identification of isthmin 1 as a novel clefting and craniofacial … · 2017-11-21 · 17 been...

L.A. Lansdon et al., 1

Identification of Isthmin 1 as a novel clefting and craniofacial patterning gene in humans 1

2

Lisa A. Lansdon,*, †,‡

Benjamin W. Darbro,*,‡

Aline L. Petrin,*,**

Alissa M. Hulstrand, ††

Jennifer 3

M. Standley,* Rachel B. Brouillette,

† Abby Long,

† M. Adela Mansilla,

* Robert A. Cornell,

‡,§ 4

Jeffrey C. Murray,*,‡

Douglas W. Houston,†,‡

J. Robert Manak*,†,‡

5

*Department of Pediatrics,

†Department of Biology,

‡Interdisciplinary Graduate Program in 6

Genetics, §Department of Anatomy & Cell Biology and **College of Dentistry, University of 7

Iowa, Iowa City, IA 52242, ††

Department of Biology, Northland College, Ashland, WI 54806 8

IRB No. 199804081 and No. 199804080. 9

Genetics: Early Online, published on November 21, 2017 as 10.1534/genetics.117.300535

Copyright 2017.


Running Title: ISM1, a novel craniofacial patterning gene 1

Key Words: branchial arches; cleft lip and palate; copy number variation; craniofacial 2

development; Xenopus laevis 3

Corresponding Author: J. Robert Manak, 129 E. Jefferson St., 449 Biology Building, University 4

of Iowa, Iowa City, IA 52242 Tel: 319-335-0180; Email: [email protected] 5

6

ABSTRACT 7

Orofacial clefts are one of the most common birth defects, affecting 1-2 per 1000 births, 8

and have a complex etiology. High-resolution array-based comparative genomic hybridization 9

has increased the ability to detect copy number variants that can be causative for complex 10

diseases such as cleft lip and/or palate. Utilizing this technique on 97 non-syndromic cleft lip and 11

palate cases and 43 cases with cleft palate only, we identified a heterozygous deletion of Isthmin 12

1 in one affected case, as well as a deletion in a second case which removes putative 3’ 13

regulatory information. Isthmin 1 is a strong candidate for clefting as it is expressed in orofacial 14

structures derived from the first branchial arch and is also in the same synexpression group as 15

fibroblast growth factor 8 and sprouty RTK signaling antagonist 1a and 2, all of which have 16

been associated with clefting. Copy number variants affecting Isthmin 1 are exceedingly rare in 17

control populations, and Isthmin 1 scores as a likely haploinsufficiency locus. Confirming its 18

role in craniofacial development, knockdown or CRISPR/Cas9-generated mutation of isthmin 1 19

in Xenopus laevis resulted in mild to severe craniofacial dysmorphologies, with several 20

individuals presenting with median clefts. Moreover, knockdown of isthmin 1 produced 21

decreased expression of LIM homeobox 8, itself a gene associated with clefting, in regions of the 22

face that pattern the maxilla. Our study demonstrates a successful pipeline from copy number 23

mailto:[email protected]


variant identification of a candidate gene to functional validation in a vertebrate model system 1

and reveals Isthmin 1 as both a new human clefting locus as well as a key craniofacial patterning 2

gene. 3

INTRODUCTION 4

Cleft lip and/or palate (CL/P) are common birth defects that cause significant morbidity 5

and can impose a substantial financial burden resulting from surgical, nutritional, dental, speech, 6

medical and behavioral interventions (Wehby and Cassell 2010). CL/P can occur as part of a 7

more complex chromosomal, Mendelian, or teratogenic syndrome, or can be an isolated finding 8

(non-syndromic; NS; as reviewed in (Leslie and Marazita 2013)). Recent work indicates that 9

60% of CL/P cases are NS (Genisca, Frias et al. 2009), and while some of the genetic and 10

environmental triggers for syndromic CL/P have been identified, the explanations for these more 11

common NS cases have remained more elusive. 12

Copy number variants (CNVs) are now considered common causes of disease (Glessner, 13

Wang et al. 2009, Greenway, Pereira et al. 2009, Mefford, Cooper et al. 2009, Mefford and 14

Eichler 2009, Rosenfeld, Ballif et al. 2010, Bassuk, Muthuswamy et al. 2013, Rosenfeld, Coe et 15

al. 2013), playing a prominent role in neurodevelopmental disorders (Girirajan, Rosenfeld et al. 16

2010, Marshall, Howrigan et al. 2017, RK, Merico et al. 2017), birth defects in general (Mefford, 17

Sharp et al. 2008, Lu, Bacino et al. 2012, Bassuk, Muthuswamy et al. 2013) and CL/P in 18

particular (Osoegawa, Vessere et al. 2008, Shi, Mostowska et al. 2009, Younkin, Scharpf et al. 19

2014, Younkin, Scharpf et al. 2015, Cao, Li et al. 2016, Conte, Oti et al. 2016, Klamt, Hofmann 20

et al. 2016, Cai, Patterson et al. 2017). Previous studies investigating the role of CNVs in 21

NSCL/P have identified two deletions (one overlapping MGAM on chromosome 7q34, and the 22

second overlapping ADAM3A and ADAM5 on chromosome 8p11) which are over-transmitted in 23


cleft versus control trios (Younkin, Scharpf et al. 2015) and one region on 7p14.1 in which de 1

novo deletions occur more frequently in probands with clefts than controls (Younkin, Scharpf et 2

al. 2014, Klamt, Hofmann et al. 2016). In addition, deletions overlapping several genes 3

previously implicated in CL/P such as SATB2, MEIS2, SUMO1, TBX1, and TFAP2A have been 4

reported (Shi, Mostowska et al. 2009, Conte, Oti et al. 2016). However, systematic studies 5

identifying rare, higher effect size CNVs followed by functional analysis in vertebrate model 6

organisms have not been explored for NSCL/P. 7

Craniofacial development in vertebrates results from the coordinated growth and 8

convergence of facial prominences which respond to a complex, tightly regulated series of 9

molecular signals (reviewed in (Twigg and Wilkie 2015)). In the early stages of development, a 10

subset of neural crest cells arising near the midbrain-hindbrain boundary (MHB; also called the 11

isthmus or isthmic organizer) migrate to populate the branchial arches, including the first 12

branchial arch which forms the mandible and maxilla. The Isthmin 1 (ism1) gene was originally 13

identified in an unbiased screen of secreted factors expressed in the Xenopus gastrula (called 14

xIsm) (Pera, Kim et al. 2002)). It is expressed prominently in the MHB, as well as in the nascent 15

mesoderm, neural tube and pharyngeal (branchial) arches in the mouse, chick and Xenopus 16

embryos (Pera, Kim et al. 2002, Osorio, Wu et al. 2014). Fgf8 (human orthologue FGF8), 17

spry1a (human orthologue SPRY1), and spry2 (human orthologue SPRY2) are co-expressed with 18

ism1 in the isthmus, branchial arches and ear vesicle in Xenopus (Christen and Slack 1997, Pera, 19

Kim et al. 2002, Panagiotaki, Dajas-Bailador et al. 2010, Wang and Beck 2014), placing them in 20

the same ‘synexpression group’. Notably, synexpression group members have been shown to 21

function in the same biological process (Niehrs and Pollet 1999, Niehrs and Meinhardt 2002). 22

Intriguingly, each of these genes with the exception of ism1 has been previously implicated in 23


clefting (Vieira, Avila et al. 2005, Goodnough, Brugmann et al. 2007, Riley, Mansilla et al. 1

2007, Welsh, Hagge-Greenberg et al. 2007, Thomason, Dixon et al. 2008, Fuchs, Inthal et al. 2

2010, Goudy, Law et al. 2010, Mangold, Ludwig et al. 2010, Yang, Kilgallen et al. 2010, Green, 3

Feng et al. 2015, Simioni, Araujo et al. 2015, Conte, Oti et al. 2016). Conditional expression of 4

Spry1 in the neural crest causes facial clefting and cleft palate in mice, and deletions of SPRY1 5

have been identified in three patients with cleft palate only (Yang, Kilgallen et al. 2010, Conte, 6

Oti et al. 2016). SPRY2 is found near the NSCL/P-associated genome-wide association study 7

signal at 13q31.1 (Ludwig, Mangold et al. 2012), and rare point mutations in this gene have been 8

identified in individuals with NSCL/P (Vieira, Avila et al. 2005). Additionally, mice carrying a 9

deletion of Spry2 have cleft palate, which has been shown to be complementary to (but 10

independent of) Fgf8 signaling during craniofacial morphogenesis (Goodnough, Brugmann et al. 11

2007, Welsh, Hagge-Greenberg et al. 2007). FGF8 itself (in addition to impaired FGF signaling 12

in general) contributes to NSCL/P in humans (Riley, Mansilla et al. 2007, Simioni, Araujo et al. 13

2015), and is altered in a Tp63-deficient mouse model of facial clefting (Thomason, Dixon et al. 14

2008). The strong evidence for each of these synexpression group members in craniofacial 15

morphogenesis and clefting implicate ISM1 as a plausible clefting candidate in humans. 16

Due to the high conservation of orofacial development between humans and Xenopus and 17

the well-established use of Xenopus as a model organism, this vertebrate has become an effective 18

model to study orofacial development and defects (Dickinson and Sive 2006, Dickinson 2016, 19

Chen, Jacox et al. 2017, Dubey and Saint-Jeannet 2017). Elegant bead implantation and 20

transplantation studies in Xenopus from the Sive laboratory have helped characterize specific 21

cellular mechanisms involved in craniofacial development, including the role of the Kinin-22

Kallikrein and Wnt/planar cell polarity pathways in mouth formation (Jacox, Sindelka et al. 23


2014, Jacox, Chen et al. 2016). Moreover, a study using Xenopus to model the effect of depleted 1

retinoic acid signaling (which leads to clefting in humans), revealed decreased expression of 2

homeobox genes lhx8 and msx2 (corresponding with a failure of dorsal anterior cartilage 3

formation), resulting in a midline orofacial cleft (Kennedy and Dickinson 2012). Interestingly, 4

FGF8b has been shown to mediate lhx8, msx1, and msx2 expression in the chick embryo through 5

regulation of retinoic acid signaling, suggesting a potential mechanism behind the specification 6

of first branchial arch derivatives via signals derived from the isthmic organizer (Kennedy and 7

Dickinson 2012, Shimomura, Kawakami et al. 2015). 8

Using high resolution microarray-based Comparative Genomic Hybridization (aCGH) in 9

a clefting cohort, we report here identification of a rare heterozygous deletion which removes 10

Isthmin 1 (ISM1), in addition to a deletion in a second unrelated case which potentially removes 11

3’ regulatory information. Additionally, sequencing of ISM1 in two CL/P cohorts identified a 12

novel mutation in cases that is absent in control populations. ISM1 scores as a 13

haploinsufficiency locus, and morpholino knockdown as well as CRISPR/Cas9 deletion in 14

Xenopus laevis resulted in mild to severe craniofacial dysmorphologies including clefting 15

phenotypes, demonstrating that ISM1 is critical in patterning craniofacial structures. Finally, 16

knockdown of ism1 reduced the craniofacial expression of a known clefting locus, lhx8. 17

Collectively, these data provide compelling evidence that ISM1 is a new craniofacial patterning 18

locus. 19

20

MATERIALS AND METHODS 21

Patient material 22


For the aCGH experiments, a total of 140 unrelated individuals with clefts (97 CLP, 43 1

CPO) were processed, with 130 individuals analyzed after passing bioinformatic quality controls. 2

All cases were NS and seen during surgical screening as part of the Operation Smile medical 3

missions in the Philippines (Murray, Daack-Hirsch et al. 1997). We used an additional 245 4

