immunoselective pressure and human leukocyte antigen...

Immunoselective Pressure and Human Leukocyte Antigen

Class I Antigen Machinery Defects in Microsatellite

Unstable Colorectal Cancers

Matthias Kloor,1Christina Becker,

1Axel Benner,

2Stefan M. Woerner,

1Johannes Gebert,

1

Soldano Ferrone,3and Magnus von Knebel Doeberitz

1

1Institute of Molecular Pathology, University of Heidelberg; 2Central Unit Biostatistics, German Cancer Research Center, Heidelberg,Germany; and 3Department of Immunology, Roswell Park Cancer Institute, Buffalo, New York

Abstract

In colorectal cancer, the immune response is particularlypronounced against tumors displaying the high microsatelliteinstability (MSI-H) phenotype. MSI-H tumors accumulatemutations affecting microsatellites located within proteinencoding regions (coding microsatellites, cMS), which lead totranslational shifts of the respective reading frames. Conse-quently, novel tumor-specific frameshift-derived neopeptides(FSP) are generated and presented by MSI-H tumor cells, thuseliciting effective cytotoxic immune responses. To analyzewhether the immunoselective pressure was reflected by thephenotype of MSI-H colorectal cancer cells, we compared herethe expression of antigen processing machinery (APM) compo-nents and human leukocyte antigen (HLA) class I antigensubunits in 20 MSI-H and 20 microsatellite-stable (MSS)colorectal cancer using a panel of newly developed APMcomponent-specific monoclonal antibodies. In addition, wedid a systematic analysis of mutations at cMS located withinAPM genes and b2-microglobulin (b2m). Total HLA class Iantigen loss was observed in 12 (60.0%) of the 20 MSI-H lesionscompared with only 6 (30.0%) of the 20 MSS colorectal cancerlesions. Moreover, total loss of membraneous HLA-A stainingwas significantly more frequent in MSI-H colorectal cancer (P =0.0024). Mutations at cMS of b2m and genes encoding APMcomponents (TAP1 and TAP2) were detected in at least 7(35.0%) of 20 MSI-H colorectal cancers but in none of the MSScolorectal cancers (P = 0.0002). These data show that defects ofHLA class I antigen processing and presentation seem to besignificantly more frequent in MSI-H than in MSS colorectalcancer, suggesting that in MSI-H colorectal cancer theimmunoselective pressure leads to the outgrowth of cells withdefects of antigen presentation. (Cancer Res 2005; 65(14): 6418-24)

Introduction

Antigen presentation of the human leukocyte antigen (HLA)class I pathway is mediated by a network of several proteins.Briefly, peptide fragments that are generated from cellular proteinsby the proteasome complex are transported to the endoplasmaticreticulum (ER) by TAP1 and TAP2 proteins. There, peptides areloaded on h2-microglobulin (h2m)–associated HLA class I heavy

chain molecules, a process that is supported by several chaperonemolecules ( for a detailed review, see ref. 1).Malignant tumors may generate a variety of antigens that may be

presented to and recognized by the host’s immune system and mayeventually lead to destruction of the respective tumor cells by CTLs(reviewed in refs. 2, 3). Abnormalities of antigen presentation havebeen found in various malignancies and may reflect the immuneselective pressure imposed by the continuous antitumoral immuneresponse of the host (reviewed in ref. 4). The immunoselectionhypothesis has been supported by the increased frequency of HLAclass I antigen presentation defects observed in tumors uponapplication of T cell–based immune therapies (5, 6). Differentmechanisms may eventually lead to impairments of HLA class Iantigen presentation (7). Inactivation of both alleles of the geneencoding h2m, most frequently because of mutation in one allele incombination with loss of heterozygosity of the b2m gene locusseems to be the most frequent mechanism leading to complete lossof HLA class I expression on the cell surface (8). Alterations ofproteasome subunits (LMP proteins) and the transporter proteinsTAP1 and TAP2 also play an important role, and have beenobserved in different tumor entities (9–11).In colorectal cancer, there is growing evidence that the extent of

the antitumoral immune response correlates with the type ofgenetic instability. Colorectal cancer may emerge through twoprincipally different carcinogenic pathways. The majority ofcolorectal cancers are characterized by numerical and structuralchromosomal alterations (chromosomal instability). In about 15%of colorectal cancers, defects of the DNA mismatch repair systemresult in rapid accumulation of deletions or insertions of singlenucleotides particularly in repetitive DNA sequences (micro-satellites), a process commonly referred to as high microsatelliteinstability (MSI-H). There are several characteristics of MSI-Hcolorectal cancer which indicate a particularly high immunoge-nicity of these tumors, for example, a dense lymphocytic infiltration(12, 13) and the comparably low frequency of distant metastases(14). Recent studies suggest that the high immunogenicity of MSI-Hcolorectal cancer is induced by the abundant expression of frame-shift neopeptides (FSP) that are generated as a consequence ofinsertion/deletion mutations at coding microsatellites (cMS; refs.15, 16). The immunogenicity of several MSI-associated FSPs hasbeen shown in vitro (15–18).Taken together, there is strong evidence for a tight immunologic

surveillance particularly of MSI-H colorectal cancer. MSI-Hcolorectal cancer cells with defects of the antigen processingmachinery (APM) might therefore be insistently selected for duringtumorigenesis. Indeed, b2m mutations leading to total HLA class Iloss have been found to be closely associated with the MSI-Hphenotype in colorectal cancer (19, 20).

