improvement of potato (solanum tuberosum l.) for abiotic...

Improvement of Potato (Solanum

tuberosum L.) for Abiotic Stress Tolerance

through Genetic Engineering

Aamir Iqbal

2016

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

This page intentionally left blank.

Reviewers and Examiners

Foreign Reviewers

1. Dr. David A. Lightfoot,

Southern Illionois University,

Illionis USA

2. Dr. Dittmar Hahn,

Texas State University,

Texas USA

3. Dr. Bernhard Seiboth

ACIB GmbH Petersgasse,

Vienna Austria

Thesis Examiners

1. Prof. Dr. Amer Jamel,

University of Agriculture Faisalabad,

Faisalabad

2. Dr. Javed Ahmad,

Wheat Botanist,

AARI Faisalabad

3. Dr. Asma Haque,

Associate Professor,

GC University

Faisalabad

Head of the Department (Name): Prof. Dr. Shahid Mansoor, S.I.

Signature with date: _____________________

ii

Improvement of Potato (Solanum

tuberosum L.) for Abiotic Stress Tolerance

through Genetic Engineering

Aamir Iqbal

Submitted in partial fulfillment of the requirements

for the degree of Ph.D.

2016

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

iii

Thesis Submission Approval

This is to certify that the work contained in this thesis entitled “Improvement of potato

(Solanum tuberosum L.) for abiotic stress tolerance through genetic engineering”

was carried out by Aamir Iqbal, and in my opinion, it is fully adequate, in scope and

quality, for the degree of Ph.D. Furthermore, it is hereby approved for submission for

review and thesis defense.

Supervisor: _____________________

Name: Dr. Shaheen Aftab

Date: 24 August, 2016

Place: NIBGE, Faisalabad

Co-Supervisor: __________________

Name: Dr. Zahid Mukhtar



Head, Department of Biotechnology: _____________________

Name: Dr. Shahid Mansoor



iv

Acknowledgement

All praise is for Almighty Allah, the creator and sustainer of all life forms in the

universe and the ultimate source of knowledge and creativity. He honoured man to be

His deputy, endowed him with intellectual power and understanding and gave him

spiritual insight so that he may discover himself, conquer nature and know his creator

through His wondrous signs. I am thankful to Dr. Zafar M. Khalid, Ex-Director and

former supervisor National Institute for Biotechnology and Genetic Engineering

(NIBGE), Faisalabad, for providing me research facilities and inspiring attitude during

the course of study. I am also thankful to our present Director Dr. Shahid Mansoor. I

would like to express deep gratitude to my supervisor Dr. Shaheen Aftab (P.S.),

Agricultural Biotechnology Division, for her guidance, consistent encouragement,

constructive criticism and kind supervision under which this research has been

conducted.

The best part of my PhD research lies with an opportunity to work with Dr.

Zahid Mukhtar (DCS), who trained me for what I did not know earlier. I really can’t

express my gratitude for him in actual sense. He gave me confidence to describe things

in best and easiest way. I will always be indebted to Ali Rizwan (PSA) for his

sympathetic and caring attitude during my research.

My words will remain incomplete for my friends Dr. Muther Mansoor

Qaisrani, Dr. Asif Habeeb, Dr. Ikram Anwar, Dr. Rizwan Haider, Dr. Vakil

Ahmed, Dr. Inaam Ullah, Dr. Ghulam Rasool, Dr. Amir Raza, Tahir Naqash, Bilal

Haider, Mehboob Ahmed, Arshad Murtaza, Ahmed Zaheer, Quddoosul-ul-Haq

Muqqaddasi, Sohail Mehmood Karimi for their support and encouragement.

No acknowledgment can adequately express my obligation to my deceased

father, mother, brothers and sister who always wished to see me glittering high up in

the sky. I owe a great deal of my success to all of them. Last but not least I would like

to acknowledge the consistent support and loving attitude of my wife Saima Siddiqui

v

and my brother in law Dr. Abdul Aleem Siddiqui who has always been the source of

inspiration and never let me down which enabled me to complete this arduous task.

I am highly grateful to Higher Education Commission of Pakistan (HEC) for

providing funding and research facilities.

Aamir Iqbal

vi

Dedicated

to

My Father (Late)

vii

Declaration of Originality

I hereby declare that the work contained in this thesis and the intellectual content of this

thesis are the product of my own work. This thesis has not been previously published

in any form nor does it contain any verbatim of the published resources which could be

treated as infringement of the international copyright law. I also declare that I do

understand the terms ‘copyright’ and ‘plagiarism,’ and that in case of any copyright

violation or plagiarism found in this work, I will be held fully responsible of the

consequences of any such violation.

________________

(Aamir Iqbal)

24 August, 2016

NIBGE, Faisalabad

viii

Copyrights Statement

The entire contents of this thesis “Improvement of potato (Solanum tuberosum L.)

for abiotic stress tolerance through genetic engineering” by Aamir Iqbal are an

intellectual property of Pakistan Institute of Engineering & Applied Sciences (PIEAS).

No portion of the thesis should be reproduced without obtaining explicit permission

from PIEAS.

ix

Table of Contents

Declaration of Originality ............................................................................................ vii

Copyrights Statement ..................................................................................................viii

Table of Contents .......................................................................................................... ix

List of Figures ............................................................................................................... xi

List of Tables ............................................................................................................... xii

Abstract .......................................................................................................................... 1

1. Introduction ................................................................................................................ 6

1.1 Economic Importance of Potato ........................................................................... 7

1.1.1 Potato Production World-wide ..................................................................... 8

1.1.2 Uses of Potato ............................................................................................... 9

1.2 Abiotic Stresses .................................................................................................... 9

1.2.1 Drought and Drought Effects ...................................................................... 10

1.2.2 Salinity Problems in Pakistan ..................................................................... 11

1.2.3 Effects of Salinity on Plants ........................................................................ 11

1.2.4 Salinity Effects on Potato ............................................................................ 11

1.3 Ways to Combat Abiotic Stresses ...................................................................... 12

1.3.1 Conventional Breeding ............................................................................... 12

1.3.2 Genetic Engineering .................................................................................... 13

1.3.3 Tissue Culture: A Tool for Improvement ................................................... 13

1.4 Characteristics of Protons Transporters and their Mechanism of Actions ........ 14

1.4.1 Proton Pumps .............................................................................................. 14

1.5 AVP1 and its Expression .................................................................................... 18

1.6 Transcription Factors ......................................................................................... 19

1.6.1 Types of Transcription Factors ................................................................... 20

1.6.2 Transcription Factors Involved in Abiotic stress ........................................ 21

1.7 HSR1 and its Expression .................................................................................... 22

1.8 Objectives of the Study ...................................................................................... 24

2. Regeneration System for Potato Cultivars ............................................................... 25

2.1 Introduction ........................................................................................................ 25

2.2 Materials and Methods ....................................................................................... 26

2.2.1 Plant Material .............................................................................................. 26

2.2.2 Surface Sterilization of Tissue Culture Accessories ................................... 26

x

2.2.3 Statistical Analysis ...................................................................................... 28

2.3 Results ................................................................................................................ 28

2.4 Discussion .......................................................................................................... 33

3. Development and Screening of Transgenic Plants for Abiotic Stress Tolerance .... 35

3.1 Introduction ........................................................................................................ 35

3.2 Materials and Methods ....................................................................................... 39

3.2.1 Construction of Plant Expression Cassette ................................................. 39

3.2.1.2 Bacterial Culture Preparation of Agrobacterium-tumefaciens (LBA4404)

.............................................................................................................................. 41

3.2.3 Transformation Efficiency of Potato Transgenic Plants ............................. 43

3.2.4 Molecular Characterization of Transgenic Plants ....................................... 43

3.2.5 Southern Analyses of Transgenic Plants ..................................................... 44

3.2.6 Screening of Transgenic Potato Plants for Abiotic Stress Tolerance (Salt &

Drought) ............................................................................................................... 44

3.2.6.1 In vitro Screening of Transgenic Potato Plants for Salt Tolerance .............. 44

3.2.6.2 In vitro Screening of Transgenic Potato Plants for Drought Tolerance ....... 44

3.2.7 Pot Studies for Salt Stress ........................................................................... 44

3.2.8 Physiological Parameters ............................................................................ 45

3.2.9 Antioxidant Analysis .................................................................................. 46

3.2.11 Statistical Analysis .................................................................................... 47

3.3 Results ................................................................................................................ 48

3.3.1 Cloning of HSR1 Gene ................................................................................ 48

3.3.2 Plant Transformation .................................................................................. 49

3.3.3 Molecular Analysis of Transgenic Plants ................................................... 51

3.3.4 Southern Analyses ...................................................................................... 52

3.3.5 In vitro Screening of Transgenic Potato Plants for Abiotic Stress Tolerance

(Salt & Drought) .................................................................................................. 53

3.3.6 Agronomic Parameters of Transgenic Potato Plants Exposed to Abiotic

Stresses (Salinity & Drought) .............................................................................. 54

3.3.7 Pot Study for Salt Stress ............................................................................. 73

3.3.8 Physiological Analysis ................................................................................ 73

3.3.9 Biochemical Analyses of Transgenic Plants ............................................... 88

3.3.10 Screening of Water Stressed Transgenic Potato Lines under Tunnel ....... 93

3.4 Discussion .......................................................................................................... 98

3.5 Conclusions ...................................................................................................... 108

4. References .............................................................................................................. 110

xi

List of Figures

Figure 1.1 Potato production (as a percentage) by world regions ........................... 8

Figure 1.2 Schematic presentation of proton pumps adapted from Gaxiola et al. 15

Figure 1.3 Schematic overview of the V-type ATPases ....................................... 17

Figure 1.4 The regulation of the transcription factor activity ............................... 20

Figure 2.1 Percentage of callus ............................................................................. 29

Figure 2.2 Percentage of shoot induction at different media ............................... 30

Figure 2.3 Number of shoots and roots in regenerated shoot for three cultivars .. 31

Figure 2.4 Different regeneration stages for potato cultivars ................................ 32

Figure 3.1 Plant global response to cope with water deficit, high temperature and

salinity .................................................................................................. 37

Figure 3.2 Schematic presentation of plasmids maps ........................................... 41

Figure 3.3 Verification of synthetic HSR1 in plant expression vector .................. 48

Figure 3.4 Different stages of transgenic plant production ................................... 50

Figure 3.5 PCR amplification of synthetic HSR1 gene fragment .......................... 52

Figure 3.6 PCR amplification of AVP1 gene fragment ......................................... 52

Figure 3.7 Southern analyses of transgenic potato plants. .................................... 53

Figure 3.8 In vitro screening of transgenic plants ................................................. 72

Figure 3.9 Salinity stress assays ............................................................................ 78

Figure 3.10 Membrane stability index of potato transgenic lines ........................... 80

Figure 3.11 Accumulation of Sodium (Na+) contents ............................................. 81

Figure 3.12 Potassium (K+) contents after salt stress .............................................. 82

Figure 3.13 Na+/K+ of transgenic and control plants after salt stress ...................... 83

Figure 3.14 Total free amino acids contents after salt stress ................................... 84

Figure 3.15 Total soluble sugar contents................................................................. 85

Figure 3.16 Estimation of total proline contents ..................................................... 87

Figure 3.17 Estimation of starch contents ............................................................... 88

Figure 3.18 Estimation of SOD production............................................................. 89

Figure 3.19 Estimation of POD production............................................................. 90

Figure 3.20 Estimation of Ascorbic peroxidase (APX) production ........................ 91

Figure 3.21 Estimation of Catalase accumulation ................................................... 92

xii

List of Tables

Table 2.1 Combinations of various growth regulators used for callus induction in

three different cultivars of potato ......................................................... 27

Table 2.2 Media combinations with growth regulators supplements for

subsequent regeneration of shoots ....................................................... 27

Table 2.3 Rooting media for callus-derived shoots of different potato cultivars 28

Table 3.1 Primers used for amplification of HSR1 and AVP1 ............................. 42

Table 3.2 Transformation efficiency % of putative transgenic plants (T0) .......... 51

Table 3.3 Mean comparison for Shoot length (cm) of transgenic (T0) vs control

potato at different levels of NaCl ......................................................... 55


potato at different levels of PEG .......................................................... 56

Table 3.5 Mean comparison for Root length (cm) of transgenic (T0) vs control




Table 3.7 Mean comparison for leaf area index (cm2) of transgenic (T0) vs

control potato at different levels of NaCl ............................................ 59

Table 3.8 Mean comparison for leaf area index (cm2) of transgenic (T0) vs

control potato at different levels of PEG ............................................. 60

Table 3.9 Mean comparison for shoot fresh weight (g) of transgenic (T0) vs




Table 3.11 Mean comparison for root fresh weight (g) of transgenic (T0) vs




Table 3.13 Mean comparison for shoot dry weight (g) of transgenic (T0) vs control


Table 3.14 Mean comparison for shoot dry weight (g) of transgenic (T0) vs control


Table 3.15 Mean comparison for root dry weight (g) of transgenic (T0) vs control




xiii

Table 3.17 Mean comparison for relative water contents (%) of transgenic (T0) vs


Table 3.18 Mean comparison for relative water contents (%) of transgenic (T0) vs


Table 3.19 Photosynthetic rate, Stomatal conductance, Transpiration rate and Sub-

stomatal conductance potential in HSR1 (C-1) ................................... 75

Table 3.20: Photosynthetic rate, Stomatal conductance, Transpiration rate and Sub-

stomatal conductance potential in all AVP1 (C-2) ............................... 77

Table 3.21 Mean comparison for tubers plant -1 of potato among transgenic and

non transgenic grown at different irrigations ....................................... 94

Table 3.22 Mean comparison for tubers weight plant -1 of potato among transgenic

and non transgenic grown at different irrigations ................................ 95

Table 3.23 Mean comparison for biomass plant -1 of potato among transgenic and

non transgenic grown at different irrigations ....................................... 96

1

Abstract

Input applications of agricultural and industrial activities have increased salt levels in

our soils. In the modern era of agricultural production of crops, shortage of water

resources makes them inaccessible for growing crops. Plant species have different

mechanisms that deal with the salt tolerance; but the capability to sustain low cytosolic

Na+ is supposed to be one of the vital factors of plant salt tolerance. Removal of Na+

from the cytoplasm of the cells and/or the maintenance of the low cytosolic Na+

concentrations is carried out either by pumping Na+ out of cells (plasma membrane

antiporter) or into the vacuoles (vacuolar antiporter) under high salinity conditions. This

process is brought about by the operation of plasma membrane-bound H+-pumps

responsible for energizing Na+/H+ antiporters. In addition to this, engineering of the

regulatory machinery involving transcription factors has emerged as a new tool now for

controlling the expression of many stress-responsive genes. Development and use of

transgenic plants with enhanced capability of salt tolerance by over-expression of genes

may help to meet the future challenges of abiotic stresses.

The effect of plant growth regulators in different combinations on in vitro

regeneration of currently grown potato cultivars (cvs). ‘Kuroda’, ‘Cardinal’ and

‘Desiree’ were determined. Overall, the callus production and in vitro regeneration

efficiency was maximum in Cardinal and Kuroda. Media combination and cultivars

having potential for good callus induction and regeneration were selected for

transformation. The novel synthetic HSR1 gene was cloned under double CaMV35S

promoter in the pGreen0029 plant expression vector. HSR1 and AVP1 genes were

transformed in potato through Agrobacterium-mediated transformation method.

Putative transgenic calli and regenerated shoots were obtained in the presence of

kanamycin (50 mg/ml) as plant tissue selection agent. Varying transformation

efficiencies (30 and 25 %) were observed in different batches for Kuroda and Cardinal,

respectively. A total of 57 transgenic plants were obtained from independent events and

were successfully established in pots containing sterilized sand.

2

Transgenic plants were confirmed by PCR and Southern hybridization. Variable

numbers (1-4) of integration sites for the transgenes were observed in the genomic DNA

of transgenic potato plants when AVP1/HSR1 specific probes were used for Southern

analysis. In order to check abiotic stress tolerance potential, transgenic plants were

subjected to in vitro screening in response to different levels of stress inducing agents

like NaCl and PEG (6000). Agronomic parameters (shoot length, root length, leaf area

index, shoot fresh weight, shoot dry weight, root fresh weight, root dry weight and

relative water contents) were recorded that shows the transgenic potato lines performed

better under stress conditions compared to the control plants.

Transgenic potato plants containing AVP1 and synthetic HSR1 genes were

analyzed for salt stress tolerance. Significantly (P ≤ 0.05) higher photosynthetic rates,

stomatal, sub-stomatal conductance and transpiration rate were observed in transgenic

plants harboring HSR1 and AVP1 genes compared to control plants. Higher Membrane

Stability Index was noted in transgenic plants than non-transformed plants. Transgenic

plants showed higher accumulation of Na+, K+ and a higher Na+/K+ ratio than non-

transformed plants. Salt analyses showed high accumulation of total free amino acids,

proline contents, and total soluble sugars indicating salt tolerance manifested by

transgenic AVP1 and HSR1 plants. To avoid the toxic level of ROS and protect the cells

from oxidative injury, accumulation of complex antioxidant enzymes such as

superoxide dismutase (SOD) (EC 1.15.1.1), peroxidase (POD) (EC 1.11.1.7), ascorbic

peroxidase (APX) (EC 1.11.1.11) and catalase (CAT) (EC 1.11.1.6) were determined

in stressed leaves which showed a significantly higher accumulation in transgenic

potato plants compared to controls. Tunnel experiment was performed for yield

components to check the potential of transgenic plants under various levels (100, 75

and 50%) of drought stress. Significantly (P ≤ 0.05) higher biomass, number of

tubers/plant and weight of tubers/plant was observed at 75 and 50% of drought stress.

This study provides an efficient protocol for regeneration efficiency of potato

cultivar Kuroda, Cardinal and Desiree using internodal explants. The results suggest

that transgenic plants expressing higher levels of AVP1 and HSR1 transcripts in potato

are able to withstand salt and drought stress regimes.

3

List of publications

Journal publication

Iqbal, A., Shaheen, A., Rizwan, A., Mansoor, S., Khalid, Z. M and Mukhtar Z. 2016.

Comparison of regeneration efficiency in Pakistani potato cultivars. Pak. J. Bot., 48(1)

285-290.

4

List of Abbreviations

ABA

ATP

AVP1

V-PPase

μL

abscisic acid

adinotriphosphate

Arabidopsis vacuolar pyrophasphatase

vacuolar pyrophasphatase

microliter

CaCl2 calcium chloride

CIM callus induction medium

CTAB

CRD

cetyl trimethyl ammonium bromide

complete randomized design

DNA deoxyribonucleic acid

EDTA ethylene diamine tetra-acetic acid

HSPs heat shock proteins

KCl potassium chloride

NaCl sodium chloride

mg milligram

mM

Mha

millimolar

million hactare

MS Murashige skoog

NaOH sodium hydroxide

MgCl2 magnesium chloride

LB Lauria Bertani

rpm revolutions per minute

RNA ribonucleic acid

CAT catalase

OD optical density

PCR polymerase chain reaction

P5CS Delta-1-pyrroline-5-carboxylate synthase

pH paviour of hydrogen

5

PEG

SIM

polyethylene glycol

shoot induction medium

TFs Transcription factors

TAE tris-acetate EDTA

Taq Thermus aquaticus

ZR

BAP

IBA

NAA

GA3

IAA

zeatin riboside

6-benzylaminopurine

Indole-3-butyric acid

naphthaleneacetic acid

gibberellic acid

indole-3-acetic acid

6

1. Introduction

World population is projected to raise a third, or 2.3 billion between 2013 and 2050.

Compared to past forty years, it is considered a sluggish frequency of expansion that

was about 3.3 billion people and this inflation has also been seen in the developing

countries. In this competition, sub-Saharan Africa’s population is growing faster (+114

percent) and East and Southeast Asia’s left behind with (+13 percent). To date, 870

million people have been reported as hungry during the period of 2010–12 and this

number examplifies 12.5% of the world population. Moreover, it is also estimated that

among these, 852 million, belong to developing countries, where the frequency of

starvation is now going to reach at 14.9% of the population [1]. In current scenario,

almost one billion people deprive of their basic necessities in terms of food energy and

this trend reflects the demand for rapid growth of food.

It is expected to attain cereal production from 2.1 to 3 billion tones by 2050 and

this projection shows a need to increase the 70% food production between 2013 and

2050 [2]. This suggests a significant increase in the production of several key

commodities. So, an exceptional pressure has been built across the world on agricultural

commodities which is due to the shocking demand of food and its applied products.

These systems are now facing opposition for water and land resources and has been

forced by unprotected agricultural practices, therefore needed certain consideration and

exact remedial action [3].

Pakistan’s economy is totally based on agriculture and its associated sectors as

currently it subsidizes about 21% to GDP. Agriculture has a great contribution towards

industrious employment prospects which comprises 45% of the labor force and 60% of

the rural population relies on this division for its occupation [4]. It has a substantial role

in certifying food safety, making inclusive economic growth, decreasing poverty and

renovating towards industrialization [5]. Now, it is needed to determine the dimensions

to feed the rapidly increasing population of Pakistan.

1. Introduction

7

1.1 Economic Importance of Potato

Potato (Solanum tuberosum L.) and other tuber bearing Solanum species originated in

the highland regions of the Andes in Peru and Bolivia [6]. Potato is the fourth most

important crop in production and ranks fifth in planted area among crop plants grown

for human consumption world-wide. Potato is an autotetraploid (2n = 4x = 48) and has

been the most commonly cultivated species in which the viable cultivars are often

sterile. It has promising status for its nutritive (starch) value and food processing

industry [7]. Most of the world’s potato crop is grown in the industrialized countries of

the northern temperate zone. Potato in developing countries has experienced the

world’s highest annual growth rate in production during the last three decades. Thus,

potato is considered as one of the best nominees for improving food shortages. In the

early 1990s, the contribution of developing countries to the global potato production

was 30% as compared to 11% in the early 1960s [8].

