immunity, vol. 2, 665-875, june, 1995, copyright 0 1995 by ... · th2 cells. we restimulated th2...

Immunity, Vol. 2, 665-875, June, 1995, Copyright 0 1995 by Cell Press

Developmental Commitment to the Th2 Lineage by Extinction of IL-12 Signaling

Susanne J. Sxabo,’ Nils G. Jacobson,* Anand S. Dighe; Uell Gubler,t and Kenneth M. Murphy’ l Department of Pathology Washington University School of Medicine St. Louis, Missouri 83110 tDepartment of Inflammation/Autoimmune Diseases Hoffmann-La Roche, Incorporated 340 Kingsland Street Nutley, New Jersey 07110

Summary

Developmental commitment to Thl or Th2 responses critically influences host susceptibility to particular pathogens. We describe a novel mechanism governing stable commitment to Th2 differentiation. Naive T cells develop strongly polarized Thl and Th2 profiles by 7 days after activation. However, commitment of these developing cells differs substantially. Although IL-4 reverses early Thl differentiation, IL-12 cannot reverse early Th2 differentiation. Thl reversibility results from maintenance of IL-4 signal transduction, whereas Th2 commitment results from rapid loss of IL-12 signallng. The IL-12 signaling defect in Th2 cells results in failure to phosphorylate Jak2, Stat3, and Stat4. Since Th2 cells express the mRNA for the cloned murine IL-12 receptor 3 subunit, the signaling defect may involve expression or function of unidentified receptor components. The rapid extlnction of IL-12 signaling in Th2 cells provides a demonstration of a mechanism for the stable commitment to a T helper phenotype.

Introduction

Differentiation of specific T helper (Th) subsets can determine specific pathogen resistance or susceptibility, and underlies development of strong cellular or humoral immune responses (Mosmann and Coffman, 1989; Scott and Kaufmann, 1991; Bottomly, 1988). Interleukin-12 (IL-12) and IL-4 drive differentiation of naive T cells toward Thl or Th2 subsets, respectively (Hsieh et al., 1992, 1993a, 1993b; Swain et al., 1990; Le Gros et al., 1990; Seder et al., 1993; Seder and Paul, 1994). Thl-type cells promote cell-mediated immunity, which protects against intracellular pathogens. Some pathogens, such as Listeria monocy- togenes, induce protective Thl responses by rapidly acti- vating macrophage production of IL-12 (Hsieh et al., 1993a, 1993b). Other pathogens, particularly Leishmania major, appear not to induce IL-12 production immediately upon infection, but rather delay induction of IL-12 for 5-7 days (Reiner et al., 1994). While some murine strains (BlO.D2) eventually develop Thl responses and resist infection despite the lack of early IL-12 production, other strains (BALBlc) develop stable Th2 responses and suc-

cumb (Fteiner et al., 1994). Helminthic infections, on the other hand, generally induceTh2 responses characterized by host T cell secretion of IL-4 (Urban et al., 1992).

As a first step in defining the basis of these differential responses to pathogens, we have undertaken an analysis of the development and stability of Thl and Th2 phenotypes. Several lines of evidence motivated our examination of the cytokine signaling pathways in early Th cells. First, IL-12 administration induces a resistant phenotype in BALB/c mice when administered concurrently with pathogens (Heinzel et al., 1993) but not when administered 7 days following infection (Sypek et al., 1993). Thus, a temporal window may limit the ability of IL-12 to alter Thl/Th2 development. Second, IL-4 dominates over IL-12 in vitro for effects on Th cell development when both cytokines are present during primary antigen-driven activation (Hsieh et al., 1993b; Schmitt et al., 1994a), suggesting that IL-4 may block IL-12 signaling at some level. Finally, we recently demonstrated that the differences in Thl/Th2 development between the strains BlO.D2 and BALB/c are due to differences in the T cells, and not in the antigen- presenting cells (APCs) (Hsieh et al., 1995). This result suggests that strain-dependent differences in Tcell signaling pathways could influence pathogen susceptibility. Thus, we initiated an examination of the developmental regulation of the IL-4 and IL-12 signaling pathways in Thl and Th2 cells.

In the present study, we have identified a novel mechanism that explains several features of Thl/Th2 develop mental regulation. Thl cells retain the capacity to signal in response to IL-12 and to IL-4, whereas Th2 cells func- tionally extinguish the IL-12 receptor signaling pathway within 3 days after primary activation. Several conse- quences for T cell development are evident. First, IL-4 can reverse phenotype development of early Thl cells. Second, IL-4 dominates over IL-12 for phenotype induction. Third, IL-4-treated naive T cells rapidly acquire a per- manent commitment to theTh2 phenotype. The molecular site of the IL-12 signaling defect in Th2 cells appears closely associated with the IL-12 receptor. Thus, although both Thl and Th2 cells express Jak2, Stat3, and Stat4, IL-12 induces phosphorylation of these proteins only in Thl cells. Moreover, Thl and Th2 cells both bind IL-12 with identical binding characteristics and express similar levels of the mRNA for the cloned murine IL-12 receptor 8 chain. These results suggest that as yet unidentified receptor components may participate in the observed effects. Strain-specific differences in this down-regulatory mechanism could provide a basis for the susceptibility of certain mouse strains to pathogens such as L. major, in which IL-12 induction is delayed rather than immediate.

Results

Th2 Ceils Rapidly Develop Phenotype Irreversibility To examine early differentiation and commitment of Th subsets, we isolated Mel-14”’ CD4+ T cells from DO1 1.10

Immunity 666

A

prfmuy IL 12 (So wnu,

CUnura condtuon~

IL 12 (fO Law,

IL&-/L 12 IL 1.%x-IL4 NdwwIl.Io

co4+Twn a-IL4

0 1 < a , IO /FN-y (xlO%/ml)

B .-. -

Th 1 PhenOtype HeveIsar 1 (tertiary stimulation)

-k---iiJr

-ry cdtule

none

IL4 (looo l&lv~

IL-4 (xi~21J/mi) 1FN-y (~lO-~U/ml)

Th2 Phenotype Reversal ttiaw stimUl8tkM

none

IL 12 (50 wild)

IL12 (10 wnd)

IL lz34HL4

a-IL4

IL4

IL-4 (x10%/ml) 1FN-y (xlo”U/ml

Figure 1. Thl Cells Can Be Reversed Toward the Th2 Phenotype, While Th2 Cells Exhibit Phenotype Irreversibility