Note: M. Kloor and C. Becker contributed equally to this article.Requests for reprints: Magnus von Knebel Doeberitz, Institute of Molecular

Pathology, University of Heidelberg, Im Neuenheimer Feld 220/221, 69120 Heidelberg,Germany. Phone: 49-6221-562876; Fax: 49-6221-565981; E-mail: [email protected].

I2005 American Association for Cancer Research.

Cancer Res 2005; 65: (14). July 15, 2005 6418 www.aacrjournals.org

Research Article

Research. on August 28, 2021. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

In this study, we analyzed in detail whether the different level ofthe immunoselective pressure on colorectal cancer of the MSI-H orthe microsatellite-stable (MSS) phenotype was reflected by adifferential pattern of defects in HLA class I antigen processing andpresentation. Therefore, we systematically examined the APMprofile of 20 MSI-H and 20 MSS colorectal cancers by immuno-histochemistry using a panel of newly developed monoclonalantibodies (mAb). To obtain additional information, mutationanalysis was done, focusing on cMS located in APM component-encoding genes. Our data suggest, that MSI-H colorectal cancersare significantly more often affected by alterations of HLA class Iantigen processing and presentation. In particular, total HLA class Iand selective HLA-A antigen loss on tumor cell surface was closelylinked to the MSI-H phenotype. Furthermore, we found thattransporter subunits TAP1 and TAP2 may be directly inactivated byMSI-related frame-shift mutations at cMS.

Materials and Methods

Tissue samples and preparation. Forty formalin-fixed, paraffin-

embedded colorectal cancer lesions (MSS, n = 20; MSI-H, n = 20) were

randomly selected from tumors previously tested for their microsatellitestatus according to the recommendations of the National Cancer Institute/

ICG-HNPCC (21). No patient included in this study had received neoadjuvant

therapy. Blocks were cut into 2-Am sections for immunohistochemicalstaining with mAb and into 5-Am sections for the preparation of genomic

DNA. Informed consent was obtained from all patients included in this study.

Antibodies. The mAb HC-10 which recognizes a determinant expressed

on h2m-free HLA-A10, HLA-A28, HLA-A29, HLA-A30, HLA-A31, HLA-A32,and HLA-A33 heavy chains and on all h2m-free HLA-B and HLA-C heavy

chains (22, 23); the mAb HC-A2 which recognizes a determinant expressed

on h2m-free HLA-A (excluding HLA-A24), HLA-B7301, and HLA-G heavy

chains (22, 24); the anti-h2m mAb L368 (25); the anti-calnexin mAb TO-5;the anti-ERp57 mAb TO-2; the anti-calreticulin mAb TO-11; and the anti-

tapasin mAb TO-3 were developed and characterized as described (26). The

anti-LMP2 mAb SY-1 and the anti-TAP1 mAb TO-1 were developed and

characterized using the strategy described elsewhere (26). Briefly, the mAb-secreting hybridomas were derived from BALB/c mice immunized with

synthetic peptides derived from the amino acid sequence of the native

protein and with recombinant proteins. Antibodies of the desired specificitywere identified by their specific binding to the immunizing peptides in

ELISA. The specificity of the selected mAb was proven by their reactivity

with the corresponding antigens when tested with lymphoid cell lysates

with the appropriate phenotype in Western blotting. The specificity of anti-

LMP2 mAb SY-1 and anti-TAP1 mAb TO-1 was corroborated further by theirlack of reactivity with a lysate of the T2 cell line, which does not express

these molecules (27). Second antibodies (biotinylated anti-mouse IgG) were

purchased from Vector (Burlingame, CA).

Immunohistochemistry. Tissue sections were stained using theVectastain elite avidin-biotin complex detection system (Vector) according

to the manufacturer’s instructions. Briefly, 2-Am sections were deparaffi-

nized with xylene and passaged through decreasing concentrations of

ethanol. Subsequently, antigens were retrieved by heating the slides ina microwave oven (thrice, 5 minutes, 560 W) at pH 6.0. Tissue sections

were incubated with an optimal amount of first antibody at 4jC overnight

(5 Ag/mL of mAb HC-10, TO-1, TO-5, and SY-3; 6.7 Ag/mL of mAb HC-A2,

L368, SY-1, SY-2, SY-4, SJJ-3, TO-3, TO-11, and NB1). After washing andincubation with an optimal amount of biotinylated anti-mouse IgG

antibodies as the secondary antibody (Vector) for 1 hour at 37jC, tissuesections were stained using 3-amino-9-ethylcarbazole (DakoCytomation,Glostrup, Denmark) or diaminobenzidine (DakoCytomation) as substrates.

Tissue sections were scored as positive, heterogeneous, and negative

when the percentage of stained tumor cells was >75, 25 to 75, and <25,

respectively. All slides were scored by two observers independently (C.B.and M.K.). Staining of normal cells in each tissue section was used as an

internal positive control; slides that exhibited no positive staining of normal

cells were not included in the evaluation.

