ijmeg0005-0125
DESCRIPTION
artikelTRANSCRIPT
Int J Mol Epidemiol Genet 2014;5(3):125-134www.ijmeg.org /ISSN:1948-1756/IJMEG0001465Original Article Molecular detection of virulence genes as markers in Pseudomonas aeruginosa isolated fromurinary tract infections Neha Sabharwal, Shriya Dhall, Sanjay Chhibber, Kusum HarjaiDepartment of Microbiology, Basic Medical Sciences Block-I, South Campus, Panjab University, Chandigarh, India, 160014Received July 19, 2014; Accepted September 10, 2014; Epub October 22, 2014; Published October 30, 2014Abstract:CatheterassociatedurinarytractinfectionsbyP.aeruginosaarerelatedtovarietyofcomplications. Quorumsensingandrelatedcircuitryguarditsvirulencepotential.ThoughP.aeruginosaaccountsforanappre-ciable amount of virulence factors, this organism is highly unstable phenotypically. Thus, genotyping of clinical iso-lates of P. aeruginosa is of utmost importance for understanding the epidemiology of infection. This may contribute towards development of immunotherapeutic approaches against this multi drug resistant pathogen. Moreover, no epidemiological study has been reported yet on uroisolates of P. aeruginosa. Thus this study was planned to obtain information regarding presence, distribution and rate of occurrence of quorum sensing and some associated viru-lence genes at genetic level. The profling of quorum sensing genes lasI, lasR, rhlI, rhlR and virulence genes like toxA, aprA, rhlAB, plcH, lasB and fiC of twelve strains of P. aeruginosaisolated from patients with UTIs was done by direct PCR. The results showed variable distribution of quorum sensing genes and virulence genes. Their percent-age occurrence may be specifcally associated with different levels of intrinsic virulence and pathogenicity in urinary tract.SuchinformationcanhelpinidentifyingthesevirulencegenesasusefuldiagnosticmarkersforclinicalP. aeruginosa strains isolated from UTIs. Keywords: Epidemiology, PCR, Pseudomonas aeruginosa, urinary tract infections, quorum sensingIntroductionP. aeruginosa is one of the most important nos-ocomialpathogenresponsibleforavarietyof infectionswithlimitedtherapeuticoptions becauseofitsantibioticresistance[1].Itpro-ducesimpressivearrayofvirulencefactors, whosecoordinatedexpressionisregulatedby differentregulatorysystems.Arecentsurvey showedthatP.aeruginosaisoneofthemost frequent pathogen isolated from ICU (Intensive careunit)-acquiredinfections[2].Catheter associated urinary tract infections (CAUTIs) are responsiblefor40%ofnosocomialinfections. P.aeruginosawithinthecatheterfrequently developsasbioflmbydirectlyattachingtoits surface.Thesesurface-associated,matrix-enclosed, microbial communities are responsi-ble for chronicity and recurrence of such infec-tionsleadingtohighmorbidityandmortality [3].Onceestablished,bacteriacommunicate with each other to coordinate the expression of specifc genes in a cell density-dependent fash-ion.Quorumsensing(QS)viaacyl-homoserine lactone(HSL),controlstheexpressionofan arrayofvirulencegenesinP.aeruginosa.The autoinducersynthase,LasI,synthesisesN-(3-oxododecanoyl)homoserinelactone(3OC12-HSL),whichregulatestheproductionofelas-tase,exotoxinAandalkalineprotease,while RhlIsynthesizestheautoinducerN-butyryl homoserinelactone(C4-HSL),whichregulates theproductionofrhamnolipid,alkalineprote-ase,elastase,cyanideandpyocyanin[4,5]. Because of the regulatory control of production of virulence factors, QS mechanisms are being proposed as a novel target for development of innovativestrategiestocontrolinfections. Moreover,importanceofQSintheestablish-ment of a successful infection has been shown in different types of animal model studies such asacutepulmonaryinfection,burnwound infection, microbial keratitis, chronic lung infec-tion and urinary tract infections [6-10]. Virulence gene distribution in P. aeruginosa UTI126Int J Mol Epidemiol Genet 2014;5(3):125-134Table 1. The conditions used for the PCR amplifcation of QS and virulence genes in P. aeruginosa strainsThe amplifcation programGene Initial DenaturationNo. of cyclesDenaturation AnnealingPrimerextensionFinalextensionlasI 95C, 2 min. 30 95C, 40 sec. 50C/60C, 1 min. 72C, 2 min. 72C, 10 min.lasR 60C, 1 min.rhlI 60C, 1 min.rhlR 60C, 1 min.toxA 95C, 2 min. 30 95C, 40 sec. 50C, 1 min. 72C, 2 min.aprA 65C, 1 min.rhlAB 95C, 5 min. 35 95C, 30 sec. 52C, 30 sec. 72C, 30 sec.plcH 55C, 30 sec.lasB 55C, 30 sec.fiC 95C, 2 min. 30 95C, 40 sec. 55C, 1 min. 72C, 2 min.Phenotypictypingmethodssuchasbiotyping, serotyping, bacteriocin typing and anti-microbi-al testing are available in literature. However, P. aeruginosa is phenotypically very unstable and therefore genotyping tend to be of great value. Infact, an understanding about the distribution of virulence genes in clinical strains can help in understandingtheepidemiologyofinfections. DetectionandidentifcationofQSsignalspro-vided information about the expression of viru-lencecomponentsoftheinfectingpathogen [9]. Scarcity of literature exists regarding genotypic analysis of P. aeruginosa responsible for caus-ingCAUTIs.Dependinguponthesiteandtype of infection, importance and role of a particular virulence factor may differ in a particular strain. However,distributionofvirulencegenesmay be different in UTI strains of P. aeruginosa, as no specifc virulence genotype has been asso-ciatedwithsuchstrains,rathercontradictory reports exist in nature. Role of QS is well estab-lished in P. aeruginosa induced microbial kera-titis, cystic fbrosis [8], pneumonia [6] as well as ithasbeenfoundtobenecessaryduringUTI [11]. Its role in UTI is controversial as some QS defcient clinical strains have been shown to be capableofcausingclinicalinfectionsofthe humansaswell[10,12].Thus,thepresent study was planned to identify specifc virulence genotypeinP.aeruginosaclinicaluroisolates. Virulence genes in this study were selected on thebasisoftheirimportance.Isolateswere screenedforQSsystems,alkalineprotease (aprA),rhamnolipidAB(rhlAB),phospholipase (plcH)andelastase(lasB).Theywerealso screenedforexotoxinA(toxA)whichishighly conservedinP.aeruginosaandnotinother species of this genus. Highly conserved fagel-linbandheterologousfagellinawerealso screened in the uroisolates. The study provides informationaboutthepercentageoccurrence anddistributionofQSandsomeassociated virulencegenes.Informationobtainedfrom such studies may provide an insight into identi-fyingvirulencegenesasusefuldiagnostic markers which may further contribute towards development of immunotherapeutic approach-es for treating UTIs caused by P. aeruginosa. MethodsClinical strains and phenotypic identifcationTwelve clinical strains of P. aeruginosa isolated frompatientswithUTIsobtainedfrom GovernmentMedicalCollegeandHospital, Chandigarh, India, were examined. The isolates werecheckedforpurity,identifedbycolony morphology,oxidasetestandbiochemical reactionsspecifctoPseudomonas.Inthis study,onewelldefnedlaboratorystrain Pseudomonas aeruginosa PAO1 was also used as a positive control. Standard strain PAO1 was generouslyprovidedbyProf.BarbaraH.Iglewski,UniversityofRochester,NewYork, U.S.A. The strains were grown in Luria Bertani (LB) (HiMedia) and maintained in 50% glycerol and stored at -20C. Gradient PCR amplifcationFor the molecular characterization of the genet-ic support of QS (las and rhl), extracellular viru-Virulence gene distribution in P. aeruginosa UTI127Int J Mol Epidemiol Genet 2014;5(3):125-134lencefactors(exotoxinA,alkalineproteaseA, rhamnolipid,phospholipase,elastase)andini-tialcolonizationfactorfagellin(fiC),genomic