ARTICLE OPEN ACCESS

Impaired kidney structure and function in spinalmuscular atrophyFlavia C Nery PhD Jennifer J Siranosian BS Ivy Rosales BS Marc-Olivier Deguise BS Amita Sharma BS

Abdurrahman W Muhtaseb BS Pann Nwe BS Alec J Johnstone BS Ren Zhang BS Maryam Fatouraei BS

Natassja Huemer BS Christiano RR Alves PhD Rashmi Kothary PhD and Kathryn J Swoboda MD

Neurol Genet 20195e353 doi101212NXG0000000000000353

Correspondence

Dr Swoboda

kswobodamghharvardedu

AbstractObjectiveTo determine changes in serum profiles and kidney tissues from patients with spinal muscularatrophy (SMA) type 1 compared with age- and sex-matched controls

MethodsIn this cohort study we investigated renal structure and function in infants and children withSMA type 1 in comparison with age- and sex-matched controls

ResultsPatients with SMA had alterations in serum creatinine cystatin C sodium glucose and calciumconcentrations granular casts and crystals in urine and nephrocalcinosis and fibrosis Neph-rotoxicity and polycystic kidney disease PCR arrays revealed multiple differentially expressedgenes and immunoblot analysis showed decreased calcium-sensing receptors and calbindin andincreased insulin-like growth factorndashbinding proteins in kidneys from patients with SMA

ConclusionsThese findings demonstrate that patients with SMA type 1 in the absence of disease-modifyingtherapies frequently manifest impaired renal function as a primary or secondary consequenceof their disease This study provides new insights into systemic contributions to SMA diseasepathogenesis and the need to identify coadjuvant therapies

Both authors contributed equally to this work

From the Department of Neurology (FCN JJS AWM PN AJJ RZ MF NH CRRA KJS) Center for Genomic Medicine Massachusetts General Hospital Boston MADepartment of Pathology (IR) Massachusetts General Hospital Boston MA Regenerative Medicine Program (M-OD RK) Ottawa Hospital Research Institute Ottawa OntarioCanada Department of Cellular and Molecular Medicine (M-OD RK) University of Ottawa Canada Centre for Neuromuscular Disease (M-OD RK) University of OttawaOttawa Ontario Canada Division of Pediatric Nephrology (AS) Massachusetts General Hospital Boston MA Department of Biology (NH) Federal University of Satildeo CarlosSorocaba Sao Paulo SP Brazil and Department of Medicine (RK) University of Ottawa Ottawa Ontario Canada

Go to NeurologyorgNG for full disclosures Funding information is provided at the end of the article

The Article Processing Charge was funded by the authors

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 40 (CC BY-NC-ND) which permits downloadingand sharing the work provided it is properly cited The work cannot be changed in any way or used commercially without permission from the journal

Copyright copy 2019 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology 1

Spinal muscular atrophy (SMA) a devastating neuromusculardisease characterized by motor neuron degeneration and pro-gressive muscle atrophy is a leading genetic cause of infantiledeath worldwide SMA is caused by mutations in the SurvivalMotor Neuron 1 (SMN1) gene that result in reduced func-tional SMN protein expression However a paralog geneSMN2 undergoes alternative splicing including the removal ofexon 7 and producing only10 functional SMN protein12

The severe infantile variant (SMA type 1) is the most frequentSMA subtype accounting for more than 50 of incident casesPatients with SMA type 1 develop early infantile-onset pro-gressive skeletal bulbar and respiratory muscle weakness Bythe time such patients present with symptoms severe de-nervation has already occurred and the majority of patientswith SMA type 1 die in infancy or childhood13

Recent cutting-edge molecular and gene therapies have shownstriking clinical benefit when such treatments were started inthe presymptomatic or early symptomatic period in infantswith SMA type 1 The US Food and Drug Administrationapproved the use of nusinersen (Spinraza Biogen CambridgeMA) a synthetic antisense oligonucleotide (ASO) that mod-ulates premessenger RNA splicing of the SMN2 gene45

Clinical trials with nusinersen have demonstrated improve-ments in morbidity and ventilator-free survival in patients withearly infantile-onset SMA67 However increased risk of renaltoxicity is listed on the FDA-approved product insert8 andsimilar therapies have been associated with acute tubularinjury910 Longitudinal studies for patients treated with nusi-nersen are still ongoing and will provide additional insights toconfirm its long-term efficacy and safety4 In the meantimeother potential therapies for SMA type 1 are under clinicalinvestigation and show promising preliminary results includingthe SMN1 gene replacement AVXS-101 (Zolgensma AveXisNovartis Chicago IL)1112 and the modulator of SMN2 splic-ing RO7034067 (Risdiplam Roche Basel Switzerland trialNCT02913482)13 These emerging therapies in conjunctionwith standardized respiratory orthopedic and nutritionalsupport will continue to improve morbidity and survival ineven the weakest patients with SMA type 1 Thus un-derstanding the full spectrum of the impact of SMN deficiencyboth within and outside of the CNS is critical to the health andwell-being of patients with SMA

Motor neurons are selectively vulnerable to SMN deficiencyand subsequently account for the earliest manifestation inSMA clinical disease However patients with SMA have de-creased levels of SMN protein throughout the whole bodyand increasing evidence indicates that SMN deficiency intissues other than motor neurons may contribute to disease

pathogenesis14ndash17 Systemic administration of an ASO (ASO-10-27) that restores SMN expression systemically extendedthe lifespan of a severe SMAmousemodel by 25-fold whereasdirect intracerebroventricular administration induced a muchmore modest increase in survival17 However the only clini-cally available ASO therapy for patients with SMA is deliveredintrathecally and largely limited to the CNS The drug reachesthe systemic circulation via CSF flow dynamics redistributingto the kidney and other organs to a variable degree before it isexcreted in urine45 Studies exploring the contribution ofperipheral systemic pathology to SMA disease phenotype arelimited and renal studies in SMA have not been performed