Identification and mutation analysis of coding microsatellites. Asystematic European Molecular Biology Laboratory (EMBL) database

search for translated (coding) microsatellites in human was done (ref. 28;

update based on EMBL Rel. 71, June 2002). Mononucleotide repeat tractsconsisting of six or more nucleotides were considered for further analysis.

For mutation analysis, tumor and normal tissue DNA was isolated from

microdissected tissue sections according to the manufacturer’s instructions

(DNeasy Tissue Kit, Qiagen, Hilden, Germany). Oligonucleotide primersused for APM gene fragment analysis are listed in Table 1. Fragment length

analysis was done on an ABI 3100 genetic analyzer (Applied Biosystems,

Darmstadt, Germany). Genescan Analysis Software (Applied Biosystems)

was used for data evaluation. Exonwise sequencing of b2m gene was carriedout as described (29).

Statistical analysis. For the comparison of immunohistochemical

staining results and frequencies of mutational events at cMS, Fisher’s exacttest was applied. In addition, a logistic regression model (30) was applied for

the comparison of MSI-H and MSS colorectal cancer.

Results

Human leukocyte antigen class I heavy chains and B2mexpression in colorectal cancer lesions. MSI-H and MSScolorectal cancer lesions were examined for HLA class I subunit

Table 1. Oligonucleotide primers used for mutation analysis of cMS in APM component-encoding genes

Gene Accession no. Repeat Position* Primer sense Primer antisense Product (bp) Tac

Calnexin BC003552 T8 1409 TATTGGTTTGGAGCTGTGGTC ATCAGCAGCTTTCTTCAGGC 124 59

Delta X61971 G6 273 CGACTGGTGACTCCTCTCCT TCCCGGTAGGTAGCATCAAC 136 59ERp57 a U42068 T6 552 ACGTTTATGGTTTGGAATGTCC CGGTAGTTATCCCTCAAGTTGC 148 59

ERp57 b U42068 A6 752 GTTTGAGGACAAGACTGTGGC CTTTTTAATTTTGCCACTGGTC 61 59

ERp57 c U42068 C6 1536 GATCTTTCTGTTTTCAGGGTGG AAAGTGGTGTTTGGCTACTGC 153 59

LMP7 U17496 C6 54 GAGAGCGGACAGATCTCTGG GAAACTGTAGTGTCCTGGGTCC 138 59TAP1 X57522 G6 2376 GTACTCCCGCTCAGTGCTTC AGAAGGCTTTCATTCTGGAGC 184 59

TAP2 AB073779 C6 218 TACTGTGGCTGCTTCAGGG AGGGAGACAGTCAGGGGG 181 59

Tapasin a AB010639 C6 569 GCTCTGCTGGACTTGAGCTT CCAGGAGCAGATGTCCCTTA 130 58

Tapasin b AB010639 C6 884 GCAGGCAAACTGAGGGTCT GTTGCTGGCATCAGGGAC 107 59

*Position of first nucleotide in cMS repeat in sequence of given accession number.cPrimer annealing temperature.

HLA Class I Antigen Machinery in MSI-H Colorectal Cancer

www.aacrjournals.org 6419 Cancer Res 2005; 65: (14). July 15, 2005



expression. The h2m-specific mAb L368 and the mAb HC-10 andHC-A2 that recognize different epitopes expressed on HLA class Iheavy chains were used as probes. Because HLA class I complexesare denatured during formalin fixation, total and membraneouslocalization of staining signals were documented separately todistinguish between free heavy chains or h2m molecules andassembled HLA class I heavy chains/h2m complexes transferred tothe cell surface.Staining results are summarized in Table 2. A loss of

membraneous heavy chain signals was observed in all tumorsexhibiting total loss of h2m staining (except two cases withregionally retained membraneous HC-A2 signals; data not shown).Loss of h2m expression accompanied by total HLA class I

antigen loss on the cell surface (Fig. 1A) was observed in 12 (60.0%)of the 20 MSI-H colorectal cancer lesions and in only 6 (30.0%) ofthe 20 MSS colorectal cancer lesions (Table 2). In addition, MSI-Hcolorectal cancers frequently displayed a specific loss of certainHLA class I heavy chains detected by the mAb HC-10 (9 of 20,45.0%) and HC-A2 (8 of 20, 42.1%). In detail, the frequency ofreduced staining with mAb HC-10 was significantly higher in MSI-H tumors than in MSS tumors (9 of 20, 45.0% versus 2 of 20, 10%;P = 0.05). Loss of membrane staining with mAb HC-A2 wassignificantly more often observed in MSI-H than in MSS colorectalcancer lesions (17 of 19, 89.5% versus 6 of 18, 33.3%; P = 0.0024).Mutations affecting the b2m gene. Exonwise sequencing of

the b2m gene detected mutations in 5 (29.4%) of 17 MSI-Hcolorectal cancer samples (Table 3). In three cases, b2m sequencingwas not possible due to poor DNA quality of the paraffin-embeddedlesions. All tumors that displayed b2m mutations were not stainedby h2m-specific mAb L368 in immunohistochemistry (Fig. 1A). Allidentified mutations were localized at coding repeats of the b2mgene, the (CT)4 repeat in exon 1 (three samples) and two A5 repeatsin exon 2 ( four samples; Table 3B). Two of the h2m-negative tumorshad two mutations, one in exon 1 and one in exon 2 (U5 and U17).We could not determine whether these mutations were localized onthe same or on different alleles of the b2m gene. No b2m mutationswere detected in the 20 MSS tumor samples.