(A) FACS-sorted naive CD4’ DO1 1 .I0 T cells (2 x 106) were cultured for 7 days with OVA peptide (0.25 PM) and 6 x 10 irradiated BALB/c splenocytes in the presence of 10 U/ml IL-12 plus 10 Kg/ml anti-IL-4 to promote Thl differentiation, or 200 U/ml IL4 plus 3 &ml anti-IL-12 to promote Th2 differentiation. Cultures were harvested on day 7, washed, and restimulated at 1.25 x 1 ob T cellslwell with OVA peptide and BALB/c splenocytes in the presence of the indicated cytokines or anticytokine antibodies. Supernatants collected after 46 hr were analyzed by ELISA for IFNT. (B) T cells were harvested on day 7 after secondary stimulation in the presence of the indicated conditions, washed, and restimulated (tertiary stimulation) at 2.5 x 105 T cells/well with OVA peptide and

T cell receptor (TCR) transgenic mice by flow cytometry. Activation of these naive T cells by OVA peptide and irradiated BALBlc splenocytes in the presence of IL-12 plus anti-IL-4 monoclonal antibody (MAb), or IL4 plusanti-IL-12 MAb for 7 days produced T cells with strongly polarized cytokine production. Naive T cells primed in the presence of IL-12 plus anti-IL-4 produced 500 U/ml of interferon-y (IFNy) and undetectable IL-4 upon restimulation, whereas naive T cells primed in the presence of IL-4 plus anti-IL-1 2 produced 300 U/ml of IL4 and undetectable IFNy (data not shown). Although this degree of polarization indicates a fully differentiated cytokine profile for these early Thl and Th2 cells, their commitment to a particular Th phenotype lineage may not be complete.

To examine this issue, we imposed conditions for reversal of phenotype differentiation on these early Thl and Th2 cells. First, we restimulated Thl cells in the presence of IL4, IL4 plus anti-IL-12, anti-IL-12 alone, IL-12, or without additions, and measured the effects on immediate cytokine production (at 48 hr) and the effects on phenotype development (cytokine production upon restimulation) (Figure 1). These early Thl cells clearly maintained responsiveness to both IL-12 and IL4 for modulation of immediate cytokine secretion (Figure 1A). Thus, addition of IL-12 increased IFNy production by nearly 2-fold, whereas neutralization of IL-12 reduced IFNy production by 70%. Addition of IL4 also reduced IFNy production by nearly 50%. Furthermore, these Thl cells could undergo long- term alterations in phenotype caused by either IL-12 or IL4(Figure 1B). Additionof IL-4duringthesecondarystim- ulation induced subsequent IL4 production and reduced subsequent IFNy production. Thus, early Thl cells respond to both IL4 and IL-12 for immediate modulation of cytokine production and for Th phenotype reversal. These results suggest that developing Thl cells retain the capacity to transduce signals for IL4 and IL-12.

We next examined the phenotype commitment of early Th2 cells. We restimulated Th2 cells in the presence of IL-12, IL-12 plus anti-lL4, anti-lL4, IL4, or without any additions and examined immediate cytokine production and subsequent phenotype development (Figure 1A). In contrast with Thl cells, Th2 cells were unaffected by any conditions both for immediate cytokine modulation and for phenotype reversal. Despite the addition of high levels of IL-12 or the neutralization of IL4, we detected no IFNy production either immediately or upon restimulation after 7 days. Furthermore, neither IL-2 nor IFNy addition restored the ability of IL-12 to induce IFNy in Th2 cells (data not shown). IL-4 production remained in the range of 300450 U/ml regardless of the experimental conditions. Thus, the observed resistance of Th2 cells to phenotype reversal by IL-12 suggested that a loss of IL-12 signaling may accom- pany early Th2 differentiation.

BALB/c splenocytes without any added conditions. Supernatants were collected after 46 hr and analyzed by ELISA for IFNy and 114.

Loss of IL-2 Signaling in Early Th2 Dwelopment 667

lnabillty of IL-12 to Induce Nuclear Factors In Developing Th2 Cells The inability of IL-12 to reverse early Th2 differentiation could either be due to a loss of IL-12-mediated signaling or to a dissociation of IL-12-induced signals from effects on differentiation. To distinguish these possibilities, we examined responses of developing Thl and Th2 cells to several cytokines by electrophoretic mobility shift assays (EMSAs) using oligonucleotide probes that bind members of the STAT family of transcription factors. The m67 probe is derived from the serum-inducible element (SIE) of the c-fos promoter (Wagner et al., 1990) and the FcyRl probe contains the IFNy response region (GRR) from the promoter of the high affinity Fey receptor (Larner et al., 1993). To control for the quality of nuclear extracts, we examined binding of these extracts to a probe specific for the ubiquitous and constitutive nuclear factor NF-Y (Szabo et al., 1993). We found a selective difference between early Thl and Th2 cells for IL-1 2 signaling (Figure 2). IL-1 2 induced EMSA complexes with both the m67 SIE and FcyRl probes in Thl cells but not in Th2 cells. The inability of Th2 cells to form complexes with these probes was specific to IL-1 2, since both IL-4 and IFNa induced EMSA complexes with these probes in both Thl and Th2 cells (Figure 2).

Notably, early Thl cells showed significantly reduced formation of DNA-binding complexes when treated with IFNy compared with Th2 cells (Figure 2). Since Thl cells produce IFNy during activation, we suspected that ligand- mediated receptor desensitization could explain this loss of IFNy signaling. To test this hypothesis, we treated Th2 cells with IFNy for 7 days and measured IFNy-induced EMSA complexes (data not shown). This prolonged exposure of Th2 cells to IFNy produced a specific reduction in IFNy-induced EMSA complexes. In contrast, IL4 and IFNa both induced EMSA complexes in both IFNy-treated and untreated Th2 cells. We conclude that loss of IFNy responsiveness by early Thl cells reflects ligand-induced desensitization. In contrast, the loss of IL-12 sensitivity by Th2 cells cannot be due to ligand-mediated desensitization, since these cells never encounter IL-12 during their development.

We previously found that IL-12-induced complexes in the Thl clone 3F6 contained Stat1 , Stat3, and Stat4 (Ja- cobson et al., 1995), but have not examined the composi- tion of these complexes in naive or early T cells. Thus, we used antibodies raised against the STAT proteins (Zhong et al., 1994a, 1994b) to identify the components of IL-12-induced complexes in early Thl and Th2 cells. Similar to our earlier findings, IL-la-induced EMSA complexes contained Statl, Stat3, and Stat4 in developing Thl cells (Figure 3A). In contrast, IL-12 failed to induce any STAT-containing complexes in developing Th2 cells. These differences between early Thl and Th2 cells were specific, since IFNa induced the expected Statlcontain- ing complexes in both Thl and Th2 cells (Figure 38). These findings further suggest that developing Th2 cells are selectively unresponsive to IL-1 2 for induction of transcription factors of the STAT family.