Potato is considered as high yielding cash crop in Pakistan and the area under

its cultivation has increased quickly since independence. The total production is 4.10

million tons from an area of 185.1 thousand hectares [9]. However, per hectare average

yield is very low (20 to 22 t/ha) as compared to some of the developed countries (45 to

50 t/ha). Pakistan has a very diverse and suitable climate for the cultivation of potato

crop. Irrigation system combined with climatic conditions permit the cultivation of

three potato crops round the year in various agroecological zones from sea level to 3000

m altitude. Autumn crop grown in plains of southern Punjab, Balochistan and Sindh,

spring crop is cultivated in the plains and lower hills of Balochistan, Khyber

Pakhtunkhwa and one summer crop is cultivated in the high altitude hilly northern areas

of Gilgit and Skardu, KPK and Azad Jummu Kashmir [10]. Almost 50% of the total

production comes from Okara, Sahiwal, Sialkot, Lahore, Kasur and Jhang districts of

Punjab. Rest of the areas for production are Pishin and Kalat districts of Balochistan

and Kaghan, Swat, Dir and Peshawar valleys of the KPK. Potato is nutritionally a

balanced staple food as compared to rice, corn, wheat and carrot. Therefore, it has a

great potential to enhance the food resources of the country and minimize the stress on

cereal crops [10].

1. Introduction

8

1.1.1 Potato Production World-wide

World-wide, more than a billion people eat potato, presenting it as a perilous crop in

terms of food security. For example, China, known as the world’s biggest population

and user of potato, expects that 50% of the increased food production will be needed to

meet the required mandate in the next 20 years and that will come from potato. The

global tendency in potato production from 1991 to 2013 has shown a 21% increase,

from 268 million tones (Mt) to 325 Mt [11]. Moreover, this is the significant (more than

90%) increase in potato production from 85 Mt to 165 Mt in the developing world,

while production in the developed world has been decreased 12% from 183 Mt to 160

Mt. Over the entire period from 1992 to 2013, Europe has been the chief producer of

potato, with 44.5% of the global while Asia ranked second (37.5%). Today, potato

production has dropped in Europe and improved in Asia which depicts that in 2010

alone Asia accounted for 47.5% of the global potato crop, whereas Europe contributed

33.3%. Across the world, it is estimated that roughly 19 million hectares (Mha) has

been devoted to potato production, having an average yield of around 17 t/ha. The data

from 2007 to 2012, reveals that decrease in potato production in Europe is due to a

reduction in the area dedicated to this crop, rather than a reduction in yield (t/ha). On

the other hand, the average yield of potato across Africa (12.2 t/ha in 2012) persist at

the lowest level globally, while in other world regions exceed 16 t/ha on average.

Figure 1.1 Potato production (as a percentage) by world regions [12]

1. Introduction

9

1.1.2 Uses of Potato

Tubers are short, thickened, mostly underground stems. They have tiny scale leaves,

each with a bud that has the tendency for developing into a whole plant. To date, the

tubers have been playing a significant role in food availability. Tubers contain

important constituents of the diet. Regardless of being ranked third as a food crop

behind wheat and rice, production of dry matter and protein per hectare is more than

the other cereal crops [13]. Nearly, 50% of potatoes are estimated to be consumed fresh,

while most of the remaining proportion of the crop are processed into food products

and ingredients, animal feed, or serve as seed tubers for the following season’s potato

crop. Being essential as a food crop, potato is also an important source of starch. Potato

starch has some distinctive features compared with commodity starches from cereals.

These properties (including high phosphate content and very large smooth granules) are

being applied in the manufacturing of high quality paper [14] and the generation of

viscous hydrocolloid systems [15]. Approximately 18% of the potato crop is being used

for starch production within the Europe.

The rapid growth rate of potato production has started to slow down in many

developing countries because of three major constraints: abiotic stresses, diseases and

pests, and scarce economic resources [16].

1.2 Abiotic Stresses

Abiotic stresses have negative impact on survival, yield and biomass production

worldwide, dropping prospective yield to 70% and more than 50% of major crop plants

[17]. Individually, the apparent yield losses estimated at 17, 20, 40, 15 and 8% by

drought, salinity, high temperature, low temperature and other factors respectively [18].

Being a multi-genic and quantitative trait, it is very difficult to have the idea of

molecular basis of the abiotic stress tolerance as compared to the biotic stress. Drought

and salinity appears to be the source of osmotic stress which causes destabilizing of

homeostasis and also the ionic distraction in the cell [19, 20]. Oxidative stress may also

cause damaging of structural and functional proteins [21].

Although, salinity problem prevails world-wide but its brutality and magnitude

is greater in arid and semi-arid regions [22-24]. Salinity has damaged a big area (almost

10%) of world’s arable land which includes half of the countries of the world [25].

1. Introduction

10

Salinity seems to be an adverse environmental constraint which restricts the

exploitation of about 800 million ha of agricultural land world-wide for agricultural

productivity [26, 27]. Out of world’s total salt affected land, more than 50% are

categorized as saline-sodic and sodic soils [28]. It is estimated that, 20% of cultivated

land is salt affected as it is being irrigated with brackish water.

High salinity seems as one of the main complications with groundwater quality

in Pakistan which comes from water logging due to irrigation, suspension of salts in the

soil, evaporation and industrial pollution. Shortage of canal water has invited farmers

to ensure the use of saline ground water that prevails widely in arid and semi-arid

environments of India and Pakistan [29, 30]. Moreover, irrigation with saline water not

only spoils the quality of food products but also confines the selection of cultivable

crops [31-34].

1.2.1 Drought and Drought Effects

Despite of being an important part for plant growth, water constitutes from 75 to 95%

of plant tissues. A substantial quantity of water is transported throughout the plant daily.

Production of sugars and complex carbohydrates is totally based on CO2 and water.

Being a carrier of nutrients and also a cooling agent, it provides an element of

maintenance through turgor [35]. Drought has been defined by metrological,

hydrological and agricultural criteria. Deficiency of precipitation over a prolonged

period of time (usually a season or even more) is called metrological drought. Although

many considered it as an occasional and casual event but drought is a normal and

persistent element of climate [36]. Reduced river and stream flow and critically low

ground water tables fulfill the criteria of hydrological drought. Agricultural drought

specifies prolonged dry period which leads to crop stress and decline in harvest. The

shortage of soil moisture has adverse effect on agriculture, when the soil moisture is

not enough to encounter the desires of growing crop. It is likely to be due to the lack of

moisture in soil resulting from rainfall or irrigation over an extended period of time.

Globally, water stress is declared to be the most serious restrictive factor in crop

yield. It is estimated that, around 28% of the world’s land is lacking the ability of

vegetation [37], and 45% of the agriculture land is going to be dry [20]. Ding et al. [38]

reported that out of 18% of the global irrigated farmland, only 40% of the global food

supply is being produced on this land. Moreover, frequent drought and hostile human

1. Introduction

11

actions might also be the reason of desertification of susceptible arid, semi-arid and dry

sub-humid areas. The Indus Basin affected by drought with other linked scarcities

during the 19th and the first half of the 20th century, scarcities averagely came about

after 7 to 8 years [39]. Drought causes an average annual yield loss of 17% in the tropics

[40] but losses can be critical and total crop failure is possible. In fact, developing

countries are facing the severe food security challenges. To survive with current

challenges, there is a great need of stress tolerant crops to fulfill the future world food

requirements [41].

1.2.2 Salinity Problems in Pakistan

It is estimated that 6.68 Mha is salt-affected and 56% of it is saline-sodic in nature [42,

43]. Among provinces, Punjab ranked first in salinity problem (43.2%), closely

followed by Sindh (34.2%), Baluchistan (21.8%), and KPK (0.8%), respectively. At

present, invasion of salinity prevails more than 25% of irrigated land and nearly 1.4

Mha of cultivated land has been affected [44]. At present in Pakistan, loss in agricultural

products due to salinity is estimated between 15 and 55 billion rupees ($340 million to

$1.2 billion). In addition, almost 15 billion rupees (A$340 million) has been lost in

terms of land left unproductive [45].

1.2.3 Effects of Salinity on Plants

There are some particular symptoms shown by the plants in response to salt regime.

Retarded growth and appearing of several disappearing color considered as first

indication of plant stress. Cellular dehydration is the result of salt stress which causes

osmotic stress and movement of water from intracellular to extracellular space reducing

cytosolic and vacuolar volumes [46]. Some overlapping properties are normally seen

in crop plants which include metabolic processes, photosynthesis reduction and some

hormonal imbalance, when subjected to salt stress.

1.2.4 Salinity Effects on Potato

Potato (Solanum tuberosum L.) is oftenly considered as salt-sensitive plant especially

in the early stages of growth [47]. It is reported that potato yield has been reduced to

50% when subjected to increase in soil salinity up to 5.9 ds/m [48]. Consequently, the

invention of tolerant potato cultivars is considered to be as one of the encouraging

tactics to develop yield strength against abiotic stress. Homeostasis in water potential

1. Introduction

12

and ion distribution has been disrupted by high salt stress. In fact, the alterations in

ionic and water homeostasis of plants lead to damage of metabolic activities, growth

custody and even plant death [49]. However, the nature of the damage faced by plants

in response to increased salinity level is still unknown. Complicated molecular

responses such as the development of stress proteins and well-matched osmolytes are

displayed by salt stress [50]. Consequently, there is a need to improve potato against

abiotic stresses such as salinity and drought in order to increase both yield and

cultivation area through use of marginal lands.

1.3 Ways to Combat Abiotic Stresses

To avoid this catastrophe, agricultural scientists are needed to discover the advance

skills for high yielding, biotic and abiotic tolerant cultivars. Esqueo et al. [51] reported

the response and adaptation of the plants to the abiotic stresses with a range of

physiological and biochemical alterations referred to as tolerance and avoidance. Both

tolerance and avoidance mechanisms have a great contribution to the capability of a

plant to persist under drought but it also depends on the rate and harshness of drought

periods [52, 53]. Several signaling pathways are activated by the plants and expression

of the genes which have been overlapped to each other are being induced by different

stress factors [54]. Consequently, for the expansion of breeding and transgenic

approaches resulting to improved stress tolerance in crops, it is very important to

explore the devices by which plant identifies environmental signals and their movement

to cellular machinery to activate adaptive responses.

1.3.1 Conventional Breeding

To fulfill the expanded need of agricultural products, crop improvement by means of

conventional breeding played an important role to increase food production and

generated hundreds of crop varieties. Conventionally, the genes controlling desirable

traits exists within the species and its relatives have been crossed together by sexual

crossing then selected for next progeny which will have more or less undesirable genes.

This presence of undesirable genes in crop plant is only due to the imprecise genetic

recombination through mating process. This is considered as the most important effect

that affects the breeding program [55]. Besides, the deficiency of germplasm with the

preferred characters, problems in setting selection conditions and the difficulty of the

resistance mechanisms is known to be the threat that restricted the breeding process

1. Introduction

13

[56]. Consequently, a very few crop varieties with improved stress tolerance have been

generated by traditional breeding. The deficiency of achievement in conventional

breeding for the development of salt tolerant crops has been attributed to the

quantitative nature of most of the procedures involved in salt tolerance [57].

Currently, the heterozygotic, tetraploid potato species are being cultivated

globally. Thus, using conventional breeding approaches various problems have been

experienced as crossing and inbreeding depression leads to the substantial decrease in

the proficiency of selection of a superior line. Being a tetraploid and quantitative in

nature, it is very difficult to select a pure line of the breeding targets [49]. A diploid that

is generated from a tetraploid plant is crossed with a closely related wild-type diploid

potato, and likewise the resultant hybrid is re-crossed with a tetraploid plant in order to

increase the genetic diversity [58]. However, potato advancement using conventional

breeding methods is slow and unpredictable. Now, quicker and more reliable techniques

like genetic engineering are being used to develop salt tolerant.

1.3.2 Genetic Engineering

It is a DNA recombination practice that facilitates the transformation of gene from one

genera to another genera and similarly among species. This practice is being widely

used in crop improvement. Genetic engineering has various benefits compared to

classical breeding for crop improvement. Primarily, genetic engineering prolongs the

genetic base by transferring valuable genes from organism [59]. Furthermore, it is well

documented that it escapes the problem of linkage drag attributed to the conventional

breeding and less time consuming. On the basis of above advantages, gene

transformation by means of genetic engineering is supposed to be the more striking and

rapid solution for improving stress tolerance as compared to the conventional breeding

[60]. To date, several crops including cotton, maize, potato, soybean and canola have

been developed and commercialized against biotic and abiotic stress through genetic

engineering [61, 62].

1.3.3 Tissue Culture: A Tool for Improvement

Establishing tissue culture system is a pre-requisite for the genetic transformation of

plants. Plant tissue culture has become an advance technique for the in vitro propagation

of a large number of genetically identical plants since last decade [63]. It offers many

unique prospects to study the biochemical, physiological and genetic nature of plants.

1. Introduction

14

Plant tissues and cells are totipotent, having capability of regenerating into whole plant

under in vitro conditions. It has also an important role in germplasm conservation of

both vegetative and seed propagated crop species.

Tissue culture and molecular techniques, both in combination have been

effectively used to integrate particular traits through gene transfer [64]. Though,

somaclonal variation is considered to be the unattractive in some of the tissue culture

based practices such as in vitro propagation and genetic transformation where genetic

constancy of regenerable culture is pre-requisite [65]. Regardless of the limitations

linked with the consumption of somaclonal variation for selection of favorite traits, it

might offer a cost effective and easily reachable tactic for potato improvement in areas

where transgenic technology has resource limitations.

1.4 Characteristics of Protons Transporters and their

Mechanism of Actions

1.4.1 Proton Pumps

In cells, 50% of the total intracellular energy assets are expended to sustain gradients

of ions across their membranes which are connected with the several purposes

attributed to the membranes of living organisms [66]. Proton pumps hold a significant

position among all transporters. Fester et al. [67] reported that plants and fungi are

parallel in using protons as a “currency” (proton electrochemical gradient) while animal

cells use Na+ ions as a driving force. Maser et al. [68] confirmed that nearly 5% of the

Arabidopsis genome seems to encode membrane transport proteins.

Primary transporters have been involved in the generation of proton

electrochemical gradient in plants and named as proton pumps because they transport

H+ to the extracellular space or into the vacuolar lumen which seems to be the largest

intracellular H+ bank. Plants have three different types of H+ transporters. Gaxiola et al.

[69] reported endosomes (vacuoles, pre-vacuolar bodies and golgi vesicles) as a

location of the vacuolar ATPase (V-ATPase) and the vacuolar pyrophosphatase (H+-

PPase) which pump H+ into the lumen of these organelles.

1. Introduction

15

Figure 1.2 Schematic presentation of proton pumps adapted from Gaxiola et al.

[69]

1.4.1.1 Plasma Membrane ATPases

The plasma membrane ATPase attributes to the P-type ATPase super-family of ion

pumps, which have been categorized by the development of a phosphorylated

intermediate during the reaction cycle and vanadate reservation [70, 71]. The plasma

membrane not only has an important role in extrusion of H+ from the cell but it also

motivates the uptake and discharge of various nutrients across the plasma membrane of

plant cells. This pump plays several activities specific to plants such as transportation

of nutrients at flowering stage, tolerance potential under stressful condition and guard

cells activities. Hydrolysis of ATP and perhaps the phospholipids give energy to both

the ion pumps of P-type and primary transporters [72]. Additionally, the P-type

ATPases are realized to be involved in several cellular practices such as producing and

sustaining the electrochemical gradient being used as the driving force for the

secondary transporters (H1-ATPases in plants and fungi and Na1/K1-ATPases in

animals), cellular signaling (Ca21-ATPases), the transport of essential micronutrients

(Zn21- and Cu21-ATPases), and extrusion of the same ions if they accumulate in too

much amounts. A total of 45 P-type ATPases have been recognized in the genome of

Arabidopsis including 12 plasma membrane H+ translocating ATPase genes (AHA1

AHA12), 14 Ca2+ATPases and seven different heavy metal pumps [73]. This pump is

also being involved in nutrient storage, phloem loading, growth and development of

1. Introduction

16

turgor. Moreover, it also creates the membrane potential that governs the flow of ions,

in or out of the cell, via their ion specific channels.

1.4.1.2 Vacuolar ATPases

This belongs to the F-type, V-type and A-type ATPase superfamily of ion pumps, which

are known to be the large and multimeric enzymes composed of two complexes; V1 or

F1 peripheral complex [74]. This complex has at least 5 sub-units which catalyzes the

hydrolysis of ATP whereas the other Vo or Fo membrane associated complex has 3

subunits and behaves as ion conducting channels [75]. F type ATPases are present in

bacteria, mitochondria and chloroplasts and are responsible for the production of ATP

from ADP at the cost of electrochemical gradient difference. The A-type ATPase is

present in Archaea and shows resemblance to F-type ATPases [76]. In Arabidopsis, V-

type ATPase complex being a multi-subunit complex which are almost ten in number

and encoded by 26 genes [77].

This pump is known to be the most complicated in subunit composition, having

three distinct proton pumps in plants. Now in eukaryotes it is emerging as a pump with

miscellaneous and surprising functions. In plants, V-ATPases are located in vacuoles

and other membranes of the secretory system, including the endoplasmic reticulum

(ER), Golgi and small vesicles and the plasma membrane [78]. This pump has a key

role to acidify the vacuole, provides the energy for transport of ions and metabolites

influencing turgor and cell expansion. Faraco et al. [79] reported that the proton

electrochemical gradient is essential for protein sorting. Unlike to the F-type ATPases,

that generate ATP from a proton gradient across a membrane, the V-type enzymes

exploit ATP to acidify compartments for receptor-mediated endocytosis, intracellular

trafficking, and protein degradation [80].

1. Introduction

17

Figure 1.3 Schematic overview of the V-type ATPases adapted from Sagermann

et al. [76]. Subunit H, also named Vma13p, is highlighted in green and only one

subunit is shown.

1.4.1.2 Vacuolar Pyrophosphatase

Both enzymes catalyze electrogenic H1 translocation from the cytosol into the vacuole,

but V-PPase has the unusual characteristic of being energized by PPi instead of ATP.

The vacuolar H+-pyrophosphatase (H+PPase) belongs to H+ translocating

pyrophosphatase family which is characterized by the use of pyrophospahtase (PPi) as

an energy source [81]. Structurally, H+PPases are homodimers of a 75-81 kDa

polypeptide that has 14-16 transmembrane segments [82]. Its catalytic domain is

located in the third loop exposed to the cytoplasmic side [83]. The H+PPase family

includes pumps found in vacuolar and golgi membranes of higher plants, algae,

protozoa, bacteria and archea [84]. Despite this the H+PPase has also been found in the

plasma membrane of Ricinus communis seedlings [85], cauliflower inflorescence [86]

and Arabidopsis thaliana [87]. Most of these enzymes operate in the hydrolytic mode

by breaking PPi molecules. Nevertheless, some other pumps, such as the H+PPi

synthase from Rhodospirillum ruburumoperate in the reverse direction [88]. There are

two types of H+PPase present in plant cells i.e. Type I whose activity is K+ dependent

and Type II which is K+ independent [89].

Low cost PPi has been used by H+PPase that is produced as a by-product from

several biosynthetic reactions, and used as a substrate to pump H+ into intracellular

1. Introduction

18

compartments, paying to the transmembrane H+ gradient. Moreover, this enzyme drives

one H+ for each PPi molecule. Mg2+ is an essential cofactor and that is why Mg2+-PPi it

is considered as a real substrate for H+PPase. The type I H+-PPase co-exists with the

H+-ATPase in the vacuolar membrane [90]. The activity of this pump has been

perceived in the fibrous root system of carrots as a residual tonoplast H+ activity in a

V-ATPase antisense mutant [91]. Pan et al. [92] reported that level of H+-PPase has

been up-regulated under stress.

1.5 AVP1 and its Expression

Yoon et al. [93] reported the heterologous expression of the AVP1 gene in

Saccharomyces cerevisiae which confers that its product is appropriate to provide the

activity of the H+-PPase in substrate binding and proton pumping. Furthermore, salt

sensitive S. cerevisiae ENAI- mutants are being successfully inhibited by the

heterologous expression of AVP1. Comparatively, transgenic Arabidopsis thaliana

harboring AVP1 showed more salt and drought tolerance than control plants [93]. In

addition to this over-expression of AVP1 in Arabidopsis causes numerous

morphological changes such as greater number of leaves, maximum cell numbers,

healthy roots development and higher auxin transport [87]. Park et al. [94] discovered

that the over-expression of the AVP1 allele (AVP1-D) plays a vital role to improve

drought tolerance in transgenic tomato plants via exhibiting higher Ca+ uptake and

greater leaf water potential under water stress. Likewise, some of the other groups also

showed that over-expression of similar genes encoding vacuolar membrane-bound

pyro-phosphatase (H+PPase or H+ pump) can be responsible to enhance both salt and

drought tolerance in heterologous system, including rice [95] and tobacco. Brini et al.

[96] described that over-expression of wheat vacuolar H+-PPaseTVP1 and Na+/H+

antiporter in transgenic Arabidopsis presented much more tolerance to water deficiency

and high applications of NaCl as compared to the wild type.

In another study, AVP1 transgenic cotton plants have been developed through

silicon carbide whisker-mediated gene transfer method [97]. These transgenic cotton

plants displayed substantial improvement in salt tolerance as compared to control.

Though, in a study reported by Li et al. [98], it was publicized that TsVPgene (vacuolar

H+-pyrophosphatase) from dicotyledonous halophyte Thellungiella halophila

transfered into the monocotyledonous maize crop enhanced the drought tolerance in

1. Introduction

19

transgenic maize. They also revealed that transgenic plants exhibited higher percentage

of seed germination, greater biomass, better developed of root systems, more solute

accumulation, less cell membrane damage relative to wild type plants under osmotic

stress. While drought stressed plants showed less growth retardation, shorter anthesis-

silking recesses and created much more grain yield than wild type plants.

