identification of a novel insulin-responsive element in the rat

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 269, No. 50, Issue of December 16, pp. 31908-31914, 1994 Printed in U.S.A.

Identification of a Novel Insulin-responsive Element in the Rat Thyrotropin Receptor Promoter*

(Received for publication, June 14, 1994, and in revised form, September 27, 1994)

Yoshie Shimura, Hiroki Shimura, Masayuki Ohmori, Shoichiro IkuyamaS, and Leonard D. Kohn From the Section on Cell Regulation, Laboratory of Biochemistry and Metabolism, NIDDK, National Institutes of Health, Bethesda, Maryland 20892

. .

By transfecting TSH receptor (TSHR)-chloramphenicol acetyltransferase (CAT) chimeras into FRTL-5 thyroid cells in the presence or absence of insulin, we identify an insulin-responsive element (IRE) between -220 and -190 bp of the TSHR 5’-flanking region. The region between -220 and -192 bp is footprinted by nuclear extracts from FRTL-5 cells and, coupled to a heterologous SVIO-CAT chimera, an oligonucleotide containing the protected region induces insulin responsiveness in FRTL-5 cells. FRTL-5 cell nuclear extracts form two groups of protein-DNA complexes, A and B, in gel shift assays using an oligonucleotide having the protected sequence; mutation data indicate only the A complexes are increased by exposure of FRTL-5 cells to insulin; TSH can also increase A complex formation, but the TSH action is insulin-dependent. The nuclear factor(s) in FRTL-5 cells that interact with the TSHR IRE are distinct from thyroid transcription factor-2 (TTF-2), the insulin regulatory factor of the thyroglobulin promoter, as evidenced by the absence of competition in gel shift assays; there is no apparent sequence similarity of this region with other known IRES. The IRE is immediately upstream of a thyroid transcription factor-1 (TTF-1) binding site, -189 to -175 bp; mutation of the TTF-1 site causing a loss of TTF-1 activity also causes a loss of insulin responsiveness when the TSHR-CAT chimera at -220 bp is transfected into FRTLd cells and an altered IRE footprint by nuclear extracts. The TSHR appears, therefore, to contain a novel IRE whose activity depends at least in part on TTF-1, a thyroid-specific, homeodo- main-containing transcription factor important both for thyroid-specific TSHR gene expression and TSWcAMP autoregulation of the TSHR.

Insulin or insulin-like growth factor-1 (IGF-1)’ is required for thyrotropin (TSH) regulation of thyroid cell growth and function. One role of insulin/IGF-1 is to increase TSHR mRNA and receptor levels in FRTL-5 thyroid cells (1). This action is tran- scriptional, is enhanced by low levels of CAMP, and is required for autoregulation of TSHR gene expression by TSWcAMP. We recently sequenced 1.7 kilobases of 5”flanking region of the rat

* This work was supported in part by the Interthyr Research Foun- dation, Baltimore, MD. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

University School of Medicine, 3-1-1 Maidashi, Higashi-ku, Fukuoka ?g Present address: Third Dept. of Internal Medicine, Kyushu

812, Japan. The abbreviations used are: IGF-1, insulin-like growth factor-1;

TSH, thyrotropin; TSHR, TSH receptor; TTF-1, thyroid transcription factor-1; TTF-2, thyroid transcription factor-2; IRE, insulin-responsive element; CS, calf serum; bp, base pairh); TG, thyroglobulin; TIF, TSHR insulin-responsive factor.

TSHR and identified a minimal promoter region, -199 to -39 bp, which exhibited the tissue-specific expression and TSW cAMP autoregulation of the TSHR in FRTL-5 thyroid cells (2-5). One regulatory element defined therein, -189 to -175 bp, binds thyroid transcription factor-1 (TTF-1) (5 , 6). The TTF-1 element contributes to thyroid-specific TSHR gene expression (5 , 6) and is involved in thyroid-specific, cAMP autoregulation of the TSHR gene ( 5 ) . TSWcAMP-increased TTF-1 phosphoryl- ation results in up-regulation of the TSHR gene. TSWcAMP- induced decreases in TTF-1 RNA levels are associated with down-regulation.

The present study identifies a novel insulin-responsive element (IRE) immediately upstream of the TTF-1 site in the TSHR minimal promoter and links its activity to a functional TTF-1 site, thereby establishing a relationship between promoter elements important for insulin and TSWcAMP regulation of TSHR gene expression, consistent with previous results (1). The nuclear factor(s) interacting with the TSHR IRE are distinct from thyroid transcription factor-2 (TTF-2), which binds the IRE of the thyroglobulin (TG) promoter (7) and is also present in FRTL-5 cell nuclear extracts.