Treatment: IlOlle IL-4 IL-12 IFN-a IFN-y nnnnn

Th phenotype: 1212121212

Probe: m67 SIE

FcPl

Fxx Y-box

1 2 3 4 5 6 7 8 9 10

Figure 2. Loss of IL-12 Responsiveness in Developing Th2 Cells Thl and Th2 differentiation was induced in naive TCR transgenic T cells as described in Experimental Procedures. On day 7 after primary antigen activation, nuclear extracts were prepared from these Thl and Th2 cells following incubation with either media, 200 U/ml IL-4 for 20 min, 10 U/ml IL-12 for 25 min, 300 U/ml IFNa for 30 min, or 500 UI ml IFNy for 10 min. EMSA was performed using “P-labeled m67 SE, FcyRI, and Ea Y box oligonucleotide probes as described in Experi- mental Procedures.

Selective Loss of IL-124nduced Phosphorylatlon of STAT Proteins In Th2 Cells Loss of IL-12-induced nuclear factors by early Th2 cells could result either from an absence of STAT proteins or from adefect in their activation. To distinguish these possibilities, we examined STAT expression and tyrosine phosphorylation in response to IL-12. Total cellular lysates prepared from IL-1 Btreated or untreated Thl and Th2 cells 7 days following primary activation were precipitated using antisera specific for Statl, Stat3, or Stat4 (Figure 4). Pre- cipitated STAT proteins were examined for phosphotyrosine content by Western blot analysis using the anti- phosphotyrosine reagent RC20 (Figure 4). IL-12 treatment led to the selective tyrosine phosphorylation of Stat3 and Stat4 in Thl cells but not in Th2 cells (Figure 4). This lack of phosphorylation was not due to the absence of Stat3 and Stat4 expression in Th2 cells, since both Thl and Th2 cells expressed these proteins as determined by direct Western blotting. Thl cells may express slightly higher Stat4 than Th2 cells, but this difference alone is unlikely to account for the lack of detectable tyrosine phosphorylation of Stat4 in Th2 cells. IL-12 also increased Stat1 phosphorylation in Thl cells over constitutive levels. In contrast, the level of Stat1 phosphorylation was unchanged in IL-1 P-treated Th2 cells. Thus, Th2 cells were selectively unresponsive to IL-12 for tyrosine phosphorylation of Stat1 , Stat3, and Stat4.

Phosphorylation of STAT family members on critically conserved tyrosine residues leads to their association and activation for DNA binding (Shuai et al., 1994). The inability of IL-12 to induce tyrosine phosphorylation of STAT proteins in Th2 cells could thus explain the loss of IL-12-

A

Probe: m67 SIE I I

Phenotype: Th 1 Th 2 III I

Treatment: - I- IL-12 -1 - I IL-12 1

Figure 3. IL-12-Induced Nuclear Complexes Contain Statl, Stat3, and Stat4 in Developing Thl Cells Nuclear extracts were prepared from Thl and Th2 cells on day 7 after primary antigen activation following incubation with medium alone, or with (A) 10 U/ml IL-12 for 25 min or (6) 300 U/ml IFNa for 30 min. EMSA was performed using the m67 SIE probe and included normal rabbit serum (NM) or the indicated anti-STAT antisera.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

0

Probe: m67 SIE I I

Phenotype: Th 1 Th2 I II I

Treatment: - - IFN-a -I - I IFN-a l

1 2 3 4 5 6 7 8 9 10 11 12 13 14

induced nuclear factors. In addition, the ThP-selective loss of IL-I 2-induced STATphosphorylation, with maintenance of STAT protein expression in Thl and Th2 cells, localizes the IL-12 signaling defect in Th2 cells to a point proximal to STAT protein phosphorylation.

IL-IP-Induced STAT Activation Is Extinguished Rapidly during Th2 Differentiation As shown above, Th2 cells lost IL-18induced activation of STAT factors by day 7 following primary activation (see Figures 2,3, and 4). To determine how rapidly this effect occurs, we induced Thl or Th2 differentiation in FACS- purified naive transgenic CD4+ Tcells and examined Stat4 expression and IL-1 P-induced tyrosine phosphorylation on days 3 and 5 following activation (Figure 5). A significant loss of IL-l e-induced Stat4 phosphorylation was evident in the IL+treated T cell cultures as early as 3 days following primary T cell activation. However, Stat4 was clearly expressed in both developing Thl and Th2 cells. By day 5 following primary T cell activation, the loss of IL-12-

induced Stat4 activation in Th2 cells was complete, despite thecontinued expression of Stat4 protein. Thus, conditions of Th2 development lead to the rapid loss of IL-12 signaling.

Jak2 and Tyk2 Expression In Developing Thl and Th2 Dells IL-12 induces the tyrosine phosphorylation of the Jak2 and Tyk2 kinases (Bacon et al., 1995), suggesting the partici- pation of these kinases in IL-12 signaling. To localize the defect in IL-12 signaling in Th2 cells, we examined the expression and activation of Jak2 and Tyk2 in developing Thl and Th2 cells (Figure 6). Jak2 and Tyk2 proteins were both clearly expressed in Thl and Th2 cells. Interestingly, Jak2 expression in Th2 cells appeared slightly reduced compared with Thl cells and showed a distinct banding pattern on Western blot analysis. The pattern of other kinases, including Jakl (data not shown) and TykP (Figure 6) and that of the STAT proteins was not different between Thl and Th2 cells (see Figures 4 and 5). Thus, the distinct

Loss of IL-2 Signaling in Early Th2 Development 669

Phenotype:

Treatment:

IP

a Stat1

a Stat3

Blot

I a P-Y

a Stat1

I a P-Y

a Stat3

a P-Y a Stat4 L a Stat4

Thl

L-2 5 1 c -

Th2

1 2 3 4 Figure 4. IL-12 Induces Tyrosine Phosphorylation of Statl, Stat3 and Stat4 in Thl Cells but Not in Th2 Cells On day 7 after primary antigen activation, whole cell lysates from Thl and Th2 cells (3.5 x 103 were prepared after treatment for 25 min with medium alone or with 10 U/ml 11-12. Lysates were immunoprecipitated with the indicated anti-STAT antisera, separated by SDS-PAGE (7% gel), transferred to nitrocellulose, and probed with antf-phosphotyrosine reagent RC20. Following exposure, blots were stripped and reprobed with the indicated STAT antisera.

pattern of JakP banding in Th2 cells does not appear to result from a general increase in protein degradation in Th2 cells. Tyrosine phosphorylation of Jak2 induced by IL-12 occurred in Thl cells, but not in Th2 cells. Thus, the defect in IL-1 2 receptor signaling in early Th2 cells is not simply due to a loss of expression of JakP or TykP kinase, and may reside upstream of Jak2 kinase activation.