DNAwasextractedfromtwelveselectedP. aeruginosa strains and from P. aeruginosa ref-erencestrainPAO1.Onecolonyofeachstrain cultured on solid medium was inoculated into 5 mlofLBandgrownovernightat37Cwith shaking.Fromthesecultures,DNAextraction was performed by using DNA extraction mini kit (Favorgen) according to the manufacturers rec-ommendations. At different annealing tempera-tures(50C,55C,60C,65C),amplifcation of above mentioned genes was carried out with PAO1DNA.Bestannealingtemperature (intenseampliconbandwithnoprimerdim-mers)waschosenfortheproflingofclinical strains. PCR protocolAmplifcationswerecarriedoutin25lvol-umescontainingtemplateDNA(50ng),Taq buffer(1X),DMSO(Dimethylsulfoxide), Magnesiumchloride(2mM),eachprimer(10 pM/l),nucleotides(dATP,dCTP,dGTP,dTTP) (200M,ThermoScientifc)andTaqpoly-phospholipaseH(plcH),elastase(lasB)[7].A setofconservedoligonucleotideprimers CW45, CW46 [16] was also used to analyse fa-gellinsubtypesintheclinicalstrains.The sequencesofspecifcprimersusedinPCR reactionsandthemolecularweightofthe obtainedampliconsarepresentedinTable2. After amplifcation, 10 l sample was subjected toelectrophoresisonastandard1%agarose gel for 1 h at 100 V, stained with ethidium bro-mide(Sigma)anddetectedbyUVtransillu- mination.Results PCR assay for QS genesTheresultsshoweddifferentdistributionof lasI, lasR, rhlI and rhlR genes in P. aeruginosa strains.TheprimersusedfordetectionofQS genesallowedtheamplifcationofthewhole genes.Nine(75%)strainsnamelyB1,B2,B3, B4,B5,B6,B7,B9andB12werepositivefor lasI gene giving amplifcation at 60C at 295 bp (Figure 1). Similarly B2, B3, B5, B6, B7, B8, B9, B11 and B12 were positive (75%) for lasR gene whichgaveamplifcationat60Cat130bp Table 2. The primer sequences used in PCR assays for QS and virulence genes detection in P. aeruginosa strainsGene Primer Nucleotide Sequence Amplicon size lasI forward 5 CGTGCTCAAGTGTTCAAGG 3 295 bpreverse 5 TACAGTCGGAAAAGCCCAG 3lasR forward 5 AAGTGGAAAATTGGAGTGGAG 3 130 bpreverse 5 GTAGTTGCCGACGACGATGAAG 3rhlI forward 5 TTCATCCTCCTTTAGTCTTCCC 3 155 bpreverse 5 TTCCAGCGATTCAGAGAGC 3rhlR forward 5 TGCATTTTATCGATCAGGGC 3 133 bpreverse 5 CACTTCCTTTTCCAGGACG 3toxA forward 5 GGAGCGCAACTATCCCACT 3 150 bpreverse 5 TGGTAGCCGACGAACACATA 3aprA forward 5 GTCGACCAGGCGGCGGAGCAGATA 3 993 bpreverse 5 GCCGAGGCCGCCGTAGAGGATGTC 3rhlAB forward 5 TCATGGAATTGTCACAACCGC 3 151 bpreverse 5 ATACGGCAAAATCATGGCAAC 3plcH forward 5 GAAGCCATGGGCTACTTCAA 3 307 bpreverse 5 AGAGTGACGAGGAGCGGTAG 3lasB forward 5 TTCTACCCGAAGGACTGATAC 3 153 bpreverse 5 AACACCCATGATCGCAAC 3fiC CW45 forward 5 GGCAGCTGGTTNGCCTG 3 1.02 kb (type a)CW46 reverse 5 GGCCTGCAGATCNCCAA 3 1.25 kb (type b)merase(1U/l,FIR- Epol).Amplifcations werecarriedoutina BioradThermalCycler for30cyclesconsist-ingofpre-denatur-ation, denaturation, an- nealing,extensionand postelongation.The parameters for the am- plifcationcyclesused ineachPCRexperi-mentarerepresented in Table 1. A set of oli-gonucleotideprimers (EurofnsGenomics) that allowed to amplify wholeQSgenes(lasI, lasR, rhlI and rhlR) [13] wereselected.Also, PCR assays were used todetecttheextracel-lularvirulencegenes encodingalkalinepro-tease(aprA)[14],exo-toxinA(toxA)[15]and rhamnolipid AB (rhlAB), Virulence gene distribution in P. aeruginosa UTI128Int J Mol Epidemiol Genet 2014;5(3):125-134(Figure 2). Five out of twelve strains (41.6%) B3, B6, B7, B8 and B11 were positive for the pres-enceofrhlIgene,givingamplifcationat60C at155bp(Figure3).rhlRgenewasfoundin sevenstrains(58.3%)B2,B3,B4,B5,B7,B8 and B11, giving amplifcation at 60C at 133 bp (Figure 4 and Table 3). PCR assay for virulence genes (fiC, toxA, aprA, lasB, plcH, rhlAB)Inthepresentstudy,clinicalstrainswere screenedfortheprevalenceofdifferentviru-lence genes of P. aeruginosa. Surprisingly, aprA gene had lowest occurrence of 16.6% in only 2 strains,B4andB8(Figure5).Theprevalence oflasBandplcHwasfoundin75%ofstrains (Figures 6 and 7 respectively). lasB was found Figure1.