iai accepts, published online ahead of print on 14 april...
TRANSCRIPT
1
The anti-apoptotic activity of the Coxiella burnetii effector protein AnkG is 1
controlled by p32-dependent trafficking 2
Rita A. Eckart1, Stephanie Bisle1, Jan Schulze-Luehrmann1, Irene Wittmann1, Jonathan 3
Jantsch1, Benedikt Schmid2, Christian Berens3 and Anja Lührmann1* 4
5
1Mikrobiologisches Institut – Klinische Mikrobiologie, Immunologie und Hygiene, 6
Universitätsklinikum Erlangen, Friedrich-Alexander Universität Erlangen-Nürnberg, 7
Wasserturmstraße 3/5, D-91054 Erlangen, Germany 8
2Lehrstuhl für Biotechnik, Department Biologie, Friedrich-Alexander-Universität 9
Erlangen-Nürnberg, Henkestrasse 91, D-91052 Erlangen, Germany 10
3Lehrstuhl für Mikrobiologie, Department Biologie, Friedrich-Alexander-Universität 11
Erlangen-Nürnberg, Staudtstrasse 5, D-91058 Erlangen, Germany 12
13
*Corresponding author: 14
Anja Lührmann1 15
Phone: (+49) 9131 85 22577; Fax: (+49) 9131 85 1001 16
Email: [email protected] 17
18
Running title: AnkG trafficking and apoptosis inhibition 19
20
IAI Accepts, published online ahead of print on 14 April 2014Infect. Immun. doi:10.1128/IAI.01204-13Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
2
Abstract 21
Intracellular bacterial pathogens frequently inhibit host cell apoptosis to ensure 22
survival of their host, thereby allowing bacterial propagation. The obligate intracellular 23
pathogen Coxiella burnetii displays anti-apoptotic activity which depends on a functional 24
type IV secretion system (T4SS). Accordingly, anti-apoptotic T4SS effector proteins, like 25
AnkG, have been identified. AnkG inhibits pathogen-induced apoptosis, possibly by 26
binding to the host cell mitochondrial protein p32 (gC1qR). However, the molecular 27
mechanism of AnkG activity remains unknown. 28
Here, we demonstrate that ectopically expressed AnkG associates with 29
mitochondria and traffics into the nucleus after apoptosis induction, although AnkG lacks 30
a predicted nuclear localization signal. We identified the p32-interaction region in AnkG 31
and constructed an AnkG-mutant (AnkGR22/23S) unable to bind to p32. By using this 32
mutant we found that intracellular localization and trafficking of AnkG into the nucleus is 33
dependent on binding to p32. Furthermore, we demonstrated that nuclear localization of 34
AnkG but not binding to p32 is required for apoptosis inhibition. Thus, the anti-apoptotic 35
activity of AnkG is controlled by p32-mediated intracellular trafficking, which in turn 36
seems to be regulated by host cell processes that sense stress. 37
38
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
3
Introduction 39
Coxiella burnetii is the obligate intracellular bacterial agent of human Q-fever, a 40
worldwide zoonotic disease (1). Infection in humans occurs by inhalation of infectious 41
material transmitted from domestic livestock, and as few as ten bacteria can result in 42
disease (2). After bacterial uptake into phagocytic cells, C. burnetii establishes a 43
phagolysosomal-like vacuole (3, 4, 5). Importantly, establishing this replicative niche 44
requires bacterial protein synthesis (6, 7), suggesting direct involvement of bacterial 45
proteins. In agreement with this assumption, the type IV secretion system (T4SS) was 46
shown to be essential for intracellular replication (8, 9). The presence of the replicative 47
C. burnetii-containing vacuole (CCV) within the cell most likely causes tremendous 48
stress for the infected cell, as the CCV almost completely fills the host cell lumen (10). 49
Eukaryotic cells often respond to intracellular pathogen invasion and stress induction by 50
initiating the intrinsic apoptotic pathway as part of the innate immune defense (11). 51
Apoptosis is a programmed cell death pathway crucial for immune system 52
maintenance and removal of damaged or infected cells (12). Two main pathways lead to 53
apoptosis. The extrinsic cell death pathway is launched in response to stimulation of 54
death receptor proteins at the cell surface by extracellular stimuli, while the intrinsic cell 55
death pathway is initiated in response to intracellular stimuli (13). 56
Apoptosis allows pathogen clearance without inflammation and additionally leads 57
to activation of the adaptive immune defense (14, 15). As a countermeasure intracellular 58
pathogens have developed multiple mechanisms to inhibit host cell apoptosis (16). C. 59
burnetii also interferes with host cell apoptosis (17, 18). How this occurs mechanistically 60
is incompletely understood, but effector proteins translocated into the host cell by the 61
T4SS are required for protection against apoptosis (8). Importantly, C. burnetii 62
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
4
possesses several anti-apoptotic effector proteins like CaeA, CaeB (19) and AnkG (20). 63
How exactly AnkG interferes with the host cell apoptotic machinery has been unknown 64
to date. However, the anti-apoptotic activity of AnkG correlates with binding to p32, 65
because only the N-terminal fragment of AnkG (amino acids (aa) 1-69), which interacts 66
with p32 and inhibits apoptosis, while the C-terminal fragment (aa 70-338) neither 67
interacts with p32 nor interferes with host cell death. Reducing the level of p32 in 68
mammalian cells made them more resistant to apoptosis, suggesting that p32 is a pro-69
apoptotic protein and that AnkG might function by interfering with this p32-mediated pro-70
apoptotic activity (20). 71
Several questions regarding AnkG´s function remained open: Does AnkG 72
influence p32 expression? Is the AnkG-p32 interaction direct or indirect? Is the binding 73
to p32 necessary for AnkG-mediated inhibition of apoptosis? 74
To address these questions we have defined the p32-binding pocket within AnkG 75
and created an AnkG mutant that does not bind to p32. Using this and several other 76
mutants we demonstrated that AnkG activity is controlled by p32-mediated trafficking, 77
which in turn seems to be regulated by cellular stress. 78
79
Materials and Methods. 80
Reagents, cell lines and bacterial strains. Unless otherwise noted, chemicals 81
were purchased from Sigma Aldrich. Complete Protease inhibitor cocktail mixture and 82