EXPERIMENTAL PROCEDURES Materials-Highly purified bovine TSH was from the NIH distribu-

tion program (NIDDK-bTSH-I-1,30 unitdmg); all other materials were the same as described (1-5). Promoter-Chloramphenicol Acetyltransferase (CAT) Chimeric Plas-

mids”pTRCAT5’-1707 and most of its 5“deletion chimeras are described (2-5). Additional 5”deletion chimeras, i.e. pTRCAT5‘-230, -220, and -190, were prepared by polymerase chain reaction (8) using forward primers with a BamHI site on the 5’-end and the ON-8L primer described previously as a reverse primer (2-5). Mutations were generated using forward primers with the mutated sequence. Amplified fragments were ligated to p8CAT and sequenced to confirm the predicted sequence (2-5, 9). To generate pCAT-promoter constructs, sense and antisense oligonucleotides containing the sequence from -220 to -188 bp, as well as an XbaI recognition site on their 5’-end, were synthesized, annealed, and inserted into the XbaI site of the pCAT-Promoter plasmid (Promega, Madison, WI) (3, 4). The inserts were sequenced (2-5, 9) to confirm copy number and direction. pSVGH, used to evaluate transfection efficiency, is described (3,4). All plasmid preparations were purified by CsCl centrifugation (2-5).

Cells-The growth and characteristics of FRTL-5 cells (ATCC CRL 8305) are described (1-5, 10). 6H medium is Coon’s modified Ham’s F-12,5% calf serum (CS), and a six-hormone mixture of bovine TSH (1 x 10”O M): insulin (10 pg/ml), cortisol (0.4 ng/ml), transferrin (5 pg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ ml) (1-5, 10).

nansient Expression Analysis-FRTL-5 cells were transfected by electroporation (2-5). They were grown to 80% confluence in 6H medium, shifted to 5H medium (no TSH) for 4 days, then returned to 6H medium 1 day before transfection. Either 25 pg of pTRCAT5’-1707 or equivalent molar amounts of the deletion mutants or p8CAT (negative control) were added with 3 pg of pSVGH; alternatively, 20 pg of the pCAT-Promoter-TSHR IRE construct or the pCAT-Promoter control were added plus pSVGH. Plasmid amounts were determined by evalu- ating transfection conditions as a function of plasmid concentration (2-5).

3 1908

TSHR Promoter Insulin-responsive Element 31909

FRTL-5 cells were pulsed (300 V, 960 microfarads), plated (about 6 x IO6 cellddish), cultured for 24 h in 6H medium, then washed with serum-free medium. Cultures were continued 48 h in 4H medium with no insulin, no TSH, and 0.2% calf serum; when added, insulin was present at 10 pg/ml, the same as in 5H medium.

Medium was taken for human growth hormone radioimmunoassay (Nichols Institute, San Juan Capistrano, CA), and cells for CAT assays (2-5, 11) which used 15 pg of cell lysate in 260 pl and a 4-h, 37 “C incubation. Acetylated chloramphenicol was measured by thin layer chromatography, autoradiography, and scintillation spectroscopy (2-5).

Nuclear Extracts-The 5H extracts were from FRTL-5 cells maintained in 5H medium plus 5% CS for 7 days. The insulin-treated or untreated extracts were from FRTL-5 cells maintained in 4H medium (-TSH, -insulin) with 0.2% CS for 7 days, then with or without 10 pg/ml insulin for 24 h. For extracts testing the effect of TSH, FRTL-5 cells were maintained either in 4H medium plus 0.2% CS with or without 10 pg/ml insulin for 7 days or in 5H medium plus 5% CS for 7 days; 1 x 10”O M TSH was then added to the culture medium for 24 h.

at -70 “C in 20 m~ HEPES-KOH, pH 7.9, 100 mM KCl, 0.1 mM EDTA, Nuclear extracts were prepared exactly as described (2-5) and stored

20% glycerol, 0.5 m~ dithiothreitol, 0.5 mM phenylmethylsulfonyl fluo- ride, 2 pg/ml leupeptin, and 2 pg/ml pepstatin A.

DNase I Protection Analysis-Genomic fragments between -270 and 96 bp or -270 and -135 bp were synthesized by polymerase chain reaction and subcloned into the p8CAT vector (3-5). Probe preparation, labeling, and purification on 8% native polyacrylamide gels, as well as DNase I footprinting, was exactly as described (2-5) with the exception that digestion used 0.5 unit of DNase I (Promega). Maxam and Gilbert sequencing reactions (12) located the footprinted regions.

Gel Mobility Shift Analyses-Gel mobility shift analyses were performed as described (2-5) except that incubations using radiolabeled oligo K, the IRE of the TG promoter (7), were in 10 mM Tris-HC1, pH 7.6, 200 m~ KCl, 5 m~ MgCl,, 1 m~ dithiothreitol, 1 mM EDTA, 12.5% glycerol, 0.1% Triton X-100, and 1 pg of poly(d1-dC).

Other Assays-Protein concentration was determined using a Bio- Rad kit; recrystallized bovine serum albumin was the standard.

RESULTS

Localization of an Insulin-responsive Element between -220 and -192 bp in the Rat TSHR Promoter-Insulin significantly stimulates the CAT activity of a 1707-bp rat TSHR promoter chimera, pTRCAT5‘-1707, when it is transfected into FRTL-5 thyroid cells (Fig. lb). 5”Deletion mutants between -1707 and -230 bp retain insulin responsiveness (data not shown); pTRCAT5’-230 and pTRCAT5‘-220 deletion mutants not only retain insulin responsiveness (Fig. lb) , but also have the high- est responses, approximately 3-fold higher than in cells without insulin (Fig. lb). The insulin response is significantly de- creased in pTRCAT5’-199 and is lost with pTRCAT-190, -177, -146, -131, and -90 (Fig. lb). These results suggest an IRE exists between -220 and -190 bp of the rat TSHR promoter (Fig. la).

