IDEALG PIA

UMR 8227 CNRS-UPMC

Station Biologique de Roscoff

Place Georges Teissier

CS90074

29688 ROSCOFF Cedex

FRANCE

Fabienne KILMARTIN

Project Manager

Phone: +33 2 98 29 23 04

Fax : +33 2 98 29 23 85

fabienne.kilmartin@sb-roscoff.fr

Philippe POTIN

Scientific Coordinator

Phone: +33 2 98 29 23 75

Fax: +33 2 98 29 23 85

philippe.potin@sb-roscoff.fr

IDERLG seaweed for the future

1

ForewordMarine biomass valorisation in France, and more specifically in the seaweed sector, has always overcome multiple crises, while respecting its traditions and turning towards future innovations and thus by maintaining knowledge and know-how through numerous direct and indirect local jobs. The seaweed industry is undoubtedly one of the strongest sectors to ensure "Blue Growth" in France. IDEALG project was launched in September 2011 and will run until December 2019. The project is organised with a transversal and complementary consortium, meeting scientific knowledge and technical / industrial expertise. More than a 100 people from diverse topics work together towards one common challenge: develop the seaweed sector in France. In order to make the best of fundamental knowledge within the seaweed sector and meet the societal challenges for a sustainable and quality production of new raw materials and products, IDEALG has mobilized some wide variety research topics such as, genetic (formal, quantitative…), functional genomics and post-genomics, system biology, biochemistry, structural biology, chemistry (analytical, organic, process chemistry), ecology, economics and social sciences. Despite this diverse consortium, IDEALG has fingered out three main targets to follow:

Demonstrate the feasibility of exploiting genomics and post-genomics research in biotechnology, Develop sustainable exploitation and aquaculture of macroalgae, Assess social and environmental issues, regarding the current exploitation of seaweed as well the impact of new practices.

Going back in time, genetics and genomics has only recently revolutionized the intimate knowledge of seaweed at the DNA and genomic levels. Indeed, specific tools and technical knowhow have been developed since the early 90’ies with the aim to accelerate scientific breakthroughs. Such tools are useful for understanding the secrets of making unique molecules, and for revealing the intimate mechanisms of their reproduction (life cycles). The geographical evolution of seaweed and relationship between each other as well as with other living organisms can also be investigated to understand the response of seaweed to environmental changes. And yet, everything was still to be done. These new tools were available and the specific staff ready, it was unthinkable not to submit to the “Biotechnologies-Bioresources Program” call in 2011, on terrestrial and marine plant biomass funded by the National Research Agency (IA-ANR). The underlined added value of IDEALG was the integration over time of basic and finalized research. IDEALG has brought together a large number of

stakeholders who share the ambition of increasing the cale in R&D approaches on seaweed in order to meet the challenges of domesticating local seaweed in response to new biomass needs, whilst anticipating the impacts on natural ecosystems and the benefits / risks of these developments. It was a tremendous opportunity offered by the Investments for Future to drive the French seaweed sector to the first position in Europe. However, the game is far from over! We are now six years later and, as you will discover in this document, research has progressed enormously. The project is now associating nearly 30 French companies in emerging collaborative projects to unlock and accelerate knowledge and technology transfer. The dissemination of the project also impacts a wide audience, from the youth to the general public, and private actors as well as stakeholders of the maritime and land sectors. Nevertheless, the seaweed industry is still facing major challenges in economic, social and environmental terms, driving IDEALG's preliminary conclusions to shed light on these aspects. These conclusions highlight the relevance of our scientific choices and the need to further effort upon public-private discussions in the perspective to maintain France's lead in seaweed research and high value applications, at the European and international level. Finally, I would like to thank all IDEALG members for their commitment to this human adventure; the whole coordination team, the work package managers as well as all the actors involved by near or by far for the achievements reached at this stage. My most profound acknowledgments go to the members of the International Advisory Board Committee, the Commission for Future Investments, the National Research Agency and in particular the scientific engineers in charge of the following of the progress of our project, the Brittany Region for its constant support towards IDEALG activities and to the seaweed sector as a whole, the competitiveness clusters Pole Mer Bretagne Atlantique and Valorial, Technological Transfer Companies (SATT Ouest-Valorisation and LUTECH), local authorities and more generally speaking all the professional actors and citizens of the concerned territories, for the trust and interest they have shown since our beginnings. Special thanks also go to all the tutors of IDEALG's partners, in particular at the University of Brittany Loire (UBL), who took over from the European University of Brittany for holding the project, and the National Centre for Scientific Research – Pierre & Marie Curie University (CNRS-UPMC) both government branches of the Roscoff Marine Station (SBR) who is in charge of implementing the project, in particular administrative staff on-site and at the Regional Delegation in Rennes.

Roscoff, 30.05.2017

2

PPhilippe Potin, Scientific coordinator of IDEALG

Summary

The IDEALG project aims to consolidate and increase the knowledge needed to develop the seaweed sector in France. The project is based on three complementary axes of studies that allow the development of the sector to be tackled by integrating both the drivers and the potential bottlenecks at the level of basic research as well as applied research and knowledge and technology transfer: Axis 1 / genomics and post-genomics research that can provide the necessary data for the potential of algae in terms of genetic diversity, metabolic pathways and interactions with other organisms or their environment. This knowledge is particularly useful for enzyme discovery and access to molecules in Axis 2 and for future breeding programs in Axis 3. Axis 2 / the development of analytical and biotechnological tools and chemical studies to explore and then control the metabolism of algae for industrial purposes Axis 3 / the development of seaweed cultivation and the conservation of genetic resources to move toward domestication. It requires new breeding approaches and research on new aquaculture practices. It also involves studies of environmental and socio-economic impacts of the seaweed sector and prospective analysis. IDEALG enters its 6th consecutive year with already a significant number of achievements. In particular, the development of genetic, chemical and mathematical tools and studies, in order to better understand the physiology, metabolism and evolution of algae in their environment. The development of biological tools involves the use of a brown algae model (Ectocarpus siliculosus). Selection by genetic breeding methods and the analysis of the different biosynthesis pathways of compounds of interest such as polysaccharides, phlorotannins or mannitol are tools which can be transposed to other algae species presenting commercial interests such as the brown algal kelp Saccharina latissima, which has been chosen as the flagship species of the project. Moreover, this work led to the construction of the first metabolic map of a brown alga (ECTOGEM) and that of a red alga (ChondrusGEM). IDEALG and R&D partners have educated/supervised 15 PhD students and published ca 85 papers in refereed journals. This, in addition to a high number of articles in newspapers and press journals and presentations at scientific meetings etc., covered the overall activities of IDEALG. Other valorization pathways are studied for applications in green chemistry, in particular the production of biological surfactants, but also in health and hygiene for the control of bacterial biofilms. Certain bacteria associated with algae are a source of molecules, including a range of characteristic and recombinant enzymes that now exceed a total of 50, capable of transforming algal compounds by conferring specific high added value activities. Algae recombinant enzymes, to a lesser extent, are also the subject of biotechnological developments in partnership with Technology Transfer facilitators. Impact studies, which at first focused on the monitoring of exploited wild populations, have produced valuable results which will now be used to improve the resource management plans. Regarding seaweed aquaculture, a SWOT analysis of the development of seaweed farming was carried out in consultation with major actors of the sector. This analysis had the objective of serving as support for decision-makers willing to address the issue. Similarly, the implementation of an ecosystem services analysis for a seaweed farming project has highlighted the tool as a support for decisions on compensatory measures. Finally, a national survey on the consumption of edible algae published a set of documents to inform the sector. Beyond the fact of securing seaweed supplies in quantity and in quality, which will necessarily involve seaweed farming and genetic selection to supplement or substitute crops, biomass extraction processes must also evolve towards a complete valorization of all seaweed fractions. The bio-refinery concept, which predominantly favors co-products from terrestrial plants to applications with varying degrees of added value, will surely be based on current developments in enzyme biotechnologies for macroalgae.

“In the era of social networks and immediate communication, it is rare to stop half-way, step back and leave written traces, especially when it exceeds 40 words and a photo. I wish here to share consistent information through this progress report which will allow all stakeholders to measure the outcomes of active research on seaweed within IDEALG as well as immediate prospects until Horizon 2020”.

