hybrid expression cassettes consisting of a milk protein promoter and a cytomegalovirus enhancer...

RESEARCH ARTICLE

Molecular Reproduction & Development (2012)

Hybrid Expression Cassettes Consisting of a Milk ProteinPromoter and a Cytomegalovirus Enhancer SignificantlyIncrease Mammary-Specific Expression of Human Lactoferrinin Transgenic Mice

YONG CHENG,1* LI-YOU AN,1 YU-GUO YUAN,1 YI WANG,1 FU-LIANG DU,2,3 BAO-LI YU,1

ZHENG-HONG ZHANG,1 YU-ZHENG HUANG,1 AND TING-JIA YANG1

1 Engineering Research Centre for Transgenic Animal Pharmaceutics in Jiangsu Province, College of Veterinary Medicine,

Yangzhou University, Yangzhou, Jiangsu, PR China2 TAP Program, Renova Life, Inc., University of Maryland, College Park, Maryland3 Laboratory of Embryology andTranslational Genomics, College of Life Sciences, NanjingNormal University, Nanjing, Jiangsu,

PR China

SUMMARY

It is very important to develop an effective, specific, and robust expression cassettethat ensures a high level of expression in the mammary glands. In this study, wedesigned and constructed a series of mammary gland-specific vectors containing acomplex hybrid promoter/enhancer by utilizing promoter sequences from milk pro-teins (i.e., goat b-casein, bovine as1-casein, or goat b-lactoglobulin) and cytomega-lovirus enhancer sequences; vectors containing a singlemilk protein promoter servedas controls.Chickenb-globin insulator sequenceswerealso included in someof thesevectors. The expression of constructs was analyzed through the generation oftransgenic mice. Enzyme-linked immunosorbent assay (ELISA) analysis revealedthat the hybrid promoter/enhancer could drive the expression of recombinant humanlactoferrin (rhLF) cDNAat high levels (1.17–8.10mg/ml) in themilk of transgenicmice,whereas control promoters achieved a very low rhLF expression (7–40 ng/ml). More-over, the expression of rhLF was not detected in the serum or saliva of any transgenicanimal. This result shows that all constructs, driven by the hybrid promoter/enhancer,had high mammary gland-specific expression pattern. Together, our results suggestthat the use of a hybrid promoter/enhancer is a valuable alternative approach forincreasing mammary-specific expression of recombinant hLF in a transgenic mousemodel.

Mol. Reprod. Dev. 2012. � 2012 Wiley Periodicals, Inc.

Received 27 January 2012; Accepted 8 June 2012

* Corresponding author:Engineering Research Centre forTransgenic Animal Pharmaceutics

College of Veterinary MedicineYangzhou UniversityNo. 12 Wenhui Road, Yangzhou225009, Jiangsu Province, PR China.E-mail: [email protected]

Yong Cheng, Li-you An, and Yu-guo Yuancontributed equally to this work.

Funded by: National Major SpecialProjects on New Cultivation forTransgenic Organisms, Grantnumbers: 2011ZX08008-004,2009ZX08008-009B, PriorityAcademic Program Development ofJiangsu Higher Education Institutions,The National Natural ScienceFoundation of China; Grant number:31101871

Published online in Wiley Online Library(wileyonlinelibrary.com).DOI 10.1002/mrd.22063

Abbreviations: BLG, b-lactoglobulin; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; hLF, human lactoferrin; rhLF, recombinant humanlactoferrin; SV40pA, SV40 polyadenylation.

� 2012 WILEY PERIODICALS, INC.

INTRODUCTION

Mammary gland-specific expression of transgenes is apopular approach used to produce foreign proteins in themilk of transgenic animals (Clark, 1998; Hong-Ying et al.,2006; Serova et al., 2012; Wang et al., 2011). The use oftransgenic animals as ‘‘mammary gland bioreactors’’ is animportant application due to the increasing demand forhigh-quality pharmaceuticals and medical diagnostic pre-parations (Natalie, 1999; Houdebine, 2009; Cicardi andZanichelli, 2010). Mammary gland bioreactors are moreprofitable than other biological systems for manufacturingrecombinant human proteins (Bosze et al., 2008). Suchbioreactors are particularly important for some of the func-tional proteins that require post-translational modificationsfor biological activity or stability.

Although mammalian cell culture systems can producebioreactive and therapeutic proteins, these proteins areexpressed at much lower levels in somatic cells andthe purification process is technically more complicated,which makes their production on a commercial scale moreexpensive (Goldman et al., 2002). The mammary bioreac-tor provides a highly economical and organic model for theproduction of these proteins. As new techniques becomeavailable, recombinant human proteins produced frommammary glands have made their way into the marketfor clinical use (Cicardi and Zanichelli, 2010; Davis andBernstein, 2011). Yet, many obstacles exist in the devel-opment of such bioreactors. One such obstacle is how toincrease the quantity of target gene expression. Therefore,optimized expression vectors are needed to increasetransgene expression in the mammary gland (Agnew andPfleger, 2011; Pipe et al., 2011; Simon et al., 2011).

Bioactive foreign proteins have been expressedspecifically in the mammary gland under the direction ofspecific milk regulatory sequences (Liu et al., 2012). Theseinclude sequences obtained from goat b-casein (Pohlmeieret al., 2011), bovine as1-casein (Ebert et al., 1994; Serovaet al., 2012), and ovine b-lactoglobulin (BLG; Barash et al.,1999; Reichenstein et al., 2005; Khodarovich et al., 2008),which contain binding sites for transcription factors suchas the signal transducer and activator of transcription5 (STAT5), CCAAT enhancer-binding protein (C/EBP),nuclear factor I (NF-I), glucocorticoid receptor (GR), E26-specific sequence factor (Ets), and octamer-bindingtranscription factor-1 (Oct-1; Reichenstein et al., 2005;Benlhabib and Herrera, 2006). Previous studies haveshown that only a small percentage of cells in themammaryglands from a transgenic animal express recombinant pro-tein, thus a more efficient mammary gland-specific vectorremains to be devised (Pantano et al., 2003; Zhou et al.,2012).

One of the key features of efficient heterologous proteinproduction in themilk of transgenic animals is a high level oftranscription of the introduced gene, especially cDNA. Forthis purpose, highly active promoters are required. Overthe last decade, transgenic rodents have been developedas models of bioreactors with mammary gland-targetedexpression (Cerdan et al., 1998; Serova et al., 2011;

Yuskevich et al., 2011). The use of a mammary-specificregulatory sequence from a given gene enables expressionto be targeted to the mammary tissue. This principle hasbeen successfully applied to large animals, but the longperiod of their reproduction and the associated high costsnecessitate the design of more efficient vectors for trans-gene expression. Recently, various schemes for improvingmammary-specific expression have been reported thatinclude the use of distal regulatory elements or large geno-mic DNA fragments [e.g., bacterial artificial chromosome(BAC) or yeast artificial chromosome (YAC)] (Alami et al.,2000; Giraldo and Montoliu, 2001; Liu et al., 2011), insula-tors such as locus control regions (Fujiwara et al., 1999;Brakebusch et al., 2011), matrix-attached regions (Lee et al.,1998; Bell et al., 2001; Sharp et al., 2006), and targeted siteintegration (McKnight et al., 1992; Zhang et al., 2009).Large genomic DNA often contains several genes, how-ever, and unknown and unwanted genes may exert nega-tive actions in the animals (McCreath et al., 2000). Weshould also note that transgenes driven by long genomicDNA fragments seldom work in the ideal, predicted state.Constructing vectors and transferring large foreign DNAfragments is demanding and difficult. Due to the relativelycomplex relationship between the host genome and theintroduced transgene, the actual and final protein expres-sion level in milk is unpredictable (Bosze and Hiripi, 2012).

