometry ofNa+-HCO-3 cotransport in basolateral membrane vesicles isolated fromrabbit renal cortex. J. Clin. Invest., 79, 12761280.

2. Igarashi, T., Inatomi, J., Sekine, T., Cha, S.H., Kanai, Y., Kunimi, M.,Tsukamoto, K., Satoh, H., Shimadzu, M., Tozawa, F. et al. (1999)Mutations in SLC4A4 cause permanent isolated proximal renal tubularacidosis with ocular abnormalities. Nat. Genet., 23, 264266.

3. Gawenis, L.R., Bradford, E.M., Prasad, V., Lorenz, J.N., Simpson, J.E.,Clarke, L.L., Woo, A.L., Grisham, C., Sanford, L.P., Doetschman, T.et al.

(2007) Colonic anion secretory defects and metabolic acidosis in micelacking the NBC1 Na+/HCO32 cotransporter.J. Biol. Chem., 282,90429052.

4. Virkki, L.V., Wilson, D.A., Vaughan-Jones, R.D. and Boron, W.F. (2002)Functional characterization of human NBC4 as an electrogenic Na+-HCOcotransporter (NBCe2).Am. J. Physiol. Cell Physiol.,282, C1278 C1289.

5. Sassani, P., Pushkin, A., Gross, E., Gomer, A., Abuladze, N., Dukkipati,R., Carpenito, G. and Kurtz, I. (2002) Functional characterization of

NBC4: a new electrogenic sodium-bicarbonate cotransporter.Am. J. Physiol. Cell Physiol., 282, C408C416.

6. Boron, W.F., Chen, L. and Parker, M.D. (2009) Modular structure ofsodium-coupled bicarbonate transporters. J. Exp. Biol., 212, 16971706.

7. Damkier, H.H., Nielsen, S. and Praetorius, J. (2007) Molecular expressionof SLC4-derived Na+-dependent anion transporters in selected humantissues.Am. J. Physiol. Regul. Integr. Comp. Physiol.,293, R2136 R2146.

8. Hunt, S.C., Xin, Y., Wu, L.L., Cawthon, R.M., Coon, H., Hasstedt, S.J.and Hopkins, P.N. (2006) Sodium bicarbonate cotransporter

polymorphisms are associated with baseline and 10-year follow-up bloodpressures.Hypertension, 47, 532536.

9. Barkley, R.A., Chakravarti, A., Cooper, R.S., Ellison, R.C., Hunt, S.C.,Province, M.A., Turner, S.T., Weder, A.B. and Boerwinkle, E. (2004)Positional identification of hypertension susceptibility genes onchromosome 2. Hypertension, 43, 477482.

10. Zhang, D., Kiyatkin, A., Bolin, J.T. and Low, P.S. (2000) Crystallographicstructure and functional interpretation of the cytoplasmic domain of

erythrocyte membrane band 3. Blood, 96, 29252933.11. Zhu, Q., Azimov, R., Kao, L., Newman, D., Liu, W., Abuladze, N.,

Pushkin, A. and Kurtz, I. (2009) NBCe1-A transmembrane segment 1lines the ion translocation pathway. J. Biol. Chem., 284, 89188929.

12. Boettger, T., Beetz, N., Kostin, S., Schneider, J., Kruger, M., Hein, L. andBraun, T. (2009) Acquisition of the contractile phenotype by murinearterial smooth muscle cells depends on the Mir143/145 gene cluster.

J. Clin. Invest., 119, 26342647.13. Kruger, M., Moser, M., Ussar, S., Thievessen, I., Luber, C.A., Forner, F.,

Schmidt, S., Zanivan, S., Fassler, R. and Mann, M. (2008) SILAC mousefor quantitative proteomics uncovers kindlin-3 as an essential factor forred blood cell function. Cell, 134, 353364.

14. Fushimi, K., Uchida, S., Hara, Y., Hirata, Y., Marumo, F. and Sasaki, S.(1993) Cloning and expression of apical membrane water channel of ratkidney collecting tubule. Nature, 361, 549552.