The H+-PPase gene (TsVPgene) was transferred into cotton both in sense and

antisense orientation under the control of CaMV35S promoter. The transgenic plants

over-expressing the H+-PPase showed much more tolerance up to the concentration of

150 and 250 mM NaCl than the isogenic wild type plants but the plants from antisense

line with lower H+- PPase activity were more sensitive to salinity than the wild type

plants. Ma et al. [99] reported that over-expression of TsVP in cotton enriched shoot

and root growth and photosynthetic performance. In a similar kind of study, over-

expression of AVP1 gene enhanced salt and drought tolerance in transformed alfalfa.

Transgenic alfalfa showed better growth in the presence of 200 mM NaCl and also

under water deficit condition. In a study reported by Ibrahim et al. [100], full length

genomic AVP1 gene (3.2 kb) was isolated and transformed to tobacco. Different salinity

levels (50-250 mM NaCl) were tested for screening these transgenic plants. These

transgenics revealed better growth and tolerance to 250 mM NaCl while the control

plants showed wilting within 36-48 h of salt treatment. These transgenic plants were

significantly more tolerant than wild type plants under different periodic drought stress

treatment. Lv et al. [101] transformed TsVP H+PPase gene from Theligeulla

halophilainto two different cotton cultivars. The screening of isolated membrane

vesicles and vacuolar membrane vesicles proved that transgenic plants had higher V-

H+PPase activity matched with wild type plants. Moreover, over-expression of TsVP

gene in cotton enhanced shoot and root growth, and transgenic plants were much more

tolerant to osmotic/drought stress than wild type plants. Over-expression of AVP1 in

cotton presented more vigorous growth than wild type plants when treated with 200

mM of NaCl in hydroponic growth conditions. The fiber yield of AVP1-expressing

cotton plants has been 20% higher than wild type plants under drought conditions [102].

1.6 Transcription Factors

Transcription factors (TFs) are the key regulatory proteins (trans-acting factors) which

increase or suppress the transcriptional rate of their target genes levels by binding to

1. Introduction

20

specific DNA sequences (cis-acting elements) in the promoter. Therefore, transcription

factors administrate main cellular pathways in response to biotic stimuli such as

reaction against pathogens or symbiotic relationships and abiotic stimuli such as light,

cold, salt or drought [103]. They coordinately regulate the expression of their target

genes that are dispersed throughout the genome. To date, different genes associated to

abiotic stress, some transcription factors and even some regulatory sequences in plant

promoters sites have been characterized and categorized.

Figure 1.4 The regulation of the transcription factor activity. TF, Transcription

factor; IN, inhibitor; P, phosphate; Pr, NBP protein or other proteins adapted from Liu

et al. [104].

1.6.1 Types of Transcription Factors

Two types of transcription factors have been reported such as basal or general, and

regulatory or specific TFs [105]. Basal TFs comprise of minimal set of proteins and are

involved in the beginning of transcription by binding with TATA-box and along with

1. Introduction

21

RNA polymerase lead towards the formation of basal transcription apparatus, acting as

the central part of each transcriptional process. Regulatory TFs fix to upstream or

downstream of the basal transcription apparatus and improve or suppress the activity of

their target genes by acting either as constitutive or inducible factors and exert gene-

specific and/or tissue-specific functions [106]. So, it is not shocking that the existence

of various types of metabolic, developmental and stress response pathways frequently

results in extreme phenotypic changes in the organism which make them exceptionally

important nominees for biotechnological tactics.

1.6.2 Transcription Factors Involved in Abiotic stress

Plants have to face numerous environmental stresses including cold and drought that

could lead to several lethal effects in plants like reduced vigor, growth and productivity.

A large number of genes involved in abiotic stress tolerance have been exploited in

Arabidopsis including drought, salt and cold-inducible genes [107, 108]. Among these

genes, a large number of transcription factors show a vital role in the regulation of the

expression of downstream target genes by specific binding to cis-acting elements in the

promoters of down-regulated genes in reaction to environmental stresses [109-111].

DREB sub-family has a particular importance in a sense that genes belong to it, increase

or inhibit the expression of many stress-inducible genes in response to abiotic stresses.

The group was further divided into six sub-groups (A-1–A-6) on the basis of its

response to different form of stress such as DREB1/CBF (C-repeat binding factor) -

like genes, belonging to the A-1 subgroup, control expression of their target genes in

response to cold whereas DREB2-like genes, belonging to the A-2 sub-group, do the

same job in response to drought [112, 113].

Sun et al. [114] reported that AtbZIP1 is an Arabidopsis transcription factor

prompted by several abiotic stresses, such as salt, cold and drought. Novel members

belonging to the A-5 subgroup, have been investigated [115] and among these the

expression of PpDBF1 from the moss Physcomitrella patens is induced in response to

several environmental stresses like drought, high salt, cold stress. Similarly, over-

expression of abscisic acid (ABA) gene improved tolerance of transgenic plants to these

environmental stresses deprived of causing growth obstruction in plants [116]. Potato

genotypes transformed with a StMYB1R-1 exhibited plant tolerance to drought stress

excluding major effects on other agricultural traits. Iorizzo et al. [117] studied the

1. Introduction

22

expression patterns of the Phytophthora infestans resistance gene RB in transgenic

potato plants across a broad range of temperatures and at different important biological

stages. It was revealed that though plant morphology have been affected by extreme

temperature and growth but RB gene was transcribed at all ages and temperatures in all

genetic backgrounds [118,119].

1.7 HSR1 and its Expression

Heat shock RNA1 (HSR1) is a transcriptional factor present in yeast. S. cerevisiae is

considered as an important model system for stress studies [120]. Heat shock response

has been known as the source of production of heat shock proteins [121]. A large share

of the genome is transcribed as non-coding RNAs (ncRNAs) in eukaryotes. Moreover,

recent studies reveal that a large number of these RNAs play vital roles in regulating

gene expression at various levels. Meanwhile, the growing diversity of ncRNAs

recognized in the eukaryotic genome recommends a serious connection between the

regulatory potential of ncRNAs and the complexity of genome organization [122]. A

range of post-translational changes gives to the increased complexity and diversity of

protein species [123].

House-keeping ncRNAs are generally required for the normal function and

viability of the cell and constitutively expressed also. Some of the important examples

include transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), small nuclear (snRNAs),

snoRNAs, RNase P RNAs, telomerase RNA, etc. [124]. Ivica et al. [125] reported that

regulatory ncRNAs or ribo-regulators comprise those ncRNAs which are expressed at

certain stages of development, during cell differentiation, or in response to external

stimuli, that could disturb the expression of other genes at the level of transcription or

translation, hence has been involved in transcriptional regulation and epigenetic gene

regulation [126]. However, many long ncRNAs have been directly involved in

regulation of activities of the related proteins [127]. Khalil et al. [128] revealed that

large intergenic ncRNAs act as epigenetic regulators of gene expression. Whereas many

of other ncRNAs display strong evolutionary maintenance, representing that they are

subject to strong purifying selection [129].

A novel ncRNA called heat shock RNA-1 (HSR1) activates the heat shock

transcription factor 1 (HSF1), which is essential for the induction of expression of heat

shock proteins (HSPs) [130]. HSR1 are present in other eukaryotic organisms including

http://www.everythingbio.com/glos/definition.php?ID=1296




1. Introduction

23

Xenopus, Drosophila, and Caenorhabditis elegans, and their homologs are functionally

interchangeable [131]. It provides favorable support for existence of nc-RNA regulators

of other important processes such as RNA polymerase II transcription [132]. The heat

shock (HS) response serves as an important defense cellular mechanism under

unfavorable environmental conditions [133].

Martinez et al. [134] reported that HSR1, a novel gene from C. tropicalis

encodes a reputed protein which is homologous to heat-shock transcription factor. It

increases salt tolerance when transformed in S. cerevisiae by increasing the expression

of ENA1. Being a cation extrusion pump, the ENA1 gene is considered as the main

cause of salt tolerance in S. cerevisiae [135]. The expression of ENA1 regulates the

halotolerance genes of S. cerevisiae [136]. The HSR1 gene encodes a putative protein

with homology to heat-shock transcription factor Hsflp [137]. HSR-1 RNA is 600-nt

poly (A) RNA and shows a high degree of homology between human and rodents. HSR-

1 RNA is constitutively expressed, and its level seems unaffected by heat shock [138].

HSR1 serves as a cellular thermo sensor that regulates the temperature threshold for the

heat shock response. So, HSR1 can be used for developing the stress tolerant plants.

Martinez et al. [134] observed that a fungal gene encoding a transcription factor

is expressed from its own promoter in Arabidopsis phloem and improves drought

tolerance by reducing transpiration and increasing osmotic potential. The also

revealed that the promoters of the induced genes were enriched in upstream activating

sequences for water stress induction. These results demonstrate that genes from

unrelated organisms can have functional expression in plants from its own promoter

and expand the possibilities of useful transgenes for plant biotechnology.

Development of stress tolerant plants have been a concern of growing

agriculture which will help the farmers across the world to cope with ever-present

environmental stresses and help to achieve higher yields. Conventional plant breeding

strategies to develop new lines of plants that show resistance tolerance to several types

of biotic and abiotic stresses are comparatively slow and require specific resistant lines

for crossing with the most wanted lines. In addition, the cellular processes leading to

stress tolerance (e.g. cold, drought and salt tolerance) in plants is complex in nature and

engage several mechanisms of cellular adaptation and a number of metabolic pathways.

Recent developments in recombinant DNA technology have facilitated the

1. Introduction

24

development of transgenic plants with multiple transgenes. Thus, the production of

genetically engineered commercial crops appear as an attractive alternative approach.

1.8 Objectives of the Study

The above point of view clearly indicates that AVP1 and HSR1 genes can be used to

create abiotic stress tolerance in plants. The purpose of this study is to investigate the

possibility to engineer enhanced abiotic stress tolerance in local potato cultivars with

the following specific objectives:

1. Cloning of HSR1 gene in plant expression vector

2. Transformation of the cloned AVP1 and HSR1 genes in potato through

Agrobacterium-mediated transformation method

3. Regeneration of transgenic potato plants, screening for the presence of transgene,

molecular analysis of transgenic plants and screening for salt tolerance

2. Regeneration System for Potato Cultivars

25


2.1 Introduction

Plant tissue culture has emerged as a powerful and cost-effective tool for the crop

improvement [139]. Tissue culture is also known as cell, tissue and organ culture

through in vitro condition. In vitro propagation tactic for the plant multiplication of

exclusively superior cultivars and crop improvement has been applied massively by the

agriculture sectors [140]. Tissue culture is also considered as the source of creating the

genetic variability for the improvement of the crop plants and to increase the number

of desirable germplasm available to the plant breeder [141].

Importance of tissue culture has been verified by getting better potato clones via

micropropagation, pathogen free propagule development, and germplasm preservation

[142]. The regeneration of potato from tissue culture contributes several commitments

such as micropropagation, preservation of hybridization potency and gene

transformation [143]. Therefore, potato is considered as an important candidate for in

vitro genetic manipulation for the development of desirable variety [144]. For this

purpose, it is needed to develop more effective in vitro regeneration system for potato

crop.

Plants regenerated through direct organogenesis are considered as true to type

and do not exhibit somaclonal variations. Organogenesis is highly dependent on the

interaction between naturally occurring endogenous growth hormones and exogenous

growth regulators added to the culture medium [145]. Expensive production of tuber

seed and its lengthy reproductive cycle increases the chances of viral and bacterial

diseases which are the major problems that have to be addressed. To overcome the

concerned problem, tissue culture strategy can increase the yield and also reduce the

costs of production by avoiding diseases and use of pesticides [146]. Improvement in

potato regeneration relies on a well-defined practice that begins with genotype

propagation features and also involves the optimization of different growth regulators

for multiplication during in vitro culture. Application of certain growth regulators is

supposed to change the chemical composition of potato while poor callus induction and


26

genotype dependent regeneration potential are known to be another influencing factors

in potato tissue culturing [147]. A very important biotechnological research objective

is to produce callus rapidly in different potato cultivars [148]. However in our

conditions none of procedures have been reported which represents the suitable in vitro

regeneration for the potato cultivars.

Thus, it was aimed to develop an improved/standard protocol allowing the

regeneration of important potato cultivars currently grown in Pakistan which ultimately

leads to mass propagation of healthy stock and successful in vitro seed tuber production

and gene transformation.

2.2 Materials and Methods

2.2.1 Plant Material

Three cultivars namely Desiree, Kuroda and Cardinal were used for in vitro

regeneration. Four week old internodal segments of about 3 to 5 cm in length were used

as explants. All cultured explants were placed on modified MS medium (MS salts & B5

vitamins) to which different growth regulators, sucrose and agar were added [149]. The

pH was adjusted to 5.8 before autoclaving at 121 ºC and 15 lbs psi for 20 min.

2.2.2 Surface Sterilization of Tissue Culture Accessories

Accessories related to tissue culture such as forceps, scissors and laminar air flow

cabinet were sprayed and allowed to air dry. Accessories were dipped in 70% ethanol

in sterilized petri plates in laminar air flow cabinet. After 10 minutes, all the accessories

were taken out from ethanol and allowed to dry under the aseptic conditions in laminar

flow. The experiment was conducted in triplicates for each cultivar. The internodal

explants were cultured on three different MS based callus induction medium (Table

2.1) and placed in a growth room maintained at 26 ºC ± 2 ºC under low light intensity

using 16 h photoperiod. Callus frequency (%) was recorded after four weeks by using

this formula

Callusing frequency (%) =No. of explants producing callus

No. of explants used × 100 … . . (2.1)


27

The explants with induced callus were shifted to shoot induction medium (Table

2.2) and after reaching 5 to 6 cm in length, regeneration frequency was recorded by

using a formula:

Regeneration frequency (%) =No. of shoots produced by callus

No. of explants used × 100 … … (2.2)

Furthermore, distinct green shoots were cut out and shifted to rooting medium

(Table 2.3). Root frequency was recorded as number of roots divided by total number

of shoots multiplied with 100.

Table 2.1 Combinations of various growth regulators used for callus induction in

three different cultivars of potato

Treatment(Media) Hormones used (mg l-1)

CIM1 MS modified (MS salt & B5 vitamins) + ZR (0.8 mg l-1) + 2,

4-D (5.0 mg l-1)

CIM2 MS modified (MS salt & B5 vitamins) + BAP (2.0 mg l-1) +

GA3 (2.0 mg l-1) + NAA (0.1 mg l-1)

CIM3

MS modified + (MS salt & B5 vitamins) + MSV1 vitamins +

JHMS vitamins + BAP (1 mg l-1) + NAA (1 mg l-1) + Myo-

inositol (100 mg l-1)

JHMS vitamins*(code names) - folic acid (25 mg l-1) + D-Biotin (5.0 mg l-1)

MSV1 vitamins*(code names) - nicotinic acid (1.0 mg l-1) + pyridoxine HCl (1.0 mg l-

1) + thiamine HCl (10 mg l-1) + myo-inositol (100 mg l-1)

Table 2.2 Media combinations with growth regulators supplements for

subsequent regeneration of shoots

Treatment

(Media) Plant growth regulators used (mg l-1)

SIM1 MS modified + ZR (0.8 mg l-1) + GA3 (0.1 mg l-1)

SIM2 MS modified + BAP (2.0 mg l-1) + GA3 (2.0 mg l-1)

SIM3 MS modified + 3R (vitamins) + myo-inositol + IAA (1mg l-1)

+ zeatin riboside (3.0 mg l-1)

3R (vitamins)*(code names) - thiamine HCl (1 mg l-1) + nicotinic acid (0.5 mg l-1) +

pyridoxine HCl (0.5 mg l-1)


28

Table 2.3 Rooting media for callus-derived shoots of different potato cultivars

Treatment

(Media) Plant growth regulators used (mg/L)

RIM1 MS modified + ZR (0.8 mg l-1) + IAA (0.1 mg l-1)

RIM2 MS modified + BAP (2.0 mg l-1) + GA3 (2.0 mg l-1) + NAA

(0.1 mg l-1)

RIM3 MS modified + MSV1 vitamins + JHMS vitamins +NAA (1

mg l-1) + I BA (2 mg l-1)

2.2.3 Statistical Analysis

Complete randomized design (CRD) was applied in triplicates by calculating the mean

values for each treatment to analyze the experimental data. To determine the effect of

growth regulators and genotypic response for in vitro regeneration, analysis of variance

with LSD test at 5% level of probability were statistically applied.

2.3 Results

The results of callus induction experiments are shown in Fig. 2.1. The highest callus

induction frequency was obtained in CIM1 for all the three cultivars tested, while poor

response was obtained in CIM3 (Table & Fig. 2.1). In CIM1, the highest callus

induction frequency was obtained in Cardinal (78%) followed by Kuroda (70%) and

Desiree (68%), respectively. In case of CIM2, Cardinal gave highest callus induction

frequency (58%) followed by Kuroda (55%) and Desiree (42%). Similarly using CIM3

media, highest frequency of callus formation was again obtained in Cardinal (42%),

followed by Desiree (40%) and Kuroda (38%).


29

Figure 2.1 Percentage of callus for media (having different combinations of

growth regulators) in three potato cultivars and internodal explants were used.

Average data taken after 4 to 6 weeks in callus induction medium.

The highest shoot regeneration frequency was obtained in SIM3 for all the

cultivars tested while poor response was obtained in SIM2. In SIM1 media

combination, no significant variation among the genotypes was observed where highest

frequency of shoot regeneration was obtained in Cardinal (78%) followed by Kuroda

(70%) and Desiree (65%). SIM2 growth regulators combination was found to be less

responsive for shoot regeneration as it gave poor response in Cardinal (52%) followed

by Kuroda (50%) and Desiree (40%). SIM3 gave significantly higher shoot

regeneration efficiency compared to rest of the two media combinations but more or

less similar for all genotypes tested, as Cardinal ranked first with 95% regeneration

efficiency followed by Kuroda (90%) and Desiree (82%), respectively.

0

10

20

30

40

50

60

70

80

90

CIM1 CIM2 CIM3

Ca

llu

s p

erce

nta

ge

Callus induction media

Desiree

Kuroda

Cardinal


30

Figure 2.2 Percentage of shoot induction at different media (having different

combinations of growth regulators) in three potato cultivars. Average data taken

after 4 to 6 weeks in shoot induction medium.

The average number of shoots per explant were also recorded (Fig. 2.3). In

SIM1, the highest shoot induction frequency was obtained in Desiree (6.3) followed by

Kuroda (5.0) and Cardinal (4.9), respectively. Desiree ranked first having 5.0 shoots

per explant followed by Cardinal (4.0) and Kuroda (2.1) when SIM2 combination was

applied. Among all the genotypes, it was observed that SIM3 treatment gave the best

results in Desiree (9.4), Cardinal (8.9) and Kuroda (6.3), respectively and also required

less time for shoot induction.

0

20

40

60

80

100

120

SIM1 SIM2 SIM3

Sh

oo

t p

ercen

tag

e %

Shoot induction media

Desiree

Kuroda

Cardinal


31

Figure 2.3 Number of shoots and roots in regenerated shoot for three cultivars. Three media (having different combinations of growth regulators) were used as

treatments. Values are means of three observations per treatment per genotype.

Moreover, in order to testify the results of all media combinations and cultivar

response, number of roots per explant were also recorded (Fig 2.3). Maximum number

of roots formation per explant was obtained in Kuroda by applying treatment RIM3

while minimum was obtained in Cardinal using RIM2. In RIM1, an average of 6.0 roots

per explant obtained in Desiree followed by Kuroda (5.7) and Cardinal (3.9),

respectively. RIM2 gave comparatively poor response as Desiree generated 5.2 roots

0

1

2

3

4

5

6

7

8

9

Desiree Kuroda Cardinal

No

. o

f ro

ots

/exp

lan

t

Potato cultivars

RIM1

RIM2

RIM3

0

2

4

6

8

10

12

Desiree Kuroda Cardinal

No

. o

f sh

oo

ts/e

xp

lan

t

Potato cultivars

SIM1

SIM2

SIM3


32

followed by Kuroda and Cardinal having 2.8 roots, respectively. In RIM3, Kuroda

ranked first for having 7.4 roots followed by Desiree (6.1) and Cardinal (4.8),

respectively.

Figure 2.4 Different regeneration stages for potato cultivars. A) Stem cuttings

cultured on callus induction medium, B) Callus initiation, C) well developed shoots

(arrows) on shoot inducing medium, D) well-developed shoots transfered to root

induction medium, E) complete plantlet of potato.

A B

C D

E


33

2.4 Discussion

Several scientists have reported regeneration from internodal explant of potato cultivars

via “one step regeneration” system with a culture medium having a blend of additional

ingredients or “two stage regeneration” method with isolated cultural stages for callus

production and root formation. Although, potato regeneration has been reported by

many scientists [150, 151] but it is believed as largely genotype dependent.

Present study was aimed at development of an effective procedure for

regeneration of different potato cultivars and also to determine the genotypes which are

suitable for regeneration. Results obtained during these experiments on callus

proliferation in different growth regulators combinations were in line with the report

that auxin (2, 4-D) is necessary for the callus production [148] as in present study, 2, 4-

D Auxin was found to have the most effective role in callus induction. Significant effect

of 2, 4-D and coconut milk on callus formation has been evident in potato tissue

culturing [152]. The results showed that increased level of 2, 4-D up to 5.0 mg/L was

found to be the most operative for callogenesis. These results also showed that the

cultivars used were not significantly different in their response to callus induction using

2, 4-D. These observations are in distinction to Khadiga et al. [153] that media

containing NAA and BAP gave longest shoot and highest node numbers. Apical

dominance and the growth of lateral buds, stimulated by BAP while NAA drops single

nodes growth and rooting of potato plantlets [154]. It is problematic to venture the

reason for this difference but genotypic response could be one of the possible factor

responsible. The results demonstrated that higher concentration of ZR (3.0 mg/L) in

combination with IAA, myo-inositol and vitamins were more effective for shoot

induction which is in agreement with the study reported by Bhuiyan [142]. This

combination of growth regulators is best for shoot initiation and proliferation of potato

cvs Desiree, Kuroda and Cardinal. Use of different vitamins such as JHMS and 3R

vitamins could be the reason for prominent results instead of other growth regulators

and confirmed the study reported by Curtis et al. [155].

