American Journal ofPathology, Vol. 150, No. 4, April 1997Copyright © American Societyfor Investigative Pathology

Identification of an Enterocytozoon bieneusi-LikeMicrosporidian Parasite in Simian-Immunodeficiency-Virus-Inoculated Macaqueswith Hepatobiliary Disease

Keith G. Mansfield,* Angela Carville,tDaniel Shvetz,* John MacKey,* Saul Tzipori,tand Andrew A. Lackner*From the New England Regional Primate Research Center,*Harvard Medical School, Southborough, and The DivisionofInfectious Diseases,t Tufts University School of VeterinaryMedicine, North Grafton, Massachusetts

Enterocytozoon bieneusi is a common opportu-nisticpathogen ofhumanpatients with acquiredimmune deficiency syndrome (AIDS) causing sig-nificant morbidity and mortality. In a retrospec-tive analysis utilizing conventional histochemicaltechniques, in situ hybridization, polymerasechain reaction, and ultrastructural examina-tion, we identified 18 simian-immunodeficiency-virus-infected macaques (16 Macaca mulatta, IM. nemestrina, and I M. cyclopis) with Enterocy-tozoon infection ofthe hepatobiliary system andsmaU intestine. The organisms were readily iden-

tijfed in the bile ducts andgaU bladder by specialstains and by in situ hybridization using a probedirected against the smaUl subunit ribosomalRNA ofhuman origin E. bieneusi Infection ofthebiliary system was associated with a nonsuppu-rative and proliferative cholecystitis and chole-dochitis. Hepatic involvement was characterizedby bridging portalfibrosis and nodular hepato-celular regeneration accompanied by markedbile ductular and septal duct hyperplasia. Ultra-structurally, aU developmental stages of the or-ganism werefound in direct contact with the hostceU cytoplasn,a spores and sporoblasts containeda double layer ofpolar tubes. Sequencing of a607-bp segment of the smaU subunit ribosomalRNA revealed 97 and 100% identity to two clonesofsmaU subunit ribosomal RNA derivedfrom E.bieneusi of human origin. Extensive morpholog-ical and genetic similarities between the simian

and human enterocytozoons suggest that exper-imentaly infected macaques may serve as a use-ful model of microsporidial infection in AIDS.(Am J Pathol 1997, 150:1395-1405)

Microsporidia are obligate intracellular protozoanparasites that lack mitochondria, eukaryotic ribo-somal characteristics, and Golgi membranes. 1-3These organisms form spores that may be highlyresistant to environmental influences and possess aunique extrusion apparatus composed of an anchor-ing disc, polar tubule, and polaroplast that allowsthem to penetrate and infect eukaryotic cells. Micros-poridia are found ubiquitously in nature and infect avariety of vertebrate and invertebrate hosts.

Microsporidial infections of normal and immuno-compromised human patients have been recog-nized with increasing frequency and have beencaused by members of the genera Encephalitozo-on,46 Enterocytozoon,7 Vittaforma, Nosema,9 andTrachipleistophora.10'11 First recognized in biopsyspecimens from human acquired immune defi-ciency syndrome (AIDS) patients in 1985, the mostcommonly diagnosed microsporidia in man is En-terocytozoon bieneusi. 1.7 Although this organismhas been identified in 30 to 50% of human immu-nodeficiency virus (HIV)-infected patients withchronic unexplained diarrhea,12-15 its role in pro-ducing a chronic enteropathy has been ques-tioned.16 More recently, E. bieneusi has been foundin association with hepatobiliary and pulmonarypathology in human AIDS patients17 18 and withdiarrhea in an HIV-negative immunocompetent in-

Supported by the Public Health Service grants RRO7000, RR00168,and DK50550.

Accepted for publication December 11, 1996.

Address reprint requests to Keith G. Mansfield, New EnglandRegional Primate Research Center, One Pine Hill Drive, PO Box9102, Southborough, MA 01772.

1395

1396 Mansfield et alAJP April 1997, Vol. 150, No. 4

dividual.19 Hepatobiliary infection of AIDS patientsmay result from contiguous spread from the gas-trointestinal tract and is linked with papillary ste-nosis, acalculous cholecystitis, bile duct dilatation,and sclerosing cholangitis.1720-22

E. bieneusi differs from other microsporidia in sev-eral important respects including 1) unique morphol-ogy of the polar tubules,23 2) precocious develop-ment of the tube complex, posterior vacuole, andpolaroplast membrane within the multinucleate plas-modium,24 3) presence of cleft-like spaces that con-tain lamellar polar tube precursors,25 and 4) infectionrestricted predominantly to epithelial cells.26 Despiteits relatively common occurrence in human AIDSpatients, fundamental aspects of parasite biology,epidemiology, and host immunity remain poorly un-derstood. These deficiencies arise in part becauseof the difficulty establishing long-term in vitro culturesystems and the absence of appropriate animalmodels.27 29

Simian immunodeficiency viruses (SlVs) are non-human primate lentiviruses that induce an acquiredimmunodeficiency with extensive similarities to hu-man AIDS. The macaque SIV (SlVmac) model hasbeen investigated extensively and has emerged asthe premier animal model of AIDS.30 32 As in man,AIDS in macaques is characterized by progressiveloss of CD4 T lymphocytes and the occurrence ofspontaneous opportunistic infections including My-cobacterium avium, Pneumocystis carin#i, cytomega-lovirus, SV40 (polyomavirus), candidiasis, and Tox-oplasma gondii.3337 Liver pathology is recognizedearly in the course of experimental SlVmac infectionand reveals alterations similar to those described inthe livers of human AIDS patients.3839 As in man,hepatic pathology is a common finding in simianAIDS, and elucidation of a specific etiology is oftenimpossible.3940

Here we report the spontaneous occurrence ofan E. bieneusi-like organism in three species ofmacaques with AIDS as a common cause of pre-viously undiagnosed chronic hepatobiliary dis-ease. This organism is virtually indistinguishablefrom E. bieneusi of human origin at the light andultrastructural level. Furthermore, sequencing ofthe small subunit ribosomal RNA (SSU-rRNA) re-vealed 97 and 100% identity to two clones of theSSU-rRNA derived from E. bieneusi of human ori-gin. Extensive similarities between the simian andhuman Enterocytozoon suggest that experimentallyinfected macaques serve as a useful model ofmicrosporidial infection in AIDS.