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationoflasIgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strainsofP.aeruginosa(lasIgeneproductsat295 bp).Figure2.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationoflasRgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (lasR gene products at 130 bp).Figure3.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationofrhlIgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strainsofP.aeruginosa(rhlIgeneproductsat155 bp).Figure4.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationofrhlRgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (rhlR gene products at 133 bp).Virulence gene distribution in P. aeruginosa UTI129Int J Mol Epidemiol Genet 2014;5(3):125-134strainsnamelyB1,B2,B3,B6,B7andB8 (Figure 8). 100% prevalence of toxA gene was found in all analyzed strains (Figure 9). P. aeru-ginosa PAO1 was found to have b-type fagel-lin, giving PCR amplifcation at 1.25 kb. Strains B1, B5 and B6 showed b-type fagellin. Strains Table 3. The distribution of virulence genes among P. aeruginosa strains Source of strain isolationThe percent (%) of positive strains for genes encoding different virulence factorsUrinary Tract lasI lasR rhlI rhlR toxA aprA rhlAB plcH lasB fiC75% 75% 41.6% 58.3% 100% 16.6% 50% 75% 75% 58.3%a bB1 + - - - + - + + + - +B2 + + - + + - + + + - -B3 + + + + + - + + + - -B4 + - - + + + - + - + -B5 + + - + + - - - + - +B6 + + + - + - + + - - +B7 + + + + + - + - + - -B8 - + + + + + + + + + -B9 + + - - + - - + - - -B10 - - - - + - - + + + -B11 - + + + + - - + + + -B12 + + - - + - - - + - -Figure5.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationofaprAgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (aprA gene products at 993 bp).positive for strains B1, B2, B3, B5, B7, B8, B10, B11andB12.plcHwasfoundpositivefor strainsB1,B2,B3,B4,B6,B8,B9,B10and B11. rhlAB was found to be positive in 50% of Figure6.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationoflasBgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (lasB gene products at 153 bp).Virulence gene distribution in P. aeruginosa UTI130Int J Mol Epidemiol Genet 2014;5(3):125-134B4, B8, B10 and B11 showed a-type fagellin givingPCRamplifcationat1.02kb.Non-fagellar strains were: B2, B3, B7, B9 and B12, whichsurprisinglyshowednoamplifcation (Figure10).PercentagefiCoccurrencewas found to be 58.3% (25% b-type fagellin, 33% a-type) (Table 3). Figure7.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationofplcHgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (plcH gene products at 307 bp).Figure8.AgarosegelelectrophoresisofPCRprod-ucts after amplifcation of rhlAB gene. MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (rhlAB gene products at 151 bp).Figure9.AgarosegelelectrophoresisofPCRprod-uctsafteramplifcationoftoxAgene.MWM-molec-ularweightmarker(100bpDNAladder,#DL004, Geneaid),+C-PAO1controlDNA,B1-B12-different strains of P. aeruginosa (toxA gene products at 150 bp). Figure 10. Agarose gel electrophoresis of PCR prod-ucts after amplifcation of fiC gene. MWM-molecular weightmarker(ORangeRuler200bpDNAladder, #SM0633,Fermentas),+C-PAO1controlDNA,B1-B12-differentstrainsofP.aeruginosa(fiCgene products at 1.02 kb and 1.25 kb).Virulence gene distribution in P. aeruginosa UTI131Int J Mol Epidemiol Genet 2014;5(3):125-134DiscussionThelargegenomeanditsgeneticcomplexity allow P. aeruginosa to thrive in diverse ecologic conditions. Multiple bacterial virulence factors impact the pathogenesis of P. aeruginosa infec-tions.Thecombinationofvirulencefactors expressed by each P. aeruginosa strain tend