Thus we investigated serum profiles and kidney tissues frompatients with SMA type 1 who died before the availability ofproven disease-altering therapies and compared them withage- and sex-matched controls Participants with SMA type 1showed low serum creatinine cystatin C (CysC) and sodiumconcentrations high circulating glucose and calcium levelsand granular casts and amorphous crystals in the urine fea-tures that indicate renal tubular dysfunction before deathParticipants with SMA displayed (1) medullary nephrocalci-nosis and fibrosis (2) multiple differentially expressed genesand molecular pathways associated with nephrotoxicity andpolycystic kidney disease (3) downregulated calcium-sensingreceptor (CaSR) and calbindin 1 (CALB1) proteins and (4)upregulated insulin-like growth factorndashbinding proteins 1(IGFBP1) and 3 (IGFBP3) compared with age- and sex-matched controls Therefore we conclude that patients withSMA type 1 have an increased risk of impaired kidney func-tion more specifically renal tubular dysfunction This factorneeds to be considered from the initial point of diagnosis

MethodsStandard protocol approvals registrationsand patient consentsMouse experiments were approved by the Animal Care andVeterinary Services of the University of Ottawa ON Canada(protocols OHRI-1927 and OHRI-1948) This study com-plies with the guidelines of the International Committee ofMedical Journal Editors The procedures comply with the in-stitutional and national guide for the care and use of laboratoryanimals Human studies were approved by the InstitutionalEthics ReviewBoard at theUniversity of Utah (protocol 8751)

MiceThis study was approved by the Animal Care and VeterinaryServices of the University of Ottawa ON Canada (protocolsOHRI-1927 and OHRI-1948) Smn2Bminusmice were obtained

GlossaryASO = antisense oligonucleotide CaSR = calcium-sensing receptor CALB1 = calbindin 1 IGF = insulin-like growth factorIGFBP = insulin-like growth factorndashbinding proteins SMA = spinal muscular atrophy SMN = survival motor neuron

2 Neurology Genetics | Volume 5 Number 5 | October 2019 NeurologyorgNG

as previously described18 and housed at the Animal Facility ofUniversity of Ottawa in accordance with the Canadian Councilon Animal Care Samples were collected from symptomaticSmn2Bminus mice at postnatal day 19 Mouse blood was collectedfollowing decapitation using either Microvette CB300 K2EDTA (Sarstedt cat 16444100) coated with EDTA forplasma extraction or Microvette CB300 Z (Sarstedt cat16440100) Bloodwas spun for 5 minutes at 10000g to obtainserum and 2000g to obtain plasma at room temperaturePlasma was analyzed for creatinine blood urea nitrogen(BUN) albumin calcium and phosphorus at a veterinaryreference laboratory using commercially available biochemicalassays (Beckman-Coulter Inc Brea CA) on an automatedclinical chemistry analyzer platform (Beckman-CoulterAU680 Beckman-Coulter Inc) Sodium chloride and potas-sium were determined using ion-selective electrodes(Beckman-Coulter) on the same platform Kidney tissues werecollected for Western blot analysis

Human experimentsThis cohort study includes a total of 13 pediatric participantswith SMA type 1 who died during the course of their diseaseand 13 age- and sex-matched pediatric controls from the NIHNeuroBioBank Written informed parental consent wasobtained for all participants with SMA under the InstitutionalEthics Review Board at the University of Utah (protocol8751) and Massachusetts General Hospital (protocol2016P000469) No participants with SMA received eitherdisease-modifying therapies nusinersen or AVXS-101 genetherapy Tissues from controls were obtained from the NIHNeuroBioBankrsquos Brain and Tissue repository at the Universityof Maryland Baltimore Comprehensive clinical data wereavailable for all participants with SMA and premortem clinicallaboratory data from medical records were available for 12participants with SMA Kidney samples were obtained duringa rapid autopsy protocol in 12 participants with SMA and 13controls Sufficient tissue was available in 4 age- and sex-matched SMA and controls for RNA (SMA 177 272 251and 195 controls 5883 5282 5564 and 5180) and protein(SMA 272 251 195 and 101 and controls 53875564 5282 and 5883) extraction and analysis

SMN1 and SMN2 copy numbersSMN1 and SMN2 copy numbers were determined by dropletdigital PCR using the Bio-Rad QX-200 system (Bio-Rad Her-cules CA) Each sample was amplified separately to measureSMN1 or SMN2 copies relative to the number ofCFTR copies Acompetitive oligo with a 39 phosphate was used to increase probespecificity19 SMN1 was detected with SMN-Ex7-FP 59AATGCTTTTTAACATCCATATAAAGCT SMN-Ex7-RP59CCTTAATTTA AGGAATGTGAGCACC SMN1-LNAprobe FAM-A+G+GGTT+T+c+AGAC and competitiveSMN1 oligoATTTTCCTTACAGGGTTTtAGACAAAATCAAAAGA-PHO SMN2 was detected with the same primers as SMN1and using SMN2-LNA probe FAM-A+G+GGTT+T+T+AGACand competitive SMN2 oligo ATTTTCCTTACAGGG