Results regarding root formation are totally in contrast to Armin et al. [154] in

which they used different combinations of NAA and BAP for root induction of different

potato cultivars. They observed that modified solid (MS) medium without NAA and

BAP was considered as best for healthy roots in potato tissue culture. Findings showed


34

that combinations of BAP and NAA with other growth regulators like zeatin and IAA

is responsible for the vigorous root formation. Among three different rooting media

combinations, RIM3 comparatively gave better results as it comprised of optimum

concentration of NAA and IBA in combination with different vitamins (Table 2.3). It

is frequently reported that a number of plant species including potato have genotypic

dependent regeneration system [156]. Outcomes with respect to influence of cultivar

on regeneration support the previous study reported by Danci et al. [157] that in potato

regeneration, a very important role is played by the genotype. Finally, SIM3 treatment

gave better results regarding shoot regeneration for all the cultivars tested while for

cultivars, Kuroda and Cardinal performed efficiently as compared to Desiree.

3. Development and Screening of Transgenic Plants for Abiotic Stress Tolerance

35

3. Development and Screening of Transgenic

Plants for Abiotic Stress Tolerance

3.1 Introduction

Salinity seems to be a threat that confines the plant development and spoils agricultural

productivity [158]. Therefore it is important to understand the physiological and

molecular mechanisms responsible for plant adaptation to abiotic stress [159, 160].

Overall for this purpose, several studies have reported in order to cope with this

alarming problem [161]. Plant species have different mechanisms that consult salt

tolerance; but the capability to sustain low cytosolic Na+ is supposed to be one of the

vital factor of plant salt tolerance [162]. Under salinity conditions, removal of Na+ from

the cytoplasm of the cells and on the other side maintenance of the low cytosolic Na+

concentrations [163, 164] is carried out either by pumping Na+ out of cells (plasma

membrane antiporter) or into the vacuoles (vacuolar antiporter). This process is brought

about by the operation of plasma membrane-bound H+-pumps responsible for

energizing Na+/H+ antiporters [165].

Transcription factors (TFs,) has ability to stimulate and suppress the cascades

of different genes via connections with other TFs, consequently playing a vital part in

plant response towards environmental stresses [166]. There is a report that confirm the

expression of several functional genes associated to abiotic stresses in response to

activation of specific TFs [167-169]. However, molecular and genomic inquiry have

revealed that there are diverse transcriptional regulatory pathways involved in stress

responsive gene expression. Interestingly, different members of the same family

frequently respond inversely to several stress stimuli while some stress responsive

genes could share the same transcription factors, as specified by the substantial

connection of the gene expression profiles that are induced in response to different

stresses [170]. Dozens of transcription factors have been transferred in plants against

abiotic stresses due to its potential response [109].

Potato is known to be supplementary salt sensitive than rice, corn and barley. In

fact, breeding for developing new potato cultivars tolerant to salt and drought stress by


36

conventional methods is boring, problematic and slow due to its complex and

quantitative inheritance pattern. However recent reports for food production warn that

conventional alone will not be able to retain pace with the growing demands of food,

fiber and fuel. Consequently, plant biotechnology, in particular genetic engineering,

can support breeding efforts in order to cope the new trials in a viable way.

Of the physiological factors, low photosynthetic ability is considered as one of

the significant alterations responsible for reduction in crop productivity. Reduction in

CO2 assimilation, amount of ATP and the level of ribulose bisphosphate is of prime

importance which may result due to water stress [190]. Under salinity, the major

response by plant is closure of stomata which limits the diffusion through stomata and

mesophyll and will increase the production of Rubisco enzyme, responsible for CO2

fixation, in order to overcome the low conductance [191]. Though, some species

(Gossypium barbadense, Hypericum balearicum) show reverse results in Rubisco

activity [192]. Furthermore CO2 concentration and carboxylation process has strong

correlation to each other as reduction in CO2 concentration will prompt a decrease in

the dynamic of the carboxylation development [193]. Abiotic stress leads to a reduction

in the use of triose phosphates and the electron transport in thylakoids which ultimately

decreases the net photosynthetic rate. Chaves et al. [194] reported that plants subjected

to salinity and water stress will be deficient in the photochemical productivity of

photosystem II (PSII) and quantum generation as well. The level of photosynthetic

pigments are also affected by water and salinity stressed plants in the form of less or

even no pigmentation. Reduction in chlorophyll a and b is considered as one of the

main reasons that directly affects plant biomass production [195]. In addition to this,

similar activity of photosynthetic pigments will start a cut down in energy intake and

carbon needed for chlorophyll synthesis. Other than chlorophyll pigments, carotenoids

are another type of pigments which play very important role in the antioxidant defense

system under stress conditions. Although it is responsible for photosynthesis process

but its concentration can also be reduced in response to the plant stress [196, 197].


37

Figure 3.1 Plant global response to cope with water deficit, high temperature and

salinity adapted from Zingaretti et al. [198]

Salinity, one of the important abiotic stresses, establishes a critical agricultural

problem in various parts of the world [199]. It has been reported that saline stress is

responsible for the numerous problems like variations in plant metabolism with

lowering of water potential, ion imbalance and specific ion toxicity, as well as stomatal

closure and reduced CO2 assimilation. Although exposure of plant cells to high salinity

leads to osmotic adjustment, inclusion and exclusion of toxic ions, but there is amassing

confirmation that high salinity also prompts oxidative stress, responsible to structural

injury of both membranes and photosynthetic machinery [200].

Reactive oxygen species (ROS) are by-products of photoreaction and cellular

oxidation generated in plants under normal conditions. Interestingly, under certain

conditions like abiotic stresses, it will reach to toxic level and may cause cellular

damage which comprises of membrane peroxidation, denaturation of proteins and DNA

damage [201]. ROS have an exclusive role in a sense that they will stimulate the cellular

defense mechanisms when exposed to stress [202]. To maintain the low levels of these

beneficial ROS, it is important for the plant cellular mechanisms to have capability to


38

detoxify the increased level of ROS that is the result of abiotic stresses. ROS production

has a common mechanism in response to a large number of abiotic stresses like air

pollutant ozone counters with cellular components in the leaf apoplast to produce ROS

which consequently enhance the rapid production of ROS by the plant cell itself, named

as an “oxidative burst”. Cellular responses to ROS accumulation have a direct

connection with the chemical properties and the site of ROS [203].

To maintain plant homeostasis, it is needed to keep the production of ROS at

non-toxic level. Thus, plants subjected to stress have developed a very effective

antioxidant defense system comprising of ascorbate and glutathione which is low in

molecular weight and also involvement of some of the protective enzymes such as

superoxide dismutase (SOD), catalase (CAT), ascorbic peroxidase (APX), and

peroxidase (POX) [204]. Naturally, exposure of plant to oxidative stress is not only

responsible for the production of the antioxidant compounds but also proliferate the

activity or expression of these protecting enzymes. There are several reports which

revealed that this sort of reaction against ROS is variable and depends on the plant

species to be studied, developmental stage of the plant and also the stress strength [46,

205]. Potato is a moderately salt-sensitive crop. Variation in salt tolerance has been

observed among different potato cultivars [206] which show that there is an association

between salt tolerance and antioxidant defence system in two different potato cultivars

in response to salt stress [207]. Hence from the study reported, it is believed that the

involvement of antioxidant defence appears to be the component of the tolerance

mechanisms of potato plants to NaCl exposure.

There are certain compatible solutes like sorbitol, mannitol, proline and some

specific proteins which have a promising role to maintain water balance. These solutes

are produced when plant cells are subjected to water or salinity stress. Though,

glutamate or ornithine are different sources for proline synthesis but glutamate is

presumed to be the precursor in stressed cells [208]. Genetically modified tobacco

plants with Delta-1-pyrroline-5-carboxylate synthase (P5CS) adds 10 fold more proline

compared to wild-type plants which confers osmotolerance and salinity stress as seen

in transgenic plants by means of genetic engineering of proline biosynthesis pathway.

In transgenic rice with P5CS gene, over-production of proline and its biomass was

observed under abiotic stress. Moreover, CBF3 a transcriptional activator over-

expressing in Arabidopsis plants had raised P5CS transcript along with proline


39

contents. Similarly, in cultured tobacco cells, over-expression of NtHAL3 genes have

increased the production of proline and ultimately salt tolerance. Promising role of

proline as an osmoprotectant has also been reported in transgenic potato [209]. In this

study, stress tolerance was measured by comparing tuber yield of transgenic lines

supplied with saline water and observed that there was less significant effect on yield

of transgenic potato compared to wild-type [210].

To circumvent the abiotic stress through genetic engineering, it is very

important to have a suitable ratio of K+ and Na+ in transgenic plants facing abiotic

stresses. For example, over-expression of the S. cerevisiae HAL1 gene in yeast

conferred salt tolerance by increasing intracellular K+ and decreasing Na+ levels which

indicates that inclusion of K+ and exclusion of Na+ is considered as very important for

plants to avoid abiotic stresses [211]. Later it was further confirmed by Amin et al.

[212] that maize plants transformed with rice OsNHX1 gene showed more biomass and

higher Na+/ K+ ratio in transgenic leaves as compared to control plants treated with 100-

200 mM NaCl. Zhao et al. [95] observed more accumulation of K+ and less Na+ in rice

shoots compared with WT when was expressed in rice plants.

Therefore, main goal of present study was to develop salt and drought tolerance

in potato by transferring AVP1 and HSR1 genes.

3.2 Materials and Methods

A synthetic HSR1, which is a yeast (Candida tropicalis) transcription factor having an

open reading frame (2.2 kbp) encoding a protein of 728 amino acids while AVP1

encoding 770 amino acids proteins of molecular weight 80 kDa were used.

3.2.1 Construction of Plant Expression Cassette

HSR1 gene cassette was cloned into pJIT163 by using the HindIII and EcoRI sites. Both

plasmid pUC57 and pJIT163 were digested with HindIII and EcoRI restriction enzymes

(Appendix #1). The digestion products were incubated at 37 °C for 16 h and after that

both were electrophoresed on agarose gel (Appendix # 2). DNA fragment of 3.6 kbp

representing the backbone of pJIT163 and 2.2 kbp representing HSR1 cassette were

eluted by GeneJETTM Gel Extraction Kit (Fermentas, Life Sciences USA) and purified

from agarose gel using the protocols as described in appendix # 2. After that eluted

fragment of HSR1 cassette from pUC57 and backbone of pJIT163 (both restricted with


40

HindIII and EcoRI) were ligated together (Appendix # 3). This ligation mixture was

incubated at 16 °C for 16 h and after that 10 μl of this mixture was transformed into

competent E. coli cells (Appendix # 4) by heat shock method (Appendix # 5). Miniprep

method was applied to isolate plasmids from E. coli cultures described in appendix # 6

and determined for the desired inserts by restriction analysis. Confirmed clone was

named as pJHS and glycerol stocks of bacterial culture were made as described in

appendix # 7.

3.2.1.1 Transformation Plant Expression Cassettes into Plant Expression Vector

Both pJHS and pGreen0029 were digested with Kpn1 and Xho1 restriction enzymes.

Both digestion reactions were incubated at 37 °C for 16 h and then electrophoresed on

agarose gel. The 3.6 kbp fragment from digestion of pJHS and 4.6 kbp fragment from

pGreen0029 (Figure 3.2) digestion were eluted and purified. These two fragments were

ligated as described in appendix # 3. This ligation mixture was incubated at 16 °C for

16 h and after that 10 μl of this mixture was transformed into competent E. coli cells.

Transformed cells were spread on solid LB medium containing kanamycin (50 mg/L)

and incubated at 37 °C for 16 h. Colonies were picked and inoculated into 5 ml aliquots

of LB liquid medium in autoclaved test tubes and incubated overnight at 37 °C with

vigorous shaking. Plasmids were then isolated from E. coli cultures by miniprep method

and screened for desired inserts by restriction analysis. Confirmed clone was named

pGSH and glycerol stocks of bacterial culture were made.


41

Figure 3.2 Schematic presentation of plasmids maps. A) pGSH (HSR1 cloned in

pGreen0029) and B) pZSI (AVP1 cloned in pGreen0029). Double enhancer of 35S

promoter cauliflower mosaic virus promoter (2 x 35S); HSR1, synthetic gene; AVP1,

Arabidopsis vacuolar pyrophosphatase genomic clone (AVP1); cauliflower mosaic

virus terminator sequence (CaMVT); nopaline synthase promoter sequence (Pnos);

neomycin phosphotransferase gene II (nptII); nopaline synthase terminator sequence

(Tnos).

3.2.1.2 Bacterial Culture Preparation of Agrobacterium-tumefaciens (LBA4404)

Plasmids of pGSH and pZSI were transformed into electrocompetent cells of

Agrobacterium tumefaciens strain LBA4404 (Appendix # 8) by electroporation

(Appendix # 9). Bacterium strain LBA4404 containing pGSH and pZSI plasmids were

incubated separately in two glass flasks having 50 ml liquid LB medium containing

antibiotics (50 mg/L kanamycin, 100 mg/L tetracycline, 100 mg/L rifampicin) for 24 h

with shaking at 28 °C. These cultures were centrifuged and pelleted in sterilized 50 ml

falcon tubes at 9000 g for 10 min. The pellet of each tube was resuspended in 2 volume

of MS liquid medium (MS salts and vitamins MS, 3 % sucrose, pH 5.7) and incubated

it for 16 to 24 h to an OD of 109 cfu at 600 nm. Cultures were confirmed by PCR, using

gene specific primers (Table 3.1) after transformation. A reaction mixture of 25 μl was

prepared in a 0.2 ml thin walled PCR tube containing 2 μl of 48 h grown Agrobacterium

culture as template DNA, 2.5 μl 10X Taq polymerase buffer (Fermentas), 2.5 μl of 2

mM dNTPs, 1.5 mM of MgCl2, 5 pM of each forward and reverse sequence specific

primers and 1.25 units of Taq DNA polymerase (Fermentas). The reaction mixture was

incubated in a thermal cycler (Eppendorf Mastercycler Gradient). The machine was

programmed for a preheat treatment of 94 °C for 5 min followed by 35 cycles of 94 °C


42

for 1 min, 56 °C for 1 min and 72 °C for 1 min, with a final incubation of 10 min at 72

°C. PCR product was electrophoresed through 1% agarose gel.

Table 3.1 Primers used for amplification of HSR1 and AVP1

S. No. Primer description Primer sequence

1 HSR1 (Forward) 5ʹ CAGTCAGAACAGTGCCTCCA 3ʹ

2 HSR1 (Reverse) 5ʹ GCGATGAACACGAACCAACT 3ʹ

3 AVP1 (Forward) 5ʹ GCAATCTTCATCCCAAGGAA 3ʹ

4 AVP1 (Reverse) 5ʹ GCTCTGTTGAGGGATTCAGC 3ʹ

3.2.2 Potato in vitro Germination

Cultivars Kuroda and Cardinal were propagated in vitro in large test tubes (150 x 25

mm). Each test tube containing Murashige and Skoog medium known as MS medium

(Section 2.2.1).

3.2.2.1 Plant Transformation

Four weeks older explants were prepared (Section 2.2.1) and inoculated with

recombinant Agrobacterium cells of different plasmids separately into the flask. After

incubation of 30 min, explants were blotted on sterilized filter paper carefully not to let

them dry out and cultured on callus induction medium (CIM) with no antibiotic (Table

2.1). The explants were washed with MS liquid medium containing one g/l cefotaxime

(Aventis Pharmaceuticals, USA) for 30 min after co-cultivation [171].

After dry blotting with sterilized filter paper, the internodal sections were

transferred to selection medium CIM containing cefotaxime and kanamycin 50 mg l-1

and incubated as described above. The plates were checked regularly for any bacterial

or fungal growth and were sub-cultured every 2-3 weeks. Well defined calli were

observed after 4-6 weeks and percentage was calculated.

After six weeks, well-developed green calli were transferred to shoot induction

medium (SIM) having antibiotics (Table 2.2). After 4-5 weeks, well defined green and

strong shoots (1-2 cm) were removed and transferred to a large test tubes (150 x 25

mm) containing root induction medium (RIM) (Table 2.3) with selective antibiotics

(kanamycine 50 mg/L, cefotaxime 250 mg/L). After one week on rooting medium, the

putative transgenic shoots developed roots and multiplication of shoots was carried out


43

by sub-culturing the auxiliary buds on to the rooting medium to increase the survival

rate of transgenic plants. These plants were acclimatized to plastic pots containing

mixed sand and soil. Vents were opened progressively after 7 days until the plants

acclimatized to the ambient humidity. Plants were then transferred to earthen pots

having soil and shifted to containment.

3.2.3 Transformation Efficiency of Potato Transgenic Plants

In order to check the transformation efficiency, inoculation of explants was done in

three batches having twenty explants for each batch in both cultivars Kuroda and

Cardinal, respectively. After inoculation number of transformed calli and number of

regenerated events were recorded in respective cultivars transformed with pGSH and

pZSI plasmids. Transformation efficiency was calculated by following formula

Transformation efficiency (%) =No. of regenerated events

No. of explants × 100 … … . (3.1)

3.2.4 Molecular Characterization of Transgenic Plants

3.2.4.1 Isolation of Total Genomic DNA

CTAB method (Appendix # 10) was used to isolate the total genomic DNA of putative

transgenic plants as described by Iqbal et al. [172].

3.2.4.2 Screening of Putative Transgenic Plants by PCR

The putative transgenic potato plants were screened for their transgenic nature by PCR

amplification using genomic DNA of transgenic plants. Amplification of pGSH and

pZSI plasmids in transgenic plants was carried out in 0.5 ml PCR tube (Section 3.2.1.2)

with gene specific primers (Table 3.1) which were custom synthesized (GIBCO, BRL,

USA).

3.2.4.3 Agarose Gel Electrophoresis

PCR amplified products were detected by using 1 % (w/v) agarose gel electrophoresis

stained in ethidium bromide (0.5 μg/ml) for visualizing the DNA bands. The gel was

placed in a gel tank containing 0.5X TAE buffer (Appendix # 11). Afterwards PCR

products (10 µl) from each reaction was mixed with 3 μl of 6X loading dye (Fermentas,

Germany) and loaded to agarose gel. The samples were subjected to electrophoresis at


44

80 volts for 40 min. Respective sizes of fragments were calculated by comparing with

1 kbp DNA and visualized on an ultraviolet transilluminator (Fermentas, Germany).

3.2.5 Southern Analyses of Transgenic Plants

Copy number of selected transgenic plants was determined by Southern hybridization

using genomic DNA. About 10 μg genomic DNA of transgenic and control plants was

digested with Kpn1 restriction enzyme and incubated it at 37 °C for overnight. Digested

and undigested DNA samples of potato lines were size fractionated through 0.8 % (w/v)

agarose gel supplemented with 10 μg ml-1 ethidium bromide at 40 V in TAE buffer for

5 to 6 h. The sample image of DNA was obtained under UV light in gel documentation

apparatus. Depurination of DNA samples and preparation of probe is given in appendix

# 12.

3.2.6 Screening of Transgenic Potato Plants for Abiotic Stress

Tolerance (Salt & Drought)

3.2.6.1 In vitro Screening of Transgenic Potato Plants for Salt Tolerance

To evaluate the salt tolerance potential of transgenic plants, MS medium supplemented

with four levels (0, 50, 100 and 200 mM) of NaCl was applied. Single node cuttings

(15-20 mm) of transgenic and non-transgenic plants were excised and transferred to jars

in triplicates. These jars were sealed with sealing film, labeled properly and incubated

for 30 days (26 oC ± 2 oC) at low light intensity 16 h photoperiod.

3.2.6.2 In vitro Screening of Transgenic Potato Plants for Drought Tolerance

Drought tolerance potential of transgenic lines was checked by applying four levels (0,

10, 15 and 20%) of PEG (Mol. Wt. 6000, Sigma, USA). After one month of water stress

transgenic and non-transformed plants were taken for the estimation of the different

agronomic parameters like shoot & root length, leaf area index, shoot fresh & dry

weight, root fresh and dry weight and relative water contents.

3.2.7 Pot Studies for Salt Stress

Transgenic potato containing AVP1 and HSR1 genes were analyzed for salt stress.

Transgenic lines and non-transformed control plants were raised in earthen pots having

a hole in the bottom and containing crushed coconut hairs and peat moss (3 Kg) in glass

house under a photoperiod of 16/8 h (light/dark) and 35% relative humidity. The pots

were watered (1L) every day with 1/8 Hoagland nutrient solution (KNO3 33.3 g l-1,


45

Ca(NO3).4H2O 9.4 g l-1, MgSO4.7H2O 2.2 g l-1, NH4NO3 2.4 g l-1, Fe.EDTA 0.6 g l-1)

for 3 weeks. After that three levels of NaCl (0, 200 and 300 mM) were supplied to the

transgenic plants. Water supplemented with salt concentration was flushed out through

the pots in a way that soil remained wet throughout the day. Leaves from transgenic

plants and non-transformed controls were collected for the estimation of different

physiological parameters and antioxidant enzymes analysis.

3.2.8 Physiological Parameters

Gas exchange attributes; net assimilation rate (A), transpiration rate (E), sub-stomatal

CO2 concentration (Ci), stomatal conductance (gs) and water-use efficiency (A/E) were

measured using an open system LCA-4 ADC portable infrared gas analyzer (Analytical

Development Company, Hoddesdon, England). Measurements were performed from

9.00 to 11.00 a.m. with the specifications described in appendix # 13.

3.2.8.1 Leaf Membrane Stability Index

Leaf membrane stability index (MSI %) was determined using a method modified

(Appendix #14) by Sairam and Saxena [213]. MSI % was calculated using the

following formula.