Expression and mutation analysis of antigen processingmachinery components. To identify APM genes that harborcoding mononucleotide repeats and thus may be targeted bymutations during MSI-H tumorigenesis, a database search wasdone. One T8 mononucleotide repeat was found in the calnexingene, nine additional repeats composed of six nucleotides weredetected in the ER chaperone ERp57 , tapasin , the proteasomesubunit Delta , the immunoproteasome subunit LMP7 , and the TAPsubunits TAP1 and TAP2 (Table 1).Fragment length analysis of these loci revealed frame-shift

mutations in the transporter genes TAP1 and TAP2 in 2 of 18(11.1%) and 1 of 17 (5.9%) of the lesions, respectively. Codingrepeats of proteasome subunits Delta and LMP7 and of chaperonemolecules calnexin , ERp57 , and tapasin were not found to bemutated in the present collective (Table 3).In addition, the expression of APM components was evaluated

by immunohistochemistry. No significant differences were ob-served between MSI-H and MSS colorectal cancer (Table 4).Interestingly, the three carcinoma lesions that encompassedmutant TAP1 and TAP2 alleles all retained regional immunoreac-tivity with the respective antibodies and were scored heteroge-neous (Fig. 1B).

Discussion

Human cancer cells accumulate various structural alterationsthat may give rise to translation of modified or novel peptidesequences that may be presented to the immune system. Immunecells may recognize these peptides as foreign and attack therespective tumor cells (4). Colorectal cancer cells with deficientDNA mismatch repair that display the MSI-H phenotype arecharacterized by a pronounced local infiltration with CTL, aphenomenon that has been proposed as a histopathologic criterionto identify MSI-H colorectal cancer (13). This suggested that MSI-Hcancer cells may present particularly antigenic peptides. In linewith this hypothesis, recent studies indeed revealed a novel class ofantigenic peptides generated by frame-shift mutations of genes

Table 2. HLA class I antigen expression in MSI-H, MSS, and total colon carcinoma specimens

HC-10 HC-10 membrane* HC-A2 HC-A2 membrane* h2m h2m membrane*

MSI-H

Positive (%) 7 (35.0) 3 (15.0) 3 (15.8) 0 (0.0) 9 (45.0) 6 (30.0)

Heterogeneous (%) 4 (20.0) 3 (15.0) 8 (42.1) 2 (10.5) 3 (15.0) 2 (10.0)Negative (%) 9 (45.0) 14 (70.0) 8 (42.1) 17 (89.5) 8 (40.0) 12 (60.0)

Samples analyzed 20 20 19 19 20 20

MSSPositive (%) 12 (60.0) 5 (25.0) 8 (44.4) 5 (27.8) 10 (50.0) 7 (35.0)

Heterogeneous (%) 6 (30.0) 8 (40.0) 7 (38.9) 7 (38.9) 6 (30.0) 7 (35.0)

Negative (%) 2 (10.0) 7 (35.0) 3 (16.7) 6 (33.3) 4 (20.0) 6 (30.0)

Samples analyzed 20 20 18 18 20 20Total

Positive (%) 19 (47.5) 8 (20.0) 11 (29.7) 5 (13.5) 18 (45.0) 13 (32.5)

Heterogeneous (%) 10 (25.0) 11 (27.5) 15 (40.5) 9 (24.3) 10 (25.0) 9 (22.5)

Negative (%) 11 (27.5) 21 (52.5) 11 (29.7) 23 (62.2) 12 (30.0) 18 (45.0)Samples analyzed 40 40 37 37 40 40

P 0.05 0.11 0.10 0.0024 0.24 0.09

*General staining and membraneous staining are documented separately.

Cancer Research




encompassing coding repetitive sequences. These peptides areapparently abundantly expressed and presented by MSI-Hcolorectal cancer cells (15–18). This might well explain theselective pressure favoring the outgrowth of h2m-negative MSI-Htumor cells which are incapable of HLA class I antigen-mediatedpresentation.In the present study, we therefore examined in detail the type

and frequency of APM component alterations that may be found inMSI-H colorectal cancer cells as a consequence of the immuno-selective pressure and compared them with MSS colorectal cancer.Previous studies that examined alterations of antigen presentationin colorectal cancer either did not distinguish between MSI-H andMSS samples (e.g., refs. 31, 32), or relied upon a collection ofcolorectal cancer specimens containing only a very smallproportion of MSI-H tumors (e.g., refs. 19, 20). In this study, weexamined for the first time a cohort of colorectal carcinomas thathad been typed for their microsatellite status a priori. Thus, equalnumbers of MSI-H and MSS samples could be included in theanalysis.Due to the denaturation of the HLA class I complex during