TTTcAGACAAAATCAAAAGA-PHO The SMN1 and SMN2probes are located at the CT base difference in SMN exon 7Each reaction was multiplexed with a primerprobe set todetect exon 14 ofCFTR as a 2-copy gene control using FP-CFTR59 AGAGAGAAGGCTGTCCTTAGT RP-CFTR59 GAGTGTGTCATCAGGTTCAGG and HEX-TTCTGAGCAGGGAGAGGCGATACT probe Copy num-bers were determined by dividing the number of SMN1 or SMN2copies by the number of CFTR copies for each sample

Biochemical analysisCysC concentrations were determined using Luminex xMAPregtechnology (Myriad RBM Austin TX) on existing frozen se-rum samples Circulating creatinine BUN calcium phospho-rous sodium chloride potassium glucose and C-reactiveprotein granular casts and amorphous crystals in the urine andgeneralized aminoaciduria analyses were available from pre-mortem clinical laboratory data in the Project Cure SMALongitudinal Population Data Repository (MassachusettsGeneral Hospital IRB protocol 2016P000469)

HistologyParaffin-embedded kidney tissues were cut at a thickness of 5-μm and stained with hematoxylin and eosin periodic acidndashSchiff Masson trichrome Alizarin red von Kossa and Prussianblue according to standard histologic protocols Sections wereexamined by an experienced renal pathologist (IR) blinded forsample IDs For immunohistochemistry paraffin-embeddedtissues were cut at a thickness of 5 μm on glass slides andincubated at 60degC for 30 minutes followed by deparaffinizationin xylene and rehydration in graded alcohol into water Antigenretrieval was performed by boiling the slides in 10 mM sodiumcitrate buffer (pH = 60) for 30 minutes Endogenous peroxi-dase activity was quenched with Dual Endogenous EnzymeBlock (DAKO Agilent CA) for 5minutes Tissue sections wereincubated with 1500 dilution of CaSR mouse monoclonal an-tibody (Novus 5C10 ADD) or 15000 dilution of CALB1rabbit polyclonal antibody (Sigma-Aldrich HPA023099) or 1100 dilution of AQP3 (Atlas Antibodies HPA014924) in 1TBSBSA at 4degC inside a humidified chamber overnight Afterwashing slides were incubated with Envision Dual Link SystemPolymer HRP (DAKO) for 30 minutes at room temperatureAfter washing the DAB+ reagent (DAKO) was added withmonitoring for 5ndash10 minutes After washing counterstain wasperformed using Harris-type hematoxylin Slides were brieflydehydrated and then mounted with Histomount solution (LifeTechnology Grand Island NY) Immunohistochemical analy-ses were performed according to standard protocols on 4-msections using the Vector ABC Reagent kit and developed withDAB substrate (Vector Laboratories Burlingame CA) Kidneyslides were also double stained for CD3 (1400 Dako A0452)CD68 (1800 Dako M0814) markers in the autostainer

PCR arrayTotal RNA was extracted from frozen kidney samples usingTRIzol reagent (Thermo Fisher Scientific WalthamMA) Allthe samples had a 280260 ratio ge19 Complementary DNA

NeurologyorgNG Neurology Genetics | Volume 5 Number 5 | October 2019 3

Table 1 Serum biochemical profiles in spinal muscular atrophy type 1 participants

PatientID no

Age atdeath Creatinine Cystatin C BUN Calcium Phosphorus Sodium Chloride Potassium Glucose

C-reactiveprotein

Granular casts andoramorphous crystals

Generalizedaminoaciduria

Normal ranges023ndash061mgdL

051ndash110mgL

5ndash17mgdL

87ndash98mgdL

37ndash74mgdL

137ndash146mmolL

98ndash109mmolL

34ndash47mmolL

60ndash108mgdL

lt08mgdL Urine results

101 102 lt005ndash04 035 30ndash17 75ndash102 43ndash55 133ndash142 102ndash115 39 82ndash142 lt07ndash32 Present Present

187 51 005ndash028 054ndash065 20ndash13 67ndash108 20ndash64 123ndash158 79ndash124 17ndash70 65ndash332 62 Absent Present

7dagger 4 02 Nt 20ndash10 81ndash103 17ndash60 134ndash143 97ndash114 33ndash70 66ndash358 lt08 Present Nt

196 38 008ndash024 057ndash066 40ndash23 81ndash106 25ndash57 133ndash159 91ndash114 17ndash69 71ndash168 lt05ndash81 Present Present

195 296 010ndash030 038ndash043 30ndash13 89ndash105 58ndash61 128ndash140 97ndash112 37ndash72 71ndash135 05ndash12 Present Normal

217 275 012ndash032 061 50ndash25 83ndash116 24ndash56 133ndash163 95ndash125 32ndash60 70ndash143 03ndash13 Present Nt

206 234 015ndash034 047ndash075 70ndash17 89ndash116 Nt 131ndash139 102ndash108 35ndash56 73ndash105 lt05 Nt Nt

403 23 006 Nt 50 83 Nt Nt Nt Nt 449 Nt Nt Nt

353 165 Nt Nt 50ndash80 89ndash106 Nt Nt Nt 32ndash54 116 Nt Nt Nt

177 138 011ndash07 054ndash069 30ndash15 84ndash104 39ndash77 132ndash146 97ndash114 30ndash54 70ndash209 02ndash05 Present Present

251 12 014ndash066 035ndash083 50ndash19 84ndash101 Nt 135ndash139 95ndash108 38ndash43 70ndash97 Nt Present Nt

