identificationandcharacterizationofanovel-typeferric ... · fhuf contains a c-terminal iron-sulfur...

Identification and Characterization of a Novel-type FerricSiderophore Reductase from a Gram-positive Extremophile*

Received for publication, October 7, 2010, and in revised form, November 3, 2010 Published, JBC Papers in Press, November 4, 2010, DOI 10.1074/jbc.M110.192468

Marcus Miethke‡1, Antonio J. Pierik§, Florian Peuckert‡, Andreas Seubert‡, and Mohamed A. Marahiel‡

From the ‡Fachbereich Chemie/Biochemie, Philipps Universitat Marburg, Hans-Meerwein-Strasse, D-35032 Marburg and the§Institut fur Zytobiologie und Zytopathologie, Philipps Universitat Marburg, 35037 Marburg, Germany

Iron limitation is one major constraint of microbial life, anda plethora of microbes use siderophores for high affinity ironacquisition. Because specific enzymes for reductive iron re-lease in Gram-positives are not known, we searched Firmicutegenomes and found a novel association pattern of putative fer-ric siderophore reductases and uptake genes. The reductasefrom the schizokinen-producing alkaliphile Bacillus halo-durans was found to cluster with a ferric citrate-hydroxamateuptake system and to catalyze iron release efficiently fromFe[III]-dicitrate, Fe[III]-schizokinen, Fe[III]-aerobactin, andferrichrome. The gene was hence named fchR for ferric citrateand hydroxamate reductase. The tightly bound [2Fe-2S] cofac-tor of FchR was identified by UV-visible, EPR, CD spectros-copy, and mass spectrometry. Iron release kinetics were deter-mined with several substrates by using ferredoxin as electrondonor. Catalytic efficiencies were strongly enhanced in thepresence of an iron-sulfur scaffold protein scavenging the re-leased ferrous iron. Competitive inhibition of FchR was ob-served with Ga(III)-charged siderophores with Ki values in themicromolar range. The principal catalytic mechanism wasfound to couple increasing Km and KD values of substrate bind-ing with increasing kcat values, resulting in high catalytic effi-ciencies over a wide redox range. Physiologically, a chromo-somal fchR deletion led to strongly impaired growth duringiron limitation even in the presence of ferric siderophores. In-ductively coupled plasma-MS analysis of �fchR revealed intra-cellular iron accumulation, indicating that the ferric substrateswere not efficiently metabolized. We further show that FchRcan be efficiently inhibited by redox-inert siderophore mimicsin vivo, suggesting that substrate-specific ferric siderophorereductases may present future targets for microbial pathogencontrol.

Siderophore-dependent iron acquisition is an essentialmetabolic feature employed by a vast number of bacteria,fungi, plants, and even higher eukaryotes (1–4). Key steps oftypical siderophore pathways include siderophore synthesis,secretion, and uptake of siderophore-bound iron that is cou-pled to its intracellular or extracellular release. Within sid-erophore pathways, iron release processes are still widely un-characterized. Generally, two enzymatic strategies are known

for direct release of ferric siderophore complexes, which arehydrolysis of the siderophore backbone or reduction of thecomplexed ferric iron species, thus representing either a scaf-fold- or metal-targeted release mechanism (5–7), which maynot necessarily be mutually exclusive. Iron release outside thecytosol, including compartments such as the bacterialperiplasm or eukaryotic vacuoles, may further be coupled toprotonation of ferric siderophore complexes (8, 9).Hydrolytic release of iron is restricted to a small number of

siderophores possessing bonds that can be efficiently attackedby water. Usually, these are ester bonds that are present intrilactone siderophores like enterobactin, bacillibactin, salmo-chelins, or triacetylfusarinine C. For those siderophores, sev-eral esterases have been described that partially or completelyhydrolyze these intramolecular ester bridges (10–14).The overwhelming majority of siderophores is assembled

by amide bond formation and thus are very robust againsthydrolysis. Their ferric complexes are generally released bymetal reduction and/or complex protonation. Reductive re-lease in the extracellular environment has been described forthe membrane-standing ferric reductases in yeast, especiallyFre1p, Fre2p, Fre3p, and Fre4p (15). They are similar to b-type cytochromes and belong to the flavocytochrome super-family using FAD, NAD(P)H, and heme cofactors for electrontransfer during catalysis. Electron shuttling across the cytoso-lic membrane is suggested to be coupled with proton transferresulting in extracellular acidification (16), which may in-crease the redox potentials of the ferric complexes. Generally,the iron-chelate redox potentials greatly differ among the dif-ferent classes of siderophores. Triscatecholates such as ferricenterobactin (Fe(III)-enterobactin) with iron binding affinitiesin the range of 1049 M�1 possess standard redox potentials oftheir ferric complexes at E�0, pH 7.0, of �750 mV or lower(17, 18). Redox potentials of hydroxamates such as fer-richrome or ferrioxamines, and citrate-hydroxamates such asferric aerobactin (Fe(III)-aerobactin) are higher but still in thenegative range below an E�0, pH 7.0, of about �300 mV,whereas carboxylates such as ferric dicitrate (Fe(III)-dicitrate)are ranging above them at E�0, pH 7.0, of about 0 mV (6). Ac-cording to the physiological range of cellular redox com-pounds, many ferric siderophores can be potentially reducedby soluble redox cofactors, a mechanism that has mainly beendescribed for cytosolic iron release in bacteria (6, 18). In thesecases, usually flavin reductases catalyze electron transfer fromNAD(P)H toward different flavins such as FMN, FAD, or ri-boflavin. These flavins may then be released from the enzymeas free reducing agents such as in Escherichia coli NAD(P)H:

* This work was supported by the Deutsche Forschungsgemeinschaft andFonds der Chemischen Industrie.

1 To whom correspondence should be addressed. Tel.: 49-6421-2825794;Fax: 49-6421-2822191; E-mail: [email protected].

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 3, pp. 2245–2260, January 21, 2011© 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

JANUARY 21, 2011 • VOLUME 286 • NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 2245

by guest on October 25, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

flavin oxidoreductase Fre and its homologs in Vibrio (19), thesulfite reductase SiR (20), andMagnetospirillum gryphiswal-dense flavin reductase FeR (21) or may stay enzyme-boundsuch as in E. coli flavohemoglobin Hmp (22), nitroreductaseNfnB, and ferredoxin-NADP� reductase Fpr (23). In addition,extracellular FSRs2 dependent on NADH and flavins weredescribed in several species, including E. coli, Yersinia entero-colitica, Pseudomonas aeruginosa, and Listeria monocytogenes(24). Generally, these FSRs act on a broad set of substrates,including iron-loaded non-siderophores such as cytochrome cor ferredoxin and non-metals such as sulfite or nitro com-pounds, and hence are not specifically linked with iron as-similatory metabolism and regulation. Still, there are few ex-amples of cytosolic FSRs showing a direct relation with ironmetabolism as well as direct interaction with a defined set offerric chelate substrates. One reductase that is suggested tofulfill these criteria is E. coli FhuF, which was shown to reduceseveral ferric hydroxamate complexes (25, 26). FhuF containsa C-terminal iron-sulfur (Fe/S) cluster that likely permits elec-tron transfer from the enzyme to its cognate substrates. Al-though FhuF-type reductases are present in several enter-obacterial species, further types of putative reductases withC-terminally conserved cysteine motif are distributed in otherphyla including Firmicutes. Their reductases have not beencharacterized yet, and it has not been described that Gram-positive bacteria possess iron-regulated or substrate-definedFSRs.Here, we describe for the first time a distinct FSR from a

Gram-positive bacterium. The reductase was found to beiron-regulated and to possess a stably bound low-potentialFe/S cofactor. Its kinetic analysis revealed a redox-scaled sub-strate spectrum defined by both cluster midpoint potentialand substrate affinity. Genetic analyses showed that its func-tion is decisive for cellular iron metabolism and that it can beinhibited by redox-inert siderophores during iron deprivation.We thus present novel mechanistics insights into cytosoliciron release, which might have implications for antibioticstrategies.

EXPERIMENTAL PROCEDURES

Growth Conditions, DNA Preparation, and Cloning—Ba-cillus halodurans DSM497 (DSMZ stock, Braunschweig,Germany) was routinely cultured in LB medium containing0.1 mM sodium sesquicarbonate (4.2 g of NaHCO3, 5.3 g ofNa2CO3 per liter) at pH 9.7 (“LB-ha broth”) at 37 °C. DNAwas prepared from late log phase cultures by the followingprocedure. After washing cells twice with TE buffer (10 mM

Tris-HCl, pH 8.0, 1 mM Na-EDTA), 0.1 mM lysozyme wasadded, and the solution was incubated for 10 min at 37 °C.Upon addition of 2% (w/v) SDS and 1 M sodium perchlo-rate, cell proteins were precipitated, and after extractionwith chloroform/isoamyl alcohol at 24:1 (v/v), DNA wasseparated into the aqueous phase. DNA was precipitated byaddition of 2 volumes of ethanol, washed in 70% (v/v) etha-

nol, dried under vacuum, and dissolved in TE buffer. RNAwas removed by RNase I treatment (0.1 mg/ml) for 1 h at37 °C. For amplification of genes BH1040 and BH1037, primerpairs ATATCTAGATAACGAGGGCAAAAAATGATCGA-GCCACCTGTTATGAATG (BH1040_forward)/GCTCGGT-TTGCGAGGGCACGTCC (BH1040_reverse), and ATAGGAT-CCGGAGGAAATGAACCAAGCGAAG (BH1037_forward)/ATAAAGCTTCTATTGTGTAAGGGAATCAACGAG(BH1037_reverse) were used, respectively, according to thedata base genome sequence of B. halodurans C-125 (restric-tion sites are underlined, primer BH1040_reverse blunt endand phosphorylated). BH1040 and BH1037 were cloned intopMM30 and pCB28a� (12) resulting in pMM30-1 andpMM20 expression vectors providing a C-terminal Strep-tagII and an N-terminal His6-tag, respectively. In vitro DNAmanipulations and E. coli transformations were done accord-ing to described methods (27).Recombinant Protein Production and Purification—E. coli