Similar Expression of IL-12 Receptor by Thl and Th2 Cells Since the IL-1 2 signaling defect in Th2 cells appeared to reside upstream of the JakP kinase, we next examined the low affinity IL-12 receptor on Thl and Th2 cells by flow cytometry and radioligand binding analysis (Figure 7). First, we used an indirect staining protocol to examine

Day 3:

Day 5:

Thl Th2 II

-+ -+ Blot

a Stat4

a P-Y

a Stat4

1 2 3 4 Figure 5. The IL-I 2 Signaling Pathway Is Rapidly Extinguished in De- veloping Th2 Cells

Naive CD4+ DDl 1 .I0 T cells were stimulated with OVA peptide and irradiated SAL& spfenocytes with IL-12 plus anti-IL-4 to promote Thl differentiatfonorwith lL-4plusantttlL-12topromoteTh2differentiation. On day 3 and day 5 after primary antigen acttvatttn whole cell lysates from developing Thl and Th2 cells (6 x lq were prepared after incubation for 25 min with medium alone or with 10 U/ml IL-12. Lysates were immunoprecipitated wfth Stat4 antiserum, separated by SDS- PAGE (7% gel), transferred to nitrocellulose, and probed with an anti- phosphotyrosine reagent RC20. Following exposure, blots were stripped and reprobed with anti-Stat4 antisera.

IL-12 binding sites by flow cytometry (Figure 7A). By this technique, levels of IL-12 receptors appeared similar for Thl and Th2 cells. The detection of the IL-12 receptor with this technique was specific, since no staining was observed using the cell line EL4.0VA, which lacks IL-12 receptor and is IL-12 unresponsive. Purified CD4+ naive T cells expressed no detectable IL-12 receptors, consistent with the lack of IL-1 2 receptor expression by resting human peripheral T cells (Chiuonite et al., 1992; Desai et al., 1992). Second, we used radioiodinated murine IL-12 to quantitate IL-1 2 receptor expression on Thl and Th2 cells by Scatchard analysis (Figure 78). Thl and Th2 cells expressed looO-15CNl IL-12 binding sites with similar dissociation constants (Ko) ranging from 30-40 pM. Thus, Thl and Th2 cells express similar numbers of IL-12 binding sites.

Recently, a cDNA encoding the murine IL-12 receptor 9 component has become available (A. Chua and U. G., unpublished data). We therefore examined the expression

Immunity 870

IP Blot

a P-Y

a Jak2

r

a Tyk2 a Tyk2

-200

-120

-200

-120

-87

-200

-120

-87

L

Figure 6. Loss of IL-1Plnduced Jak2 Kinase Tyrosine Phosphoryla- tion in Developing Th2 Cells

Whole cell lysates were prepared from Thl and Th2 cells (4 x 103 on day 5 after secondary antigen activation following incubation for 10 min with medium alone or with 10 U/ml IL-12 and immunoprecipitated with antiserum to either Jak2 or Tyk2. Following separation by SDS-PAGE (7.5% gel) and transfer to nitrocellulose, the blot was probed with theanti-phosphotyrosineantibody4G10, followed bystrip- ping and reprobing with the respective Jak2 or TykP antisera.

levels of this mRNA in early Thl and Th2 cells by Northern blot analysis (Figure 8). The results demonstrated that in these cells, the levels and expression patterns for the IL-12 receptor p mRNA are very similar (the two transcripts detected represent alternate splice events; A. Chua and U. G., unpublished data). Thus, loss of IL-12 receptor signaling in Th2 cells is not due to the down-regulation nor the complete absence of the murine IL-1 2 receptor p chain.

Discussion

To evaluate the basis of Thl and Th2 phenotype development and stability, we have used the Doll.10 TCR transgenic system to characterize the early responses of T cells tovarious cytokines during phenotype differentiation.

We find that the phenotype of early Thl T ceils was effi- ciently reversed by addition of 114. In contrast, Th2 ceils were clearly resistant to phenotype reversal, even in the presence of high levels of IL-12. Perez and colleagues (1995) have recently reported results similar to these findings. Thl development in some systems requires the coordinate action of IL-12 and IFNy (Schmitt et al., 1994b; Macatoniaet al., 1993). However, we found that IL-12 plus IFNy also failed to induce phenotype reversal of Th2 cells. To understand the molecular basis of these observations, we analyzed cytokine responsiveness in Thl and Th2 cells. Thl cells were responsive to both IL4 and IL-12 as assessed by EMSA. In contrast, Th2 cells, while responsive to IL-4 and IFNy, were completely unresponsive to IL-12. Thus, this result suggests that a specific loss of IL-I 2 signaling may prevent developing Th2 cells from un- dergoing phenotype reversal.

To evaluate this hypothesis, we focused on specific components of the IL-12 signaling pathway. Recently, we and others have demonstrated that IL-12 signaling in T ceils uses a unique Jak-STAT pathway (Jacobson et al., 1995; Bacon et al., 1995). IL-I 2 was shown to induce the phosphorylation of the tyrosine kinases Jak2 and Tyk2 in phytohemagglutinin-activated human peripheral T cells (Bacon et al., 1995). In addition, we have recently reported that IL-12 rapidly induces tyrosine phosphorylation of Statl, Stat3 and Stat4 in the Thl clone 3F6 (Jacobson et al., 1995). Thus, to assess IL-12 signaling specifically, we examined these STAT proteins and Jak family kinases in early Thl and Th2 cells.

Th2 cells were unable to phosphorylate Stat1 , Stat3, or Stat4 in response to IL-1 2. This loss of the IL-l 2 signaling pathway occurred within 3 days following activation of naive T ceils in the presence of iL4. This signaling defect was not due to a lack of any of the identified proteins of the IL-l 2-induced Jak-STAT signaling pathway, including Statl, Stat3, Stat4, Jak2, and TykP (Figures 4 and 6). Moreover, these same signaling molecules were active in Th2 cells in distinct signaling pathways of other cytokines. For example, the IFNa and IFNy pathways that utilize TykP (IFNa) (Velazquez et al., 1992), Jak2 (IFN?) (Watling et al., 1993), and Stat1 (IFNa and IFN?) (Mulier et al., 1993) were intact in Th2 cells. Furthermore, early Thl and Th2 cells expressed similar levels of IL-12 binding sites and similar forms of the cloned IL-12 receptor mRNA. Thus, weconclude that earlyTh2cellsspecificaliydown-regulate IL-12 signaling during their development from naive cells at a proximal step in the IL-12 receptor pathway.

Potential Mechanisms of IL-12 Unresponsiveness in Th2 Ceils A cDNA was recently cloned that encodes a human IL-12 receptor component representing the low affinity subunit (6 subunit) of the human IL-12 receptor complex (Chua et al., 1994). Presently, the putative additional subunit(s) required to generate a high affinity functional human IL-I 2 receptor complex found on phytohemagglutinin-activated peripheral blood mononuclear cells is not yet identified (A. Chua. and U. G., unpublished data). We find that Thl


A E, ~ : Naive T cells

-.