Several major elements are required to obtain satisfac-tory transgene expression (Yasunaga et al., 2011). Theseinclude essential gene insulators (Brakebusch et al., 2011),chromatin openers (de Groot et al., 1999), enhancers(Boulos et al., 2006), locus control regions (Bell et al.,2001), and introns (Sam et al., 2010). One of the mostimportant elements may be the factor(s) controlling trans-gene transcription that restricts transgene expression in thecell type of interest (Gehrke et al., 2003; Dronadula et al.,2011). In many instances, the resultant transgene expres-sion in milk has not always been high or stable, and ectopictranscription may be one of the main reasons for the vari-able and unpredictable expression efficiency of foreigngenes. This suggests that the DNA sequences controllinggene transcription, even those controlling post-transcrip-tional RNA splicing, may contribute to the expression of thetransgene. Thus, it is likely that these DNA sequences losea large part of their efficiency when foreign cDNAs areintroducedwithin a gene. For example, recombinant humanlactoferrin (hLF) has been expressed in the milk of trans-genic cows at a level of 2.8mg/ml when the bovine as1-caseinpromoterwasusedasa regulator (Riegoet al., 1993;Cerdan et al., 1998; Pantano et al., 2003). In contrast, Liuet al. (2004) reported a high hLF expression in milk (up to8.02mg/ml) under the control of the hLF 50-flanking and 30-regulatory regions. Long genomic DNA fragments maysuppress ectopic effects, but this outcome does not alwaysoccur.Randomcleavagemayoccur in longDNA fragments,making it necessary to determine if the transgene isintact and is working as expected in transgenic animals(Houdebine, 2009).

The cytomegalovirus (CMV) enhancer is widely used fortransgene expression, although other alternatives exist

2 Mol Reprod Dev (2012)

Molecular Reproduction & Development CHENG ET AL.

(Hallauer and Hastings, 2000; Arai et al., 2003; Bouloset al., 2006). Zarrin et al. (1999) found that in B lymphoidcell lines, the CMV enhancer is more efficient than theRous sarcoma virus (RSV), SV40 viral, and Vll cellularpromoters. In this study, our aim was to build a series ofpromoters/enhancers bearing at least one or both of thefollowing characteristics: the ability to promote high levels oftransgene expression inmilk and the ability to direct expres-sion specifically in the mammary gland. To this end, weconstructed vectors expressing recombinant hLF (rhLF)under the control of various combinations of the followingregulatory sequences: goat b-casein promoter, bovineas1-casein promoter, goat BLG promoter, CMV enhancer,chicken b-globin insulator, and SV40 polyadenylation(SV40 pA) sequences. The ability of these chimericpromoters/enhancers to drive high levels of mammary-specific rhLF expression in transgenic mice was examined.

RESULTS

Construction of cDNA-hLF Expression CassettesWith Hybrid CMV Enhancer and Milk ProteinPromoter

We generated two classes of vector-based cDNA-hLFexpression cassettes. The Class 1 vectors (Constructs A,B, and C) were hybrid promoter/enhancer vectors con-structed by using a CMV enhancer (Constructs A, B, andC), a chicken b-globin insulator (Construct A), and a SV40polyadenylation signal (SV40pA; Constructs A, B, and C)along with a milk protein regulatory sequence, which wasproduced as follows: a fragment of the 588-bp CMV enhan-cer and a fragment of the 241-bp SV40pA were inserted inthe position between the 50-flanking region and the cDNA-hLF, and in the region between the cDNA-hLF and the 30-flanking region inConstruct A (pgCNCG/LF25; Fig. 1, upperpanel), Construct B (pbCNCS/LF36; Fig. 1, middle panel),andConstruct C (pgBLC/LF14; Fig. 1, lower panel), respec-tively. In Construct A (pgCNCG/LF25), in addition to theinsertion of both theCMVenhancer andSV40pA, the 2.4-kbbinary chicken b-globin 50-HS4 region containing a 250-bpinsulator core element was used as an insulator. Thissequence was linked upstream of the goat 50-b-caseinsequence (Fig. 1, upper panel).

Class 2 vectors (Constructs Ac, Bc, Cc) contained thebasic components of the milk protein regulator sequencesand SV40pA including bovine as1-casein, goat b-casein,and goat b-lactoglobulin, all of which contained a transcrip-tion start position, exon 1, or/and exon 2 (except for 50-BLG,which had exon 1 only). In addition, both vector Construct B(pbCNCS/LF36) and control Construct Bc (pbCN/LF203)consisted of exon 1 and exon 2 of the 50-casein regulatorysequence; a part of intron 17; all of intron 18, exon 19, the30-UTR, and the terminator in 30-casein gene.

Production of Transgenic MiceWe used six mammary expression vectors (Class 1:

Constructs A, B, and C; Class 2: Constructs Ac, Bc, Cc)

to produce transgenic mice. As indicated in Table 1, thenumber of zygotes collected for the six hLF transgenicconstructs ranged from 403 to 2,065, and 295–1,438micro-injected embryos were transferred into 9–41 recipients.Approximately 33–80 newborns were delivered fromeach transgenic construct. Transgenic founder animalswere identified by PCR amplification of genomic tailDNA, by Southern blotting, and finally by sequencing(Fig. 2). Approximately 5–7 hLF-positive transgenic F0mice were produced for each construct, and as a result,a total of 33 transgenic founders were obtained (Table 1).This further led to the generation of 26 lines (Construct A: 3lines, Construct Ac: 4 lines, Construct B: 5 lines, ConstructBc: 5 lines, Construct C: 4 lines, and Construct Cc: 5 lines),which were used for hLF expression experiments (Table 2).Ten founder males bearing the transgene were mated withC57 females. These females delivered pups in 36 litters,with 16 female and 20 male F1 progeny that were identifiedas transgenic.

Secretion of Recombinant hLF Into MilkOutof all the transgenic lines (n¼ 31), rhLFwasdetected

in the milk of 15 founder females and 16 F1 females(Table 2) using an enzyme-linked immunosorbentassay (ELISA). As shown in Figure 3, rhLF expression inthe milk of transgenic mice was more efficient using thehybrid promoter/enhancer (i.e., Constructs A, B, and C)than that generated using other transgenic constructscontaining only a single promoter (i.e., Controls and Con-structs Ac, Bc, and Cc). In the three Construct A lines, rhLFwas expressed at levels of 2.84–8.10mg/ml in the twofounder females and at levels of 2.69–3.84mg/ml in thetwo F1 females (from one male ID #9). It is worth notingthat a founder mouse (ID #2) in Construct A expressedthe highest level of rhLF (8.10mg/ml among all groups(P<0.01, Table 2). Among the five lines of founder micefrom the Construct B group, the rhLF expression inmilk in four lines of founder mice was 1.17–6.0mg/ml at�9.5 weeks of age. No data on rhLF expression couldbe obtained from one transgenic male because thisfounder had no descendants. For the Construct C lines,two founderand fourF1 femalesexpressed rhLFat levels of1.49–3.45mg/ml. These rhLF concentrations in the milkwere equivalent to concentrations reported in human colos-trum (Nagasawa et al., 1972). As shown in Table 2, sevenlines of female foundermice carryingConstruct Ac (ID #193and #208), Construct Bc (ID #107, #148, and #113), aswell as Construct Cc (ID #7B and #18B), and 10 F1 femalemouse lines, including three Construct Ac lines (ID #F67,#F69, and #F71), two Construct Bc lines (ID #F56and #F68), and five Construct Cc lines (ID #F5, #F9,#F12, #F44, and #F45), showed little or extremely lowlevels of rhLF (7–90 ng/ml) in their milk when tested at�9.5 weeks of age.

Todetermine thepossibility of ectopic expressionof rhLFin the transgenic animals, we analyzed rhLF levels in thesalivaandbloodof lactatingmice.Therewereno indicationsof rhLF expression in the serum or saliva collected from

Mol Reprod Dev (2012) 3

RHLF EXPRESSION IN MICE DRIVEN BY HYBRID PROMOTER

Figure 1. Structure of constructs containing regulatory elements and cDNA-hLF for mammary gland-specific expression. All constructs weredivided into two classes based on the presence or absence of CMV enhancer. Construct A (pgCNCG/LF25): The vector contained a hybridpromoter/enhancer consisting of a binary chicken b-globin insulator, CMV enhancer, the goat b-casein promoter sequence, and SV40polyadenylation site, SV40pA (pA); Construct Ac (pgCN/LF18): Control of Construct A, contained all components of Construct A, exceptCMV. Construct B (pbCNCS/LF36): The expression vector contained a hybrid promoter/enhancer consisting of the bovine as1-casein promoter,CMV enhancer, and pA; Construct Bc (pbCN/LF203): Control of Construct B, contained all components of Construct B, except CMV. Construct C(pgBLC/LF14): This vector contained a hybrid promoter/enhancer consisting of goat b-lactoglobulin (BLG) promoter, CMV, and pA.Construct Cc(pBnF95): Control of Construct C, contained all components of Construct C, except CMV. cDNA-hLF, 2.32 kb;& chicken b-globin insulator,2.4 kb; 50 goat b-casein promoter, 6.175 kb; 30 goat b-casein promoter, 7.146 kb; CMV enhancer, 0.588 kb; SV40pA,pA, 0.242 kb; 50 bovine aS1-casein promoter, 5.579 kb; 30 bovine aS1-casein promoter, 1.44 kb; 50 goat b-lactoglobulin, 4.132 kb;