351 056 021ndash034 096 20ndash16 89ndash106 39ndash51 137ndash143 103ndash112 26ndash55 73ndash218 Nt Present Nt

Lowest value 1111 (100) 49 (44) 812 (67) 712 (58) 58 (63) 910 (90) 710 (70) 711 (64) 012 (0) 08 (0) 89 (89) 45 (80)

Highest value 211 (18) 09 (0) 312 (25) 1112 (92) 18 (13) 310 (30) 810 (80) 911 (82) 1012 (83) 58 (63)

Abbreviations BUN = blood urea nitrogen Nt = not tested

4NeurologyG

enetics

|Vo

lume5N

umber

5|

Octob

er2019

NeurologyorgN

G

was generated from 500 ng of purified RNA using the RT2 FirstStrandKit (Qiagen Venlo theNetherlands) protocol or 300 ngfor SuperScript IV VILO(11766050 ThermoFisher Scientific)TheNephrotoxicity and Polycystic KidneyDisease RT2 ProfilerPCR Arrays (PAHS-094Z and PAHS-168Z Qiagen) wereperformed and each messenger RNA (mRNA) gene expres-sion was calculated relative to the average of 5 housekeepinggenes in the arrays accordingly to the manufacture instructions

Western blotProtein was extracted from frozen kidney samples using RIPAlysis buffer (Cell Signaling Technology Danvers MA) Sam-ples were sonicated and centrifuged at 10000 rpm for 10minutes at 4degC Protein concentrations were determined usingthe Bradford assay (Bio-Rad) Protein samples (30 μg) wererun on a NuPAGE 12 Bis-Tris Protein Gel (NP0342BoxInvitrogen by Thermo Fisher Scientific) electrophoresis andtransferred to a nitrocellulose membrane Membranes wereincubated with Odyssey blocking buffer (Li-Cor 927ndash40000)diluted 11 in Tris-buffered saline buffer REVERT Total Pro-tein Stain (Li-Cor 926ndash11010) was used for loading controlPrimary antibodies were incubated overnight at 4degC to probefor SMN (BD Transduction San Jose CA Catalog 610647Dilution 12000 monoclonal) IGFBP1 (Santa Cruz DallasTX Catalog c-55474 Dilution 11000 monoclonal) IGFBP3(Abcam Cambridge UK Catalog ab77635 Dilution 11000goat polyclonal) IGF-1 (Abcam Catalog ab9572 Dilution 1500 rabbit polyclonal) IGFALS (Thermo Fisher Scientific

Catalog PA5-59252 Dilution 11000 rabbit polyclonal) CaSR(Novus Denver CO Catalog NB120-19347SS Dilution 1500 monoclonal) CALB1 (Sigma Saint Louis MO CatalogHPA023099 Dilution 1750 rabbit polyclonal) and α-tubulin(Cell Signaling Technology Catalog 3873S Clone DM1ADilution 12000 monoclonal) Secondary antibodies wereIRDye 680RDDonkey anti-Mouse IgG (Li-CORCatalog 925-68072 Dilution 15000) IRDye 680RD Donkey anti-GoatIgG (Li-COR Lincoln NE Catalog 925-68074 Dilution 15000) IRDye 800CW Donkey anti-Mouse IgG (Li-CORCatalog 925-32212 Dilution 110000) IRDye 800CW Don-key anti-Rabbit IgG (Li-COR Catalog 925-32213 Dilution 110000) and IRDye 800CW Donkey anti-Goat IgG (Li-CORCatalog 925-32214 Dilution 12000) Membranes were im-aged using the Odyssey CLx (Li-COR) Blots were quantifiedusing ImageJ and normalized by α-tubulin

Statistical analysisData are presented as mean plusmn standard error of the mean withdots as individual values Sample size is indicated in the figurelegends Statistical analyses were performed using GraphPadPrism 7 software (GraphPad Software Inc) Unpaired 2-tailedStudent t tests were used to compare groups Statistical sig-nificance was defined as p lt 005

Data availabilityAll data relevant to this study are contained within thearticle

Figure 1 Kidney histopathology in patients with SMA type 1

Sections from the kidneys of SMA cases showmedullary calcifications (yellowarrows HampE andPAS) along collecting ductsMedullary interstitial fibrosis is alsopresent (trichrome) Representative images were taken at 100times (indicated as 10times objective) and 400times magnifications HampE = hematoxylin and eosin PAS =periodic acidndashSchiff SMA = spinal muscular atrophy

NeurologyorgNG Neurology Genetics | Volume 5 Number 5 | October 2019 5

ResultsTo determine whether renal function is affected in a model ofSMA we first evaluated serum creatinine BUN albumincalcium phosphorus sodium chloride and potassium inSmn2Bminus mice Smn2Bminus mice have reduced SMN proteincontent through the whole body including in the kidney(figure S1 linkslwwcomNXGA174) exhibiting a classicSMA phenotype and a short lifespan (lt30 days)1820 Smn2Bminus

mice had reduced circulating creatinine BUN albumin cal-cium and chloride at symptomatic age postnatal day 19 (tableS1) These initial observations suggest that renal abnormali-ties are present in an intermediate mouse model of thedisease