Materials and Methods

Animals and Tissue SamplesMacaques (Macaca mulatta, M. cyclopis, and M.nemestrina) were housed at the New England Re-gional Primate Research Center in a centralized bi-olevel 3 containment facility in accordance with stan-dards of the American Association for Accreditationof Laboratory Animal Care and Harvard MedicalSchool's Animal Care and Use Committee. Housingconsists of two levels of hanging high-energy-partic-ulate air-filtered steel cages in which animals areindividually kept. Contact between animals is pre-vented by the physical layout of these cages. Ani-mals are fed a standard commercial monkey chowdiet (PMI Feeds, St. Louis, MO) supplemented by avariety of fresh fruit. Water is available ad libitumthrough sterilized glass bottles that are filled manu-ally from the Center's private nonchlorinated watersupply.

Animals were inoculated intravenously with one ofthree pathogenic strains of SIV (SlVmac251, SIV-mac239, or SIV J5), the history, preparation and invivolin vitro properties of which have been describedand reviewed extensively.41 44 Animals were in-cluded in a variety of infectivity, pathogenesis, andvaccine studies and received no antiretroviral agentsor antimicrobial prophylaxis. Animals were moni-tored closely and euthanized when moribund ordeemed necessary by the veterinary staff. Completepostmortem examinations were performed on all an-imals, and representative samples of tissue weretaken for formalin fixation, freezing, and electron mi-croscopy. In addition to hematoxylin and eosin(H&E), selected sections were stained with Weber'smodified trichrome,45 Ziehl-Neelsen, Brown-Hopps,methenamine-silver, and Masson's trichrome stains.

Index Case and Retrospective AnalysisMicrosporidial infection was initially recognized in anSlVmac239-inoculated rhesus macaque (M. mulatta502-91) that died with proliferative cholecystitis. Af-ter identification of this index case, a retrospectiveanalysis was conducted of all macaques dying withAIDS after inoculation with SlVmac (n = 177) duringthe period September 1991 to May 1996. All animalswith cholangiohepatitis, cholecystitis, or choledochi-tis (n = 51) were identified through review of nec-ropsy records and H&E-stained slides. These caseswere subjected to further analysis by in situ hybrid-ization, immunohistochemistry, polymerase chain re-action (PCR), and/or electron microscopy. Six nor-

Enterocytozoon Infection in Simian AIDS 1397AJP April 1997, Vol. 150, No. 4

mal macaques and eight SIV-infected macaqueswithout gastrointestinal lesions were similarly inves-tigated.

ImmunohistochemisttyImmunohistochemistry was performed on formalin-fixed, paraffin-embedded tissues using an avidin-biotin complex technique as previously described.46Cryptosporidia were detected using a monoclonalantibody clone BEL 0126 (Biogenesis, Sandown,NH), and biliary epithelium was visualized usinga rabbit polyclonal anticytokeratin (Dako, Carpin-teria, CA).

Electron MicroscopyFormalin-fixed specimens of common bile duct andgall bladder were processed and embedded inEpon 812 resin. Ultrathin sections were stained withuranyl acetate and lead acetate and examined on aJEOL 100S transmission electron microscope.

PCR and SequencingDNA was isolated from frozen stored sections of liverobtained from six animals with confirmed hepaticEnterocytozoon infection and from one normal nonin-fected control by proteinase K digestion and phenolextraction (Sigma Chemical Co., St Louis, MO). Thepreviously described forward primer EBIEF1 (5'GAAACTTGTCCACTCCTTACG 3') and reverseprimer EBIER1 (5' CCATGCACCACTCCTGCCATT3') were used to amplify a 607-bp fragment from theputative E. bieneusi-like organism SSU-rRNA gene.47Amplification of DNA was performed in a 50-,iu reac-tion volume containing 1.5 mmol/L MgCI2, 50 mmol/LKCI, 10 mmol/L Tris/HCI (pH 9.0), 0.2 mmol/L dNTPs,400 pmol/L of each primer, and 2.5 U of AmplitaqDNA polymerase in a 9600 thermal cycler (Perkin-Elmer Cetus, Foster City, CA). The amplification pro-file consisted of 1 minute at 57°C, 2 minutes at 72°C,and 30 seconds at 940C for 35 cycles followed by a10-minute extension at 72°C. Precautions againstcontamination were followed as previously de-scribed.48 The 607-bp amplification product fromthree animals was cloned (Invitrogen, San Diego,CA) and sequenced with forward and reverse prirrm-ers using an ABI prism automated sequencer.