To further localize the IRE and identify the full extent of any protein-DNA interaction, DNase I protection was performed. A nuclear extract from FRTL-5 cells cultured in 5H medium containing insulin and 5% CS protected the region between nucle- otides -217 to -192 bp on the coding (Fig. 2a) and -220 to -193 bp on the noncoding strand (data not shown). Nuclear extracts from FRTL-5 cells cultured in 4H medium with 0.2% CS protected the same regions on the coding (data not shown) and noncoding strand (Fig. 2b), but the addition of insulin resulted in extracts with enhanced protection, This is illustrated com- paring protections using 7.5 and 15 pg of extract protein (Fig. 2b). The protection of this region is clearly separate from that protected by TTF-1, -189 to -175 bp and -185 to -177 on the coding and noncoding strands, respectively (Fig. 2; Refs. 5 and 6).

These results (Figs. 1 and 2) suggest that the rat TSHR promoter contains an IRE, -220 to -192 bp, immediately upstream of the TTF-1 site (Fig. la) and that the ability of insulin to increase IRE-dependent gene transcription is similar to its

a Response Insulin

€lament CT rich m -, -. . . . . . .

-220 -192 -189 -175

-230 -220 -190 -177 -146 -131 -90 -2

b 0 insulin (-) ,c .. insulin (+)

FIG. 1. Effect of insulin on the CAT activity of chimeric plasmids containing 5’ deletions of the 5‘-flanking region of the rat TSHR. Regulatory elements of the minimal TSHR promoter (2-6) are diagrammatically presented in a. The putative IRE between -220 and -192 bp (dark bar) is immediately upstream of the TTF-1 binding site. The deletions and their chimeric CAT plasmids inpanel b are as follows: -1707 to -230 (pTRCAT5”230), to -220 (pTRCAT5”220), to -199 (pTRCAT5’-199), to -190 (pTRCAT5”190), to -177 (pTRCAT5”177), to -146 (pTRCAT5’-146), to -131(pTRCAT5”131), to -90 (pTRCAT5”90). FRTL-5 cells were cotransfected with the noted plasmids and pSVGH by electroporation and maintained in 4H medium plus 0.2% serum with (dark bars) or without (open bars) 10 pg/ml insulin for the last 48 h of culture. Conversion rates were normalized to growth hormone levels and CAT activities compared to the p8CAT promoterless control, whose minimal activity is arbitrarily set to 1. Activities are presented as the mean t S.E. for three separate experiments. A statistically significant increase induced by insulin is noted by one ( p < 0.05) or two ( p < 0.01) asterisks (*I.

ability to increase TSHR gene transcription in run-on experiments, about 2-%fold (1).

The TSHR IRE Confers Insulin Responsiveness Attached to an SV40 Promoter-A pCAT-promoter vector (Promega) can be used to evaluate the enhancer activity of elements within genes, including the TSHR (3, 4, 13). One or two copies of the TSHR between -220 and -188 bp were ligated in either direction to the 3‘-end of this SV40 promoter-driven CAT gene and activity measured after transient transfection into FRTL-5 cells (Fig. 3). The presence of the IRE in the sense but not the antisense direction caused a small increase in CAT activity in proportion to copy number (Fig. 3). More importantly, there was a significant increase in CAT activity in cells exposed to insulin, whether the insert was in the sense or antisense direction; also the insulin response was exaggerated in proportion to copy number in the sense constructs (Fig. 3). In sum, the TSHR sequence associated with insulin responsiveness conferred a positive insulin response on a SV40 heterologous promoter transfected into FRTL-5 thyroid cells.

A Discrete Set of Insulin-increased Protein-DNA Complexes Interact with the TSHR IRE-Gel mobility shift experiments were performed using as radiolabeled probe the double- stranded, synthetic oligonucleotide, -220 to -188 bp of the rat TSHR, containing the IRE sequence. Multiple specific protein- DNA complexes were formed with nuclear extracts from FRTL-5 cells (Fig. k), as evidenced by self-competition with the homologous unlabeled oligonucleotide (Fig. k, Competitor, + versus - lanes). None of these protein-DNA complexes were prevented by including a double-stranded synthetic oligonucleotide, -194 to -169 bp, containing the downstream TTF-1 protected region between -189 and -175 bp (data not shown). The protein-DNA complexes could be divided into two groups