15. Nielsen, S., DiGiovanni, S.R., Christensen, E.I., Knepper, M.A. andHarris, H.W. (1993) Cellular and subcellular immunolocalization of

vasopressin-regulated water channel in rat kidney. Proc. Natl Acad. Sci.USA, 90, 1166311667.

16. Nielsen, S., Smith, B.L., Christensen, E.I., Knepper, M.A. and Agre, P.(1993) CHIP28 water channels are localized in constitutivelywater-permeable segments of the nephron. J. Cell Biol., 120, 371383.

17. Nielsen, S., Frokiaer, J., Marples, D., Kwon, T.H., Agre, P. and Knepper,M.A. (2002) Aquaporins in the kidney: from molecules to medicine.

Physiol. Rev., 82, 205244.18. Sikri, K.L., Foster, C.L., Bloomfield, F.J. and Marshall, R.D. (1979)

Localization by immunofluorescence and by light- andelectron-microscopic immunoperoxidase techniques of Tamm-Horsfallglycoprotein in adult hamster kidney. Biochem. J., 181, 525532.

19. Kao, L., Kurtz, L.M., Shao, X., Papadopoulos, M.C., Liu, L., Bok, D.,Nusinowitz, S., Chen, B., Stella, S.L., Andre, M. et al. (2011) Severeneurologic impairment in mice with targeted disruption of the electrogenicsodium bicarbonate cotransporter NBCe2 (Slc4a5 gene). J. Biol. Chem.,286, 3256332574.

20. Quigley,R., Chakravarty, S., Zhao, X., Imig, J.D.and Capdevila, J.H. (2009)Increased renal proximal convoluted tubule transport contributes tohypertension in Cyp4a14 knockout mice.Nephron Physiol., 113, p23p28.

21. Fleming, I. (2005) Cytochrome P-450 under pressure: more evidence for alink between 20-hydroxyeicosatetraenoic acid and hypertension.Circulation, 111, 57.

22. Pravenec, M., Churchill, P.C., Churchill, M.C., Viklicky, O., Kazdova, L.,Aitman, T.J., Petretto, E., Hubner, N., Wallace, C.A., Zimdahl, H. et al.(2008) Identification of renal Cd36 as a determinant of blood pressure andrisk for hypertension. Nat. Genet., 40, 952954.

23. Okamura, D.M., Lopez-Guisa, J.M., Koelsch, K., Collins, S. and Eddy,A.A. (2007) Atherogenic scavenger receptor modulation in thetubulointerstitium in response to chronic renal injury. Am. J. Physiol.

Renal Physiol., 293, F575F585.



12/12

24. Baines, R.J. and Brunskill, N.J. (2008) The molecular interactionsbetween filtered proteins and proximal tubular cells in proteinuria.Nephron Exp. Nephrol., 110, e67e71.

25. Hildebrandt, F. and Heeringa, S.F. (2009) Specific podocin mutationsdetermine age of onset of nephrotic syndrome all the way into adult life.

Kidney Int., 75, 669671.26. Saario, S.M. and Laitinen, J.T. (2007) Monoglyceride lipase as an enzyme

hydrolyzing 2-arachidonoylglycerol. Chem. Biodivers., 4, 19031913.

27. Wagner, C.A., Finberg, K.E., Stehberger, P.A., Lifton, R.P., Giebisch,G.H., Aronson, P.S. and Geibel, J.P. (2002) Regulation of the expressionof the Cl-/anion exchanger pendrin in mouse kidney by acid-base status.

Kidney Int., 62, 21092117.28. Lifton, R.P., Gharavi, A.G. and Geller, D.S. (2001) Molecular

mechanisms of human hypertension. Cell, 104, 545556.29. Rice, T., Cooper, R.S., Wu, X., Bouchard, C., Rankinen, T., Rao, D.C.,

Jaquish, C.E., Fabsitz, R.R. and Province, M.A. (2006) Meta-analysis ofgenome-wide scans for blood pressure in African American and Nigeriansamples. The National Heart, Lung, and Blood Institute GeneLink Project.