30 goat b-lactoglobulin, 1.784 kb. CMV Fwas used as the forward primer, and LFRwas used as the reverse primer for CMV/LF detection. Ac Fwas used as the forward primer andAcRwas used as the reverse primer for Construct Ac. Bc Fwas used as the forward primer, andBcRwas usedas the reverse primer for Construct Bc. Cc Fwas used as the forward primer, andCcRwasused as the reverse primer for Construct Cc. The detailedsequence of primers is indicated in Table 3. Digoxigenin (DIG)-labeled hLF cDNA (2.3 kb) was used as a probe for Southern blot hybridization, asshown in Figure 1. Hybridization was performed after genomic DNA was digested with EcoRI. The sizes of the detected fragments in transgene-positivemicewere 3,697bp (Construct A), 4,462bp (Construct B), and 5,743bp (Construct C). Because Constructs Ac, Bc, and Cc lacked CMV(588bp) only, the relative sizes of the detectable fragments (digested with EcoRI) for control cDNAs were 3,109bp (Construct Ac), 3,874bp(Construct Bc), and 5,155bp (Construct Cc).

TABLE 1. Production of hLF Transgenic Founder Mice (F0) and F1 Offspring

Construct

No. ofcollectedzygotes

No.(%) ofinjectedzygotesa

No.(%) of

embryostransferreda

No. ofrecipients

Averageno. of

embryos/recipient

No.(%) of

recipientspregnant

Total No.(%) of F0b

No.(%, sex) ofpositive F0c

No.of F1

No.(%, sex) ofpositive F1d

A 2,065 1,652 (80.0) 1,438 (69.6) 41 35 13 (31.7) 80 (5.6) 7 (8.8, 5F, 2M) 32 9 (28.1, 4F, 5M)B 1,768 1,415 (80.0) 1,248 (70.6) 27 46 8 (29.6) 49 (3.9) 5 (10.2, 4F, 1M) 22 5 (22.7, 1F, 4M)C 1,641 1,473 (89.8) 1,297 (79.0) 21 61.8 7 (33.3) 69 (5.3) 5 (7.2, 2F, 3M) 6 6 (100, 4F, 2M)Ac 430 352 (81.9) 317 (73.7) 9 35 4 (44.4) 39 (12.3) 5 (12.8, 2F, 3M) 14 7 (50, 4F, 3M)Bc 403 331 (82.1) 295 (73.2) 10 29 5 (50.0) 41 (13.9) 6 (14.6, 3F, 3M) 6 3 (50, 2F. 1M)Cc 644 531 (82.4) 468 (72.7) 25 19 5 (20.0) 33 (7.1) 5 (15.2, 3F, 2M) 8 6 (75, 5F, 1M)

F, female; M, male.aThe percentage was calculated based on the number of zygotes collected.bThe percentage was calculated based on the number of embryos transferred.cThe percentage was calculated based on the number of F0 offspring delivered.dThe percentagewas calculated based on the number of F1 offspring delivered, Positive F1 offspring were pooled for analysis in the table, therewere derivedfrom several transgenic line(s).



any of the transgenic mice (Table 2). By pooling the dataof rhLF expression from three hybrid promoter/enhancer groups, the average expression level in trans-genicmice lineswas reported to be 4.38, 3.24, and 2.43mg/ml for Constructs A, B, and C (P>0.05), respectively, asshown in Figure 3. Overall, the Construct-A group[particularly one founder (ID #2)] generated higher averagelevels of rhLF expression in the milk of transgenic micecompared to other groups (Constructs B and C; P< 0.01;Table 2).

Whey was separated from the milk of the followingtransgenic mice: ID #2 (Construct A), #4 (Construct B),#13 (Construct B), and #19 (Construct C). Western blotanalysis revealed that the samples from thesemice showedthe same band as that of the native hLF protein control, witha molecular size of �80 kDa (Fig. 3); however, this bandwas not observed in samples from normal mice used asControls. These results indicated that the rhLF proteinpresent in the milk of transgenic mice carrying the geneConstruct A (pgCNCG/LF25), B (pbCNCS/LF36), and C(pgBLC/LF14) had the samemolecular weight as that of thenative protein.

DISCUSSION

Our study has clearly demonstrated that the constructionof a multiplex promoter/enhancer is an attractive alternativefor improving the expression of valuable proteins of eco-nomic interest and for achieving their overexpression in themammaryglandsof transgenic animals.We found that whentheCMVenhancerwas inserted in theexpression vectors, alltransgenic female mice expressed significantly higher hLFlevels in the milk compared to those expressed of non-CMVtransgenic controls. Therewere variations in hLF expressionamongConstructsA,B,andC;however, thesedifferences inhLF levels were not statistically significant.

Promoters of milk protein genes have been used totarget high-level expression of foreign proteins in the milkof transgenic mice. Lee et al. constructed a mWAPpromoter/hLF cDNA fusion transgene, but only attainedan hLF expression of 4.8�10�4mg/ml (Kim et al., 1998).In this study, hLF cDNA expression was driven by a 2-kbbovine b-casein promoter, and the hLF protein expressionin the milk of seven transgenic mice was reported in therangeof 1�10�3 to 0.2mg/ml. To inducehigher expression

Figure2. Identification of transgenicmice.A: PCR screening of Construct A founders usingCMV/LF primers. LaneM:DL2000DNAmarker; LaneP: positive control of Construct A vector; Lane N: non-transgenic mice as negative control; Lane 1–7: PCR results of the samples obtained fromtransgenic mice; Lanes 4, 6, and 7 show positive results for the founders numbered as #2, #9, and #99. B: Southern blot hybridization oftransgenic founders of Construct A. Genomic DNA of putative PCR-positive founders was digested by EcoRI. Using a DIG-labeled hLF probe, a3,697-bp fragment was detected in Construct A. Lane P: positive control of Construct A vector; Lane N: non-transgenic mice as negativecontrol; Lane 1: Sample of Founder#2; Lane2: Sample of Founder#9. Founders#2and#9were positive for Construct A.C:Multiple alignmentof the targeted hLF cDNA (239bp) sequence with the PCR-amplified fragments from transgenic mice, designated as Constructs A, B, C, Ac, Bc,and Cc. The PCR amplification was performed using the primers indicated in Figure 1 and Table 3. The results obtained from the transgenicfounders carrying Constructs A, B, C, Ac, Bc, and Cc showed a 100% match between a homologous 239-bp sequence and the targeted hLFcDNA.



TABLE 2. Expression Profiles of rhLF in Milk, Serum, and Saliva of Transgenic Mice

TransgeneConstruct Regulatory elements

FounderID # (sex) F1 ID # (sex)

Expression in mg/ml (mean�SEM)*

Milk Serum/saliva

A Goat b-casein-CMV-2�b-globin 2 (F) 8,100� 930A

No/no

99 (F) 2,840� 410B

9 (M) F18 (F) 3,840� 460B

F27 (F) 2,690� 860B

B Bovine as1-casein-CMV-SV40 4 (F) 4,300� 880B

No/no

13 (F) 1,500� 360C

42 (F) 1,170� 850C

46 (F) 6,000� 710D

8 (M) NoC Goat b-lactoglobulin-CMV-SV40 19 (F) 1,580� 750C

No/no

25 (M) F6 (F) 3,450� 380B

F7 (F) 3,180� 340B

23 (M) F1 (F) 2,310� 480B

F9 (F) 2,540� 460B

48 (F) 1,490� 670C

Ac Control of A, goat b-casein 193 (F) 0.016� 0.0011E

No/no

208 (F) 0.015� 0.0094E

236 (M) F67 (F) 0.011� 0.0014E

F69 (F) 0.019� 0.0025E

237 (M) F71 (F) 0.023� 0.0032E

Bc Control of B, bovine as1-casein 107 (F) 0.007� 0.0013E

No/no

148 (F) 0.040� 0.0016E

113 (F) 0.030� 0.0029E

164 (M) F56 (F) 0.020� 0.0021E

181 (M) F68 (F) 0.040� 0.0023E

Cc Control of C, goat b-lactoglobulin 7B (F) 0.090� 0.0030E

No/no

18B (F) 0.012� 0.0039E

E7 (M) F5 (F) 0.030� 0.0091E

E8 (M) F9 (F) 0.008� 0.0016E

F12 (F) 0.014� 0.0037E

25B (F) F44 (F) 0.020� 0.0055E

F45 (F) 0.016� 0.0024E

aValues within the same column with different superscripts (A,B,C,D,E) differ, P<0.01.