the formalin fixation process, the immunohistochemical detec-tion of functionally active HLA heavy chain/h2m complexes wasnot feasible. Therefore, h2m positivity and membraneous

localization of anti-HLA heavy chains antibody stainings wereused as the criterion indicative for the expression of intact HLAclass I complexes on tumor cell surface. Using this approach, acomplete loss of membraneous h2m staining accompanied byloss of membraneous HLA class I heavy chain staining wasobserved in 60.0% of the MSI-H carcinoma lesions comparedwith only 30.0% of the MSS carcinomas. Mutations of the b2mgene were detected in five of these h2m-negative MSI-Hcolorectal cancers, in the remaining seven cases, no mutationswere detected, suggesting, for example, large deletions whichcould not be detected by gene sequencing or loss of h2mexpression not related to mutational events. No b2m mutationswere detected in any of the MSI-H tumors displaying positiveh2m staining in immunohistochemistry or any of the MSS tumors.Thus, in a larger collection of MSI-H cases, our study confirmsprevious studies assuming a close correlation of b2m mutationswith the MSI-H phenotype in colorectal cancer (19, 20). Theelevated mutation frequency of the b2m gene most probablyindicates that b2m represents a relevant target gene during MSIcarcinogenesis. In addition, we observed that selective HLA-Adown-regulation was significantly more frequent in MSI-Hcolorectal cancers. Menon et al. (33) have previously reportedan association of HLA-A negativity with a better prognosis in

Figure 1. A, immunohistochemicalstainings with mAbs L368 (h2m, left),HC-A2 (middle ), and HC-10 (right ). TumorU13 (MSI-H, top row ): tubular tumor cryptson the right are h2m positive and retainmembrane staining with mAbs specific forHLA class I heavy chains. Carcinoma cells(left) present complete loss of h2mexpression. In the h2m-negative region,reactivity with mAbs HC-10 (reduced incarcinoma compared with surroundingstroma cells) and HC-A2 is exclusivelycytoplasmatic. Tumor U18 (MSI-H, bottomrow ): Complete loss of h2m expressionin tumor cells; note positive staining intumor-infiltrating lymphocytes. Weakcytoplasmatic staining with mAb HC-10indicates reduction of HLA class I heavychain expression; HC-A2 reactivity is lostcompletely. Surrounding stromal cellsserve as internal positive control.B, immunohistochemical staining oftumors that harbor mutations at codingmicrosatellites of APM genes. Tumor U5(TAP1 mutation positive, top row ) and U10(TAP2 mutation positive, bottom row ) withmAbs TO-1 and SY-2, respectively. Tworegions of each tumor. Expression of TAP1and TAP2 is regionally retained in bothtumors (right ) but lost or markedly reducedin regions near the infiltration front (left ).Infiltrating lymphocytes serve as internalpositive controls.





colorectal cancer patients; however, MSI typing had only beendone in six HLA-negative tumors, with MSI present in three of six(50%) samples analyzed. The authors therefore speculated thatthere might be a relation of HLA-A negativity with MSI. Our dataprove that down-regulation or loss of HLA-A heavy chains isclosely associated with the MSI-H phenotype, thus validating the

assumption of Menon et al. (33) in a collective that has been MSI-typed a priori.Notably, significant differences between MSI-H and MSS

colorectal cancer were restricted to membraneous HLA-A staining,whereas general HLA-A staining differences did not reachstatistical significance. These data may point to the functional

Table 3.

A. Mutations at cMS located within APM component encoding genes

cMS U1 U2 U3 U4 U5 U6 U7 U8 U9 U10 U11 U12 U13 U14 U15 U16 U17 U18 U19 U20 Total (%)

b2m * NA mut1 wt wt mut2/mut4 wt NA wt wt wt wt wt mut5 wt NA wt mut3/mut5 mut5 wt wt 5/17 (29.4)

Calnexin T8 wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt 0/20 (0)

Delta G6 NA wt wt wt wt wt wt wt wt wt wt wt wt wt NA wt wt wt NA wt 0/17(0)

ERp57 T6 wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt 0/20 (0)ERp57 A6 wt wt wt wt NA wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt 0/19 (0)

ERp57 C6 NA wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt 0/19 (0)

LMP7 C6 wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt wt 0/20 (0)TAP1 G6 wt wt wt wt mut6 mut6 wt wt wt wt wt wt NA wt wt wt wt NA wt wt 2/18 (11.1)

TAP2 C6 NA wt wt wt wt wt wt wt wt mut7 wt wt wt wt NA wt wt wt NA wt 1/17 (5.9)

Tapasin a C6 wt NA wt wt wt wt wt NA wt NA wt NA wt wt wt NA wt NA NA NA 0/12 (0)

Tapasin b C6 NA wt wt wt wt wt wt wt wt NA wt NA wt wt NA wt wt wt NA wt 0/15 (0)

B. Description of mutations on nucleotide and amino acid level

Gene Mutation Description on

nucleotide level

Description on

amino acid level

Consequence

b2m mut1 c.43_44delCT L15fsX55 Frameshift, stop 41 aa downstream

mut2 c.47_48delCT S16fsX55 Frameshift, stop 40 aa downstream

mut3 c.45_48delTTCT L15fsX42 Frameshift, stop 28 aa downstream

mut4 c.204_205insA V68fsX88 Frameshift, stop 21 aa downstreammut5 c.204delA K67fsX102 Frameshift, stop 36 aa downstream

TAP1 mut6 c.2351delG G784fsX878 Frameshift, nonsense stretch of 95 aa

TAP2 mut7 c.223delC L75X Stop codon

Abbreviations: aa, amino acid; mut, mutant; wt, wild type.