BL21 cells transformed with the desired expression vectorwere grown in LB medium at 37 °C until an A600 of 0.5 andthen induced with 0.2 mg/liter anhydrotetracycline(pMM30-1) or 0.2 mM isopropyl �-D-thiogalactopyranoside(pMM20) for 3 h at 30 °C. For purification of recombinant B.halodurans BH1040, cells were harvested, resuspended in 150mM NaCl, 100 mM Tris-HCl, pH 8.0, and disrupted by using aFrench press (Thermo Scientific), and the filtrated lysate wassubjected to Strep-Tactin chromatography using an FPLCpurifier system (GE Healthcare) and a column with 2 ml ofStrep-Tactin superflow material (IBA). The recombinant pro-tein was eluted with 2.5 mM D-desthiobiotin (IBA). Purifica-tion of recombinant B. halodurans BH1037 and recombinantBacillus subtilis SufU was done by Ni2�-nitrilotriacetic acidchromatography as described previously (12, 35). The pooledand concentrated elution fractions were then applied to sizeexclusion chromatography using a 26/60 Superdex 200 col-umn and 150 mM NaCl, 100 mM Tris-HCl, pH 8.0. Fractionsof the dominant single UV peak were analyzed by SDS-PAGE,and those containing pure protein were concentrated usingcentrifugal filter devices with a 10,000 cutoff. Protein concen-tration was determined by Bradford method (28) using a BSAcalibration curve. Protein was shock-frozen in liquid nitrogenand stored at �80 °C.UV-Visible Analysis—For measurement of oxidized protein

spectra, purified protein was diluted to the desired concentra-tion in 150 mM NaCl, 100 mM Tris-HCl, pH 8.0, and the solu-tion was placed into a quartz cuvette (n � 1 cm). For mea-surement of reduced protein spectra, the protein was treatedwith 5 mM sodium dithionite under anaerobic conditions(95% N2, 5% H2). Reduced protein was placed into an anaero-bic cuvette, which was tightly sealed before measurementswere performed. Spectra were recorded at an Ultrospec 3000spectrophotometer usually from 250 to 800 nm. Data wereanalyzed with SWIFT Scan 2.06.Analytical Gel Filtration—A Zorbax GF-250 column was

equilibrated with 150 mM NaCl, 100 mM Tris-HCl, pH 8.0,using an Agilent HPLC system (1200 series). The column wascalibrated using a mixture of ferritin (440 kDa), aldolase (158kDa), conalbumin (75 kDa), ovalbumin (44 kDa), carbonic

2 The abbreviations used are: FSR, ferric siderophore reductase; Fd, ferre-doxin; Phen, 1,10-phenanthroline; BP, 2,2�-bipyridyl; NHE, normal hydro-gen electrode; ICP-MS, inductively coupled plasma mass spectrometry.

FchR, a Novel Gram-positive Ferric Siderophore Reductase

2246 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 3 • JANUARY 21, 2011


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

anhydrase (29 kDa), and aprotinin (6.5 kDa) at 0.5 ml/min at25 °C. 100 �g of purified recombinant FchR was then appliedat the same flow rate and temperature. UV spectra at 280 nmwere recorded and analyzed with Agilent ChemStation soft-ware B.03.Western Analysis—B. halodurans wild-type (WT) and B.

halodurans �fchR were cultivated in LB-ha broth supple-mented with 100 �M FeCl3 or different concentrations (5–50�M) of 2,2�-bipyridyl (BP) and 1,10-phenanthroline (Phen).Cells were harvested at late log phase, washed twice with TEbuffer, and disrupted after addition of 1 mM serine proteaseinhibitor PMSF by sonication (four times for 1 min at 50watts). Cell debris was removed by centrifugation (15,000 � g,60 min, 4 °C), and clear lysate was separated. Protein concen-trations of cytosolic extracts were determined by the Bradfordmethod, and 20 �g were applied to each lane for SDS-PAGE(12% acrylamide). Furthermore, debris fractions containingmajor portions of cell membranes were resolubilized in 8 M

urea, 0.5 M DTT by boiling at 95 °C for 20 min. Resolubilizedmembrane fractions were also subjected to SDS-PAGE. As acontrol, 0.1 �g of purified recombinant FchR was additionallyloaded on the gels, which were developed for 1.2 h at 150 mV,and then proteins were blotted onto a hyperbond PVDFmembrane for 1 h at 200 mV. After blocking with 2.5% (w/v)BSA in TBS, polyclonal FchR-specific antibody (Pineda, Ber-lin, Germany) was applied for 12 h, and after washing second-ary antibody (goat anti-rabbit IgG coupled with alkaline phos-phatase; Bio-Rad) was applied for 2 h. Blots were developedusing 5-bromo-4-chloro-3-indolyl phosphate and nitro bluetetrazolium at pH 9.5 for signal detection.Chemical Iron and Sulfide Determination—For iron deter-

mination, three samples (5, 10, and 20 �l) of 80 �M purifiedFchR, two buffer controls, and five samples (1, 2, 5, 10, and 20nmol) of iron standard (NH4)2Fe(SO4)2�6 H2O were diluted to100 �l with H2O. Subsequently, 100 �l of 1% (w/v) hydro-chloric acid were added, and samples were mixed gently.Samples were incubated at 80 °C for 10 min, and 500 �l of7.5% (w/v) ammonium acetate, 100 �l of 4% (w/v) ascorbicacid, 100 �l of 2.5% (w/v) SDS, and 100 �l of iron chelator(Ferene) were added sequentially. Samples were centrifugedfor 5 min at 15,000 � g, and absorbance was measured at 590nm against water. For determination of acid-labile sulfide,three samples (10, 20, and 40 �l) of 120 �M purified FchR, twobuffer controls, and six samples (2, 10, 20, 30, 40, and 50nmol) of Li2S sulfide standard were diluted to 200 �l withH2O. Then 600 �l of 1% (w/v) zinc acetate and 50 �l of 7%(w/v) NaOH were added, and samples were mixed shortly andincubated for 15 min at 22 °C. After short centrifugation, 150�l of N,N�-dimethyl-p-phenylenediamine, 0.1% (w/v) in 5 M

HCl, and 150 �l of 10 mM FeCl3 in 1 M HCl were addedquickly to start methylene blue formation. After short vortex-ing, samples were centrifuged for 5 min at 15,000 � g, andabsorbance was measured at 670 nm against water.EPR Analysis—Purified FchR was reduced anaerobically by

incubation with 5 mM dithionite for 5 min to achieve quanti-tative cluster reduction. 50 �M of reduced protein were thenmeasured at 40 K and 9.4681 GHz using a Bruker EPR spec-trometer. The cluster concentration was quantified by com-

paring the numerically double-integrated 40 K spectra withthose of a 1 mM Cu(II)-EDTA standard without saturationeffects.EPR Redox Titration—20 �M holo-FchR in 10 mM Tris-

HCl, pH 7.5, 50 mM NaCl were anaerobically incubated andmixed with redox mediators methyl viologen, benzyl viologen,neutral red, safranine T, phenosafranine, and anthraquinone-2-sulfonate (40 �M each). Actual redox potentials were deter-mined continuously by using a platinum electrode and a Ag/AgCl reference electrode under constant mixing of theprotein/indicator solution as described previously (29). In-creasing amounts of dithionite were added stepwise, and 13samples were taken between �215 mV/NHE (correspondingto the start potential) and �520 mV/NHE (corresponding tocomplete reduction). Immediately, frozen samples were mea-sured at 77 K, and both amplitudes and slopes of the gy �1.956 feature were plotted after corrections for sample vol-umes and concentrations and analyzed by fitting to theNernst equation.HPLC and Mass Spectrometric Analysis—Culture superna-

tant extracts were analyzed by using a C-18 column (Mach-erey-Nagel) with a water, 0.05% formic acid (A) and acetoni-trile, 0.045% formic acid (B) gradient from 5 to 95% B in 30min with a column temperature of 45 °C. Electrospray ioniza-tion-mass spectra of the eluting compounds were recorded inpositive ion mode within the mass range of 100–1000m/z.For a complete desalting of proteins by HPLC using an Agi-lent 1100 system, samples were applied to a monolithic 50:1ProSwift RP-4H column (Dionex). Desalted proteins wereeluted by the following gradient of A and B at a column tem-perature of 40 °C and a flow rate of 0.2 ml/min: isocratic elu-tion with 5% A for 2 min, followed by a linear gradient to 95%B within 8 min, and holding 95% B for additional 4 min. On-line mass spectrometric analysis was done with a QStar Pulsari mass spectrometer (ABSciex, Darmstadt, Germany)equipped with an electrospray ionization source. Parameterswere as follows: DP1 75, FP 265, DP2 15, CAD 2, GS1 65, andCUR 35. The voltage applied was 5500 V. Positive ions withinthe mass range of 500–2000m/z were detected. For betterperformance, the “Enhance All” mode was activated.CDMeasurements—CDmeasurements were carried out at

a temperature of 20 °C using a J-810 spectropolarimeter(Jasco) and 0.5-cm path length cuvettes. Spectra were re-corded with a measuring range from 650 to 265 nm, a band-width of 1 nm, a data pitch of 0.2 nm, a response of 1 s, andwith standard sensitivity. The scanning speed was 100 nmmin�1, and the presented data are an accumulation of 10scans. The protein concentration of holo-FchR was 20 �M in20 mM Tris-HCl, pH 8.8 (the presented curves are correctedfor the signal of the buffer). First, a spectrum of reduced holo-FchR was recorded, and then Ga(III)-dicitrate was added to afinal concentration of 200 �M, and the next measurement wastaken, followed by addition of Fe(III)-dicitrate to yield a finalconcentration of 100 �M and conductance of the next mea-surement. Incubation times between each addition and mea-surement were 15 min. The addition of the compounds wasperformed under anaerobic conditions.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Fluorescence Titration—Purified recombinant protein solu-tion in 150 mM NaCl, 100 mM Tris-HCl, pH 8.0, was adjustedto the desired concentration, and 2 ml were applied into a 1 �1-cm2 quartz cuvette. The cuvette was placed into an FP-6500spectrofluorimeter (Jasco) and thermostated at 22 °C. Con-centrated ferric siderophore stock solutions were freshly pre-pared and added stepwise to the protein solution. Tyrosine/tryptophan fluorescence was measured after excitation at 280nm (slit width 5 nm) at 340 nm (slit width 5 nm). Each mea-surement was averaged three times. Data analysis and KD cal-culation were done as described previously (30).Enzyme Kinetics and Inhibition Studies—All kinetic studies