In Situ HybridizationIn situ hybridization was performed on formalin-fixed,paraffin-embedded tissues obtained at necropsy us-

ing a modification of a technique previously de-scribed.49 A 446-bp PCR product of the SSU-rRNAgene was derived from human origin E. bieneusi us-ing amplification primers Vl (5' CAGGTTGATTCT-GCCTGAC 3')5O and Mic 3 (5' CAGCATCCAC-CATAGACAC 3'). The method entailed labeling 3.0jig of the E. bieneusi PCR product with digoxigenin-1 1-dUTP in a random-primed labeling reaction con-taining 2 U of Klenow enzyme (Boehringer Mann-heim, Indianapolis, IN) in a total reaction volumeof 100 ,ld. The labeled probe was quantitated(Boehringer Mannheim) and then hybridized over-night to 5-,tm-thick tissue sections that had beenplaced on Superfrost Plus slides (Fisher Scientific,Pittsburgh, PA) under denaturing conditions at aconcentration of 0.025 ng/,tl and a temperature of370C. Slides were then washed in 1X standard salinecitrate followed by immunostaining with an avidin-biotin-horseradish-peroxidase complex technique(Vector Laboratories, Burlingame, CA) using diami-nobenzidine as the chromogen (Sigma). As negativecontrols, sections were hybridized to an irrelevantprobe consisting of the pUC19 plasmid labeled withdigoxigenin. Additional controls included normal andSIV-infected animals without lesions of the gastroin-testinal tract and human small intestinal biopsies withconfirmed E. bieneusi infection (kindly provided by D.Kotler).

Results

Microsporidiosis Is a CommonUnrecognized Infection in Simian AIDSRetrospective analysis of SlVmac-inoculated ma-caques with AIDS during a 4.5-year period revealedthat 28.8% (51/177) had evidence of cholangitis,cholangiohepatitis, choledochitis, and/or cholecysti-tis at death. Further analysis of these cases by in situhybridization, special stains, and/or PCR revealedthat 35.2% (18/51) had Enterocytozoon organismswithin biliary and intestinal epithelium. Cryptospo-ridium parvum was recognized in the bile ducts, gallbladder, and/or septal ducts of 37.3% (19/51) ofanimals by immunohistochemistry. In 9.8% (5/51),lesions were attributed to retrograde bacterial cho-ledochitis/cholangitis. Dual microsporidial and bac-terial or cryptosporidial infection was recognized in9.8% (5/51) of the cases. Cytomegalovirus was iden-tified in biliary epithelium of 1 animal with cholangio-hepatitis. No agent was recognized in 25.5% (13/51)of the cases. Signalment, viral inoculum, survival,and concurrent opportunistic pathogens in ma-

1398 Mansfield et alAJP April 1997, Vol. 150, No. 4

Table 1. Summary of Signalment,Microsporidial Infection

Viral Inoculum, Survival, and Concurrent Diseases of Macaques with Hepatic

Age atdeath Viral Survival

Animal Sex (months) inoculum (months) Concurrent disease

1 Mc 12-82 M 119 SlVmac239 32 Adenovirus, suppurative pneumonia2 Mm 139-86 M 44 SlVmac251 12 PCP, Balantidium coli, SIV

arteriopathy3 Mm 169-86 F 69 SlVmac251 24 PCP4 Mm 206-86 M 70 SlVmac239 34 SIV arteriopathy, LPD,

Cryptosporidium parvum5 Mm 163-88 M 50 SlVmac251 39 SIV arteriopathy, MAC6 Mm 358-88 M 48 SlVmac239 38 Cryptosporidium parvum, LPD7 Mm 206-89 M 46 SlVmac239 15 Giardia lamblia, glomerulonephritis,

SIV arteriopathy, Cryptosporidiumparvum

8 Mn 351-89 M N/A SlVmac251 12 Entamoeba spp., SIV arteriopathy,adenovirus, amyloidosis

9 Mm 175-90 M 22 SlVmac239 17 PCP, SIV arteriopathy10 Mm 246-90 M N/A SlVmac239 19 PCP, LPD11 Mm 247-90 F N/A SlVmac251 18 MAC12 Mm 345-90 M 45 SIV-J5 17 LPD, PCP13 Mm 132-91 M 32 SlVmac239 22 SIV arteriopathy, Entamoeba spp.,

adenovirus14 Mm 446-91 M 52 SlVmac239 29 None15 Mm 502-91 M 55 SlVmac239 36 MAC, PCP, adenovirus, CMV, SIV

arteriopathy16 Mm 506-91 M 45 SlVmac239 20 MAC, CMV, PCP, LPD, Entamoeba

spp., SIV encephalitis, LPD17 Mm 371-92 M 41 SlVmac251 18 PCP, enterocolitis18 Mm 227-94 F 31 SlVmac239 12 MAC, Balantidium coli

M, male; F, female; Mm, Macaca mulatta; Mn, M. nemestrina; Mc, M.carinii pneumonia; LPD, lymphoproliferative disease; N/A, not available.

caques with microsporidiosis are indicated in Table1. Infection was not recognized in the small intestineor hepatobiliary system of 6 normal macaques or 8SIV-inoculated macaques without gastrointestinal le-sions.

Hepatobiliary Pathology Coincides withLocalization of OrganismIn situ hybridization was a sensitive and specific in-dicator of microsporidial infection revealing organ-isms in 18 animals (16 M. mulatta, 1 M. cyclopis, and1 M. nemestrina). Organisms were found intracellu-larly in a perinuclear location occasionally causingan indentation of the adjacent nuclear membrane.Plasmodia varied in size from 4 to 12 ,tm and con-tained small nonstaining clefts (Figure 1). Sporesand sporoblasts also stained with Weber's modifiedtrichrome, Ziehl-Neelsen, Brown-Hopps, and methe-namine-silver stains measuring 0.8 to 1.5 ,um in di-ameter with an eccentric belt-like body. In situ hy-bridization stained a variety of parasite stages andrevealed far more organisms than these conven-tional histochemical techniques.