*(CT)4 dinucleotide repeat and three mononucleotide repeats are summarized.

Table 4. Expression of APM components in MSI-H and MSS colorectal cancer lesions

TAP 1 TAP2 LMP 7 MB1 LMP 2 Delta LMP 10 Z Erp57 Tapasin Calnexin Calreticulin

MSI-HPositive (%) 6 (30.0) 15 (75.0) 15 (78.9) 12 (60.0) 13 (65.0) 13 (65.0) 10 (58.8) 5 (26.3) 16 (80.0) 9 (50.0) 9 (45.0) 14 (70.0)

Heterogeneous (%) 7 (35.0) 4 (20.0) 3 (15.8) 5 (25.0) 3 (15.0) 4 (20.0) 6 (35.3) 5 (26.3) 4 (20.0) 3 (16.7) 7 (35.0) 5 (25.0)

Negative (%) 7 (35.0) 1 (5.0) 1 (5.3) 3 (15.0) 4 (20.0) 3 (15.0) 1 (5.9) 9 (47.4) 0 (0) 6 (33.3) 4 (20.0) 1 (5.0)

Samples analyzed 20 20 19 20 20 20 17 19 20 18 20 20MSS

Positive (%) 4 (21.1) 9 (45.0) 12 (60.0) 11 (57.9) 13 (65.0) 14 (70.0) 9 (50.0) 7 (36.8) 11 (55.0) 10 (50.0) 15 (75.0) 10 (52.6)

Heterogeneous (%) 6 (31.6) 6 (30.0) 7 (35.0) 3 (15.8) 3 (15.0) 5 (25.0) 4 (22.2) 3 (15.8) 6 (30.0) 5 (25.0) 2 (10.0) 6 (31.6)

Negative 9 (47.4) 5 (25.0) 1 (5.0) 5 (26.3) 4 (20.0) 1 (5.0) 5 (27.8) 9 (47.4) 3 (15.0) 5 (25.0) 3 (15.0) 3 (15.8)Samples analyzed 19 20 20 19 20 20 18 19 20 20 20 19

Total

Positive (%) 10 (25.6) 24 (60.0) 27 (69.2) 23 (59.0) 26 (65.0) 27 (67.5) 19 (54.3) 12 (31.6) 27 (67.5) 19 (50.0) 24 (60.0) 24 (61.5)Heterogeneous (%) 13 (33.3) 10 (25.0) 10 (25.6) 8 (20.5) 6 (15.0) 9 (22.5) 10 (28.6) 8 (21.1) 10 (25.0) 8 (21.1) 9 (22.5) 11 (28.2)

Negative (%) 16 (41.0) 6 (15.0) 2 (5.1) 8 (20.5) 8 (20.0) 4 (10.0) 6 (17.1) 18 (47.4) 3 (7.5) 11 (28.9) 7 (17.5) 4 (10.3)

Samples analyzed 39 40 39 39 40 40 35 38 40 38 40 39

P 0.85 0.11 0.37 0.62 1.00 0.78 0.27 0.66 0.15 0.83 0.12 0.52

Cancer Research




relevance of HLA-A loss in antigen presentation breakdown,suggesting that h2m-positive tumors, potentially capable of HLAclass I antigen presentation, are particularly affected by loss ofHLA-A expression, thereby reflecting the particular immunoselec-tive pressure exerted on these tumors. In contrast, HLA-B andHLA-C staining results showed significant differences only whenregarding general but not membraneous staining. Hence, thesignificance of loss of HLA-B and HLA-C expression in MSI-Hcolorectal cancer awaits further clarification.Previous studies suggested the involvement of proteasome

subunits and transporters of antigen presentation in immuneevasion of colorectal cancer cells. TAP1 has been reported to belost in z14% of colorectal cancer (32, 34), whereas LMP7 and TAP2down-regulation has been found to impair antigen presentationpredominantly in MSS colorectal cancer (20). We were interested todefine whether these APM components or ER chaperones might betargets of microsatellite instability and hit by mutations in cMS.Whereas no mutations were detected in proteasome subunits andER chaperones, frame-shift mutations in transporter genes TAP1and TAP2 were identified in 3 of 20 MSI-H carcinomas. Thesemutations were not detected in corresponding normal tissuesamples, underlining that they were not polymorphisms but reallysomatic mutations occurring during MSI tumorigenesis. TAP1mutations were detected in two cases; one case harbored amutation at the C6 repeat of TAP2 . Interestingly, none of thetumors with mutations at these loci presented a completeimmunohistochemical loss of the corresponding protein. Thisobservation may be explained either by retained protein translationfrom an intact second allele, or by a positive staining reaction dueto the use of antibodies recognizing epitopes located upstream ofthe mutated repeat. In this case, immunohistochemical staining