were performed under anaerobic atmosphere (5% H2 in N2) at25 °C. For initial determination of enzyme substrate spec-trum, 50 �M FchR was reduced with 5 mM dithionite for 5min, then purified anaerobically via size exclusion chromatog-raphy using an Econo-Pac 10DG column (Bio-Rad), andincubated with 150 �M ferric siderophore substrates (Fe(III)-dicitrate and ferrioxamine E (Sigma); Fe(III)-aerobactin,Fe(III)-schizokinen, ferrichrome (EMC microcollections,Tubingen, Germany), Fe(III)-enterobactin (31)) for 10 min in100 mM NaCl, 50 mM Tris-HCl with varying pH values at 7.0,7.5, 7.8, 8.0, 8.3, 8.5, 9.0, and 9.5 (although pH 9.5 is at thelimit of the optimal buffer range, the same buffer was used toensure comparable experimental conditions). Fe/S clusterspectra were measured before and after incubation to monitorcluster reoxidation. To test efficiency of FchR reduction by aphysiological electron donor, measurements were repeated byusing 2 mM NADH, NADPH, FADH2 (all obtained fromSigma) and ferredoxin (Fd; source, Spinacia oleracea; Sigma),which was reduced with dithionite and purified anaerobically.Detailed kinetics were then performed in 50 mM Tris-HCl, pH8.0, 100 mM NaCl at 25 °C by using 1 �M holo-FchR and 10�M Fd together with a regenerative system consisting ofNADPH:Fd oxidoreductase (source, S. oleracea; Sigma),which bears a low potential flavin with E1⁄2 � �442 mV, pH8.0 (32), and reversibly transfers electrons to Fd, possessing alow potential Fe2S2 cluster with E1⁄2 � �420 mV (33), throughformation of a 1:1 stoichiometric complex (32). Furthermore,glucose-6-phosphate dehydrogenase (source, S. cerevisiae;Sigma) was used to ensure low steady-state concentrationsof NADP� potentially acting as a competitive inhibitor ofNADPH:Fd oxidoreductase (34). Nonlimiting rate determina-tion was done with starting concentrations of 2 mM glucose6-phosphate and 2 mM NADPH, 0.5 units of regenerative en-zymes, and varying concentrations of potassium ferricyanide(E�0, pH 7.0, � 436 mV). Conditions found to be sufficient fornonlimiting electron transfer were then applied to FchR-de-pendent kinetics with ferric siderophores over a substrateconcentration range from 1 to 1000 �M. After 10 min, prein-cubation of regenerative enzymes with their substrates (glu-cose 6-phosphate, NADPH, Fd) and FchR, ferric siderophoreswere added, and starting velocities of iron release were mea-sured by 3 min of incubation (initially determined to bewithin the time-dependent linear catalytic range). Fe(II) re-lease was detected by addition of 0.15% (w/v) ferene and im-mediate measurement of absorbance at 590 nm using an Ul-trospec 3000 spectrophotometer (GE Healthcare) or,

alternatively, a NanoDrop ND-1000 (peQLab). Fe(II) concen-trations were calculated by using a Fe(II)-ferene calibrationcurve measured at the same wavelength. Further kinetics forFe(III)-dicitrate, Fe(III)-aerobactin, and ferrichrome were per-formed in presence of 100 �M apo-SufU (source, B. subtilis(35)), which was de-metallized before by three dialysis steps in100 mM EDTA-containing reaction buffer and frequent ther-mal shifts to 45 °C. Background reduction of ferric sid-erophore substrates (at maximum 4% relative to FchR-depen-dent reduction) was determined for each kinetic in absence ofFchR and subtracted from iron release in the presence ofFchR. Each kinetic was performed three times independently,and averaged data were plotted with obtained standard devia-tions. Kinetic parameters were determined upon Michaelis-Menten analysis by using Microcal Origin 5.0 software. Inhi-bition assays were performed by using Fe(III)-dicitrate as asubstrate and Ga(III)-dicitrate and Ga(III)-desferrioxamine Eas potential inhibitors. To determine the Ki values, Fe(III)-dicitrate concentrations were set around the Km value andadditionally at saturating concentrations. Concentrations ofthe inhibitors were varied from 0 to 70 �M in case of Ga(III)-dicitrate and 0 to 12.5 �M in case of Ga(III)-desferrioxamineE. Assays were performed according to the established stan-dard kinetic conditions. The inhibition constants were calcu-lated by using the Dixon plot method (36).Mutant Construction—A PCR hybrid construct was gener-

ated by fusing the CmR cassette of vector pX (37) with homol-ogous flanking regions of gene BH1040 (38). The 3�-ends ofthe upstream and downstream flanks contained complemen-tary 3�-ends to the resistance cassette fused in a second PCR.PCRs were performed with Platinum�Pfx DNA polymerase(Invitrogen) and the Expand long template PCR system(Roche Applied Science). Transformation was done with B.halodurans protoplast cells following described methods (39,40). Shortly thereafter, protoplasts were generated in Proto-blast(PB)-buffer containing 20% (w/v) sucrose, 10 mM MgCl2,and 20 mM Tris-HCl, pH 9.2, supplemented with 5% (w/v)lysozyme at 37 °C. They were harvested by centrifugation at3000 � g for 10 min and resuspended in PB-buffer. DNA wasadded together with 25% (w/v) PEG 8000, and after 10 min ofincubation, 2� Penassay broth containing 20% (w/v) sucrosewas added with equal volume, and protoplasts were recoveredby centrifugation. Treated protoblasts were resuspended inPenassay broth-mixed PB-buffer and gently shaken for 30 minat 30 °C. Transformants were selected on modified DM3 re-generation plates with chloramphenicol at 20 �g/ml.Growth Assays and Siderophore Tests in DefinedMedium—

For defined growth studies with B. haloduransWT and�fchR, modified iron-limited Belitsky minimal medium (41) atpH 9.5 was used. Strains were inoculated to a starting A600 of0.05, and growth was monitored continuously until stationaryphase was reached. Endogenous siderophore production wastested by Arnow (42) and modified Csaky test (43). Extractionof culture supernatants for analysis of siderophore species wasdone as described previously (44). For siderophore supple-mentation assays, microtiter scale cultures were used thatwere supplemented with 100 �M of FeCl3, ferric siderophores,or Ga(III)-loaded siderophores. Cultured were incubated at




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

300 rpm at 37 °C, and growth was monitored by using a mi-crotiter plate reader. Three independent cultures for eachcondition were set up, and growth data were plotted withtheir corresponding standard deviations.ICP-MS Analysis—Cultures were inoculated with overnight

cultures to a starting A600 of 0.05 and were harvested afterreaching stationary growth phase. Cells were centrifuged at18,000 � g for 5 min; pellets were washed three times withbuffer containing 10 mM Tris-HCl, 1 mM EDTA, pH 7.5, andfinally with milliQ/water to remove extracellular traces of salt.Cells were dried for 20 h at 100 °C and treated with suprapurenitric acid for quantitative breaking, and intracellular metalcontents were analyzed by ICP-MS using an ICP-MS Agilent7500ce. Three biological replicates for each condition were

analyzed, and averaged data of the measurements were givenwith corresponding standard deviations. Analysis of metalcontents in protein solutions (20 mM Tris-HCl, pH 7.5) wasdone after 1:20 dilution appropriate to obtain the requiredsample volumes and identical sample viscosities. Yttrium wasadded to all samples as an internal standard.

RESULTS

Identification of Iron-associated Reductase Genes inFirmicutes—Several species within the Firmicutes group pos-sess putative non-flavin reductase genes with conserved C-terminal cysteines that are closely associated with ATP-bind-ing cassette-type iron uptake systems (Fig. 1, A and B). Aphylogenetic analysis shows that these Firmicute reductases

FIGURE 1. A, global ClustalW alignment (identical and similar amino acids shown black and gray shaded boxes, respectively) of putative ferric siderophorereductases with C-terminally conserved cysteine motifs (highlighted in orange) from five Firmicute species (Gsp, Geobacillus sp. WCH70; Afl, Anoxybacillusflavithermus WK1; Bli, Bacillus licheniformis ATCC14580; Bme, B. megaterium DSM319; Bha, B. halodurans C-125) and five Enterobacteriaceae (Cro,Citrobacter rodentium ICC168; Sen, Salmonella enterica subsp. enterica SPB7; Sso, Shigella sonnei Ss046; Eco, E. coli K-12; Kpn, Klebsiella pneumoniae 342).Predicted transmembrane regions in the FhuF-type reductases are indicated by red-coded box. B, association of ferric siderophore ATP-binding cassette-type uptake genes and putative reductases in Firmicute species. Blue, substrate binding genes; yellow, permease genes; green, ATPase genes; red, reductasegenes. Nomenclature for B. licheniformis and B. megaterium genes was taken from homologs of the B. subtilis ferric hydroxamate transporter yfiY-yfiZyfhA-yusV (51). C, phylogenetic clustering of reductase sequences aligned in A. Theoretical evolutionary rates of nucleotide substitutions resulting in sequencediversity by assuming one common ancestor are indicated. D, upper panel, predicted gene cluster for schizokinen biosynthesis (black arrows) and export(gray arrow) from B. megaterium QM B1551 and B. halodurans C-125 with given GenBankTM locus tags and percentages of amino acid sequence identities.Predicted gene functions are as follows: BMQ_4069/BH2624 (S. meliloti RhbA homologs), 2,4-diaminobutyrate 4-transaminase; BMQ_4068/BH2623 (RhbBhomologs), L-2,4-diaminobutyrate decarboxylase; BMQ_4067/BH2622 (RhbC homologs); type A siderophore synthetase; BMQ_4066/BH2621 (RhbD ho-mologs), acyl-CoA transferase; BMQ_4065/BH2620 (RhbE homologs), type B siderophore synthetase; BMQ_4064/BH2619, major facilitator superfamily-typetransporter; BMQ_4063/BH2618 (RhbF homologs), type C siderophore synthetase. Lower panel, electrospray ionization-MS positive ion mode spectrum ofextracted schizokinen from B. halodurans iron-deprived culture medium. Mass peaks are as follows: 403.1 � [M � H2O � H]�; 421.4 � [M � H]�; 424.9 �[M � H2O � Na]�; 443.2 � [M � Na]�; 456.2 � [M � H2O � Fe � 2H]�; 459.1 � [M � K]�; 473.9 � [M � Fe � 2H]�.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

form a rather heterogeneous but distinct cluster clearly distin-guished from the homogeneous cluster of enterobacterialFhuF-like reductases that show a high degree of conservationamong each other (Fig. 1C). Transmembrane-spanning seg-ments predicted within the FhuF sequences are not or withhigh uncertainty predicted within the Firmicute reductasesequences, suggesting topological differences between thesereductases of different phyla. Within the Bacillus genus, theconserved C-terminal CCX4CX6CX2C motif within the reduc-tase sequences partially differs from the CCX10CX2C FhuFmotif, and the identities of the full-length amino acid se-quences compared with E. coli FhuF are between 4 and 14%,indicating that the homology of the corresponding genes isuncertain. This suggests that the predicted Firmicute reducta-ses represent a novel type of putative FSRs with C-terminalconserved cysteine motif potentially showing novel featurescompared with FhuF.Among known Bacillus species, B. halodurans is one excep-