Organisms were most commonly identified in thegall bladder (1 1/15), extrahepatic bile duct (10/15),

cyclopis; MAC, Mycobacterium avium complex; PCP, Pneumocystis

and hepatic septal duct (9/18) epithelium and lessfrequently in duodenal (5/16), jejunal (5/16), bileductular (4/18), and pancreatic duct (2/15) epithe-lium. Within the gall bladder and bile duct, organ-isms were found with greatest frequency in the lumi-nal epithelial cells and less frequently in cells of theepithelial diverticulae or crypts. Organisms werepresent in the pancreatic lymph node of 1 animal (M.mulatta 446-91; Figure 1F). Other than this singlecase, infection was limited to epithelial cells; dissem-ination to the mesenteric lymph nodes, lung, kidney,brain, or spleen was not recognized by in situ hybrid-ization in any animal (n = 13).

Localization of the microsporidian by in situ hybrid-ization was consistently associated with morpholog-ical alteration of the hepatobiliary tract. Histologi-cally, lesions in the gall bladder and bile ducts werecharacterized by proliferation of biliary epitheliumwith mild to moderate fibrosis and a nonsuppurativeinflammatory response composed of lymphocytesand plasma cells that occasionally formed well de-fined lymphoid nodules (Figure 2). In addition, extru-sion of individual biliary epithelial cells containingorganisms was often noted (Figure 1A, inset). Epi-thelial changes were predominantly atrophic in twocases. Multifocally, small aggregates of neutrophils

Enterocytozoon Infection in Simian AIDS 13994/P April 1997, Vol. 150, No. 4

Figure 1. Enterocytozoon parasite in SIVmac-infected macaques uith hepatobiliary disease. A: Spores atnd sporoblasts in biliary epithelium of'the gallbladder. Ziehl-Neelsen acid-fast stain; mnagnification, X 472. Inset: Extrusionz of individual epithelial cell-conitaining spores. Serial section of A;Weber's modified tricbrome. B: In situ hybridization using digoxigenin-labeled probe against E. bieneusi SSU-rRNA in comnmon bile duct demon-stratintg multiple organi.sms in luminal epithelium. DAB cbromogen; magnification, X 71. C: In situ bybridization for microsporidia in gall bladderepitheliun. DAB chronmogen; magnification, X205 D: Enterocytozoon in hepatic septal duct epithelium of macaqzue with nonisupplurative cholan-giohepatitis, bridging portal-portalfibrosis anid niodular hepatocelltnlar regenieration. In situ hybridization; DAB cbroniogen; magoiification, x205.Inset: Organism in bile ductular epitbelium, adjacent field. E: Perinuclear plasmodia. Note cleft-like spaces and intracytoplasniic spores. In situhybridization; DAB chromogen; magnification, x 623. F: Enterocytozoon parasite inz panicreatic lymph niode. In situL hybridization; DAB cbronmogetn;magnification, x 294.

were often present in biliary glands or crypts, butneutrophils were never the predominant inflamma-tory cell. The presence of a chronic nonsuppurativeand proliferative choledochitis accompanied by ex-trusion of individual biliary epithelial cells was highlysuggestive of microsporidial infection.

Parenchymal lesions in the liver were characterizedby bridging portal fibrosis accompanied by markedbile ductular and septal duct hyperplasia (Figure 3).Segmental erosion of the limiting plate and piecemealnecrosis were evident in cases with hepatic involve-ment. A lymphoplasmacytic infiltrate was invariably

present within expanding portal tracts and occasion-ally formed well defined lymphoid nodules. Hepatocel-lular nodular regeneration accompanied the bridgingfibrosis. Focal neutrophilic infiltrates, intrahepatic cho-lestasis, and periductal concentric fibrosis were evi-dent rarely and, when present, were highly suggestiveof concurrent infection by C. parvum. The triad of bridg-ing portal fibrosis, nodular lymphocytic infiltrates, andmarked bile duct and ductular hyperplasia was foundexclusively in association with microsporidial infection,permitting a presumptive diagnosis that was confirmedby in situ hybridization in all cases.

.J

1400 Mansfield et alAJP Apil 1997, Vol. 150, No. 4

..I

F ."

., .i

e

Figure 3. A: Severe bnidging portal-portalfibrosis with nodular hepa-Figure 2. Chronic hepatobiliary disease in a SIVmac-infected rhesus tocellular hyperplasia in a rhesus macaque liver infected with E.macaque with in situ hybridization and PCR-confirmed microsporid- bieneusi -like microsporidia. Masson 's trichrome; magnification, X 67.ian parasites. A: Chronic nonsuppurative and proliferative chole- B: Marked yperplasia of hepatic biliardochitis. HE&E magnification, x27 B: Enlargement ofA. Notefibrosis portal tracts demonstrated by immunohistochemistry for cytokeratinand lymphoplasmacytic infiltrates. H&E magnification, x88. (sra seto oflvri-iue2)Imnhsohmsr Ao(senal section of liver in FTgure 2A). Immunobistcbemistry; DAB

cbromogen; magnification, x 67.

Ultrastructural Morphology Is Indicative ofthe Enterocytozoon GenusOn ultrastructural examination, organisms measur-ing approximately 0.8 x 1.5 ,um were found in biliaryepithelial cells of the common bile duct and gallbladder (Figure 4). Various stages were found indirect contact with the host cell cytoplasm and oftenin close association with mitochondria. Spores andsporoblasts had a thin dense outer layer (exospore)and a thicker electron-lucent region (endospore) fol-lowed by a thin limiting inner plasma membrane.Within these stages, a double layer of polar tubesoften coiled around an electron-translucent inclusionforming five to seven turns in cross section. A singlenucleus was found in the sporoplasm.