TTABLE OF CCONTENTS

1 Foreword 2 Summary 5 Introduction

6 Goals and organization 7 Partnership and Expertise 8 Facts and Figures

13 Axis1 - Increase fundamental knowledge: from genes to molecules 14 The Seaweed-Omics virtual platform

17 Seaweed biotic interactions, adaptation and acclimatation 18 Integrative analysis of seaweed metabolism

22 Axis2 - Improve seaweed valorisation 22 The use of marine enzymes and proteins with biotechnological potential 25 Applied blue chemistry

28 Axis3 - Maintain sustainable seaweed resource 29 Seaweed breeding and genetic resources 30 Open sea aquaculture practices and technologies 31 Occurrence of diseases 31 Modelling potential areas for seaweed farming in France 34 Evaluating socio-economic impacts of seaweed farming 35 Exploiting wild populations: kelps and shore seaweed

37 IDEALGs support to the seaweed sector in France

38 Regional Implications: BREIZH'ALG Program 39 The status of Wakame farming in France and perspectives 40 IDEALG: a support to resource management committees 41 Dissemination and new outcoming projects

44 Conclusions and perspectives for 202048 Appendix49 1 - List of Figures and Table 150 2 - Publications & Patents56 3 - PhDs within IDEALG66 4 - Conferences and communication

5

INTRODUCTION

6

GGoals and organisation oof IDEALG

IDEALG's ambition is to create for the very first time in France, a virtuous and complementary continuum of skills and expertise in the field of seaweed, traveling from the academic sector to economic valorisation. This approach puts in perspective a virtual technology transfer centre in order to stimulate innovation within the sector and develop new biotechnological applications in a sustainable way. This continuum integrates a comprehensive network of scientific approaches based on strong interactions between partners as well as several SMEs and industries. The main objectives of IDEALG are to:

Make the most of basic genomic knowledge and post-genomic research to generate new tools to improve and domesticate local seaweed species.

Stimulate the use of macroalgae in the biotechnology sector, including the exploitation of the meta-genomics of micro-organisms closely associated with macroalgae.

Anticipate the economic, social and environmental impacts generated by the development of the sector, without losing sight of developments in other maritime activities (including the development of oyster and abalone- Off-shore wind turbines). Conservation and biosecurity issues will also be addressed in a context of competition for space and water. The IDEALG work program is organized into 10 main tasks (work-packages or WP). Four WPs focus on

fundamental research developments, including a transversal task that focuses on the development of tools and the production of so-called "omic" data from the implementation of genomic approaches in the broad sense. Three other WPs are to transfer new biological knowledge acquired to generate developments in biotechnology, aquaculture and chemistry. Two tasks are devoted to the establishment of platforms for dissemination and transfer to the stakeholders, one concerns social, economic and environmental issues and the other is devoted to technology transfer. Finally, a task is dedicated to new collaborative projects in the perspective to further. The general structure of IDEALG appears in Figure 1 below and highlights three main targets:

Increase fundamental knowledge: from the genes to the molecules Improve seaweed valorisation Maintain sustainable seaweed resource

Figure 1: Research axes and interactions between the work packages within IDEALG

7

PPartnership and Expertise

The IDEALG project is administratively held by the CNRS and UBL and is conducted by Dr Philippe Potin, CNRS research director at the Roscoff Marine Station. The partnership is composed of 12 academic institutes (CNRS, UBL, UBO, UBS, ENSCR, Agrocampus Ouest, University of Nantes, IFREMER, INRIA, INRA), 4 private organisations (CWeed aquaculture, ALEOR, France

Haliotis, Bezhin Rosko) and 1 technical centre specialised in seaweed biomass transformation (CEVA). The consortium is mainly concentrated in Brittany due to the expertise which has developed through time (in relation to historical activities in the region) involving seaweed production and valorisation.

Dr. Philippe Potin SScientific coordinator of IDEALG

CNRS research director at the Roscoff Marine Station (UMR 8227), Philippe Potin is specialised in seaweed biology and metabolomics. He undertook his PhD through a private-public project on seaweed valorisation and since has developed his scientific career in Seaweed Biotechnologies with great interest towards societal and industrial challenges. Philippe is in charge of implementing the IDEALG project, initiates new collaborative projects (WP9) and supervises the knowledge transfer in the blue biotechnology sector for seaweeds (WP10).

8

DDr Catherine Boyen CCNRS -- UUMR 8227 Laboratory manager (LBI2M) at the Roscoff Marine Station since 2004, Catherine is specialised in seaweed biology and functional genomics. Catherine is in charge of co-coordinating WP1 by implementing the virtual “omics” platform and developing and upscaling genomic and post-genomic tools.

DDr Myriam Valero CCNRS -- UUMI 3614 / UMR 7227 Laboratory manager (EBEA) at the Roscoff Marine Station, Myriam is specialised in seaweed population genetics. Myriam is in charge of co-coordinating WP2 and focuses her work on brown seaweed domestication and genetic dissemination of cultivated strains.

DDr Erwan Corre CCNRS -- FFR 24244 Bio-analyst research engineer in charge of the ABIMS bio-informatics platform at the Roscoff Marine Station, Erwan is in charge of implementing high-throughput big data analysis from divers sequencing projects from seaweed to associated bacteria

DDr Annee Siegel IINRIA -- IIRISA Research director at the IRISA-INRIA, Anne is team leader and specialised in Qualitative dynamical systems in computer science, biology and discrete mathematics. Anne brings a strong expertise in modelling seaweed metabolic networks.

DDr Martial Laurans IIFREMER Research scientist at the IFREMER centre of Brest, Martial is specialised in benthic ecology and population dynamics. Martial is in charge of measuring and monitoring the impact of off-shore seaweed harvesting on wild populations and global ecosystems.

DDr Katia Frangoudes UUniversité Bretagne Occidenttale ((UBO) Resaerch engineer in marine socio-economics, Katia is specialised in the fisheries and seaweed management and governance. Katia is in charge of co-coordinating the WP8 related to societal studies on seaweed resource (harvesting and cultivating).

DDr Alain Dufour UUniversité Bretagne Sud (UBS) Laboratory manager (LBCM), Alain is specialised in bacterial biofilms and anti-biofilm activities. Alain is in charge of evaluating anti-bacterial, and anti-biofilm properties of seaweed extracts and works closely with the Roscoff Marine Station for the sequencing of biofilm forming bacteria.

DDr Charles Tellier UUniversité de Nantes Former laboratory director (UFIP), Charles is specialised chemical and structural biology, biochemistry and protein engineering. Charles will bring his expertise in chemio-enzymatic synthesis of bacterial and algal proteins.

9

MMarie Lesueur AAgrocampus Ouest Research Engineer in the Fisheries department of Agrocampus Ouest, Marie is specialised in socio-economics of the sector and integrated coastal management. Marie is in charge of analysing the economics of the seaweed sector, and in particularly for food applications, with extensive consumer and market studies at a national level.

DDr Jean--PPhilippe Steyer IINRA Laboratory manager (LBE), Jean Philippe is specialised instrumentation, modelling and command control of anaerobic digestion processes. Jean Philippe, with his internal team undertakes LCA studies (Arnaud Helias…).

DDr Maud Benoit CCEVA R&D project manager at the CEVA in charge of Innovative Algae based Products, Maud is specialised in green chemistry (mainly biopolymers) and processing. Maud is co-coordinating the WP7 with Thierry Benvegnu (ENSCR) and will bring her expertise in processing seaweed biomass and upscaling.

DDr Thierry Benvegnu EENSC--RRennes Professor in Chemistry, Thierry will bring a solid expertise in seaweed polysaccharidetransformation with applications in the green chemistry sector (biodegradable surfactants). Thierry works closely with the CEVA on applied blue chemistry topics (WP7).

DDr Akira Peters BBezhin Rosko CEO of Bezhin Rosko, Akira is an independent scientist working on algal strains (private culture collection). Akira is co-coordinating WP6 Aquaculture and brings his expertise on seaweed aquaculture and preservation method on specific strains.

JJean--FFrançois Arbonna CCWeed AAquaculture CEO of CWeed aquaculture for 20 years, Jean Francois is a pioneer in Brittany regarding seaweed aquaculture. Jean Francois is in charge of preserving seaweed strains which have been selected throughout IDEALG in the view of improvement (crossings) and domestication studies which will be in line with downstream industrial needs.

CChristophe CCaudan AALEOR

Founded in 2007 by Olivier Bourtourault, Jean-Yves de Chaisemartin et James Amos, ALEOR will make the necessary space and tools available for seaweed cultivation trials and optimisation studies undertaken in WP6, notably a hatchery, on-land and out at sea cultivation systems as well as photobioreactors.

DDr Sylvain Huchette FFrance Haliotis CEO of France Haliotis (abalone production farm), Sylvain has a PhD and strong experience in Abalone reproduction and quality production. Sylvain will study the impact of seaweed feed on Abalone reproduction and quality. In turn, the chemical monitoring of the grazed seaweed will be undertaken by the Roscoff Marine Station for the better understanding of response to biotic stress.

10

FFacts and Figures

Scientific productions

The IDEALG project was funded up to 10 million euros distributed among the 18 partners and broken down over 10 years. Between 2011 and 2016, total expenses reached 5.9 million euros, i.e. 59% of the allocated budget. Over the same period of 6 years, scientific outcomes of IDEALG have increasing steadily. A total amount of 85 articles are now published in international journals (see Appendix). Moreover, 7 patents and a Soleau envelope have been deposited underlining the valorisation level of this research. A large number (see Appendix) of public communications as well as technical and studentship reports mentioning the support of IDEALG are also registered. In 2016, the cost of an IDEALG publication is estimated on average just under 70 k€ / paper. As a matter of figure, this publication cost can stand for the salary cost (including social charges) of 1 year Postdoc

position. As shown in the Figure 2, the publication cost has reduced tremendously since the beginning of IDEALG and is vowed to reduce even more with time (expenses will reduce and knowledge to valorise will be steady or increase).