tion because it lacks genes to synthesize or utilize catecholatesiderophores. Although rather closely related to the nonalka-liphilic model bacterium B. subtilis (45), the complete bacilli-bactin pathway is absent in the genome, including biosynthe-sis genes dhbACEBF, ferric bacillibactin uptake genes feuABC,and trilactone hydrolase besA. However, uptake systems forelemental iron, iron dicitrate, and iron hydroxamates arepresent and similar to the corresponding systems in B. subti-lis. To test siderophore production in B. halodurans, iron-limited minimal medium cultures were grown until stationaryphase, and secretion of catecholate and/or hydroxamate com-pounds was tested by using the Arnow and Csaky tests, re-spectively. Only the Csaky test specific for hydroxamates gavea positive response (data not shown), revealing the ability ofB. halodurans to produce hydroxamic compounds duringiron limitation, which is in agreement with a recent study(46). HPLC-MS analysis of extracted iron-deprived culturesrevealed the presence of a mass pattern according to schizoki-nen (Fig. 1D) (47). This citrate-hydroxamate siderophore,which is structurally closely related to aerobactin produced byEnterobacteriaceae, was so far only isolated from Bacillusmegaterium (48, 49). However, the present genome analysisrevealed in both B. megaterium and B. halodurans the samegene cluster with high homology that includes all genes foundto be involved in rhizobactin 1021 biosynthesis in Sinorhizo-bium meliloti except rhbG, which is required for asymmetricacylation of the otherwise schizokinen-like scaffold (Fig. 1D)(50). Thus, B. halodurans was identified as a further speciesproducing schizokinen during iron limitation, further sup-porting the requirement for a reductive iron release mecha-nism in this bacterium.Sequence analysis of the reductase-associated transport

system revealed homology to B. subtilis Fe(III)-siderophoreATP-binding cassette transporters. Highest identities areshared with the Fe(III)-dicitrate YfmCDEF and the ferric cit-rate-hydroxamate YfiYZ-YfhA-YusV transporter (51) by B.haloduransORFs BH1037 (29 and 26% amino acids identityto substrate-binding proteins YfmC and YfiY, respectively),BH1038 (37% amino acids identities for both YfmD and YfmEand 34 and 32% amino acids identities for YfiZ and YfhA to

the N- and C-terminal sequence parts of the BH1038 trans-membrane fusion protein, respectively), and BH1039 (56 and74% identities to ATPase subunits YfmF and YusV, respec-tively). In contrast to B. subtilis, the B. halodurans geneBH1039 is associated with an additional gene, BH1040, en-coding the putative FSR. The overlapping start and stopcodons of genes BH1039 and BH1040 are indicative for theirtranslational coupling, which has also been observed for post-transcriptional regulation of fur expression (52); however, it isnot a common regulatory feature in the context of bacterialiron metabolism. Thus, BH1040 is predicted to encode anovel type of FSRs in Firmicutes and hence would representthe first example of a non-flavin FSR in Gram-positivebacteria.Production and Initial Characterization of the BH1040

Gene Product—To address the function of BH1040, the genewas recombinantly expressed as a Strep-tag II fusion, and theprotein was purified via Streptactin chromatography. Thereddish-brown color of concentrated elution fractionspointed to the binding of a chromogenic cofactor. The UV-visible spectrum of the aerobically purified protein showed inaddition to 280 nm significant absorption features at 330 and450 nm as well as slight additional peaks at 560 and 670 nm,which were strongly weakened upon dithionite reduction,indicating the binding of an Fe/S cluster (Fig. 2A). EPR spec-troscopy revealed that the cluster was EPR-silent in its oxi-dized state. Upon reduction with 5 mM dithionite for 5 min,an EPR signal indicative for the presence of a reduced [2Fe-2S]� cluster was found with g values gz � 2.001, gy � 1.956,and gx � 1.866 (Fig. 3A). These values are similar to thosereported for FhuF (25), but the total FchR EPR spectrum isbroader, and thus gz and gx are ranged above and below thecorresponding FhuF g values, respectively. By using a 1 M

Cu(II)-EDTA standard, the cluster-binding holoprotein frac-tion was estimated with 25 �M in a total protein concentra-tion of 55 �M. Thus, about half of the fraction of the recombi-nantly purified protein was found to be loaded with the Fe/Scofactor. These findings were supported by mass spectromet-ric analysis revealing the presence of two fractional species atnearly equal ratios (Fig. 2B). One species showed the massexpected for the recombinant apoprotein, although the otherspecies showed a mass shift of plus 174 corresponding to thepresence of a [2Fe-2S] cluster. This indicates that one BH1040monomer is able to bind one complete Fe/S cofactor. Chemi-cal determination of releasable iron and sulfide revealed equalmolar ratios of both compounds, which were further found tobe in molar stoichiometries of 1:1 with total purified protein.Given a holoprotein fraction of nearly 50%, this indicated thebinding of two labile iron and sulfur species per holoproteinmonomer. The same molar ratio of iron to holoprotein con-tent was obtained by ICP-MS analysis of an BH1040 dilutionseries over a range of 100 to 105 ppb. To further determine apossible oligomerization state of the protein, analytical gelfiltration was performed, revealing that the protein domi-nantly exists in the monomeric state (Fig. 2C). The combina-tion of apo-BH1040 and holo-BH1040 did not result in differ-ent retention signals, indicating that cluster binding does notsignificantly change the hydrodynamic properties of BH1040.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

To further analyze the putative iron-dependent regulationand the cellular topology, polyclonal antibodies were raisedand used for Western blot analysis of total cellular protein ofcytosolic and membrane-containing fractions from culturesgrown under iron-sufficient and iron-deprived conditions(Fig. 2D). As a result, the protein was detected in cytosolicfractions of cultures treated with each 5 or 50 �M of both 2,2�-bipyridyl and 1,10-phenanthroline demonstrating its iron-dependent induction. No signal was detected in membranefractions even in presence of each 75 �M 2,2�-bipyridyl and1,10-phenanthroline, suggesting that BH1040 is a cytosolicprotein and not associated with the cytosolic membrane.Determination of the [2Fe-2S] Cluster Redox Potential—To

determine the Fe/S cluster midpoint redox potential as anestimate of the redox capacity of holo-BH1040, the proteinwas subjected to anaerobic EPR titration using dithionite asthe reducing agent. First, it was tested if the Fe/S cluster wasstable against elongated incubation with dithionite. EPR anal-ysis revealed complete stability of the [2Fe-2S]� signal over 45min of continuous dithionite reduction at pH 7.5, and thus,redox titration was performed at same pH within this time

frame. By following the amplitude changes of the gy � 1.956feature, a midpoint potential of �348.4 mV (versus NHE) wasdetermined by Nernst fitting (Fig. 3B). EPR slopes were fur-ther evaluated, resulting in essentially the same potential.Thus, FchR was revealed to possess a midpoint potentiallower than free flavin or nicotinamide cofactors and evenlower than determined for the E. coli FhuF reductase (26).Characterization of the Substrate Spectra of BH1040 and

BH1037—To issue the capacity of BH1040 to release ironfrom ferric siderophores, the protein was reduced with 5 mM

dithionite under anaerobic conditions. Dithionite was re-moved by size exclusion chromatography, and reduction ofthe [2Fe-2S] cluster was proofed by UV-visible spectroscopy.The reduced holoprotein was then incubated with severalferric siderophores for 10 min at pH 8.0, and both the UV-visible spectrum of the Fe/S cofactor and the amount of re-leased Fe(II) were analyzed. In case of Fe(III)-dicitrate andseveral ferric hydroxamates, the UV-visible spectrum of thecluster was found to shift into the oxidized state, but not incase of ferric triscatecholates (Fig. 4A). Similarly, the releaseof Fe(II) detected by ferene absorbance at 590 nm was most

FIGURE 2. Cofactor characterization, iron-dependent regulation, and cellular localization of BH1040 (FchR). A, UV-visible analysis of FchR (35 �M) afteraerobic purification and dithionite reduction; inset, SDS-PAGE analysis of purified protein. B, mass spectrometric analysis of aerobically purified FchR withrecombinant Strep-tag II showing the mass of apo-FchR-Strep-tag II (32,585 atomic mass units) and holo-FchR-Strep-tag II (32,759 atomic mass units) carry-ing a [2Fe-2S] cofactor. C, analytical gel filtration using a Zorbax GF-250 column with 100 �g of FchR and calibration proteins; F, ferritin; A, aldolase; C, conal-bumin; O, ovalbumin; CA, carbonic anhydrase; AP, aprotinin. D, Western analysis with FchR polyclonal antibodies. Lane 1, marker; lane 2, recombinantly puri-fied FchR; lane 3, B. halodurans cytosolic protein extract; lane 4, B. halodurans �fchR cytosolic protein extract (50 �M BP/50 mM Phen); lane 5, B. haloduranscytosolic protein extract (5 �M BP/5 �M Phen); lane 6, B. halodurans cytosolic protein extract (50 �M BP/50 �M Phen); lane 7, B. halodurans membrane frac-tion; lane 8, B. halodurans membrane fraction (50 �M BP/50 �M Phen).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

strong with Fe(III)-dicitrate (100%), significantly present withFe(III)-aerobactin (47%) and ferrichrome (16%), but less than0.1% with Fe(III)-enterobactin. Thus, because of its capabilityof releasing iron from Fe(III)-dicitrate, ferric citrate-hydrox-amates, and ferric hydroxamates, the protein was named con-sequently FchR (ferric citrate and hydroxamate reductase).The highest enzyme activity was found between a pH range of7.8 and 8.5, although lower activities were found at pH 7.0and 9.5 with 87 and 73% of release from Fe(III)-aerobactincompared with pH 8.0 at the same experimental conditions.Thus, the enzyme showed an optimal activity at modest alka-line conditions in vitro, which corresponds to the measuredinternal pH of alkaline bacteria, including B. halodurans thatis maintained at around 8.0 in the presence of an external pHfrom 8.0 to 11.0 (53). To further address the specificity of theassociated substrate-binding protein BH1037, the protein wasrecombinantly produced as Strep-tag II fusion, and binding ofseveral ferric siderophores was tested by tyrosine/tryptophanfluorescence quenching (Fig. 4B). Although no significantbinding was observed with Fe(III)-dicitrate, ferrichrome, andferric triscatecholates, titration with Fe(III)-schizokinen and

Fe(III)-aerobactin led to strong quenchings resulting in simi-lar dissociation constants of 3.9 � 1.5 and 8.0 � 4.4 nM, re-spectively. Thus, BH1037 showed strong substrate specificityfor the structurally related ferric citrate-hydroxamates Fe(III)-schizokinen and Fe(III)-aerobactin, suggesting that the trans-porter associated with FchR delivers this class of preferredFchR substrates into the cytosol.Kinetic Analysis of Iron Release Using a Ferredoxin-coupled