NSCL/P cases from the US (Iowa) and 275 NSCL/P cases from the Philippines for direct 5

sequencing of the coding regions of the gene, as well as a set of 344 Filipino control samples. 6

All participants included in this study were recruited following signed informed consent obtained 7

in compliance with Institutional Review Board (IRB No. 199804081 (Philippines) and IRB No. 8

199804080 (Iowa)). 9

Comparative genomic hybridization 10

Comparative genomic hybridization was performed as recommended by the array 11

manufacturer (Roche NimbleGen cgh_cnv_userguide_v7p0) on 140 unrelated Filipinos with 12

clefts. Briefly, 1 ug of case DNA was labeled with Cy3-coupled nonamers and 1 ug of control 13

DNA (from an unaffected Filipino male) was labeled with Cy5-coupled nonamers. 34 ug of each 14

labeled DNA was co-hybridized to a Roche NimbleGen human whole genome tiling microarray 15

(Human CGH 2.1M Whole-Genome Tiling v2.0D Array) and the array was washed, scanned, 16

and analyzed. 17

Copy number variation detection and quality control 18

BioDiscovery’s Nexus Copy Number FASST2 Segmentation Algorithm, a Hidden 19

Markov Model (HMM) based approach, was used to make initial copy number calls. The 20

significance threshold for segmentation was set at 1.0E-6 also requiring a minimum of 3 probes 21

per segment and a maximum probe spacing of 1000 between adjacent probes before breaking a 22

segment. The log2 ratio thresholds for single copy gain and single copy loss were set at 0.3 and -23


0.3, respectively. A 3:1 sex chromosome gain threshold was set to 1.2 and a 4:1 sex 1

chromosome gain threshold was set to 1.7. NimbleGen’s DEVA segMNT Algorithm, which 2

minimizes squared error relative to the segment means, was used as a second algorithm for all 3

copy number calls after data extraction, LOESS spatial correction and background correction. 4

Default parameters were used apart from setting the minimum segment difference to 0.3 and 5

requiring a minimum of 3 probes per segment to more similarly call CNVs when compared to 6

Nexus. X-shift values in females (hybed against a male control) were adjusted by the median X-7

shift across all females in the cohort. Finally, CNV calls from Nexus and DEVA were compared 8

using the BEDTOOLS intersect function. Only calls with a 50% reciprocal overlap were retained 9

for further analysis. Microarray data was quality controlled based on several data metrics 10

generated by DEVA and Nexus. DEVA was used to calculate experimental metrics that include 11

interquartile density, ratio range, signal range, mean empty, mean experimental, and mean 12

random (for a detailed discussion of these metrics see (Brophy, Alasti et al. 2013)). Nexus also 13

calculated a surrogate measure of noise (Quality score). Lastly, following the calculation of the 14

high-quality CNV Regions (CNVRs), the number of duplications and deletions (and total 15

CNVRs) was used as a quality control metric. For each metric across all arrays the mean and 16

standard deviation were calculated. Any array that had six or more metrics falling outside of two 17

standard deviations of the mean was excluded from further analysis. 18

Filtering Nexus calls to identify rare copy number variants 19

We identified a total of 20,630 CNVs called by both Nexus and DEVA from the 130 20

arrays passing quality controls (see copy number variation detection and quality control). We 21

then compared the CNV calls to an in-house curated list of CNVs from the Database of Genomic 22

Variants (DGV). We included all studies containing 100 or more individuals within DGV which 23


used CGH or SNP arrays. Any CNVs occurring at a frequency of <1% within each study were 1

removed from the list of likely benign variants, as these are defined as rare occurrences and are 2

more likely to contribute to a disease phenotype. We then filtered our CNV calls to include only 3

CNVs that 1) had a 50% or less overlap with these likely benign variants or a segmental 4

duplication, 2) overlapped an exon of a gene, 3) spanned a minimum of 10kb, and, 4) had log2 5

median shift values of ≤-0.7 or ≥0.42 for deletions and amplifications, respectively. All calls 6

were visually inspected and false positives were removed. We also excluded one gene (IQCA1) 7

which was overlapped by a CNV in 75% of the samples, since these calls were likely due to a 8

control-specific CNV or a Filipino-specific polymorphism. Using these criteria, we identified 51 9

deletions and 83 amplifications (Supplemental Table 1). For our functional analysis, we focused 10

on deletions overlapping protein coding genes occurring at a frequency of <1%; these CNVs 11

overlapped 42 genes (Figure 1, Supplemental Table 2). 12

ISM1 deletion breakpoints 13

Upon identification of deletions in or near ISM1 by aCGH, we performed a validation by 14

independent methods using Long Range PCR (LRPCR) followed by direct sequencing of the 15

PCR product. We used flanking primers (designed using Primer3; (Rozen and Skaletsky 2000)) 16

ranging from 500bp to 3kb on each side of the potential breakpoints as given by the aCGH 17

analysis by Nexus Copy Number. LRPCR was performed using Takara LA Taq following the 18

manufacturer’s protocol. The PCR products were analyzed on a 1.5% agarose gel and sent to 19

Functional Biosciences (http://functionalbio.com/web/index.php) for direct sequencing in order 20

to identify the exact coordinates of the breakpoints (chr20:12,737,592-13,341,144 for the coding 21

deletion, chr20:13,281,543-13,293,591 for the 3’ deletion; based on hg19 genome build). 22

Direct sequencing of ISM1 in cases and controls 23

http://functionalbio.com/web/index.php


Primers were designed using Primer3 (Rozen and Skaletsky 2000) for the six coding 1

exons of ISM1. PCR conditions and primers are available upon request. Sequencing reactions 2

were performed by Functional Biosciences (http://functionalbio.com/web/index.php). Polyphen 3

2, SIFT, MutationTaster, MutationAssessor, FATHMM Prediction and FATHMM-MKL Coding 4

Prediction within dbNSFP (Liu, Wu et al. 2016) were used to predict whether the variants 5

detected were deleterious, and phastCons and phyloP LRT scores were obtained from the UCSC 6

Genome Browser. 7

Sequencing of clefting loci in two cases 8

All exons of ISM1, FGF8 and SPRY2 were sequenced in the two cases harboring copy 9

number variants overlapping or near ISM1 as per above, with the following modification: 10

sequencing reactions were performed by the Carver Center for Genomics in the Department of 11

Biology, University of Iowa. Primers are available upon request. 12

Xenopus embryos 13

Adult Xenopus laevis females were induced by injecting human chorionic gonadotropin 14

(hCG). Eggs were collected in high-salt 1.2x MMR, rinsed with 0.3X MMR (10X MMR: 1M 15

NaCl, 18mM KCl, 20mM CaCl2, 10mM MgCl2, 150mM Hepes, pH 7.6), drained, then fertilized 16

using a 1.5mL sperm suspension in 0.3X MMR for 10 minutes before washing in 0.1X MMR. 17

After 1 hour, the embryos were dejellied in 2% cysteine in 0.1X MMR (pH 7.9) for 4 minutes 18

before washing the embryos with 0.1X MMR. Embryos were reared in 0.1X MMR to the 19

desired developmental stage. 20

Whole mount in situ hybridization 21

Full-length ism1.L cDNA in pCMV-SPORT6 was obtained commercially (TransOMIC 22

Technologies). Antisense probes were synthesized from the plasmid and diluted to 1ug/mL in 23

http://functionalbio.com/web/index.php


hybridization buffer before use. Whole mount in situ hybridization was performed as previously 1

described (Hulstrand and Houston 2013). To assess the reduction in lhx8 levels upon ism1 2

knockdown, we compared lhx8 maxillary expression levels on both sides of the embryos, with 3

one side injected with ism1 morpholino (6 or 12 ng) and the other side subjected to a standard 4

control needle prick. We used ImageJ software to assess the mean intensities of signal for both 5

sides and then divided the ism1 knockdown value by control value to arrive at a fold change. A 6

minimum of six embryos were used for each group. 7

mRNA synthesis 8

The coding region of the full-length ism1.L cDNA (Accession No. BC160753; 9

GE/Dharmacon) was amplified by PCR and cloned into pCR8/GW/TOPO (Invitrogen). Clones 10

were sequenced and inserted into a custom pCS2-HA/GW vector using LR recombination 11

(Invitrogen). Template RNA was linearized using NotI for sense transcription and capped 12

mRNAs were synthesized using the SP6 mMESSAGE mMACHINE kit (Ambion). 13

Embryo microinjections 14

Fertilized embryos were injected essentially as described (Hulstrand and Houston 2013). 15

Embryos were transferred into 0.5X MMR containing 2% Ficoll400 (GE Bioscience) and 16

injected with morpholino oligonucleotides (MOs) or mRNAs into the animal hemisphere at the 17

two-four cell stages. Antisense oligos complimentary to the ism1 5’UTR and translation start 18

site to block translation (5’-GCCAGTCGCAACATCCTCTTGATGC-3’) or complimentary to 19

the exon1/intron1 spice junction to disrupt the splicing of ism1 (5’-20

TGTATGTGGAATGGACTAACCTGTA-3’) were synthesized (Gene Tools). Capped mRNAs 21

were injected at two cell stage followed by either MO at four cell stage for rescue experiments. 22


The standard control oligo (Gene Tools) was used as a negative control for all injection 1

experiments (5’-CCTCCTTACCTCAGTTACAATTTATA-3’). 2

CRISPR/Cas9 mutagenesis 3

Mutations in ism1 were generated in F0 embryos using a CRISPR/Cas9 injection 4

strategy. Guide RNAs were designed against exon 1 of Xenopus laevis ism1.L (5’-5

GCTGGAGTTGGAGGAGCTAT[CGG]-3’; the PAM site is in brackets). Ism1.L is the only 6

homeolog remaining following speciation through allopolyploidization (Session, Uno et al. 7

2016) and thus Xenopus is functionally diploid for this gene. Genome editing was performed 8

using Alt-R™ reagents from IDT (Coralville, Iowa). Custom crRNAs were synthesized and 9

annealed with a common tracrRNA, incubated with an equimolar amount of Cas9 protein (IDT, 10

1.5-3 µM each final concentration) at 37˚C for 10 minutes. Fertilized eggs were injected with ~ 11

6 nl of this mix at the one-cell stage (300pg RNA/1.5 ng Cas9). The presence of mutations was 12

verified by PCR amplification of exon 1 DNA followed by T7 endonuclease assays or cloning 13

and sequencing of PCR products (Supplemental Figure 1). 14

Immunostaining 15

Embryos for immunostaining were fixed in MEMFA and washed into 1X PBS as 16

described (Hulstrand and Houston 2013). Embryos were washed in PBT (1X PBS, 0.2% BSA, 17

0.5% Triton X-100) and blocked for four hours at room temperature (RT) in PBT+2.5% BSA. 18

Samples were washed in PBT again and incubated in anti-E-cadherin mAb 8C2 (Developmental 19

Studies Hybridoma Bank, 1:5 dilution) overnight at 4°C. Embryos were washed five times one 20

hour in PBT. Alexa 488-conjugated goat anti-mouse IgG secondary antibodies and Alexa 568-21

Phalloidin were diluted 1:500 in 1xPBT and incubated overnight at 4°C. Embryos were washed 22


five times one hour in PBT and 1 hour in 1x PBS before imaging on an SP2 confocal 1

microscope. 2

Data availability 3

Plasmids are available upon request. Raw CNV array tiff, Nexus data summary txt files 4

and DEVA segMNT txt files are publicly available at GEO (GSE100845). 5

6

RESULTS 7

Comparative genomic hybridization identifies deletions in the ISM1 genomic interval 8

We analyzed aCGH data from 130 non-syndromic CLP and CPO Filipino cases that 9

passed quality controls (QC; see Materials and Methods) to identify potentially disease-10

associated rare copy number variants. Data analysis was performed using Nexus Copy Number 11