to determinetheoutcomeofaninfectiouspro-cess. However, in the clinical cases, it is often diffcult to distinguish between simple coloniza-tionandinfection,andnodiagnostictoolis available to assess the virulence potential of a given isolate [17]. Taking into account the poor availabilityofinformationonthepatternsof virulencefactorspossessedbyP.aeruginosa strains isolated from patients with CAUTIs, the genetic profling of virulence determinants was carried out. P. aeruginosa possesses two QS systems, Las andRhl.Isolatesobtainedfrompatientswith lower respiratory tract, non-surgical or surgical woundinfectionsandsputaofcysticfbrosis patients showed high percentage of functional QS systems (97.5%) [12]. Similarly, all analysed isolatesfromrespiratorytract,woundsecre-tions and from patients with cardiovascular sur-geryassociatedinfectionspossessedQS genes(100%)[7].Inthepresentstudy,allthe strains were found to have varied distribution of individualQSgenes.Theprimersusedfor detection of QS genes allowed the amplifcation of the whole genes. All the four QS genes were notdetectedinanyofthestrainstested. Senturk et al. revealed that lasI, lasR, rhlI, rhlR genes may be differently distributed in clinical isolates.However,presenceofallfourQS genes may not be necessarily indicative of phe-notypicproductionofC4-HSLandC12-HSL. These defciencies were linked to combinations of point mutation [10]. The two QS systems do notoperateindependently.LasR-C12-HSL complexpositivelyregulatestranscriptionof RhlRandRhlI.ExpressionofrhlRisnotonly dependentonLasR,butonRhlRitself[18]. Since the circuitry is interlinked, the absence of any of the component in clinical strains did not compromise their ability for phenotypic expres-sion of QS system [10, 12]. AnotherimportantP.aeruginosavirulence determinantisalkalineprotease.Theproteas-es promote the development of bacteria within theinfectedhostandinterferewiththehost immune system. Only 30 - 40% of strains from ear,bloodandlungsshowedhighprotease activity [19]. Uroisolates of P. aeruginosa in our study showed least presence of alkaline prote-ase(16.6%),indicatingthatalkalineprotease may not be playing a very important role in the pathogenesis of UTI. This was also indicated in anotherstudyfromourlaboratorywhere50% ofstrainspossessingalkalineproteasewere althoughabletocolonizekidneytissue,but wereunabletomultiplyandshowedverylow bacterial count [20]. Since aprA is encoded by bothLasandRhlsystems,itspercentage occurrencemaycorroboratewiththelower presenceofRhlsystem.Althoughlessimpor-tant in establishing UTI, its negligible presence maymakethesestrainsdifferentfromstrains isolated from other infectious sites and hence animportantmarkerinstrainscausingUTIs. OurresultscorroboratethefndingofCotaret al.whoshowedthatlowerpresenceofapar-ticular virulence factor makes it a more impor-tantfactorinthatparticularinfection.Inthis regard, PCR results of an earlier study showed the presence of gene encoding ExoS in 64.87% ofstrainsandExoUin56.54%strains.Itwas suggested that ExoU could be a marker of viru-lence for strains isolated from respiratory tract and wound secretions [7]. Analysis of P. aerugi-nosaclinicalisolatesfromdifferentsitesalso highlightedthatboththeinfectionsiteaswell as the duration of infection infuenced the viru-lenceofthebacteriabyalteringproductionof extracellularvirulencefactors[21].Thus expressionofaprAmayalsoberelatedtoan infectionsitewhereabundantsubstrateis availableforitsgrowth.Theurinarytractmay not be providing the substrate for expression of aprA, which needs to be exploited. Elastase (encoded by lasB) is a powerful T2SS secreted proteolytic enzyme. This enzyme has a wide range of substrates, including elements of connective tissue such as elastin, collagen, fbronectinandlaminen.Phospholipidsare