We further investigated available renal tissues and laboratorydata from a cohort of 13 participants with SMA type 1 whowere followed longitudinally and died in infancy or childhooddue to complications of SMA and compared them with age-and sex-matched controls (tables S2 and S3 linkslwwcomNXGA174) All participants with SMA were confirmed tohave homozygous deletion of SMN1 and 2 SMN2 copies(table S2) whereas all controls had at least 1 SMN1 copy(table S3) During longitudinal follow-up laboratory studies

were obtained in the clinical care setting including circulatingcreatinine BUN calcium phosphorus sodium chloride po-tassium glucose and C-reactive protein In addition we eval-uated circulating CysC a cysteine protease inhibitor producedby all nucleated cells and freely filtered by the glomerulus Bycomparing the blood test results with reference values most ofthe patients in our study consistently had values out of theexpected range in all these analytes (table 1 and table S4)

We investigated kidneys from 12 participants with SMA whounderwent comprehensive rapid research autopsy witha postmortem interval time ranging from 1 to 20 hours in allbut 1 subject (table S2 linkslwwcomNXGA174) Theabsolute mass of kidneys from SMA type 1 and controls wassimilar (figure S2) We found several histopathologic changesin kidney tissues from participants with SMA type 1 withoutcorresponding abnormalities in controls (figures 1 and 2figure S3 table 2 and table S5) Participants with SMA type 1showed varying degrees of tubular injury characterized by lossof brush borders flattened epithelium with detachment andoccasional protein casts Interstitial fibrosis and tubular atro-phy were absent to minimal Occasional intratubular calcifi-cation was present in 2 of 12 participants with SMA (figure 1Aand table 2 IDs 206 and 217) The glomeruli showed rare

Figure 2 Medullary calcifications in patients with SMA type 1

The medullary calcifications (black arrows) are positive for von Kossa and Alizarin red stains Immunohistochemical studies show CD3+ (brown) and CD68+

(blue) cells along calcifications black (arrows) Representative images were taken at 100times (indicated as 10times objective) and 400times magnifications SMA = spinalmuscular atrophy

6 Neurology Genetics | Volume 5 Number 5 | October 2019 NeurologyorgNG

Table 2 Pathologic findings in spinal muscular atrophy type 1 kidneys

IDno Pathologic findings in kidneys at autopsy

Cortex Medulla

Glomerular changes Tubular changes

Interstitium Interstitium

Calcification Inflammation Fibrosis Calcification FibrosisAlizarinred

vonKossa

CD3CD68

101 Tubules showed normal size pyknotic nuclei acutetubular necrosis and calcifications in the cortex andmedulla

Rare mesangialhypercellularity rareadhesions

Mild to moderate lt5 None lt5 lt5 Focallt5

Pos Pos Pos

187 Patchy foci of necrosis bilaterally mild ectasia of therenal collecting system

None Mild None None None None None Nt Nt Nt

196 Small focal nephrocalcinosis in the right kidney Focal mesangialhypercellularityrareadhesions

Mild to moderateoccasional proteincasts

None None None lt5 Focallt5

Pos Pos Neg

195 No reported abnormalities None Mild None None None None None Neg Neg Nt

217 Scattered calcifications in the kidney Rare mesangialhypercellularity rareadhesions and lt5 globalsclerosis

Mild Focalintratubular

Mild lt5 50 50 Pos Pos Pos

206 Multifocal calcifications in the renal medulla withsurrounding inflammation and fibrosis Focal hyalinecasts dilated tubules in the medulla are associatedwith areas of dystrophic calcification andaccumulation of macrophages and multinucleatedcells Pale renal medullary pyramids bilaterally

Rare mesangialhypercellularity rareadhesions and lt1 globalsclerosis

Mild Focalintratubular

lt1 lt10 60 60 Pos Pos Pos

403 Acute tubular congestion of kidneys Diffuse mesangialhypercellularity rareadhesions and lt1 globalsclerosis

None None None 20 None None Nt Neg Nt

353 Acute passive congestion microcalcifications Focal mesangialhypercellularity rareadhesions and lt5 globalsclerosis

None None lt5 None 20 20 Pos Pos Pos

177 Scattered nephrocalcinosis None None None None None None None Nt Neg Nt

251 No reported abnormalities None None None None None None None Nt Nt Nt

351 No reported abnormalities None None None lt5 None lt5 Focallt5

Nt Pos Nt

272 No reported abnormalities None Mild None None None lt1 None Nt Neg Nt

Abbreviations Pos = positive Neg = negative Nt = not tested

Neurolo

gyorgN

GNeurologyG

enetics|

Volume5N

umber

5|

Octob

er2019

7

focal mesangial hypercellularity and adhesions in 6 partic-ipants with SMA (figures 1 and 2 and figure S3 IDs 101 196217 206 403 and 353) Approximately 50 of SMA kidneysshowed tubular injury medullary calcinosis and fibrosis(table 2) Medullary calcification surrounding collecting ductsassociated with interstitial fibrosis was prominent in 2 par-ticipants (figure 1 A and B IDs 206 and 217) Alizarin redand von Kossa stains confirmed medullary calcium phosphatedeposits Positive staining for T-cell and macrophage markers(CD3 and CD68) around calcification foci indicates an in-flammatory response (figure 1B) Overall pathologic abnor-malities in the kidney were present in two-thirds ofparticipants with SMA type 1 in our cohort Although findingssuggesting acute tubular injury could be confounded by

terminal events the tubulointerstitial lesions includingnephrocalcinosis and interstitial fibrosis are indicative ofchronic renal dysfunction Future studies will be important todetermine whether impaired kidney function is a primaryconsequence of reduced SMN protein a secondary conse-quence of muscle atrophy and bone disease or more likelya combination of both