(version 7.5; BioDiscovery Inc., Hawthorne, CA), DEVA (version 1.2; Roche NimbleGen, 12

Madison, WI) and several in-house custom Python scripts as described previously (see Materials 13

and Methods and (Brophy, Alasti et al. 2013). Since we wished to identify key genes involved in 14

craniofacial patterning that could be validated in vertebrate model organisms, we focused on 15

variants that were represented in <1% of the cohort and exceedingly rare or absent in the control 16

population, since disease-causing genomic variants of high effect size are known to be rare in the 17

population (Kaiser 2012). Overall, 51 coding deletions and 83 coding amplifications 18

(Supplemental Table 1), overlapping at least one exon of 200 genes (Supplemental Table 2), 19

were identified when compared to an in-house curated list of benign variants occurring at a 20

frequency of ≥1% in the Database for Genomic Variants (DGV; see Materials and Methods). 21

One individual harbored a 2.4Mb duplication of 22q11.21, which is a commonly reported 22

pathogenic variant in 22q11.2 duplication syndrome (Ensenauer, Adeyinka et al. 2003) and 23


presents as a spectrum of phenotypic abnormalities with or without CL/P. We revisited this 1

individual’s clinical file and were unable to rule out the possibility of a 22q11.2 duplication 2

syndrome versus a non-syndromic cleft due to insufficient phenotyping. Aside from the 22q11.2 3

duplication locus, 4 deletions (IMMP2L, PTPRD, CDH1, NOSIP) and 5 amplifications (IFIT2, 4

SLC46A1, RFC1, TULP4, DMD) overlapped genes previously associated with clefting 5

(Supplemental Tables 1 and 2), providing evidence that our pipeline was effective in identifying 6

clefting loci. 7

Next, we elected to follow up novel clefting candidates that were overlapped by a 8

deletion in <1% of the case cohort (since deletions are likely more deleterious than 9

amplifications), had a haploinsufficiency score ≤10 (predicted as likely haploinsufficent in 10

DECIPHER; https://decipher.sanger.ac.uk/) and were overlapped by CNVs at a higher frequency 11

in cases versus controls (Figure 1). Nine genes passed all filters and fit these criteria, so we 12

assessed the biological plausibility of each gene’s involvement in clefting by searching the 13

Mouse Genome Informatics (MGI; http://www.informatics.jax.org/) database for expression in 14

the mouth, palate and face, and NCBI and PubMed for known biological function. Four of the 15

genes, Cadherin 1 (CDH1), Protein inhibitor of activated STAT 2 (PIAS2), UDP-glucose 16

pyrophosphorylase 2 (UGP2), and Isthmin 1 (ISM1) fulfilled these criteria (Supplemental Table 17

2). Variants in CDH1 have been previously implicated in cleft lip and palate in individuals with 18

hereditary diffuse gastric cancer (Frebourg, Oliveira et al. 2006) and therefore CDH1 was not 19

considered for further functional validation. Although PIAS2 was sequenced for damaging 20

variants in 192 Europeans with NSCLP along with other genes encoding Small ubiquitin-like 21

modifier (SUMO) proteins, no such variants were identified (Carta, Pauws et al. 2012), and thus 22

additional support for its involvement for clefting is needed. UGP2 has been identified as a 23

https://decipher.sanger.ac.uk/


biomarker for gallbladder cancer and metastatic hepatocellular carcinoma (Tan, Lim et al. 2014, 1

Wang, Yang et al. 2016) and thus was not a compelling clefting candidate. The remaining locus, 2

ISM1, was particularly intriguing since this gene is in the same synexpression group as FGF8, 3

SPRY1 and SPRY2, which themselves are associated with oro-facial clefting (see Introduction 4

and Discussion), is expressed in the oral mucosa in humans (Valle-Rios, Maravillas-Montero et 5

al. 2014), and interacts with αVβ5 integrins, a family of integrins which causes cleft palate in 6

mice when mutated (Aluwihare, Mu et al. 2009). Thus, we selected ISM1 for functional follow 7

up. 8

ISM1 is a haploinsufficiency locus 9

Large sequencing and microarray studies have identified numerous highly constrained or 10

haploinsufficient regions of the genome (Petrovski, Wang et al. 2013, Zarrei, MacDonald et al. 11

2015, Ruderfer, Hamamsy et al. 2016), and only four deletions overlapping the coding region of 12

ISM1 have been reported in control populations within the Database of Genomic Variants (DGV; 13

http://dgv.tcag.ca). Significantly, of these four, only one deletion CNV event is from a study 14

containing greater than 40 individuals, and in that study the deletion encompassed the first exon 15

of ISM1 in one patient out of 873 (Uddin, Thiruvahindrapuram et al. 2015). This is significant 16

given that as of mid-2017, the DGV had identified over six million sample level CNVs from 17

control populations of over 70 studies. Data from the DECIPHER database and the ClinGen 18

resource (https://decipher.sanger.ac.uk/; https://www.clinicalgenome.org/) further support the 19

likelihood that ISM1 is intolerant to copy number reductions. Specifically, there are only three 20

entries within the ClinGen resource of deletion CNVs spanning ISM1 and two of those are in 21

excess of 6Mb and encompass numerous other genes. The one deletion CNV event in ClinGen 22

that is under this threshold (~570kb) was labeled a variant of uncertain significance and did not 23

http://dgv.tcag.ca/

https://decipher.sanger.ac.uk/

https://www.clinicalgenome.org/


contain detailed phenotypic information (nssv584541). In DECIPHER there are five deletion 1

CNV events spanning ISM1, three of which are >3Mb in size and two that are in the range of 2

500-600kb. The latter two were both found to be inherited and in patients with either no 3

phenotypic data provided or minimal data without a mention of clefting. Finally, there are only 4

two deletions involving ISM1 noted in the CNV calls from the ExAC database (data from 5

>60,000 individuals; http://exac.broadinstitute.org/) and the gene itself is predicted to be 6

haploinsufficient (%HI 8.20 reported by DECIPHER) (Huang, Lee et al. 2010). Taken together, 7

these data suggest ISM1 is likely a haploinsufficiency locus. 8

A second ISM1 deletion removes putative 3’ regulatory sequences 9

Using either aCGH or LRPCR, we assessed whether any family members also harbored 10

the ISM1 coding deletion at chr20:12,737,592-13,341,144 (hg19) which removed ISM1 and 11

SPTLC3. We found that the deletion was paternally inherited in two brothers (with both the 12

father and brother of the proband being unaffected) (Supplemental Figure 2). Interestingly, while 13

assessing all coding deletions and amplifications passing our pipeline for nearby noncoding 14

variants, we detected one deletion immediately 3’ of ISM1 (chr20: 13,281,543-13,293,591 hg19) 15

overlapping a ChIP-seq validated CTCF binding site and other putative ISM1 regulatory 16

sequences (Figures 2, 3), although we are uncertain of the effect this deletion would have on 17

ISM1 expression. The 3’ deletion of ISM1 was inherited maternally from a mother with cleft lip 18

only (Supplemental Figure 2). This deletion was confirmed in both the unaffected maternal 19

grandfather and two unaffected maternal uncles. We also inspected the ISM1 genomic region for 20

presence of CNVs for samples which did not pass QC (all of which were of sufficient quality for 21

CNV calling within this interval) and confirmed that only two out of 140 probands harbored 22

http://exac.broadinstitute.org/


deletions in or near ISM1. These data are consistent with incomplete penetrance of the 1

phenotype. 2

ISM1 direct sequencing in NSCL/P 3

The rare coding deletion identified in the ISM1 genomic interval prompted us to look for 4

single nucleotide variants in ISM1 in NSCL/P patients. We sequenced each of its six exons in a 5

total of 520 cases (245 individuals of European descent from the US (Iowa) and 275 Filipinos 6

with NSCL/P) in addition to 344 control subjects from the Philippines. The NHLBI Exome 7

Sequencing Project Variant Server (EVS) and the 1000 Genomes Project (Genomes Project, 8

Abecasis et al. 2012) were used as control references for the cases of European descent. We 9

identified nine missense variants (several of which had never been reported (Supplemental Table 10

3)). The most promising variant (N188S) did not appear in any of the 8400 control alleles whilst 11

occurring in 1 out of 456 case alleles, is absent from dbSNP, EVS, ExAC and 1000 Genomes, 12

and is predicted to be probably damaging by Polyphen, damaging by MutationTaster and 13

FATHMM MKL, but tolerated by SIFT, FATHMM, and MutationAssessor. However, we note 14

that greater power is needed to convincingly assess pathogenicity of the variants detected in 15

cases. 16

Sequencing of clefting loci in ISM1 cases 17

In order to assess whether damaging genomic variants in remaining copies of ISM1 (from 18

the two cases harboring deletions overlapping or near ISM1) might be contributing to the clefting 19

phenotype, we sequenced all exons of ISM1 in both cases, and were unable to find any missense 20

variants. We also decided to sequence all exons of FGF8 and SPRY2 (the synexpression group 21

members having the strongest connections to human clefting)) in order to determine whether 22

missense variants in these genes might be contributing to the phenotype. Only one variant was 23


identified (rs504122), a common variant in SPRY2 in the case harboring the deletion overlapping 1

ISM1. 2

Characterization of ism1 expression during Xenopus laevis craniofacial development 3

Previous work in Xenopus laevis identified concentrated ism1 expression in the branchial 4

arches (BAs) and midbrain hindbrain boundary (MHB) at stage 30 (Pera, Kim et al. 2002). 5

Since craniofacial precursors derive from the first branchial arch, we performed in situs of 6

Xenopus laevis embryos at tailbud and tadpole stages to determine if ism1 is expressed in the 7

developing face (Figure 4). We found ism1 was strongly expressed in the MHB, BAs and ear 8

placode (stages 28 and 33; Figure 4 A-B), with decreasing expression in the MHB and BAs 9

(stages 37-39; Figure 4 C-D) but increasing and concentrated expression around the primary 10

mouth in the region of the developing mandible and maxilla which correlates with growth of the 11

maxillary processes towards the midline (stages 28-39; Figure 4 A’-D’). These results 12

demonstrate ism1 is expressed in areas critical for craniofacial development in Xenopus laevis 13

embryos. 14

Decreased expression of ism1 in Xenopus laevis results in craniofacial dysmorphologies 15

To determine if knockdown of ism1 expression resulted in craniofacial defects in 16

Xenopus laevis embryos, we injected wildtype embryos with morpholino oligonucleotides (MOs) 17

targeting the translation start site (ism1 ATG MO) or the exon 1 intron 1 splice junction (ism1 18

e1i1 MO). Injecting the embryos at a 4 cell stage with 12ng of the ism1 ATG MO (n=42) 19

resulted in a spectrum of phenotypic abnormalities including a shortened axis (n=10; 23.8%), an 20

upturned tail (n=3; 4.2%), a curved tail (n=5; 6.4%), an abnormal gut (n=20; 47.6%), loss of one 21

or both eyes (n=1; 2.4%), and mouth defects (n=20; 47.6%). These phenotypes were 22

recapitulated with the injection of the ism1 e1i1 MO. Injection of embryos with a control MO 23


failed to produce similar dysmorphologies (n=21), providing evidence that the phenotypes were 1

due to decreased Ism1 activity and not morpholino toxicity. In addition, injection of HA-tagged 2

ism1 mRNA lacking the MO binding site, and thus impervious to the morpholino, rescued the 3

spectrum of phenotypes in the majority of embryos, including the craniofacial abnormalities 4

(Figure 5). An increased dose of 24ng ism1 ATG MO (n=49) resulted in similar yet more 5

penetrant whole embryo (n=36; 73.5%), melanocyte localization (n=39; 79.6%), and craniofacial 6