Figure 2: Cumulated expenses (€) and number of IDEALG publications between 2011 and 2016

Deliverable status

Since our beginning in 2011, a total of 69 technical deliverables have been submitted to the funding agency ANR, representing a completion rate of 36%. The distribution of this rate is balanced among the work packages with between 20 and 64% (see Figure 3).

Figure 3: Completion rate of IDEALG deliverables 2011-2016.

Human resources and equity

The IDEALG consortium as defined in 2011 brought together more than 90 people, women and men, entrepreneurs, researchers, engineers and technicians distributed among the 18 partners. Since 2011, 44 people have been recruited under contract with the

aim to support the work of IDEALG by bringing technical expertise and knowledge. Therefore, IDEALG counts now more than 130 people actively working either directly or indirectly for IDEALG.

A total of 44 people was recruited through IDEALG funding, on a short-term contract basis (between 2 and 4 years). Notably, engineer and postdoc positions were opened in majority with two thirds of the employed staff, compared to technical positions. Global gender

equity between women and men was reached within the permanent staff (44% for women) as well as for the recruited staff (49% for women) as shown in Figure 4.

FiiiiFiFiiigure 2:::: Cumulatedddd expennnnnssssssseessssss (€) aaaaaaannnnnndddd nummmmmmmmmmmbbbbeeeeeeer of IDEALALALLALALLLLALLLLLLALLLLLLLALALLALGpublicccccaatatattttataaatattatatttiooooons bbeetweennnneeeenneeenneeeeennnenneen 222222222222222222222222222011 aaaaannnnndddddd 201666

11

Women49%

Men51%

Figure 4: Gender distribution within the IDEALG recruited staff.

However, going more in detail, disparities appeared. The proportion of women is higher in positions involving technical skills (60-80%), whilst men are more represented on executive-research positions (75%), as shown in Figure 5. On the other hand, Engineer positions reached equity (50%).

Figure 5: Gender distribution within position categories of recruited IDEALG staff

Since PhD funding cannot be attributed by the ANR, side projects had to be submitted in order to support IDEALG in its basic and applied research tasks as well as accomplish training of future research scientists in the sector. IDEALG labelled PhDs were therefore co-funded by Regions of Brittany and Pays de la Loire, CIFFRE, Ministry of Research and Europe. The number of active PhD students varies between 7 and 16 per year, with a strong growth since 2014 (Figure 6). The growing number of PhD students involved in IDEALG reflects a significant leverage effect with an acceleration of research and industrial projects. Since 2011, 26 PhD students have been involved in the advancement of IDEALG's work and 15 Thesis have been submitted and defended (list and abstracts in Appendix).

Figure 6: Number of PhD students and presented Thesis per year, co-funded in the spectrum of IDEALG (2011-2016).

Figure 7: IDEALG general assembly at the Roscoff Marine Station, October 2013

Fiiiiiiiiiiiiiiiiiiiigggugugugguuggggggggggggggggggggggggggguggggggggggg re 666666666666666666666666: NNNuuuuuuNNuuuuNummmmmmmmmmbmmm er oooofff ff PPPPhPPPPPP D sttttttuududddddu ennnnnnnnnts aaaaaanddddddddddddd pressssssseennnnnnnnnted TThhhhThhT eeessssssssssis peryear, cooooooo-------------fuuuuuufuuuuunnnnndnnn eeeeedeeeeeeee in thhhhhhhhhe spectrtrrrrtrt ummmmmm ooooof IDDDDDEEAAAAAALLLGGGGL (22222202222 1111111111111111111111-201111116111 ))))))))).))))))))))).))))))Figure 555: GGeGG nder

distributittiittttttttttttttttttttttttttttt onnnoonnn witttthin poooosition catttegorieeeees of recrrruited IDEALGstaff

12

IDEALG contract recruits: what’s next?

Among the staff recruited on temporary contracts, since the beginning of IDEALG, a number of recruits have found other positions in order to maintain their knowledge acquired during the IDEALG experience and further their interest in the sector. Approximately one third of the recruits have been employed on a contract basis once again or on permanent positions. Below are a few examples of permanent positions now occupied by the recruited staff.

Alexandra Jeudy Alexandra was recruited on an IDEALG contract as an engineer assistant on the Crystallography platform at the Roscoff Marine Station. She rapidly succeeded the CNRS examination to be positioned as a permanent staff on the platform and actively contributing to tasks within Axis-1

Dr Simon Dittami Simon was recruited as a IDEALG Post-doc at the Roscoff Marine Station. He succeeded the CNRS examination in 2015 and is now positioned as a permanent research scientist in the same laboratory. Simon is furthering his research topic on gene expression and metabolic networks and currently co-coordinating WP4

Dr Emeline Creis Emeline undertook her PhD under the supervision of Dr Philippe Potin (CNRS) and Dr Erwan ArGall (UBO) between 2012-2015. Funded Bretagne Region, Emeline’s doctorate involved the biosynthesis pathways of phlorotannin in brown seaweed. Emeline furthered her experience in the private sector in charge of an on-shore seaweed cultivation unit.

Dr Celine CONAN Céline undertook her PhD in partnership between the private company Goemar-Arysta and the Roscoff Marine Station, under the supervision of Dr Philippe Potin (CNRS) and Dr Anne Guiboileau (Goemar). Her subject focused on plant bio stimulant properties of brown seaweed extracts. Céline is now occupying a permanent position as a research manager within the Goemar-Arysta company in Saint Malo

Dr Bertrand Jaquemin Bertrand was recruited within IDEALG at the Roscoff Marine Station as a research engineer, bringing his expertise in ecology, evolution and population genetics. Bertrand has recently joined the CEVA as a project manager in seaweed monitoring service.

Dr Yann Guitton Yann was recruited as a IDEALG Post-doc at IRISA in Rennes. He succeeded the examination at the ONIRIS- Nantes in 2013 and is now research engineer on the metabolomic platform.

Dr Elisabeth Ficko-Blean Liz is Canadian and was recruited as IDEALG Postdoc at the Roscoff Marine Station. Her ambition is to understand the mechanisms of enzymes that modify the original polysaccharides of marine algae. Liz successfully passed the CNRS examination to be senior research scientist at the Roscoff Marine Station.

Dr Monique Ras Monique was project manager of IDEALG from 2012 to 2016 at the Roscoff Marine Station. She was then employed as Innovation Project Coordinator in the private OLMIX group until May 2017. Monique has now decided to set up her own company "BLUE SCIENCE Consulting and Management" which will be supported and hosted in the Blue Valley Science Park in Roscoff.

Axis-1Increase

fundamental knowledge:from genes to molecules

14

Axis 1CCatherine Boyen, Catherine Leblanc, Simon Dittami (SBR--CCNRS) and Anne Siegel (IRISA) are major actors in this work axis wwhich involvess a large panel of tasks related to increasee the fundamental knowledge on seaweeds and associated mmicrobes, from genes to metabolites, that is essential to improve seaweed valorisation and maintain their biological and ggenetic resources. These activities have required the implementation of a virtuall platform for integrating genomics, ffunctional genomics, phenotyping, and bioinformatic developments dedicated to the project ((WP1--SSeaweed ”OMICS”). To iincrease the fundamental knowledge on the defence mechanisms against pathogens or grazers and stress ressponses in aalgae, integrated studies were also conducted on the physiology and adaptation traits of seaweeds in their natural eenvironment (WP3). The understanding of biofilm formation and control at the algal surface and the microbial ddegradation pathways oof seaweeds cell walls benefited also from the development of metagenomics tools. To gain an iintegrated knowledge of the algal metabolism, metabolic maps of one representative of brown and red seaweeds were ddeveloped in WP4. Aspects of this metabolic knowleedge have been considered for investigating genetic resources, bbreeding, harvesting natural populations of algae and to develop aquaculture practices in axis 3 with the aim to better eexploit algal resources. Using these integrative approaches combining strrategies for genome mining, global ttranscriptomics, proteomics and metabolomics, Axis 2 of IDEALG has discovered dozens of novel metabolites and fully ccharacterized more than 50 enzymes that could have potential applications in industry and be developed forr seaweed vvalorisation.

TThe Seaweed--OOmics virtual platform

The Seaweed-Omics virtual platform links transversal activities which aim is to develop new tools and to acquire and store data and provide support to other work packages of IDEALG (mainly WP2 to WP5, but also in a lesser extent WP9. The idea is to share and centralise expertise and efforts (financial and human) in order to streamline the production of data and the development of new technological tools as well as to facilitate the access to the infrastructures and equipment of the consortium. The production of data includes genomic and metagenomic data, as well as many other “omics” data essential for deciphering the major metabolic pathways and gene network regulations of marine algae as well as associated organisms (pathogens and endo/epiphytes). The development of tools involves mainly functional genomics and genetics that are crucial for identifying gene functions/phenotypes and for generating new bio-catalysts. Another objective is also to ensure an appropriate bioinformatic environment and support to analyse, store and make accessible the various sets of “omics” data and tools that will be developed and produced in the course of the project. IDEALG participates to the equipment and to provide human resources for the Bioinformatics and Genomics facilities which are now embedded within the EMBRC France infrastructure at the Roscoff Marine Station.