Electron Donor/Recycling System—To reduce the cofactors ofFSRs, coupled processes of electron transfer are necessary. Itis known that reduced flavin cofactors such as FMNH2 andFADH2 are released from corresponding NAD(P)H:FMN re-ductases or NAD(P)H:FAD reductases and nonspecificallyreduce siderophores, especially under conditions of low pH(54). However, it was not shown yet how an FSR that interactsdirectly with the ferric siderophore substrates is reduced byupstream electron transfer processes. Thus, before recordingdetailed kinetics of iron release, we searched for a native elec-tron donor system that would ensure the nonlimited catalyticfunction of FchR in vitro. Initial tests with several reducedcellular electron carriers, including FMNH2, FADH2,NAD(P)H, ascorbate-H2, and Fd, revealed that Fdred led toefficient reduction of the FchR [2Fe-2S] cluster revealed byUV-visible spectral analysis. Tests with several ferric sid-erophore substrates showed that fast iron release occurredwhen incubating oxidized FchR with reduced Fd, whereasreduced Fd alone had a background activity of maximal 4%relative to FchR during a reaction time of 1 min. Because thegenome of B. halodurans contains at least three ferredoxinhomologs (BH0209, BH1605, and BH2357) and furthermore aputative ferredoxin:NADP� reductase (BH3408, a homolog toB. subtilis yumC), a three-component electron donor systemwas established consisting of NADPH as primary source, Fdas FchR reducer, and a ferredoxin:NADP� reductase as a re-cycling enzyme (Fig. 4C). Regeneration of NADPH for highsteady-state activities was ensured by coupling the ferredoxin:NADP� reductase with glucose-6-phosphate dehydrogenase.Electron transfer rates of this system were tested with ferri-cyanide as a high potential substrate and were found to have akcat of 398 � 2 s�1 (Fig. 4C). The high rate electron transferwas then applied to perform FchR-dependent kinetics withvarious potential ferric siderophore substrates. All kineticsfollowed a Michaelis-Menten-type behavior (Fig. 4D), andkinetic parameters could be determined for Fe(III)-dicitrateand Fe(III)-(citrate)-hydroxamate conversion (Table 1). Thetriscatecholate Fe(III)-enterobactin proved to be a poor sub-strate, and the conversion rate was near background activitywithout observed saturation, and thus the kcat value was esti-mated to be below 0.1 min�1, although the Km value was notspecified further. All further kinetics were saturated, althoughwith very different kcat and Km values changing drasticallywith increasing redox potential of the free ferric chelate sub-strates. Only for Fe(III)-schizokinen and Fe(III)-aerobactinwere similar kinetic parameters obtained, accounting for theirstructural and hence redox potential similarity. Significantcatalytic efficiencies for low potential ferric hydroxamatessuch as ferrichrome and ferrioxamine E were only observedbecause their Km values strongly dropped, indicating stronger

FIGURE 3. EPR analysis of BH1040 (FchR) Fe/S cofactor and EPR redoxtitration. A, EPR spectrum of dithionite-reduced FchR measured at 40 Kwith 9.4681 GHz microwave frequency, 0.2 milliwatt microwave power, 100kHz modulation frequency, and 1.25 mT modulation amplitude. Found gvalues are as follows: gz � 2.001; gy � 1.956; gx � 1.866. B, normalizedNernst plot of EPR amplitude change (based on the 1.956 EPR feature) ob-tained from redox titration with dithionite showing a midpoint potential of�348.4 mV (versus NHE). Spectra were obtained at 77 K with 9.4681 GHzmicrowave frequency, 5.0 milliwatt microwave power, 100 kHz modulationfrequency, and 1.25 mT modulation amplitude.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

substrate affinity despite lower turnover rates. Because kcatvalues for those substrates were quite low under the testedconditions, and the redox equilibrium favored the state ofFe(III) because of the presence of released apo-siderophores,we tested if the essential Gram-positive scaffold protein SufU(BH3468 homolog) from the related species B. subtilis (35,

55), which tightly binds Zn(II) (�0.75 mol/mol protein) whenrecombinantly produced, would enhance the release of Fe(II)by shifting the iron redox equilibrium to the ferrous side. In-deed, de-metallized apo-SufU that contained only 0.05 mol ofZn(II)/mol of protein had strong effects on both Km and kcatvalues for assayed ferric substrates. Catalytic efficiencies were

FIGURE 4. A, qualitative estimation of substrate spectrum of FchR by incubation of 50 �M reduced and purified enzyme with 150 �M of potential ferric sid-erophore substrates for 10 min at pH 8.0. UV-visible spectra were measured before and after incubation to monitor Fe/S cluster reoxidation. B, fluorescencetitration of BH1037 applied at a concentration of 3 �M was performed with Fe(III)-dicitrate, ferrichrome, Fe(III)-schizokinen, and Fe(III)-aerobactin. Quench-ing curves obtained with Fe(III)-schizokinen and Fe(III)-aerobactin upon excitation of protein tyrosine/tryptophan fluorescence at 280 nm, and emission offluorescence at 340 nm were fitted according to the law of mass action by using a 1:1 stoichiometric binding model. C, scheme of electron donor/recyclingsystem coupled with FchR-dependent activity for kinetic analysis of iron release (upper panel). Applied starting concentrations were 2 mM glucose 6-phos-phate, 2 mM NADPH, and 10 milliunits of regenerative enzymes ferredoxin:NADP� reductase and glucose-6-phosphate dehydrogenase. After 10 min ofequilibration, transfer rates for nonlimiting electron shuttling in the presence of varying concentrations of ferricyanide as terminal acceptor were deter-mined at pH 8.0 (lower panel). Data of three independent determinations were averaged, plotted with standard deviations, and analyzed by Michaelis-Men-ten kinetic. D, iron release kinetics with different ferric siderophore substrates and pre-equilibrated 1 �M FchR, 10 �M Fd, and electron donor/recycling sys-tem as indicated in C. Release activity was monitored by determination of Fe(II)-ferene absorbance at 590 nm. Amounts of released Fe(II) per time werecalculated using a Fe(II)-ferene spectral calibration curve, and background activity was subtracted for each measurement by performing control reactionswithout FchR. Data of three independent determinations for each substrate were averaged, plotted with corresponding standard deviations, and fitted ac-cording to the Michaelis-Menten model.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

found to be enhanced 2.2-, 5.8-, 5.4-, and 1.3-fold in presenceof 100 �M apo-SufU in the case of Fe(III)-dicitrate, Fe(III)-schizokinen, Fe(III)-aerobactin, and ferrichrome, respectively(Table 1). These data indicate that efficient product scaveng-ing can be a further strategy in vivo to enhance reduction effi-ciency of the available iron sources.Enzyme Inhibition with Ga(III)-Citrate and Ga(III)-Ferriox-

amine E—Because Fe(III) can be efficiently replaced in sid-erophores with redox inert Ga(III) because of their similarcoordination properties (56), we tested if such siderophoremimics would inhibit FchR-mediated ferric siderophore con-version. The standardized kinetic conditions were applied toinhibition tests using Fe(III)-dicitrate as substrate and Ga(III)-dicitrate and Ga(III)-ferrioxamine E as potential inhibitors.Initial studies revealed minor inhibitory effects for Ga(III)-dicitrate, although effects for Ga(III)-ferrioxamine E weresignificantly stronger. Because inhibitory effects were strictlydependent on the present substrate concentrations, competi-tive inhibition of Ga(III)- and Fe(III)-charged siderophores atthe FchR active site was predicted. The competitive inhibitionmode was verified during detailed inhibition studies with vari-ations of inhibitor and substrate concentrations in the initiallyobserved inhibition range. To determine inhibition constantsfor the two inhibitors, data of the inhibition series were ana-lyzed by Dixon plot method resulting in a Ki(Ga(III)-dicitrate) of86 �M and a Ki(Ga(III)-ferrioxamine E) of 14.5 �M (Fig. 5).Direct Binding Studies with Ferric Siderophores and FchR—

Because the kinetic analysis revealed a correlation betweencatalytic efficiency and siderophore redox potential, we at-tempted to analyze if FchR is able to specifically recognizedifferent ferric siderophores characterized by octahedral oxy-gen-mediated iron coordination, and next if binding of themetal-charged siderophore would alter the geometry of thecatalytically active Fe/S cofactor in a way that inner sphereelectron transfer could occur. To directly measure protein-ligand interactions between FchR and different substrates,catalytically inactive FchR bearing the oxidized Fe/S cofactorwas used to determine binding constants by fluorescence ti-tration. Iron-charged and noncharged forms of citrate, aer-obactin, desferrichrome, and desferrioxamine E were used asligands in titration experiments. Although noncharged formsdid not display binding within the micromolar range, the

tested ferric iron complexes showed KD values between �10and 100 �M with 18 � 1 �M for ferrioxamine E, 58 � 4 �M forferrichrome, 74 � 5 �M for Fe(III)-aerobactin, and 104 � 8

TABLE 1Kinetic data of FchR for various ferric siderophore substrates determined anaerobically in 50 mM Tris-HCl, pH 8.0, 100 mM NaCl at 25 °CNDmeans not determined.

Fe(III)-dicitrate Fe(III)-schizokinen Fe(III)-aerobactin Ferrichrome Ferrioxamine E Fe(III)-enterobactin

Km (�M) 110 � 8 93 � 4 96 � 24 68 � 10 26 � 2 NDKm (�M) in presence of 100 �M apo-SufU 94 � 6 49 � 5 55 � 5 52 � 6 ND NDkcat (min�1) 114 � 3 32 � 0.4 27 � 2 11 � 0.5 2 � 0.1 0.1kcat (min�1) in presence of 100 �M apo-SufU 214 � 7 98 � 7 84 � 5 26 � 3 ND NDkcat/Km (mM�1 s�1) 17.2 5.8 4.7 2.7 1.5 NDkcat/Km (mM�1 s�1) in presence of 100 �Mapo-SufU

37.8 33.5 25.1 8.3 ND ND

Specific activity (units/mg) 3.5 1.0 0.8 0.3 0.1 NDSpecific activity (units/mg) in presence of100 �M apo-SufU

6.6 3.0 2.6 0.8 ND ND

E�0 (pH 7.0) (mV) of free ligand � 0a ND -336b -400c -481d -750ea Data are from Ref. 6.b Data are from Ref. 77.c Data are from Ref. 78.d Data are from Ref. 79.e Data are from Ref. 17.