reactivity may be preserved, even if the corresponding proteinshave lost their functional activity in the tumor cells.Using immunohistochemistry, TAP1 and TAP2 were not detected

in 41.0% and 15.0% of the lesions analyzed, respectively. Althoughnot statistically significant, we observed a trend towards a higherfrequency of TAP2 loss in MSS colorectal cancer. This observationis in agreement with the data of Cabrera et al. (20) who describeddysregulation of TAP2 as one important factor contributing to APMimpairment in MSS colorectal cancer.In summary, our data show that the MSI-H phenotype in

colorectal cancer is associated with a high frequency of defects inHLA class I antigen presentation. Most APM components did notreveal significant differences between MSI-H and MSS colorectalcancer, underlining that frame-shift mutations of the b2m generepresent the predominant cause of antigen presentation break-down in MSI-H colorectal cancer. In addition, a specific loss ofHLA-A heavy chains is significantly associated with the MSI-Hphenotype. Moreover, we provide evidence that genes coding forTAP subunits TAP1 and TAP2 may be immediate mutationaltargets of MSI carcinogenesis. Further studies examining theprognostic effect of APM alterations on the survival of MSI-Hcolorectal cancer patients are currently in progress.

Acknowledgments

Received 1/6/2005; revised 4/6/2005; accepted 4/28/2005.Grant support: Deutsche Krebshilfe and National Cancer Institute, Department of

Health and Human Services/USPHS grant CA67108.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank I. Voehringer and B. Kuchenbuch for excellent technical assistance and Y.Schwitalle for critical reading of the article and for helpful discussion.



References

1. van Kaer L. Major histocompatibility complex classI-restricted antigen processing and presentation.Tissue Antigens 2002;60:1–9.

2. Jager D, Jager E, Knuth A. Immune responses totumour antigens: implications for antigen specificimmunotherapy of cancer. J Clin Pathol 2001;54:669–74.

3. Boon T, van den Eynde B. Tumour immunology. CurrOpin Immunol 2003;15:129–30.

4. Chang CC, Campoli M, Ferrone S. HLA class I defectsin malignant lesions: what have we learned? Keio J Med2004;52:220–9.

5. Restifo NP, Marincola FM, Kawakami Y, TaubenbergerJ, Yanelli JR, Rosenberg SA. Loss of functional h2-microglobulin in metastatic melanomas from fivepatients receiving immunotherapy. J Natl Cancer Inst1996;88:100–8.

6. Garcia-Lora A, Algarra I, Gaforio JJ, Ruiz-Cabello F,Garrido F. Immunoselection by T lymphocytes gener-ates repeated MHC class I-deficient metastatic tumorvariants. Int J Cancer 2001;91:109–19.

7. Seliger B, Cabrera T, Garrido F, Ferrone S. HLA class Iantigen abnormalities and immune escape by malignantcells. Semin Cancer Biol 2002;12:3–13.

8. Benitez R, Godelaine D, Lopez-Nevot MA, et al.Mutations of the h2-microglobulin gene result in a lackof HLA class I molecules on melanoma cells of twopatients immunized with MAGE peptides. TissueAntigens 1998;52:520–9.

9. Dissemond J, Goette P, Moers J, et al. Association ofTAP1 downregulation in human primary melanomalesions with lack of spontaneous regression. MelanomaRes 2003;13:253–8.

10. Dissemond J, Goette P, Moers J, et al. Immunopro-teasome subunits LMP2 and LMP7 downregulation in

primary malignant melanoma lesions: association withlack of spontaneous regression. Melanoma Res 2003;13:371–7.

11. Seliger B, Atkins D, Bock M, et al. Characterization ofhuman lymphocyte antigen class I antigen-processingmachinery defects in renal cell carcinoma lesions withspecial emphasis on transporter-associated with antigen-processing down-regulation. Clin Cancer Res 2003;9:1721–7.

12. Dolcetti R, Viel A, Doglioni C, et al. High prevalenceof activated intraepithelial cytotoxic T lymphocytes andincreased neoplastic cell apoptosis in colorectal carci-nomas with microsatellite instability. Am J Pathol 1999;154:1805–13.

13. Smyrk TC, Watson P, Kaul K, Lynch HT. Tumor-infiltrating lymphocytes are a marker for microsatelliteinstability in colorectal carcinoma. Cancer 2001;91:2417–22.

14. Buckowitz A, Knaebel HP, Benner A, et al. Micro-satellite instability in colorectal cancer is associatedwith local lymphocyte infiltration and low frequency ofdistant metastases. Br J Cancer 2005;92:1746–53.

15. Linnebacher M, Gebert J, Rudy W, et al. Frameshiftpeptide-derived T-cell epitopes: a source of novel tumor-specific antigens. Int J Cancer 2001;93:6–11.

16. Saeterdal I, Gjertsen MK, Straten P, Eriksen JA,Gaudernack G. TGF hRII frameshift-mutation-derivedCTL epitope recognised by HLA-A2-restricted CD8+ Tcells. Cancer Immunol Immunother 2001;50:469–76.