Figure 3. Analysis of recombinant hLF expression in the milk of transgenic mice by Western blot and ELISA. A: SDS–PAGE and Western blotanalysis of the milk from transgenic mice. Lane M: molecular weight standards; Lane P: hLF Control (Sigma), size, �80 kDa; Lane N: wheyobtained from themilk of non-transgenic mice; Lane#2: whey obtained from Construct A transgenic Founder #2; Lane #4: whey obtained fromConstruct A transgenic Founder#4.B: Comparison of recombinant hLF expression in themilk of transgenicmicewith different hybrid expressioncassettes. Data are represented as mean�SEM. The first two bars provide a comparison of rhLF expression in the milk of transgenic micecontaining Construct A (4 females, 4.37mg/ml) and Construct Ac (5 females, 17 ng/ml. The next two bars compare the rhLF expression inConstruct B (4 females, 3.24mg/ml) and Construct Bc (5 females, 27 ng/ml). The last two bars provide a comparison of rhLF expression inConstruct C (6 females, 2.43mg/ml) and Construct Cc (7 females, 27 ng/ml). ELISA results indicated that there was no significant differencein hLF expression in the milk of transgenic mice containing Constructs A, B, and C.



of the protein, an expression cassette comprising of a 10-kbbovine b-casein gene promoter and the hLF genomicsequence, in place of the cDNA, was constructed. Thisled to anhLFexpression of 0.06–6.6mg/ml in themilk of fivetransgenic mice (Kim et al., 1998; van Berkel et al., 2002;Liu et al., 2004). Nuijens et al. (1997) produced transgenicmice harboring either an hLF cDNA or a genomic hLFsequence fused to the regulatory elements of the bovineas1-casein gene. They found that the expression of rhLF inthe milk was approximately 0.2mg/ml in the cDNA linesand 2.5mg/ml in the genomic lines. Use of a constructcarrying the entire hLF genomic sequence was capableof producing rhLF at concentrations ranging from 0.29to 8mg/ml in mice, and 2.5–3.4mg/ml in cows (van Berkelet al., 2002; Yang et al., 2008).

Bioinformatic approaches have shown that the CMVenhancer contains a wide range of cis-elements (Meierand Stinski, 1996) as well as CAAT and TATA signals.Previous studies have already shown that the CMV enhan-cer can drive transgenic expression (Xia et al., 2006). In thepresent study using transgenic mice, we explored thepossibility of designing vector(s) for a robust mammarygland-specific, high-level expression of rhLF. Our resultsdemonstrated that Construct A (pgCNCG/LF25), whichcontained the CMV enhancer, regulatory sequences ofgoat b-casein, and two chicken b-globin insulator frag-ments, yielded a rhLF expression level of 8.10mg/ml inthe milk of one transgenic mouse line. In addition, noexpression of rhLF was detected in the serum or salivacollected from any of the transgenic mice. To date, theseare the highest rhLF levels reported in an expressionmodelusing a short cDNA target, rather than genomic hLF, in thecontext of a variety of studies examining tissue-specificexpression of exogenous genes in vivo (Shi et al., 2009).Our results indicate that although the CMV enhancer is nottissue-specific, a hybrid promoter/enhancer combined withmammary protein regulatory sequences and aCMVenhan-cer possesses a unique control function necessary for bothmammary gland-specific expression and high-level expres-sion in transgenic mice.

In our study, no rhLF expression was detected in theserum or saliva collected from transgenic mice with a hybridpromoter/enhancer or from the controls. Thus, it is reason-able to assume that rhLF was only expressed in the milk ofthe mouse constructs driven by vectors containing milkprotein promoters, and inclusion of the CMV enhancer didnot increasenon-specific expression in theserumandsaliva.We hypothesize that the CMV sequence acts as a specificsupplemental enhancer in the hybrid expression cassettesrather than a promoter for non-specific expression. We alsohypothesize that the 588-bp CMV enhancer can activate thebovine as1-casein, goat b-casein, and BLG promotersdirecting mammary-specific cDNA-hLF expression, particu-larly in transgenic mice used in this study.

Our aim was to create a set of highly efficient promoters/enhancers that could be used in mammary-specific expres-sion systems. We chose to combine several regulatoryelements, which included sequences from bovineas1-casein, goat b-casein, BLG, and chicken b-globin

(Brakebusch et al., 2011), along with the CMV enhancerand SV40pA sequence. To understand if the hybridpromoter/enhancer containing casein/BLG and CMV acti-vates expression of the targeted gene and to compare thecharacteristics of transgenic expression, we constructedcontrol vectors that contained only casein or b-lactoglobulinpromoterswithout theCMVenhancer.Thehybridandcontrolvectors were tested in transgenic mice to assess theirefficacy in mammary-specific expression. It should be notedthat some expression cassettes fail to function in someindividual animals due to ‘‘transgene silencing,’’ a phenom-enon with a particularly high frequency in mice (up to 70%),but much less so in livestock, such as the BLG-A1AT mini-genedescribedby Dr.Clark’s laboratory (Clarket al., 1992;Yull et al., 1997). The optimally constructed BLG-A1ATtransgene was remarkable in providing very high levels ofexpression, but was silenced in 30% of the transgenic mice,with little or no detectable levels of A1AT (Clark et al., 1992;Yull et al., 1997). In our study, wedid not observe ‘‘transgenesilencing’’ in our lines when the CMV enhancer was insertedin the expression cassettes. We believe that there may besome differences in vector construction or in the expressionpatterns of A1AT versus hLF, resulting in differences inBLG-driven expression of the two transgenes.

ELISA analysis revealed that in the threemouse founderlines that integrated the transgene driven by the casein/CMV enhancer or the BLG/CMV enhancer hybrids, rhLFwas expressed in the milk at an average concentration of3.25mg/ml. One of the founder lines containing the Con-struct-A (pgCNCG-LF25) transgene expressed rhLF at aparticularly high concentration of �8.1mg/ml. In contrast,the other 14 lines that did not have the CMV promoter, thatis, Construct Ac (pgCNG/LF18), Construct Bc (pbCN-LF203), and Construct Cc (pBnF95), exhibited a very low(7–90 ng/ml) quantity of rhLF (Table 2). In three of thegroups showing a high expression of rhLF (11 lines fromConstructs A, B, and C), there was an approximate100,000-fold increase in target protein expression in themilk of transgenic mice (P< 0.01). Additionally, in thisstudy, the comparison of lines with a transgene containinga hybrid promoter/enhancer and casein/CMV enhancer orBLG/CMV enhancer with those containing only the promo-ter revealed obvious differences in milk rhLF expressionlevels. In view of this large difference, we can conclude thatthe vectors that are driven by the hybrid promoter/enhancershow increased activities and have a potentially betterstability required for high levels of transgene expressionin the milk. Moreover, although the data were insufficient tostatistically confirm the interrelationship between the hybridpromoter/enhancer and elimination of the position effect,we can deduce that the use of promoter/enhancermarkedlysuppressed the position effect. Noticeably, there was nolocus control region sequence in Constructs B and C;however, in mice carrying these transgenes, rhLF wasexpressed in a mammary-specific manner and at highlevels in the milk. In contrast, transgenic mice carryingConstruct Ac, which contained locus control regions aswell as casein regulatory elements, did not express hLF,and rhLFwasnot detectable in theirmilk. To our knowledge,



this is the first study to demonstrate theuseof a casein/CMVor a BLG/CMV hybrid promoter/enhancer to drive theexpression of a functional gene, thereby producing veryhigh levels of transgene expression in themilk of transgenicmice.

In all our experiments, hLF cDNA served as the targetgene. Most studies have achieved very low levels of cDNAexpression in the mammary gland of transgenic mice(Petitclerc et al., 1995; Bianchi et al., 2009). The expressionlevel of rhLF reported in our study (8.1mg/ml) may be thehighest level reported to date, regardless of the use of cDNAsequence. Previously reported levels have been in the rangeof 6.6–8.02mg/ml, respectively (Kim et al., 1998; Liu et al.,2004). Recently, the 50-kb mWAP-hLF hybrid gene locuscontaining the whole hLF genomic DNA-directed hLFexpression that ranged from 16.7 to 29.8mg/ml in fivetransgenic lines (Shi et al., 2009). Because we did notconstruct a vector containing genomic hLF, we are uncertainif we could have achieved even higher expression of hLFby such a genomic expression vector.