Other achievements and work in progress are in:

SSeaweeds genomics: The genomes of the red alga Chondrus crispus and of several strains of the have been sequenced and annotated or re-sequenced for mutants or ecotypes of Ectocarpus genome strain. In addition, a genome sequencing project of more than 40 strains, covering 37 species of brown algae, was initiated in collaboration with France Génomique

(Phaeoexplorer project, https://www.france-genomique.org/spip/spip.php?article185).

MMetagenomics and bacterial genomes: The sequencing of 7 genomes from marine bacteria associated with algae was carried out. The annotation of these genomes was carried out on the PF MicroScope of the Infrastructure for Bioinformatics (IFB) in Evry. This first phase is continued by the sequencing on the Roscoff GENOMER core facility of about 100 new genomes of marine bacteria involved in the degradation of marine polysaccharides in order to identify new enzymes and to reconstruct the metabolic map of the bacterial communities concerned. Several inventories of bacterial microflora associated with brown algae or abalone have been carried out using a metabarcoding (16S) approach.

TThe development of methods for genetic ttransformation of the EE. siliculosus aalgal model: An RNAi protocol was developed in the brown alga Fucus and initial results indicated that the protocol can be transferred to E. siliculosus (Figure 8). Moreover, the choice has been made to concentrate efforts on the development of a reverse genetics approach of Tilling in E. siliculosus. A library of 2200 individual mutants was generated by optimizing a UV mutagenesis protocol. The mutagenized samples were collected and a multiplexing strategy was implemented to analyse the mutant populations for candidate genes (illustration next column). Sequence analysis is underway.

TThe development of new tools for protein eexpression: in order to improve the production rate of active soluble proteins for biotechnology applications, efforts have been made to optimize the existing protocols (new cloning techniques in E. coli) and to develop New heterologous systems [diatom, Pichia

15

yeast and system of overexpression in Bacillus compatible with the regulation for the agri-food and health for the status GRAS (Generally Recognized As Safe). All these approaches have been validated for a number of target proteins from algae and marine bacteria and the biochemical and functional studies are underway in WP3, 4 and 5.

Figure 8: Ecto-tilling protocol

PPhenotyping: Large sets of transcriptomic data were generated for the red alga Chondrus crispus (abiotic stress) and different mutants or ecotypes of Ectocarpus in order to feed WP2, 3, 4 and 5. The sequencing of peptides by mass spectrometry confirmed the identification of proteins of several metabolic pathways (phlorotannin, iodine and mannitol) in various approaches of proteomics in algae and bacteria. Metabolic profiling of brown and red algae was performed on METABOMER core facilty to analyse copper tolerance in 2 species of brown algae, chemical interactions with herbivores in brown algae, metabolism of phlorotannin and fatty acids. A protocol of random mutagenesis by transposition has been developed in the marine bacterium model Zobellia galactanivorans in order to allow the functional characterization of candidate or unknown genes in this organism. Glycomic approaches to characterize the cell wall composition of algae have been developed (see highlights).

BBioinformatics: Numerous developments have been carried out in order to deploy automated data processing tools and pipelines within the "Galaxy" web

environment: New Generation of Sequencing (NGS) data analysis, phylogeny, RADseq, semi-automated analysis of raw data Metabolomics (Workflow4Metabo see Highlight). - Development of prototypes and tools to facilitate theidentification of biological compounds of algae andmarine bacteria- Development of the Samifier prototype of decisionsupport for biologists in order to standardize thedescription of a network metabolic network.- Development of the GMOD (Generic ModelOrganisms Database) suite. GMOD is a suite ofinterconnected opensource applications and databasesto view, annotate and manage algae genetics andgenomics data.- Contribution with the PIA EMBRC-Fr to thedevelopment of the Marine Models Organismsdatabase which now offers a dedicated and integratedenvironment.

Figure 9: RNA interference in Ectocarpus following transfection of gametes with tubulin siRNA. The photograph shows a transfected Ectocarpus individual which has not undergone cell division (arrow) whereas the other two individuals of about the same length

16

Glycomics: medium throughput phenotyping of the cell wall of the brown algae led to the discovery of a new polysaccharide MLG (mixed- - -D-glucans.The composition of the cell walls of algae may vary according to the species, depending on the stage of development, the geographical location and the season. To date, much of the knowledge gained on the composition of brown algae walls has been based on labour-intensive chemical extractions, followed by in-depth structural analyses and is focused on specific individuals. A major challenge related to cell wall analysis in brown algae is access to a rapid phenotyping method that provides relevant information on polysaccharide structures from large sample populations.

To do this, specific probes and antibodies have been developed in order to characterize the components of the walls of brown algae in algae tissues. An immuno-localization imaging approach has been developed to perform medium / high throughput screening of various algal tissues from different culture conditions and / or species. For example, this tool can be used to identify specific ecotypes or cell wall mutants. It was complemented by the adaptation and optimization of a glyco-array type chip that allows the medium throughput screening of collections of extracts of brown algae at and has led, in particular, to the discovery of a new polysaccharide MLG (mixed- - -D-glucans.

Workflow4Metabo: the first fully open and collaborative online platform for computational metabolomics.The team of bioinformaticians led by Christophe Caron and Erwan Corre at the Roscoff Marine Station and a chemical analyst hired by IDEALG, Dr Sophie Goulitquer developed in collaboration with the national infrastructures IFB and MetaboHub, Workflow4Metabolomics (W4M), the first fully open and collaborative online platform for computational metabolomics. W4M is a virtual search environment built on the Galaxy web platform. It allows ergonomic integration, exchange and execution of individual modules and workflows.

The W4M infrastructure allows experimental users with no particular programming skills and advanced developers to perform state-of-the-art reproducible computer analyses from raw data to metabolite annotation (Giacomini et al., 2014-Ref.17). The entire W4M suite and computing tools can be downloaded as a virtual machine for local installation (http://workflow4metabolomics.org/).

17

SSeaweed biiotic interactions, adaptation and acclimatization

To support the efforts of genetic improvement of algae by identifying traits of interest and provide a better understanding of the interactions between algae and their associated bacteria in support of aquaculture techniques or for the transformation of algal biomass, an increased knowledge is required. During this first phase of the IDEALG project, work involved studies of algae defence responses to pathogen or herbivore attacks, of algal adaptation mechanisms in their natural environment, and the associated microflora and its role in the physiology of algae or their degradation. The achievements enabled the acquisition of data on transcriptomic and metabolic regulation in brown and red macroalgae subjected to abiotic stresses such as copper pollution, UV, environmental acidification, temperature rise or emersion, in situ and in the laboratory (Ref.). We have also continued the study of biotic interactions in algae, focusing our work on kelps

and especially the exploited species. We have thus shown that, like terrestrial plants, kelps regulate their metabolism in response to herbivores and that defence responses may propagate within the alga in a systemic way (see highlight). In parallel, we identified endophytes of Saccharina latissima using molecular methods and studied the dynamics of the trophic network associated with Laminaria hyperborea in situ. A second axis of our work involves the genomic and functional characterization of the bacterial microflora associated with algae, to better understand its role in the degradation of algal polysaccharides (sequence of the genome of Zobellia galactanivorans and other model bacteria, digestive microflora of algae-fed abalone), and in the physiology and adaptation of algae in their marine environment. More detailed research is also underway to isolate and identify compounds extracted from algae with antibiofilm activities against bacteria.

Systemic defence against herbivores in kelpsFollowing the elicitation of its defences at one extremity, Laminaria digitata presents physiological responses along its thallus, which can lead to a global protection of the alga. The brown algae belong to one of the eukaryotic lineages, the Stramenopiles, where complex multicellular organisms evolved, with the Opisthokonta (animals, mushrooms) and plantae (terrestrial plants, green and red algae). In these three lines, biotic stresses induce very similar local defence responses. These are followed by immune protection of the whole individual, in animals and plants. In order to investigate whether systemic responses also exist in large brown algae (hypotheses in the below illustration) different parts of Laminaria digitata plantlets were challenged with oligoguluronates and then defensive responses were measured in the distal parts that were not in contact with this defence elicitor.

A systemic response was detected at distance, which included oxidative responses, increased haloperoxidase activities, and increased protection against herbivores (Thomas et al., 2014-Ref.37). This is the first time that such communication has been demonstrated during the defence reactions of brown algae. Preliminary results based on the use of pharmacological inhibitors also suggest that the release of free fatty acids could play a role in this systemic signalling, similar to plants. These results also indicate that systemic immunity has undoubtedly emerged independently, following convergent evolutions within the three multicellular eukaryotic lineages.