31910 TSHR Promoter Insulin-responsive Element

FIG. 2. DNase I protection analyses of the promoter region of rat TSHR gene from -270 to -96 hp (a) a n d -270 a n d -135 bp ( h ) by nuclear ex t rac ts f rom FRTLS cells. Coding strand d a t a arc prvarnted in p a n c d n, non-coding strand d a h in pnnel h. Imnes 1 and 2 in each contain the A+G and T+C ladder determined by Maxam and Gilbert sequence

gested with DNase 1. In panrl Q, lane 4 reactions: lane 3 is unprotected prohe di-

conbins the prohe preincuhated with 30 pg of nuclear extract from FRTL5 cells. In pnnrl h the other lanes represent incubations with 7.5 or 15 pg of nuclear extract from FRTLB cells which had been maintained either with (+) or without ( - )

10 j&ml insulin (INSJ for 24 h. Nucleo- tide positions are referenced to the ATG codon (+1) (numbering is relative to the ATG start codon, which is defined as +1). The open and dark hnrs on the right of each panel diagrammatically denote the sequences protected hy the extracts; oprn hnrs denote the TTF-1 binding site, whereas dark hnrs denote the putative IRE.

a

r IO 20 r) 40

R a k e cAlmh4ty

FIG. 3. CAT activity of a chimeric plasmid containing one or two copies of the insulin-responsive element from t h e rat TSHR promoter l igated in e i ther direct ion to t h e 3”end of a SV40 promoter-driven CAT gene. (‘himeras wrre created by ligatinl: the r e ~ o n c o n h ~ n i n g TSI1R I R E : sequrnce, -220 to -188 hp, to the pCAT- Promoter plasmid from Promega. Constructs are diagrammatically rep- resented: nrrotc’s and ( + ) or ( - ) designations depict the direction and number of the IRE sequences, 5’ to 3 ’ 0 ) or the converse (4). After transfection (see Fig. 1). FRTLR cells wrre incubated in 4H medium plus 0.2?i serum with (dark ham) or without (open bars) 10 p g h l insulin for the last 48 h. CAT activities, measured as in Fig. 1, are the mean of three separate experiments 2 S.E. The nsterisk ( ” ) denotes a statistically significant insulin-induced increase ( p e 0.05).

based on the influence of insulin; group A, particularly protein- DNAcomplexes 2 and 3, was increased in extracts from FRTL5 cells exposed to insulin, while group B was not (Fig. 4a).

Low levels of CAMP enhance the ability of insulin to increase TSHR mRNA levels, a phenomenon associated with positive TSWcAMP autoregulation of the TSHR (1,5). Consistent with this, TSH (Fig. 4h) and 10 p~ forskolin (data not shown) enhanced formation of group A, but not group B protein-DNA complexes; moreover, the TSWforskolin effect is evident only in the presence of insulin and 5 4 CS. Thus, in the absence of insulin and in 0.2% CS, TSH treatment of F R T L 5 cells had no effect on the formation the A complexes by nuclear extracts from the cells (Fig. 4h). In contrast, in cells treated with insulin and in 5% CS (Fig. 4c, lanes 3 and 4 (+ insulin, + serum)), TSH increased the group A complexes (Fig. 4c, lane 4 (+ T S H ) versus lane 3 (- T S H ) ) .

It should be noted (Fig. 4c) that serum does not have an effect on the group A protein-DNA complexes beyond tha t of insulin (Fig. 4c, lane 3 (+ serum) versus lane 2 (- serum)). In data not

b

2

- 217

- 192 - 189

- 175

0) a 0) I

2 tl n n

I I I I I I

- 177

- 185

- 193

- 220

I

shown, the addition of 5% CS to F R T L 5 cells in the absence of exogenously added insulin resulted in nuclear extracts that duplicated the increase in A complexes induced by insulin treatment alone. This is consistent with previous observations (1) tha t 5% CS substitutes for exogenously added insulin in increasing TSHR RNA levels but has no additive effect.

Mutation Data Indicate the Insulin-increased Group A Com- plexes are Related to Insulin-increased Promoter Activity-To evaluate the functional relevance of the insulin-induced protein-DNAcomplexes formed by the putative IRE, we introduced 5- and 3-bp mutations into different portions of the sequence between -220 and -192 bp, mt-1 and mt-2, respectively (Fig. ,%I). The mt-1 mutations approximates the sequence in the human TSHR gene (14); mt-2 was made to complement mt-1 by placing mutations only in the 5’-third of the protected region (Fig. 5a) .

A radiolabeled oligonucleotide with the mt-1 sequence loses the ability to form insulin-sensitive A complexes with FRTL-5 cell nuclear extracts (Fig. 5h) and an unlabeled mt-1 oligonucleotide loses the ability to prevent their formation by the radiolabeled wild type TSHR IRE oligonucleotide (data not shown). In contrast, the radiolabeled mt-2 oligonucleotide did not lose the ability to form insulin-sensitive A complexes, but, rather, the ability to form B complexes (Fig. 5h).

Mutations in pTRCAT5’-220 that matched the mt-1 and mt-2 sequence between -220 and -190 bp, pTRCAT5‘-220 mt-1 and pTRCAT5‘-220 mt-2, respectively, were transfected into FRTLS cells. pTRCAT5’-220 mt-1 lost insulin responsiveness, whereas pTRCAT5’-220 mt-2 exhibited the same insulin responsiveness as pTRCAT5’-220. These results clearly link the group A insulin-increased protein-TSHR IRE complexes and insulin responsiveness.