(n=38; 77.5%) abnormalities, while an even higher dose of 48ng (n=26) resulted in 100% 7

penetrance of the whole embryo abnormalities in addition to a low percentage with no heads 8

altogether (n=9; 34.6%). Intriguingly, we observed at a low penetrance a cleft-like mouth in the 9

embryos injected with 24ng ism1 ATG MO (n=5; 10.2%), which was not present in any embryos 10

injected with the control MO at the same dose (Figure 6 A-B). Whole-mount antibody staining 11

against F-actin (phalloidin) and E-cadherin, were used to further visualize these midline mouth 12

defects (Figure 6 C), which have previously been reported as a cleft-like phenotypes in Xenopus 13

embryos disrupted for retinoic acid signaling (Kennedy and Dickinson 2012). 14

Decreased expression of lhx8 and msx2 in the maxillary and nasal prominences has been 15

reported in retinoic acid deficient embryos (Kennedy and Dickinson 2012). Since human LHX8 16

was previously shown to be associated with human clefting (Yildirim, Kerem et al. 2014), we 17

assessed lhx8 expression in ism1 knockdown stage 30 embryos (Figure 7). Due to the fact that 18

lhx8 is expressed at too low of an overall level to be detected using our current techniques (and 19

that we would need to significantly increase our number of injected embryos (Kennedy and 20

Dickinson 2012)), we instead elected to quantify the relative differences in the lhx8 in situ 21

signals in half embryo knockdowns. Comparison of the ism1 MO knockdown side injected with 22

6ng ATG MO to the control needle prick side resulted in significantly reduced lhx8 expression in 23


the developing maxilla (mean of 1.4 fold reduction; Figure 7 E,F), whereby 12ng ATG MO 1

resulted in an even more significant reduction (average of 2.1 fold reduction, with some embryos 2

showing almost complete absence of lhx8 in the knockdown half). Collectively, these data 3

suggest that Ism1 may either regulate specific subsets of branchial arch signaling networks or 4

affect cellular processes such as cell migration. 5

To further confirm a role for ism1 in craniofacial morphogenesis, we generated intragenic 6

deletions of ism1 in Xenopus using CRISPR/Cas9 in F0 embryos which were confirmed by PCR 7

of dysmorphic embryos followed by Sanger sequencing (Supplemental Figure 1). Notably, all 8

dysmorphic animals harboring ism1 deletions recapitulated the phenotypic spectrum of the ism1 9

MO-depleted embryos including a short axis, curved tail, abnormal gut, aberrant eye 10

development, abnormal melanocyte localization (data not shown), as well as the craniofacial 11

phenotypes, including small or absent mouths (Supplemental Figure 3). The observation of the 12

same range of phenotypes with injection of ATG MO, e1i1 MO or CRISPR/Cas9 mutation of 13

ism1, in addition to the successful rescue of the MO knockdown phenotypes with ism1 mRNA, 14

confirms our results are specifically due to the knockdown of ism1 and not off target effects. 15

16

DISCUSSION 17

Our study describes a successful pipeline from CNV-based disease gene discovery to 18

functional characterization in a vertebrate model system, resulting in the identification of ISM1 19

as a new clefting and craniofacial patterning locus. Importantly, we specifically sought to 20

identify copy number losses that would more likely be of higher effect size in order to identify 21

craniofacial genes playing key roles in facial patterning. We thus focused on deletions that were 22

present in less than 1% of the cohort, were extremely rare or absent in control populations, and 23


altered the coding sequence of genes having high haploinsufficiency scores. This analysis 1

strategy revealed a deletion of ISM1 in a non-syndromic cleft lip and palate case (NSCLP). 2

Intriguingly, we also identified a deletion 3’ of ISM1 that removes a conserved CTCF site just 3

downstream of its polyadenylation site as well as additional sequences of high regulatory 4

potential, although we cannot assess the effect of the 3’ regulatory deletion on ISM1 expression 5

in the developing face and thus are uncertain of its pathogenicity. However, it is important to 6

note that no other non-coding CNVs were identified near our other final clefting candidates. 7

Additionally, Sanger sequencing of ISM1 in a collection of cases with NSCLP from two cohorts 8

relative to controls detected several missense variants, one of which appears to be promising due 9

to its absence in control populations (N188S). 10

Our functional studies in Xenopus laevis revealed that depletion of ism1 results in severe 11

perturbation of craniofacial morphogenesis in animals presumed to have an increased percentage 12

of mutant cells in the developing face, in addition to causing reduced expression of a known 13

clefting locus, lhx8 (Zhao, Guo et al. 1999, Yildirim, Kerem et al. 2014). Additional lines of 14

evidence further strengthen the connection of ISM1 orthologues to craniofacial, and specifically, 15

lip/palate development. First, the midbrain-hindbrain boundary (MHB, also known as the 16

isthmic organizer) is a signaling hub that regulates expression of other signaling molecules in the 17

region, including secreted proteins such as Wnts (Wnt1, Wnt8b) (Joyner, Liu et al. 2000, Rhinn 18

and Brand 2001, Wurst and Bally-Cuif 2001, Raible and Brand 2004), Fibroblast growth factor 19

family members (FGF8, FGF17, FGF18) (McMahon, Joyner et al. 1992, Meyers, Lewandoski et 20

al. 1998, Reifers, Bohli et al. 1998, Picker, Brennan et al. 1999, Belting, Hauptmann et al. 2001, 21

Rhinn and Brand 2001, Burgess, Reim et al. 2002, Reim and Brand 2002, Chi, Martinez et al. 22

2003, Jaszai, Reifers et al. 2003), Spry family members (SPRY1, SPRY2, SPRY4) (Panagiotaki, 23


Dajas-Bailador et al. 2010, Wang and Beck 2014) and Isthmin 1 (Pera, Kim et al. 2002). 1

Signaling from the MHB regulates expression of genes encoding transcription factors including 2

Hox paralogs known to play a key role in neural crest and branchial arch (BA) patterning, and 3

disruptions in their expression patterns lead to craniofacial dysmorphologies including clefting in 4

Xenopus laevis (Irving and Mason 2000, Trainor, Ariza-McNaughton et al. 2002, Kennedy and 5

Dickinson 2012). Thus, signals from the isthmus could help control neural crest cell migration 6

into the BAs and drive the specification (or even migration) of primary BA derivatives which are 7

required for craniofacial development and palate closure (Trainor, Ariza-McNaughton et al. 8

2002). 9

ISM1 is secreted 60 kDa protein, composed of both a thrombospondin type 1 repeat 10

(TSR) domain in the central region, as well as an “adhesion-associated domain in MUC4 and 11

other proteins” (AMOP) domain at the C-terminus (Pera, Kim et al. 2002). The AMOP domain 12

contains an ‘RKD’ motif which is involved in integrin-dependent cell adhesions (Schwartz, 13

Schaller et al. 1995, Maubant, Saint-Dizier et al. 2006, Zhang, Chen et al. 2011), and 14

thrombospondins can mediate cellular attachment (Kosfeld and Frazier 1993). Unlike the 15

traditional RGD motif in the AMOP domain, the RKD motif of ISM1 was demonstrated to 16

selectively bind the extracellular surface of αVβ5 integrins which are involved in vascular 17

permeability and cell migration. Intriguingly, mice that lack two αVβ integrins display cleft 18

palate due to lack of fusion of the palatal shelf (Aluwihare, Mu et al. 2009, Zhang, Chen et al. 19

2011, Venugopal, Chen et al. 2015), suggesting that ISM1 could play a role in promoting or 20

facilitating cell migration through integrin regulation, either from the MHB to the branchial 21

arches or from the branchial arches into the developing face. It is important to point out that 22

ISM1 is a secreted protein, and CCN1/Cyr61 has been identified as a secreted factor which can 23


induce cell migration through interaction with the αVβ3 class of integrins (Maity, Mehta et al. 1

2014), a class which is closely related to αVβ5 (Xiang, Ke et al. 2011). Alternatively, ISM1 may 2

be playing a role in proliferation and/or survival of cranial neural crest cells and/or branchial 3

arch-derived structures. Live imaging of migrating neural crest cells into the arches upon Ism1 4

knockdown will help resolve this issue. 5

ism1 is tightly expressed in a nearly identical pattern to known clefting genes such as fgf8 6

(Riley, Mansilla et al. 2007, Simioni, Araujo et al. 2015), as well as spry1 (Yang, Kilgallen et al. 7

2010, Conte, Oti et al. 2016) and spry2 (Vieira, Avila et al. 2005, Ludwig, Mangold et al. 2012) 8

(both of which cause clefting when altered in mouse models (Goodnough, Brugmann et al. 2007, 9

Yang, Kilgallen et al. 2010)). These genes are thus part of a synexpression group, and genes 10

expressed in highly similar patterns have been shown to work in the same biological process 11

(Niehrs and Pollet 1999, Niehrs and Meinhardt 2002). Importantly, deletion of Fgf8 within the 12

first branchial arch results in incomplete facial development in mice due to partial failure of 13

neural crest cell survival (Trumpp, Depew et al. 1999, Tucker, Al Khamis et al. 1999) whereas 14

hypomorphic alleles lead to abnormal craniofacial development, including hypoplastic 15

pharyngeal arches (Abu-Issa, Smyth et al. 2002). These observations, along with the likelihood 16

that ism1 is a haploinsufficiency locus, strongly implicated ism1 as a key molecule involved in 17

craniofacial development, and this was confirmed with the functional validation studies in frog 18

which show that loss of ism1 can produce dysmorphic faces including a clefting phenotype. 19

Future functional studies, including analysis of FGF and retinoic acid signaling markers as well 20

as identification of ISM1 action, will help reveal the role of ISM1 in this complex process. 21

In our study, the case harboring a heterozygous ISM1 coding deletion presented with cleft 22

lip and palate craniofacial defects (with other family members carrying the deletion exhibiting 23


incomplete penetrance), possibly due to the strong haploinsufficiency score of ISM1. However, 1

we have also presented compelling evidence that ISM1 plays a broad and prominent role in 2

craniofacial development. These data are likely reconciled by the fact that the remaining ISM1 3

allele in unaffected family members carrying the deletion resulted in sufficient ISM1 expression 4

to prevent a clefting phenotype, whereas manipulations using morpholinos and CRISPR/Cas9 in 5

frogs led to a more drastic reduction in Ism1 with little or no wild type Ism1 function to 6

compensate, thus resulting in additional phenotypic abnormalities. It is also possible that 7

hypomorphic variants in additional clefting loci might be contributing to the clefting phenotypes 8

in the affected cases, although we were unable to identify any damaging variants in either of two 9

synexpression group members strongly associated with human clefting (FGF8, SPRY2). 10

11

ACKNOWLEDGEMENTS 12

We thank Amanda Dickinson for thoughtful discussions as well as for generously 13

providing in situ probes, and Jason Dierdorff for technical assistance with the aCGH processing. 14

We are ever grateful to the families who participated in this research and the many nurses, 15

doctors, dentists, speech pathologists and others who provided care both in the US and through 16

Operation Smile in the Philippines. This work was supported by National Institutes of Health 17

grants to JRM (R01DE021071), DWH (R01GM083999), JCM (R37DE-08559), and LAL 18

(T32GM008629). 19

20

REFERENCES 21


Abu-Issa, R., G. Smyth, I. Smoak, K. Yamamura and E. N. Meyers (2002). "Fgf8 is required for 1

pharyngeal arch and cardiovascular development in the mouse." Development 129(19): 2

4613-4625. 3

Aluwihare, P., Z. Mu, Z. Zhao, D. Yu, P. H. Weinreb, G. S. Horan, S. M. Violette and J. S. 4

Munger (2009). "Mice that lack activity of alphavbeta6- and alphavbeta8-integrins 5

reproduce the abnormalities of Tgfb1- and Tgfb3-null mice." J Cell Sci 122(Pt 2): 227-6