MSI % =C1

C2× 100 … … … … . . … … … … … . . (3.2)

3.2.8.2 Estimation of Na+and K+ Contents

Na+ and K+ were estimated by following the protocol described by Flowers and

Hajibagheri [214] with slight modifications (Appendix # 15). The Na+ and K+ contents

were determined using a Flame Photometer (Janway Co., USA).

3.2.8.3 Determination of Na+/K+ Ratio

Na+/K+ ratio was calculated by dividing the values of Na+ by K+ contents obtained from

the stressed leaves at 0, 200 and 300 mM, respectively.

3.2.8.4 Measurement of Total Free Amino Acid

Total free amino acids were estimated following the methodology (Appendix # 16) of

Van Slyke et al. [215]. Optical density of the coloured solution was recorded at 570 nm


46

using spectrophotometer. Standard curve was developed with leucine and free amino

acid was calculated using the formula given below,

Amino acids =Sample reading × Sample volume × Dilution factor

Weight of fresh leaf × 1000 … … . . (3.3)

3.2.8.5 Determination of Leaf Proline

Developed leaves were taken from transgenic and non-transformed control potato

plants individually and processed for the estimation of free proline produced in

response to salinity stress. Plant material (0.2 g) was normalized in 1 ml of sterilized

ion-free water; the remnant was removed by centrifugation at 3,800 × g. Proline was

determined as described by Bates et al. [216] with slight alterations (Appendix # 17).

3.2.8.6 Measurement of Total Soluble Sugar Contents

Total soluble sugar content of transgenic and non-transformed plants were estimated

by following the protocol described by Dubois et al. [217] with slight alterations

(Appendix # 18). The amount of sugar was determined with respect to a standard curve

developed using anhydrous reagent grade glucose.

3.2.8.7 Estimation of Starch Contents

Starch was determined as followed by Smith and Zeeman [218] with few modifications

described in appendix # 19.

3.2.9 Antioxidant Analysis

The activities of superoxide dismutase (SOD), peroxidase (POX), catalase (CAT), and

ascorbic peroxidase (APX) were determined spectrophotometrically. Leaves were

homogenized in a medium containing of 50 mM phosphate buffer pH 7.0 and 1 mM

dithiothreitol (DTT) as described by Dixit et al. [219].

3.2.9.1 Superoxide Dismutase (SOD)

SOD activity was assayed by determining the inhibition rate of nitroblue tetrazolium

(NBT) reduction with xanthine oxidase as a hydrogen peroxide generating agent

adopting the method of Giannopolitis and Ries [220]. The absorbance at 560 nm was

measured using a UV-visible (IRMECO U2020) spectrophotometer. One unit SOD

activity reflects enzyme quantity resulting in 50% photochemical inhibition of NBT.


47

3.2.9.2 Peroxidase (POD)

The activity of POD was determined by measuring peroxidation of hydrogen peroxide

with guaiacol as an electron donor. The reaction solution for POD consists of 50 mM

phosphate buffer with pH 5, 20 mM of guaiacol, 40 mM of H2O2 and 0.1 mL enzyme

extract. The increase in the absorbance due to the formation of tetraguaiacol was

assayed after every 20 sec at 470 nm. One unit of the enzyme was considered as the

amount of the enzyme that was responsible for the increase in OD value of 0.01 in 1

min. The enzyme activity was determined and expressed as unit min-1 g-1 fresh weight

basis.

3.2.9.3 Catalase (CAT)

Catalase activity was assayed by measuring the conversion rate of hydrogen peroxide

to water and oxygen molecules, following the method described by Maehly [221]. The

activity was assayed in 3 mL reaction solution comprising 50 mM phosphate buffer pH

7.0, 5.9 mM of H2O2 and 0.1 mL enzyme extract. The catalase activity was determined

by decline in absorbance at 240 nm after every 20 sec due to consumption of H2O2.

Absorbance change of 0.01 unit min-1 was defined as one unit catalase activity.

3.2.9.4 Ascorbic Peroxidase (APX)

APX activity was measured by monitoring the decrease in absorbance of ascorbic acid

at 290 nm (Extinction coefficient 2.8 nM cm-1) in 1 ml reaction mixture containing 50

mM phosphate buffer (pH 7.6), 0.1 mM Na-EDTA, 12 mM H2O2, 0.25 mM ascorbic

acid and the sample extract as described by Cakmak et al. [222].

3.2.10 Tunnel Study (Drought study)

To study the performance for the quantitative parameters of the transgenic potato plant with

respect to control, drought (100, 75 & 50% irrigations) experiments were conducted at the

NIBGE tunnel. Fertilizer was applied @165-112-112 NPK Kg/ha in the form of urea, SOP

and DAP. Observations were recorded at the maturity stage about 3 month’s age crop for

the quantitative physiological parameters.

3.2.11 Statistical Analysis

Analysis of variance (ANOVA) with completely randomized design and LSD test was

used to determine the significant effects regarding the influence of transgenes AVP1


48

and synthetic HSR1 in all the studied traits. Significant difference between transgenic

lines and control plants was set at 5% level of probability for testing the hypothesis. All

experiments were conducted in triplicates and statistical analysis was performed by

using Microsoft® Office Excel 2013.

3.3 Results

3.3.1 Cloning of HSR1 Gene

3.3.1.1 Construction of Plant Expression Cassette

A fully-modified and artificially synthesized HSR1 gene was initially cloned under

double CaMV35S promoter and CaMV terminator in pJIT163 at HindIII and EcoRI

restriction sites (Section 3.2.1). The expression cassette bearing HSR1 gene along with

promoter and terminator was lifted with KpnI and XhoI restriction enzymes and ligated

in pGreen0029 and this final construct was named as pGSH (Section 3.2.1). Cloning of

plasmid was confirmed by cutting pGSH with KpnI and XhoI restriction enzymes,

separated on 1% agarose gel. Figure 3.2 shows the release of DNA fragment of exact

size of pGSH plasmid (3.6 kbp).

Figure 3.3 Verification of synthetic HSR1 in plant expression vector

(pGreen0029). Lane 1-2 shows released DNA fragment (3.6 kbp) of pGSH after

restriction with KpnI and XhoI; Lane 3: 1kbp DNA ladder; Lane 4-5: pGreen0029

plant expression vector.

4.6 kbp3.6 kbp

1 2 3 4 5


49

3.3.2 Plant Transformation

3.3.2.1 Transformation of Solanum tuberosum cv ‘Cardinal’ and ‘Kuroda’

Transformation of synthetic HSR1 and AVP1 genes was carried out in potato cultivars

through Agrobacterium in three independent batches consisting of 20 explants (stem

cuttings) of each. The explants were transformed to selection medium (Table 2.1)

without antibiotics after 3 days of co-cultivation. Calluses were induced in both

transformed and control explants after a week but with the passage of time the

untransformed callus turned black or died while the transformed callus remained

greenish which indicates the successful integration of transformation events (Fig. 3.4

C). The well-developed callus was transformed to shoot induction medium (Table 2.2).

After 4 weeks of culture on SIM, green buds were obtained and produced well defined

shoots (Fig. 3.3 D). These buds were excised after attaining the length of 2 to 3 cm and

transformed to large test tubes containing root induction medium (Table 2.3) for the

development of roots (Fig. 3.4 E). The regenerated plantlet developed roots on the

selective medium was used as the first indicator of the transgenic nature of regenerated

plantlets. Since untransformed control plants were unable to generate roots on the same

selective media. Multiplication of rooted plants were carried out by cutting auxiliary

buds and cultured on MS selective rooting medium. About 25-30 independent

transgenic plants of each construct and cultivar were produced in 4 to 6 months in which

phenotypically well performed lines from each construct were selected for in vitro

screening bioassays in growth room. The plants were transferred to plastic pots and

initially kept covered under plastic bags for retaining humidity. The bags were removed

after a week to acclimatize them to the ambient temperature. Finally the plants were

transferred to soil in large pots and shifted to containment for getting T0 plants.

Transgenic plants produced were normal in their phenotype in every aspect. Correlating

with the normal pattern of growth, there was no decrease in stem and leaves

development and was indistinguishable in appearance from control potato plants. Data

results of Table 3.2 showed that cultivar Kuroda integrated with pGSH (HSR1) having

25 % transformation efficiency and for cultivar Cardinal it was comparatively less (20

%), respectively. Transformation efficiency of transgenic plants integrated with pZSI

(AVP1) was also recorded and 25% transformation efficiency was observed in both

cultivars Kuroda and Cardinal (Table 3.2).


50

Figure 3.4 Different stages of transgenic plant production. A: Inoculated stem

cuttings cultured on callus induction medium; B: Callus formation the transformant

cells on the selective callusing medium while the non-transformant explants become

dead after 2-weeks; C: Transformed callus on selection medium after 3-4 weeks; D:

Well developed shoots (on shoot inducing selection medium); E: Rooting of a

transgenic bud on RIM; F: Transgenic plants in growth chamber and tunnel for bio-

assay.

A B

C D

E F


51

Table 3.2 Transformation efficiency % of putative transgenic plants (T0)

Sr.

No Genes Cultivars

No. of

Explants

No. of

transformed

calli

No. of

regenerated

events

Average

transformation

efficiency (%)

1

HSR1

Kuroda

20 12 6

25 2 20 11 4

3 20 13 5

4

Cardinal

20 9 5

20 5 20 11 3

6 20 10 4

7

AVP1

Kuroda

20 9 4

25 8 20 10 6

9 20 11 5

10

Cardinal

20 9 4

25

11 20 11 5

12 20 10 6

3.3.3 Molecular Analysis of Transgenic Plants

3.3.3.1 Polymerase Chain Reaction (PCR) Analysis

Genomic DNA was isolated (Section 3.2.4.1) from the newly growing leaves of

putative transgenic plants. PCR analysis was performed for the detection of internal

fragment (750 bp) of transgene AVP1 and synthetic HSR1 (650 bp) using specific 5'

forward and 3' reverse primers (Table 3.1). The figure 3.4 indicated the presence of

target HSR1 fragment (650 bp) in representative putative transgenic potato lines and in

the positive control (plasmid) while no band was amplified in the negative control

(untransformed plant) and similarly figure 3.6 showed the amplified product of AVP1

fragment (750 bp) in the transgenic lines.


52

Figure 3.5 PCR amplification of synthetic HSR1 gene fragment from

representative T0 transgenic potato plants; Lane M: 1 kbp DNA ladder, Lane 1:

positive control plasmid, Lane 2: negative (water) control, Lane 3: non-transformed

(WT), Lane 4-14 represents (P-1, P-2, P-4, P-8, P-6, P-9, P-10, P-11, P-12 and P-16)

transgenic lines.

Figure 3.6 PCR amplification of AVP1 gene fragment from representative T0

transgenic potato plants. Lane M: 1 kbp DNA ladder, Lane 1: positive control

plasmid, Lane 2: negative (water) control, Lane 3: WT, Lane 4-9 represents (P-33, P-

37 and P-42, P-22, P-23 and P-24) transgenic lines

3.3.4 Southern Analyses

Variable numbers (1-4) of integration sites for the transgenes were observed in the

genomic DNA of transgenic potato plants when AVP1/HSR1 specific probes were used

for Southern analysis. Figure 3.7 (A & B) shows the presence of hybridized bands

which indicated that HSR1 and AVP1 genes have been integrated into the potato

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M

650 bp

750 bp

M 1 2 3 4 5 6 7 8 9


53

genome. It also showed that HSR1 in P-3 and P-6 integrated at one locus while in P-2

and P-9 it was integrated at two loci. In P-4, four number of insertions were detected

and no hybridized signal was observed in non-transgenic line. Integrated copies ranged

from 1-4 (Fig 3.7 B) was noted in transgenic potato plants harboring AVP1 construct.

Transgenic lines P-23 and P-24 contains one while P-29 showed AVP1 insertion at two

locus. Maximum gene integration (4) was observed in P-22 while no integration was

observed in untransformed plants.

Figure 3.7 Southern analyses of transgenic potato plants. A) Lane 1-6 shows

transgenes for HSR1; Lane 6 non-transformed; Lane 7: control (Plasmid), B) Lane 1-6

shows transgenes for AVP1; Lane 6: non-transformed; Lane 7: control (Plasmid)

3.3.5 In vitro Screening of Transgenic Potato Plants for Abiotic Stress

Tolerance (Salt & Drought)

Agronomic parameters (Section 3.2.6.2) were recorded carefully during the course of

study. Figure 3.8 shows the transgenic potato lines under stress conditions were

significantly different at P ≤ 0.05 for all the observed parameters. It was observed that

1 2 3 4 5 6 7

1 2 3 4 5 6 7

A

B


54

transgenic lines showed better performance as compared to non-transformed potato

lines regarding growth and some other important parameters.

3.3.6 Agronomic Parameters of Transgenic Potato Plants Exposed to

Abiotic Stresses (Salinity & Drought)

3.3.6.1 Shoot Length

Transgenic lines transformed with HSR1 (C-1) and AVP1 (C-2) were analyzed on four

different levels of NaCl (0, 50, 100 and 200 mM) and PEG (0, 10, 15 and 20%),

respectively. The results for shoot length have been given in table 3.3. Results

demonstrated that transgenic lines (P-20, P-16, P-4 and P-2) integrated with C-1

showed significantly higher shoot length while rest of the lines were non-significant

compared to control plants when no salt was applied. Transgenic lines (P-23 and P-29)

of cultivar Kuroda integrated with C-2 have given maximum shoot length (17.3 & 16.7

cm) while minimum shoot length (13.2 & 14.7 cm) was noted in the non-transgenic

control (NTC). In transgenic lines integrated with C-1, variable shoot length was

obtained under 50 mM of NaCl which ranged from 12.1 cm – 17.3 cm compared to 9.0

cm in the controls. Similar trend was recorded in all tested genotypes transformed with

C-2 which varied from 12.9 – 17.1 cm and significantly higher to that of the control

(8.0 cm) plants (Table 3.3). Distinguished response was observed at 100 and 200 mM,

in which significantly (P ≤ 0.05) higher shoot length was noted in transgenic lines

integrated with C-1 and C-2 compared to control plants.


55


potato at different levels of NaCl

Values sharing the common letters are non-significant at 0.05 probability level. Sign ±

shows standard error mean. NTC: Non transgenic control, C-1: (HSR1), C-2: (AVP1)

Except, P-16, P-11 and P-23 of cultivar Kuroda harboring C-1 and C-2 gene,

rest of the transgenic lines have shown non-significant difference compared to control

plants when no stress was applied. At 10% of PEG, significant range of shoot length

(14.2 – 17.4 cm) was obtained in transgenic lines integrated with C-1 than control (11.2

cm). The results revealed that at 15 and 20% of PEG, significantly higher shoot length

was obtained in all transgenic lines of C-1 & C-2 as compared to control (Table 3.4).

Line # Genes Salt stress

0 mM 50 mM 100 mM 200 mM

P-0 NTC 15.4 ± 0.9 c 9.0 ± 0.4 d 6.0 ± 0.2 c 3.0 ± 0.1 b

P-2

C-1

16.9 ± 0.8 ab 16.5 ± 0.7 b 11.0 ± 0.1 a 5.5 ± 0.1 a

P-4 17.9 ± 1.1 a 17.3 ± 0.9 a 11.3 ± 0.2 a 5.4 ± 0.2 a

P-6 16.1 ± 0.9 bc 15.5 ± 1.1 c 10.2 ± 0.3 b 5.7 ± 0.3 a

P-0 NTC 14.5 ± 0.4 cd 8.8 ± 0.1 e 6.2 ± 0.1 c 2.8 ± 0.1 b

P-9

C-1

15.0 ± 1.2 bc 14.1 ± 0.7 c 12.1 ± 0.6 a 5.4 ± 0.2 a

P-11 13.4 ± 0.9 d 12.1 ± 0.7 d 10.2 ± 0.5 c 5.7 ± 0.3 a

P-12 14.9 ± 0.7 cd 15.5 ± 0.8 b 11.0 ± 0.6 a 5.4 ± 0.2 a

P-14 14.4 ± 0.6 cd 14.1 ± 0.9 c 11.3 ± 0.4 a 5.5 ± 0.4 a

P-16 17.6 ± 1.3 a 17.3 ± 1.1 a 10.2 ± 0.6 b 5.4 ± 0.3 a

P-19 15.9 ± 1.1 bc 15.5 ± 0.9 b 10.2 ± 0.5 b 5.5 ± 0.4 a

P-20 16 ± 0.8 ab 15.5 ± 0.8 b 6.8 ± 0.3 c 5.4 ± 0.3 a

P-0 NTC 14.7 ± 1.1 c 8.0 ± 0.6 d 6.4 ± 0.4 c 2.9 ± 0.1 b

P-22

C-2

15.9 ± 1.3 bc 15.2 ± 0.9 b 12.0 ± 0.7 a 5.4 ± 0.2 a

P-23 17.3 ± 1.4 a 17.1 ± 1.2 a 11.2 ± 0.8 ab 5.3 ± 0.3 a

P-24 15.4 ± 1.1 bc 15.0 ± 0.7 bc 11.0 ± 0.9 ab 5.1 ± 0.2 a

P-26 13.6 ± 0.9 d 13.2 ± 0.6 c 9.4 ± 0.4 b 5.0 ± 0.3 a

P-29 16.7 ± 1.1 ab 16.5 ± 0.8 ab 11.1 ± 0.5 ab 5.1 ± 0.2 a

P-31 13.8 ± 0.8 cd 13.6 ± 0.6 c 9.1 ± 0.3 b 5.0 ± 0.3 a

P-0 NTC 13.2 ± 0.7 c 7.7 ± 0.5 d 6.3 ± 0.1 c 3.1 ± 0.1 b

P-33

C-2

13.0 ± 0.6 c 12.9 ± 0.7 c 10.0 ± 0.3 a 5.0 ± 0.3 a

P-37 16.4 ± 0.8 a 16.1 ± 0.9 a 10.2 ± 0.6 a 4.8 ± 0.2 ab

P-42 14.7 ± 0.5b 14.1 ± 0.8 bc 9.2 ± 0.4 b 5.0 ± 0.3 a

P-45 15.0 ± 0.6 ab 14.7 ± 0.8 b 9.3 ± 0.4 b 5.1 ± 0.2 a


56


potato at different levels of PEG



3.3.6.2 Root Length (cm)

All transgenic lines transformed with C-1 of cultivar Kuroda and Cardinal were non-

significant to the control while P-37 and P-45 integrated with C-2 were significantly

higher to the control plants without salinity stress (Table 3.5). At 50 mM of NaCl,

maximum root length (12.7 cm) was obtained in transgenic lines P-2, P-12 and P-19 of

C-1 while P-31 and P-22 integrated with C-2 have given significantly higher root length

compared to control plants. At 100 and 200mM, transgenic lines (C-1 & C-2) showed

significantly higher root length than respective control plants.

Line # Genes PEG (6000)

0% 10% 15% 20%

P-0 NTC 15.3 ± 1.3 b 11.2 ± 0.9 c 8.2 ± 0.3 c 3.8 ± 0.1 b

P-2

C-1

16.0 ± 1.5 ab 16.6 ± 1.3 ab 12.2 ± 0.6 a 5.3 ± 0.2 a

P-4 17.3 ± 1.9 a 17.1 ± 1.2 a 11.7 ± 0.5 ab 5.3 ± 0.3 a

P-6 15.3 ± 2.1 b 15.4 ± 1.1 b 11.0 ± 0.2 b 5.4 ± 0.4 a

P-0 NTC 14.7 ± 1.8 bc 10.7 ± 0.9 d 7.8 ± 0.1 c 3.6 ± 0.1 b

P-9

C-1

15.3 ± 1.7 b 14.2 ± 0.8 c 10.5 ± 0.3 b 5.4 ± 0.2 a

P-11 17.1 ± 1.6 a 17.4 ± 1.5 a 12.3 ± 0.5 a 5.4 ± 0.3 a

P-12 15.4 ± 1.4 b 15.2 ± 1.3 b 10.4 ± 0.6 b 5.7 ± 0.3 a

P-14 14.5 ± 1.3 c 14.3 ± 1.1 c 10.9 ± 0.5 ab 5.3 ± 0.4 a

P-16 17.6 ± 1.8 a 17.4 ± 1.4 a 11.3 ± 0.3 ab 5.6 ± 0.4 a

P-19 15.3 ± 1.4 b 15.5 ± 0.9 b 10.6 ± 0.4 b 5.8 ± 0.3 a

P-20 14.8 ± 1.2 bc 15.1 ± 0.8 b 10.3 ± 0.3 b 5.6 ± 0.2 a

P-0 NTC 15.9 ± 1.3 a 7.3 ± 0.7 d 5.7 ± 0.1 d 2.9 ± 0.6 c

P-22

C-2

15.3 ± 1.4 a 14.4 ± 0.8 bc 12.1 ± 0.7 a 5.6 ± 0.4 a

P-23 16.0 ± 1.5 a 16.2 ± 1.1 a 11.0 ± 0.6 ab 5.8 ± 0.3 a

P-24 14.7 ± 1.3 ab 14.5 ± 0.9 bc 11.4 ± 0.5 ab 5.5 ± 0.4 a

P-26 12.9 ± 1.6 b 12.3 ± 0.4 c 8.5 ± 0.2 c 4.7 ± 0.3 b

P-29 15.9 ± 1.7 a 15.5 ± 0.6 ab 10.4 ± 0.6 b 4.7 ± 0.4 b

P-31 13.1 ± 1.1 b 12.8 ± 0.3 c 8.4 ± 0.3 c 4.5 ± 0.3 b

P-0 NTC 14.3 ± 0.9 a 7.8 ± 0.1 d 5.3 ± 0.1 c 3.2 ± 0.1 b

P-33

C-2

13.8 ± 1.1 a 12.1 ± 0.4 c 9.0 ± 0.4 a 4.7 ± 0.3 a

P-37 14.1 ± 0.9 a 15.2 ± 0.6 a 9.5 ± 0.5 a 4.1 ± 0.2 a

P-42 13.9 ± 1.2 a 13.6 ± 0.4 bc 8.1 ± 0.4 b 4.4 ± 0.2 a

P-45 14.0 ± 1.1 a 13.9 ± 0.3 b 8.3 ± 0.5b 4.5 ± 0.2a


57





At 0% of PEG, non-significant results were recorded while a narrow but

significantly higher range (10.1 – 12.8 cm) of root length was noted in transgenic lines

integrated with C-1 compared to control (8.7 cm) in response to 10% of PEG. At 15%

of PEG, maximum root length (7.4 cm) was noted in transgenic line P-12 and P-19 of

C-1, while 6.2 cm in P-42 of C-2. At 20% PEG level, maximum root length was

observed in P-11 (4.9 cm) of C-1 while least was observed in the control (2.5 cm) plants.