Xtreme Gene 9 Transfection Reagent were from Roche. Protein A/G Sepharose was 83
from Santa Cruz. Staurosporine was from Cell Signaling. Cell lines were cultured at 84
37°C in 5% CO2 in media containing 10% heat-inactivated fetal bovine serum 85
(Biochrom) and 1% penicillin-streptomycin (Invitrogen). CHO-FcR cells were grown in 86
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
5
minimal essential medium alpha medium (Invitrogen), HeLa and HEK293 cells were 87
maintained in Dulbecco´s modified Eagle´s medium (Invitrogen). Bone marrow derived-88
DCs from C57BL/6 mice were prepared as described (21). Escherichia coli strains DH5α 89
and BL21-DE3 were cultivated in Luria-Bertani (LB) broth supplemented with 90
kanamycin, or ampicillin where appropriate. L. pneumophila serogroup 1 ΔflaA strains 91
were grown as described (20). 92
Plasmids and primers. Plasmid and primers used are listed in Tables 1 and 2. 93
Plasmid construction. For creation of the constructs AnkG1-91-pCMV-HA, 94
AnkG50-338-pCMV-HA, AnkG1-157-pCMV-HA and AnkF-pCMV-HA, the genes were 95
amplified from C. burnetii Nine Mile phase II clone 4 genomic DNA by PCR using the 96
primers listed in table 2, restricted with the enzymes indicated and ligated with likewise-97
restricted pCMV-HA. For creation of the constructs AnkGR23S-pCMV-HA and 98
AnkGR22/23S-pCMV-HA the genes were amplified from AnkGFL-pCMV-HA with primers 99
listed in table 2 that were 5’ phosphorylated. The PCR constructs were gel-purified and 100
ligated. For cloning of the constructs AnkG1-69-pEGFP and AnkG70-338-pEGFP, the genes 101
were amplified from AnkG1-69-pJV400 or AnkG70-338-pJV400 using the primers listed in 102
table 2, restricted with the enzymes indicated and ligated with likewise-restricted 103
pEGFP. For creation of the constructs AnkGR22/23S-pJV400, NES-AnkG-pJV400 and 104
NLS-AnkGR22/23S-pJV400, the genes were amplified from AnkGR22/23S-pEGFP or NES-105
AnkG-pEGFP using the primers listed in table 2, restricted as indicated and ligated with 106
likewise-restricted pJV400. For cloning the construct NES-AnkG-pGEFP, the gene was 107
amplified from AnkGFL-pEGFP using the primers listed in table 2, restricted with the 108
indicated enzymes and ligated with likewise restricted pEGFP. For cloning the construct 109
NLS-AnkGR22/23S-pEGFP, the gene was amplified from AnkGR22/23S-pCVM-HA using the 110
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
6
primers listed in table 2, restricted with the indicated enzymes and ligated with likewise 111
restricted pEGFP. 112
Confocal microscopy. CHO cells were plated on coverslips and were 113
transfected with the indicated plasmids. The cells were fixed with 4% paraformaldehyde 114
(Alfa Aeser) in PBS (Biochrom), permeabilized with ice-cold methanol, quenched with 115
50mM NH4Cl (Roth) in PBS. The cells were mounted using ProLong Gold with DAPI 116
(Invitrogen) to visualize the nucleus. For mitochondrial staining, the cells were incubated 117
using Mitotracker (Molecular Probes) before fixation. Confocal fluorescence microscopy 118
was performed using a Zeiss LSM 700 confocal microscope. 119
Nuclear fragmentation assays. Was performed as described (19). 120
Co-immunoprecipitation. HEK293 cells were transiently transfected with the 121
plasmids indicated. On the following day, the cells were washed with PBS and incubated 122
with lysis buffer (20mM HEPES (pH7.5), 200mM NaCl, 1mM EDTA, 0.1% (vol/vol) 123
Nonidet P-40, 10% (vol/vol) glycerol, 1x protease inhibitor, 1mM DTT) for 30min on ice. 124
After centrifugation the supernatants were incubated with anti-GFP rabbit serum from 125
Invitrogen for 2h at 4°C. Complexes were precipitated by adding protein A/G PLUS-126
Agarose and incubated for 45min at 4°C. The beads were washed three times with 127
washing buffer (20mM HEPES (pH7.5), 100mM NaCl, 1mM EDTA, 0.1% (vol/vol) 128
Nonidet P-40) and samples were analyzed. 129
Protein purification. E. coli BL21 (DE3) cells transformed with plasmids 130
producing GST, GST-AnkG or His-p32 were grown in LB broth containing ampicillin. 131
IPTG was added to the media and samples were incubated for 4h at 30°C. The cells 132
were resuspended in PBS containing Protease inhibitor. After disruption by French 133
Press, the lysate was incubated in 1% Trition X-100 for 1h at 4°C. Lysates were clarified 134
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
7
by centrifugation at 15000x g for 30min. Proteins were purified using glutathione-135
sepharose or Ni-NTA agarose colums respectively. 136
GST-tag pull-down. Purified GST or GST-AnkG were loaded onto glutathione–137
sepharose columns (GE Healthcare), and purified His-p32 was added to the columns. 138
The columns were washed three times with PBS and bound proteins were eluted with 139
10mM glutathione in PBS (pH 9.0). The input, the eluate and the bead fractions were 140
analyzedas indicated 141
His-tag pull-down. Purified His-p32 was loaded onto Ni-NTA agarose columns 142
(GE Healthcare), and GST or GST-AnkG added to the columns. The columns were 143
washed with increasing concentrations of imidazol in lysis buffer (50mM Tris-HCl pH 7.5, 144
150mM NaCl, 1mM DTT) and bound proteins were eluted with 500mM imidazol in lysis 145
buffer. Eluate and input fractions were analyzed as indicated. 146
Statistical analysis. The unpaired Student’s t-test was used. 147
Legionella pneumophila ΔflaA infection. Dendritic cells derived from C57Bl/6 148
mice were infected with the L. pneumophila ΔflaA containing the indicated plasmid as 149
described (20). 2h and 10h after infection, cells were lysed and plated on charcoal yeast 150
extract plates. The plates were incubated for three days at 37°C and colony forming 151
units were counted. Colony number after 2h infection represents the infection efficiency, 152
after 10h the survival of the intracellular bacteria. 153
154
Results 155
AnkG binds p32 directly. To analyze the interaction of AnkG with p32, we first 156
determined whether the binding is direct or indirect. Typically, GST pull-down 157
experiments are used to verify direct interactions between two proteins. Thus, we 158
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
8
expressed and purified GST, GST-tagged AnkG and His-tagged p32 from Escherichia 159