hydrolysed by phospholipase C which is encod-edbyplcHgene.Rhamnolipid,beingarham-nose-containing glycolipid biosurfactant, has a detergent-likestructureandisconsideredto solubilize the phospholipids of lung surfactant, makingthemmoreaccessibletocleavageby phospholipaseC[22].ItsencodedbyrhlAB gene.ProductionoftheQS-dependentviru-lence factor, rhamnolipid by P. aeruginosa iso-latesisassociatedwithdevelopmentofVAP (ventilator-associatedpneumonia)[6].Infew studies, all isolates from burn, wound and pul-Virulence gene distribution in P. aeruginosa UTI132Int J Mol Epidemiol Genet 2014;5(3):125-134monarytractinfectionsharboredlasB,plcH and rhlAB gene. Prevalence of a gene in all the environmental and clinical isolates implies the importance of a factor for survival of P. aerugi-nosainvarioussettings[7,23,24].Inthe present study the prevalence of lasB and plcH wasfoundin75%ofstrains.Thepresenceof lasB can be corroborated with the percentage occurrence of las genes (lasI and lasR) since it isencodedbybothLasandRhlsystems. Similarly rhamnolipid is encoded by Rhl system. The presence of rhlAB (50%) corroborated with thepercentageoccurrenceofRhlgenes(rhlI; 41.6% and rhlR; 58.3%). 100%prevalenceoftoxAgeneinallanalyzed strains was found to be related to the presence oflasIandlasRgenes.Itplaysanimportant role as a virulence factor of P. aeruginosa with-in catheter associated UTIs [15] and in one of the study, over 80% of isolates from urine were found to possess toxA gene [24]. Its presence was also observed in high percentage among P. aeruginosastrainsisolatedfromrespiratory and burn infections [7]. In case of bacteraemia, 56.7%ofP.aeruginosastrainsproducedexo-toxin [25]. Khan and Cerniglia developed a PCR to detect P. aeruginosa by amplifying the toxA geneandreportedthat96%ofP.aeruginosa isolatescontainedthetoxAgene,whereas other species of bacteria did not yield any posi-tiveresults[26].Inanotherstudy,90.7%ofP. aeruginosaisolatestestedfromburn,wound andpulmonarytractinfections,harboredtoxA gene [23]. The ptxR gene, expression enhancer of toxA gene, was only detected in P. aerugino-saisolates;whereasotherspeciesof Pseudomonas did not yield any positive results [27], indicating importance of toxA in P. aerugi-nosa and in UTI. Apartfromextracellularfactors,theinitial attachmentmediator(fagella)playsasignif-cant role in initiation of infection. Two types of fagellinproteinshavebeenidentifedinP. aeruginosa, type a and type b, which can be distinguishedonthebasisofmolecularsize and reactions with type-specifc polyclonal and monoclonal antibodies [28]. Type a and b fa-gellinofP.aeruginosadonotexhibitphase variation; a single strain produces single type of fagellin,andnoswitchingbetweentypesa andbhasbeenobserved.Oligonucleotide primersspecifcforN-terminal(CW46)and C-terminal (CW45) conserved regions of fagel-lin gene were used for PCR amplifcation of the fagellin gene of P. aeruginosa PAO1. In a physi-calgenomeanalysisofthevirulence-associat-ed fiC locus in P. aeruginosa strains, mapping andsequencingrevealedgroupsofheterolo-gous a-type (1164 bp; 1185 bp) and highly con-servedb-type(1467bp)fagellingenes[29]. PercentagefiCoccurrencewasfoundtobe 58.3%(25%b-typefagellin,33%a-type). Absenceoffagellinwasobservedinalmost 40% of the uroisolates obtained from patients withUTIsinourstudy.Theorganismmust becomenon-motiletochronicallypersist. Phagocyticcellsresponddirectlytofagellar motility. This represents a novel mechanism by whichtheinnateimmunesystemfacilitates clearance of bacterial pathogens, and provides an explanation for how selective pressure may result in bacteria with down-regulated fagellar geneexpressionandmotilityasisevidentin isolatescausingchronicinfections[30].Thus, variationinthefagellingenedistribution