18

The composition of the digestive flora of the abalone, is more influenced by the season than by the dietAs part of a colaboration between France Haliotis and the Roscoff Marine Station, the effect of four algal diets was tested on the digestive microbiota of abalone, raised in open sea waters for one complete year.

Despite major differences between the polysaccharide compositions of the four selected algae, three main bacterial genera (Psychrilyobacter, Mycoplasma, and Vibrio) dominate the digestive microbiota of the abalone, with varying proportions depending on the season.

We have also shown that specificities of bacterial composition exist as a function of the diet (see side graphic). Although they represent a small proportion of the bacterial community, these minor bacteria may be essential for the proper assimilation of algae by abalone (Gobet et al. submitted-Ref.18)

IIntegrative analysis of seaweed metabolism

The integrative analysis of the seaweed metabolism over the first five years of IDEALG required the reconstruction of algal metabolic networks. Given the lack of well characterized models in the different algal lineages, this process required the development of new tools adapted to our models. The obtained networks have been developed to be used as a basis to study enzymatic functions / evolutionary history of selected pathways, and as a basis to elucidate algal bacterial interactions. The main highlight is the reconstruction of the first genome-scale metabolic network of a brown alga Ecto-GEM (Prigent et al. 2014-Ref.30). Reconstruction was made possible by the development of novel tools (Prigent et al. 2017-Ref.31) suitable to work with highly incomplete draft networks. Since this first reconstructed network, the developed tools have been

incorporated into user-friendly workspace giving access to these tools to a larger community beyond IDEALG and to the future automatic reconstruction and comparison of several algal network inside IDEALG (AuReMe, http://aureme.genouest.org/). These tools, initially intended only for gap-filling networks, have proven to be versatile and have since also been used to generate hypotheses on metabolic interactions between an alga and its microbiome. Other achievements and work in progress involved: - The construction of similar networks is currentlyunder construction for the red alga Chondruscrispus- The development of an algorithm for theclassification of Haloacid dehydrogenases (HADs)and it use on the genome of Ectocarpus and several

Composition of the abalone microbiota, showing the common bacterial genus on the left and those more specific to each algal diet on the right.

19

EctoGEM, the first biological network to study the metabolism of a brown algaA strong collaboration between IRISA (Anne Sigel) and the Roscoff Marine Station (Thierry Tonon) generated EctoGEM, the very first functional brown algal metabolic network. This network was based on data from the Ectocarpus seaweed model and consisting of 1866 reactions and 2020 metabolites (ppiipeline illustrated in A). Its analysis shed light e.g. on the evolution of phenylalanine biosynthesis (illustrated in B) and the molybdenum co-factor biosynthesis pathway and has become a valuable community resource.

AA BB

MMENECO: development of a topological gap--ffilling tool adapted for metabolic networks of non--mmodel organisms The development of EctoGEM necessitated to automatize other operations. Therefore, the working group generated Meneco, a simple tool for the topology-based analysis and gap-filling of metabolic networks. This tool has been incorporated into a comprehensive workspace for the semi-automatic construction of metabolic networks for non-model organisms (Aureme Workspace based upon the Padmet toolbox).

other brown algae, as well as several brown-algae associated bacteria. - The development of an algorithm for the classificationof Haloacid dehydrogenases (HADs) and its use on thegenome of Ectocarpus.- The biochemical characterization of.HADs and otherenzymes thought to be involved in the mannitolmetabolism in collaboration with Axis2.- The detailed analysis of the genomic basis of steroidmetabolism in red and brown algae, highlightingseveral unique algal features. Experimental validationof the presence of predicted sterols is currently inprogress.

- The use of metabolic networks to generatehypotheses on probable interactions between algaeand selected associated bacteria (see Figure 10 for anexample), and are in the process of generating thenecessary data to adapt this procedure toalgal/bacterial metagenomes.- The experimental identification of metabolites in anorganism is an important part of creating acorresponding metabolic model. We have thereforemade a significant contribution toWorkflow4metabolomics, an analytical pipeline to treatdata from metabolite profiling.

20

Figure 10: A predicted metabolic complementarity between E. siliculosus (orange enzymes) and the symbiotic bacterium Candidatus Phaeomarinobacter ectocarpi (blue enzymes) for the synthesis of Vitamin B5: the alga is likely providing pantotate, the bacterium may provide beta-alanine for this purpose

AAxis 1 publication short list

1. Bordron P et al. (2013). Lecture Notes inComputer Science :206–218.

2. Bordron P. et al. (2015). Microbiology open.http://doi.wiley.com/10.1002/mbo3.315.

3. Bourdon J. et al (2011). PLoS Comput. Biol. 74. Collen, J et al. (2013) PNAS USA 110: 5247-

52525. Collet G. et al (2013). In:LNAI 8148 :245–256.6. Cormier, A. et al. (2017). New Phytologist, 214:

219-232.7. Coste F. et al. (2014) ICFCA 2014: 235-2508. Coste F. et al. (2014) ICGI 2014: 49-639. Creis E. et al. (2015). Plos One, 10(6):

e0128003.10. Dittami S. M. et al. (2014). Frontiers in

Genetics, doi: 10.3389/fgene.2014.00241.11. Dittami SM et al. (2014) Front. Genet. 5:241.12. Dittami SM. Et al. (2014). Mol. Ecol. 23: 1656–

60.13. Dittami SM. Et al. (2016) ISME J. 10: 51–63.14. Farnham G et al. (2013) J. Phycol. 49:819-82915. Gaillard F. and Potin P. (2013) Chapter in

Outstanding Molecules of Marine Organisms.Wiley..

16. Geoffroy A. et al.. J. Phycol., 51: 480–489.17. Giacomoni F. et al. (2014). Bioinformatics.

31:1493-518. Gobet A. et al, (2017), submitted19. Godfroy O. et al. (2015) Marine Genomics 24 :

109-113.

20. Goulitquer S. et al. (2012) Mar Drugs. 10:849-80.

21. Jam M. et al. (2016) FEBS J 283: 1863-1879.22. Kowalczyk et al. (2014) PLoS One. 9:e8657423. Labourel A. et al. J Biol Chem. 289:2027-4224. Leclerc J. C. et al. (2013). Marine Biology, 160:

3249-3258.25. Leclerc J.-C. et al. (2013). MEPS 494: 87–105.26. Leclerc J.-C. et al. (2015). Estuar. Coast. & Shelf

Sci., 152: 11-22.27. López-Cristoffanini et al. (2015) Proteomics.

15:3954-6828. Martin M. et al. (2014) Appl. Env. Microbiol.,

80 : 4958-496729. Martin M. et al. (2014) Appl. Microbiol.

Biotechnol., 98: 2917-35.30. Prigent S. et al. (2014). Plant J. 80:367–38131. Prigent S. et al. (2017) PLoS Comput. Biol.

13(1): e1005276.32. Ritter A. et al. (2014). BMC Plant Biology 14,

116.33. Ritter A. et al. (2017). Plos One 12: e0173315.34. Rousvoal S et al. J. Phycol. 52 : 493–50435. Sordet C. et al. (2014) Aquatic Toxicol. 150:

220-22836. Tapia J. et al. (2016) Frontiers in Microbiology

7: 197.37. Thomas F. et al., (2014) New Phytol 204: 567–

576.38. Tonon T et al. (2011). Omics 15:883–92.

21

Axis-2Improve seaweed valorisation

22

Axis 2MMirjam Czjzek (SBR), Maud Benoit (CEVA), TThierry BBenvegnu (ENSCR) and Charles Tellier (University of Nantes) are major aactors in this wwork axis wwhich iinvolves a large panel of tasks related to seaweed biomolecule production, characterisation aand transformation for high--vvalue products. NNo specific applicaation is targeted, which leaves way to develop a wide vvariety of tools which could be used in diverse sectors.

TThe use of maarine eennzymes aand proteins with biotechnological potential

The originality of numerous metabolic pathways in macroalgae opens the access to marine enzymes and proteins with unique activities and properties that can be used to produce high added value products or enzymes as tools in white (blue) biotechnological processes. One of our first tasks was to identify, clone and produce these novel enzymes and proteins of interest in a soluble form, to have sufficient quantities of the protein samples to perform biochemical characterizations and eventually start exploring potential applications. To date about 390 proteins have been cloned, of which about 50 enzymes have been produced and purified and the biochemical and structural characterizations are ongoing. These novel enzymes were investigated for the transformation of marine polysaccharides and other marine specific metabolites. For example, we ave identified and characterized a marine bacterial iodo-peroxidase, a glycoside hydrolase of GH105 family with the unprecedently described activity by cleaving the products of an ulvan lyase, thereby producing monosaccharides (reference 7); several members of a new family GH117 that hydrolyse

agaro-oligosaccharides to release the 3,6-anhydro-L-galactose (reference 8); and analysed in detail themechanistic determinants of two distinct marinelaminarinases (references 2 and 5) as well as thebinding properties of a CBM6 attached to one ofthe laminarinases (reference 6).We also undertook bioengineering experimentsinvolving a marine agarase, to invert its hydrolyticactivity and to favour trans-glycosylation, with theaim to produce long-chain agaro-oligosaccharides.