coli. Purified GST or GST-AnkG was incubated with His-p32 and the putative protein 160
complex pulled-down with glutathione-coated sepharose beads. The eluate and bead 161
fractions were subjected to SDS-PAGE and stained with Coomassie blue (Fig. 1A). 162
Additionally, we analyzed eluate and bead fractions by immunoblot analysis (Fig. 1B). 163
As shown in Figs. 1A and 1B, His-p32 is pulled-down by GST-AnkG, but not by GST 164
alone. To confirm the direct interaction, we also performed the reverse experiment. 165
Thus, purified GST or GST-AnkG and His-p32 were incubated and His-coupled proteins 166
were pulled-down with nickel-NTA-coated agarose beads. Immunoblot analysis revealed 167
that His-p32 pulled-down GST-AnkG (Fig. 1C), but not GST (data not shown). 168
Therefore, binding of AnkG to p32 is direct, because no additional proteins were needed 169
for this interaction. 170
AnkG does not alter the p32 steady-state protein leveI. AnkG was suggested 171
to mediate its anti-apoptotic activity by blocking p32 function (20). Therefore, we first 172
analyzed whether the expression of AnkG results in a reduced p32 protein level. Thus, 173
the respective p32 protein level of cells ectopically expressing GFP or GFP-AnkG was 174
analyzed by immunoblot using an anti-p32 antibody. As shown in Fig. 1D, the p32 175
protein level was not altered by GFP-AnkG expression, suggesting that AnkG does not 176
act by changing the steady-state protein level of p32. Furthermore, AnkG expression did 177
not cause any changes in the intracellular distribution of p32 (Figure 1E). 178
AnkG associates with mitochondria and traffics into the nucleus after stress 179
induction. The host cell protein p32 is mainly found in the mitochondria (22, 23) and a 180
small fraction in the nucleus (24). In order to address the question where the interaction 181
between AnkG and p32 occurs within the cell, we analyzed the intracellular localization 182
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
9
of ectopically expressed GFP-AnkG. As demonstrated in Fig. 2A GFP-AnkG showed 183
vesicular staining with close association to host cell mitochondria. 184
The distribution of p32 is altered by perturbation of the physiological state of the 185
cell (23-25). As AnkG interacts with p32, we asked whether AnkG also alters its 186
intracellular localization after cellular stress induction. Thus, we treated GFP-AnkG 187
expressing cells for different time periods with staurosporine to cause cellular stress and 188
analyzed subsequently the intracellular localization of AnkG by immunofluorescence. 189
Before treatment the majority of GFP-AnkG was localized in close association with the 190
mitochondria and to a lesser degree in the nucleus, although AnkG does not contain a 191
predicted nuclear localization signal. After treatment with staurosporine, the intracellular 192
localization of GFP-AnkG changed. After 4h GFP-AnkG was mainly present within the 193
nucleus and only a minority remained in close association with the mitochondria (Fig. 194
2B). These results demonstrate that AnkG traffics into the nucleus after apoptosis-195
induction. Furthermore, it suggests that AnkG requires binding to p32 or another host 196
cell protein to get transported into the nucleus, as AnkG does not contain a predicted 197
nuclear localization. 198
The amino-terminal fragment AnkG1–69 contains one or more regions necessary 199
for inhibition of apoptosis and for binding to p32, whereas AnkG70-338 neither binds to p32 200
nor inhibits apoptosis (20). If the change in intracellular localization depends on binding 201
to p32, the intracellular localization of AnkG70-338 should not change after staurosporine 202
treatment. Thus, we analyzed the intracellular localization of AnkG1-69 and AnkG70-338 203
after cellular perturbation. As shown in Fig. 2C AnkG1–69 was mainly localized in the 204
nucleus under healthy and apoptotic conditions. The nuclear localization of GFP-AnkG1-205
69 under healthy conditions might be due to its small size of 34kDa. GFP-AnkG1-69 can 206
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
10
freely migrate into the nucleus and is most likely actively retained within the nucleus. In 207
contrast, AnkG70-338 was mainly localized in the cytoplasm and this localization did not 208
change after treatment with staurosporine. These results led to the hypothesis that 209
trafficking of AnkG might depend on binding to p32 and that nuclear localization might 210
be important for AnkG-mediated apoptosis-inhibition. However, to prove the first 211
hypothesis it was necessary to generate an AnkG mutant unable to bind to p32. 212
An arginine-rich region within AnkG is required for binding to p32. To 213
narrow down the region within AnkG required for binding to p32 we generated different 214
AnkG truncations. We expressed HA-tagged AnkG truncations and GFP-p32 in HEK293 215
cells, precipitated proteins from the cell lysates with an anti-GFP antibody and evaluated 216
the co-immunoprecipitation of the different AnkG truncations by immunoblot analysis. As 217
shown in Fig. 3A HA-AnkG, HA-AnkGΔAnk, HA-AnkG1-157, HA-AnkG1-91 and HA-AnkG1-69 , 218
but not HA-AnkF, HA-AnkG70-338, HA-AnkG50-338 and HA-AnkG29-338 co-precipitated with 219
GFP-p32. Thus, the first 28 aa of AnkG are most likely required for binding to p32. This 220
N-terminal part contains seven arginine residues. Because p32 was shown to bind to 221
arginine-rich regions (26, 27), we generated point mutations within this arginine-rich N-222
terminal part, replacing arginine with serine. To analyze binding of the AnkG mutants to 223
p32 co-immunoprecipitation was performed. While HA-AnkG and HA-AnkGR23S co-224
precipitated with GFP-p32, HA-AnkGR22/23S did not (Fig. 3B). Hence, we identified the 225
p32-binding region within AnkG and generated an AnkG mutant unable to bind to p32. 226
AnkG intracellular localization and trafficking depends on p32 binding. Next, 227
we analyzed the intracellular localization of the AnkG mutant AnkGR22/23S by 228
immunofluorescence. As shown in Fig. 3C, ectopically expressed GFP-AnkGR22/23S co-229
localized with αtubulin, suggesting that intracellular localization of AnkG is dependent on 230
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