FIGURE 5. Inhibition studies with Ga(III)-charged redox-inert substratemimics. By applying the standard kinetic conditions, inhibition assays wereperformed with Fe(III)-dicitrate as FchR substrate and Ga(III)-dicitrate (A)and Ga(III)-desferrioxamine E (B) as potential inhibitors. To determine inhibi-tion constants, different Fe(III)-dicitrate concentrations were chosen (50,100, 200, and 400 �M), and concentrations of the inhibitors were variedfrom 0 to 70 �M in case of Ga(III)-dicitrate and 0 to 12.5 �M in case of Ga(III)-desferrioxamine E. Three independent measurements for each concentra-tion were performed; data were averaged and plotted with their standarddeviations according to the Dixon plot method. Ki values were determinedfrom corresponding curve intersections of the plotted diagrams.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�M for Fe(III)-dicitrate (Fig. 6A). Thus, the determined bind-ing affinities for these substrates were found to be in a similarrange within the same order of magnitude. This suggests thata common motif of these complexes is responsible for ligand-protein interaction. Because no binding of nonloaded sid-erophores was observed, formation of the octahedral iron-oxomotif seems to be essential for the substrate-dependentinteractions.In addition to the determination of enzyme-ligand binding

affinities, the possibility of Fe/S cluster rearrangement uponsubstrate binding was tested, which may occur upon occupa-tion of the inner coordination sphere of the metal-oxo centerduring electron transfer. For this purpose, reduced FchR withor without additional dithionite was incubated anaerobicallywith excess Ga(III)-dicitrate (500 �M) and varying amounts(0–200 �M) Fe(III)-dicitrate, which would allow us to trap an

interactive transition state between cofactor and substrate.Mixtures were analyzed by EPR and CD spectroscopy. In thecase of added Ga(III)-dicitrate, no significant changes of sig-nal pattern compared with the reduced FchR spectrum wereobserved. Further anaerobic addition of Fe(III)-dicitrate tothe mixture of FchR and Ga(III)-dicitrate resulted in stepwiseoxidation without changing the EPR-monitored Fe/S clustersignal. Addition of Fe(III)-dicitrate, which exceeded the re-duced FchR concentration in the presence of Ga(III)-dicitrate,led over a time period of 15 min to complete oxidation of thecluster, as monitored by CD (Fig. 6B), showing that the cata-lytic properties of FchR remained fully intact. Thus, becausecluster geometry was not found to be affected in the presenceof both redox-inert and redox-active metal-oxo centers, weinfer no direct interaction between Fe/S cofactor and sid-erophore substrate.Growth Analysis of an fchR Deletion Mutant—To test the in

vivo effect of FchR deficiency, a B. halodurans fchR deletionmutant was constructed by replacing the gene via homolo-gous recombination by a chloramphenicol resistance cassetteupon protoplast transformation. The obtained mutant strainwas subjected to growth studies in defined minimal medium.Cell density of �fchR under iron-limited conditions after en-try into stationary phase was about 25% of wild-type (WT)culture. However, addition of 100 �M Fe(III) restored growthto about 87% compared with WT under iron repletion (Fig.7A). In contrast, feeding of iron-limited WT and mutant cul-tures with 100 �M Fe(III)-dicitrate, Fe(III)-aerobactin, fer-richrome, and ferrioxamine E led to a strongly reduced mu-tant growth recovery that was not higher than about 30% incomparison with equally treated WT cultures. These datasuggested that FchR is essential for iron acquisition from bothcitrate and hydroxamate siderophores. We further tested theeffect of redox-inert siderophore mimics Ga(III)-dicitrate,Ga(III)-aerobactin, and Ga(III)-desferrioxamine E on iron-limited WT and �fchR cultures. Supplementation of 100 �M

of these compounds decreased WT growth to 1.7-, 2.3-, and1.3-fold, respectively, whereas mutant growth was not signifi-cantly affected (Fig. 7B). These data indicate that Ga(III)-loaded siderophores affect the FchR-dependent ferric sid-erophore reduction and may act as competitive inhibitors ofFchR in the bacterial cultures.ICP-MS Analysis Reveals That the fchR Mutant Accumu-

lates Iron Intracellularly—Because the fchRmutant showed astrongly reduced growth during iron deprivation, we analyzedthe metal content of the intracellular fractions of WT andmutant cells by using ICP-MS (Table 2). Strikingly, the fchRmutant was found to contain a 4.4-fold higher intracellulariron content than the WT. Under iron repletion (100 �M

FeCl3), the relative cytosolic iron level in �fchR shifted to 1.2-fold compared with the WT and thus was still higher evenunder conditions of extracellular iron excess. Although addi-tion of 1 mM citrate to iron-repleted cultures during mid-loggrowth phase still increased WT growth compared with iron-repleted cultures not supplemented with citrate, growth ofmutant cultures treated in the same way was not significantlyaffected, but intracellular iron content further increased 4.5-fold. To address if intracellular accumulations of iron in the

FIGURE 6. A, fluorescence titrations with oxidized (catalytically inactive)holo-FchR and various ferric siderophore substrates. Concentrations of 50�M FchR were used for titration with Fe(III)-dicitrate, Fe(III)-aerobactin, andferrichrome, and 20 �M FchR were used for titration with ferrioxamine E.Quenching curves obtained after tyrosine/tryptophan excitation at 280 nmby fluorescence emission at 340 nm were fitted to the law of mass action byassuming 1:1 stoichiometric binding. B, CD analysis of the [2Fe-2S] clusterspectrum of holo-FchR, either after aerobic purification or after quantitativereduction of the enzyme. Additionally, Ga(III)-dicitrate and Fe(III)-dicitratewere sequentially added to reduced holo-FchR under anaerobic conditionsafter each measurement to compare spectral changes upon redox-inert andredox-active substrate interaction.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

fchRmutant was dependent on the presence of ferric sid-erophore species, iron-limited cultures of WT and �fchR sup-plemented with 100 �M Fe(III)-dicitrate, Fe(III)-aerobactin,ferrichrome, and ferrioxamine E (see Fig. 7A) were subjectedto total cellular iron determination. Although supplementa-tion of ferric siderophores led to an intracellular increase ofiron content in the WT in the range of 2.5–7.5-fold, the in-crease was drastically higher in the mutant ranging fromabout 4.0- to 13.0-fold compared with nonsupplemented cul-tures. In contrast, supplementation with Ga(III)-charged sid-erophores (see Fig. 7B) led to a comparable accumulation ofgallium in both mutant and WT, although at a lower levelcompared with the iron accumulation (Table 2). Dependenton the chelator, intracellular accumulation of iron and gal-lium strongly varied, thus indicating that especially ferrioxam-ine E and Ga(III)-desferrioxamine E uptake rates were slowerthan those observed for Fe(III)-dicitrate or Fe(III)-aerobactin.In conclusion, FchR was found to be an essential componentof Fe(III)-dicitrate and ferric (citrate)-hydroxamate utilizationin iron-limited cell cultures. Its absence in �fchR led to distor-tion of iron homeostasis associated with strong cytosolic ironaccumulation, and its presence in WT made cells susceptiblefor growth inhibition caused by Ga(III)-charged substratemimics.

DISCUSSION

In this study, we present the first combined kinetic, inhibi-tory, and mechanistic analysis of a non-flavin-dependent FSRwithin bacterial systems. We discovered a pattern of associa-tion between ferric siderophore uptake systems and putativereductases with C-terminal Fe/S cluster-binding motif in sev-eral species of the Firmicutes group, in which the presence ofsubstrate-specific FSRs was not shown before. One of thesereductases, FchR, was characterized in B. halodurans andfound to possess similar and distinct features to the E. coliFhuF reductase. Although utilization of an Fe/S cofactor and asubstrate spectrum that includes hydroxamate siderophoreswas also described for FhuF, the differences to the FhuF-typereductases are significant. FchR was found to be a cytosolicenzyme and was not localized in cytoplasmic membrane frac-tions in contrast to E. coli FhuF (25, 26). The primary functionof FhuF was found to be associated with ferric hydroxamatereduction, especially of coprogen, ferrichrome, and ferriox-amine B (26). In contrast, FchR covers a broader range of fer-ric siderophores, including citrate-hydroxamates and car-boxylates. Furthermore, an fchRmutant was found to begrowth-limited during iron deprivation even in presence ofdifferent ferric siderophores, whereas a fhuFmutant was onlyfound to be affected during growth with ferrioxamine B assole iron source (57, 58). In both fhuFmutant (26) and fchRmutant, intracellular accumulation of iron in the presence ofdifferent ferric siderophores indicates that these reductasesare key enzymes for further cytosolic metabolization of theseiron sources. However, different routes of iron release via thehydrolytic triscatecholate-trilactone pathway or the reductivehydroxamate pathways may form bypasses for each other inE. coli, whereas B. halodurans obviously lacks hydrolytic re-lease pathways and hence fchR seems to be a general bottle-

TABLE 2ICP-MS-determined intracellular metal abundances given in ppmbased on dried cell weightFor analysis, B. haloduransWT and �fchR cells were grown in iron-limitedminimal medium at pH 9.5 to stationary phase with or without addition of iron orgallium compounds. In line three, 1 mM citrate was added during mid-log growthphase to cultures supplemented with 100 �M FeCl3.

Culture condition WT �fchR

�Fe(III)/�Ga(III) 46 � 4 199 � 5100 �M Fe(III) 323 � 8 388 � 7�1 mM citrate 317 � 5 1729 � 55100 �M Fe(III)-dicitrate 331 � 12 2345 � 68100 �M Fe(III)-aerobactin 255 � 7 2537 � 33100 �M ferrichrome 267 � 6 1604 � 21100 �M ferrioxamine E 112 � 5 756 � 9100 �M Ga(III)-dicitrate 32 � 2 57 � 3100 �M Ga(III)-aerobactin 39 � 3 39 � 1100 �M Ga(III)-desferrioxamine E 16 � 4 7 � 1

FIGURE 7. Growth analysis of B. halodurans WT (dark gray bars) and�fchR (light gray bars) in defined minimal medium supplemented withredox-active or redox-inert FchR substrates. A, cells were grown in iron-limited minimal medium without addition of iron (�Fe(III)) or with additionof either 100 �M FeCl3 (Fe(III)), Fe(III)-dicitrate (Fe(III)-DC), Fe(III)-aerobactin(Fe(III)-AB), ferrichrome (Fe(III)-FC), or ferrioxamine E (Fe(III)-FO). Absorbances(A600) of stationary cultures were monitored from three independentgrowth experiments, and averaged data were plotted with correspondingstandard deviations. B, cells were grown in modified iron-limited Belitskyminimal medium without addition of iron or gallium (�Fe(III)/Ga(III)) or withaddition of either 100 �M GaCl3 (Ga(III)), Ga(III)-dicitrate (Ga(III)-DC), Ga(III)-aerobactin (Ga(III)-AB), or Ga(III)-desferrioxamine E (Ga(III)-DFO). Cultures ofthree independent growth experiments each were grown to stationaryphase, and averaged absorbances (A600) were plotted with correspondingstandard deviations.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

neck for siderophore-dependent iron release processes. Theclose association of fchR with a ferric citrate-hydroxamateuptake system further differentiates it from lone-standingfhuf-type reductases in Enterobacteriaceae and points to itscoordinated expression during iron limitation together withferric substrate uptake genes. Interestingly, the substratespectrum of FchR includes both carboxylate- and (citrate)-hydroxamate-type siderophores, and there was a clear rela-tionship between redox potential of the enzyme Fe/S cofactorand the reductive potential of the ferric substrate. Thus, al-though translationally coupled with a ferric citrate-hydrox-amate uptake system specific for Fe(III)-schizokinen andFe(III)-aerobactin, the catalytic efficiency for Fe(III)-dicitratereduction was higher than for ferric citrate-hydroxamates.This suggests the possibility of effective substrate competitiondependent on the available iron source under native condi-tions. Although utilization of citrate as an iron source is arather ubiquitous feature due to its general presence in pri-mary metabolism, the utilization and availability of secondarymetabolite siderophores vary among habitats. Thus, in a spe-cies that primarily uses ferric siderophore reduction for ironassimilation in an alkaline environment that renders citrateinto a higher affinity siderophore than under neutral or acidicconditions, higher efficiency for Fe(III)-dicitrate conversion(in addition to its still favorable redox potential for fast ironrelease) may have been forced evolutionarily.The production of schizokinen as a citrate-hydroxamate-

type siderophore in B. halodurans is first shown in this study,and the putative schizokinen biosynthesis gene cluster thatadditionally contains a predicted major facilitator superfam-ily-type efflux transporter was identified as well. Togetherwith the substrate specificity of FchR and the uptake-associ-ated binding protein BH1037, a complete siderophore path-way for endogenous schizokinen utilization can now be sug-gested, which in B. halodurans includes seven genes(BH2618–BH2624) for biosynthesis and efflux and four genes(BH1037–BH1040) for uptake and cytosolic iron release (Fig.1, B and D).