SSU-rRNA Sequence Reveals Identity to E.bieneusi of Human OriginTo further characterize the organism, PCR was per-formed on DNA extracted from frozen liver samplesobtained from six rhesus macaques with hepaticmicrosporidiosis and resulted in amplification of a607-bp product in all cases (Figure 5). BLAST se-

quence similarity searching was performed on aconsensus sequence derived from cloned PCRproducts obtained from three animals and revealed100 and 97% identity to published sequences ofhuman origin E. bieneusi (Genbank accession num-bers L16868 and L07123, respectively).50-52

DiscussionHere we report the first spontaneous microsporidialinfection of immunosuppressed macaques, reveal-ing striking similarities to the disease produced by Ebieneusi in man. The identified organism is virtuallyindistinguishable from E. bieneusi of human origin atthe morphological and genetic level and results in adisease process of similar distribution and characterto that seen in human AIDS patients.

Retrospective analysis utilizing conventional histo-chemical techniques, in situ hybridization, PCR, andultrastructural examination revealed that microspo-ridial infection was a common unrecognized patho-gen in rhesus macaques inoculated with SlVmacand housed in a biolevel 3 containment facility. As inman, organisms were found most commonly in epi-

.,.

'Y.: ",.1.'W' .,

Enterocytozoon Infection in Simian AIDS 1401AJP April 1997, Vol. 150, No. 4

Figure 4. A: Electron photomicrograph of sporoblasts in biliary epitbelium ofgall bladder. Magnification, X 13,600. B: Coiled polar tube doubletssurrounding electron translucent inclusion. Magnification, X36,000. C: Multiple sporoblasts in bile duct epitbelium. Magnification, X28,000.

thelial cells of the gastrointestinal tract and wereassociated with proliferation of biliary epithelium anda nonsuppurative inflammatory response. Distribu-tion in the biliary tree and liver suggests contiguousspread from the common bile duct. Although lesscommon in our cohort, villous atrophy and bluntingwere noted in association with infection of entero-cytes. The reason enteric infection was less fre-quently recognized in our macaques is unknown butmay relate to selection of this cohort or to distinctdifferences in parasite or host biology.

Spontaneous microsporidial infection of nonhu-man primates has been recognized rarely. Enceph-alitozoon cuniculi has previously been identified as acause of granulomatous meningoencephalitis, hep-

atitis, and nephritis in squirrel monkeys (Saimiri sciu-reus).53 56 Intestinal infection caused by an uniden-tified microsporidian has also been reported in adusky titi monkey (Callicebus moloch).57 Experimen-tal inoculation of immunodeficient SIV-infected rhe-sus macaques with human origin E. cuniculi and Ehellem produced transient infection of the majority ofanimals with lesions noted in the kidney and liv-er.58'59 SIV-infected immunocompetent macaquesdeveloped a specific antibody response and shedspores intermittently, whereas immunodeficient ani-mals developed progressive disease and shedspores in the urine and feces.

Multiple lines of evidence indicate that the identi-fied organism in our macaques is identical or closely

I

I

1402 Mansfield et alAJP ApIl 1997, Vol. 150, No. 4

MW 1 2 3 4 5 6 7 8

100

700-K500-300-100

Figure 5. PCR amplification products using E. bieneusi-specificprm-ers from six rhesus macaques with in situ hybridization confirmedmicrosporidiosis after agarose gel electrophoresis and ethidium bro-mide staining. MW molecular uweight marker XI (Boebringer Mann-heim, Mannheim, Germany); lane 1, Mm 169-86; lane 2, Mm 157-90; lane 3, Mm 206-89; lane 4, 446-91; lane 5, 358-88; lane 6,371-92, lane 7, Mm 313-93; lane 8, DH2O.

related to the newly recognized pathogen of man, E.bieneusi. Ultrastructurally, the organism was charac-terized by a double row of polar tubes in spores andsporoblasts that formed five to seven coils in section,a distinctive feature of the genus Enterocytozoon.Additional morphological findings characteristic ofthe genus were the presence of all developmentalstages in the host cytoplasm and the observation ofcleft-like spaces in the plasmodium. Amplificationand sequencing of a 607-bp segment of the SSU-rRNA revealed 100 and 97% identity to reportedsequences of El bieneusi obtained from human AIDSpatients (Genbank accession numbers L16868 andL07123). Finally, as in human beings infected with Elbieneusi, microsporidial infection of macaques was

restricted primarily to epithelial cells of the gastroin-testinal tract.

Despite these similarities, subtle differences be-tween the organisms do exist, suggesting that themacaque-associated pathogen represents a distinctsubspecies or new species within the Enterocyto-zoon genus. Whereas El bieneusi most commonlyinfects the enterocytes of the villous tip epithelium ofman, infection of the biliary tree was the most com-

monly recognized site in our cohort. Furthermore,inoculation of SIV-infected immunocompromisedmacaques with human origin El bieneusi resulted inproductive but limited infection of the small intestineonly.60 Although extensive identity was present over

the 607-bp SSU-rRNA segment sequences, thishighly conserved region may not adequately distin-guish closely related organisms. Whether these ma-

caques have been infected with a host-adapted E.bieneusi of human origin or a distinct organism withinthe Enterocytozoon genus cannot be determined atthis time. Pending further analysis of DNA sequence

data and further characterization of the parasite bi-

ology, we will refer to the pathogen as E. bieneusi-likeorganism.