The TSHR IRE Is Distinct from the TG IRE Which Rinds TTF-2-The synthesis of TG (15, 16), like the TSHR (l), is increased by insulin/IGF-llserum. An IRE on the TG promoter has been described (7) and i ts thyroid-specific nuclear protein in FRTL-5 cells termed TTF-2. The DNA sequence in the region between -220 and -192 bp of the TSHR is 4 2 6 homologous with the TG IRE (Fig. 6a ). An oligonucleotide with the sequence of the TG IRE, oligo K (71, did not, however, at a 250-fold excess,


a b C

FIG. 4. Ability of an oligonucleotide Extmct Ins.(-) Ins.(+) Extract Extract containine t h e IRE of the rat TSHR to n n TSH - + TSH - - - + form protein-DNA complexes with - nuclear extracts f rom FRTLR cells + - + Insulin - - insulin - + + + treated with insul in (a) or TSH ( h a n d c), as assayed in gel mobility shift analyses. A radiolahrled. douhlc- stranded oligonucleotide containing the I R K sequencr of the TSHR, -220 to -188 bp, was incubated with nuclear extrach from FRTL:', cells. In la) , the pmhe was incubated without (-) or with (+) 125 ng of unlabeled oligonucleotide as a competitor. Nuclear extract was from FRTL5 cells that had been maintained in 4 H medium for 7 days and incubated with (+ )o r without ( -J 10 pg/ml insulin ( I N S ) for the last 24 h. In h, nuclear extracts were prepared from FRTL:', cells cultured in 0.29 serum without (-) insulin for 7 days and then treated with (+) or without ( - ) 1 x 10"" M TSH for 24 h. In c, nuclear extracts were prepared from FRTLB cells cultured in 0.27 (Serum -) or 5'7 CS (Serum +) for 7 days and with (+)or without (-) 10 pdml insulin. Cells were then treated with (+) or without (-) 1 x 10"" 51 TSH for 24 h.

1- 2-

I

5 ' -220 5'.220ml-1 5'-220ml-2 p8CAT

.I: 1

e t ; b-' U

Serum - - + +

the rat TSHR IRE on protein-DNA FIG. 5. The effect of muta t ions in

complexes formed with FRTLR cell nuclear extracts ( h ) or on the CAT activity (c) . The sequencrs in rr drpict the mutations and thr wild type TSlIR IRE sequrnce. In h, each oligonucleotide was usrd as radiolabeled prohe and incuhatrd with 1 pg of nuclear extract from FRTIA cells maintained in 411 medium plus 0.2r; CS for 7 days and 10 pdml insulin for 24 h (see Fig. 4n). In c, cells were transfected with the TSHR CAT mutants indicatrd and, after rlrctroporation, placed in 411 medium plus 0.2ri serum with tdnrh hnrs) or without (open ham) 10 pg/ml insulin for the last 48 h of culture (see Fig. 1 ). Cells wrre cotransfected with pSVGI1. conversion rates normalized to GH levrls, and CAT activity presented relative to pRCAT control, whose activity is arhi- trarily set at unity. Activities are the mean = S.E. of three separate experiments; a statistically significant insulin e f k t is noted hy one ( p < 0.05) or two I p < 0.01) astar;shs (i ).

prevent formation of the A or B protein-DNA complexes involv- ing the rat TSHR IRE and insulin-treated, FRTL-5 cell nuclear extracts (Fig. 6h) . Furthermore, the unlabeled TSHR IRE oligonucleotide was unable to abolish the formation of any of the protein-DNA complexes formed with radiolabeled oligo K (Fig. e). These results indicate that the IRES on the TSHR and the TG promoter interact with different nuclear factors.

The Activity ofthe IRE Is Related to the Activity ofthe TTF-1 Site-In the TG promoter, functional TTF-1 sites are necessary

for expression of insulin responsiveness (7). To determine if the ?TF-1 site downstream of the IRE (Fig. l a ) was functionally related to the TSHR IRE, we introduced a nonsense mutation into the TTF-1 site of pTRCAT5'-220 (Fig. 7a) , which we had previously shown causes a loss of 'ITF-1 activity and binding (5). The mutant chimera, pTRCAT5'-220TTF-lNS, lost insulin responsiveness when transfected into FRTL5 thyroid cells, by comparison to the wild type construct (Fig. 7h) . In addition, as exemplified by DNase I protection studies of the coding strand

31912 TSHR Promoter Insulin-responsive Element

a TSHR IRE CTTQTTTQQATQQAQAQTTQCCTAQQCAAQCOQ I I I I I I I I I I

TG-oliga K TQACTAQTAQAQAAAACAAAQTQA

FIG. 6. The rat TSHR IRE and the TC IRE, ol igo K, do not interact with the name nuclear proteins in extracts from FRTL-5 thyroid cells. I’nnd n dr- picts thc, rat TSlIR rrgion, -220 to -188 hp, containing thr IRE. also thr TG IRE, -106 to -83 hp, which is termed oligo K, and their alignment to indicate regions of potential homology. In h, the rat TSHR IRE is radiolnhrlrd and incubated without an unlabeled oligonucleotide compet-

beled rat TSHR IRE, or with a 250-fold itor (-), with a 250-fold excess of unla-

excess of TG oligo K. In c, TG oligo K is radiolabeled and incubated in the ahsence

TG oligo K (n-fold excess over laheled (0, or presence of increasing unlabeled

probe) or rat TSHR IRE oligonucleotide. Gel mobility shift analyses were performed as descrihrd under “Experimental Procedures.”