8 8 Th2

i

B Thl

1440 sites/cell Kd = 3.39 x10-l’ M

0 0.05 0.1 0.15

Bound (ng)

Th2 0.5 1003 sites/cell

0 Kd = 4.06x10-” M

0 0.05 0. I

Bound (ng)

Figure 7. Comparable IL-12 Receptor Expression on Thl and Th2 Cells

(A) Detection of surface IL-12 receptor expression by flow cytometry. IL-12 receptor expression was quantitated using an indirect staining technique as described in Experimental Procedures. Naive CD4+ T cells, and Thl and Th2 cells on day 4 following secondary activation byantigen wereanalyzed for IL-12 receptorexpression. EL4.0VAcells were included as a negative control. (B) Detection of IL-12 binding sites by Scatchard analysis. Scatchard analysis was performed using ‘251-labeled murine IL-12 on Thl and Th2 cells on day 4 after secondary antigen-driven activation.

Immunity 672

day 7 day 9 s in 9 i 2 i 2 2 s I-l-l-l-l--w

- 28s

- 18s

.” : : . .

: :J . , : ” _

GAPDH

Figure 9. Expression of Murine IL-12 Receptor mRNA in Thl and Th2 Cells

Total cellular RNA was isolated from Thl and Th2 cells on days 7 and 9 after secondary antigen activation, EL4.0VA, and TA3 cells. Northern blotting was performed using the full-length murine IL-12 receptor p subunit cDNA as a probe. The blot was stripped and reprobed for GAPDH.

and Th2 cells express similar numbers of IL-12 binding sites as determined by radioligand binding analysis and that these cells also express similar levels of the murine IL-12 receptor 8 mRNA. Therefore, it is likely that as for the human IL-12 receptor, the murine IL-12 receptor requires (an) additional subunit(s) to be functional. We can also speculate that the inability of Th2 cells to respond to IL-1 2 may be due to down-regulation or modification of this additional receptor subunit(s). It will thus be very important to evaluate the expression in Thl and Th2 cells of the other IL-12 receptor component(s) as they are identified.

A second potential mechanism for the IL-12 unresponsiveness observed in Th2 cells could be the down- regulation or modification/inactivation of one or more of the components of the IL-12 signaling pathway specifically in Th2 cells. While we were unable to demonstrate specific functional alterations in the signaling components of Th2 cells, some differences were apparent by Western blot analysis. For example, when Jak2 was immunoprecipitated from Thl and Th2 cells, we observed distinct patterns of antigenic epitopes in these two cell types. In Th2 cells, JakP may be modified in some posttranslational manner, resulting in loss of function.

Implications for Immune Response Regulation The lossof IL-12 responsiveness in earlyTh2 development has important implications relevant for immune responses to pathogens, and may help to explain several previous observations. First, loss of IL-1 2 signaling may participate in the observed dominance of IL-4 over IL-12 in in vitro studies (Hsieh et al., 1993b; Schmitt et al., 1994a). Sec- ond, the rapid down-regulation of IL-12 signaling may dic-

tate the temporal limits observed for the ability of IL-12 for curing Leishmaniasis (Reiner et al., 1994; Sypek et al., 1993). Furthermore, it is possible that genetic variation in this down-regulatory pathway could play a role in the strain-dependent susceptibility to pathogens, such as L. major, which show a delayed induction of IL-12.

IL-4 dominates IL-12 for effects on Th phenotype differentiation in several systems. Hsieh et al. (1993b) found that addition of IL4 concurrently with IL-12 caused the differentiation of the naive DO1 1 .lO TCR transgenic T cell to the Th2 phenotype in a manner indistinguishable from cells induced with IL-4 alone. Moreover, Schmitt and colleagues (1994a) have produced similar results using anti- CD3 polyclonal activation of naive CD4+ cells. IL-12 recep tors are not expressed by naive murine (Figure8) or resting human peripheral T cells (Chiuonite et al., 1992; Desai et al., 1992). Since IL4 receptors are apparently present on resting peripheral human and murine T cells (Foxwell et al., 1989; Lowenthal et al., 1988) IL-4 signaling may precede IL-12 signaling on activated naive T cells, prior to theexpressionof IL-12 receptors. Furthermore, IL-4can induce expression of the IL4 receptor (Ohara and Paul, 1988; Dokter et al., 1992) further favoring development of the Th2 pathway. Thus, our finding of early extinction of IL-12 signaling may be relevant to the dominance of IL4 over IL-12 in Th phenotype differentiation.

This finding may also explain the temporal window re- stricting the ability of IL-12 to cure L. major infection in susceptible BALB/c mice. IL-12 administered at the time of L. major infection confers a protective Thl phenotype in BALB/c mice (Heinzel et al., 1993; Sypek et al., 1993). However, IL-12 administration 7 days following infection fails to induce Thl development or to produce a cure (Sy- pek et al., 1993). Thus, the effectiveness of IL-12 in induc- ing protective Thl responses in BALB/c is limited to ashort time frame of less than 7 days. The rapid extinction of IL-12 receptor signaling we observed in vitro in developing Th2 cells from the BALB/c background may be the expla- nation for the limited temporal effectiveness of IL-12.

In the initial stage of L. major infection, CD4+ T cells from both susceptible and resistant mice express similar levels of IL4 transcripts (Reiner et al., 1994). In susceptible BALB/c mice, IL-12 production is induced on days 5-7following infection but is ineffective in altering the non- curative Th2 response. These results may be explained by our in vitro observation that BALBlc-derived early Th2 cells are unresponsive to IL-12. In resistant strains (e.g., BlO.D2) IL-12 production on days 5-7 correlates with a down-regulation of ThP-type cytokine transcripts and the emergence of a curative Thl response (Reiner et al., 1994). The ability of this delayed production of IL-12 to promote the development of Thl responses suggests a maintenanceoftheIL-12signalingpathwayin theTcellsof resistant mice. Therefore, it will be of interest to determine whether the loss of IL-12 responsiveness in Th2 cells correlates with the susceptible phenotype.

Implications for Immune Therapy The efficacy of some vaccines, for example those to L. major, depend on the development and maintenance


of particular Th phenotypes (Afonso et al., 1994). There- fore, an understanding of the mechanisms governing phenotype development and stability directly contribute to vaccine development. IL-1 2 has been proposed as a thera- peutic agent for redirecting predominant Th2 responses in parasitic infections and allergies (Scott et al., 1989; Scott, 1993). Our resultssuggest that strategies todirect immune responses to specific antigens should take into consider- ation the potential for a unidirectional developmental pathway in which established Th2 responses may be much more difficult to reverse.