Similar trend was obtained for root length (ranging from 3.1 – 3.8 cm) of C-2, which is

considerably better than that of control (2.0 cm) plants (Table 3.6)


0 mM 50 mM 100 mM 200 mM

P-0 NTC 13.1 ± 1.1 a 7.8 ± 0.4 b 5.4 ± 0.1 b 2.6 ± 0.1 b

P-2

C-1

13.3 ± 0.9 a 12.7 ± 0.9 a 7.0 ± 0.3 a 4.1 ± 0.1 a

P-4 12.9 ± 1.1 a 12.4 ± 0.5 a 7.0 ± 0.4 a 4.4 ± 0.1 a

P-6 12.8 ± 1.0 a 12.2 ± 0.4 a 7.1 ± 0.3 a 4.5 ± 0.2 a

P-0 NTC 12.9 ± 0.9 ab 7.4 ± 0.3 d 5.0 ± 0.2 c 2.4 ± 0.1 b

P-9

C-1

11.7± 0.8 b 11.4 ± 0.5 b 7.3 ± 0.4 a 4.5 ± 0.3 a

P-11 12.1± 0.9 b 10.5 ± 0.6 c 6.9 ± 0.2 ab 4.6 ± 0.2 a

P-12 12.9 ± 0.9 ab 12.7 ± 0.5 a 7.3 ± 0.3 a 4.1 ± 0.2 a

P-14 12.7 ± 0.8 ab 12.2 ± 0.6 a 7.0 ± 0.3 a 4.4 ± 0.3 a

P-16 11.3 ± 0.9 b 10.5 ± 0.5 c 6.9 ± 0.4 ab 4.5 ± 0.4 a

P-19 13.7 ± 1.1 a 12.7 ± 0.6 a 7.0 ± 0.3 a 4.5 ± 0.2 a

P-20 13.1 ± 1.2 a 10.5 ± 0.4 c 7.1 ± 0.4 a 4.6 ± 0.1 a

P-0 NTC 12.1 ± 0.8 a 7.0 ± 0.3 c 4.9 ± 0.2 b 2.4 ± 0.1 c

P-22

C-2

11.9 ± 0.7 ab 11.1 ± 0.2 a 6.5 ± 0.3 a 3.8 ± 0.2 b

P-23 12.4 ± 1.1 a 10.9 ± 0.4 a 6.5 ± 0.2 a 4.1 ± 0.3 a

P-24 12.7 ± 1.2 a 10.4 ± 0.5 ab 6.4 ± 0.1 a 4.1 ± 0.2 a

P-26 12.6 ± 1.3 a 10.1 ± 0.6 ab 6.6 ± 0.2 a 4.1 ± 0.2 a

P-29 10.3 ± 0.8 b 9.5 ± 0.3 b 6.8 ± 0.3 a 4.0 ± 0.2 a

P-31 13.0 ± 1.1 a 11.4 ± 0.4 a 6.5 ± 0.4 a 3.9 ± 0.1 a

P-0 NTC 9.5 ± 0.8 b 6.7 ± 0.1 c 4.6 ± 0.2 b 2.2 ± 0.1 b

P-33

C-2

10.1 ± 0.7 ab 10.7 ± 0.3 a 6.5 ± 0.3 a 4.0 ± 0.2 a

P-37 11.0 ± 0.6 a 9.9 ± 0.4 ab 6.6 ± 0.4 a 4.2 ± 0.2 a

P-42 9.9 ± 0.5 ab 10.8 ± 0.5 a 6.9 ± 0.3 a 4.0 ± 0.2 a

P-45 10.7 ± 0.7 a 9.8 ± 0.4ab 6.1 ± 0.2a 4.0 ± 0.3a


58





3.3.6.3 Leaf Area Index (cm2)

The data table 3.7 shows that at 0 mM, non-significant results were observed in all

transgenic lines except P-31 and P-14 of cultivar Kuroda integrated with C-2 and C-1,

respectively. The transgenic plant P-12 integrated with C-1 showed the best leaf area

index 0.23 and 0.19 cm2, respectively followed by P-22 of C-2 with 0.22 and 0.18 cm2

while significantly reduced in control (0.10 and 0.08 cm2) plants in response to 50 and

100 mM, respectively. On the other hand, less variation (0.14 – 0.15 cm2) of leaf area

index obtained among transgenic lines of C-1 which is significantly higher to the non-

transformed plants (0.09 cm2) at 200 mM of NaCl (Table 3.7).


0% 10% 15% 20%

P-0 NTC 12.5 ± 1.2 ab 8.7 ± 0.3 c 4.4 ± 0.1 c 2.5 ± 0.1 b

P-2

C-1

12.1 ± 1.1 b 12.4 ± 0.5 a 7.3 ± 0.5 a 4.4 ± 0.2 a

P-4 13.0 ± 1.3 a 11.5 ± 0.6 b 6.7 ± 0.4 ab 4.7 ± 0.2 a

P-6 12.6 ± 0.9 ab 11.9±1.1ab 6.7 ± 0.3 ab 4.7 ± 0.1 a

P-0 NTC 11.6 ± 0.8 a 8.2 ± 0.4 e 4.0 ± 0.1 c 2.3 ± 0.1 b

P-9

C-1

12.1 ± 0.8 a 11.5 ± 0.6 bc 6.8 ± 0.2 ab 4.7 ± 0.2 a

P-11 11.5 ± 1.1 a 10.1 ± 0.5 d 7.3 ± 0.3 a 4.9 ± 0.3 a

P-12 11.4 ± 1.2 a 12.8 ± 1.2 a 7.4 ± 0.4 a 4.3 ± 0.2 a

P-14 12.0 ± 0.9 a 12.4 ± 1.1 ab 7.2 ± 0.3 a 4.4 ± 0.1 a

P-16 12.2 ± 1.1 a 10.5 ± 0.6 cd 6.9 ± 0.2 ab 4.3 ± 0.2 a

P-19 11.3 ± 0.9 a 12.7 ± 0.8 a 7.4 ± 0.3 a 4.3 ± 0.2 a

P-20 11.6 ± 1.2 a 10.2 ± 0.9 d 6.3 ± 0.2 b 4.2 ± 0.1 a

P-0 NTC 10.7 ± 0.8 a 6.5 ± 0.4 d 4.3 ± 0.3 b 2.0 ± 0.2c

P-22

C-2

10.9 ± 0.7 a 10.3 ± 0.6 a 5.8 ± 0.4 a 3.1 ± 0.2 c

P-23 11.0 ± 1.2 a 10.5 ± 0.8 a 5.7 ± 0.2 a 3.8 ± 0.1 a

P-24 10.6 ± 1.0 ab 9.8 ± 0.5 ab 5.9 ± 0.3 a 3.8 ± 0.2 a

P-26 9.2 ± 0.7 b 9.3 ± 0.4 b 6.0 ± 0.4 a 3.7 ± 0.2 a

P-29 9.5 ± 0.6 b 8.6 ± 0.6 c 5.9 ± 0.3 a 3.8 ± 0.3 a

P-31 11.0 ± 0.8 a 10.5 ± 0.8 a 6.1 ± 0.4 a 3.3 ± 0.3 ab

P-0 NTC 11.1± 0.5 a 6.3 ± 0.3 b 4.1 ± 0.2 c 2.2 ± 0.1 b

P-33

C-2

10.6 ± 0.7 a 9.9 ± 0.7 a 5.9 ± 0.3 a 3.6 ± 0.2 a

P-37 10.1 ± 0.6 b 9.2 ± 0.6 a 5.8 ± 0.4 a 3.8 ± 0.3 a

P-42 11.2 ± 0.8 a 10.0 ± 0.8 a 6.2 ± 0.5 a 3.7 ± 0.3 a

P-45 10.3 ± 0.7 ab 9.1 ± 0.6 a 5.7 ± 0.3 ab 3.7 ± 0.2 a


59

Table 3.7 Mean comparison for leaf area index (cm2) of transgenic (T0) vs control




On the other hand, transgenic line P-23 of Kuroda integrated with C-2 showed

the best leaf area index 0.25 cm2 followed by P-22, P-26 and P-45 (0.24 cm2) when

subjected to no stress of PEG. At 10% of PEG, estimation of leaf area index for all

transgenic lines of C-1 (ranging from 0.19 – 0.22 cm2) determined that performance of

transgenic plants were significantly higher to the non-transformed (0.14 cm2).

Moreover, transformed genotypes integrated with C-2 showed narrow range (0.17 –

0.21 cm2) of leaf area index but it was significantly higher than control (0.10 cm2)

plants. Similar trend was observed for leaf area index (ranging from 0.15 – 0.18 cm2)

of transgenic lines transformed with C-1 but significantly higher to the control (0.10

cm2) plants at 15% of PEG. At the same level of PEG, maximum leaf area index was

obtained in P-22 (0.17 cm2) of C-2 while minimum was observed in control (0.06 cm2)

plants. At 20% of PEG, a narrow range (0.08 – 0.13 cm2) was found for leaf area index


0 mM 50 mM 100 mM 200 mM

P-0 NTC 0.17 ± 0.1 ab 0.11 ± 0.1 b 0.07 ± 0.01 c 0.09 ± 0.01 b

P-2

C-1

0.19 ± 0.2 a 0.21 ± 0.2 a 0.18 ± 0.02 a 0.15 ± 0.05 a

P-4 0.13± 0.1 c 0.22 ± 0.3 a 0.16 ± 0.1 b 0.14 ± 0.06 a

P-6 0.16 ± 0.3 b 0.21 ± 0.3 a 0.18 ± 0.09 a 0.13 ± 0.04 a

P-0 NTC 0.16 ± 0.4 b 0.10 ± 0.2 b 0.08 ± 0.07 b 0.07 ± 0.09 b

P-9

C-1

0.14 ± 0.2 c 0.22 ± 0.2 a 0.18 ± 0.05 a 0.12 ± 0.08 a

P-11 0.17 ± 0.5 ab 0.22 ± 0.1 a 0.18 ± 0.06 a 0.11 ± 0.06 a

P-12 0.18 ± 0.6 ab 0.23 ± 0.3 a 0.19 ± 0.05 a 0.12 ± 0.07 a

P-14 0.19 ± 0.7 a 0.22 ± 0.2 a 0.18 ± 0.04 a 0.13 ± 0.08 a

P-16 0.16 ± 0.4 b 0.21 ± 0.1 a 0.17 ± 0.2 a 0.14 ± 0.07 a

P-19 0.15 ± 0.5 bc 0.22 ± 0.2 a 0.18 ± 0.3 a 0.15 ± 0.06 a

P-20 0.17 ± 0.6 ab 0.22 ± 0.1 a 0.18 ± 0.5 a 0.15 ± 0.05 a

P-0 NTC 0.19 ± 0.7 b 0.11 ± 0.2 b 0.07 ± 0.01 b 0.03 ± 0.08 c

P-22

C-2

0.21 ± 0.6 a 0.22 ± 0.3 a 0.18 ± 0.2 a 0.10 ± 0.07 a

P-23 0.15 ± 0.4 c 0.20 ± 0.4 a 0.15 ± 0.01 a 0.09 ± 0.06 a

P-24 0.19 ± 0.6 b 0.19 ± 0.2 a 0.16 ± 0.2 a 0.08 ±0.05ab

P-26 0.20 ± 0.7 ab 0.20 ± 0.1 a 0.16 ± 0.3 a 0.10 ± 0.06 a

P-29 0.21 ± 0.8 a 0.20 ± 0.2 a 0.16 ± 0.4 a 0.07 ± 0.08 b

P-31 0.22 ± 0.9 a 0.21 ± 0.4 a 0.17 ± 0.5 a 0.09 ± 0.06 a

P-0 NTC 0.17 ± 0.4 b 0.10 ± 0.3 b 0.08 ± 0.03 b 0.04 ± 0.02 b

P-33

C-2

0.20 ± 0.3 a 0.20 ± 0.4 a 0.16 ± 0.1 a 0.10 ± 0.04 a

P-37 0.19 ± 0.5 a 0.19 ± 0.3 a 0.15 ± 0.02 a 0.08 ± 0.03 a

P-42 0.18 ± 0.6 ab 0.20 ± 0.4 a 0.16 ± 0.09 a 0.10 ± 0.08 a

P-45 0.17 ± 0.4 b 0.20 ± 0.4 a 0.16 ± 0.01 a 0.10 ± 0.06 a


60

in transgenic lines of both C-1 and C-2 which was significantly higher than the non-

transformed (0.04 and 0.03 cm2, respectively) plants (Table 3.8).

Table 3.8 Mean comparison for leaf area index (cm2) of transgenic (T0) vs control




3.3.6.4 Shoot Fresh Weight (cm)

The shoot fresh weight of transgenic lines except P-14 (0.47 g) and P-12 (0.45 g) of

cultivar Kuroda harboring C-1 were non-significantly different to the control plants

when 0 mM of NaCl was applied. The maximum shoot fresh weight (0.45 g) was observed

in P-2 of Cardinal integrated with C-1 while P-22 and P-24 of cultivar Kuroda

transformed with C-2 have given significantly better response at 50 mM of NaCl. It was

observed that shoot fresh weight (ranging from 0.15 - 0.35 g) transformed with C-1

have shown better response than control (0.10 g) plants at 100 mM (Table 3.9). A

diverse range (0.18 – 0.30 g) was exhibited by transgenic plants integrated with C-2

which was significantly higher to the non-transformed plants (0.10 g). At 200 mM of


0% 10% 15% 20%

P-0 NTC 0.20 ± 0.5 a 0.14 ± 0.08 b 0.10 ± 0.05 c 0.04 ± 0.04 b

P-2 C-1 0.21 ± 0.8 a 0.19 ± 0.07 a 0.18 ± 0.08 a 0.11 ± 0.05 a

P-4 0.19 ± 0.7 ab 0.21 ± 0.06 a 0.18 ± 0.07 a 0.10 ± 0.04 a

P-6 0.18 ± 0.9 b 0.22 ± 0.05 a 0.15 ± 0.06 ab 0.10 ± 0.03 a

P-0 NTC 0.19 ± 0.7 b 0.12 ± 0.04 b 0.09 ± 0.03 c 0.03 ± 0.02 d

P-9

C-1

0.20 ± 0.9 b 0.22 ± 0.03 a 0.17 ± 0.07 a 0.11 ± 0.01 ab

P-11 0.22 ± 0.4 a 0.22 ± 0.04 a 0.16 ± 0.08 ab 0.13 ± 0.08 a

P-12 0.21 ± 0.6 ab 0.22 ± 0.04 a 0.19 ± 0.01 a 0.12 ± 0.04 a

P-14 0.19 ± 0.7 b 0.22 ±0.05 a 0.18 ± 0.01 a 0.11 ± 0.03 ab

P-16 0.23 ± 0.9 a 0.22 ± 0.06 a 0.18 ± 0.02 a 0.09 ± 0.05 bc

P-19 0.20 ± 0.7 b 0.22 ± 0.07 a 0.18 ± 0.03 a 0.10 ± 0.04 bc

P-20 0.21 ± 0.8 ab 0.19 ± 0.05 a 0.18 ± 0.08 a 0.08 ± 0.03 c

P-0 NTC 0.23 ± 0.9 ab 0.10 ± 0.02 c 0.06 ± 0.04 c 0.03 ± 0.02 b

P-22

C-2

0.24 ± 0.7 a 0.21 ± 0.04 a 0.17 ± 0.06 a 0.11 ± 0.04 a

P-23 0.25 ± 0.5 a 0.18 ± 0.08ab 0.14 ± 0.01 b 0.11 ± 0.05 a

P-24 0.22 ± 0.4 b 0.18 ± 0.06ab 0.14 ± 0.04 b 0.12 ± 0.06 a

P-26 0.24 ± 0.3 a 0.18 ± 0.04ab 0.14 ± 0.08 b 0.11 ± 0.07 a

P-29 0.21 ± 0.2 bc 0.18 ± 0.03ab 0.15 ± 0.07 b 0.13 ± 0.08 a

P-31 0.20 ± 0.7 c 0.19 ± 0.04 a 0.16 ± 0.03 ab 0.11 ± 0.06 a

P-0 NTC 0.19 ± 0.4 c 0.09 ± 0.01 b 0.05 ± 0.02 b 0.04 ± 0.02 c

P-33

C-2

0.21 ± 0.5 b 0.18 ± 0.02 a 0.14 ± 0.01 a 0.11 ± 0.03 a

P-37 0.22 ± 0.6 ab 0.17 ± 0.03 a 0.14 ± 0.03 a 0.11 ± 0.02 a

P-42 0.23 ± 0.8 a 0.18 ± 0.04 a 0.14 ± 0.04 a 0.08 ± 0.01 ab

P-45 0.24 ± 0.9 a 0.18 ± 0.05 a 0.14 ± 0.05 a 0.12 ± 0.03 a


61

salinity stress, the results showed that shoot fresh weight (0.11 – 0.22 g) was found to

be significantly higher in transgenic lines integrated with both constructs (C-1 & C-2)

than non-transformed control plants (0.04 and 0.09 g, respectively).


control potato at different levels of NaCl



The data table 3.10 shows that non-significant results were observed in all

transgenic and control plants at 0% of PEG while at 10%, all the transgenic plants of

cultivar Kuroda and Cardinal transformed with C-1 showed significantly higher shoot

fresh weight, as compared to weight (0.18 g) of non-transgenic control. The transgenic

lines of both cultivars Kuroda and Cardinal containing C-1 and C-2 also showed better

shoot fresh weight as compared to non-transgenic control when exposed to 15% of

PEG. At 20% of PEG, maximum shoot fresh weight (0.25 g) was observed in P-12 of

cultivar Kuroda integrated with C-1 and least was noted in control (0.09 g). On the other

Line # Genes Salt stress (NaCl)

0 mM 50 mM 100 mM 200 mM

P-0 NTC 0.47 ± 0.01 a 0.18 ± 0.03 c 0.11 ± 0.04 c 0.09 ± 0.04 b

P-2

C-1

0.42 ± 0.03 b 0.45 ± 0.04 a 0.32 ± 0.05 a 0.19 ± 0.05 a

P-4 0.40 ± 0.04 b 0.35 ± 0.02 b 0.28 ± 0.04 b 0.18 ± 0.04 a

P-6 0.49 ± 0.08 a 0.43 ± 0.01 a 0.35 ± 0.03 a 0.21 ± 0.06 a

P-0 NTC 0.42 ± 0.09 b 0.16 ± 0.04 d 0.10 ± 0.02 d 0.08 ± 0.05 d

P-9

C-1

0.44 ± 0.04 ab 0.39 ± 0.05 b 0.28 ± 0.02 bc 0.18 ± 0.04 c

P-11 0.43 ± 0.05 b 0.33 ± 0.06 b 0.21 ± 0.01 c 0.15 ± 0.03 b

P-12 0.46 ± 0.04 a 0.43 ± 0.07 a 0.35 ± 0.08 a 0.22 ± 0.05 a

P-14 0.47 ± 0.03 a 0.24 ± 0.08 c 0.15 ± 0.07 d 0.20 ± 0.04 a

P-16 0.40 ± 0.02 c 0.35 ± 0.09 b 0.24 ± 0.05 bc 0.13 ± 0.02 bc

P-19 0.44 ± 0.07 ab 0.38 ± 0.01 b 0.23 ± 0.04 bc 0.14 ± 0.01 b

P-20 0.45 ± 0.06 a 0.37 ± 0.02 b 0.25 ± 0.03 bc 0.12 ± 0.05 c

P-0 NTC 0.42 ± 0.04 ab 0.16 ± 0.03 c 0.10 ± 0.04 d 0.04 ± 0.02 d

P-22

C-2

0.39 ± 0.03 b 0.41 ± 0.04 a 0.30 ± 0.06 a 0.17 ± 0.08 b

P-23 0.44 ± 0.08 a 0.32 ± 0.05 b 0.26 ± 0.04 ab 0.16 ± 0.06 b

P-24 0.43 ± 0.07 ab 0.41 ± 0.04 a 0.25 ± 0.02 ab 0.22 ± 0.07 a

P-26 0.44 ± 0.05 a 0.36 ± 0.02 b 0.27 ± 0.01 ab 0.16 ± 0.05 b

P-29 0.45 ± 0.04 a 0.33 ± 0.03 b 0.19 ± 0.07 c 0.12 ± 0.04 c

P-31 0.42 ± 0.03 ab 0.40 ± 0.08 a 0.30 ± 0.06 a 0.19 ± 0.06 ab

P-0 NTC 0.40 ± 0.04 a 0.14 ± 0.09 c 0.09 ± 0.04 c 0.05 ± 0.04 c

P-33

C-2

0.39 ± 0.02 ab 0.29 ± 0.08 b 0.18 ± 0.02 b 0.13 ± 0.03 a

P-37 0.37 ± 0.06 b 0.32 ± 0.04 ab 0.22 ± 0.04 a 0.11 ± 0.02 ab

P-42 0.40 ± 0.07 a 0.36 ± 0.04 a 0.21 ± 0.06 a 0.13 ± 0.06 a

P-45 0.41 ± 0.04 a 0.37 ± 0.06 a 0.27 ± 0.01 a 0.14 ± 0.05 a


62

hand, all genotypes tested for shoot fresh weight (ranging from 0.07 – 0.18 g)

transformed with C-2 was significantly higher to the control (0.01 g) plants.