PrabeVSHR IRE) - Probe(oligoK) K Y

I l l

CMpelilOr 2 g Competior o l i K TSHR IRE “ 0 5 20 50250 0 5 20 5 0 2 5 0

I 4

u b i

(Fig. 7c), the TTF-1NS mutation causes not only a loss in protection of the TTF-1 site between -175 and -182 bp (Fig. 7c, lower ham, lane 1 versus lane 2 ) but also alters protection of the TSHR IRE (Fig. 7c, upper bars, lane 1 versus lane 2 ) . This is particularly evident as a loss in protection of the region between -210 and -217 bp (Fig. 7c, upper ham, lane l versus lane 2 ) . A functional TTF-1 binding site in the TSHR is, therefore, required for insulin responsiveness of the IRE, as in the case of the TG promoter, despite the fact the lTF-1 and IRE oligonucleotides are not mutual competitors and the factors binding the TSHR and TG IREs are not identical (Fig. 6).

DISCUSSION Insulin, IGF-1, or serum increases TSHR gene expression

and receptor number in rat FRTL5 cells (1 ). In this report we identify a sequence, -220 to -192 bp of the TSHR 5”flanking region, which confers the positive stimulatory effect of insulin on the rat TSHR promoter. Thus, deletion analyses of the 5’- flanking region localize a functional IRE between -220 and -192 bp, the IRE is footprinted better by extracts from insulin- treated FRTLS cells, and the IRE confers insulin responsiveness to a heterologous SV40 promoter transfected into FRTLS thyroid cells.

This site has properties consistent with its being the functionally relevant IRE in the rat TSHR promoter. Thus, the increase in insulin-induced promoter activity is similar to the insulin-induced increases in mRNA levels or measured in run-on experiments (1). The IRE is adjacent to the minimal TSHR promoter, -199 to -39 bp, which exhibits the tissue- specific and cAMP-autoregulatory properties of the TSHR gene (2-6). Most important, the IRE has properties that relate i t to TSWcAMP autoregulation of the TSHR as predicted in the studies of insulin/IGF-1 regulation of TSHR mRNA levels (1). Thus, we show that TSWcAMP further increases formation of the protein-DNA complexes related to insulin-induced IRE function and that the TSWcAMP effect requires the presence of insulin. This is consistent with both the requirement of insulin for TSWcAMP autoregulation (1) and the additive or synergis- tic action of TSWcAMP on insulin-increased TSHR synthesis (1). In addition we show that mutation of the TTF-1 site results

in the loss of IRE function and in altered IRE footprinting. Since the TTF-1 site is important for TSWcAMP autoregulation of the TSHR (5), this links the insulin-TSH/cAMP regulation of the TSHR gene as predicted (1). We would, therefore, suggest the minimal TSHR promoter that has properties of tissue-specific expression, TSWcAMP autoregulation, and insulin responsiveness of the TSHR gene in FRTL5 thyroid cells is between -220 and -39 bp of 5‘-flanking region.

The TSHR IRE appears to be a novel IRE. Thus, we identify proteins whose ability to form complexes with the IRE is increased by insulin, the group A complexes. We establish that these are functionally relevant by showing that mutations of the TSHR IRE, which eliminate its ability to form the group A complexes, also abolish the ability of insulin to stimulate promoter activity. We also show, most importantly, that the nuclear proteins interacting with the TSHR and TG IRES in FRTL5 thyroid cells are not identical; thus, oligo K, the TG IRE, does not compete for the proteins interacting with TSHR IRE and the converse. Despite being a “thyroid-specific” gene whose synthesis is, like TG, increased by insulin/IGF-1, the TSHR has a functionally distinct IRE and binds transcription factofis) different from TTF-2. We term the TSHR insulin- responsive factors TIFs.

Insulin stimulates transcription of glyceraldehyde-3-phos- phate dehydrogenase, a-amylase, and insulin-like growth factor-binding protein-1; i t inhibits transcription of phosphoenolpyruvate carboxykinase and glucagon (17, 18). Comparison (19-23) of the cis elements defined as the IREs of these genes reveals they contain one or two AT-rich regions (Fig. 8, PEPCK and a-Amylase, underlined). The TG IRE contains an AT-rich region (Fig. 8, TG or TG-AS, underlined ). On the TG-antisense ( A S ) sequence i t is 70% homologous with the a-amylase AT-rich region; and i t s mutation (Fig. 8, TG-ASm) results in the loss of insulin responsiveness (7). The TSHR IRE includes the sequence CTTG’MTGG, -220 to -212 bp (Fig. 8, TSHR, single underline), with 60% homology to the phosphoenolpyruvate carboxykinase IRE. However, mutation data (Fig. 5) indicate that this AT-rich region (Figs. 5 and 8, TSHR mt-2) is not important for formation of the insulin-induced A complexes nor for insulin responsiveness of the TSHR promoter. Rather, the


a -220 -1 90 -170

S-CTTGTTTGGATGGAGAGTTGCCTAGGCAAGCGGAGCACTTGAGAGCCTCTCC-3 I I I

5'-220 IRE TTF-1

S-220lTF-lNS 5'- CTTGTTTGGATGGAGAGTTGCCTAGGCAAGCGAAACGCCAGTGCGACTCTCC -3 . . . . . . . .