232. 7

Bassuk, A. G., L. B. Muthuswamy, R. Boland, T. L. Smith, A. M. Hulstrand, H. Northrup, M. 8

Hakeman, J. M. Dierdorff, C. K. Yung, A. Long, R. B. Brouillette, K. S. Au, C. Gurnett, 9

D. W. Houston, R. A. Cornell and J. R. Manak (2013). "Copy number variation analysis 10

implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene." 11

Hum Mol Genet 22(6): 1097-1111. 12

Belting, H. G., G. Hauptmann, D. Meyer, S. Abdelilah-Seyfried, A. Chitnis, C. Eschbach, I. Soll, 13

C. Thisse, B. Thisse, K. B. Artinger, K. Lunde and W. Driever (2001). "spiel ohne 14

grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain 15

boundary organizer." Development 128(21): 4165-4176. 16

Brophy, P. D., F. Alasti, B. W. Darbro, J. Clarke, C. Nishimura, B. Cobb, R. J. Smith and J. R. 17

Manak (2013). "Genome-wide copy number variation analysis of a Branchio-oto-renal 18

syndrome cohort identifies a recombination hotspot and implicates new candidate genes." 19

Hum Genet 132(12): 1339-1350. 20

Burgess, S., G. Reim, W. Chen, N. Hopkins and M. Brand (2002). "The zebrafish spiel-ohne-21

grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 22


and is essential for formation of the midbrain and hindbrain, and for pre-gastrula 1

morphogenesis." Development 129(4): 905-916. 2

Cai, Y., K. E. Patterson, F. Reinier, S. E. Keesecker, E. Blue, M. Bamshad and J. Haddad, Jr. 3

(2017). "Copy Number Changes Identified Using Whole Exome Sequencing in 4

Nonsyndromic Cleft Lip and Palate in a Honduran Population." Birth Defects Res 5

109(16): 1257-1267. 6

Cao, Y., Z. Li, J. A. Rosenfeld, A. N. Pursley, A. Patel, J. Huang, H. Wang, M. Chen, X. Sun, T. 7

Y. Leung, S. W. Cheung and K. W. Choy (2016). "Contribution of genomic copy-number 8

variations in prenatal oral clefts: a multicenter cohort study." Genet Med 18(10): 1052-9

1055. 10

Carta, E., E. Pauws, A. C. Thomas, K. Mengrelis, G. E. Moore, M. Lees and P. Stanier (2012). 11

"Investigation of SUMO pathway genes in the etiology of nonsyndromic cleft lip with or 12

without cleft palate." Birth Defects Res A Clin Mol Teratol 94(6): 459-463. 13

Chen, J., L. A. Jacox, F. Saldanha and H. Sive (2017). "Mouth development." Wiley Interdiscip 14

Rev Dev Biol 6(5). 15

Chi, C. L., S. Martinez, W. Wurst and G. R. Martin (2003). "The isthmic organizer signal FGF8 16

is required for cell survival in the prospective midbrain and cerebellum." Development 17

130(12): 2633-2644. 18

Christen, B. and J. M. Slack (1997). "FGF-8 is associated with anteroposterior patterning and 19

limb regeneration in Xenopus." Dev Biol 192(2): 455-466. 20

Conte, F., M. Oti, J. Dixon, C. E. Carels, M. Rubini and H. Zhou (2016). "Systematic analysis of 21

copy number variants of a large cohort of orofacial cleft patients identifies candidate 22

genes for orofacial clefts." Hum Genet 135(1): 41-59. 23


Dickinson, A. J. (2016). "Using frogs faces to dissect the mechanisms underlying human 1

orofacial defects." Semin Cell Dev Biol 51: 54-63. 2

Dickinson, A. J. and H. Sive (2006). "Development of the primary mouth in Xenopus laevis." 3

Dev Biol 295(2): 700-713. 4

Dubey, A. and J. P. Saint-Jeannet (2017). "Modeling human craniofacial disorders in Xenopus." 5

Curr Pathobiol Rep 5(1): 79-92. 6

Ensenauer, R. E., A. Adeyinka, H. C. Flynn, V. V. Michels, N. M. Lindor, D. B. Dawson, E. C. 7

Thorland, C. P. Lorentz, J. L. Goldstein, M. T. McDonald, W. E. Smith, E. Simon-8

Fayard, A. A. Alexander, A. S. Kulharya, R. P. Ketterling, R. D. Clark and S. M. Jalal 9

(2003). "Microduplication 22q11.2, an emerging syndrome: clinical, cytogenetic, and 10

molecular analysis of thirteen patients." Am J Hum Genet 73(5): 1027-1040. 11

EVS Exome Variant Server, NHLBI GO Exome Sequencing Project (ESP),Seattle, WA. 12

Frebourg, T., C. Oliveira, P. Hochain, R. Karam, S. Manouvrier, C. Graziadio, M. Vekemans, A. 13

Hartmann, S. Baert-Desurmont, C. Alexandre, S. Lejeune Dumoulin, C. Marroni, C. 14

Martin, S. Castedo, M. Lovett, J. Winston, J. C. Machado, T. Attie, E. W. Jabs, J. Cai, P. 15

Pellerin, J. P. Triboulet, M. Scotte, F. Le Pessot, A. Hedouin, F. Carneiro, M. Blayau and 16

R. Seruca (2006). "Cleft lip/palate and CDH1/E-cadherin mutations in families with 17

hereditary diffuse gastric cancer." J Med Genet 43(2): 138-142. 18

Fuchs, A., A. Inthal, D. Herrmann, S. Cheng, M. Nakatomi, H. Peters and A. Neubuser (2010). 19

"Regulation of Tbx22 during facial and palatal development." Dev Dyn 239(11): 2860-20

2874. 21

Genisca, A. E., J. L. Frias, C. S. Broussard, M. A. Honein, E. J. Lammer, C. A. Moore, G. M. 22

Shaw, J. C. Murray, W. Yang, S. A. Rasmussen and S. National Birth Defects Prevention 23


(2009). "Orofacial clefts in the National Birth Defects Prevention Study, 1997-2004." Am 1

J Med Genet A 149A(6): 1149-1158. 2

Genomes Project, C., G. R. Abecasis, A. Auton, L. D. Brooks, M. A. DePristo, R. M. Durbin, R. 3

E. Handsaker, H. M. Kang, G. T. Marth and G. A. McVean (2012). "An integrated map 4

of genetic variation from 1,092 human genomes." Nature 491(7422): 56-65. 5

Girirajan, S., J. A. Rosenfeld, G. M. Cooper, F. Antonacci, P. Siswara, A. Itsara, L. Vives, T. 6

Walsh, S. E. McCarthy, C. Baker, H. C. Mefford, J. M. Kidd, S. R. Browning, B. L. 7

Browning, D. E. Dickel, D. L. Levy, B. C. Ballif, K. Platky, D. M. Farber, G. C. Gowans, 8

J. J. Wetherbee, A. Asamoah, D. D. Weaver, P. R. Mark, J. Dickerson, B. P. Garg, S. A. 9

Ellingwood, R. Smith, V. C. Banks, W. Smith, M. T. McDonald, J. J. Hoo, B. N. French, 10

C. Hudson, J. P. Johnson, J. R. Ozmore, J. B. Moeschler, U. Surti, L. F. Escobar, D. El-11

Khechen, J. L. Gorski, J. Kussmann, B. Salbert, Y. Lacassie, A. Biser, D. M. McDonald-12

McGinn, E. H. Zackai, M. A. Deardorff, T. H. Shaikh, E. Haan, K. L. Friend, M. Fichera, 13

C. Romano, J. Gecz, L. E. DeLisi, J. Sebat, M. C. King, L. G. Shaffer and E. E. Eichler 14

(2010). "A recurrent 16p12.1 microdeletion supports a two-hit model for severe 15

developmental delay." Nat Genet 42(3): 203-209. 16

Glessner, J. T., K. Wang, G. Cai, O. Korvatska, C. E. Kim, S. Wood, H. Zhang, A. Estes, C. W. 17

Brune, J. P. Bradfield, M. Imielinski, E. C. Frackelton, J. Reichert, E. L. Crawford, J. 18

Munson, P. M. Sleiman, R. Chiavacci, K. Annaiah, K. Thomas, C. Hou, W. Glaberson, J. 19

Flory, F. Otieno, M. Garris, L. Soorya, L. Klei, J. Piven, K. J. Meyer, E. Anagnostou, T. 20

Sakurai, R. M. Game, D. S. Rudd, D. Zurawiecki, C. J. McDougle, L. K. Davis, J. Miller, 21

D. J. Posey, S. Michaels, A. Kolevzon, J. M. Silverman, R. Bernier, S. E. Levy, R. T. 22

Schultz, G. Dawson, T. Owley, W. M. McMahon, T. H. Wassink, J. A. Sweeney, J. I. 23


Nurnberger, H. Coon, J. S. Sutcliffe, N. J. Minshew, S. F. Grant, M. Bucan, E. H. Cook, 1

J. D. Buxbaum, B. Devlin, G. D. Schellenberg and H. Hakonarson (2009). "Autism 2

genome-wide copy number variation reveals ubiquitin and neuronal genes." Nature 3

459(7246): 569-573. 4

Goodnough, L. H., S. A. Brugmann, D. Hu and J. A. Helms (2007). "Stage-dependent 5

craniofacial defects resulting from Sprouty2 overexpression." Dev Dyn 236(7): 1918-6

1928. 7

Goudy, S., A. Law, G. Sanchez, H. S. Baldwin and C. Brown (2010). "Tbx1 is necessary for 8

palatal elongation and elevation." Mech Dev 127(5-6): 292-300. 9

Green, R. M., W. Feng, T. Phang, J. L. Fish, H. Li, R. A. Spritz, R. S. Marcucio, J. Hooper, H. 10

Jamniczky, B. Hallgrimsson and T. Williams (2015). "Tfap2a-dependent changes in 11

mouse facial morphology result in clefting that can be ameliorated by a reduction in Fgf8 12

gene dosage." Dis Model Mech 8(1): 31-43. 13

Greenway, S. C., A. C. Pereira, J. C. Lin, S. R. DePalma, S. J. Israel, S. M. Mesquita, E. Ergul, J. 14

H. Conta, J. M. Korn, S. A. McCarroll, J. M. Gorham, S. Gabriel, D. M. Altshuler, L. 15

Quintanilla-Dieck Mde, M. A. Artunduaga, R. D. Eavey, R. M. Plenge, N. A. Shadick, 16

M. E. Weinblatt, P. L. De Jager, D. A. Hafler, R. E. Breitbart, J. G. Seidman and C. E. 17

Seidman (2009). "De novo copy number variants identify new genes and loci in isolated 18

sporadic tetralogy of Fallot." Nat Genet 41(8): 931-935. 19

Huang, N., I. Lee, E. M. Marcotte and M. E. Hurles (2010). "Characterising and predicting 20

haploinsufficiency in the human genome." PLoS Genet 6(10): e1001154. 21

Hulstrand, A. M. and D. W. Houston (2013). "Regulation of neurogenesis by Fgf8a requires 22

Cdc42 signaling and a novel Cdc42 effector protein." Dev Biol 382(2): 385-399. 23


Irving, C. and I. Mason (2000). "Signalling by FGF8 from the isthmus patterns anterior 1

hindbrain and establishes the anterior limit of Hox gene expression." Development 2