Furthermore we were interested in determining the mo-lecular mechanisms associated with renal dysfunctionNephrotoxicity and polycystic kidney disease PCR arraysrevealed multiple differentially expressed genes in kidneysfrom participants with SMA type 1 compared with controls(figure 2 A and B) Each PCR array targeted 84 genes

Figure 3 Changes in genes involved in calcium reabsorption in the kidney from SMA participants

Volcano plots derived from (A) Nephrotoxicity RT2 ProfilerPCR Array and (B) Polycystic Kidney Disease RT2 Profiler PCRArray in kidney samples fromSMAand controls Upregulatedand downregulated genes are indicated in red and blue re-spectively (n = 3ndash4) Unpaired 2-tailed Student t tests wereused to compare groups SMA = spinal muscular atrophy

8 Neurology Genetics | Volume 5 Number 5 | October 2019 NeurologyorgNG

previously characterized as biomarkers associated with ei-ther kidney toxicity or cystic renal disease We found 25differentially expressed genes in the nephrotoxicity array(figure S4A linkslwwcomNXGA174 and table S6) and8 in the polycystic kidney disease array (figure S4B andtable S7 figures 3 and 4) These genes are involved incalcium signaling apoptosis cell proliferation metal ionbinding glucose metabolism oxidative stress and kidneytransporters signaling Moreover immunohistochemistry(figure 2 C and D) and immunoblot (figure 2 E and F)analysis demonstrated that participants with SMA type 1had decreased CaSR and CALB1 protein expression

It has been previously demonstrated that insulin-like growthfactor 1 (IGF-1) is dysregulated in severely affected SMAmice17 Given that IGF-1 signaling plays a role in the mainte-nance of normal renal function21 we further evaluated IGF-1signaling in renal tissues from SMA type 1 and controls Par-ticipants with SMA type 1 had normal IGF-1 protein contentbut increased levels of IGFBP1 and IGFBP3 (figure 2 E and F)

DiscussionMost of the patients in our study consistently had valuesout of the expected range in several blood analytes Webelieve that many of these abnormalities are an expectedconsequence of severe generalized muscle atrophy andbone disease For example low creatinine concentrationsin these participants were expected because creatinine isa product of creatine metabolism and creatine is mainlypresent in muscle22 Importantly analysis of urine sedi-ment revealed granular casts andor amorphous crystalsand generalized aminoaciduria in the majority of partic-ipants with SMA type 1 (table 1) These elements beingfound in urine are associated with acute and chronic kidneyinjury with potential calcium oxalate deposition within therenal tubules This process may lead to obstruction of theurine flow in the tubules while the intratubular crystalsdevelop an inflammatory reaction with the renal inter-stitium and promote acute kidney dysfunction2324

Overall the clinical laboratory data in these participantsstrongly suggest that the majority had impaired kidney

Figure 4 Increased IGFBPs in kidney from SMA participants

(A) Representative immunohistochemistry (magnification 100times) and (B) quantification of staining intensity for CaSR and CALB1 in kidney samples from SMAand controls (n = 9ndash10) (C) Representative immunoblot and (D) quantification of protein content in kidney samples from SMA (n = 4) and controls (n = 4) Dataare presented as mean SEM with dots as individual values Unpaired 2-tailed Student t tests were used to compare groups p lt 005 p lt 001 p lt00001 CALB1 = calbindin 1 CaSR = calcium-sensing receptor IGF = insulin-like growth factor IGFBP = insulin-like growth factor binding proteins SMA= spinalmuscular atrophy

NeurologyorgNG Neurology Genetics | Volume 5 Number 5 | October 2019 9

function before death with features indicative of renaltubular dysfunction

Participants with SMA type 1 had decreased CaSR andCALB1 protein expression CaSR and CALB1 play criticalanticalcification roles CaSR acts as a sensitive detector ofextracellular calcium and regulates parathyroid hormone ac-tivity protecting against calcium phosphate precipitation2526

CALB1 regulates calcium reabsorption and models of kidneydysfunction show downregulated CALB127 Altogether thesechanges in the expression of key molecules and proteins areconsistent with renal function abnormalities as indicated bypremortem clinical laboratory testing

Participants with SMA type 1 had increased levels of IGFBP1and IGFBP3 IGF signaling is complex and IGFBPs have animportant role in this signaling by enhancing or inhibitingIGF-1 IGFBP1 also affects cell growth and apoptosis2128

Transgenic mice with increased Igfbp1 expression demon-strate reduced number of nephrons and glomerulosclerosis29

whereas those with Igfbp3 overexpression show hypoplastickidneys30 Kidneys in early-stage diabetic rats show increasedIGFBP1 expression31 and increased IGFBP3 protease activitycorrelates with the degree of albuminuria in patients withdiabetic nephropathy32 Thus increased local expression ofIGFBPs supports the concept of impaired kidney function inparticipants with SMA

The precise mechanism by which kidney function is impairedin patients with SMA type I is not fully understood We be-lieve that changes in kidney structure gene and protein ex-pression are in large part a consequence of severe generalizedmuscle atrophy immobility and dysregulation of bone me-tabolism resulting in secondary medullary calcification andrenal tubular dysfunction However given the numerousfunctions of the SMN protein SMN deficiency could alsocontribute to changes in gene expression through directmechanisms SMN protein plays an integral role in the spli-ceosomal assembly and processing of pre-mRNA species in allcells33 For example SMN depletion has been demonstratedto cause intron retention triggering a global DNA damageand stress response34 In future studies additionalapproaches including in vitro studies are necessary for de-termining whether SMN has a primary contribution to thegene expression profile in developing nephrons