The observed binding of different ferric substrates withmoderate to low affinities by FchR indicates a general relaxedrecognition of ferric siderophore complexes leading to prom-iscuity within the tested substrate spectrum. In contrast,binding of the apo-forms of these siderophores was not ob-served, indicating that the formation of the iron-oxo centersin the siderophore complexes were crucial for establishingprotein interaction. Although structural information is notpresent for FchR-type reductases, ferric siderophore bindingvia the oxygen donor atoms involved in ferric iron coordina-tion is a common theme in bacterial ferric siderophore bind-ing and receptor proteins (59–64), and the iron-oxo-depen-dent substrate recognition mode of FchR suggests thatbinding of this structural motif is essential during catalysis.Furthermore, Km values were found to correspond to KD val-ues of protein-substrate interaction especially for substratesthat have lower turnover rates. These low potential substratesshow saturation of catalysis at low concentrations, likely be-cause of longer interaction between substrate and proteinaccording to enzyme cofactor-limited electron transfer rates.

This further indicates that first-order rate constant k2 is gen-erally much lower than k�1 and further decreases with thedrop of substrate redox potential, again pointing to the inter-dependence of cofactor redox potential and substrate bindingaffinity during the reductive process.This leads to the definition of two different kinetic modes

established for substrates over a wide range of the redox po-tential scale as follows: high Km and kcat values for high redoxpotential substrates like Fe(III)-dicitrate and low Km and kcatvalues for low potential substrates within the group of hy-droxamates. The latter mode is possibly achieved by efficientbinding at the ferric-oxo center until electron transfer is com-pleted and fast product dissociation occurred. The mecha-nism of increasing binding affinities toward lower potentialsubstrates likely explains the capability of electron transfer tothose substrates ranging outside the effective Fe/S cluster re-dox potential such as ferrioxamine E which is about 70 mVbelow the determined midpoint range of �348 � 59 mV.However, strong limitations of transfer apparently occur ifsubstrate redox potentials range far below as in the case offerric triscatecholates, which were not observed to saturatecatalysis at high concentrations and which showed marginalturnover rates. Furthermore, the mechanism of electrontransfer seems not to involve a ternary complex formationbetween Fe/S cofactor, siderophore metal center, and sid-erophore donor atoms. Either the resulting species is kineti-cally too unstable that it cannot be trapped by redox-inertmetal centers or, more likely, charge transfer does not pro-ceed directly via cofactor interaction with the siderophoremetal center. This unlikely inner sphere electron transfer hasbeen reported so far only for metal chelate reduction by smallreducing molecules or free metal ions (7). Still, an innersphere electron transfer via a catalytically active residue thattransiently occupies the substrate metal coordination spherecannot be excluded. However, because kinetic exchange ratesbetween ferric ions and their siderophore ligands are gener-ally rather low (65), electron transfer via an outer spheremechanism is more likely in terms of fast reaction kineticsand could involve the intrinsic ligand-to-metal charge-trans-fer, which is mediated by the ligand donor atoms.Despite the capability of reducing substrates, including low

potential ferric hydroxamates, the strong enhancement ofcatalytic rates in the presence of an Fe(II) acceptor during thereaction suggests that iron release can be a rate-limiting stepduring iron assimilation if ferrous iron scavengers are eithersaturated or, on the other hand, not present in sufficientamounts. However, as shown previously, induction of iron-cofactor-binding proteins such as B. subtilis or E. coli sufgenes (66, 67) occurs during iron-limiting conditions, whichcould contribute to an increase of iron release rates by cytoso-lic iron sequestration. Thus, the enhancement of ferrous ironrelease observed in the presence of apo-SufU, which was mostlikely due to equilibrium displacements between free sub-strate (Fe(III)�L) and product (Fe(II)�L) concentrations, pointsto a possibility of shifting redox potentials in the cytosol aspredicted previously (18). Thus, the mechanism of releasediron scavenging by efficient intracellular sinks such as theFe/S cluster or heme assembly systems can be seen as a fur-




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ther mode of increasing the actual redox potentials of the FSRsubstrates. Because these intracellular systems are ubiquitous,this strategy can be referred to as a rather general one in addi-tion to compartment-specific mechanisms of low potentialincrease like extracellular or periplasmic acidification or theintracellular drain of iron during extracellular release that iscoupled with efficient uptake such as in the yeast FRE/FTR1-FET3 system (15). Interestingly, the highest ratios of 5–6-foldenhancement of catalytic efficiencies were observed forFe(III)-schizokinen and Fe(III)-aerobactin, not for Fe(III)-dicitrate, indicating limitations of increasing turnover ratesfor high potential substrates by product sequestration at leastunder the examined conditions in vitro. In summary of thepresent findings and previous knowledge, a current model ofcytosolic iron release mechanisms in bacterial systems is pre-sented (Fig. 8).A further observation made during this study was that

Ga(III)-charged siderophores can act competitively as inhibi-tors of reductive iron release in vitro and in cell culture. Invitro, Fe(III)-dicitrate is effectively competed by Ga(III)-des-ferrioxamine with a low micromolar Ki value and less effec-tively by Ga(III)-dicitrate, which is in agreement with the dif-ferent binding constants found for the ferric complexes ofthese chelators. Because single turnover of Fe(III)-dicitrate inthe presence of excess of Ga(III)-dicitrate occurred withinseveral minutes as observed during CD measurements, FchRinhibition by these mimics may not only depend on direct

competition with the ferric substrate at the substrate-bindingsite but may further interfere with the regeneration of theFchR reduction potential during multistep catalysis. Inhibi-tion in vivo further depends on the uptake capacity forGa(III)-loaded siderophores. Ga(III)-aerobactin and Ga(III)-dicitrate were taken up with similar efficiency, and Ga(III)-aerobactin showed the most significant inhibition of growth,whereas Ga(III)-desferrioxamine was taken up poorly andthus had no stronger growth inhibitory effect, in contrast toits stronger inhibitory effect shown in vitro. The inhibitoryeffect of redox-inert siderophore mimics was clearly demon-strated here for the FchR-dependent growth of the B. halo-duransWT strain showing a strong contrast to the �fchRmu-tant. Interestingly, the utilization of iron source mimeticsbased on gallium as a pharmacologically studied and Foodand Drug Administration-approved metal (68–69) has al-ready shown to be successful during animal infection modelstudies using P. aeruginosa and Francisella tularensis (70, 71).Thus, the inhibition study presented here provides a furtherrationale for observed antibiotic effects of gallium-sid-erophore mimetics and may underlie further therapeutic in-vestigations. These may include pathogens that are predictedto use reductive iron release strategies within their virulence-relevant siderophore pathways, as for example Bacillus an-thracis and Bacillus cereus (72),Mycobacterium tuberculosis(73, 74), Y. enterocolitica (73), P. aeruginosa (73, 75), or Staph-ylococcus aureus (76).

FIGURE 8. Current model of cytosolic iron release systems in Gram-positive and Gram-negative bacteria. On the left side, the pathway for iron releaseby specific hydrolysis of intrinsic siderophore ester linkages in trilactone scaffolds such as ferric enterobactin (hydrolyzed by E. coli Fes) or ferric bacillibactin(hydrolyzed by B. subtilis BesA) is indicated. On the right side, specific and unspecific reactions for ferric siderophore reduction are depicted. Reaction withenzymes encoded by iron-regulated genes and specifically interacting with a certain group of ferric siderophores are represented by Fe/S cluster-depen-dent E. coli FhuF (most specific for ferrioxamine B) and B. halodurans FchR (most specific for ferric dicitrate and ferric citrate-hydroxamates). Furthermore,unspecific possibilities of reduction (at least observed in vitro) are indicated by E. coli Fre and Fpr transferring electrons via released or stably bound flavin(Fl) cofactors, respectively. As shown in this study, iron-scavenging apoproteins such as Fe/S cluster assembly proteins and, putatively, further iron sinkssuch as heme and storage proteins can be regarded as (direct or indirect) acceptors of the released cytosolic iron. The intracellular binding capacity of ironmay serve both as an enhancer or buffer of the upstream release reactions, mainly by influencing the actual cytosolic ferric siderophore redox potentials.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Acknowledgments—We thank Dr. Uwe Linne and Natalia Fritzlerfor help with mass spectrometric analysis; Dr. Olaf Burghaus forsupporting EPR analysis; Dr. Jurgen Knoll and David Nette for as-sistance with ICP-MS analysis; Alexander Albrecht for providingrecombinant SufU protein, and Christiane Bomm for technicalassistance.

REFERENCES1. Hider, R. C., and Kong, X. (2010) Nat. Prod. Rep. 27, 637–6572. Andrews, S. C., Robinson, A. K., and Rodríguez-Quinones, F. (2003)

FEMS Microbiol. Rev. 27, 215–2373. Namba, K., and Murata, Y. (2010) Chem. Rec. 10, 140–1504. Devireddy, L. R., Hart, D. O., Goetz, D. H., and Green, M. R. (2010) Cell

141, 1006–10175. Miethke, M., and Marahiel, M. A. (2007)Microbiol. Mol. Biol. Rev. 71,

413–4516. Schroder, I., Johnson, E., and de Vries, S. (2003) FEMS Microbiol. Rev.

27, 427–4477. Harrington, J. M., and Crumbliss, A. L. (2009) Biometals 22, 679–6898. Froissard, M., Belgareh-Touze, N., Dias, M., Buisson, N., Camadro, J. M.,

Haguenauer-Tsapis, R., and Lesuisse, E. (2007) Traffic 8, 1601–16169. Raymond, K. N., Muller, G., and Matzanke, B. F. (1984) Top. Curr.