127(1): 177-186. 3

Jacox, L., J. Chen, A. Rothman, H. Lathrop-Marshall and H. Sive (2016). "Formation of a "Pre-4

mouth Array" from the Extreme Anterior Domain Is Directed by Neural Crest and 5

Wnt/PCP Signaling." Cell Rep 16(5): 1445-1455. 6

Jacox, L., R. Sindelka, J. Chen, A. Rothman, A. Dickinson and H. Sive (2014). "The extreme 7

anterior domain is an essential craniofacial organizer acting through Kinin-Kallikrein 8

signaling." Cell Rep 8(2): 596-609. 9

Jaszai, J., F. Reifers, A. Picker, T. Langenberg and M. Brand (2003). "Isthmus-to-midbrain 10

transformation in the absence of midbrain-hindbrain organizer activity." Development 11

130(26): 6611-6623. 12

Joyner, A. L., A. Liu and S. Millet (2000). "Otx2, Gbx2 and Fgf8 interact to position and 13

maintain a mid-hindbrain organizer." Curr Opin Cell Biol 12(6): 736-741. 14

Kaiser, J. (2012). "Human genetics. Genetic influences on disease remain hidden." Science 15

338(6110): 1016-1017. 16

Kennedy, A. E. and A. J. Dickinson (2012). "Median facial clefts in Xenopus laevis: roles of 17

retinoic acid signaling and homeobox genes." Dev Biol 365(1): 229-240. 18

Klamt, J., A. Hofmann, A. C. Bohmer, A. K. Hoebel, L. Golz, J. Becker, A. M. Zink, M. 19

Draaken, A. Hemprich, M. Scheer, G. Schmidt, M. Martini, M. Knapp, E. Mangold, F. 20

Degenhardt and K. U. Ludwig (2016). "Further evidence for deletions in 7p14.1 21

contributing to nonsyndromic cleft lip with or without cleft palate." Birth Defects Res A 22

Clin Mol Teratol 106(9): 767-772. 23


Kosfeld, M. D. and W. A. Frazier (1993). "Identification of a new cell adhesion motif in two 1

homologous peptides from the COOH-terminal cell binding domain of human 2

thrombospondin." J Biol Chem 268(12): 8808-8814. 3

Leslie, E. J. and M. L. Marazita (2013). "Genetics of cleft lip and cleft palate." Am J Med Genet 4

C Semin Med Genet 163C(4): 246-258. 5

Liu, X., C. Wu, C. Li and E. Boerwinkle (2016). "dbNSFP v3.0: A One-Stop Database of 6

Functional Predictions and Annotations for Human Nonsynonymous and Splice-Site 7

SNVs." Hum Mutat 37(3): 235-241. 8

Lu, W., C. A. Bacino, B. S. Richards, C. Alvarez, J. E. VanderMeer, M. Vella, N. Ahituv, N. 9

Sikka, F. R. Dietz, S. H. Blanton and J. T. Hecht (2012). "Studies of TBX4 and 10

chromosome 17q23.1q23.2: an uncommon cause of nonsyndromic clubfoot." Am J Med 11

Genet A 158A(7): 1620-1627. 12

Ludwig, K. U., E. Mangold, S. Herms, S. Nowak, H. Reutter, A. Paul, J. Becker, R. Herberz, T. 13

AlChawa, E. Nasser, A. C. Bohmer, M. Mattheisen, M. A. Alblas, S. Barth, N. Kluck, C. 14

Lauster, B. Braumann, R. H. Reich, A. Hemprich, S. Potzsch, B. Blaumeiser, N. 15

Daratsianos, T. Kreusch, J. C. Murray, M. L. Marazita, I. Ruczinski, A. F. Scott, T. H. 16

Beaty, F. J. Kramer, T. F. Wienker, R. P. Steegers-Theunissen, M. Rubini, P. A. Mossey, 17

P. Hoffmann, C. Lange, S. Cichon, P. Propping, M. Knapp and M. M. Nothen (2012). 18

"Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate 19

identify six new risk loci." Nat Genet 44(9): 968-971. 20

Maity, G., S. Mehta, I. Haque, K. Dhar, S. Sarkar, S. K. Banerjee and S. Banerjee (2014). 21

"Pancreatic tumor cell secreted CCN1/Cyr61 promotes endothelial cell migration and 22

aberrant neovascularization." Sci Rep 4: 4995. 23


Mangold, E., K. U. Ludwig, S. Birnbaum, C. Baluardo, M. Ferrian, S. Herms, H. Reutter, N. A. 1

de Assis, T. A. Chawa, M. Mattheisen, M. Steffens, S. Barth, N. Kluck, A. Paul, J. 2

Becker, C. Lauster, G. Schmidt, B. Braumann, M. Scheer, R. H. Reich, A. Hemprich, S. 3

Potzsch, B. Blaumeiser, S. Moebus, M. Krawczak, S. Schreiber, T. Meitinger, H. E. 4

Wichmann, R. P. Steegers-Theunissen, F. J. Kramer, S. Cichon, P. Propping, T. F. 5

Wienker, M. Knapp, M. Rubini, P. A. Mossey, P. Hoffmann and M. M. Nothen (2010). 6

"Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft 7

lip with or without cleft palate." Nat Genet 42(1): 24-26. 8

Marshall, C. R., D. P. Howrigan, D. Merico, B. Thiruvahindrapuram, W. Wu, D. S. Greer, D. 9

Antaki, A. Shetty, P. A. Holmans, D. Pinto, M. Gujral, W. M. Brandler, D. Malhotra, Z. 10

Wang, K. V. F. Fajarado, M. S. Maile, S. Ripke, I. Agartz, M. Albus, M. Alexander, F. 11

Amin, J. Atkins, S. A. Bacanu, R. A. Belliveau, Jr., S. E. Bergen, M. Bertalan, E. 12

Bevilacqua, T. B. Bigdeli, D. W. Black, R. Bruggeman, N. G. Buccola, R. L. Buckner, B. 13

Bulik-Sullivan, W. Byerley, W. Cahn, G. Cai, M. J. Cairns, D. Campion, R. M. Cantor, 14

V. J. Carr, N. Carrera, S. V. Catts, K. D. Chambert, W. Cheng, C. R. Cloninger, D. 15

Cohen, P. Cormican, N. Craddock, B. Crespo-Facorro, J. J. Crowley, D. Curtis, M. 16

Davidson, K. L. Davis, F. Degenhardt, J. Del Favero, L. E. DeLisi, D. Dikeos, T. Dinan, 17

S. Djurovic, G. Donohoe, E. Drapeau, J. Duan, F. Dudbridge, P. Eichhammer, J. 18

Eriksson, V. Escott-Price, L. Essioux, A. H. Fanous, K. H. Farh, M. S. Farrell, J. Frank, 19

L. Franke, R. Freedman, N. B. Freimer, J. I. Friedman, A. J. Forstner, M. Fromer, G. 20

Genovese, L. Georgieva, E. S. Gershon, I. Giegling, P. Giusti-Rodriguez, S. Godard, J. I. 21

Goldstein, J. Gratten, L. de Haan, M. L. Hamshere, M. Hansen, T. Hansen, V. 22

Haroutunian, A. M. Hartmann, F. A. Henskens, S. Herms, J. N. Hirschhorn, P. 23


Hoffmann, A. Hofman, H. Huang, M. Ikeda, I. Joa, A. K. Kahler, R. S. Kahn, L. 1

Kalaydjieva, J. Karjalainen, D. Kavanagh, M. C. Keller, B. J. Kelly, J. L. Kennedy, Y. 2

Kim, J. A. Knowles, B. Konte, C. Laurent, P. Lee, S. H. Lee, S. E. Legge, B. Lerer, D. L. 3

Levy, K. Y. Liang, J. Lieberman, J. Lonnqvist, C. M. Loughland, P. K. E. Magnusson, B. 4

S. Maher, W. Maier, J. Mallet, M. Mattheisen, M. Mattingsdal, R. W. McCarley, C. 5

McDonald, A. M. McIntosh, S. Meier, C. J. Meijer, I. Melle, R. I. Mesholam-Gately, A. 6

Metspalu, P. T. Michie, L. Milani, V. Milanova, Y. Mokrab, D. W. Morris, B. Muller-7

Myhsok, K. C. Murphy, R. M. Murray, I. Myin-Germeys, I. Nenadic, D. A. Nertney, G. 8

Nestadt, K. K. Nicodemus, L. Nisenbaum, A. Nordin, E. O'Callaghan, C. O'Dushlaine, S. 9

Y. Oh, A. Olincy, L. Olsen, F. A. O'Neill, J. Van Os, C. Pantelis, G. N. Papadimitriou, E. 10

Parkhomenko, M. T. Pato, T. Paunio, C. Psychosis Endophenotypes International, D. O. 11

Perkins, T. H. Pers, O. Pietilainen, J. Pimm, A. J. Pocklington, J. Powell, A. Price, A. E. 12

Pulver, S. M. Purcell, D. Quested, H. B. Rasmussen, A. Reichenberg, M. A. Reimers, A. 13

L. Richards, J. L. Roffman, P. Roussos, D. M. Ruderfer, V. Salomaa, A. R. Sanders, A. 14

Savitz, U. Schall, T. G. Schulze, S. G. Schwab, E. M. Scolnick, R. J. Scott, L. J. 15

Seidman, J. Shi, J. M. Silverman, J. W. Smoller, E. Soderman, C. C. A. Spencer, E. A. 16

Stahl, E. Strengman, J. Strohmaier, T. S. Stroup, J. Suvisaari, D. M. Svrakic, J. P. 17

Szatkiewicz, S. Thirumalai, P. A. Tooney, J. Veijola, P. M. Visscher, J. Waddington, D. 18

Walsh, B. T. Webb, M. Weiser, D. B. Wildenauer, N. M. Williams, S. Williams, S. H. 19

Witt, A. R. Wolen, B. K. Wormley, N. R. Wray, J. Q. Wu, C. C. Zai, R. Adolfsson, O. A. 20

Andreassen, D. H. R. Blackwood, E. Bramon, J. D. Buxbaum, S. Cichon, D. A. Collier, 21

A. Corvin, M. J. Daly, A. Darvasi, E. Domenici, T. Esko, P. V. Gejman, M. Gill, H. 22

Gurling, C. M. Hultman, N. Iwata, A. V. Jablensky, E. G. Jonsson, K. S. Kendler, G. 23


Kirov, J. Knight, D. F. Levinson, Q. S. Li, S. A. McCarroll, A. McQuillin, J. L. Moran, 1

B. J. Mowry, M. M. Nothen, R. A. Ophoff, M. J. Owen, A. Palotie, C. N. Pato, T. L. 2

Petryshen, D. Posthuma, M. Rietschel, B. P. Riley, D. Rujescu, P. Sklar, D. St Clair, J. T. 3

R. Walters, T. Werge, P. F. Sullivan, M. C. O'Donovan, S. W. Scherer, B. M. Neale, J. 4

Sebat, Cnv and C. Schizophrenia Working Groups of the Psychiatric Genomics (2017). 5

"Contribution of copy number variants to schizophrenia from a genome-wide study of 6

41,321 subjects." Nat Genet 49(1): 27-35. 7

Maubant, S., D. Saint-Dizier, M. Boutillon, F. Perron-Sierra, P. J. Casara, J. A. Hickman, G. C. 8

Tucker and E. Van Obberghen-Schilling (2006). "Blockade of alpha v beta3 and alpha v 9

beta5 integrins by RGD mimetics induces anoikis and not integrin-mediated death in 10

human endothelial cells." Blood 108(9): 3035-3044. 11

McMahon, A. P., A. L. Joyner, A. Bradley and J. A. McMahon (1992). "The midbrain-hindbrain 12

phenotype of Wnt-1-/Wnt-1- mice results from stepwise deletion of engrailed-expressing 13

cells by 9.5 days postcoitum." Cell 69(4): 581-595. 14

Mefford, H. C., G. M. Cooper, T. Zerr, J. D. Smith, C. Baker, N. Shafer, E. C. Thorland, C. 15