11
p32 binding. To analyze whether intracellular trafficking of AnkG also depends on p32 231
binding, we treated GFP-AnkGR22/23S expressing cells for different time periods with 232
staurosporine and analyzed the intracellular localization of AnkGR22/23S by 233
immunofluorescence. The majority of GFP-AnkGR22/23S co-localized with αtubulin and to 234
a lesser degree to the nucleus. Importantly, the intracellular localization of GFP-235
AnkGR22/23S was not changed by treatment with staurosporine (Fig. 3D). Taken together, 236
nuclear localization and trafficking of AnkG depend on its binding to p32. 237
AnkG has to migrate into the nucleus to inhibit apoptosis. Having 238
demonstrated that AnkG traffics into the nucleus after apoptosis induction, our goal was 239
to determine whether this nuclear localization is essential for the anti-apoptotic activity of 240
AnkG. Consequently, we expressed a chimera comprising GFP-AnkG fused to the 241
nuclear export signal of the HIV-1 Rev protein (GFP-NES-AnkG). This nuclear export 242
signal has been used successfully to prevent nuclear import of the Golgi vesicle 243
tethering protein p115 (28). GFP-NES-AnkG was excluded from the nucleus (Fig. 4A), 244
but still binds to p32 (Fig. 4B). As shown in Fig. 4C, GFP-NES-AnkG was present 245
exclusively in the cytoplasm and did not migrate into the nucleus after apoptosis-246
induction (Fig. 4C). Thus, GFP-NES-AnkG can be used to analyze whether AnkG 247
nuclear localization is required for apoptosis inhibition. Therefore, we ectopically 248
produced GFP, GFP-AnkG and GFP-NES-AnkG transiently in CHO cells and treated the 249
cells with staurosporine to induce cell death. Nuclear fragmentation was visualized by 250
DAPI staining and counted to measure apoptosis. Whereas 35% of cells expressing 251
GFP had fragmented nuclei, this number was reduced to 20% in cells expressing GFP-252
AnkG (Fig. 4D). Importantly, 40% of cells expressing GFP-NES-AnkG had fragmented 253
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
12
nuclei, demonstrating that NES-AnkG does not inhibit apoptosis. Thus, the anti-apoptotic 254
activity of AnkG strictly requires its translocation into the nucleus. 255
Neither AnkGR22/23S nor NES-AnkG prevents pathogen-induced apoptosis. 256
Next, we asked whether AnkG delivered into the host cell by the T4SS also depends on 257
nuclear localization to exert its anti-apoptotic activity. Because C. burnetii harbors 258
several anti-apoptotic effector proteins, the construction of an ankG deletion-mutant 259
complemented or not with nes-ankG might not provide an answer to this question. 260
Instead we employed a gain-of-function analysis using Legionella pneumophila ΔflaA to 261
determine whether translocation of different AnkG mutants could prevent apoptosis. L. 262
pneumonia ΔflaA caused rapid apoptosis in mouse bone marrow-derived dendritic cells 263
(DCs) and, thus, could not replicate in these cells (21). These pathogen-induced 264
incidents were blocked by adding AnkG to the repertoire of L. pneumophila effector 265
proteins (20). Therefore, this model can be used to analyze whether AnkG has to bind to 266
p32 or whether AnkG has to migrate into the nucleus to inhibit pathogen-induced 267
apoptosis. We infected DCs with L. pneumophila ΔflaA containing either the empty 268
vector (pJV400), AnkG (pJV400-AnkG), NES-AnkG (pJV400-NES-AnkG) or AnkGR22/23S 269
(pJV400-AnkGR22/23S). At 2h and 10h post-infection, the cells were lysed and bacterial 270
colony forming units were counted. As shown in Fig. 5A, bacterial uptake was not 271
affected by the addition of AnkG or any of the AnkG mutants. At 10h post-infection, only 272
12% of the initial inoculum of L. pneumophila ΔflaA containing vector alone were 273
recovered, suggesting that these bacteria induce apoptosis in their host cells and, thus, 274
are not able to survive and replicate (Fig. 5B). In contrast, nearly 50% of the L. 275
pneumophila ΔflaA encoding AnkG were recovered, suggesting that AnkG delivered into 276
the host cell by the L. pneumophila T4SS is able to disrupt pathogen-induced apoptosis 277
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
13
in DC, in agreement with a previous report (20). Neither L. pneumophila ΔflaA encoding 278
NES-AnkG nor L. pneumophila ΔflaA encoding AnkGR22/23S seemed to inhibit pathogen-279
induced apoptosis in DCs, as demonstrated by recovery rates of less than 10%. These 280
results support our previous findings and suggest that AnkG depends on binding to p32 281
for proper localization and trafficking into the nucleus and that the nuclear localization is 282
essential for inhibition of host cell apoptosis. 283
The intracellular trafficking, but not the anti-apoptotic activity of AnkG, 284
depends on binding to p32. The previous experiments did not clarify whether the 285
binding to p32 is also necessary for AnkG-mediated anti-apoptotic activity. To address 286
this question we constructed a chimera by fusing the SV40 large T antigen nuclear 287
localization signal (29) to the amino-terminus of AnkGR22/23S (GFP-NLS-AnkGR22/23S). 288
Ectopic expression of this construct displays nuclear localization (Fig. 5C). Next, we 289
ectopically produced GFP, GFP-AnkG and GFP-NLS-AnkGR22/23S transiently in CHO 290
cells and treated the cells with staurosporine to induce cell death. Nuclear fragmentation 291
was visualized by DAPI staining and counted to measure apoptosis. Whereas 35% of 292
cells expressing GFP had fragmented nuclei, this number was reduced to 23% in cells 293
expressing GFP-AnkG (Fig. 5D). Importantly, 22% of cells expressing GFP-NLS-294
AnkGR22/23S had fragmented nuclei. Thus, AnkG depends on binding to p32 for proper 295
localization and trafficking, but not for anti-apoptotic activity. 296
297
Discussion 298
The elimination of infected cells via apoptosis is an evolutionarily conserved 299
defense mechanism (30). So it is not surprising that many intracellular pathogens have 300
developed mechanisms to counter apoptosis-induction by their host cells (16). Several 301
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
14
intracellular pathogens inject effector proteins into the host cell to prevent premature 302