Although many long regulatory elements have beenuseful for driving targeted transgene expression in milk,low efficiency and uncertain expression are seen in mosttransgenic individuals (Bosze and Hiripi, 2012). This hascaused researchers to spend considerable time and effortproducing animals over-expressing these transgenes. Inthe present study,we demonstrated that, compared to long-fragment vectors, hybrid promoters/enhancers incorporat-ing mammary-specific sequences ascribe a high level ofstability and an efficient expression in transgenicmice. Thisis the first time that a synergistic effect has been reportedby the use of binary or ternary promoter/enhancer elementsfor mammary-specific expression of rhLF in the milk oftransgenic mice. In addition, our study showed that theexpression of ternary hybrid promoter/enhancer/insulatorelement-driven transgene in themilk of transgenicmicewasslightly higher than that of the binary element-driven trans-gene. In summary, our ternary hybrid promoter/enhancerdesign containing a casein or a BLG promoter, a CMVenhancer, and a binary chicken b-globin insulator can beconsidered a first step toward creating and validating animproved mammary gland-specific vector, which ensureshigh-level expression of the transgene, independent of theintegration site. This newly developed vector may be usedas a robust promoter for gene-specific expression, particu-larly to direct mammary-specific expression of transgenes,similar to the CAG promoter that consists of the CMVenhancer, the chicken b-actin promoter, and an intron(Xu et al., 2001; Ito et al., 2006; Shi et al., 2012). Furtherconfirmation of the efficacy of this unique hybrid promoter/enhancer vector is currently underway in domestic animals,such as rabbit, goat, pig, and cattle.

MATERIALS AND METHODS

ReagentsAll chemicals were purchased fromSigmaChemical Co.

(St. Louis, MO), unless otherwise indicated.

Hybrid Promoter Constructs and ExpressionVector Constructs

A 2.32-kb hLF cDNA was amplified by PCR using ahumanmammary gland cDNA library (Invitrogen Life Tech-nologies, Carlsbad, CA; Cat. No. 8903026) as a templateand primer set LF1 (Table 3). Both bovine casein and hLFcDNA primer sequences were obtained from the GenBankdatabase. All primers (Table 3) were edited using thePremier 5.0 software, and were designed to contain appro-priate restriction enzyme recognition sites at the 50 and 30

ends of the amplified fragments. The fragments (preparedas described above) were then cloned into a pGEM-T EasyVector (Promega Corporation, Madison, WI; Cat. No.A3600) to generate pGEMT-hLF. In the final construct,hLF cDNA was preceded by the respective milk proteinregulatory sequence. In some vectors, the CMV enhancerwas inserted between the milk protein regulatory sequenceand hLF cDNA sequence (Fig. 1).

Three expression vectors consisting of a combinedpromoter/enhancer were generated and defined as (1)Construct A (pgCNCG/LF25), (2) Construct B (pbCNCS/LF36), and (3) Construct C (pgBLC/LF14; Fig. 1). Theapproach used for the construction of these vectors isdescribed in detail below.

(1) Construct A: The alternative name of Construct A ispgCNCG/LF25. As indicated in Figure 1, the 50 regula-tory sequences of goat b-casein (length, 6.18 kb) con-tained a 4.10-kb 50 regulatory sequence, TATA box,exon 1, and exon 2. The 7.15-kb 30 regulatory sequenceof goat b-casein was used as a downstream regulatoryelement and as a terminator for driving intensifyingexpression of cDNA-hLF. The 2.45-kb double-elementof the chicken b-globin insulator was obtained from theplasmid pBC1 (Invitrogen Life Technologies, Cat.No. K270-01). The immediate-early promoter of CMV(588-bp), which contained the CAAT signal and theTATA signal, was obtained from the pcDNA3.1 plasmid(Invitrogen Life Technologies; Cat. No. V044-50). TheSV40 polyadenylation signal site (SV40pA), included242-bp transcription termination signal sequencesobtained from the pcDNA3.1 plasmid.

The plasmid pBC1 containing the binary chickenb-globin insulator and 50 and 30 regulatory regions ofgoat b-casein was purchased from Invitrogen Life Tech-nologies (Cat. No. K270-01). The SalI–XhoI fragmentsof the CMV enhancer were isolated and ligated into theXhoI site of pBC1. The SalI–XhoI sites were then elimi-nated, and the remaining single XhoI site was retainedfor ligation. The cDNA sequence of the hLFgene clonedin the pGEMT-Easy plasmid was digested with XhoI,and a fragment of 2.32 kb containing ATG codons wasinserted into the XhoI site. The total length of ConstructA was 18.87 kb. This combination of the 50 flankingpromoter and the CMV enhancer is hereafter referredto as a hybrid promoter/enhancer.

Construct Ac, with the alternative name pgCN/LF18, served as a control vector for Construct A. The18.28-kb vector largely consisted of the elements of



Construct A, but without the 588-bp CMV enhancer(Fig. 1).

(2) Construct B: Alternative name: pbCNCS/LF36. As indi-cated in Figure 1, the 50 flanking region (5.58 kb) ofbovine as1-casein regulatory sequence was amplifiedfrom bovine genomic DNA by PCR using a bovine as1-casein primer set (Table 3), which included the TATAbox and was located between bases �4,142 andþ1,437 relative to the transcriptional start position inConstruct B. The 30 downstream regulatory region ofbovine as1-casein (a 1.44-kb fragment) was amplifiedfrom bovine genomic DNA, and was located betweenbases þ16,295 þ17,735 in pbCNCS/LF36. The CMVenhancer-SV40pA fragment withSalI ends cloned fromthe pCEPC4 plasmid (Invitrogen Life Technologies;Cat. No. V044-50) was inserted into the SalI sitebetween the upstream regulatory region and thedownstream regulatory region to generate pGEMT-bCN-CMV-40pA. The 2.32-kb fragment of hLF cDNAwith XhoI ends was then inserted into the XhoI siteof pGEMT-bCN-CMV-40pA in the correct orientationto construct pbCNCS/LF36. The resultant 10.17-kbvector was sequenced to confirm the sequence (SBSCompany Service, Beijing, China).

Construct Bc, with the alternative name pbCN/LF203, served as a control vector for Construct B.The 9.58-kb vector largely consisted of the elementsof Construct B, but lacked the CMV enhancer (Fig. 1).

(3) Construct C: Alternative name: pgBLC/LF14. As indi-cated in Figure 1, the 50 and 30 flanking regions wereobtained from goat BLG regulatory DNA sequencesspanning the bases �4,149 to �17 (4.13 kb) and thebases þ6,254 to þ8,037 (1.78 kb), which were gener-ated by PCR from genomic DNA obtained from goatskin tissue using a goat BLG primer set (Table 3) andcloned into the pGEM-T vector to form pGEM-gBLG.For Construct C, pCEP-4/LF was first generated byinsertion of a 2.3-kbXhoI DNA fragment encompassingthe hLF coding region from pGEMT-hLF into the XhoIsite of pCEP-4. A 3.15-kb SalI–SalI fusion fragment ofCMV enhancer-hLF-SV40 was then recovered frompCEP-4/LF and ligated into pGEM-gBLG, which hadbeen digested with XhoI. Finally, pgBLC/LF14 with asize of 9.07 kb was constructed.

Construct Cc, with the alternative name pBnF95,served as a control vector for Construct C. The 8.48-kb vector largely consisted of the elements of ConstructC, but lacked the CMV enhancer (Fig. 1).