Experlmentsl Procedures

Cytoklnss snd Antlbodies Recombinant human IL-2 was provided by Takeda (Osaka, Japan), recombinant murine IL4 was provided by Genzyme (Cambridge, Mas- sachusetts), murine IL4 was also produced as high titer culture super- natant of transfected PSI5 mastocytoma cells, recombinant murine IL-12 was provided by Hoffmann-La Roche (Nutley. New Jersey), recombinant human IFNaM, was provided by Hoffmann-La Roche (Ba- sel, Switzerland), and recombinant murine IFNy was provided by Gen- entech (South San Francisco, California). Anti-IL-4 MAb 11811 has been described (Ohara and Paul, 1985). Polyclonal goat anti-murine IL-12 antisera was supplied by Hoffmann-La Roche (Nutley, New Jer- sey). Anti-IL-12 MAb (TOSH) was provided by Drs. C. S. Tripp and E. R. Unanue (Washington University School of Medicine, St. Louis, Missouri) (Tripp et al., 1994). Polyclonal rabbit antisera specific for Statl, StatP, Stat3, and Stat4were provided by Dr. J. Darnell (Rockefel- ler University, NewYork, New York; Zhongetal., 1994a, lQQ4b). 4610, a murine anti-phosphotyrosine antibody, was provided by Dr. B. Drucker (Oregon Health Sciences University, Portland, Oregon). The anti-phosphotyrosine reagent RC20 was purchased from Transduction Laboratories (Lexington, Kentucky). Polyclonal rabbit antisera specific for Jak2 were purchased from Upstate Biotechnology (Lake Placid, New York). Polyclonal antisera specific for Tyk2 were purchased from Santa Cruz Biotechnology (Santa Cruz, California). Polyclonal goat anti-murine IL-12 was supplied by Hoffmann-La Roche (Nutley, New Jersey).

Medium and Peptldes Cultures of T cells were maintained in Iscove’s modified Dulbecco’s Eagle Medium (Washington University Tissue Culture Support Center, St. Louis, Missouri) supplemented with 10% fetal calf serum (FCS) (Hyclone, Logan, Utah), 2 mM L-glutamine, 0.1 mM sodium pyruvate, 0.1 mM MEM nonessential amino acids, 100 U/ml penicillin, 100 pgl ml streptomycin, and 50 pM P-mercaptoethanol. OVA peptide from chicken ovalbumin (residues 323-339) was synthesized on an Applied Biosystems model 430 peptide synthesizer (Foster City, California).

Anlmals Mice transgenic for the DO1 1.10 af3-TCR (Murphy et al., 1990) were maintained on the BALB/c background. Female BALB/c mice were purchased from Harlan Sprague Dawley (Indianapolis, Indiana).

Transgenlc T Cell Purlflcstlon CD4+ T cells from transgenic mice were purified and naive T cells were isolated by FACS sorting as described (Hsieh et al., 1995). FACS sorting generally yielded purities of >Q6% Mel-14WD4+ T cells.

T Cell Cultures FACS-sorted naive CD4+ DO1 1 .lO T cells (2 x 103 were stimulated in 2 ml cultures with 0.25 uM OVA peptide presented by irradiated BALBlc splenocytes (2000 rads, 6 x lW/well) in the presence of 10 U/ml IL-12 and 10 pg/ml anti-IL-4 (IIBII) to promote Thl phenotype development or 200 U/ml IL-4 and 3 Pa/ml anti-IL-1 2 (TOSH) to promote Th2 phenotype development. At 72 hr, the cells were expanded Mold in fresh medium. These differentiated Thl and Th2 cells were harvested on day 7, washed, and counted. T cells (1.25 x Iv) were restimulated with OVA peptide and BALBlc splenocytes with or without addition of cytokines or anti-cytokine antibodies as indicated in the

figure legends. Supernatants were collected after 46 hr and analyzed by capture enzyme-linked immunosorbent assay (ELISA) for IFNy (Buchmeier and Schreiber, lQ65). For tertiary stfmulattons, T cells were harvested on day 7 after secondary stimulation, washed, and counted. T cells (2.5 x 1Q) were restimulated with OVA and BALB/c spleno cytes without further additions to assess the effects of the conditions used for secondary stimulation on Th phenotype differentiation. Super- natants were wllected after 46 hr and analyzed by capture ELISA for IFNy and IL4 (Buchmeier and Schreiber, lga5; Hsieh et al., 1992).

For immunoprecipitations and nuclear extract preparation from primary stimulations, 1 x lad FAGS-sorted naive CDs+ DC1 1 .lO T cells were stimulated in 10 ml cultures with OVA peptide (0.25 PM) and irradiated BALB/c splenocytes (4 x IO? with IL-12 plus anti-IL-4 (Thl) or IL4 plus anti-IL-12 (Th2). At 72 hr, the cells were expanded l&fold in fresh medium containing 40 U/ml 11-2. Secondary stimulation of Thl and Th2 cells occurred on day 7 after primary activation and was carried out as described above. Cells from either the primary or secondary stimulation were washed and incubated in complete media with 2% FCB (for Jak21Tyk2 immunoprecipltations) or media containing 10% FCS for 3-12 hr prior to incubation with cytokines.

Nuclear Extracts snd EMSA Nuclear extracts were prepared and EMSAs performed as described (Szabo et al., 1993). In brief, nuclear extracts (3 ug of protein) were incubated at room temperature with 32P-labeled double-stranded oligonucleotide probe (0.2 ng, 1 x 105 cpm) in binding buffer with 1 pg poly(dl-dC) for 30 min prior to separation by electrophoresis through a 5.25% polyacrylamide gel in 0.4 x Tris-borate-EDTA. Antibody su- pershifts were performed by adding 2 ul of diluted antiserum (diluted 1:lO in binding buffer) to binding reactions for an additional 30 min of incubation.

Ollgonuc~tldo Probes The following double-stranded oligonucleotides were used in EMSA experiments: m67 SIE, GTCGACATTTCCCGTAAATCGTCGA; FcyRl GRR, TCGACGTATTTCCCAGAAAAGGAACCTCGA; Ea Y box, TCG- ACAllnXTGATTGGTTAAAAGTC. The m67 SIE and FqRl probes bind to members of the STAT family of transcription factors. The Y box probe from the I-Ea chain promoter binds to the constitutive factor NF-Y.