The present study has important clinical implicationsPatients with SMA type 1 are living longer due to recentadvances in SMA therapeutics and impaired kidney functionis likely to be a significant comorbidity To help improve long-term survival and well-being of patients with SMA it is im-portant to think ahead to provide therapeutic avenues that canpositively modulate renal function

AcknowledgmentFinancial support was provided to KJS from NIH NINDSR21-NS108015 and Cure SMA RK was supported by Cure

SMAFamilies of SMA Canada Muscular DystrophyAssociation (USA) (575466) and Canadian Institutes ofHealth Research (CIHR) (PJT-156379) M-OD wassupported by a Frederick Banting and Charles Best CIHRDoctoral Research Award NH was supported by CAPESBrazil The authors thank Vicky L McGovern and ArthurHM Burghes for technical support and scientific discussionand Patricia Della Pelle for technical support in histologyControl tissues were obtained from the NIHNeuroBioBankrsquosBrain and Tissue repository at the University of MarylandBaltimore They are very grateful to all the SMA families whoparticipated in this study

Study fundingNo targeted funding reported

DisclosureDisclosures available NeurologyorgNG

Publication historyReceived by Neurology Genetics April 10 2019 Accepted in final formJune 25 2019

Appendix Authors

Name Location Role Contribution

Flavia C Nery MassachusettsGeneralHospitalBoston MA

Author Directed the researchproject and designedexperiments performedexperiments collectedclinical data analyzed thedata wrote themanuscript participatedin the data interpretationand reviewed andapproved the finalmanuscript

Jennifer JSiranosian

MassachusettsGeneralHospitalBoston MA

Author Performed experimentscollected clinical dataanalyzed the data wrotethe manuscriptparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Ivy Rosales MassachusettsGeneralHospitalBoston MA

Author Performed experimentsanalyzed the dataparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Marc-OlivierDeguise

University ofOttawaCanada

Author Performed mouseexperimentsparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Amita Sharma MassachusettsGeneralHospitalBoston MA

Author Performed experimentscollected clinical dataparticipated in the datainterpretation andreviewed and approvedthe final manuscript

10 Neurology Genetics | Volume 5 Number 5 | October 2019 NeurologyorgNG

References1 Groen EJN Talbot K Gillingwater TH Advances in therapy for spinal muscular

atrophy promises and challenges Nat Rev Neurol 201814214ndash2242 Faravelli I Nizzardo M Comi GP Corti S Spinal muscular atrophy-recent thera-

peutic advances for an old challenge Nat Rev Neurol 201511351ndash359

3 Thomas NH Dubowitz V The natural history of type I (severe) spinal muscularatrophy Neuromuscul Disord 19944497ndash502

4 Corey DR Nusinersen an antisense oligonucleotide drug for spinal muscular atrophyNat Neurosci 201720497ndash499

5 Wood MJA Talbot K Bowerman M Spinal muscular atrophy antisense oligonu-cleotide therapy opens the door to an integrated therapeutic landscape Hum MolGenet 201726R151ndashR159

6 Finkel RS Mercuri E Darras BT et al Nusinersen versus sham control in infantile-onset spinal muscular atrophy N Engl J Med 20173771723ndash1732

7 Finkel RS Chiriboga CA Vajsar J et al Treatment of infantile-onset spinal muscularatrophy with nusinersen a phase 2 open-label dose-escalation study Lancet 20163883017ndash3026

8 Spinraza (Nusinersen) Injection [package insert] Cambridge MA Biogen Inc 20169 Khvorova A Watts JK The chemical evolution of oligonucleotide therapies of clinical

utility Nat Biotechnol 201735238ndash24810 Van Poelgeest EP Swart RM Betjes MGH et al Acute kidney injury during therapy

with an antisense oligonucleotide directed against PCSK9 Am J Kidney Dis201362796ndash800

11 Mendell J Al-Zaidy S Shell R et al AVXS-101 phase 1 gene therapy clinical trial inSMA type 1 end-of-study event free survival and achievement of developmentalmilestones Neuromuscul Disord 201727(Suppl 2)S208

12 Mendell JR Al-Zaidy S Shell R et al Single-dose gene-replacement therapy for spinalmuscular atrophy N Engl J Med 20173771713ndash1722

13 Ratni H Ebeling M Baird J et al Discovery of risdiplam a selective survival of motorneuron-2 (SMN2) gene splicing modifier for the treatment of spinal muscular atrophy(SMA) J Med Chem 2018616501ndash6517

14 Rudnik-Schoneborn S Heller R Berg C et al Congenital heart disease is a feature ofsevere infantile spinal muscular atrophy J Med Genet 200845635ndash638

15 Simone C Ramirez A Bucchia M et al Is spinal muscular atrophy a disease of themotor neurons only pathogenesis and therapeutic implications Cell Mol Life Sci2016731003ndash1020

16 Deguise MO Kothary R New insights into SMA pathogenesis immune dysfunctionand neuroinflammation Ann Clin Transl Neurol 20174522ndash530

17 Hua Y Sahashi K Rigo F et al Peripheral SMN restoration is essential for long-termrescue of a severe spinal muscular atrophy mouse model Nature 2011478123ndash126

18 Deguise MO De Repentigny Y McFall E Auclair N Sad S Kothary R Immunedysregulationmay contribute to disease pathogenesis in spinal muscular atrophymiceHum Mol Genet 201726801ndash819

19 Anhuf D Eggermann T Rudnik-Schoneborn S Zerres K Determination of SMN1and SMN2 copy number using TaqManTM technology Hum Mutat 20032274ndash78