TABLE 3. Oligonucleotide Primers Used for Preparation of Milk Protein Regulatory Sequences, the CMV Enhancer, andhLF cDNA, and for Detection of Transgenic Mice

Primer sets Sequence (50–30)aCorresponding

regionb or functionProductsize (kb) Constructs

Bovine as1-caseinCN1 ggaagcttAGTTCTCCCTTACCCAGTCTATTTCTGG

�4,142 to þ1,437 5.579 Construct B (pbCNCS/LF36)CN2 tacgtaGGCAAGAGCAACAGCCACAAGACAGGCN3 ggctcgagaAGGTCAATGAACTGAGCAAGGTAAGG

þ16,295 to þ17,735 1.440 Construct Bc (pbCN/LF203)CN4 gcaagcttCGGGTGTTGGTCATGGACAGGGoat b-lactoglobulinBLG1 aggtcgacGTGTTCTGCTGTTTGGGTCTTTAGTGTCTCC

�17 to 4,149 4.132 Construct C (pgBLC/LF14)BLG2 tactcgagGCTGGGGTCGTGCTTCTGAGCTCTGBLG3 atctcgagCAGCTGGTGAGCCCCTGCCGGTGCCTC

þ6,254 to 8,037 1.784 Construct Cc (pBnF95)BLG4 atgcggccgCACAACTCTGCAGGCCGGGAAGC-CMV enhancerCM1 tatgtcgacGTTGACATTGATTATTATTG

Enhancer 0.58

Construct A (pgCNCG/LF25)CM2 gaggctcgagGAGCTCTCTGCTTATATAGA Construct B (pbCNCS/LF36)

Construct C (pgBLC/LF14)hLF cDNALF1 gtctcgagCATGAAACTTGTCTTCCTCG

hLF coding region 2.3 All vectorsgctcgagAGCAGGGAATTGTAAGCAGACMV/hLFCMV/LF F: ATGGGCGTGGATAGCGGTTTGAC

Detection of mice 0.45

Construct A (pgCNCG/LF25)R: GCTACGACACTGGGAACTACCACC Construct B (pbCNCS/LF36)

Construct C (pgBLC/LF14)Milk protein regulatory region/hLFAc F: GATTGACAAGTAATACGCTGTTTCCTC

Detection of mice

2.5 Construct Ac (PgCN/LF18)R: CATCAGAAGTTAAACAGCACAGTTAGBc F: CCATAAATCTAGGGTTTG

1.23 Construct Bc (pgCN/LF14)R: TCAAGAATGGACGAAGTGTCc F: GTCATTAAGTTCATAGCCCAT

1.87 Construct Cc (pBnF95)R: TCAAGAATGGACGAAGTGT

aNucleotide sequences written in lower case letters contain recognition sites for restriction enzymes and link to the template sequences for amplificationwritten in upper case letters.bTranscription units begin at position þ1.



All vectors were verified by sequencing (Invitrogen Cor-poration and Applied Biosystems, Inc., Shanghai, China)and used for microinjection to generate transgenic mice.The double-stranded DNA fragments ranging from 8.24 to18.87 kb were extracted from the plasmids using SalI andNotI digestion, and further purified with the QIAquick GelExtraction kit (QIAGEN, Cat. No. 28704, Germany) prior tomicroinjection.

Generation of Transgenic MiceThe purified transgenes were microinjected into one

pronucleus (usually the male pronucleus) of fertilizedeggs from ICF1 (C57BL/6� ICR) superovulated femalemice. The transgene-bearing pronuclei were then trans-ferred to recipient foster mothers of the same strain. Syn-chronization of the estrus cycle and the protocols forsurgery and embryo transfer have been described else-where (Nagy et al., 1997; Houdebine, 2003).

Transgenic founder animals were identified by PCRanalysis of genomic DNA extracted from tail tips. PCRwas performed by using CMV enhancer-hLF-specific orcasein-hLF-specific primers (Table 3, CMV/hLF set;Fig. 1); a total of 30 cycles were carried out, with eachcycle comprising of the following conditions: 45 sec at94�C, 1min at 61�C, and 30 sec at 72�C. The reactionproducts were separated on a 1.4% agarose gel, stainedwith ethidiumbromide, and photographed (Sambrook et al.,1989).

Southern blot analysis was further performed to verifythe putatively transgene-positive founders, and the positionof the digestion site and the probe is shown in Figure 1.Briefly, the putative foundermice genomicDNA (10mg)wasdigested with EcoRI. The digested DNA was separatedusing a 0.8% agarose gel and transferred to a hybridmembrane. The transferred membrane was hybridizedwith digoxigenin (DIG)-labeled hLF cDNA (2.3 kb). Hybri-dization results were obtained by NET/BCIP (DIG-HighPrime DNA Labeling and Detection Starter Kit I; RocheDiagnostics, Indianapolis, IN). Finally, to confirm transgenicintegration, we sequenced the PCR products andcompared them with vector templates using DNAStarbio-software package (DNASTAR, Inc., Madison, WI).Transgenic F1 lines were established by crossing trans-genic founder mice with C57BL/6J mice. Transgenic F1mice were identified by PCR amplification of genomic tailDNA using the same process described above for foundermice.

Milk, Saliva, and Blood CollectionMouse milk was collected as described previously

(Tanida et al., 2001). Briefly, transgenic female foundermice aged 6–7 weeks old were mated with C57 male mice.Female mice were separated from their pups for 3 hr andtreated intraperitoneally with 0.3 IU of oxytocin. They werethen anesthetized using pentobarbitone sodium (25mg/g ofbody weight). Next, 50–200ml of milk was collected once,between 10 and 13 days postpartum, by gently massaging

the inguinal glands at 30min after the oxytocin treatment.Milk samples were diluted for analysis with two volumes ofmilk-buffered saline [125mM NaCl, 25mM Tris, pH 7.4,5mMKCl, 2mMphenylmethylsulfonyl fluoride (PMSF)] andcentrifuged at 4�C for 30min at 12,000g to separate thewhey, casein, and fat fractions. Thedilutedwheywasstoredat �80�C.

Lactating mice were induced to secrete saliva by treat-ment with pilocarpine hydrochloride (Sigma–Aldrich; LotP0472). Saliva was then collected from the mouth. Bloodsamples were collected from the orbital sinus of the ani-mals. All samples were then prepared by centrifugation at7,000�g for 15min at 4�C.

Enzyme-Linked Immunosorbent Assay (ELISA)The amount of rhLF in mouse milk, saliva, and blood

was analyzed by ELISA. Milk, saliva, and blood werecollected as described above. For ELISA, milk sampleswere diluted between 1:10 and 1:80. Serially diluted lacto-ferrin (Sigma–Aldrich; Cat. No. L0520-5 mg) was used as apositive control and standard. Milk from normal mice wasused as a negative control. All samples were coated inmicro-wells and incubated overnight at 4�C. The wells werewashed three times with PBS-T (137mM NaCl, 10mMNa2HPO4, 3mM KCl, 2mMK2H2PO4, 0.05% Tween-20)for 5min and incubated at 37�C with 200ml PBS-T contain-ing 10% fetal calf serum (FCS; Thermo Fisher Scientific,Inc., Logan, UT; Cat. No. SH30070.03). Non-specific reac-tions were blockedwith 200ml PBS containing 10%FCS for120min at 37�C. The wells were then washed three timeswith PBS-T and incubated for 90min at 37�Cwith 100ml of a1:4,000 dilution of rabbit anti-hLF serum (Nordic Immuno-logical Laboratories, Tilburg, The Netherlands). After athorough washing, wells were incubated for 90min at37�C with 50ml of horseradish peroxidase-conjugatedgoat anti-rabbit secondary antibody (1:10,000 dilution;Signalway Antibody, College Park, MD; Cat. No. L3012).After three additional washeswith PBS-T, 50ml of substrate(0.5mg/ml diaminobenzidene, 1mg/ml imidazole, and1ml/ml 30% H2O2 added just before use) was added tothe wells in a dark room at 37�C, and the developed colorwas read at 490 nm on an spectrophotometric platereader (ELX-800 absorbance microplate reader; Bio-Tek,Winooski, VT). The rhLF expression levels were extrapo-lated from a standard curve generated using commercial,purified hLF (Sigma–Aldrich) diluted to 0.25, 0.5, 1, 2, and4mg/ml. The lowest limit of hLF detection by ELISA was0.2 ng/ml.

Western Blot AnalysisProtein samples of skimmilk obtained fromall transgenic

mice were diluted 1:1 in 2� SDS–PAGE sample buffer(100mM Tris–Cl, pH 6.8, 200mM 1,4-dithiothreitol, 4%SDS, 0.2% bromophenol blue, 20% glycerol), denaturedin boiling water for 10min, and loaded onto a 12% denatur-ing polyacrylamide gel (Mini-PROTEANII ElectrophoresisCell; BIO-RAD Laboratories, Hercules, CA). Separated



proteins were transferred to 0.45-mm membranes(polyvinylidene fluoride transfer membrane; BioTrace,Pall Co., Washington, NY; Lot 0701523). The membraneswere then blocked at 4�C overnight in 20mM Tris, 137mMNaCl (pH 7.6), 0.1% Tween-20, and 10% FBS. rhLF wasdetected using a polyclonal rabbit, anti-hLF primary anti-body and a horseradish peroxidase-conjugated goat anti-rabbit secondary IgG (Sino-American Biotechnology Co.,San Diego, CA; Cat. No. GRH807005).