T

L 5'-220 5-220TTF-lNS p8CAT

C lTF-1NS WT "

'I -217

IRE

- E - 192

- 189

FIG. 7. Effect of muta t ing the Tl'F-I site on the insulin-increased CAT activity of the ch imer ic pTRCAT&220 plasmid ( b ) and on DNase I protection of t h e lTF-1 and TSHR IRE (c) . Panel a depicts the sequences of the IRE and 'ITF-I sites in wild type lundcrlined 1 and mutated constructs. Astrrrsks denote mutntcd residues; details of the mutation anti its consequences on ITF-I activity have been descrihed (51 . In h, FRTL-5 cells were transfected with the noted plasmids and pSVGH. As in Fig. 1, cells were incuhnted in 4H medium plus 0.2'; C S with (dark bars) or without (open bars) 10 pdml insulin for the last 48 h of culture. CAT activities are compared to the p8CAT promoterless control. whose activity is arbitrarily set to 1, after conversion rates were normalized to growth hormone levels: activities are the mean 2 S.E. for three separate experiments. A statistically significant ( p < 0.01) insulin effect is noted hy a single asterisk ( - ) . c, DNase protection of the coding strand of wild type TSHR (as in Fig. 2 0 ) is compared to protection of the TTF-1h'S mutant. h n e s I and 2 contain the Maxnm and Gilbert sequence reactions. In the remaining lanes containing, respectively, the Tl'F-INS or the wild type construct, DNase I digestion of the unprotected prohe Inn extract) is compared with digestion of the probe preincuhated with 30 pg of nuclear extract from FRTLR cells. Sucleotide positions are referenced to the ATG codon ( + I ) (numhering is relative to the ATG sk3rt codon, which is defined as +I 1. The open and dad: bars on the right of each pianel denote the 'ITF-1 and IRE protected regions; dark bars denote wild type TTF-1 and IRE, whereas oprn bars are the same regions on the TTF-ISS mutant.

Gene 5"sequence-3

P E R K -.~.T";_"_'T".:..c;~:..:'

a-Amylase c:-,:..ycr.:yc:\

TG . ,.., . . I .. .\ >.l_,,",." ,.r""d:-'i ~,.. ,-. ,.-. r . r . . . ,~. . .

TG-AS ??J.r?7?77?77:.~:>c--?,

TG-ASm '?::,(y ::..- :,:."?:'Y1':,~'r???r': .... .

TSHR -." ~"".-,~ ,.,.,.. ~ . - ~ ,.,. .-.,.,. ". . j . . 6 . . .i",. .... I I t , , . . . . * . ,%, . :<>,

TSHR ml-2 c:-. - ::..c,~~~~~.:~~~~~:-;~'r~,~.,~c~~"', ... . ;x .

FIG. 8. Alignment of IRE regions from the phosphoenolpyruvate carboxykinase (PEPCK), n-amylase, TG, a n d T S H R For each IRE, thc. srquence that is homologous to the phosphoenolp?.ruvate carhoxykinase gene is undrrlincd with a single bar. The TG sequence is presented in the sense t W - S ) and antisense (TG-AS) direction. TC- ASnt and TSHR mt-2 depict mutant sequences: dots denote the mutated residues. In the TSHR gene, the region whose mutation aholishes the insulin effect is douhlr underlined.

responsible region is downstream and has no sequence homology with known IRES (Fig. 5, TSHR mt-1; Fig. 8, double underline). This suggests that proteins interacting with the IREs of these other genes do not interact with the TSHR IRE and are distinct from TIFs, as is 1TF-2 (Fig. 6). The TSHR IRE appears, therefore, to be a novel IRE whose identification may have broader significance.

The existence of distinct IREs in the TSHR and TG genes and the fact they bind different transcription factors probably re- flect differences in their role and regulation; thus, the TSHR regulates thyroid cell growth and functions, whereas TG is one functional protein under control of the TSHR. The TSHR, like the insulin, nerve growth, and epidermal growth factor receptors, has a promoter with properties of a housekeeping gene, i.e. having a GC-rich 5"flanking region with no TATA or CCAAT boxes (2); all might, therefore, be expected to be insulin-regu- lated. Nevertheless, to the best of our knowledge, this is the first report of an IRE that regulates gene expression in this group (17, 18). This is also the first report describing an IRE in pituitary glycoprotein hormone receptors, despite the fact they are structurally related a t a cDNA and promoter level and the function of each requires interactive relationships between insulin/IGF-1 and TSWcAMP autoregulation (24, 25).