host cell death. However, their molecular mechanisms of action are distinct (31). Here 303
we analyzed the anti-apoptotic activity of AnkG. We showed that the effector protein 304
AnkG localizes in association with the host cell mitochondria in unstressed cells (Fig. 305
2A). This is in contrast to a report showing that mCherry-AnkG co-localized with 306
microtubules (32). The difference in localization of AnkG cannot be explained by the cell 307
line used, because both studies used HeLa cells. The only other difference is the tag 308
used. However, we have not detected any tag-dependent differences in the intracellular 309
localization of AnkG so far. GFP-, HA- and myc-tagged AnkG all displayed the same 310
intracellular localization in HeLa and CHO-FcR cells (data not shown). Interestingly, 311
ectopically expressed GFP-AnkGR22/23S co-localized with tubulin (Fig. 3C), and thus 312
displays the same intracellular localization as reported for mCherry-AnkG (32). This 313
localization is surprising, as one would predict that AnkG unable to bind p32 would 314
display cytoplasmic localization. Furthermore, after staurosporine treatment GFP-NES-315
AnkG displays partial co-localization with tubulin (data not shown). Therefore, it can be 316
speculated that microtubule-association might play a role in AnkG activity under certain 317
cellular conditions. 318
There are several anti-apoptotic type III or type IV secretion system effector 319
proteins that target the host cell mitochondria, the central organelle of the intrinsic 320
apoptotic pathway. Such targeting of the mitochondria by bacterial proteins seems to be 321
evolutionarily conserved, as plant pathogens also target the mitochondria to suppress 322
the hypersensitive response, a form of programmed cell death (33). As shown in Fig. 2A 323
AnkG only partially co-localized with mitochondria, suggesting that this effector protein is 324
not transported into the mitochondria, as it has been shown for Ats1 and PorB. Ats1 325
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
15
from Anaplasma phagocytophilum uses the mitochondrial import machinery to get 326
transported into the mitochondria (34), while the meningococcal PorB associate with a 327
porin located in the outer mitochondrial membrane (35). Importantly, the anti-apoptotic 328
activity of Ats1 correlates with mitochondrial import (34). AnkG, in clear contrast, has to 329
get transported into the nucleus to act anti-apoptotically (Fig. 4D). Interestingly, this 330
transport into the nucleus, which depends on the ability of AnkG to bind to p32, only 331
happens under apoptotic or stress conditions (Fig. 2B and 3D). This leads to the 332
hypothesis that AnkG primarily targets the mitochondria to sense host cell apoptotic 333
stress and then hitchhikes to the nucleus, the organelle of activity. As a consequence it 334
can be concluded that the activity of AnkG is adjusted by a host cell stress sensor which 335
regulates the transport process. 336
For intracellular trafficking of AnkG from the mitochondria to the nucleus and, 337
thus, for activity control, binding to p32 is essential. This is in agreement with a report 338
that proposed that p32 is involved in bridging a signaling pathway that extends from the 339
mitochondria to the cell nucleus (23). However, once AnkG is within the nucleus, binding 340
to p32 is not needed for anti-apoptotic activity (Fig. 5D). This result suggests that AnkG 341
must instead interfere with a nuclear function to prevent host cell death. There are 342
several effector proteins known to target the host cell nucleus. The Chlamydia 343
trachomatis effector protein NUE is a histone methyltransferase targeting histones (36). 344
AnkA from A. phagocytophilum mediates epigenetic changes at the CYBB promotor 345
(37), leading to a global down-regulation of host defense genes (38). How AnkG 346
modulates nuclear function has to be determined, but the activity of AnkG is clearly 347
regulated by host cell stress signaling and p32-dependent trafficking. This is, to our 348
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
16
knowledge the first example that an anti-apoptotic effector protein is regulated by host 349
cell protein-mediated trafficking. 350
The question how effector proteins are regulated has only rarely been 351
investigated. There are several avenues of regulation thinkable: 1) regulation by time 352
point and dosage of translocation; 2) regulation by modulation through other effector 353
proteins; 3) regulation by host cell dependent modification (phosphorylation, lipidation, 354
sumoylation etc.). Examples already exist for the latter scenario. It was shown that 355
intracellular localization, and thereby the function of Legionella pneumophila effector 356
proteins containing a CAAX motif are affected by lipidation through the host cell 357
farnesyltransferase and class I geranylgeranyltransferase (39). The Helicobacter pylori 358
T4SS effector protein CagA is phosphorylated by the host cell tyrosine kinases Src and 359
Abl. Phosphorylated CagA can then modulate various signaling cascades associated 360
with cell polarity, cell proliferation, actin-cytoskeletal rearrangements, cell elongation, 361
disruption of tight and adherence junctions, pro-inflammatory responses and apoptosis 362
inhibition (40). Here, we have identified a fourth possibility to regulate the activity of 363
effector proteins: regulation by stress sensing and intracellular trafficking. In our opinion, 364
more knowledge about host cell requirements for regulation of effector proteins is 365
needed. This knowledge will not only help to understand microbial pathogenesis better, 366
but will also allow us to develop new strategies for therapy. The first steps down this 367
avenue have already been made. An exemplified study showed that identifying host cell 368
signaling pathways required for bacterial survival might help to control infection (41). 369
370
Acknowledgements 371
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
17
This work was supported by the Deutsche Forschungsgemeinschaft (DFG) through the 372
Collaborative Research Initiative 796 (SFB796; to A.L. and C.B.) and through the Priority 373
Programme SPP1580 (to A.L.) as well as by the ERA-NET PathoGenoMics 3rd call (to 374