Statistical AnalysisThe expression data for recombinant hLF in the milk

of both hybrid promoter/enhancer and promoter-only(Controls) transgenic mice were subjected to an arc-sintransformation frommilk samples per animal collected overa period of 3–5 days. The transformed data were thenanalyzed and compared using the chi-square test and/orStudent’s t-test. A P-value of <0.05 was consideredsignificant.

ACKNOWLEDGMENTS

This study was supported by grants from NationalMajor Special Projects on New Cultivation for TransgenicOrganisms (2011ZX08008-004, 2009ZX08008-009B); AProject Funded by the Priority Academic Program Devel-opment of Jiangsu Higher Education Institutions (PAPD);and The National Natural Science Foundation of China(31101871).

REFERENCES

Agnew DE, Pfleger BF. 2011. Optimization of synthetic operons

using libraries of post-transcriptional regulatory elements.Meth-

ods Mol Biol 765:99–111.

Alami R, Greally JM, Tanimoto K, Hwang S, Feng YQ, Engel JD,

Fiering S, Bouhassira EE. 2000. Beta-globin YAC transgenes

exhibit uniform expression levels but position effect variegation

in mice. Hum Mol Genet 9:631–636.

Arai Y, IshiwataM, Baba S, Kawasaki H, Kosugi I, Li RY, Tsuchida

T,MiuraK, Tsutsui Y. 2003.Neuron-specific activation ofmurine

cytomegalovirus early gene e1 promoter in transgenic mice. Am

J Pathol 163:643–652.

Barash I, FaermanA,RichensteinM,KariR,DamaryGM,ShaniM,

Bissell MJ. 1999. In vivo and in vitro expression of human serum

albumin genomic sequences in mammary epithelial cells with

beta-lactoglobulin and whey acidic protein promoters. Mol

Reprod Dev 52:241–252.

Bell AC,West AG, Felsenfeld G. 2001. Insulators and boundaries:

Versatile regulatory elements in the eukaryotic. Science

291:447–450.

Benlhabib H, Herrera JE. 2006. Expression of the Op18 gene is

maintained by the CCAAT-binding transcription factor NF-Y.

Gene 377:177–185.

Bianchi M, Crinelli R, Giacomini E, Carloni E, Magnani M. 2009. A

potent enhancer element in the 5’-UTR intron is crucial for

transcriptional regulation of the human ubiquitin C gene.

Gene 448:88–101.

Bosze Z, Hiripi L. 2012. Recombinant protein expression in milk of

livestock species. Methods Mol Biol 824:629–641.

Bosze Z, Baranyi M, Whitelaw CB. 2008. Producing recombinant

human milk proteins in the milk of livestock species. Adv Exp

Med Biol 606:357–393.

Boulos S, Meloni BP, Arthur PG, Bojarski C, Knuckey NW. 2006.

Assessment of CMV, RSV and SYN1 promoters and the wood-

chuck post-transcriptional regulatory element in adenovirus

vectors for transgene expression in cortical neuronal cultures.

Brain Res 1102:27–38.

Brakebusch C, Pihlajaniemi T. 2011. Mouse as aModel Organism

From Animals to Cells. Dordrecht, Heidelberg, London,

New York: Springer. pp 1–10.

Cerdan MG, Young JI, Zino E, Falzone TL, Otero V, Torres HN,

Rubinstein M. 1998. Accurate spatial and temporal transgene

expression driven by a 3.8-kilobase promoter of the bovine beta-

casein gene in the lactatingmousemammary gland.Mol Reprod

Dev 49:236–245.

Cicardi M, Zanichelli A. 2010. Replacement therapy with C1

esterase inhibitors for hereditary angioedema. Drugs Today

(Barc) 46(11):867–874.

Clark AJ, Cowper A, Wallace R, Wright G, Simons JP. 1992.

Rescuing transgene expression by co-integration. Biotechnol-

ogy (NY) 10:1450–1454.

Clark AJ. 1998. The mammary gland as a bioreactor: Expression,

processing, and production of recombinant proteins. J Mam-

mary Gland Biol Neoplasia 3:337–350.

Davis B, Bernstein JA. 2011. Conestat alfa for the treatment of

angioedema attacks. Ther Clin Risk Manag 7:265–273.

deGroot N, vanKuik-Romeijn P, Lee SH, de Boer HA. 1999. Over-

expression of the murine polymeric immunoglobulin receptor

gene in themammary gland of transgenicmice. Transgenic Res

8:125–135.

Dronadula N, Du L, Flynn R, Buckler J, Kho J, Jiang Z, Tanaka S,

Dichek DA. 2011. Construction of a novel expression cassette

for increasing transgene expression in vivo in endothelial cells of

large blood vessels. Gene Ther 18:501–508.

Ebert KM, DiTullio P, Barry CA, Schindler JE, Ayres SL, Smith TE,

Pellerin LJ,MeadeHM,Denman J,RobertsB. 1994. Induction of

human tissue plasminogen activator in the mammary gland of

transgenic goats. Biotechnology (NY) 12:699–702.

Fujiwara Y, Miwa M, Takahashi R, Kodaira K, Hirabayashi M,

Suzuki T, Ueda M. 1999. High-level expressing YAC vector

for transgenic animal bioreactors. Mol Reprod Dev 52:414–

420.

Gehrke S, Jerome V, Muller R. 2003. Chimeric transcriptional

control units for improved liver-specific transgene expression.

Gene 322:137–143.



Giraldo P, Montoliu L. 2001. Size matters: Use of YACs, BACs

and PACs in transgenic animals. Transgenic Res 10:83–

103.

Goldman IL, Kadulin SG, Razin SV. 2002. Transgenic goats in the

World Pharmaceutical Industry of the 21st Century. Russ J

Genet 38:1–14.

Hallauer PL, Hastings KE. 2000. Human cytomegalovirus IE1

promoter/enhancer drives variable gene expression in all fiber

types in transgenic mouse skeletal muscle. BMC Genet 1:1.

Hong-Ying S, Si-Guo L, Jian-Quan C, Ai-Min Z, Guo-Xiang C.

2006. Expression of a variant of human tissue-type plasminogen

activator in transgenic mousemilk. J Exp Anim Sci 43:211–218.

Houdebine LM. 2009. Production of pharmaceutical proteins by

transgenic animals. Comp Immunol Microbiol Infect Dis 32:

107–121.

Houdebine LM. 2003. Animal transgenesis and cloning. Chiche-

ster, UK: John Wiley & Sons, Ltd. pp 14–156.

Ito M, Yokouchi K, Yoshida K, Kano K, Naito K, Miyazaki J, Tojo H.

2006. Investigation of the fate of Sry-expressing cells using an in

vivo Cre/loxP system. Dev Growth Differ 48:41–47.

Khodarovich IuM, Vorob’eva NE, Mezina MN, Piniugina MV,

Prokof’ev MI, Larionov OA. 2008. Expression of human inter-

feron beta in the mammary gland of transgenic rabbits. Bioorg

Khim 34:185–193.

Kim SJ, Yu DY, Han YM, Lee CS, Lee KK. 1998. Cloning of

human genomic lactoferrin sequence and expression in the

mammary glands of transgenic animals. Adv Exp Med Biol

443:79–83.

Lee TH, KimSJ, Han YM, YuDY, LeeCS, Choi YJ, MoonHB, Baik

MG, Lee KK. 1998. Matrix attachment region sequences

enhanced the expression frequency of a whey acidic protein/

human lactoferrin fusion gene in the mammary gland of trans-

genic mice. Mol Cells 8:530–536.

Liu S, Li X, Lu D, Shang S,WangM, ZhengM, Zhang R, Tang B, Li

Q, Dai Y, Li N. 2012. High-level expression of bioactive

recombinant human lysozyme in the milk of transgenic mice

using a modified human lactoferrin BAC. Transgenic Res. 21:

407–414.

Liu Z, Zhao C, Fan B, Dai Y, Zhao Z, Wang L, Zheng M, Feng J,

Chen Y, Duan Y, Li N. 2004. Variable expression of human

lactoferrin gene in mice milk driven by its 90 KB upstream

flanking sequences. Anim Biotechnol 15:21–31.

McCreath KJ, Howcroft J, Campbell KH, Colman A, Schnieke AE,

Kind AJ. 2000. Production of gene-targeted sheep by nuclear

transfer from cultured somatic cells. Nature 405:1066–1069.