Immunopmclpltstlon and Western Blot Analysis Analysis of the tyrosine phosphorylation of STAT family members was performed essentially as described (Jacobson et at., lQQ5). In brief, total cellular lysates of 3-4 x IO’ T cells were immunoprecipitated with anti-STAT antisera and resolved by SDS-PAGE. Following transfer to nitrocellulose, blots were probed with RC20 (1:2500). Blots were stripped and reprobed with anti-STAT antisera (1:3000). For analysis of Jak2 and TykP kinase phosphorylation, total cellular lysates of 4 x 10’ T cells were immunoprecipitated as described (Witthuhn et al., 1993). The immunoprecipitates were resolved by SDS-PAGE and transferred to nitrocellulose. lmmunoblotting with anti-phosphotyro sine MAb 4GlO and reprobing with antiserum against Jak2 or Tyk2 was performed as, described (Bacon et al., 1995).

flow Cytometric Analysis Cells (1 x 1 q were incubated at 4OC for 2 hr with 100 ng of recombinant murine IL-12 (7 nM) in a total volume of 200 pl of staining buffer (phosphate-buffered saline [PBS] containing 10% FCS and 2% normal rabbit serum). Cells were washed three times and resuspended in 106 ul of staining buffer wntaining 1 pg of polyclonal goat anti-murine 11-12. After incubation for 30 min. cells were washed three times and incubated for 30 min in staining buffer with biotinylated rabbit antigoat immunoglobulin G (Vector Laboratories, Burlingame, California). Cells were then washed three times with PBS (lacking serum) and incubated for 30 min in 1013 nl of PBS containing streptavidin-phycoerythrin wn- jugate (Chromoprobe. Incorporated, Redwood City, California). Cells were washed, resuspended in 400 cl of PBS, and analyzed by flow cytometry on a Becton Dickinson FACScan (Becton Dickinson, Brain- tree, Massachusetts).

Scatchard Analysis IL-12 binding sites on Thl and Th2 cells were quantitated by radioli-

Immunity 674

gand binding analysis using lZSI-labeled murine IL-12 essentially as described (Chizzonite et al., 1992). Recombinant murine IL-12 was radioiodinated using Bolton-Hunter reagent (Bolton and Hunter, 1973) (Amersham, Indianapolis, IN).

Northern Blot Analysis Total RNA was isolated from Thl and Th2 cells using RNAzol RNA isolation solvent (Tel-Test, Friendswood, Texas). Northern blot analysis was performed with 15 pg of total RNA per lane using standard procedures. The full-length murine IL-12 receptor cDNA, which was used as a probe, was cloned by homology to the human IL-12 receptor (U. G., unpublished data).

Acknowledgments

We thank Drs. E. Unanue, R. Schreiber. and C. Tripp for reagents and helpful discussions; Drs. B. Drucker, J. Darnell, and J. O’Shea for valuable antibodies; and P. Chand for FACS sorting. This work was supported by National Institutes of Health grants Al31236 and Al34560, and a grant from the Monsanto Corporation.

Received February 26, 1995; revised April 13, 1995.

Afonso, L. C., Scharton, T. M., Vieira, L. Q., Wysocka, M., Trinchieri, G., and Scott, P. (1994). The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263, 235-237.

Bacon, C. M., f&Vicar, D. W., Ortaldo, J. Ft., Rees, R. C., O’Shea, J. J., and Johnston, J. A. (1995). Interleukin-12 induces tyrosine phosphorylation of JAW and TYK2: differential use of Janus tyrosine kinases by interleukin-2 and interleukin-12. J. Exp. Med. 781,399-404.

Bolton, A. E., and Hunter, W. hf. (1973). The labelling of proteins to highspecific radioactivities byconjugation toa’%containingacylating agent. Biochem. J. 133, 529-539.

Bottomly, K. (1968). A functional dichotomy in CD4+ T lymphocytes. Immunol. Today 9, 266-274.

Buchmeier, N. A., and Schreiber, R. D. (1965). Requirementofendoge- nous interferon-gamma production for resolution of Listeria monocyto- genes infection. Proc. Nat. Acad. Sci. USA 82, 7404-7406.

Chizzonite, R., Truitt, T., Desai, B. B., Nunes, P., Podlaski, F. J., Stern, A. S., and Gately, M. K. (1992). IL-12 receptor. I. Characterization of the receptor on phytohemagglutinin-activated human lymphoblasts. J. Immunol. 748, 31173124.

Chua, A. O., Chizzonite, R., Desai, B. B., Truitt, T. P., Nunes, P., Minetti, L. J., Warrier, Ft. R., Presky. D. H., Levine, J. F., Gately, M. K., and Gubler, U. (1994). Expression cloning of a human IL-12 receptor component: a new member of the cytokine receptor superfamily with strong homology to gpl30. J. Immunol. 153, 126-136.

Desai, B. B.. Quinn, P. M., Wolitzky, A. G., Mongini. P. K., Chizzonite, R., and Gately, M. K. (1992). IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148, 3125-3132.

Dokter, W. H. A., Borger, P., Hendriks, D., van de Horst, I., Halie, MR., and Vellenga, E. (1992). Interleukin-t (11-t) receptor expression on human T cells is affected by different intracellular signaling pathways and by IL-4 at transcriptional and posttranscriptional level. Blood 80, 2721-2728.

Foxwell, B. M., Woerly, G., and Ryffel, B. (1989). Identification of interleukin 4 receptor-associated proteins and expression of both high- and low-affinity binding on human lymphoid cells. Eur. J. Immunol. 19, 1637-1641.

Heinzel, F. P., Schoenhaut, D. S., Rerko, R. M., Rosser, L. E., and Gately, M. K. (1993). Recombinant interleukin-12 cures mice infected with Leishmania major. J. Exp. Med. 777, 1505-1509.

Hsieh, C-S., Heimberger, A. B., Gold, J. S., O’Garra, A., and Murphy, K. M. (1992). Differential regulation of T helper phenotypedevelopment by interleukins 4 and 10 in an alpha-beta-T-cell-receptor transgenic system. Proc. Nat. Acad. Sci. USA 89, 6065-6069.

Hsieh, C.-S., Macatonia, S. E., O’Garra, A., and Murphy, K. M. (1993a). Pathogen induced Thl phenotype development in CD4’ alpha-beta-

TCR trangenic Tcells is macrophage dependent. Int. Immunol. 5,371- 362.

Hsieh, C.-S., Macatonia, S. E., Tripp, C. S., O’Garra, A., and Murphy, K. M. (1993b). Development of Thl CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260, 547-549.

Hsieh, C-S., Macatonia. S. E., O%arra,A., and Murphy, K. M. (1995). T cell genetic background determines default T helper phenotype development in vitro. J. Exp. Med. 787, 713-721.

Jacobson, N. G., Szabo, S. J., Weber-Nordt, R. M., Zhong, Z., Schreiber, R. D., Darnell, J. E., and Murphy, K. M. (1995). lnterleukin 12 signalling in Thl cells involves tyrosine phosphorylation of Stat3 and StaM. J. Exp. Med. 181, 1755-1762.