Skinner, C. E. Schwartz, D. A. Nickerson and E. E. Eichler (2009). "A method for rapid, 16

targeted CNV genotyping identifies rare variants associated with neurocognitive disease." 17

Genome Res 19(9): 1579-1585. 18

Mefford, H. C. and E. E. Eichler (2009). "Duplication hotspots, rare genomic disorders, and 19

common disease." Curr Opin Genet Dev 19(3): 196-204. 20

Mefford, H. C., A. J. Sharp, C. Baker, A. Itsara, Z. Jiang, K. Buysse, S. Huang, V. K. Maloney, 21

J. A. Crolla, D. Baralle, A. Collins, C. Mercer, K. Norga, T. de Ravel, K. Devriendt, E. 22

M. Bongers, N. de Leeuw, W. Reardon, S. Gimelli, F. Bena, R. C. Hennekam, A. Male, 23


L. Gaunt, J. Clayton-Smith, I. Simonic, S. M. Park, S. G. Mehta, S. Nik-Zainal, C. G. 1

Woods, H. V. Firth, G. Parkin, M. Fichera, S. Reitano, M. Lo Giudice, K. E. Li, I. 2

Casuga, A. Broomer, B. Conrad, M. Schwerzmann, L. Raber, S. Gallati, P. Striano, A. 3

Coppola, J. L. Tolmie, E. S. Tobias, C. Lilley, L. Armengol, Y. Spysschaert, P. Verloo, 4

A. De Coene, L. Goossens, G. Mortier, F. Speleman, E. van Binsbergen, M. R. Nelen, R. 5

Hochstenbach, M. Poot, L. Gallagher, M. Gill, J. McClellan, M. C. King, R. Regan, C. 6

Skinner, R. E. Stevenson, S. E. Antonarakis, C. Chen, X. Estivill, B. Menten, G. Gimelli, 7

S. Gribble, S. Schwartz, J. S. Sutcliffe, T. Walsh, S. J. Knight, J. Sebat, C. Romano, C. E. 8

Schwartz, J. A. Veltman, B. B. de Vries, J. R. Vermeesch, J. C. Barber, L. Willatt, M. 9

Tassabehji and E. E. Eichler (2008). "Recurrent rearrangements of chromosome 1q21.1 10

and variable pediatric phenotypes." N Engl J Med 359(16): 1685-1699. 11

Meyers, E. N., M. Lewandoski and G. R. Martin (1998). "An Fgf8 mutant allelic series generated 12

by Cre- and Flp-mediated recombination." Nat Genet 18(2): 136-141. 13

Murray, J. C., S. Daack-Hirsch, K. H. Buetow, R. Munger, L. Espina, N. Paglinawan, E. 14

Villanueva, J. Rary, K. Magee and W. Magee (1997). "Clinical and epidemiologic studies 15

of cleft lip and palate in the Philippines." Cleft Palate Craniofac J 34(1): 7-10. 16

Niehrs, C. and H. Meinhardt (2002). "Modular feedback." Nature 417(6884): 35-36. 17

Niehrs, C. and N. Pollet (1999). "Synexpression groups in eukaryotes." Nature 402(6761): 483-18

487. 19

Osoegawa, K., G. M. Vessere, K. H. Utami, M. A. Mansilla, M. K. Johnson, B. M. Riley, J. 20

L'Heureux, R. Pfundt, J. Staaf, W. A. van der Vliet, A. C. Lidral, E. F. Schoenmakers, A. 21

Borg, B. C. Schutte, E. J. Lammer, J. C. Murray and P. J. de Jong (2008). "Identification 22


of novel candidate genes associated with cleft lip and palate using array comparative 1

genomic hybridisation." J Med Genet 45(2): 81-86. 2

Osorio, L., X. Wu and Z. Zhou (2014). "Distinct spatiotemporal expression of ISM1 during 3

mouse and chick development." Cell Cycle 13(10): 1571-1582. 4

Panagiotaki, N., F. Dajas-Bailador, E. Amaya, N. Papalopulu and K. Dorey (2010). 5

"Characterisation of a new regulator of BDNF signalling, Sprouty3, involved in axonal 6

morphogenesis in vivo." Development 137(23): 4005-4015. 7

Pera, E. M., J. I. Kim, S. L. Martinez, M. Brechner, S. Y. Li, O. Wessely and E. M. De Robertis 8

(2002). "Isthmin is a novel secreted protein expressed as part of the Fgf-8 synexpression 9

group in the Xenopus midbrain-hindbrain organizer." Mech Dev 116(1-2): 169-172. 10

Petrovski, S., Q. Wang, E. L. Heinzen, A. S. Allen and D. B. Goldstein (2013). "Genic 11

intolerance to functional variation and the interpretation of personal genomes." PLoS 12

Genet 9(8): e1003709. 13

Picker, A., C. Brennan, F. Reifers, J. D. Clarke, N. Holder and M. Brand (1999). "Requirement 14

for the zebrafish mid-hindbrain boundary in midbrain polarisation, mapping and 15

confinement of the retinotectal projection." Development 126(13): 2967-2978. 16

Raible, F. and M. Brand (2004). "Divide et Impera--the midbrain-hindbrain boundary and its 17

organizer." Trends Neurosci 27(12): 727-734. 18

Reifers, F., H. Bohli, E. C. Walsh, P. H. Crossley, D. Y. Stainier and M. Brand (1998). "Fgf8 is 19

mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of 20

midbrain-hindbrain boundary development and somitogenesis." Development 125(13): 21

2381-2395. 22


Reim, G. and M. Brand (2002). "Spiel-ohne-grenzen/pou2 mediates regional competence to 1

respond to Fgf8 during zebrafish early neural development." Development 129(4): 917-2

933. 3

Rhinn, M. and M. Brand (2001). "The midbrain--hindbrain boundary organizer." Curr Opin 4

Neurobiol 11(1): 34-42. 5

Riley, B. M., M. A. Mansilla, J. Ma, S. Daack-Hirsch, B. S. Maher, L. M. Raffensperger, E. T. 6

Russo, A. R. Vieira, C. Dode, M. Mohammadi, M. L. Marazita and J. C. Murray (2007). 7

"Impaired FGF signaling contributes to cleft lip and palate." Proc Natl Acad Sci U S A 8

104(11): 4512-4517. 9

RK, C. Y., D. Merico, M. Bookman, L. H. J, B. Thiruvahindrapuram, R. V. Patel, J. Whitney, N. 10

Deflaux, J. Bingham, Z. Wang, G. Pellecchia, J. A. Buchanan, S. Walker, C. R. Marshall, 11

M. Uddin, M. Zarrei, E. Deneault, L. D'Abate, A. J. Chan, S. Koyanagi, T. Paton, S. L. 12

Pereira, N. Hoang, W. Engchuan, E. J. Higginbotham, K. Ho, S. Lamoureux, W. Li, J. R. 13

MacDonald, T. Nalpathamkalam, W. W. Sung, F. J. Tsoi, J. Wei, L. Xu, A. M. Tasse, E. 14

Kirby, W. Van Etten, S. Twigger, W. Roberts, I. Drmic, S. Jilderda, B. M. Modi, B. 15

Kellam, M. Szego, C. Cytrynbaum, R. Weksberg, L. Zwaigenbaum, M. Woodbury-16

Smith, J. Brian, L. Senman, A. Iaboni, K. Doyle-Thomas, A. Thompson, C. Chrysler, J. 17

Leef, T. Savion-Lemieux, I. M. Smith, X. Liu, R. Nicolson, V. Seifer, A. Fedele, E. H. 18

Cook, S. Dager, A. Estes, L. Gallagher, B. A. Malow, J. R. Parr, S. J. Spence, J. 19

Vorstman, B. J. Frey, J. T. Robinson, L. J. Strug, B. A. Fernandez, M. Elsabbagh, M. T. 20

Carter, J. Hallmayer, B. M. Knoppers, E. Anagnostou, P. Szatmari, R. H. Ring, D. 21

Glazer, M. T. Pletcher and S. W. Scherer (2017). "Whole genome sequencing resource 22


identifies 18 new candidate genes for autism spectrum disorder." Nat Neurosci 20(4): 1

602-611. 2

Rosenfeld, J. A., B. C. Ballif, B. S. Torchia, T. Sahoo, J. B. Ravnan, R. Schultz, A. Lamb, B. A. 3

Bejjani and L. G. Shaffer (2010). "Copy number variations associated with autism 4

spectrum disorders contribute to a spectrum of neurodevelopmental disorders." Genetics 5

in Medicine 12(11): 694-702. 6

Rosenfeld, J. A., B. P. Coe, E. E. Eichler, H. Cuckle and L. G. Shaffer (2013). "Estimates of 7

penetrance for recurrent pathogenic copy-number variations." Genet Med 15(6): 478-481. 8

Rozen, S. and H. Skaletsky (2000). "Primer3 on the WWW for general users and for biologist 9

programmers." Methods Mol Biol 132: 365-386. 10

Ruderfer, D. M., T. Hamamsy, M. Lek, K. J. Karczewski, D. Kavanagh, K. E. Samocha, C. 11

Exome Aggregation, M. J. Daly, D. G. MacArthur, M. Fromer and S. M. Purcell (2016). 12

"Patterns of genic intolerance of rare copy number variation in 59,898 human exomes." 13

Nat Genet 48(10): 1107-1111. 14

Schwartz, M. A., M. D. Schaller and M. H. Ginsberg (1995). "Integrins: emerging paradigms of 15

signal transduction." Annu Rev Cell Dev Biol 11: 549-599. 16

Session, A. M., Y. Uno, T. Kwon, J. A. Chapman, A. Toyoda, S. Takahashi, A. Fukui, A. 17

Hikosaka, A. Suzuki, M. Kondo, S. J. van Heeringen, I. Quigley, S. Heinz, H. Ogino, H. 18

Ochi, U. Hellsten, J. B. Lyons, O. Simakov, N. Putnam, J. Stites, Y. Kuroki, T. Tanaka, 19

T. Michiue, M. Watanabe, O. Bogdanovic, R. Lister, G. Georgiou, S. S. Paranjpe, I. van 20

Kruijsbergen, S. Shu, J. Carlson, T. Kinoshita, Y. Ohta, S. Mawaribuchi, J. Jenkins, J. 21

Grimwood, J. Schmutz, T. Mitros, S. V. Mozaffari, Y. Suzuki, Y. Haramoto, T. S. 22

Yamamoto, C. Takagi, R. Heald, K. Miller, C. Haudenschild, J. Kitzman, T. Nakayama, 23


Y. Izutsu, J. Robert, J. Fortriede, K. Burns, V. Lotay, K. Karimi, Y. Yasuoka, D. S. 1

Dichmann, M. F. Flajnik, D. W. Houston, J. Shendure, L. DuPasquier, P. D. Vize, A. M. 2

Zorn, M. Ito, E. M. Marcotte, J. B. Wallingford, Y. Ito, M. Asashima, N. Ueno, Y. 3

Matsuda, G. J. Veenstra, A. Fujiyama, R. M. Harland, M. Taira and D. S. Rokhsar 4

(2016). "Genome evolution in the allotetraploid frog Xenopus laevis." Nature 538(7625): 5

336-343. 6

Shi, M., A. Mostowska, A. Jugessur, M. K. Johnson, M. A. Mansilla, K. Christensen, R. T. Lie, 7

A. J. Wilcox and J. C. Murray (2009). "Identification of microdeletions in candidate 8

genes for cleft lip and/or palate." Birth Defects Res A Clin Mol Teratol 85(1): 42-51. 9

Shimomura, T., M. Kawakami, H. Okuda, K. Tatsumi, S. Morita, K. Nochioka, T. Kirita and A. 10