20 Eshraghi M McFall E Gibeault S Kothary R Effect of genetic background on thephenotype of the Smn 2B- mouse model of spinal muscular atrophy HumMol Genet2016254494ndash4506

21 Oh Y The insulin-like growth factor system in chronic kidney disease pathophysi-ology and therapeutic opportunities Kidney Res Clin Pract 20123126ndash37

22 Hijikata Y Hashizume A Yamada S et al Biomarker-based analysis of preclinicalprogression in spinal and bulbar muscular atrophy Neurology 201890e1501ndashe1509

23 Mulay SR Shi C Ma X Anders HJ Novel insights into crystal-induced kidney injuryKidney Dis (Basel) 2018449ndash57

24 Luciano RL Perazella MA Crystalline-induced kidney disease a case for urine mi-croscopy Clin Kidney J 20158131ndash136

25 Vezzoli G Terranegra A Rainone F et al Calcium-sensing receptor and calciumkidney stones J Transl Med 20119201

26 Ba J Brown D Friedman PA Calcium-sensing receptor regulation of PTH-inhibitableproximal tubule phosphate transport Am J Physiol Physiol 2003285F1233ndashF1243

27 Iida T Fujinaka H Xu B et al Decreased urinary calbindin 1 levels in proteinuric ratsand humans with distal nephron segment injuries Clin Exp Nephrol 201418432ndash443

28 Jones J Gockerman A Busby W et al Insulin-like growth factor binding protein 1stimulates cell migration and binds to the alpha5beta1 integrin by means of its Arg-Gly-Asp sequence EMBO J 19939010553ndash10557

29 Doublier S Seurin D Fouqueray B et al Glomerulosclerosis in mice transgenic forhuman insulin-like growth factor-binding protein-1 Kidney Int 2000572299ndash2307

30 Modric T Silha JV Shi Z et al Phenotypic manifestations of insulin-like growthfactor-binding protein-3 overexpression in transgenic mice Endocrinology 20011421958ndash1967

31 Flyvbjerg A Kessler U Dorka B Funk B Oslashrskov H Kiess W Transient increase inrenal insulin-like growth factor binding proteins during initial kidney hypertrophy inexperimental diabetes in rats Diabetologia 199235589ndash593

32 Shinada M Akdeniz A Panagiotopoulos S Jerums G Bach LA Proteolysis of insulin-like growth factor-binding protein-3 is increased in urine from patients with diabeticnephropathy J Clin Endocrinol Metab 2000851163ndash1169

33 Swoboda KJ Romancing the spliceosome to fight spinal muscular atrophy N Engl JMed 20143711752ndash1754

34 Jangi M Fleet C Cullen P et al SMN deficiency in severe models of spinal muscularatrophy causes widespread intron retention and DNA damage Proc Natl Acad Sci2017114E2354ndashE2356

Appendix (continued)

Name Location Role Contribution

AbdurrahmanW Muhtaseb

MassachusettsGeneralHospitalBoston MA

Author Performed experimentsparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Pann Nwe MassachusettsGeneralHospitalBoston MA

Author Performed experimentscollected clinical dataparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Alec JJohnstone

MassachusettsGeneralHospitalBoston MA

Author Performed experimentscollected clinical dataparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Ren Zhang MassachusettsGeneralHospitalBoston MA

Author Performed experimentscollected clinical dataparticipated in the datainterpretation andreviewed and approvedthe final manuscript

MaryamFatouraei

MassachusettsGeneralHospitalBoston MA

Author Performed experimentsparticipated in the datainterpretation andreviewed and approvedthe final manuscript

NatassjaHuemer

MassachusettsGeneralHospitalBoston MA

Author Performed experimentsparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Christiano RRAlves

MassachusettsGeneralHospitalBoston MA

Author Analyzed the data wrotethe manuscriptparticipated in the datainterpretation andreviewed and approvedthe final manuscript

RashmiKothary

University ofOttawaCanada

Author Performed mouseexperimentsparticipated in the datainterpretation andreviewed and approvedthe final manuscript

Kathryn JSwoboda

MassachusettsGeneralHospitalBoston MA

Author Directed the researchproject and designedexperiments collectedclinical data wrote themanuscript participatedin the data interpretationand reviewed andapproved the finalmanuscript

NeurologyorgNG Neurology Genetics | Volume 5 Number 5 | October 2019 11

DOI 101212NXG000000000000035320195 Neurol Genet

Flaacutevia C Nery Jennifer J Siranosian Ivy Rosales et al Impaired kidney structure and function in spinal muscular atrophy

This information is current as of August 12 2019

ServicesUpdated Information amp

httpngneurologyorgcontent55e353fullhtmlincluding high resolution figures can be found at

References httpngneurologyorgcontent55e353fullhtmlref-list-1

This article cites 33 articles 1 of which you can access for free at

Subspecialty Collections

httpngneurologyorgcgicollectionmuscle_diseaseMuscle disease

httpngneurologyorgcgicollectionall_neuromuscular_diseaseAll Neuromuscular Disease

httpngneurologyorgcgicollectionall_medical_systemic_diseaseAll MedicalSystemic diseasefollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpngneurologyorgmiscaboutxhtmlpermissionsits entirety can be found online atInformation about reproducing this article in parts (figurestables) or in

Reprints

httpngneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

reserved Online ISSN 2376-7839Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology All rightsan open-access online-only continuous publication journal Copyright Copyright copy 2019 The Author(s)

is an official journal of the American Academy of Neurology Published since April 2015 it isNeurol Genet