In situ hybridization proved to be a sensitive andspecific indicator of microsporidial infection and re-vealed far more organisms than could be appreci-ated by conventional histochemical techniques. Theincreased sensitivity of in situ hybridization over con-ventional histochemical techniques is not unex-pected. We suspect that, whereas conventionaltechniques rely on specific anatomic structures,such as the thick exospore wall, to demonstrate or-ganisms, in situ hybridization detects RNA thatshould be present in all parasite life stages. Despitewidespread use of in situ hybridization to investigatepathogenesis of viral diseases, its use to investigatemicrosporidial infections has not previously been re-ported. The development of oligonucleotide probesspecific for microsporidial organisms would allowdifferentiation to the species level in routinely pro-cessed formalin-fixed, paraffin-embedded tissuesamples.The source and timing of infection in our ma-

caques could not be determined by retrospectiveanalysis. Preliminary evidence indicates that micros-poridial infection is present in the normal rhesuscolony and that individuals may harbor the organismfor extended periods. Animals are housed individu-ally in the biolevel 3 facility, suggesting that diseaseresults after reactivation of infection. Recent evi-dence in man indicates that clinical microsporidiosisfrom E. hellem may result after persistent infection inAIDS patients.61 Notwithstanding these observa-tions, the possibility of transmission by fomites toimmunosuppressed animals while in the biolevel 3facility cannot be excluded.

Development of a rhesus macaque model of E.bieneusi infection offers unique opportunities to studyaspects of parasite biology not available throughstudy of the human disease. These opportunities willinclude the ability to investigate disease pathogen-esis and host immunological response after inocula-tion of microsporidial organisms and to study theprogressive effect of lentivirus-induced immunosup-pression on microsporidial-induced disease.

AcknowledgmentsWe thank Drs. R. Desrosiers and N. Letvin for accessto macaque tissues, Alison Hampson for photo-graphic assistance, Dr. R. Desrosiers and D. Regierfor aid in sequencing and cloning.

Enterocytozoon Infection in Simian AIDS 1403AJP April 1997, Vol. 150, No. 4

References

1. Weber R, Bryan RT, Schwartz DA, Owen RL: Humanmicrosporidial infection. Clin Microbiol Rev 1996,7:426-461

2. Orenstein JM: Intestinal microsporidiosis. Adv AnatPathol 1996, 3:46-58

3. Schwartz DA, Sobottka I, Leitch GJ, Cali A, VisvesvaraGS: Pathology of microsporidiosis: emerging parasiticinfections in patients with acquired immunodeficiencysyndrome. Arch Pathol Lab Med 1996, 120:173-188

4. Cali A, Kotler DP, Orenstein JM: Septata intestinalis, n.g.n. sp., an intestinal microsporidian associated withchronic diarrhea and dissemination in AIDS patients.J Protozool 1993, 40:101-112

5. Didier ES, Didier PJ, Friedberg DN, Stenson SM, Milli-champ JM, Shadduck JA: Isolation and characteriza-tion of a new human microsporidian, Encephalitozoonhellem (n.sp.), from three AIDS patients with keratocon-junctivitis. J Infect Dis 1991, 163:617-621

6. De Groote MA, Visvesvara G, Wilson ML, Pieniazek NJ:Polymerase chain reaction and culture confirmation ofdisseminated Encephalitozoon cuniculi in a patient withAIDS: successful therapy with albendazole. J Infect Dis1995, 171:1375-1378

7. Desportes I, Le Charpentier Y, Galian A: Occurrence ofa new microsporidian: Enterocytozoon bieneusi gn, nsp,in the enterocytes of a human patient with AIDS.J Protozool 1985, 32:250-254

8. Silveira JA, Canning EU: Vittaforma corneae n. comb.for the human microsporidium Nosema corneum Shad-duck, Mecoli, Davis & Font, 1990, based on its ultra-structure in the liver of experimentally infected athymicmice. J Eukaryot Microbiol 1995, 42:158-165

9. Margileth AM, Strano AJ, Chandra R, Neafie R, Blum M,McCully RM: Disseminated nosematosis in an immuno-logically compromised infant. Arch Pathol 1973, 95:145-150

10. Chupp GL, Alroy J, Adelman LS, Breen JC, SkolnickPR: Myositis due to Pleistophora (microsporidia) in apatient with AIDS. Clin Infect Dis 1993, 16:15-21

11. Hollister WS, Canning EU, Weidner EU, Field AS,Kench J, Marriott DJ: Development and ultrastructureof Trachipleistophora hominis n.g. n.sp. after in vitro iso-lation from AIDS patient and inoculation into athymicmice. Parasitology 1996, 112:143-154

12. Molina JM, Sarfati B, Beauvais M, Lemann A, LesourdA, Ferchal F, Casin I, Lagrange P, Modigliani R, Der-ouin F, Modai J: Intestinal microsporidiosis in humanimmunodeficiency virus-infected patients with chronicunexplained diarrhea. J Infect Dis 1993, 167:217-221

13. Eeftinck Schattenkerk JKM, Van Gool T, van Ketel RJ,Bartelsman JFWM, Kuiken CL, Terpstra WJ, Reiss P:Clinical significance of small-intestinal microsporidiosisin HIV-1-infected individuals. Lancet 1991, 337:895-898

14. Field AM, Hing M, Milliken S, Marriott DJ: Microsporidia

in the small intestine of HIV infected patients: a newdiagnostic technique and a new species. Med J Aust1993, 158:390-394

15. Greensom WK, Belitsos PC, Yardley JH, Bartlett JG:AIDS enteropathy: occult enteric infections and duode-nal mucosal alterations in chronic diarrhea. Ann InternMed 1991, 114:366-372