A.L.). We thank Dr. Christian Bogdan for his valuable comments on the manuscript. 375
376
References 377
378
1. Maurin M, Raoult D. 1999. Q fever. Clin. Microbiol. Rev. 12: 518-553. 379
2. Baca OG, Paretsky D. 1983. Q fever and Coxiella burnetii: a model for host-380
parasite interactions. Microbiol. Rev. 47: 127-149. 381
3. Howe D, Melnicakova J, Barak I, Heinzen RA. 2003. Maturation of the Coxiella 382
burnetii parasitophorous vacuole requires bacterial protein synthesis but not 383
replication. Cell. Microbiol. 5: 469-80. 384
4. Howe D, Shannon JG, Winfree S, Dorward DW, Heinzen RA. 2010. Coxiella 385
burnetii phase I and II variants replicate with similar kinetics in degradative 386
phagolysosome-like compartments of human macrophages. Infect. Immun. 78: 387
3465-3474. 388
5. Maurin M, Benoliel AM, Bongrand P, Raoult D. (1992). Phagolysosomal 389
alkalinization and the bactericidal effect of antibiotics: the Coxiella burnetii 390
paradigm. J. Infect. Dis. 166: 1097- 1102. 391
6. Howe D, Mallavia LP. 2000. Coxiella burnetii exhibits morphological change and 392
delays phagolysosomal fusion after internalization by J774A.1 cells. Infect. 393
Immun. 68: 3815-3821. 394
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
18
7. Romano PS, Gutierrez MG, Beron W, Rabinovitch M, Colombo MI. 2007. The 395
autophagic pathway is actively modulated by phase II Coxiella burnetii to 396
efficiently replicate in the host cell. Cell. Microbiol. 9: 891-909. 397
8. Beare PA, Gilk SD, Larson CL, Hill J, Stead CM, Omsland A, Cockrell DC, 398
Howe D, Voth DE, Heinzen RA. 2011. Dot/Icm type IVB secretion system 399
requirements for Coxiella burnetii growth in human macrophages. MBio 2: 400
e00175-00111. 401
9. Carey KL, Newton HJ, Lührmann A, Roy CR. 2011. The Coxiella burnetii 402
Dot/Icm system delivers a unique repertoire of type IV effectors into host cells and 403
is required for intracellular replication. PLoS Pathog. 7: e1002056. 404
10. Van Schaik EJ, Chen C, Mertens K, Weber MM, Samuel JE. 2013. Molecular 405
pathogenesis of the obligate intracellular bacterium Coxiella burnetii. Nat. Rev. 406
Microbiol. 11: 561-573. 407
11. Lamkanfi M, Dixit VM. 2010. Manipulation of host cell death pathways during 408
microbial infections. Cell Host Microbe. 8: 44-54. 409
12. Byrne GI, Ojcius DM. 2004. Chlamydia and apoptosis: life and death decisions 410
of an intracellular pathogen. Nat. Rev. Microbiol. 2: 802-808. 411
13. Hotchkiss RS, Strasser A, McDunn JE, Swanson PE. 2009. Cell death. N. 412
Engl. J. Med. 361: 1570-1583. 413
14. Gallucci S, Lolkema M, Matzinger P. 1999. Natural adjuvants: endogenous 414
activators of dendritic cells. Nat. Med. 5: 1249-1255. 415
15. Elliott MR, Ravichandran KS. 2010. Clearance of apoptotic cells: implications in 416
health and disease. J. Cell. Biol. 189: 1059-1070. 417
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
19
16. Faherty CS, Maurelli AT. 2008. Staying alive: bacterial inhibition of apoptosis 418
during infection. Trends Microbiol. 16: 173-180. 419
17. Lührmann A, Roy CR. 2007. Coxiella burnetii inhibits activation of host cell 420
apoptosis through a mechanism that involves preventing cytochrome c release 421
from mitochondria. Infect. Immun. 75: 5282-5289. 422
18. Voth DE, Howe D, Heinzen RA. 2007. Coxiella burnetii inhibits apoptosis in 423
human THP-1 cells and monkey primary alveolar macrophages. Infect. Immun. 424
75: 4263-4271. 425
19. Klingenbeck L, Eckart RA, Berens C, Lührmann A. 2013. The Coxiella burnetii 426
type IV secretion system substrate CaeB inhibits intrinsic apoptosis at the 427
mitochondrial level. Cell. Microbiol. 15: 675-687. 428
20. Lührmann A, Nogueira CV, Carey KL, Roy CR. 2010. Inhibition of pathogen-429
induced apoptosis by a Coxiella burnetii type IV effector protein. Proc. Natl. Acad. 430
Sci. U.S.A. 107: 18997-19001. 431
21. Dedio J, Jahnen-Dechent W, Bachmann M, Müller-Esterl W. 1998. The 432
multiligand-binding protein gC1qR, putative C1q receptor, is a mitochondrial 433
protein. J. Immunol. 160: 3524-3542. 434
22. Matthews DA, Russell WC. 1998. Adenovirus core protein V interacts with 435
p32—a protein which is associated with both the mitochondria and the nucleus. J. 436
Gen. Virol. 79: 1677-1685. 437
23. Brokstad KA, Kalland KH, Matthews DA, Russell WC. 2001. Mitochondrial 438
protein p32 can accumulate in the nucleus. Biochem. Biophys. Res. Commun. 439
281: 1161-1169. 440
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
20
24. Robles-Flores M, Rendon-Huerta E, Gonzalez-Aguilar H, Mendoza-441
Hernandez G, Islas S, Mendoza V, Ponce-Castaneda MV, Gonzalez-Mariscal 442
L, Lopez-Casillas F. 2002. p32 (gC1qBP) is a general protein kinase C (PKC)-443
binding protein; interaction and cellular localization of P32-PKC complexes in ray 444
hepatocytes. J. Biol. Chem. 277: 5247-5255. 445
25. Hall KT, Giles MS, Calderwood MA, Goodwin DJ, Matthews DA, Whitehouse 446
A. 2002. The Herpesvirus Saimiri open reading frame 73 gene product interacts 447
with the cellular protein p32. J. Virol. 76: 11612-11622. 448
26. Beatch MD, Everitt JC, Law LJ, Hobman TC. 2005. Interactions between 449
rubella virus capsid and host protein p32 are important for virus replication. J. 450
Virol. 79: 10807-10820. 451
27. Mukherjee S, Shields D. 2009. Nuclear import is required for the pro-apoptotic 452
function of the Golgi protein p115. J. Biol. Chem. 284: 1709-1717. 453
28. Nogueira CV, Lindsten T, Jamieson AM, Case CL, Shin S, Thompson CB, 454
Roy CR. 2009. Rapid pathogen-induced apoptosis: a mechanism used by 455
dendritic cells to limit intracellular replication of Legionella pneumophila. PLoS 456
Pathog. 6: e1000478. 457
29. Kalderon D, Roberts BL, Richardson WD, Smith AE. 1984. A short amino acid 458
sequence able to specify nuclear location. Cell. 39: 499-509. 459
30. Ashida H, Mimuro H, Ogawa M, Kobayashi T, Sanada T, Kim M, Sasakawa C. 460
2011. Cell death and infection: a double-edged sword for host and pathogen 461
survival. J. Cell Biol. 195: 931-942. 462
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
21
31. Raymond B, Young JC, Pallett M, Endres RG, Clements A, Frankel G. 2013. 463
Subversion of trafficking, apoptosis, and innate immunity by type III secretion 464