23

Engineering laminarinases for the production of oligo- -1,3-glucans

-Glucans are well known for their biological properties, useful in developing immunotherapies in order to enhance the natural ability of immune system to fight against diseases or to relieve the patients from side effects associated to severe treatments.

Our main objective is to use specific glycosidases extracted from macroalgae as new biocatalysts -glucans either with O-glycosidic linkages or with thio-bridges. Such chemo-enzymatic synthesis first required production of structurally well-defined oligosaccharides, especially those containing sulphur atoms. The resulting increased stability allowed obtaining 10-fold increase efficiency against colon cancer stem-like cells comparing with native laminarin.

Some other oligosaccharides were then involved in chemical coupling biocatalyzed by a mutant of (E269S) LamA glycosidase from Z. galactanivorans. Even if improvements are still required, we could obtain tetra saccharides with good selectivity. Our current endeavour is focused on a double mutant in order to (i) optimize both molecular recognition and transglycosylation efficiency, and (ii) target hexa- or octa- -glucans which have better biological activities (Ref. 6 and 7).

Brown algae contain phlorotannins, aromatic (phenolic) compounds that are unique in the plant kingdom. Phlorotannins are natural antioxidants of great interest for the treatment and prevention of cancer and inflammatory, cardiovascular and neurodegenerative diseases. Long term research of metabolic pathways of this compound has led to elucidate the key step in its production process, by using a small brown alga model species, Ectocarpus

siliculosus. This work also revealed the important role of a specific enzyme (PKSIII) in the biosynthesis of intermediate metabolites. These findings have been patented and knowledge transfer is at a sufficiently mature state to facilitate the production of phlorotannins of marine origin, phloroglucnol derivatives which are already used as natural extracts in the pharmaceutical and cosmetic industries

24

A PKS enzyme from Ectocarpus, structure, function and valorisation of a phloroglucinol synthaseBrown algal phlorotannins are structural analogues of terrestrial plant condensed tannins, such as anthocyanidins and other flavonoids, and similar to plant phenolics they carry numerous bioactive functions. Despite their importance in brown algae, their corresponding biosynthetic pathways have been hardly characterized at the molecular level. We found that a predicted type III polyketide synthase (PKSIII) in the genome of the brown alga Ectocarpus siliculosus, EsiPKS1, recombinantly expressed in E. coli, catalyses a major step in the biosynthetic pathway of phlorotannins, i.e. the synthesis of phloroglucinol monomers using malonyl-CoA. The crystal structure at 2.85-Å resolution of the first dimeric algal EsiPKS1 provided a first glimpse of its active site, showing a modified Cys residue, probably connected to an acetyl group. An additional pocket compared to all known PKSIII, contains a reaction product that might correspond to a phloroglucinol precursor. We also monitored phloroglucinol content in Ectocarpus cells in vivo and found a correlation of the PKS III gene expression level with the phloroglucinol amount during seawater adaptation or acclimation.

These findings shed new light on the origin and evolution of a major metabolism among the photosynthetic stramenopiles and also provide new molecular tools to further investigate the regulation of phlorotannin biosynthesis, together with their biological role in brown algae. (Ref. 1). Based on the activity of the heterologously expressed protein, a project of maturation towards biotechnological applications of this type of enzymes have been initiated and is presently expecting a contract with a private company through the Toulouse White Biotechnologies demonstrator network.

AApplied blue chemistry

Four seaweed species were studied (CEVA), covering the 3 main groups of algae (brown, red, green). First, the optimization of the pre-treatment methods was carried out on 2 brown algae widely used on an industrial scale and whose culture is completely controlled. Indeed, the large volumes currently produced in Europe (harvesting or cultivation) lead to problems of stabilization of algae awaiting transformation. Seaweed stabilization represents a considerable challenge for the organization of supply chains.

These processes could help compensate the seasonality of macroalgae, thus hoping to work on fresh algae stabilized throughout the year. For the pre-treatment of raw materials, various processes are used

industrially today, such as conventional hot drying, bleaching, salting for longer storage times, or the use of preservatives such as formaldehyde for applications such as the extraction of alginates. In the framework of Axis 2 (WP7), experiments were carried out to observe the preservation of the algae Saccharina latissima and Laminaria digitata by the silage (lactic fermentation) process. The main results showed that algae conservation is possible for 90 days at a temperature below 20 °C. During tests in the presence of lactic ferments, a decrease in pH of 7 to 4 is observed, under anaerobic conditions (Figure 11). The production of lactic acid in situ reaches 6% after 9 days of silage. An evaluation of the quality of the alginates extracted before and after the silage process will be carried out in the coming months.

25

Figure 11: Evolution of pH upon different S. latissima fermentation studies (CEVA, WP7)

A fractionation process was developed mainly on a green alga model, Ulva armoricana. Several aspects have been studied within this topic: extraction of polysaccharides (Ulvans, starch), extraction of DMSP, processes of chemical or enzymatic hydrolysis, production of a platform molecule (glucose), ethanolic fermentation from hydrolysate of algae Important developments have occurred on the cationization of marine polysaccharides of red algae: carrageenan. Glycine betaine (co-product of the sugar

industry) was used as a cationic agent (Figure 12). These new chemical derivatives, of marine origin, present both interesting properties in terms of bioactivity and rheology. In parallel with this research, other developments have also taken place on the synthesis of surfactant molecules, from polysaccharides extracted from algae, agar type and alginates. These compounds could find applications in the fields of cosmetics or detergents.

(a) (b)

(c) (d)(c’)

Figure 12: Transmission electron microscopy (TEM) of aqueous solution: carrageenan 0.0825 g/L and GB amide surfactant 0.29 g/L

26

A start-up company linking blue and green chemistry

The work on the use of algal polysaccharides for the synthesis of surfactant molecules between ENSCR and CEVA has initiated the development of new chemical compounds from seaweeds which can be upgraded by the “SURFACTGREEN” start-up. This company was created in 2016, with the aim of producing and commercializing surfactants of plant or marine origin.

AAxis 2 publication short list

1. Meslet-Cladière, L. et al. (2013) The Plant Cell, 25, 3089–3103.2. Labourel A. et al. J Biol Chem 289:2027-42.3. Hehemann JH. Et al (2014) Curr Opin Struct Biol. 28C:77-86.4. Fournier JB. et al. (2014). Appl Environ Microbiol. 80(24):7561-73.5. Legentil L. et al (2015) Molecules. 20(6):9745-66.6. Labourel A. et al. (2015) Acta Crystallogr D Biol Crystallogr. 71(Pt 2):173-84.7. Ficko-Blean E. et al. Acta Crystallogr D Biol Crystallogr. 71(Pt 2):209-23.8. Jam M. et al.. FEBS J. 283(10):1863-79.9. Ropartz D. et al. (2016) Anal Chim Acta. 933:1-9.10. Gaillard C. et al. (2017) Carbohydrate Polymers, 155, 49-6011. Gaillard C. et al. (2016) Data in brief, 9, 508-52312. Covis, R. et al. (2015) Carbohydrate Polymers: 121, 436-44813. Covis R et al. (2016) Journal Polymer Research 23:7814. Brockmann D. et al. (2015) Biofuel, Bioprod. Bioref. 9:696–708

Patents in progress: Oligo- -carraghénanes, composition cosmétique, dermatologique et pharmaceutique les contenant, et leur utilisation BNT218167FR00 Oligoporphyranes, procédé et médicament BNT218168FR00 Alpha-1,3-(3,6-Anhydro) -D-Galactosidases et leur utilisation pour hydrolyser des polysaccharides BNT218168FR00-GC9QK Nouvelle ulvane lyase et son utilisation pour cliver des polysaccharides BNT221378FR00

Axis-3 Maintain sustainable

seaweed resource

28

Axis 3MMartial Laurans (IFREMER), Katia Frangoudes (UBO), Marie Lesueur (AAgrocampus Ouest), Pierree Jammes (CEVA), Myriam VValero (SBR), Pierre Boudry (IFREMER) and Akira Peters (Bezhin Rosko) are all involved in this integrated work axis in wwhich seaweed domestication and aquaculture meets socio--eeconomic aspects and environmental impacts. The global aim iis to bring knowledge able to improve seaweed genetic resources (WP2) develop aquaculture practices and production ((WP6) whilst reducing impacts (WP8). Societal and administrative barriers relative to seaweed farming is a major issue in BBrittany and need tto be unlocked by integrating scientific and technical knowledge in order to evaluate the factual bbenefitss aand risks.

SSeaweed breeding and genetic resources

Most of the practices of seaweed farming rely on the collection of spores from a few sporophytes collected in wild populations. In order to develop a genetic improvement program, we have:

Developed reliable and rapid methods for identifying the sex of gametophytes; Established a perennial bank of unialgal culture of male and female gametophytes (potential parents); Sought to control fertility, i.e. induce reproduction or, conversely, accelerate vegetative growth.