17. Ripberger E, Linnebacher M, Schwitalle Y, Gebert J,von Knebel Doeberitz M. Identification of an HLA-A0201-restricted CTL epitope generated by a tumor-specific frameshift mutation in a coding microsatelliteof the OGT gene. J Clin Immunol 2003;23:415–23.

18. Schwitalle Y, Linnebacher M, Ripberger E, Gebert J,von Knebel Doeberitz M. Immunogenic peptides

generated by frameshift mutations in DNA mismatchrepair deficient cancer cells. Cancer Immunity 2004;4:14.

19. Bicknell DC, Kaklamanis L, Hampson R, Bodmer WF,Karran P. Selection for h2-microglobulin mutation inmismatch repair defective colorectal carcinomas. CurrBiol 1996;6:1695–7.

20. Cabrera CM, Jimenez P, Cabrera T, Esparza C,Ruiz-Cabello F, Garrido F. Total loss of MHC class Iin colorectal tumors can be explained by twomolecular pathways: b2-microglobulin inactivationin MSI-positive tumors and LMP7/TAP2 downregula-tion in MSI-negative tumors. Tissue Antigens 2003;61:211–9.

21. Boland CR, Thibodeau SN, Hamilton SR, et al.A National Cancer Institute workshop on microsatelliteinstability for cancer detection and familial predisposi-tion: development of international criteria for thedetermination of microsatellite instability in coloncancer. Cancer Res 1998;58:5248–57.

22. Stam NJ, Spits H, Ploegh HL. Monoclonal antibodiesraised against denatured HLA-B locus heavy chainspermit biochemical characterization of certain HLA-Clocus products. J Immunol 1986;137:2299–306.

23. Perosa F, Luccarelli G, Prete M, Favoino E, Ferrone S,Dammacco F. h2-Microglobulin-free HLA class I heavychain epitope mimicry by monoclonal antibody HC-10-specific peptide. J Immunol 2003;171:1918–26.

24. Sernee MF, Ploegh HL, Schust DJ. Why certainantibodies cross-react with HLA-A and HLA-G: epitopemapping of two common MHC class I reagents. MolImmunol 1998;35:177–88.

25. Lampson LA, Fisher CA, Whelan JP. Striking paucityof HLA-A, B, C and h2-microglobulin on humanneuroblastoma cell lines. J Immunol 1983;130:2471–8.

26. Ogino T, Wang X, Kato S, Miyokawa N, Harabuchi Y,Ferrone S. Endoplasmatic reticulum chaperone-specific



Cancer Research


monoclonal antibodies for flow cytometry and immuno-histochemical staining. Tissue Antigens 2004;62:385–93.

27. Salcedo M, Momburg F, Hammerling GJ, LjunggrenHG. Resistance to natural killer cell lysis conferred byTAP1/2 genes in human antigen-processing mutantcells. J Immunol 1994;152:1702–8.

28. Woerner SM, Gebert J, Yuan YP, et al. Systematicidentification of genes with coding microsatellitesmutated in DNA mismatch repair-deficient cancer cells.Int J Cancer 2001;93:12–9.

29. Bicknell DC, Rowan A, Bodmer WF. h2-Micro-

globulin gene mutations: a study of established colorec-tal cell lines and fresh tumors. Proc Natl Acad Sci U S A1994;91:4751–6.

30. Harrell FE. Regression modeling strategies: withapplications to linear models, logistic regression, andsurvival analysis. New York: Springer; 2001.

31. Norazmi M, Hohmann AW, Skinner JM, Bradley J.Expression of MHC class I and class II antigens incolonic carcinomas. Pathology 1989;21:248–53.

32. Atkins D, Ferrone S, Schmahl GE, Storkel S, Seliger B.Down-regulation of HLA class I antigen processing

molecules: an immune escape mechanism of renal cellcarcinoma? J Urol 2004;171:885–9.

33. Menon AG, Morreau H, Tollenaar RA, et al. Down-regulation of HLA-A expression correlates with a betterprognosis in colorectal cancer patients. Lab Invest2002;82:1725–33.

34. Kaklamanis L, Townsend A, Doussis-AnagnostopoulouIA, Mortensen N, Harris AL, Gatter KC. Loss of majorhistocompatibility complex-encoded transporter associ-ated with antigen presentation (TAP) in colorectal can-cer. Am J Pathol 1994;145:505–9.



2005;65:6418-6424. Cancer Res Matthias Kloor, Christina Becker, Axel Benner, et al. Colorectal CancersClass I Antigen Machinery Defects in Microsatellite Unstable Immunoselective Pressure and Human Leukocyte Antigen

Updated version

http://cancerres.aacrjournals.org/content/65/14/6418

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/14/6418.full#ref-list-1

This article cites 31 articles, 8 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/14/6418.full#related-urls

This article has been cited by 17 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/14/6418To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/65/14/6418.full#ref-list-1

http://cancerres.aacrjournals.org/content/65/14/6418.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



immunoselective pressure and human leukocyte antigen...

Documents