system effectors. Trends Microbiol. 21: 430-441. 465
32. Voth DE, Howe D, Beare PA, Vogel JP, Unsworth N, Samuel JE, Heinzen RA. 466
2009. The Coxiella burnetii ankyrin repeat domain-containing protein family is 467
heterogeneous, with C-terminal truncations that influence Dot/Icm-mediated 468
secretion. J. Bacteriol. 191: 4232-4242. 469
33. Rudel T, Kepp O, Kozjak-Pavlovic V. 2010. Interaction between bacterial 470
pathogens and mitochondrial cell death pathways. Nat. Rev. Microbiol. 8: 693- 471
34. Niu H, Kozjak-Pavlovic V, Rudel T, Rikihisa Y. 2010. Anaplasma 472
phagocytophilum Ats-1 is imported into host cell mitochondria and interferes with 473
apoptosis induction. PLoS Pathog. 6: e1000774. 474
35. Massari P, Ho Y, Wetzler LM. 2000. Neisseria meningitidis porin PorB interacts 475
with mitochondria and protects cells from apoptosis. Proc. Natl. Acad. Sci. U.S.A. 476
97: 9070-9075. 477
36. Pennini ME, Perrinet S, Dautry-Varsat A, Subtil A. 2010. Histone methylation 478
by NUE, a novel nuclear effector of the intracellular pathogen Chlamydia 479
trachomatis. PLoS Pathog. 6: e1000995. 480
37. Garcia-Garcia JC, Rennoll-Bankert KE, Pelly S, Milstone AM, Dumler JS. 481
2009. Silencing of host cell CYBB gene expression by the nuclear effector AnkA 482
of the intracellular pathogen Anaplasma phagocytophilum. Infect. Immun. 77: 483
2385-2391. 484
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
22
38. Garcia-Garcia JC, Barat NC, Trembley SJ, Dumler JS. 2009. Epigenetic 485
silencing of host cell defense genes enhances intracellular survival of the 486
rickettsial pathogen Anaplasma phagocytophilum. PLoS Pathog. 5: e1000488. 487
39. Ivanov SS, Charron G, Hang HC, Roy CR. 2010. Lipidation by the host 488
prenyltransferase machinery facilitates membrane localization of Legionella 489
pneumophila effector proteins. J. Biol. Chem. 285: 34686-34698. 490
40. Tegtmeyer N, Wessler S, Backert S. 2011 Role of the cag-pathogenicity island 491
encoded type IV secretion system in Helicobacter pylori pathogenesis. FEBS J 492
278: 1190-1202. 493
41. Kuijl C, Savage ND, Marsman M, Tuin AW, Janssen L, Egan DA, Ketema M, 494
van den Nieuwendijk R, van den Eeden SJ, Geluk A, Poot A, van der Marel 495
G, Beijersbergen RL, Overkleeft H, Ottenhoff TH, Neefjes J. 2007. Intracellular 496
bacterial growth is controlled by a kinase network around PKB/AKT1. Nature 450: 497
725-730. 498
499
Figure legends 500
Figure 1: AnkG binds directly to the host cell protein p32 and does not alter its steady 501
state protein level. (A) Glutathione–sepharose columns with GST-AnkG or GST alone 502
were incubated with His-p32. Eluate (E1-E4) and bead (beads) fractions were resolved 503
by SDS-PAGE and stained with Coomassie blue. (B) Glutathione–sepharose columns 504
with GST-AnkG or GST alone were incubated with His-p32. Input, eluate (E1-E4) and 505
bead (beads) fractions were subjected to immunoblot analysis using anti-GST and anti-506
p32 antibodies. (C) Ni-NTA agarose columns with His-p32 were incubated with GST or 507
with GST-AnkG. Eluate (E1-E4) and input were subjected to immunoblot analysis using 508
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
23
anti-GST and anti-His antibodies. (D) HEK293 cells were transfected with plasmids 509
encoding GFP or GFP-tagged AnkG. Protein extracts were separated by SDS-PAGE, 510
transferred to a PVDF membrane and probed with antibodies directed against GFP, p32 511
and actin. One representative immunoblot out of at least three independent experiments 512
is shown. (E) HeLa cells were transiently transfected with plasmids encoding GFP or 513
GFP-tagged AnkG. The cells were treated with Mitotracker (red) followed by fixation and 514
permeabilization. P32 was stained with a specific primary antibody and a secondary 515
dye405 labeled antibody (blue). Figure 2: Intracellular localization of AnkG. (A) 516
Representative immunofluorescence micrographs show HeLa cells transiently 517
transfected with a plasmid encoding GFP-tagged AnkG (green). The cells were treated 518
with Mitotracker (red) followed by fixation, permeabilization and staining of the nuclei 519
with DAPI (blue). (B) CHO-FcR cells transiently transfected with GFP-tagged AnkG were 520
incubated with 2µM staurosporine. After the indicated time-points cells were fixed and 521
the intracellular localization of AnkG was analyzed in at least 100 transfected cells per 522
sample using confocal microscopy from eight independent experiments. * p< 0.001, n.s. 523
not significant (p=0.055) (C) Representative immunofluorescence micrographs show 524
CHO-FcR cells expressing GFP-tagged AnkG, -AnkG1-69 or -AnkG70-338 (green). The 525
cells were incubated with staurosporine followed by fixation, permeabilization and 526
staining of the nuclei with DAPI (blue). 527
Figure 3: Identification of the p32 binding site. (A and B) HEK293 cells were co-528
transfected with plasmids encoding GFP-tagged p32 and the indicated HA-tagged AnkG 529
mutants (HA-tagged AnkF was used as negative control). The proteins were precipitated 530
from the cell lysates with an anti-GFP antibody. Immunoblot analysis was used to detect 531
p32 (anti-GFP) and Ank-proteins (anti-HA) in the lysates (pre-IP) and precipitates (IP). 532
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
24
(C) Representative immunofluorescence micrographs show HeLa cells expressing GFP-533
tagged AnkGR22/23S (green). The cells were fixed, permeabilized and stained with anti-534
tubulin antibody (red) and DAPI (blue). (D) CHO-FcR cells expressing GFP-tagged 535
AnkGR22/23S were incubated with 2µM staurosporine. After the indicated time points cells 536
were fixed and the localization of AnkG was analyzed in at least 100 transfected cells 537
per sample from four independent experiments using confocal microscopy. n.s. not 538
significant 539
Figure 4: AnkG has to migrate into the nucleus to inhibit staurosporine-induced 540
apoptosis. (A) Representative immunofluorescence micrograph show CHO-FcR cells 541
expressing GFP-tagged NES-AnkG (green). The cells were treated with Mitotracker 542
(red) followed by fixation, permeabilization and staining of the nuclei with DAPI (blue). 543
(B) HEK293 cells were co-transfected with plasmids encoding the indicated GFP-tagged 544