Larner, A. C., David, M., Feldman, G. M., Igarashi, K., Hackett, R. H., Webb, D. S., Sweitzer, S. M., Petricoin, E. F., and Finbloom. D. S. (1993). Tyrosine phosphorylation of DNA binding proteins by multiple cytokines. Science 267, 1730-1733.

Le Gros, G., Ben-Sasson, S. Z., Seder, R. A., Finkelman, F. D., and Paul, W. E. (1990). Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of lL-4-producing cells. J. Exp. Med. 172, 921-929.

Lowenthal, J. W., Castle. B. E., Christiansen, J., Schreurs.J., Rennick, D., Arai, N., Hoy. P., Takebe, Y., and Howard, M. (1966). Expression of high affinityreceptorsfor murin interleukin 4(BSF-1)on hemopoietic and nonhemopoietic cells. J. Immunol. 740, 456-464.

Macatonia, S. E., Hsieh, C-S., Murphy, K. M., and O’Garra, A. (1993). Dendritic cells and macrophages are required for Thl development of CD4’ T cells from alpha j3 TCR transgenic mice: IL-12 substitution for macrophages to stimulate IFN-gamma production is IFNgamma- dependent. Int. Immunol. 5, 1119-l 126.

Mosmann,T. R.,andCoffman, R. L. (1969).Thl andTh2cells:different patternsof lymphokinesecretion lead todifferentfunctional properties. Annu. Rev. Immunol. 7, 145-173.

Muller, M., Laxton, C., Briscoe, J., Schindler, C., Improta, T., Darnell, J. E., Jr., Stark, G. R., and Kerr, I. M. (1993). Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alphaand-gammasignal transduction pathways. EMBO J. 12,4221-4226.

Murphy, K. M., Heimberger, A. B., and Loh, D. Y. (1990). Induction by antigen of intrathymic apoptosis of CD4’ CD6+ TCR-lo thymocytes in vivo. Science 250, 1720-l 723.

Ohara, J., and Paul, W. E. (1965). Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-l. Nature 315, 333-336.

Ohara, J., and Paul, W. E. (1966). Up-regulation on interleukin 4/B-cell stimulatory factor 1 receptor expression. Proc. Natl. Acad. Sci. USA 85, 6221-6225.

Perez, V. C., Lederer, J., Lichtman, A.. and Abbas, A. K. (1995). Stabil- ity of Thl and Th2 populations. Int. Immunol., in press.

Reiner, S. L., Zheng, S., Wang, Z.-E., Stowring, L., and Locksley, R. M. (1994). Leishmania promastigotes evade interleukin 12 (IL-12) induction by macrophages and stimulate a broad range of cytokines from CD4’T cells curing initiation of infection. J. Exp. Med. 779,447- 456.

Schmitt, E., Hoehn, P., Germann, T., and Rude, E. (1994a). Differential effects of interleukin-12 on the development of naive mouse CD4+ T cells. Eur. J. Immunol. 24, 343-347.

Schmitt, E., Hoehn, P., Huels, C., Goedert, S., Palm, N.. Rude, E., and Germann, T. (1994b). T helper type 1 development of naive CD4+ T cells requires the coordinate action of interleukin-12 and interferon- gamma and is inhibited by transforming growth factor-beta. Eur. J. Immunol. 24, 793-796.

Scott, P. (1993). IL-12: initiation cytokine for cell-mediated immunity. Science 260,496-497.

Scott, P., and Kaufmann, S. H. E. (1991). The role of T-cell subsets and cytokines in the regulation of infection. Immunol. Today 12, 346 340.

Scott, P., Pearce, E., Cheever, A. W.. Coffman. R. L., and Sher, A. (1969). Role of cytokines and CD4+ T-cell subsets in the regulation of parasite immunity and disease. Immunol. Rev. 772, 161-162.

Loss of IL-2 Signaling in Earfy Th2 Development 675

Seder, Ft. A., and Paul, W. E. (1994). Acquisition of lymphokine producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12,635- 673.

Seder, R. A., Gazzinelli, R., Sher, A., andPaul, W. E. (1993). Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90, 10188-10192. Shuai, K., Horvath, C. M., Huang, L. H., Qureshi, S. A., Cowburn, D., and Darnell, J. E., Jr. (1994). Interferon activation of the transcription factor Stat91 involves dimerization through SH2ghosphotyrosyl pep tide interactions. Cell 76, 821-828. Swain, S. L., Weinberg, A. D., English, M., and Huston, G. (1990). IL-4 directs the development of ThS-like helper effecters. J. Immunol. 145, 3796-3906.

Sypek, J. P., Chung, C. L., Mayor, S. E. H., Subramanyam, Goldman, S.J., Sieburth, D. S., Wolf, S. F., and Schaub. R. G. (1993). Resolution of cutaneous Leishmaniasis: interleukin-12 initiates a protective T helper type 1 immune response. J. Exp. Med. 177, 1797-1602. Szabo, S. J., Gold, J. S., Murphy, T. L.. and Murphy;K. M. (1993). Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc. Mol. Cell. Biol. 13,4793-4&x.

Tripp, C. S., Gately, M. K., Hakimi, J., Ling, P., and Unanue, E.R. (1994). Neutralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: reversal by IFNgamma. J. Immunol. 752, 1883- 1007. Urban, J. F., Madden, K. B., Svetic, A., Cheever, A., Trotta, P. P., Gause. W. C., Katona, I. M., and Finkelman, F. D. (1992). The impor- tance of Th2 cytokines in protective immunity to nematodes. Immunol. Rev. 127, 205-220.

Velazquez, L., Fellous, M., Stark, G. R., and Pellegrini. S. (1992). A protein tyrosine kinase in the interferon alpha/beta signaling pathway. Cell 70. 313-322. Wagner, B. J., Hayes, T. E., Hoban, C. J., and Cochran, 8. H. (1990). The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J. 9, 44774404. Waning, D., Guschin, D., Muller, M., Silvennoinen, O., Witthuhn. B. A., Quelle, F. W., Rogers, N. C.. Schindler, C., Stark, G. R., Ihle, J. N., and Kerr, I. M. (1993). Complementation by the protein tyrosine kinase JAK2 of a mutant cell line defective in the interferon-gamma signal transduction pathway. Nature 366, 166-170.

Witthuhn, 8. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, O., and Ihle, J. N. (1993). JAKPassociateswith theerythropoetin receptor and is tyrosine phosphorylated and activated following stimulation with ertyhropoetin. Cell 74, 227-236. Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1994a). Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 95-98. Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1994b). Stat3 and Stat4: members of the family of signal transducers and activators of transcrip tion. Proc. Natl. Acad. Sci. USA 97, 48064810.

immunity, vol. 2, 665-875, june, 1995, copyright 0 1995 by ... · th2 cells. we restimulated th2...

Documents