Thus, molecular markers to identify male and female gametophytes have been developed for several species of brown algae (Lipinska et al., 2015). This has led to the isolation and conservation of several thousands of gametophytes which are currently in culture at the Roscoff Marine Station and within the company Bezhin Rosko.

Finally, experimental protocols have been developed to manipulate the life cycle of different species of brown algae (Ectocarpus, Laminaria ochroleuca and Chorda filum). The physico-chemical parameters tested are temperature, light intensity and photoperiod. In addition, the effect of interactions with bacteria on fertility and algal growth has been experimentally tested on the Pylaiella littoralis species complex, showing that bacteria play potentially an important role.

Finally, we rapidly focused our efforts on S. latissima, because it was the model that was chosen for the development of a genetic improvement program within IDEALG. In this species, control of fertility and the isolation of gametophytes allowed the production of controlled crosses, followed by the cultivation of the offspring on long lines (Figure 11).

FFigure 133:: Controled crossings of SS. latissima. SSeeding of collectors in cculture chambers then transferoon long--llines for oopen sea cultivation aat Roscoff or Saint Malo.. Photo on the left, after 70 days growing (WP2).

The model species Ectocarpus was initially used to develop the QTL mapping tool and results showed the proof of concept for investigating specific traits which can be of industrial interest. Stress tolerance to environmental parameters such as temperature and salinity were studied by exposing the Ectocarpus parents and 89 descendants of the same family to more or less stressful temperature and salinity conditions. We identified 39 QTLs for growth-related traits under different temperatures and salinities and their plasticity (Figure 14, Avia et al., 2017) Thanks to the development of this specific tool, genetic mapping and QTL analysis of agronomic traits of

interest will be undertaken on S. latissima F2 generation we are growing on long lines (see above). The offspring of these S. latissima crosses will be used on the one hand to establish the genetic map and the QTL analysis in the view of genetic improvements; and on the other hand, to analyse the importance of depression of inbreeding and / or allofecondation in this species. In parallel to these tool developments, a large range of S. latissima individuals were collected along the Frenchcoasts, phenotyped with biomass-related traits andgenotyped for other traits such as the variation iniodine concentration.

29

The very first worldwide collection of 3000 seaweed strains was set up at the Roscoff Marine Station. This collection involves more than 15 species of Ectocarpus and other Ectocarpales identified taxonomically by barcoding and several hundreds of strains, tissues and DNA of other model species: U. pinatifida, S. latissima, G. chilensis was also implemented.Although the red alga Gracilaria chilensis is not a localspecies, effort has been given to study the impact of its

extensive exploitation in Chile (sea highlight on next page) and hence outline the potential drawbacks which could affect France in the view of developing seaweed farms on the territory.

FFigure 144:: Genetic map of the brown seaweed EEctocarpus sshowing the localization of detected QTLss for temperature, ssalinity and their associated plasticity and survival traits (WP2).

OOpen sea aquaculture practices and technologies

IDEALG partners have adapted newly developed cultivation techniques to local brown seaweed species, other than the introduced U. pinnatifida, such as the large brown algae Saccharina latissima, Laminaria ochroleuca and Alaria esculenta. These new developments allow diversification and at the same time respond to demands of the quite volatile market. These local seaweed species are generally raised from spores collected from natural populations, with the gametophyte generation raised in suspension (“free-living”) and brought to fertility in nurseries. Subsequently, embryonic sporophytes are sprayed onto ropes, which after firm attachment are out planted to the field. Saccharina latissima being the identified flagship species of IDEALG, a large range of experiments were carried out in order to optimize its production. Seeding density, of which showed little influence of the latter on final yield, as well as different disposition of ropes out at sea (i.e. surface optimization) were studied.

Several periods of deployment at sea were tested from 2012 to 2016 indicating that early autumn (October) offered the best yields for the harvesting period between May and June.

© CEVA

30

Gracilaria chilensis exploitation in Chili towards extinction?From the 1970s, natural beds of G. chilensis were extensively harvested in Chile for agar production, until they collapsed in the late 1980s because of overexploitation. This crisis coincides with a rather limited genetic diversity. Today, G. chilensis is by far the most important seaweed crop cultivated in Chile, and also one of the few seaweeds for which evidence of domestication has been reported. Both ancestral, extensive culture practices and intensive aquafarming are based on vegetative propagation, using thallus cuttings and re-planting onto muddy soft sediments in bays and estuaries. Analysis of the genetic variability of natural populations using conventional molecular markers (microsatellites and DNA sequencing) demonstrated a trans-ocean origin (colonization from New Zealand) of the species Gracilaria chilensis farmed in Chile, which was considered to be endemic to the country. This work also revealed very low genetic diversity of the cultivated or wild populations of this species in Chile compared to populations in New Zealand.

The new NGS tools developed within this species are currently used to test the relative importance of the different possible scenarios: (1) bottleneck at the time of colonization of the Chilean coast, (2) overexploitation of natural populations, and (3) Method of clonal propagation that better explain the low genetic diversity currently observed in Chile. This work suggests that the erosion of genetic diversity along the Chilean coast may have seriously limited the capacity of individuals to adapt to changing environments and/or to respond to further human selective pressure for aquaculture needs. In conclusion, this study emphasises how the conjunction of recent bottlenecks with the predominance of clonal propagation seems to be driving this species into an extinction vortex in Chile (Guillemin et al., 2014).

© CNRS

31

An innovative raft system was designed to optimize cultivation surfaces by increasing the total length of cultivation lines per hectare. A significant improvement was reached with 2200 lm/ha, while typical values for the traditional longline system are in the range of 300 to 1000 lm/ha. The raft system has also shown good yield of Saccharina latissima compared to the traditional longline system. Indeed, the raft system was found to be particularly suitable under wave-protected conditions yielding 20kg alga/m2, but it was more vulnerable at more exposed sites, compared to traditional long-lines.

Cultivation of red algae Porphyra/Pyropia, which resembles Asian Nori used in Sushis, was also studied. The Conchocelis (or diploid phase) of Porhyra present

in Brittany was taken into culture to complete their life cycle, and was identified by molecular barcoding. Results showed that the diversity of these algae in Britany has probably been underestimated with possibly the presence of a few imported species. The best mariculture result in this group of macroalgae was obtained by co-cultivation of P. purpurea collected in the intertidal oyster cultivation zone, with results of 2kg/m2.

OOccurrence of diseases

Seaweed mass culture is liable to attract diseases, and therefore cultured ropes were regularly examined for disease symptoms. Over the five years, only one case of mass kelp pathology was observed on a concession. In 2016, Laminaria ochroleuca grown in southern Brittany (Morbihan) looked unhealthy and showed lesions in the blades.

At the same moment control cultures established on the northern coast of Brittany, grown from different spores in order not to mix geographic populations, were perfect. The causative agent of the disease in the Morbihan experiment remained unknown, in nurseries, juveniles of Saccharina latissima occasionally presented massive mortalities. Again, the reason for this was not found.

These studies highlight the need for further research on seaweed disease infections. Fundamental studies undertaken in Axis-1 have started addressing this point. Damageable endophytic algae for instance are being studied. Moreover, recent findings in Axis-1, on the effect of bacteria on seaweed, suggest that juvenile production in artificial water based conditions is most probably not recommended. Indeed, natural challenging by marine bacteria at juvenile stages might improve defence mechanisms.

MModellliing potential areas for seaweed farming in France Identification of suitable areas for seaweed aquaculture was studied with S. latissima growth parameters. Results involved superposition of climatological and hydrographic data with parameters

required for the establishment of mariculture infrastructures. Results showed surface predictions which are suitable for Saccharina mariculture in

© CEVA

© ALEOR

32

Brittany. Depending on depth constraints, between 50000 and 450000 ha were identified (Figure 13).

Figure 15: Potential areas for the cultivation of S. latissima in Brittany (WP6, CEVA).

So far, among the geographical sites identified as promising for seaweed aquaculture, some were not at all employed in practice. These results led to a first attempt by an IDEALG member to cultivate domestic kelp in the south Brittany (Morbihan).

Modelling the potential of seaweed aquaculture for bioremediation in areas under anthropogenic influence was also addressed by using a new 3D ecosystem model. The model was developed and applied to the brown species Saccharina latissima to evaluate the potential of seaweed aquaculture for bioremediation.

It was evaluated by performing simulations with and without the CEVA sea farm. The model showed that even if the area of the sea farm is expanded, the impact on dissolved nitrogen and phosphorus concentration remain low. Only the ammonium concentration decreased significantly. In terms of nitrogen and phosphorus uptake, the total nitrogen removed by Saccharina latissima was estimated at 10.8 tons between March and April (36 Tons for Ulva sp.). Compared to the loads in dissolved inorganic nitrogen brought by two rivers discharging nearby in the same period, the values remained very low.