AnkG mutants or GFP as negative control. The proteins were precipitated from the cell 545
lysates with an anti-GFP antibody. Immunoblot analysis was used to detect endogenous 546
p32 (anti-p32) or AnkG (anti-AnkG) in the lysates (pre-IP) and precipitates (IP). (C) 547
CHO-FcR cells expressing GFP-tagged NES-AnkG were incubated with 2µM 548
staurosporine. After the indicated time-points cells were fixed and the localization of 549
AnkG was analyzed in at least 100 transfected cells per sample from three independent 550
experiments using confocal microscopy. n.s. not significant (D) CHO-FcR cells 551
expressing GFP, GFP- AnkG or -NES-AnkG were treated with staurosporine for 4h. The 552
cells were fixed, permeabilized and the nuclei were stained with DAPI. The nuclear 553
morphology of at least 100 GFP expressing cells was scored in four independent 554
experiments. n.s. not significant * p< 0.02. 555
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
25
Figure 5: Neither AnkGR22/23S nor NES-AnkG can prevent pathogen-induced apoptosis 556
(A/B) Dendritic cells were infected with Legionella pneumophila ΔflaA containing the 557
indicated plasmids. The data shown are from one representative experiment of three 558
experiments with similar results. Shown is the bacterial uptake after 2 hours infection (A) 559
and the relative number of intracellular bacteria 10 hours after infection compared to the 560
2 hour value. **p= 0.001 (C) Representative immunofluorescence micrograph shows 561
CHO-FcR cells expressing GFP-NLS-AnkGR22/23S (green) incubated with mitotracker 562
(red) followed by fixation, permeabilization and staining of the nuclei with DAPI (blue). 563
(D) CHO-FcR cells expressing GFP, GFP-AnkG or GFP-NLS-AnkGR22/23S were treated 564
with 2µM staurosporine for 4h. After treatment the cells were fixed, permeabilized and 565
the nuclei were stained with DAPI. The nuclear morphology was scored of at least 100 566
GFP expressing cells in three independent experiments. * p< 0.01. 567
568
Tables 569
570 Plasmid Primer Reference AnkGFL-pCMV-HA 20 AnkG∆Ank-pCMV-HA 20 AnkG1-69-pCMV-HA 20 AnkG70-338-pCMV-HA 20 AnkG1-91-pCMV-HA 329/339 This study AnkG50-338-pCMV-HA 331/340 This study AnkG1-157-pCMV-HA 307/310 This study AnkGR23S-pCMV-HA 590/591 This study AnkGR22/23S-pCMV-HA 590/592 This study AnkF-pCMV-HA 79/229 This study pGEX-5X Amersham AnkG-pGEX-5X 20 p32-pET16b 184/185 This study pEGFP Clontech AnkG-pEGFP 20 p32-pEGFP 20 AnkG1-69-pEGFP 329/338 This study AnkG70-338-pEGFP 332/340 This study
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
26
AnkGR22/23S-pEGFP - This study NES-AnkG-pEGFP 665/34 This study NLS-AnkGR22/23S-pEGFP 746/400 This study pJV400 20 pJV400-AnkG 20 pJV400-AnkGR22/23S 373/26 This study pJV400-NES-AnkG 696/26 This study Table 1: Primer numbers are as in Table 2. 571
572 Number Sequence Site 26 5' AAGGCGCGCCTCACCGAGGACTAGACAG AscI 34 5’ AAGGATCCTCACCGAGGACTAGACAGA BamHI 79 5’ CCGGTACCCTACCGCTGGAAGCCGC KpnI 184 5’ CCCATATGCTGCACACCGACGGAGAC NdeI 185 5’ CCGGATCCCTACTGGCTCTTGACAAAACT BamHI 229 5’ CCGAATTCATGTGCAATACCAACATGTCT EcoRI 307 5’ CCGGTACCATGAGTAGACGTGAGACTCC KpnI 310 5’ CCGGTACCTTATTTATATTTGATTTTCACATCAGC KpnI 329 5' CCAAGATCTCTATGAGTAGACGTGAGACTCC BglII 330 5’ CCAAGATCTCTATGGGACATCCTGTAAGAAGAAG BglII 331 5’ CCAAGATCTCTATGTCGTTTGAAATACTCATAAATGC BglII 332 5’ CCAAGATCTCTATGCTTCGCGGGGATTCTTTTCA BglII 338 5' CCGGTACCTCAGTAGTTTTTTATTATGCTCAAGCT KpnI 339 5’ CCGGTACCTCAGAAATCCGTCTTTGGCGGTA KpnI 340 5' CCGGTACCTCACCGAGGACTAGACAGA KpnI 373 5' CCGGCCGGCCATGAGTAGACGTGAGACTCC FseI 400 5' CCGGTACCTCACCGAGGACTAGACAGA KpnI 590 P-5’ CGTTGAGGATATTGTGCTAGTGGGAGTCTACGTCTAC
TCAT -
591 P-5’ CGACAGGAACTCGAACGCCGAGAAGTAGATTGAGCC GAAAA
-
592 P-5’CGACAGGAACTCGAACGCCGAGTAGTAGATTGAGC CGAAAA
-
665 5’ CCGGTACCGCCTCCAGCAGCCTCCCCTGGAGGACTGACCCTGAGTAGACGTGAGACTCCCACTAGC
KpnI
696 5’ CCGGCCGGCCATGCTCCAGCTGCCTCCCC FseI 746 5’ CCACTCAGATCTCTCCTAAGAAGAAAAGGAAGGTTAGT
AGACGTGAGACTCCCACTAGCACAA
BglII
Table 2. Underlined denotes the location of the restriction site. 573
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
A GST-AnkG + His-p32
E1 E2 E3 E4 Beads
GST + His-p32
GST-AnkG
HIS-p32
GST
GST-tag pull-down
B
E1 E2 E3 E4 BeadsGST
His
-p32
anti-GST
anti-p32
GST-tag pull-downinput
GST-tag pull-downinput
anti-GST
anti-p32
GST-
AnkG
His
-p32
E1 E2 E3 E4 Beads
HIS-tag pull-down input
anti-GST
anti-HIS
GST-
AnkG
HIS
-p32
E1 E2 E3 E4
GST-AnkG + HIS-p32C D
anti-GFP
anti-p32
anti-actin
GFP
GFP
-AnkG
E1 E2 E3 E4 Beads
EMerge
Merge
p32
p32 GFP-AnkG
GFP
Mitotracker
Mitotracker
10µm
10µm
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
0
25
50
75
100
125
Mock 30 120 240
% p
he
no
typ
e
min staurosporine
Mitochondrial
associa!on
nuclear
***
A
B
C
GFP-AnkG Mitotracker
Merge Zoom
GFP-AnkG GFP-AnkG1-69 GFP-AnkG70-338
Mock
Staurosporine
***n.s.
10µm
10µm10µm 10µm
10µm10µm10µm
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
0
25
50
75
100
Mock 30 120 240
% p
he
no
typ
e
min staurosporine
Co-localiza!on
with Tubulin
nuclear
amino acid 18 19 20 21 22 23 24 25 26 27 28
AnkG T R T P R R R L S R K
AnkG T R T P R S R L S R K
AnkG T R T P S S R L S R K
R23S
R22/23S
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkF
HA-AnkG
HA-AnkG
HA-AnkG
HA-AnkF
HA-AnkG
HA-AnkG
HA-AnkG
pre-IP
IP
anti-HA
anti-HA
anti-GFP
WT
∆Ank
1-157
1-91
1-69
29-338
50-338
70-338
anti-HA
anti-GFP
D
C
BA
GFP-AnkG αTubulin MergeR22/23S
R22S
R22/23S
R23S
R22/23S
WT
WT
pre-IP IP
n.s.n.s.
n.s.
10µm
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
0
25
50
75
100
Mock 30 120 240
% p
he
no
typ
e
min staurosporine
cytosolic
nuclear
GFP-NES-AnkG Mitotracker Merge
anti-AnkG
anti-p32
IPpre-IP
GFP
GFP-NES-AnkG
GFP-AnkG
GFP-AnkG
GFP
GFP-AnkG
GFP-AnkG
GFP-NES-AnkG
R22/23S
R22/23S
n.s.
10
20
30
40
50
% fr
agm
en
ted
nu
clei
GFP
GFP-AnkG
GFP-NES-AnkG
D
C
B
A
*
n.s.
n.s.n.s.
10µm10µm
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from
0
10
20
30
40
50
60
% s
urvi
val
0
5
10
15
20
25
bact
eria
l *10
3 /wel
l
pJV400
pJV400-A
nkG
pJV400-A
nkG
pJV400-N
ES-AnkG
R22/23S
pJV400
pJV400-A
nkG
pJV400-A
nkG
pJV400-N
ES-AnkG
R22/23S
GFP-NLS-AnkG Mitotracker Merge
0
10
20
30
40
% f
rag
me
nte
d n
ucl
ei
GFPGFP-AnkG
GFP-NLS-AnkG
R22/23S
n.s.
*
* *
D
C
A B
on Septem
ber 6, 2018 by guesthttp://iai.asm
.org/D
ownloaded from