control potato at different levels of PEG



3.3.6.5 Root Fresh Weight (g)

The maximum root fresh weight (0.37 g) was observed in P-19, P-11 and P-4 integrated

with C-1 followed by 0.36 g in P-9, P-16 and P-2 at 0 mM of NaCl. On the other hand,

transgenic line P-31 with C-2 also showed significantly better root fresh weight (0.37

g) compared to weight (0.32 g) of non-transgenic plants. Transgenic lines P-2 and P-6

of cultivar Cardinal integrated with C-1 showed the best root fresh weight 0.34 g and

0.26 g at 50 and 100 mM of salinity stress, respectively. Furthermore, transgenic plant

P-22 of cultivar Kuroda harboring C-2 gene also exhibited maximum root fresh weight

as compared to non-transgenic control at both stress levels (Table 3.11). At 200 mM of

salinity stress, maximum root fresh weight (0.17 g) was observed in transgenic line P-


0 % 10 % 15 % 20 %

P-0 NTC 0.52 ± 0.08 ab 0.20 ± 0.05 c 0.14 ± 0.07 c 0.09 ± 0.02 c

P-2

C-1

0.53 ± 0.07 ab 0.46 ± 0.06 a 0.35 ± 0.06 ab 0.19 ± 0.03 b

P-4 0.56 ± 0.9 a 0.36 ± 0.04 b 0.26 ± 0.05 b 0.19 ± 0.01 b

P-6 0.49 ± 0.05 b 0.50 ± 0.08 a 0.39 ± 0.04 a 0.24 ± 0.05 a

P-0 NTC 0.50 ± 0.04 a 0.18 ± 0.07 e 0.12 ± 0.03 c 0.08 ± 0.04 d

P-9

C-1

0.49 ± 0.06a 0.40 ± 0.03 b 0.31 ± 0.02 ab 0.20 ± 0.05 b

P-11 0.45 ± 0.08 b 0.37 ± 0.07 bc 0.24 ± 0.01 b 0.18 ± 0.05 b

P-12 0.51 ± 0.07 a 0.48 ± 0.08 a 0.38 ± 0.04 a 0.25 ± 0.06 a

P-14 0.46 ± 0.05 ab 0.27 ± 0.04 d 0.26 ± 0.05 b 0.17 ± 0.04 b

P-16 0.47 ± 0.04 ab 0.37 ± 0.04 bc 0.25 ± 0.04 b 0.12 ±0.03 bc

P-19 0.49 ± 0.07 a 0.41 ± 0.05 b 0.26 ± 0.03 b 0.16 ± 0.02 b

P-20 0.50 ± 0.06 a 0.32 ± 0.04 c 0.26 ± 0.02 b 0.13 ± 0.01 bc

P-0 NTC 0.42 ± 0.04 ab 0.19 ± 0.03 c 0.10 ± 0.04 d 0.01 ± 0.04 d

P-22

C-2

0.44 ± 0.02 a 0.37 ± 0.04 a 0.29 ± 0.04 a 0.15 ± 0.03 ab

P-23 0.40 ± 0.04 b 0.30 ± 0.07 b 0.24 ± 0.03 b 0.14 ± 0.02 b

P-24 0.43 ± 0.09 a 0.39 ± 0.04 a 0.28 ± 0.02 a 0.18 ± 0.01 a

P-26 0.45 ± 0.07 a 0.35 ± 0.05 ab 0.25 ± 0.01 ab 0.14 ± 0.03 b

P-29 0.41 ± 0.06 ab 0.31 ± 0.7 b 0.17 ± 0.07 c 0.10 ± 0.04 c

P-31 0.40 ± 0.05 b 0.38 ± 0.08 a 0.29 ± 0.05 a 0.17 ± 0.02 a

P-0 NTC 0.42 ± 0.03 ab 0.17 ± 0.5 c 0.09 ± 0.06 d 0.02 ± 0.01 c

P-33

C-2

0.44 ± 0.04 a 0.28 ± 0.4 b 0.14 ± 0.02 c 0.07 ± 0.06 ab

P-37 0.45 ± 0.08 a 0.31 ± 0.6 ab 0.21 ± 0.01 b 0.09 ± 0.05 a

P-42 0.42 ± 0.07 ab 0.34 ± 0.7 a 0.19 ± 0.01 bc 0.08 ± 0.07 a

P-45 0.39 ± 0.06 b 0.33 ± 0.5 a 0.26 ± 0.05 a 0.08 ± 0.05 a


63

12 of Kuroda integrated with C-1 construct and minimum (0.06 g) was observed in P-

20 of the same cultivar. At same stress level, P-24 of Kuroda having C-2 exhibited

better root fresh weight (0.13 g) as compared to non-transgenic control (0.02 g).





In the absence of PEG, transgenic plant (P-19) of cultivar Kuroda containing C-

1 also showed better root fresh weight as compared to non-transgenic control.

Transgenic line P-6 of cultivar Cardinal integrated with C-1 gene showed the best root

fresh weight value (0.35 g) at 10% while it could not maintained the top position at

15% of PEG. At same stress level, the transgenic line P-2 showed the best root fresh

weight (0.24 g). Furthermore, transgenic line P-9 of Kuroda harboring C-1 also

maintained better root fresh weight as compared to non-transgenic control when 20%

of PEG was applied (Table 3.12). Significant difference in root fresh weight (g) at 10,


0 mM 50 mM 100 Mm 200 mM

P-0 NTC 0.33 ± 0.08 b 0.12 ± 0.02 c 0.08 ± 0.03 c 0.003 ± 0.007 c

P-2

C-1

0.36 ± 0.07 a 0.34 ± 0.07 a 0.26 ± 0.04 a 0.12 ± 0.09 ab

P-4 0.37 ± 0.05 a 0.23 ± 0.06 b 0.17 ± 0.06 b 0.15 ± 0.08 a

P-6 0.33 ± 0.04 b 0.34 ± 0.08 a 0.26 ± 0.05 a 0.11 ± 0.06 b

P-0 NTC 0.31 ± 0.03 b 0.11 ± 0.05 d 0.09 ± 0.09 d 0.004 ± 0.001 d

P-9

C-1

0.36 ± 0.02 a 0.27 ± 0.04 b 0.15 ± 0.01 bc 0.10 ± 0.09 ab

P-11 0.37 ± 0.01 a 0.23 ± 0.02 c 0.14 ± 0.06 c 0.08 ± 0.07 b

P-12 0.32 ± 0.06 b 0.32 ± 0.01 a 0.23 ± 0.04 a 0.17 ± 0.02 a

P-14 0.34 ± 0.04 ab 0.29 ± 0.05 ab 0.21 ± 0.03 a 0.16 ± 0.04 a

P-16 0.36 ± 0.03 a 0.29 ± 0.04 ab 0.15 ± 0.04 bc 0.08 ± 0.03 b

P-19 0.37 ± 0.02 a 0.30 ± 0.04 a 0.16 ± 0.06 b 0.09 ± 0.04 b

P-20 0.32 ± 0.01 b 0.27 ± 0.03 b 0.17 ± 0.07 b 0.06 ± 0.05 c

P-0 NTC 0.32 ± 0.08 b 0.15 ± 0.02 d 0.08 ± 0.03 c 0.02 ± 0.01 c

P-22

C-2

0.36 ± 0.09 a 0.36 ± 0.05 a 0.24 ± 0.05 a 0.12 ± 0.05 a

P-23 0.35 ± 0.07 ab 0.25 ± 0.04 c 0.20 ± 0.04 ab 0.10 ± 0.01 a

P-24 0.34 ± 0.06 ab 0.29 ± 0.02 b 0.21 ± 0.02 ab 0.13 ± 0.03 a

P-26 0.33 ± 0.05 b 0.28 ± 0.02 b 0.16 ± 0.08 b 0.08 ± 0.007 b

P-29 0.36 ± 0.04 a 0.25 ± 0.04 c 0.15 ± 0.09 bc 0.08 ± 0.003 b

P-31 0.37 ± 0.06 a 0.29 ± 0.02 b 0.21 ± 0.05 ab 0.08 ± 0.001 b

P-0 NTC 0.36 ± 0.04 a 0.13 ± 0.01 d 0.09 ± 0.03 c 0.03 ± 0.003 b

P-33

C-2

0.36 ± 0.07 a 0.30 ± 0.07 b 0.17 ± 0.02 a 0.08 ± 0.004 a

P-37 0.34 ± 0.08 ab 0.26 ± 0.03 c 0.17 ± 0.02 a 0.07 ± 0.007 a

P-42 0.33 ± 0.09 b 0.31 ± 0.04 ab 0.15 ± 0.03 b 0.08 ± 0.006 a

P-45 0.35 ± 0.04 ab 0.35 ± 0.04 a 0.17 ± 0.02 a 0.08 ± 0.007 a


64

15 and 20% was noted in transgenic lines integrated with C-2 of both Kuroda and

Cardinal.





3.3.6.6 Shoot Dry Weight (g)

The data table 3.13 shows that at 0 mM, maximum shoot dry weight (0.23 g) was

observed in P-20 integrated with C-1 and minimum (0.18 g) was observed in P-6 and

P-14, respectively. Transgenic lines P-31 and P-33 of C-2 showed significantly better

shoot dry weight (0.23 and 0.18 g) as compared to control (0.17 and 0.14 g,

respectively) plants when no stress was applied. At 50 mM of stress, all transgenic lines

integrated with both C-1 and C-2 showed significantly higher shoot dry weight

compared to control plants. The cultivar Cardinal of C-1 gene at 100 mM has given

maximum shoot dry weight (0.10 g) in P-6 followed by P-2 and P-9 (0.09 g). Similarly


0 % 10 % 15 % 20 %

P-0 NTC 0.30 ± 0.01 b 0.19 ± 0.04 c 0.07 ± 0.07 c 0.04 ± 0.09 b

P-2

C-1

0.30 ± 0.06 b 0.32 ± 0.03 a 0.24 ± 0.08 a 0.14 ± 0.08 a

P-4 0.35 ± 0.08 a 0.21 ± 0.02 b 0.16 ± 0.09 b 0.13 ± 0.07 a

P-6 0.36 ± 0.06 a 0.35 ± 0.04 a 0.23 ± 0.08 a 0.14 ± 0.06 a

P-0 NTC 0.33 ± 0.07 c 0.17 ± 0.03 c 0.08 ± 0.06 c 0.05 ± 0.08 e

P-9

C-1

0.37 ± 0.05 ab 0.29 ± 0.09 a 0.16 ± 0.05 b 0.19 ± 0.09 a

P-11 0.35 ± 0.06 abc 0.23 ± 0.07 b 0.15 ± 0.04 b 0.06 ± 0.07 de

P-12 0.34 ±0.04 bc 0.22 ± 0.08 b 0.24 ± 0.03 a 0.16 ± 0.09 b

P-14 0.35 ± 0.06 abc 0.23 ± 0.07 b 0.12 ± 0.08 b 0.15 ± 0.08 b

P-16 0.37 ± 0.03 ab 0.22 ± 0.04 b 0.13 ± 0.09 b 0.09 ± 0.07 d

P-19 0.39 ± 0.024 a 0.29 ± 0.03 a 0.14 ± 0.07 b 0.08 ± 0.06 d

P-20 0.31 ± 0.08 c 0.24 ± 0.05 b 0.15 ± 0.08 b 0.11 ± 0.05 c

P-0 NTC 0.33 ± 0.07 b 0.11 ± 0.07 d 0.05 ± 0.04 d 0.009 ± 0.04 d

P-22

C-2

0.34 ± 0.05 ab 0.31 ± 0.09 a 0.24 ± 0.03 a 0.10 ± 0.07 b

P-23 0.35 ± 0.04 a 0.19 ± 0.08 c 0.18 ± 0.03 bc 0.08 ± 0.06 bc

P-24 0.33 ± 0.03 b 0.27 ± 0.07 b 0.20 ± 0.05 ab 0.07 ± 0.05 bc

P-26 0.36 ± 0.04 a 0.26 ± 0.05 b 0.14 ± 0.04 c 0.06 ± 0.04 c

P-29 0.33 ± 0.05 b 0.21 ± 0.06 c 0.14 ± 0.03 c 0.06 ± 0.03 c

P-31 0.34 ± 0.06 ab 0.27 ± 0.07 b 0.20 ± 0.02 ab 0.14 ± 0.02 a

P-0 NTC 0.32 ± 0.07 b 0.10 ± 0.05 e 0.06 ± 0.07 c 0.008 ± 0.08 c

P-33

C-2

0.35 ± 0.04 ab 0.14 ± 0.06 d 0.12 ± 0.08 b 0.19 ± 0.07 a

P-37 0.36 ± 0.05 a 0.24 ± 0.07 c 0.12 ± 0.09 b 0.06 ± 0.06 b

P-42 0.34 ± 0.06 ab 0.29 ± 0.04 b 0.13 ± 0.07 ab 0.05 ± 0.05 b

P-45 0.37 ± 0.05 a 0.36 ± 0.03 a 0.15 ± 0.08 a 0.06 ± 0.04 b


65

significantly higher shoot dry weight in transgenic plants of C-2 gene was also recorded

in response to same level of stress. At 200 mM of salinity level, minimum shoot dry

weight, 0.003 g was noted in the control of C-1 gene while P-22 of cultivar Kuroda and

P-33 of cultivar Cardinal of C-2 have given significantly better response (0.08 g) for

shoot dry weight at 200 mM salinity level as compared to control (0.001 g) plants (Table

3.13).

Table 3.13 Mean comparison for shoot dry weight (g) of transgenic (T0) vs




Transgenic line P-6 of the potato cultivar Cardinal integrated with C-1 gene

showed the best shoot dry weight (0.23 g) at 0% of PEG. Furthermore, transgenic line

P-29 of Kuroda harboring C-2 gene also maintained better root dry weight as compared

to non-transgenic control. (Table 3.14). At 10% of PEG, maximum shoot dry weight

(0.18 g) of C-1 was obtained in P-6 of cultivar Cardinal followed by P-2, P-4 and P-12

(0.16 g) which was significantly higher to the control (0.08 g) plants. The potential for


0 mM 50 mM 100 mM 200 mM

P-0 NTC 0.18 ± 0.01 b 0.10 ± 0.04 c 0.01 ± 0.09 c 0.003 ± 0.001 d

P-2

C-1

0.22 ± 0.07 a 0.17 ± 0.03 a 0.09 ± 0.08 a 0.08 ± 0.004 a

P-4 0.23 ± 0.05 a 0.15 ± 0.02 ab 0.08 ± 0.04 ab 0.04 ± 0.003b

P-6 0.18 ± 0.04 b 0.17 ± 0.01 a 0.10 ± 0.08 a 0.03 ± 0.007 bc

P-0 NTC 0.20 ± 0.03 b 0.11 ± 0.04 c 0.02 ± 0.07 d 0.004 ± 0.004 c

P-9

C-1

0.22 ± 0.02 ab 0.18 ± 0.05 a 0.09 ± 0.06 a 0.01 ± 0.003 ab

P-11 0.20 ± 0.04 b 0.17 ± 0.06 a 0.08 ± 0.05 ab 0.01 ± 0.007 ab

P-12 0.21 ± 0.05 ab 0.15 ± 0.05 ab 0.06 ± 0.04 bc 0.02 ± 0.006 a

P-14 0.18 ± 0.07 c 0.12 ± 0.07 bc 0.08 ± 0.07ab 0.01 ± 0.005 ab

P-16 0.23 ± 0.08 a 0.13 ± 0.04 b 0.07 ± 0.05 b 0.02 ± 0.004 a

P-19 0.22 ± 0.06 ab 0.14 ± 0.03 ab 0.06 ± 0.03 bc 0.01 ± 0.002 ab

P-20 0.25 ± 0.04 a 0.13 ± 0.02 b 0.07 ± 0.02 b 0.02 ± 0.001 a

P-0 NTC 0.17 ± 0.03 b 0.08 ± 0.01 d 0.02 ± 0.01 c 0.001 ± 0.008 d

P-22

C-2

0.20 ± 0.02 ab 0.16 ± 0.01 a 0.12 ± 0.04 a 0.08 ± 0.006 a

P-23 0.17 ± 0.01 b 0.13 ± 0.02 ab 0.10 ± 0.05 ab 0.04 ± 0.004 bc

P-24 0.19 ± 0.07 ab 0.15 ± 0.03 a 0.11 ± 0.03 a 0.04 ± 0.002 bc

P-26 0.20 ± 0.08 ab 0.14 ± 0.07 ab 0.11 ± 0.04 a 0.06 ± 0.006 ab

P-29 0.22 ± 0.09 a 0.11 ± 0.04 bc 0.10 ± 0.06 ab 0.05 ± 0.007 b

P-31 0.23 ± 0.07 a 0.14 ± 0.03 ab 0.10 ± 0.07 ab 0.06 ± 0.009ab

P-0 NTC 0.14 ± 0.06 b 0.07 ± 0.02 c 0.03 ± 0.08 c 0.002 ± 0.004 d

P-33

C-2

0.18 ± 0.05 a 0.12 ± 0.04 b 0.05 ± 0.07 b 0.08 ± 0.003 a

P-37 0.17 ± 0.04 a 0.12 ± 0.06 b 0.08 ± 0.06 ab 0.03 ± 0.002 b

P-42 0.12 ± 0.01 b 0.13 ± 0.07 ab 0.08 ± 0.07 ab 0.02 ± 0.007 bc

P-45 0.17 ± 0.07 a 0.15 ± 0.09 a 0.10 ± 0.08 a 0.03 ± 0.005b


66

shoot dry weight of all tested genotypes ranged from 0.02 – 0.08 g in transgenic lines

of C-2 which was significantly higher than control plants (0.001 g) at 10% of PEG level.

The cultivar Cardinal has given maximum value (0.09 g) in P-2 (C-1), minimum (0.03

g) in P-20 (C-1) of Kuroda at 15% of PEG. At 20% maximum, (0.07 g) was recorded

in P-2 of C-1 gene, while minimum in the control (0.002 g). At same level of PEG, the

transgenic lines (ranging from 0.02 – 0.08 g) of C-2 have shown significant difference

with respect to control (0.003 g) plants (Table 3.14).

Table 3.14 Mean comparison for shoot dry weight (g) of transgenic (T0) vs


Values sharing the common letters are non-significant at 0.05 probability level. NTC:

Non transgenic control, C-1: (HSR1), C-2: (AVP1)

3.3.6.7 Root Dry Weight (g)

At 0 mM salinity level, comparing the transgenic and control of Kuroda, maximum root

dry weight (0.17 g) was noted in the P-9 and P-19 of C-1 and minimum (0.14 g) in the

control. Similarly, maximum value (0.23 g) was noted in P-37 of C-2 gene however it

was non-significant with other transgenes except P-31 that was at par with control. At


0 % 10 % 15 % 20 %

P-0 NTC 0.19 ± 0.07 b 0.08 ± 0.08 c 0.009 ± 0.001 c 0.002 ± 0.006 c

P-2

C-1

0.21 ± 0.06 ab 0.16 ± 0.07 ab 0.09 ± 0.03 a 0.07 ± 0.07 a

P-4 0.22 ± 0.05 a 0.16 ± 0.05 ab 0.08 ± 0.04 a 0.05 ± 0.01 b

P-6 0.23 ± 0.04 a 0.18 ±0.04 a 0.07 ± 0.06 ab 0.04 ± 0.09 b

P-0 NTC 0.17 ± 0.03 b 0.07 ± 0.001 d 0.008 ± 0.006 d 0.003 ± 0.01 b

P-9

C-1

0.21 ± 0.08 a 0.16 ± 0.06 a 0.08 ± 0.06 a 0.02 ± 0.01 a

P-11 0.20 ± 0.09 a 0.15 ± 0.05 a 0.08 ± 0.01 a 0.02 ± 0.03 a

P-12 0.17 ± 0.07 b 0.16 ± 0.07 a 0.06 ± 0.02 ab 0.03 ± 0.01 a

P-14 0.19 ± 0.05 ab 0.14 ± 0.08 ab 0.08 ± 0.04 a 0.02 ± 0.01 a

P-16 0.17 ± 0.04 b 0.14 ± 0.09 ab 0.03 ± 0.05 bc 0.03 ± 0.001 a

P-19 0.18 ± 0.07 ab 0.10 ± 0.07 bc 0.04 ± 0.06 bc 0.03 ± 0.009 a

P-20 0.20 ± 0.08 a 0.10 ± 0.06 bc 0.03 ± 0.02 bc 0.03 ± 0.008 a

P-0 NTC 0.21 ± 0.09 b 0.10 ± 0.05 d 0.009 ± 0.001 d 0.003 ± 0.007 c

P-22

C-2

0.23 ±0.05 ab 0.14 ± 0.04 b 0.11 ± 0.04 a 0.07 ± 0.002 a

P-23 0.24 ±0.08 a 0.11 ± 0.03 c 0.11 ± 0.03 a 0.08 ± 0.003 a

P-24 0.22 ± 0.06 ab 0.15 ± 0.02 b 0.12 ± 0.02 a 0.07 ± 0.004 a

P-26 0.23 ± 0.05 ab 0.19 ± 0.09 a 0.09 ± 0.08 b 0.03 ± 0.006 b

P-29 0.25 ± 0.01 a 0.18 ± 0.04 a 0.08 ± 0.07 b 0.04 ± 0.004 b

P-31 0.22 ± 0.09 ab 0.18 ± 0.02 a 0.07 ± 0.05 c 0.04 ± 0.003 b

P-0 NTC 0.19 ± 0.05 b 0.11 ± 0.07 c 0.008 ± 0.006 c 0.004 ± 0.008 b

P-33

C-2

0.19 ± 0.04 b 0.17 ± 0.06 a 0.08 ± 0.02 a 0.03 ± 0.007 a

P-37 0.23 ± 0.03 a 0.17 ± 0.05 a 0.07 ± 0.03 b 0.02 ± 0.006 a

P-42 0.24 ± 0.02 a 0.16 ± 0.04 ab 0.09 ± 0.04 a 0.02 ± 0.005 a

P-45 0.20 ± 0.01 ab 0.15 ± 0.03 b 0.08 ± 0.07 a 0.03 ± 0.001 a


67

50 mM, transgenic line of Kuroda has given maximum root dry weight (0.14 g) in P-

12 of C-1 gene. A variable (0.11 - 0.20 g) response was exhibited by the transgenic

lines of C-2 but significantly higher to the non-transformed plants (0.07 g). The results

revealed that root dry weight (ranging from 0.04 – 0.09 g) transformed with C-1, were

significantly higher to the control (0.01 g) plants while P-23 of C-2 in Kuroda showed

maximum root dry weight (0.11 g) than control (0.03 g) plants. Similar kind of

significant interaction was observed in transgenic lines compared to control plants

subjected to 200 mM of NaCl (Table 3.15).