McKnight RA, Shamay A, Sankaran L, Wall RJ, Hennighausen

L. 1992. Matrix-attachment regions can impart position-

independent regulation of a tissue-specific gene in transgenic

mice. Proc Natl Acad Sci USA 89:6943–6947.

Meier JL, Stinski MF. 1996. Regulation of human cytomegalovirus

immediate-early gene expression. Intervirology 39:331–342.

Nagasawa T, Kiyosawa I, Kuwahara K. 1972. Amounts of lacto-

ferrin in human colostrum and milk. Journal of Dairy Science

55:1651–1659.

NagyAGM,Vintersten K, Behringer R, editors. 1997.Manipulating

themouse embryo: A laboratorymanual. NewYork: Cold Spring

Harbor Lab. pp 289–358.

Natalie SR. 1999. Biopharmaceutical production in transgenic

livestock. Trends Biotechnol 17(9):367–374.

Nuijens JH, vanBerkel PH,GeertsMEJ,Hartevelt PP, deBoerHA,

Veen HA, Pieper FR. 1997. Characterization of recombinant

human lactoferrin secreted in milk of transgenic mice. J Biol

Chem 272:8802–8807.

Pantano T, Rival-Gervier S, Prince S, Menck-Le Bourhis C,

Maeder C, Viglietta C, Houdebine LM, Jolivet G. 2003. In vitro

and in vivo effects of a multimerized alphas 1-casein enhancer

on whey acidic protein gene promoter activity. Mol Reprod Dev

65:262–268.

Petitclerc D, Altai J, Theron MC, Bearzotti M, Bolifraud P, Kann G,

StinnakreM-G,PointuH,PuissantC,HoudebineL-M.1995. The

effect of various introns and transcription terminators on the

efficiency of expression vectors in various cultured cell lines

and in the mammary gland of transgenic mice. J Biotechnol

40:169–178.

Pipe SW, Miao H, Butler SP, Calcaterra J, Velander WH. 2011.

Functional factor VIII made with von Willebrand factor at high

levels in transgenic milk. J Thromb Haemost 9:2235–2242.

Pohlmeier WE, Hovey RC, Van Eenennaam AL. 2011. Reproduc-

tive abnormalities in mice expressing omega-3 fatty acid

desaturase in their mammary glands. Transgenic Res 20:

283–292.

Reichenstein M, German T, Barash I. 2005. BLG-e1—A novel

regulatory element in the distal region of the beta-lactoglobulin

gene promoter. FEBS Lett 579:2097–2104.

Riego E, Limonta J, Aguilar A, Perez A, de Armas R, Solano R,

Ramos B, Castro FO, de la Fuente J. 1993. Production of

transgenic mice and rabbits that carry and express the human

tissue plasminogen activator cDNA under the control of a bovine

alpha S1 casein promoter. Theriogenology 39:1173–1185.

Sam MR, Zomorodipour A, Shokrgozar MA, Ataei F, Haddad-

Mashadrizeh A, Amanzadeh A. 2010. Enhancement of the

human factor IX expression, mediated by an intron derived

fragment from the rat aldolase B gene in cultured hepatoma

cells. Biotechnol Lett 32:1385–1392.

Sambrook J, Maniatis T, Fritsch EF. 1989. Molecular Cloning:

A Laboratory Manual. New York: Cold Spring Harbor Lab.

pp 215–327.

Serova IA, Dvoryanchikov GA, Andreeva LE, Burkov IA, Dias LP,

BattulinNR,SmirnovAV,SerovOL. 2012. A3,387bp50-flankingsequence of the goat alpha-S(1)-casein gene provides correct

tissue-specific expression of human granulocyte colony-stimu-

lating factor (hG-CSF) in the mammary gland of transgenic

mice. Transgenic Res 21:485–498.



Sharp JA, Cane KN, Mailer SL, Oosthuizen WH, Arnould JP,

Nicholas KR. 2006. Species-specific cell-matrix interactions

are essential for differentiation of alveoli like structures

and milk gene expression in primary mammary cells of the

Cape fur seal (Arctocephalus pusillus pusillus). Matrix Biol

25:430–442.

ShiC,WelshPA,Sass-KuhnS,WangX,McCloskeyDE,PeggAE,

Feith DJ. 2012. Characterization of transgenic mice with over-

expression of spermidine synthase. Amino Acids 42:495–505.

Shi G, Chen H, Wu X, Zhou Y, Liu Z, Zheng T, Huang P. 2009. A

mWAP-hLF hybrid gene locus gave extremely high level

expression of human lactoferrin in the milk of transgenic

mice. Transgenic Res 18:573–582.

Simon M, Antalikova J, Chrenek P, Horovska L, Hluchy S,

Michalkova K, Jankovicova J, Tancin V. 2011. Analysis of the

expression of platelet antigens CD9 and CD41/61 in transgenic

rabbits with the integrated human blood clotting factor VIII gene

construct. Gen Physiol Biophys 30:S83–S87.

Tanida T, Rao F, Hamada T, Ueta E, Osaki T. 2001. Lactoferrin

peptide increases the survival of Candida albicans-inoculated

mice by upregulating neutrophil and macrophage functions,

especially in combination with amphotericin B and granulo-

cyte-macrophage colony-stimulating factor. Infect Immun

69:3883–3890.

van Berkel PH, Welling MM, Geerts M, van Veen HA, Ravensber-

gen B, Salaheddine M, Pauwels EK, Pieper F, Nuijens JH,

Nibbering PH. 2002. Large scale production of recombinant

human lactoferrin in the milk of transgenic cows. Nat Biotechnol

20:484–487.

Wang Y, Tong J, Li S, Zhang R, Chen L, ZhengM,WangM, Liu G,

Dai Y, ZhaoY, Li N. 2011.Over-expression of human lipoprotein

lipase in mouse mammary glands leads to reduction of milk

triglyceride and delayed growth of suckling pups. PLoS ONE

6:e20895.

Xia W, Bringmann P, McClary J, Jones PP, Manzana W, Zhu Y,

Wang S, Liu Y, Harvey S, Madlansacay MR, McLean K, Rosser

MP, MacRobbie J, Olsen CL, Cobb RR. 2006. High levels of

protein expression using different mammalian CMV promoters

in several cell lines. Protein Expr Purif 45:115–124.

Xu ZL, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T,

Hayakawa T. 2001. Optimization of transcriptional regulatory

elements for constructing plasmid vectors. Gene 272:149–

156.

YangP,WangJ,GongG,SunX,ZhangR,DuZ, LiuY, LiR,DingF,

TangB,Dai Y, Li N. 2008.Cattlemammary bioreactor generated

by a novel procedure of transgenic cloning for large-

scale production of functional human lactoferrin. PLoS ONE

3:e3453.

Yull F, Binas B, Harold G, Wallace R, Clark AJ. 1997. Transgene

rescue in themammarygland is associatedwith transcription but

does not require translation of BLG transgenes. Transgenic Res

6:11–17.

Yasunaga M, Oumi N, Osaki M, Kazuki Y, Nakanishi T, Oshimura

M, Sato K. 2011. Establishment and characterization of a trans-

genicmousemodel for in vivo imaging ofBmp4expression in the

pancreas. PLoS ONE 6:e24956.

Yuskevich V, Khodarovich Y, Kagarliskiy G, Stremovskiy O,

Maksimenko O, Lukash S, Polanovsky O, Deyev S. 2011.

Expression of humanized anti-Her2/neu single-chain IgG1-like

antibody in mammary glands of transgenic mice. Biochimie

93:628–630.

Zarrin AA,Malkin L, Fong I, LukKD,GhoseA, Berinstein NL. 1999.

Comparison of CMV, RSV, SV40 viral and Vlambda1 cellular

promoters in B and T lymphoid and non-lymphoid cell lines.

Biochim Biophys Acta 1446:135–139.

Zhang X, Wu Y, Luo F, Su H, Bai Y, Hou Y, Yu B. 2009.

Construction of targeting vector for expressing human GDNF

in cattle mammary gland. Appl Biochem Biotechnol 159:

718–727.

Zhou Y, Lin Y, Wu X, Xiong F, Lv Y, Zheng T, Huang P, Chen H.

2012. The high-level Expression of human tissue plasminogen

activator in the milk of transgenic mice with hybrid gene locus

strategy. Mol Biotechnol 50:137–144.



hybrid expression cassettes consisting of a milk protein promoter and a cytomegalovirus enhancer...

Documents