among P. aeruginosa isolates from UTI patients maybeduetotheselectivepressureofthe disease.Differencesinthedistributionsofvirulence genesinthepopulationstrengthenstheprob-ability that some P. aeruginosa strains are bet-ter adapted to the specifc conditions found in specifcinfectioussites.Althoughgenotypic role of extracellular products such as protease andexotoxinAhavebeenshownincorneal infection, respiratory infection and burn wound [7, 14, 24, 25], no genotypic reports are avail-able on P. aeruginosa induced UTIs, apart from somephenotypicstudies[10,20].Deter- mination of different virulence genes of P. aeru-ginosa isolates suggest that they are associat-edwithdifferentlevelsofintrinsicvirulence and pathogenicity. This may have different con-sequencesontheoutcomeofinfection.The presentstudyisfrstofitskindtoshowthe presence and distribution of four QS genes and sixvirulencegenesviz:lasI,lasR,rhlI,rhlR, toxA, aprA, rhlAB, plcH, lasB and fiC across the genomeofP.aeruginosauroisolates.These virulence factors could represent a useful diag-nosticmarkerfortheinvestigationofuroiso-latesofP.aeruginosa.Thus,simultaneous detection of genes by PCR provides more conf-dentdetectionofP.aeruginosafromUTIs, gives an idea of percentage and rate of occur-Virulence gene distribution in P. aeruginosa UTI133Int J Mol Epidemiol Genet 2014;5(3):125-134renceofsomevirulencegenesandsourceof infection (urinary tract), which further can con-tributetothederivationofanimmunotherapy against UTI.AcknowledgementsWegratefullyacknowledgeDr.BarbaraH. Iglewski, University of Rochester, New York USA forprovidingthestandardstrainofPseudo- monasaeruginosa.Thefnancialassistance provided in the form of a research fellowship by University Grant Commission (UGC), New Delhi, India is gratefully acknowledged. Disclosure of confict of interestNone to declare.Address correspondence to: Kusum Harjai, Depart- mentofMicrobiology,BasicMedicalSciencesBlo- ck-I, South Campus, Panjab University, Chandigarh, India,160014.Tel:+91-1722534142;E-mail:ku- [email protected][1]EmpelJ,FilczakK,MrwkaA,HryniewiczW, LivermoreDM,GniadkowskiM.Outbreakof Pseudomonas aeruginosa Infections with PER-1 Extended-Spectrum b-Lactamase in Warsaw, Poland:FurtherEvidenceforanInternational ClonalComplex.JClinMicrobiol2007;45: 2829-2834.[2]Vincent JL. Microbial resistance: lessons from the EPIC study. European prevalence of infec-tion. Intensiv Care Med 2000; 26 Suppl 1: S3-S8.[3]Trautner BW, Darouiche RO. Role of bioflm in catheter-associated urinary tract infection. Am J Infect Control 2004; 32: 177-183.[4]PearsonJP,PassadorL,IglewskiBH,Green-berg EP. A second N-acyl-L-homoserine lactone signal produced by Pseudomonas aeruginosa. ProcNatlAcadSciUSA1995;92:1490-1494. [5]WinsonMK,CamaraM,LatifA,FoglinoM, Chhabra SR, Daykin M, Bally M, Chapon V, Sal-mond GP, Bycroft BW. Multiple N-acyl-L-homo-serinelactonesignalmoleculesregulatepro-ductionofvirulencedeterminantsand secondary metabolites in Pseudomonas aeru-ginosa.ProcNatlAcadSciUSA1995;92: 9427-9431.[6]Kohler T, Guanella R, Carlet J, Delden C. Quo-rum sensing-dependent virulence during Pseu-domonasaeruginosacolonisationandpneu-moniainmechanicallyventilatedpatients. Thorax 2010; 65: 703-710.[7]Cotar AI, Chifriuc MC, Banu O, Lazar V. Molecu-larcharacterizationofvirulencepatternsin Pseudomonasaeruginosastrainsisolated from respiratory and wound samples. Biointer-face Res Appl Chem 2013; 3: 551-558.[8]Willcox MDP, Zhu H, Conibear TCR, Hume EH, Givskov M, Kjelleberg S, Rice SA. Role of quo-rumsensingbyPseudomonasaeruginosain microbial keratitis and cystic fbrosis. Microbi-ology 2008; 154: 2184-2194.[9]KumarR,ChhibberS,GuptaV,HarjaiK. Screening & profling of quorum sensing signal moleculesinPseudomonasaeruginosaiso-latesfromcatheterizedurinarytractinfection patients.IndianJMedRes2011;134:208-213.