Wanaka (2015). "Retinoic acid regulates Lhx8 expression via FGF-8b to the upper jaw 11

development of chick embryo." J Biosci Bioeng 119(3): 260-266. 12

Simioni, M., T. K. Araujo, I. L. Monlleo, C. V. Maurer-Morelli and V. L. Gil-da-Silva-Lopes 13

(2015). "Investigation of genetic factors underlying typical orofacial clefts: mutational 14

screening and copy number variation." J Hum Genet 60(1): 17-25. 15

Tan, G. S., K. H. Lim, H. T. Tan, M. L. Khoo, S. H. Tan, H. C. Toh and M. Ching Ming Chung 16

(2014). "Novel proteomic biomarker panel for prediction of aggressive metastatic 17

hepatocellular carcinoma relapse in surgically resectable patients." J Proteome Res 18

13(11): 4833-4846. 19

Thomason, H. A., M. J. Dixon and J. Dixon (2008). "Facial clefting in Tp63 deficient mice 20

results from altered Bmp4, Fgf8 and Shh signaling." Dev Biol 321(1): 273-282. 21


Trainor, P. A., L. Ariza-McNaughton and R. Krumlauf (2002). "Role of the isthmus and FGFs in 1

resolving the paradox of neural crest plasticity and prepatterning." Science 295(5558): 2

1288-1291. 3

Trumpp, A., M. J. Depew, J. L. Rubenstein, J. M. Bishop and G. R. Martin (1999). "Cre-4

mediated gene inactivation demonstrates that FGF8 is required for cell survival and 5

patterning of the first branchial arch." Genes Dev 13(23): 3136-3148. 6

Tucker, A. S., A. Al Khamis, C. A. Ferguson, I. Bach, M. G. Rosenfeld and P. T. Sharpe (1999). 7

"Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb 8

development." Development 126(2): 221-228. 9

Twigg, S. R. and A. O. Wilkie (2015). "New insights into craniofacial malformations." Hum Mol 10

Genet 24(R1): R50-59. 11

Uddin, M., B. Thiruvahindrapuram, S. Walker, Z. Wang, P. Hu, S. Lamoureux, J. Wei, J. R. 12

MacDonald, G. Pellecchia, C. Lu, A. C. Lionel, M. J. Gazzellone, J. R. McLaughlin, C. 13

Brown, I. L. Andrulis, J. A. Knight, J. A. Herbrick, R. F. Wintle, P. Ray, D. J. 14

Stavropoulos, C. R. Marshall and S. W. Scherer (2015). "A high-resolution copy-number 15

variation resource for clinical and population genetics." Genet Med 17(9): 747-752. 16

Valle-Rios, R., J. L. Maravillas-Montero, A. M. Burkhardt, C. Martinez, B. A. Buhren, B. 17

Homey, P. A. Gerber, O. Robinson, P. Hevezi and A. Zlotnik (2014). "Isthmin 1 is a 18

secreted protein expressed in skin, mucosal tissues, and NK, NKT, and th17 cells." J 19

Interferon Cytokine Res 34(10): 795-801. 20

Venugopal, S., M. Chen, W. Liao, S. Y. Er, W. S. Wong and R. Ge (2015). "Isthmin is a novel 21

vascular permeability inducer that functions through cell-surface GRP78-mediated Src 22

activation." Cardiovasc Res 107(1): 131-142. 23


Vieira, A. R., J. R. Avila, S. Daack-Hirsch, E. Dragan, T. M. Felix, F. Rahimov, J. Harrington, 1

R. R. Schultz, Y. Watanabe, M. Johnson, J. Fang, S. E. O'Brien, I. M. Orioli, E. E. 2

Castilla, D. R. Fitzpatrick, R. Jiang, M. L. Marazita and J. C. Murray (2005). "Medical 3

sequencing of candidate genes for nonsyndromic cleft lip and palate." PLoS Genet 1(6): 4

e64. 5

Wang, Q., Z. L. Yang, Q. Zou, Y. Yuan, J. Li, L. Liang, G. Zeng and S. Chen (2016). "SHP2 and 6

UGP2 are Biomarkers for Progression and Poor Prognosis of Gallbladder Cancer." 7

Cancer Invest 34(6): 255-264. 8

Wang, Y. H. and C. W. Beck (2014). "Distal expression of sprouty (spry) genes during Xenopus 9

laevis limb development and regeneration." Gene Expr Patterns 15(1): 61-66. 10

Wehby, G. L. and C. H. Cassell (2010). "The impact of orofacial clefts on quality of life and 11

healthcare use and costs." Oral Dis 16(1): 3-10. 12

Welsh, I. C., A. Hagge-Greenberg and T. P. O'Brien (2007). "A dosage-dependent role for Spry2 13

in growth and patterning during palate development." Mech Dev 124(9-10): 746-761. 14

Wurst, W. and L. Bally-Cuif (2001). "Neural plate patterning: upstream and downstream of the 15

isthmic organizer." Nat Rev Neurosci 2(2): 99-108. 16

Xiang, W., Z. Ke, Y. Zhang, G. H. Cheng, I. D. Irwan, K. N. Sulochana, P. Potturi, Z. Wang, H. 17

Yang, J. Wang, L. Zhuo, R. M. Kini and R. Ge (2011). "Isthmin is a novel secreted 18

angiogenesis inhibitor that inhibits tumour growth in mice." J Cell Mol Med 15(2): 359-19

374. 20

Yang, X., S. Kilgallen, V. Andreeva, D. B. Spicer, I. Pinz and R. Friesel (2010). "Conditional 21

expression of Spry1 in neural crest causes craniofacial and cardiac defects." BMC Dev 22

Biol 10: 48. 23


Yildirim, Y., M. Kerem, C. Koroglu and A. Tolun (2014). "A homozygous 237-kb deletion at 1

1p31 identified as the locus for midline cleft of the upper and lower lip in a 2

consanguineous family." Eur J Hum Genet 22(3): 333-337. 3

Younkin, S. G., R. B. Scharpf, H. Schwender, M. M. Parker, A. F. Scott, M. L. Marazita, T. H. 4

Beaty and I. Ruczinski (2014). "A genome-wide study of de novo deletions identifies a 5

candidate locus for non-syndromic isolated cleft lip/palate risk." BMC Genet 15: 24. 6

Younkin, S. G., R. B. Scharpf, H. Schwender, M. M. Parker, A. F. Scott, M. L. Marazita, T. H. 7

Beaty and I. Ruczinski (2015). "A genome-wide study of inherited deletions identified 8

two regions associated with nonsyndromic isolated oral clefts." Birth Defects Res A Clin 9

Mol Teratol 103(4): 276-283. 10

Zarrei, M., J. R. MacDonald, D. Merico and S. W. Scherer (2015). "A copy number variation 11

map of the human genome." Nat Rev Genet 16(3): 172-183. 12

Zhang, Y., M. Chen, S. Venugopal, Y. Zhou, W. Xiang, Y. H. Li, Q. Lin, R. M. Kini, Y. S. 13

Chong and R. Ge (2011). "Isthmin exerts pro-survival and death-promoting effect on 14

endothelial cells through alphavbeta5 integrin depending on its physical state." Cell 15

Death Dis 2: e153. 16

Zhao, Y., Y. J. Guo, A. C. Tomac, N. R. Taylor, A. Grinberg, E. J. Lee, S. Huang and H. 17

Westphal (1999). "Isolated cleft palate in mice with a targeted mutation of the LIM 18

homeobox gene lhx8." Proc Natl Acad Sci U S A 96(26): 15002-15006. 19

20

21


Figure 1: Bioinformatic analysis pipeline leading to the identification of ISM1 as a clefting 1

candidate. CNVs from 130 high-quality CGH arrays were called by Nexus 7 Software and 2

compared to calls made by DEVA software using the BEDTOOLS 50% reciprocal overlap 3

function. Calls were retained if they were called by both programs, did not overlap in a list of 4

curated benign variants from DGV or segmental duplications by 50% or more, overlapped an 5

exon of a protein coding gene, spanned 10kb, had a shift value of -0.7 or 0.42, were overlapped 6

by a deletion in <1% of cases, were likely haploinsufficiency loci, and not previously implicated 7

in clefting. These deletions were assessed in MGI, NCBI and PubMed for biological plausibility, 8

and one gene (ISM1) was selected for functional follow up. All calls were visually inspected and 9

artifacts were removed. (CLP – cleft lip and palate; CPO – cleft palate only) 10

Figure 2: Identification of heterozygous deletions in two unrelated probands with non-11

syndromic cleft lip and palate. The deletion detected in proband 1 removes the entirety of ISM1 12

and SPTLC3 while the deletion in proband 2 occurs just 3’ of ISM1. Plots of aCGH data were 13

generated by Nexus 7 software. 14

Figure 3: Deletion 3’ to ISM1 deletes regulatory information. CTCF binding sites (blood cell 15

line, dark blue) indicative of an insulator element (epithelial cell lines, teal) are deleted by the 3’ 16

ISM1 deletion (red). In addition, the deletion removes chromatin marks H3K4Me1 and 17

H3K27Ac (indicative of enhancers, both shown in purple), which were also detected within the 18

epithelial cell lines (orange = strong enhancer; yellow = weak enhancer). 19

Figure 4: In situ hybridization of ism1 expression in late stage Xenopus laevis embryos. 20

Embryos are shown in a lateral (A-D) or anterior (A’-D’) view with the cement gland (cg) 21

labeled for ventral orientation. (A) Stage 28 embryo showing strong expression in the branchial 22

arches (ba), midbrain-hindbrain boundary (mhb), ear placode (e), and tailbud (tb) with the yellow 23

arrowheads marking the primitive mouth. (B) Stage 33 embryos showing decreased expression 24

in the branchial arches (ba), midbrain-hindbrain boundary (mhb) and tailbud (tb), with 25

concentrated expression surrounding the primitive mouth (arrowhead) and expression in the 26

somites (s). (C-D) Stage 37 and 39 embryos showing continued concentrated ism1 expression 27

surrounding the primitive mouth (arrowhead). 28

Figure 5: Knockdown of ism1 results in whole embryo and craniofacial defects which are 29

rescued by ism1 mRNA. Whole embryo knockdown of ism1 with 12ng translation blocking 30

(ATG) morpholino (MO) results in first branchial arch derivative defects and is rescued with the 31

injection of 200pg ism1 mRNA lacking the MO binding site (p = <0.001, Fisher’s Exact Test). 32

33

Figure 6: Morpholino knockdown of ism1 in Xenopus laevis embryos results in clefting 34

phenotypes. (A) Quantification of embryos injected with 24ng control morpholino (Ctrl MO) 35

versus 24ng ism1 translation-blocking (ATG) MO shows craniofacial anomalies and clefting 36

phenotypes in the ism1-altered group. (B) Faces of stage 43 embryos which are uninjected (top) 37

or injected with 24ng ism1 ATG MO and exhibiting a cleft (bottom). Mouths have been outlined 38


in red. (C) Phalloidin (red) and E-cadherin (green) staining to detect cell boundaries and 1

epithelial cells, respectively, of the mouth of an uninjected (top) or 24ng ism1 ATG MO injected 2

(bottom) embryos. 3

Figure 7: Expression of lhx8 decreases with knockdown of ism1. Embryos are shown in an 4

anterior view with the cement gland (cg) labeled for ventral orientation. Control uninjected (Un) 5

or embryos pricked with the injection needle on half (HP) show strong lhx8 expression in the 6

first branchial arch at stage 28 (A-D) surrounding the primitive mouth (yellow arrowhead) as 7

well as in the maxillary prominences (green arrowhead). Knockdown of ism1 with 12ng ATG 8

MO in half of the animal results in undetectable (E) or decreased (F) branchial arch expression of 9

lhx8, especially in the maxillary prominence. 10

11

identification of isthmin 1 as a novel clefting and craniofacial … · 2017-11-21 · 17 been...

Documents