16. Rabeneck L, Gyorkey F, Genta RM, Gyorkey P, FooteLW, Risser JMH: The role of microsporidia in the patho-genesis of HIV-related chronic diarrhea. Ann InternMed 1993, 895-899

17. Pol S, Romana CA, Richard S, Amouyal P, Desportes-Livage I, Carnot F, Pays J, Berthelot P: Microsporidiainfection in patients with the human immunodeficiencyvirus and unexplained cholangitis. N EngI J Med 1993,328:95-99

18. Weber R, Kuster H, Keller R, Bachi T, Spycher MA,Briner J, Russi E, Luthy R: Pulmonary and intestinalmicrosporidiosis in a patient with the acquired immu-nodeficiency syndrome. Am Rev Respir Dis 1992, 146:1603-1605

19. Sandfort J, Hannemann A, Gelderblom H, Stark K,Owen RL, Ruf B: Enterocytozoon bieneusi infection in animmunocompetent patient who had acute diarrhea andwho was not infected with the human immunodefi-ciency virus. Clin Infect Dis 1994, 19:514-516

20. McWhinney PHM, Nathwani D, Green ST, Boyd JF,Forrest JA: Microsporidia detected in association withAIDS-related sclerosing cholangitis. AIDS 1991,5:1394-1395

21. Beaugerie L, Teilhac MF, Deluol A, Fritsch J, Girard P,Rozenbaum W, Le Quintrec Y, Chatelet F: Cholangi-opathy associated with microsporidia infection of thecommon bile duct mucosa in a patient with HIV infec-tion. Ann Intern Med 1992, 117:401-402

22. Pol S, Romana C, Richard S, Carnot F, Dumont J,Bouche H, Pialoux G, Stern M, Pays J, Berthelot P:Enterocytozoon bieneusi infection in acquired immuno-deficiency syndrome-related sclerosing cholangitis.Gastroenterology 1992, 102:1778-1781

23. Orenstein JM: Microsporidiosis in the acquired immu-nodeficiency syndrome. J Parasitol 1991, 77:843-864

24. Cali A, Owen RI: Intracellular development of entero-cytozoon, a unique microsporidian found in the intes-tine of AIDS patients. J Protozool 1990, 37:145-155

25. Desportes-Livage I, Harper F, Hilmarsdottir I, Ben-hamou Y, Ombrouck C, Gentilini M: The phospholipidsin Enterocytozoon bieneusi: an electron spectroscopicimaging study. Folia Parasitol 1993, 40:275-278

26. Schwartz DA, Abou-Elella A, Wilcox CM, Gorelkin L,Visvesvara GS, Thompson SE, Weber R, Bryan RT: Thepresence of Enterocytozoon bieneusi spores in the lam-ina propria of small intestinal biopsies with no evidenceof disseminated microsporidiosis. Arch Pathol LabMed 1995, 119:424-428

27. Visvesvara GS, Leitch GJ, Pieniazek NJ, Silva AJ, Wal-lace S, Slemenda SB, Weber R, Schwartz DA, GorelkinL, Wilcox CM, Bryan RT: Short-term in vitro culture and

1404 Mansfield et alAJP April 1997, Vol. 150, No. 4

molecular analysis of the microsporidian, Enterocyto-zoon bieneusi. J Eukaryot Microbiol 1995, 42:506-510

28. Van Gool T, Canning EU, Gilis H, Van Den BerghWeerman MA, Eeftinck Schattenkerk JKM, Dankert J:Septata intestinalis frequently isolated from stool ofAIDS patients with a new cultivation method. Parasitol-ogy 1994, 109:281-289

29. Canning EU, Hollister WS: Enterocytozoon bieneusi(Microspora): prevalence and pathogenicity in AIDSpatients. Trans R Soc Trop Med Hyg 1990, 84:181-186

30. King NW, Chalifoux LV, Ringler DJ, Wyand MS, SehgalPK, Daniel MD, Letvin NL, Desrosiers RC, Blake BJ,Hunt RD: Comparative biology of natural and experi-mental SlVmac infection in macaque monkeys: a re-view. J Med Primatol 1990, 19:109-118

31. Lackner AA: Pathology of simian immunodeficiencyvirus induced disease. Curr Top Microbiol Immunol1994, 199:35-64

32. Desrosiers RC: The simian immunodeficiency viruses.Annu Rev Immunol 1990, 8:557-578

33. Mansfield KG, Pauley D, Young HL, Lackner AA: My-cobacterium avium complex in macaques with AIDS isassociated with a specific strain of simian immunode-ficiency virus and prolonged survival after primary in-fection. J Infect Dis 1995, 172:1149-1152

34. Vogel P, Miller CJ, Lowenstine LL, Lackner AA: Evi-dence of horizontal transmission of Pneumocystis cariniipneumonia in simian immunodeficiency virus-infectedrhesus macaques. J Infect Dis 1993, 168:836-843

35. Baskin GB: Disseminated cytomegalovirus infection inimmunodeficient rhesus monkeys. Am J Pathol 1987,129:345-352

36. Horvath CJ, Simon MA, Bergsagel DJ, Pauley DR, KingNW, Garcea RL, Ringler DJ: Simian virus 40-induceddisease in rhesus monkeys with simian acquired im-munodeficiency syndrome. Am J Pathol 1992, 140:1431-1440

37. Sasseville VG, Pauley DR, MacKey JJ, Simon MA: Con-current central nervous system toxoplasmosis and sim-ian immunodeficiency virus-induced AIDS encephalo-myelitis in a barbary macaque (Macaca sylvana). VetPathol 1995, 32:81-83