Photobioreactor cultivation of the brown alga Ectocarpusmodel using unattached variantsSmall stages of macroalgae are of interest as source of valuable chemical compounds. They usually live attached to surfaces and are unattractive for culture in bioreactors because their harvest is virtually impossible. Unattached variants of the brown alga Ectocarpus model, referred to as “oro-imm” for an unattached gametophyte and “distag” for a weakly attached sporophyte, were exposed to different culture conditions and subsequently grown in a 1 m3 bioreactor (see below).

Maximum exponential growth in both variants (RGR ~ 0.4) represented a doubling time of ca. 1.7 days, comparable to other fast growing macroalgae but more than fast-growing microalgae. Our methods allow mass culture of Ectocarpus, new variants of which can be crossed withinto the non-attached strains, and show how other originally attached macroalgal species might be adapted to mass culture in bioreactors.

33

On shore cultivation was also studied with the aim to control environmental parameters and enhance the production of particular compounds of interest.

The green seaweed Ulva sp. was grown in on-shore tanks with the aim to modulate environmental conditions for enrichment trials such as increasing starch content for chemical valorisation, notably ethanol production through fermentation processes (WP6, CEVA). Inoculum quality, density in the tanks, nutrient stress (no addition of N) and a short cultivation period of 7-14 days were factors which only slightly improving the starch content.

Similar trials with the brown seaweed S. latissima, aiming to increase the mannitol and laminarin contents, did not shown significant results. Small species or microscopic stages of macroalgae may be cultivated in suspension in photobioreactors, in a similar way to microalgae. However, most candidate algae are in nature firmly attached to surfaces, prescribing their cultivation in bioreactors. Using unattached variants of the brown alga Ectocarpus model, representing the two generations of the alga, conditions of nutrient and light were optimised to allow mass culture in 1000L aquaria (see highlight above).

The difficulty to obtain farming concessions on the Brittany coast has encouraged farmers to develop tank cultivation. Notably, two companies have recently started such activities targeting Ulva sp. and juvenile kelps. Despite these difficulties, ALEOR company has recently obtained an extension permit of the current concession, increasing the cultivation surface from 7 ha to 27 ha. The administrative procedure required about two years work. The new surfaces will allow raising a diversity of local macroalgae demanded by the market, such as Alaria esculenta, Laminaria ochroleuca, Palmaria palmata and Saccharina latissima.

EEvaluating socio--eeconomic impacts of seeaweed farming

In France, the high mortality that has affected the oyster sector since 2008 has provided an opportunity for stakeholders in the sector to undertake a broad consultation on the state of activity and how to get out of the crisis. At the end of this consultation, some recommendations were made at the national level, including diversification towards seaweed farming. Since this new activity is still in its infancy and the prospects for its development raise many questions such as technical and economic feasibility, its integration into the coastal environment and its governance. Regarding these issues, a SWOT analysis was carried out on the development of seaweed farming in France and discussed with a large range of stakeholders (http://www.idealg.ueb.eu/). An analysis of the governance system of this activity was also carried out and a first work on its social acceptability is now in progress. Specific tools which can help decision makers to progress has been used within IDEALG. An LCA approach was undertaken on the production and valorisation (bioethanol) of Ulva, and proved the tool

useful for measuring environmental impacts of the whole process and for comparing it with other alternatives (terrestrial biomass…). In support to decision making tools, an ecosystem service multicriteria approach was undertaken by using the INVEST method which combines GIS tools and "service equivalence analysis" provided by habitats. This work deals with the question of the evaluation of ecosystem services and the costs of compensation in the context of seaweed farming projects at sea. The analysis was carried out on the basis of a case study (Normanno-Breton Gulf). The results highlight the effects of the potential location of seaweed farms on access criteria (physical constraints), potential conflicts of use, impacts on habitats and compensation costs. They also highlight the flexibility of the method, which can be refined by integrating other indicators and thus provide a robust decision-making tool. A wider survey on seaweed and ecosystem services is currently underway.

© CEVA

34

Axis 3 publication short listEExploiting wild populations: kelps and shore seaweed

IDEALG supports the existing traditional practices exploiting wild populations of seaweed in France. Approximately 70 000 tons of seaweed are harvested each year mainly for the colloid industry, feed and agriculture but also niche markets such as marine cosmetics and food. If aquaculture is developing, the wild population harvesting counts for 99% of the exploited biomass.

Understanding the natural dynamics of the resource is a prequisite in order to ensure sustainable practices. Besides anthropogenic activity, it is important to understand the factors that influence the seasonal or annual evolution of these resources. Thus, an individual follow-up with tag rings is undertaken on Laminaria hyperborea on two different sites. A similar approach is performed on Laminaria digitata.

The results characterize the dynamics of these algae in terms of growth, mortality or recruitment and the impact of winter conditions on these parameters. All these data allowed the development of a dynamic model of laminar biomass on the Molène archipelago. The integration of this knowledge and data can help management orientations for the exploitation of these species. Regarding algae harvested on the foreshore, the approach is similar for several species. A better understanding of natural cycles allows to develop other management approaches and to favour

harvesting methods that have the least impact on regrowth or on the environment. The integration of this work has taken place in the setting up of new harvesting schedules for several species with a spatial distribution including rules of access, in particular by the existence of fallow. The results on the trophic network associated with Laminaria hyperborea show the importance of this alga. Not only as a resource but as a structuring species of an ecosystem and thus integrate the recommendations that are necessary for its exploitation.

Increasing knowledge about algae, their operators and the market

IDEALG has addressed several key dimensions of the development of the seaweed sector. The dynamics of the resources, kelp and shore seaweed, were studied in support of the implementation of management measures and within the framework of a process of professionalization of hand activities. From the perspective of the development of seaweed farming and the implementation of compensation measures, the impact of production infrastructures on ecosystem services has been studied. The social organization of the sector and the markets were analysed. Results highlighted the institutional evolution represented by the intervention of new actors such as the Parc Marin d’Iroise and the crucial importance of supporting the expansion of the market of seaweed as food, especially for the development of seaweed aquaculture. The profession of harvesting of shore seaweed, seldom studied until now, has been investigated and is the object of an accompaniment by the IDEALG project team in its professionalization.

© A. LEDUFF

35

AAxis 3 publication short list

1. Leclerc et al., (2013). MEPS 494: 87–105.2. Leclerc J. C., et al., (2013). Marine Biology, 160 : 3249-3258.3. Leclerc J.-C., et al., (2015). Estuar. Coast. & Shelf Sci., 152 : 11-22.4. Leclerc J.-C., et al., (2016). Hydrobiologia, 777: 33-545. Brockmann D., et al (2015). Society of Chemical Industrie and John Wiley &Sons6. Leclerc J.-C., et al., (2015). Estuar. Coast. & Shelf Sci., 152: 11-227. Bennett S., et al., (2015). Ecol. Lett., 18 : 677-6868. Bordeyne F., et al, (2015). Mar. Biol., 162 : 2119-21299. Frangoudes, K. Garineaud C. (2015). Mare Publications Series, Springer.10. Taelman, SE, et al., (2015). Algal Research-Biomass Biofuels Bioproducts. 11: 173-18311. Cabral, P., et al., (2016). Marine Policy 71 (2016), pp. 157-165.12. Delaney, A. K. et al., (2016). Seaweed in Health and Disease Prevention, Elsevier, pp.7-40.13. GOUIN, S. et al., (2015). La revue de l'observatoire des IAA de Bretagne n°118, 10-1714. Stagnol D., et al., (2016). J. Appl. Phycol., 28 : 3407-3411.15. Stagnol D., et al., (2016). Estuar. Coast. Shelf Sci., 174: 65-70.16. Stagnol D., et al., (2016). Mar. Fresh. Res., 67 : 153-161.17. Bordeyne F., et al., 2017. J. Sea Res., 120 : 50-59.18. Peters et al. (2015) Cryptogamie, Algologie 36 : 3-29.19. Avia K. et al (2017). Scientific reports 7, 4324120. De Jode A. (2014). Master 2 Report : Ecologie Biodiversité et Evolution, Spécialité Ecologie Evolutive.21. Duarte, et al., (2007): Rapid Domestication of Marine Species. Science 316 : 382–383.22. Glémin, S. & Bataillon, T. (2009) New Phytol. 183 :273–290.23. Guillemin M-L, et al., (2014). PLoS ONE 9(12): e114039.24. Guzinski J., et al., (2016). Journal of Applied Phycology, 28: 3057-3070.25. Heesch S, et al. (2010). New Phytologist 188, 42-51.26. Lipinska AP, et al. (2015). PloS One 10, e0140535.27. Molvot F. (2015). Master 2 report : Master Evolution, Biodiversité et Ecologie (Paris 6).28. Montecinos A. (2016). NHN. Université Paris VI et Universidad Austral de Chile.29. Montecinos AE, et al. (under press). Molecular Ecology.30. Peterson, B. K., et al., (2012). PloS one 7, e37135.31. Valero M., et al., (2017). Perspectives in Phycology 4, 33-46