Chem. 123, 49–10210. Lin, H., Fischbach, M. A., Liu, D. R., and Walsh, C. T. (2005) J. Am.

Chem. Soc. 127, 11075–1108411. Zhu, M., Valdebenito, M., Winkelmann, G., and Hantke, K. (2005)Mi-

crobiology 151, 2363–237212. Miethke, M., Klotz, O., Linne, U., May, J. J., Beckering, C. L., and Ma-

rahiel, M. A. (2006)Mol. Microbiol. 61, 1413–142713. Abergel, R. J., Zawadzka, A. M., Hoette, T. M., and Raymond, K. N.

(2009) J. Am. Chem. Soc. 131, 12682–1269214. Kragl, C., Schrettl, M., Abt, B., Sarg, B., Lindner, H. H., and Haas, H.

(2007) Eukaryot. Cell 6, 1278–128515. Yun, C. W., Bauler, M., Moore, R. E., Klebba, P. E., and Philpott, C. C.

(2001) J. Biol. Chem. 276, 10218–1022316. Lesuisse, E., Casteras-Simon, M., and Labbe, P. (1995) Anal. Biochem.

226, 375–37717. Loomis, L. D., and Raymond, K. N. (1991) Inorg. Chem. 30, 906–91118. Pierre, J. L., Fontecave, M., and Crichton, R. R. (2002) Biometals 15,

341–34619. Ingelman, M., Ramaswamy, S., Niviere, V., Fontecave, M., and Eklund,

H. (1999) Biochemistry 38, 7040–704920. Coves, J., Eschenbrenner, M., and Fontecave, M. (1993) Biochem. Bio-

phys. Res. Commun. 192, 1403–140821. Xia, M., Wei, J., Lei, Y., and Ying, L. (2007) Curr. Microbiol. 55, 71–7522. Poole, R. K., Rogers, N. J., D’mello, R. A., Hughes, M. N., and Orii, Y.

(1997)Microbiology 143, 1557–156523. Takeda, K., Sato, J., Goto, K., Fujita, T., Watanabe, T., Abo, M., Yo-

shimura, E., Nakagawa, J., Abe, A., Kawasaki, S., and Niimura, Y. (2010)Biometals 23, 727–737

24. Cowart, R. E. (2002) Arch. Biochem. Biophys. 400, 273–28125. Muller, K., Matzanke, B. F., Schunemann, V., Trautwein, A. X., and

Hantke, K. (1998) Eur. J. Biochem. 258, 1001–100826. Matzanke, B. F., Anemuller, S., Schunemann, V., Trautwein, A. X., and

Hantke, K. (2004) Biochemistry 43, 1386–139227. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989)Molecular Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY

28. Bradford, M. M. (1976) Anal. Biochem. 72, 248–25429. Netz, D. J., Stumpfig, M., Dore, C., Muhlenhoff, U., Pierik, A. J., and Lill,

R. (2010) Nat. Chem. Biol. 6, 758–76530. Miethke, M., and Skerra, A. (2010) Antimicrob. Agents Chemother. 54,

1580–158931. Fischbach, M. A., Lin, H., Liu, D. R., and Walsh, C. T. (2005) Proc. Natl.

Acad. Sci. U.S.A. 102, 571–57632. Batie, C. J., and Kamin, H. (1981) J. Biol. Chem. 256, 7756–7763

33. Tagawa, K., and Arnon, D. I. (1968) Biochim. Biophys. Acta 153,602–613

34. Dykes, J., and Davis, D. J. (1982) Arch. Biochem. Biophys. 218, 46–5035. Albrecht, A. G., Netz, D. J., Miethke, M., Pierik, A. J., Burghaus, O.,

Peuckert, F., Lill, R., and Marahiel, M. A. (2010) J. Bacteriol. 192,1643–1651

36. Dixon, M. (1953) Biochem. J. 55, 170–17137. Kim, L., Mogk, A., and Schumann, W. (1996) Gene 181, 71–7638. Wach, A. (1996) Yeast 12, 259–26539. Gilmour, R., and Krulwich, T. A. (1997) J. Bacteriol. 179, 863–87040. Usami, R., Kudo, T., and Horikoshi, K. (1990) Starch 42, 230–23241. Stulke, J., Hanschke, R., and Hecker, M. (1993) J. Gen. Microbiol. 139,

2041–204542. Arnow, L. E. (1937) J. Biol. Chem. 118, 531–53743. Gillam, A. H., Lewis, A. G., and Andersen, R. J. (1981) Anal. Chem. 53,

841–84444. Valdebenito, M., Crumbliss, A. L., Winkelmann, G., and Hantke, K.

(2006) Int. J. Med. Microbiol. 296, 513–52045. Takami, H., Nakasone, K., Takaki, Y., Maeno, G., Sasaki, R., Masui, N.,

Fuji, F., Hirama, C., Nakamura, Y., Ogasawara, N., Kuhara, S., and Hori-koshi, K. (2000) Nucleic Acids Res. 28, 4317–4331

46. McMillan, D. G., Velasquez, I., Nunn, B. L., Goodlett, D. R., Hunter,K. A., Lamont, I., Sander, S. G., and Cook, G. M. (2010) Appl. Environ.Microbiol. 76, 6955–6961

47. Storey, E. P., Boghozian, R., Little, J. L., Lowman, D. W., andChakraborty, R. (2006) Biometals 19, 637–649

48. Mullis, K. B., Pollack, J. R., and Neilands, J. B. (1971) Biochemistry 10,4894–4898

49. Byers, B. R., Powell, M. V., and Lankford, C. E. (1967) J. Bacteriol. 93,286–294

50. Challis, G. L. (2005) ChemBioChem 6, 601–61151. Ollinger, J., Song, K. B., Antelmann, H., Hecker, M., and Helmann, J. D.

(2006) J. Bacteriol. 188, 3664–367352. Vecerek, B., Moll, I., and Blasi, U. (2007) EMBO J. 26, 965–97553. Horikoshi, K. (1999)Microbiol. Mol. Biol. Rev. 63, 735–75054. Adjimani, J. P., and Owusu, E. (1997) J. Inorg. Biochem. 66, 247–25255. Riboldi, G. P., Verli, H., and Frazzon, J. (2009) BMC Biochem. 10, 356. Emery, T. (1986) Biochemistry 25, 4629–463357. Nelson, M., Carrano, C. J., and Szaniszlo, P. J. (1992) Biometals 5, 37–4658. Hantke, K. (1987)Mol. Gen. Genet. 210, 135–13959. Peuckert, F., Miethke, M., Albrecht, A. G., Essen, L. O., and Marahiel,

M. A. (2009) Angew. Chem. Int. Ed. Engl. 48, 7924–792760. Locher, K. P., Rees, B., Koebnik, R., Mitschler, A., Moulinier, L., Rosen-

busch, J. P., and Moras, D. (1998) Cell 95, 771–77861. Grigg, J. C., Cooper, J. D., Cheung, J., Heinrichs, D. E., and Murphy,

M. E. (2010) J. Biol. Chem. 285, 11162–1117162. Clarke, T. E., Ku, S. Y., Dougan, D. R., Vogel, H. J., and Tari, L. W. (2000)

Nat. Struct. Biol. 7, 287–29163. Muller, A., Wilkinson, A. J., Wilson, K. S., and Duhme-Klair, A. K.

(2006) Angew. Chem. Int. Ed. Engl. 45, 5132–513664. Clarke, T. E., Braun, V., Winkelmann, G., Tari, L. W., and Vogel, H. J.

(2002) J. Biol. Chem. 277, 13966–1397265. Tufano, T. P., Pecoraro, V. L., and Raymond, K. N. (1981) Biochim. Bio-

phys. Acta 668, 420–42866. Chillappagari, S., Seubert, A., Trip, H., Kuipers, O. P., Marahiel, M. A.,

and Miethke, M. (2010) J. Bacteriol. 192, 2512–252467. Patzer, S. I., and Hantke, K. (1999) J. Bacteriol. 181, 3307–330968. Bernstein, L. R. (1998) Pharmacol. Rev. 50, 665–68269. Kaneko, Y., Thoendel, M., Olakanmi, O., Britigan, B. E., and Singh, P. K.

(2007) J. Clin. Invest. 117, 877–88870. Banin, E., Lozinski, A., Brady, K. M., Berenshtein, E., Butterfield, P. W.,

Moshe, M., Chevion, M., Greenberg, E. P., and Banin, E. (2008) Proc.Natl. Acad. Sci. U.S.A. 105, 16761–16766

71. Olakanmi, O., Gunn, J. S., Su, S., Soni, S., Hassett, D. J., and Britigan,B. E. (2010) Antimicrob. Agents Chemother. 54, 244–253

72. Hotta, K., Kim, C. Y., Fox, D. T., and Koppisch, A. T. (2010)Microbiol-ogy 156, 1918–1925

73. Crosa, J. H., and Walsh, C. T. (2002)Microbiol. Mol. Biol. Rev. 66,




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

223–24974. Ryndak, M. B., Wang, S., Smith, I., and Rodriguez, G. M. (2010) J. Bacte-

riol. 192, 861–86975. Mossialos, D., Ochsner, U., Baysse, C., Chablain, P., Pirnay, J. P., Koe-

dam, N., Budzikiewicz, H., Fernandez, D. U., Schafer, M., Ravel, J., andCornelis, P. (2002)Mol. Microbiol. 45, 1673–1685

76. Dale, S. E., Doherty-Kirby, A., Lajoie, G., and Heinrichs, D. E. (2004)

Infect. Immun. 72, 29–3777. Harris, W. R., Carrano, C. J., and Raymond, K. N. (1979) J. Am. Chem.

Soc. 101, 2722–272778. Wawrousek, E. F., and McArdle, J. V. (1982) J. Inorg. Biochem. 17,

169–18379. Spasojevic, I., Armstrong, S. K., Brickman, T. J., and Crumbliss, A. L.

(1999) Inorg. Chem. 38, 449–454




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

MarahielMarcus Miethke, Antonio J. Pierik, Florian Peuckert, Andreas Seubert and Mohamed A.

from a Gram-positive ExtremophileIdentification and Characterization of a Novel-type Ferric Siderophore Reductase

doi: 10.1074/jbc.M110.192468 originally published online November 4, 20102011, 286:2245-2260.J. Biol. Chem.

10.1074/jbc.M110.192468Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/286/3/2245.full.html#ref-list-1

This article cites 78 references, 24 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M110.192468

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;286/3/2245&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/286/3/2245

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=286/3/2245&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/286/3/2245

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/286/3/2245.full.html#ref-list-1

http://www.jbc.org/

identificationandcharacterizationofanovel-typeferric ... · fhuf contains a c-terminal iron-sulfur...

Documents