Am. J. Hypertens., 19, 270274.30. Stutz, A.M., Teran-Garcia, M., Rao, D.C., Rice, T., Bouchard, C. and

Rankinen, T. (2009) Functional identification of the promoter ofSLC4A5, a gene associated with cardiovascular and metabolic

phenotypes in the HERITAGE Family Study. Eur. J. Hum. Genet., 17,14811489.

31. Voss, A.K., Thomas, T. and Gruss, P. (1997) Germ line chimeras from

female ES cells. Exp. Cell Res., 230, 4549.32. Leneuve, P., Colnot, S., Hamard, G., Francis, F., Niwa-Kawakita, M.,

Giovannini, M. and Holzenberger, M. (2003) Cre-mediated germlinemosaicism: a new transgenic mouse for the selective removal of residualmarkers from tri-lox conditional alleles. Nucleic Acids Res., 31, e21.

33. Rappsilber, J., Mann, M. and Ishihama, Y. (2007) Protocol formicro-purification, enrichment, pre-fractionation and storage of peptidesfor proteomics using StageTips. Nat. Protoc., 2, 18961906.

34. Olsen, J.V., Schwartz, J.C., Griep-Raming, J., Nielsen, M.L., Damoc, E.,

Denisov, E., Lange, O., Remes, P., Taylor, D., Splendore, M. et al. (2009)

A dual pressure linear ion trap orbitrap instrument with very high

sequencing speed. Mol. Cell. Proteomics, 8, 27592769.

35. Cox, J. and Mann, M. (2008) MaxQuant enables high peptide

identification rates, individualized p.p.b.-range mass accuracies and

proteome-wide protein quantification.Nat. Biotechnol., 26, 13671372.

36. Cox, J., Neuhauser, N., Michalski, A., Scheltema, R.A., Olsen, J.V. and

Mann, M. (2011) Andromeda: a peptide search engine integrated into theMaxQuant environment. J. Proteome Res., 10, 17941805.

37. Moeller, H.B., Knepper, M.A. and Fenton, R.A. (2009) Serine 269

phosphorylated aquaporin-2 is targeted to the apical membrane of

collecting duct principal cells. Kidney Int., 75, 295303.

38. Lin, S.L. and Chan, J.C. (1973) Urinary bicarbonate: a titrimetric method

for determination. Clin. Biochem., 6, 207210.

39. Stehberger, P.A., Schulz, N., Finberg, K.E., Karet, F.E., Giebisch, G.,Lifton, R.P., Geibel, J.P. and Wagner, C.A. (2003) Localization and

regulation of the ATP6V0A4 (a4) vacuolar H+-ATPase subunit defective

in an inherited form of distal renal tubular acidosis. J. Am. Soc. Nephrol.,

14, 30273038.

40. Nowik, M., Lecca, M.R., Velic, A., Rehrauer, H., Brandli, A.W. and

Wagner, C.A. (2008) Genome-wide gene expression profiling revealsrenal genes regulated during metabolic acidosis. Physiol. Genomics, 32,

322334.

41. Brazma, A., Hingamp, P., Quackenbush, J., Sherlock, G., Spellman, P.,Stoeckert, C., Aach, J., Ansorge, W., Ball, C.A., Causton,H.C. et al. (2001)

Minimum information about a microarray experiment (MIAME)-toward

standards for microarray data.Nat. Genet.,29, 365371.

42. Qi, Z., Whitt, I., Mehta, A., Jin, J., Zhao, M., Harris, R.C., Fogo, A.B. and

Breyer, M.D. (2004) Serial determination of glomerular filtration rate in

conscious mice using FITC-inulin clearance. Am. J. Physiol. Renal

Physiol., 286, F590F596.


hum. mol. genet.-2012-gröger-1025-36

Documents