Two last points deserve mention. First, TTF-2 and TIF(s) appear to have different roles in the regulation of major histo- compatibility class I gene expression in FRTL-5 thyroid cells (27); one interacts with a silencer important in determining constitutive levels of class I in tissues, the other with a silencer important for TSWmethimazole down-regulation of class I. Second, the loss of insulin responsiveness of the TSHR mt-1 mutation, which mimics the sequence of the human TSHR promoter in this region, suggests that the IREs of the human and rat TSHR promoter are not identical or function differ- ently. The basis for this is unknown a t this time but may relate

31914 TSHR Promoter ~ n s ~ ~ ~ ~ - r e s ~ o n s ~ u e Element

to differences in insulin responsiveness of the rat and human TG promoters (26).

REFERENCES 1. Saji, M., Akamizu, T., Sanchez, M., Obici, S., Awedimento, E., Gottesman, M.,

2. Ikuyama, S., Niller, H. H., Shimura, H., Akamizu, T., and Kohn, L. D. (1992)

3. Ikuyama, S., Shimura, H., Hoeffler, J. P., and Kohn, L. D. (1992) Mol.

4. Shimura, H., Ikuyama, S., Shimura, Y., and Kohn, L. D. (1993) J. Biol. Chem.

5. Shimura, H., Okajima, F., Ikuyama, S., Shimura, Y., Saji, M., and Kohn L. D.

6. Civitareale, D., Castelli, M. P., Falasca, P., and Saiardi, A. (19931 Mol.

7. Santisteban, P., Acebron, A., Polyca~ou- schwa^, M., and Di Lauro, R. (1992)

8. Saiki, R. K., Gelfand, D. H., Stoffei. S., Scharf, S. J., Higuchi, E., Horn, G. T.,

9. Sanger, E, Nicklen, S., and Godson, A. R. (1977)Proc. Natl. Acad. Sci. U. S. A.

and Kohn, L. D. (1991) Endocrinology 130,520-533

Mol. Endocrinol. 6, 793-804

Endocrinol. 6, 1701-1715

268,24125-24137

(1994) Mol. Endocrinol. 8, 1049-1069

Endocrinol. 7, 1589-1595

Mol. Endocrinol. 6,1310-1317

Mullis, K. E., and Erlich, H. A. (19881 Science 239,487-491

'74,5463-5467 10. Ambesi-Impiombato, F. S. (August 26, 1986) U. S. Patent 4,608,341 11. Gorman, C . M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Bwl. 2,

12. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65,499-560 13. Kanei-Ishii, C., and Ishii, S. (1989) Nucleic Acids Res. 17, 1521-1536

10441051

14. Gross, B., Misrahi, M., Sar, S., and Milgrom, E. i1991) Bzochem. Biophys. Res. ~ o r n ~ ~ ~ . 177,679-687

15. Santisteban, E, Kohn, L. D., and Di Lauro, R. (1987) J. Bid. Chem. 262, 404544052

16. Kohn, L. D., Saji, M., Akamizu, T., Ikuyama, S., Isozaki, O., Kohn, A. D.,

Aloj, S. M. (1989)Adu. Exp. Med. Biol. 261, 151-210 Santisteban, P., Chan, J. Y. C., Bellur, S., Rotella, C. M., Alvarez, E V., and

17. Meisler, M. H., and Howerd, G. (1989)Annu. Reu. Physiol. 51,701-714 18. OBrien, R. M., and Granner, D. K. (1991) Biochem. J . 278,609419 19. Nasrin, N., Ercolani, L., Denaro, M., Kong, X. F., Kang, I., and Alexander, M.

20. Johnson, T. M., Rosenberg, M., and Meisler, M. H. (1993) J. Biol. Chem. 268,

21. O'Brien, R. M., Lucas, P. C., Forest, C . D., Magunuson, M. A,, and Granner,

22. Philippe, J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7224-7227 23. Suwanickul, A, Morris, S. L., and Powell, D. R. 11993) J. Biol. Chem. 268,

24. Takahasi, S., Conti, M., and Van Wyk, J. 6. ( 1 9 9 0 ) ~ n d ~ r i n ~ ~ y 126,736-745 26. Kohn, L. D., Ban, T., Okajima, F., Shimura, H., Shimura, X, Hidaka, A.,

Giuliani, C., Napolitano, G., Kosugi, S., Ikuyama, S., Akamizu, T., Tahara,

Ciinieal Cordations (Weintraub, B., ed) pp. 133-153, Raven Press, New K., and Saji, M. (1995) in Molecular Endocrinology: Basic Concepts a d

York

(1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5273-5277

464-468

D. K. (1990) Science 249,533-537

17063-17068

27. Napolitano, G., Saji, M., Palmer, L., Giuliani, C., Singer, D. S., and Kohn, L. D. 26. Eggo, M. C., and Burrow, G. N. (1989) Adu. Exp. Med. Biol. 261,327-340

(1994) Program of the 76th Annual Meeting of the American Endocrine Society, Abstr. 1264, p. 516

identification of a novel insulin-responsive element in the rat

Documents