38. Baskin GB, Murphey-Corb M, Watson EA, Martin LN:Necropsy findings in rhesus monkeys experimentallyinfected with cultured simian immunodeficiency virus(SIV)/delta. Vet Pathol 1988, 25:456-467

39. Gerber MA, Chen M, Hu F, Baskin GB, Petrovich L:Liver disease in rhesus monkeys infected with simianimmunodeficiency virus. Am J Pathol 1991, 139:1081-1088

40. Glasgow BJ, Anders K, Layfield LJ, Steinsapir KD,Gitnick GL, Lewin KJ: Clinical and pathologic findingsof the liver in the acquired immune deficiency syn-drome (AIDS). Am J Clin Pathol 1985, 83:582-588

41. Daniel MD, Letvin NL, King NW, Kannagi M, Sehgal PK,Hunt RD: Isolation of T-cell tropic HTLV-III-like retrovi-rus from macaques. Science. 1985, 228:1201-1204

42. Letvin NL, Daniel MD, Sehgal PK, Desrosiers RC, Hunt

RD, Waldron LM, MacKey JJ, Schmidt DK, ChalifouxLV, King NW: Induction of AIDS-like disease in ma-caque monkeys with T-cell tropic retrovirus STLV-I11.Science 1985, 230:71-73

43. Kestler HW, Li Y, Naidu YM, Butler CV, Ochs MF,Jaenel G, King NW, Daniel MD, Desrosiers RC: Com-parison of simian immunodeficiency isolates. Nature1988, 331:619-621

44. Rud EW, Cranage M, Yon J, Quirk J, Ogilvie L, Cook N,Webster S, Dennis M, Clarke BE: Molecular and bio-logical characterization of simian immunodeficiency vi-rus macaque strain 32H proviral clones containing nefsize variants. J Gen Virol 1994, 75:529-543

45. Weber R, Bryan RT, Owen RL, Wilcox CM, Gorelkin L,Visvesvara GS: Improved light microscopical detectionof microsporidian spores in stool and duodenal aspi-rates. N EngI J Med 1992, 326:161-166

46. Horvath CJ, Hunt RD, Simon MA, Sehgal PK, RinglerDJ: An immunohistologic study of granulomatous in-flammation in SIV-infected rhesus monkeys. J Leuko-cyte Biol 1993, 53:532-540

47. Da Silva AJ, Schwartz DA, Visvesvara GS, De Moura H,Slemenda SB, Pieniazek NJ: Sensitive PCR diagnosisof infections by Enterocytozoon bieneusi (Microsporidia)using primers based on the region coding for small-subunit rRNA. J Clin Microbiol 1996, 34:986-987

48. Kwok S, Higuchi R: Avoiding false positives with PCR.Nature 1989, 339:237-238

49. Ilyinskii PO, Daniel MD, Simon MA, Lackner AA, Des-rosiers RC: The role of upstream U3 sequences in thepathogenesis of simian immunodeficiency virus-in-duced AIDS. J Virol 1994, 68:5933-5944

50. Zhu X, Wittner M, Tanowitz HB, Kotler D, Cali A, WeissLM: Small subunit rRNA sequence of Enterocytozoonbieneusi and its potential diagnostic role with use of thepolymerase chain reaction. J Infect Dis 1993, 168:1570-1575

51. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ:Basic alignment search tool. J Mol Biol 1990, 215:403-410

52. Hartskeerl RA, Schuitema ARJ, deWachter R: Second-ary structure of the small subunit ribosomal RNA se-quence of the microsporidium Encephalitozoon cuniculi.Nucleic Acids Res 1993, 21:1489

53. Brown RJ, Hinkle DK, Trevethan SP, Kupper JL, McKeeAE: Nosematosis in a squirrel monkey (Saimiri sciu-reus). J Med Primatol 1972, 2:114-123

54. Zeman DH, Baskin GB: Encephalitozoonosis in squirrelmonkeys (Saimirisciureus). Vet Pathol 1985, 22:24-31

55. Anver M, King NW, Hunt RD: Congenital encephalito-zoonosis in a squirrel monkey (Saimiri sciureus). VetPathol 1972, 9:475-480

56. Shadduck JA, Baskin G: Serologic evidence of en-cephalitozoon cuniculi infection in a colony of squirrelmonkeys (Saimiri sciureus). Lab Anim Sci 1989, 39:328-330

Enterocytozoon Infection in Simian AIDS 1405AJP April 1997, Vol. 150, No. 4

57. Seibold HR, Fussell EN: Intestinal microsporidiosis inCallicebus moloch. Lab Anim Sci 1973, 23:115-118

58. Didier PJ, Didier ES, Murphey-Corb M: Experimentalmicrosporidiosis in immunodeficient monkeys. FASEBJ 1996, 9:A5614

59. Didier ES, Varner PW, Aldras AM, Millchamp NJ, Mur-phey-Corb M, Bohm R, Shadduck JA: Experimental mi-crosporidiosis in immunocompetent and immunodefi-cient mice and monkeys. Folia Parasitol 1996, 41:1-11

60. Tzipori S, Carville A, Widmer G, Kotler D, Mansfield KG,Lackner A: Transmission and establishment of a per-sistent infection of E bieneusi derived from a humanwith AIDS in SIV-infected rhesus monkeys. J Infect Dis1997 (in press)

61. Hollister WS, Canning EU, Colbourne NI, Curry A,Lacey CJN: Characterization of E. hellem (Microspora)isolated from the nasal mucosa of a patient with AIDS.Parasitology 1996, 94:351-358