[10]Senturk S, Ulusoy S, Bosgelmez-Tinaz G, Yagci A.QuorumsensingandvirulenceofPseudo-monasaeruginosaduringurinarytractinfec-tions. J Infect Dev Ctries 2012; 6: 501-507.[11]Kumar R, Chhibber S, Harjai K. Quorum sens-ingisnecessaryforthevirulenceofPseudo-monasaeruginosaduringurinarytractinfec-tion. Kidney Int 2009; 76: 286-292.[12]SchaberJA,CartyNL,McDonaldNA,Graham ED,CheluvappaR,GriswoldJAandHamood AN. Analysis of quorum sensing-defcient clini-calisolatesofPseudomonasaeruginosa.J Med Microbiol 2004; 53: 841-853. [13]Zhu H, Bandara R, Conibear TCR, Thuruthyil SJ, RiceSA,KjellebergS,GivskovMandWillcox MDP. Pseudomonas aeruginosa with LasI Quo-rum-SensingDefciencyduringCornealInfec-tion.InvestOphthalmolVisSci2004;45: 1897-1903. [14]Schmidtchen A, Wolff H, Hansson C. Differen- tialProteinaseExpressionbyPseudomonas aeruginosaDerivedfromChronicLegUlcers. Acta Derm Venereol 2001; 81: 406-409.[15]Goldsworthy MJH. Gene expression of Pseudo-monasaeruginosaandMRSAwithinacathe-ter-associatedurinarytractinfectionbioflm model. Bioscience Horizons 2008; 1: 28-37.[16]Winstanley C, Coulson MA, Wepner B, Morgan JA,HartCA.Flagellingeneandproteinvaria-tion amongst clinical isolates of Pseudomonas aeruginosa.Microbiology1996;142:2145-51.[17]Sadikot RT, Blackwell TS, Christman JW, Prince AS. PathogenHost Interactions in Pseudomo-nasaeruginosaPneumonia.AmJRespirCrit Care Med 2005; 171: 1209-1223.[18]Juhas M, Eberi L, Tummler B. Quorum sensing: the power of cooperation in the world of Pseu-domonas. Environ Microbiol 2005; 7: 459-471. [19]Lomholt JA, Poulsen K, Kilian M. Epidemic Pop-ulation Structure of Pseudomonas aeruginosa: Evidence for a Clone That Is Pathogenic to the EyeandThatHasaDistinctCombinationof Virulence gene distribution in P. aeruginosa UTI134Int J Mol Epidemiol Genet 2014;5(3):125-134VirulenceFactors.InfectImmun2001;69: 6284-6295. [20]MittalR,KhandwahaRK,GuptaV,MittalPK, Harjai K. Phenotypic characters of urinary iso-latesofPseudomonasaeruginosa&theiras-sociationwithmouserenalcolonization.Indi-an J Med Res 2006; 123: 67-72. [21]Rumbaugh KP, Griswold JA, Hamood AN. Pseu-domonasaeruginosastrainsobtainedfrom patients with tracheal, urinary tract and wound infection:variationsinvirulencefactorsand virulence genes. J Hosp Infect 1999; 43: 211-218.[22]VanDeldenC,IglewskiBH.Cell-to-cellsignal-ingandPseudomonasaeruginosainfections. Emerg Infect Dis 1998; 4: 551-560.[23]Nikbin VS, Aslani MM, Sharaf Z, Hashemipour M, Shahcheraghi F, Ebrahimipour GH. Molecu-laridentifcationanddetectionofvirulence genesamongPseudomonasaeruginosaiso-lated from different infectious origins. Iraninan J Microbiol 2012; 4: 118-123.[24]Wolska K, Szweda P. Genetic features of clini-calP.aeruginosastrians.PolishJMicrobiol 2009; 58: 255-260.[25]Bahaa El-Din A, Magda El-Nagdy M, Badr R, El-Sabagh A. Pseudomonas aeruginosa Exotoxin A: Its Role in Burn Wound Infection, and Wound Healing. Egypt J Plast Reconstr Surg 2008; 32: 59-65. [26]KhanAA,CernigliaCE.DetectionofPseudo-monasaeruginosafromclinicalandenviron-mental samples by amplifcation of the exotox-inAgeneusingPCR.ApplEnvironMicrobiol 1994; 60: 3739-3745.[27]VasilML,ChamberlainC,GrantCCR.Molecu-larstudiesofPseudomonasexotoxinAgene. Infect Immun 1986; 52: 538-548.[28]Allison S, Dawson M, Drake D, Montie TC. Elec-trophoreticseparationandmolecularweight characterizationofPseudomonasaeruginosa H-antigenfagellins.InfectImmun1985;49: 770-774.[29]Spangenberg C, Heuer T, Brger C, Tmmler B. Genetic diversity of fagellins of Pseudomonas aeruginosa. FEBS Lett 1996; 396: 213-217.[30]Lovewell RR, Collins RM, Acker JL, OToole GA, Wargo MJ, Berwin B. Step-Wise Loss of Bacte-rialFlagellarTorsionConfersProgressive PhagocyticEvasion.PLoSPathog2011;7: 1-15.