At 0% of PEG has given maximum root dry weight (0.18 g) in P-2 of C-1

followed by P-4 and P-6 while minimum (0.14 g) was noted in the control. On the other

hand, similar trend was observed for root dry weight in P-2 (0.13 g) of cultivar Cardinal

integrated with C-1 which was significantly higher to the non-transformed (0.05 g)


0 mM 50 mM 100 mM 200 mM

P-0 NTC 0.11 ± 0.4 b 0.09 ± 0.001 b 0.01 ± 0.008 c 0.001 ± 0.004 b

P-2

C-1

0.15 ± 0.3 a 0.12 ± 0.5 a 0.07 ± 0.004 b 0.008 ± 0.003 a

P-4 0.11 ± 0.5 b 0.10 ± 0.6 ab 0.06 ± 0.006 b 0.008 ± 0.002 a

P-6 0.16 ± 0.4 a 0.10 ± 0.7 ab 0.09 ± 0.001 a 0.007 ± 0.006 a

P-0 NTC 0.14 ± 0.2 b 0.08 ± 0.007c 0.02 ± 0.003 c 0.002 ± 0.001 c

P-9

C-1

0.17 ± 0.3 a 0.13 ± 0.6 a 0.07 ± 0.004 a 0.006 ± 0.001 b

P-11 0.16 ± 0.4 a 0.12 ± 0.5 ab 0.07 ± 0.001 a 0.008 ± 0.004 a

P-12 0.14 ± 0.5 ab 0.14 ± 0.4 a 0.07 ± 0.009 a 0.009 ± 0.001 a

P-14 0.15 ± 0.3 ab 0.10 ± 0.3 b 0.06 ± 0.006 a 0.007 ± 0.003 ab

P-16 0.13 ± 0.2 b 0.12 ± 0.5 ab 0.05 ± 0.002 b 0.005 ± 0.001 bc

P-19 0.17 ± 0.7 a 0.10 ± 0.6 b 0.04 ± 0.001 b 0.004 ± 0.001 c

P-20 0.16 ± 0.8 a 0.11 ± 0.6 ab 0.06 ± 0.003 a 0.003 ± 0.001 c

P-0 NTC 0.17 ± 0.6 b 0.07 ± 0.007 c 0.03 ± 0.007 c 0.009 ± 0.002 c

P-22

C-2

0.21 ± 0.5 a 0.19 ± 0.6 a 0.10 ± 0.2 a 0.08 ± 0.01 a

P-23 0.20 ± 0.6 ab 0.20 ± 0.5 a 0.11 ± 0.6 a 0.07 ± 0.03 a

P-24 0.18 ± 0.5 b 0.18 ± 0.4 a 0.10 ± 0.7 a 0.06 ± 0.01 ab

P-26 0.17 ± 0.4 b 0.11 ± 0.3 bc 0.09 ± 0.004 ab 0.04 ± 0.02 b

P-29 0.20 ± 0.7 ab 0.13 ± 0.2 b 0.07 ± 0.003 b 0.04 ± 0.001 b

P-31 0.22 ± 0.5 a 0.11 ± 0.4 bc 0.08 ± 0.007 b 0.03 ± 0.009 bc

P-0 NTC 0.19 ± 0.6 b 0.06 ± 0.002 c 0.04 ± 0.002 b 0.008 ± 0.004 c

P-33

C-2

0.20 ± 0.7 ab 0.12 ± 0.5 b 0.07 ± 0.006 a 0.02 ± 0.01 b

P-37 0.23 ± 0.8 a 0.17 ± 0.6 a 0.08 ± 0.007 a 0.03 ± 0.02 ab

P-42 0.20 ± 0.8 ab 0.18 ± 0.7 a 0.07 ± 0.006 a 0.04 ± 0.03 a

P-45 0.22 ± 0.6 a 0.11 ± 0.6 b 0.08 ± 0.005 a 0.04 ± 0.002 a


68

plants at 10% of PEG. Transgenic line P-2 of cultivar Cardinal integrated with C-1

showed the best root dry weight 0.09 g and 0.07 g at 15 and 20% PEG, respectively

(Table 3.16). In order to investigate the tolerance potential, root dry weight of all the

transgenic lines integrated with C-2 along with control plants were recorded at both 15

and 20 % of PEG levels. The results revealed that transgenic lines were significantly

higher (ranging from 0.02 – 0.12 g and 0.01 – 0.05 g, respectively) as compared to

control (0.004 and 0.008 g, respectively) plants.






0 % 10 % 15 % 20 %

P-0 NTC 0.14 ± 0.01 b 0.05 ± 0.001 c 0.009 ± 0.001 d 0.009 ± 0.004 c

P-2

C-1

0.18 ± 0.02 a 0.13 ± 0.08 a 0.09 ± 0.002 a 0.07 ± 0.006 a

P-4 0.16 ± 0.03 ab 0.11 ± 0.07 ab 0.04 ± 0.003 c 0.01 ± 0.007 b

P-6 0.14 ± 0.07 b 0.10 ± 0.06 b 0.06 ± 0.005 b 0.06 ± 0.006 a

P-0 NTC 0.11 ± 0.04 b 0.04 ± 0.03 b 0.008 ± 0.003 b 0.007 ± 0.001 b

P-9

C-1

0.13 ± 0.05 ab 0.08 ± 0.04 a 0.06 ± 0.004 a 0.06 ± 0.002 a

P-11 0.11 ± 0.06 b 0.09 ± 0.05 a 0.06 ± 0.003 a 0.05 ± 0.003 a

P-12 0.14 ± 0.03 a 0.09 ± 0.06 a 0.05 ± 0.004 a 0.06 ± 0.004 a

P-14 0.15 ± 0.02 a 0.07 ± 0.01 a 0.05 ± 0.006 a 0.05 ± 0.005 a

P-16 0.12 ± 0.01 ab 0.08 ± 0.001 a 0.05 ± 0.004 a 0.06 ± 0.003 a

P-19 0.11 ± 0.05 b 0.08 ± 0.003 a 0.04 ± 0.003 a 0.05 ± 0.004 a

P-20 0.10 ± 0.04 b 0.08 ± 0.04 a 0.05 ± 0.005 a 0.05 ± 0.004 a

P-0 NTC 0.12 ± 0.03 b 0.04 ± 0.02 c 0.004 ± 0.003 d 0.008 ± 0.001 c

P-22

C-2

0.15 ± 0.04 a 0.11 ± 0.06 a 0.12 ± 0.04 a 0.04 ± 0.002 a

P-23 0.13 ± 0.05 ab 0.10 ± 0.05 a 0.05 ± 0.06 bc 0.01 ± 0.009 b

P-24 0.12 ± 0.06 b 0.11 ± 0.04 a 0.03 ± 0.07 c 0.05 ± 0.007 a

P-26 0.14 ± 0.04 a 0.08 ± 0.06 b 0.07 ± 0.08 b 0.04 ± 0.003 a

P-29 0.13 ± 0.05 ab 0.08 ± 0.03 b 0.03 ± 0.06 c 0.02 ± 0.001 ab

P-31 0.14 ± 0.03 a 0.09 ± 0.002 b 0.02 ± 0.009 cd 0.04 ± 0.002 a

P-0 NTC 0.11 ± 0.02 b 0.05 ± 0.001 b 0.005 ± 0.007 d 0.007 ± 0.005 c

P-33

C-2

0.14 ± 0.03 a 0.09 ± 0.002 a 0.03 ± 0.009 b 0.03 ± 0.003 ab

P-37 0.13 ± 0.02 ab 0.09 ± 0.003 a 0.08 ± 0.008 a 0.04 ± 0.001 a

P-42 0.15 ± 0.05 a 0.09 ± 0.001 a 0.02 ± 0.007 b 0.04 ± 0.002 a

P-45 0.14 ± 0.06 a 0.08 ± 0.003 a 0.01 ± 0.006 b 0.02 ± 0.001 b


69

3.3.6.8 Relative Water Contents (RWC %)

Salinity stress at 0, 50, 100 and 200 mM levels significantly reduced the RWC in both

cultivars Kuroda and Cardinal (Table 3.17). However, more reduction was observed in

the control (non-transgenic) as compared to the transgenic lines. At 0 mM of salinity

stress, maximum relative water contents (78%) was recorded in P-19 of cultivar Kuroda

integrated with C-1 gene followed by P-31 of the same cultivar harboring C-2.

Minimum water contents were observed in P-16 (C-1). At 50 mM level in the cultivar

Cardinal, maximum relative water contents (66%) in P-2 of C-1 gene followed by P-22

of cultivar Kuroda integrated with C-2 gene. Minimum water contents were observed

in P-14 (C-1). At 100 mM salinity level, transgenic line P-4 of cultivar Cardinal

transformed with C-1 maintained higher relative water contents 54% and lowest (26%)

observed in the control. These results demonstrated that significantly higher RWC was

exhibited in transgenic lines P-22, P-23 (52%) and P-31 (47%) of cultivar Kuroda

integrated with C-2 as compared to non-transformed plants (27%). In Kuroda at 200

mM, P-22 (C-2) showed highest (43%) RWC followed by transgenic line P-2 (42%) of

cultivar Cardinal integrated with C-1 gene while lowest (7%) was observed in control

plants (Table 3.17).


70

Table 3.17 Mean comparison for relative water contents (%) of transgenic (T0)

vs control potato at different levels of NaCl



Significant reduction was observed for relative water contents in the tested

transgenic and non-transgenic control lines in response to different levels of PEG. More

reduction was observed in the control. At 0% PEG level, there was no significant

difference among the transgenic lines integrated with C-1 and C-2 and control. At 10%

PEG level in the potato cultivar Cardinal, transgenic line P-2 (C-1) showed higher

(67%) followed by P-22 (64%) integrated with C-2. At 15% of PEG level P-4 (C-1)

55% and P-23 of C-2 showed 51% relative water contents as compared to the control

(29%). At 20% of PEG, maximum (53%) RWC was observed in transgenic line P-12

of C-1 gene which was significantly higher as compare to control (7%) plants (Table

3.18). The results obtained for RWC exhibited by transgenic lines (ranging from 19 –

52%) of C-2 demonstrated that transformed lines were significantly higher to the

control plants (14%).


0 mM 50 mM 100 mM 200 mM

P-0 NTC 67 ± 1.5 b 35 ± 0.91 c 26 ± 0.91 c 17 ± 0.63 d

P-2

C-1

70 ± 1.9 a 66 ± 0.82 a 52 ± 0.85 a 42 ± 1.1 a

P-4 72 ± 1.5 a 62 ± 1.2 a 54 ± 0.25 a 30 ± 0.99 b

P-6 73 ± 1.4 a 55 ± 1.1 b 40 ± 0.36 b 21 ± 0.46 c

P-0 NTC 70 ± 1.3 b 33 ± 0.51 c 25 ± 0.22 c 16 ± 0.21 c

P-9

C-1

75 ± 1.2 a 58 ± 0.92 a 41 ± 1.1 ab 24 ± 0.82 ab

P-11 72 ± 0.9 ab 50 ± 1.3 b 33 ± 0.57 b 22 ± 0.22 b

P-12 71 ±1.3 ab 59 ± 0.92 a 46 ± 1.3 a 29 ± 0.95 a

P-14 70 ± 1.5 b 42 ± 1.31 b 34 ± 0.37 b 24 ± 0.43 ab

P-16 66 ± 1.6 b 49 ± 1.51 b 44 ± 0.69 a 22 ± 0.62 b

P-19 78 ± 1.3 a 57 ± 1.4 a 35 ± 0.65 b 25 ± 0.85 ab

P-20 72 ± 1.2 ab 58 ± 1.1 a 39 ± 0.34 b 23 ± 0.31 b

P-0 NTC 69 ± 1.1 b 38 ± 0.71 c 27 ± 0.32 d 19 ± 0.18 d

P-22

C-2

72 ± 0.9 ab 62 ± 0.65 a 52 ± 0.22 a 43 ± 0.64 a

P-23 73 ± 0.8 ab 63 ± 0.45 a 52 ± 1.3 a 41 ± 0.42 a

P-24 74 ± 0.7 ab 54 ± 0.81 b 40 ± 0.45 b 31 ± 0.82 b

P-26 75 ± 1.2 a 58 ± 0.98 ab 42 ± 0.65 b 25 ± 0.32 c

P-29 70 ± 1.1 b 52 ± 0.99 b 34 ± 0.23 c 20 ± 0.22 d

P-31 77 ± 0.8 a 59 ± 1.1 ab 47 ± 0.34 c 37 ± 0.63 ab

P-0 NTC 71 ± 0.7 b 36 ± 0.32d 25 ± 0.23 d 17 ± 0.25 c

P-33

C-2

76 ± 1.1 a 44 ± 0.65 c 36 ± 0.35 b 26 ± 0.37 a

P-37 73 ± 0.9 a 51 ± 1.2 b 37 ± 0.36 b 20 ± 0.22 b

P-42 72 ± 0.8 ab 59 ± 0.98 a 42 ± 1.1 a 20 ± 0.21 b

P-45 70 ± 0.7 b 59 ± 0.88a 39 ± 0.36 ab 18 ± 0.10 bc


71

Table 3.18 Mean comparison for relative water contents (%) of transgenic (T0)

vs control potato at different levels of PEG




0 % 10 % 15 % 20 %

P-0 NTC 75 ± 2.4 a 32 ± 2.1 c 22 ± 1.5 c 7 ± 0.8 c

P-2

C-1

74 ± 2.1 ab 67 ± 1.6 a 54 ± 1.7 a 43 ± 1.1 a

P-4 77 ± 2.0 a 62 ± 1.9 ab 55 ± 1.4 a 39 ± 0.7 ab

P-6 70 ± 1.9 b 56 ± 2.0 b 41 ± 1.3 b 32 ± 1.1 b

P-0 NTC 72 ± 1.8 ab 31 ± 1.6 d 20 ± 2.1 d 6.8 ± 0.2 d

P-9

C-1

71 ± 2.5 b 58 ± 1.4 a 43 ± 2.2 a 24 ± 0.36 b

P-11 73 ± 2.0 ab 52 ± 1.6 b 34 ± 2.0 c 20 ± 0.5 bc

P-12 77 ± 1.8 a 60 ± 2.3 a 46 ± 1.6 a 53 ± 1.2 a

P-14 71 ± 1.7 b 43 ± 2.2 c 36 ± 1.5 b 25 ± 1.0 b

P-16 72 ± 1.6 ab 50 ± 1.9 b 37 ± 1.4 b 19 ± 0.9 bc

P-19 71 ± 1.4 b 58 ± 1.7 a 37 ± 1.3 b 22 ± 0.8 b

P-20 69 ± 2.3 b 60 ± 1.6 a 40 ± 1.2 ab 18 ± 0.6 c

P-0 NTC 66 ± 2.2 b 39 ± 2.0 c 29 ± 1.6 d 14 ± 0.3 d

P-22

C-2

68 ± 2.1 ab 64 ± 2.1 a 50 ± 1.7 a 42 ± 0.2 b

P-23 72 ± 1.9 a 61 ± 2.6 a 51 ± 1.5 a 42 ± 0.1 b

P-24 71 ± 1.7 a 54 ± 2.0 b 41 ± 1.3 b 33 ± 1.1 c

P-26 73 ± 1.6 a 57 ± 2.4 ab 42 ± 2.1 b 25 ± 0.4 d

P-29 74 ± 1.5 a 53 ± 2.2 b 34 ± 1.6 c 19 ± 0.3 e

P-31 71 ± 1.4 a 58 ± 1.6 ab 46 ± 1.2 b 52 ± 0.2 a

P-0 NTC 76 ± 2.3 a 37 ± 1.4 c 27 ± 1.6 b 13 ± 0.1 c

P-33

C-2

72 ± 2.2 a 42 ± 1.3 bc 35 ± 1.7 a 24 ± 0.3 a

P-37 73 ± 2.4 a 48 ± 1.2 b 35 ± 1.5 a 19 ± 0.2 b

P-42 66 ± 1.3 a 57 ± 1.1 a 36 ± 1.6 a 18 ± 0.4 b

P-45 69 ± 1.2 a 57 ± 1.5 a 37 ± 1.4 a 16 ± 0.5 bc


72

Figure 3.8 In vitro screening of transgenic plants (T0). A) In vitro screening of

transgenic plants comparison to control, B) comparison of transformed shoots and

roots with non-transformed at 50 mM NaCl, C) comparison at 100 mM, D)

comparison at 200 mM.


73

3.3.7 Pot Study for Salt Stress

Potato plants of randomly selected transgenic plants of C-1 & C-2 were exposed to salt

stress. Transgenic potato plants were grown in pots having soil and showed

significantly greater biomass and plant height as compared to non-transformed control.

3.3.8 Physiological Analysis

Physiological parameters such as photosynthetic rate (Pn), stomatal conductance (C),

transpiration rate (E) and sub-stomatal conductance (Ci) are the substantial traits for the

screening of tolerant lines. In the present study, interaction among treatments, lines and

lines x treatments were also found significant which are briefly summarized below:

3.3.8.1 Photosynthetic Rate (Pn)

Salinity stress significantly influenced the photosynthetic rate (Pn) in all the tested

potato transgenic lines. Transgenic lines integrated with C-1 are non-significantly

different to the control plants when no stress was applied. Some genotypes transformed

with C-2 showed significant difference to the control plants as maximum net

photosynthetic rate was observed in P-24 (28.6 µmol m-2 sec-1) while P-22, P-23 and P-

33 was non-significantly different to the control plants in response to 0 mM (Table

3.19). At 200 Mm of NaCl, significantly higher Pn was found in all genotypes tested.

Maximum Pn (18.8 µmol m-2 sec-1) was observed in P-6 followed by 18.7, 18.6, 18.5,

18.4 and 18.1 µmol m-2 sec-1 in P-3, P-2, P-12, P-9 and P-16, respectively while

minimum Pn (15.6 µmol m-2 sec-1) was noted in respective non-transgenic line. At 300

mM stress, photosynthetic rate for C-1 transformed genotypes, was significantly higher

(15.9 µmol m-2 sec-1) in P-2 followed by P-16 (15.6), P-9 (15.4), P-12 (15.3), P-3 (15.2)

and P-6 (14.5 µmol m-2 sec-1) than non-transgenic control plants (12.7 µmol m-2 sec-1).

Similarly, a close variation (15.3 - 16.5 µmol m-2 sec-1) was observed for Pn in all tested

genotypes transformed with C-2 and it was significantly higher than control plants (12.0

µmol m-2 sec-1) at 300 mM.

3.3.8.2 Stomatal Conductance (C)

A marked adverse effect of salinity stress (0, 200 and 300 mM) was noted on stomatal

conductance. It was significantly better in transformed plants growing under different

levels of salinity than non-transformed plants. In the absence of salinity, significantly

higher stomatal conductance was observed in cultivar Kuroda transformed with C-1 as


74

compared to control while for cultivar Cardinal no significant difference was noted in

transgenic lines and control plants (Table 3.19). Genotypes transformed with C-2 did

not show any significant difference when no stress was applied. At 200 mM salt stress,

maximum (11.7 mmol m-2 sec-1) stomatal conductance was exhibited by transgenic line

P-12 closely followed by 11.0, 10.1, 10.0, 9.5 and 9.1 mmol m-2 sec-1 in P-2, P-9, P-16,

P-3 and P-6, respectively while in non-transgenic control it was 8.9 mmol m-2 sec-1.

Genotypes transformed with C-2 were also tested for stomatal conductance and a

significant trend was again obtained at 200 mM of NaCl. Maximum (11.6 mmol m-2

sec-1) was exhibited by P-22 which was significantly higher than control (9.2 mmol m-

2 sec-1) plants while minimum (8.36 mmol m-2 sec-1) was exhibited by P-26 (8.3 mmol

m-2 sec-1) significantly lower than non-transformed plants. Variable (5.0 – 8.1 mmol m-

2 sec-1) pattern for stomatal conductance (at 300 mM) was noted in potato lines

transformed with C-1 which was significantly higher than control plants (Table 3.19).


75

Table 3.19 Photosynthetic rate, Stomatal conductance, Transpiration rate and

Sub-stomatal conductance potential in HSR1 (C-1) transformed genotypes under

different concentrations of salinity

Cultivars

Salt

in

(mM)

Photosynthesis

rate (Pn) µmol

m-2 sec-1

Stomatal

conductance

(C) mmol m-2

sec-1

Transpiration

rate (E) mmol

m-2 sec-1

Sub-stomatal

conductance

(Ci) µmol mol-

1

Ctr

0

21.5 ± 1.3 ab 13.4 ± 1.1 b 11.3 ± 1.1 b 1025 ± 10.6 b

P-16 23.9 ± 1.4 a 15.0 ± 1.6 a 12.5 ± 1.0 a 998.6 ± 6.5 c

P-1 24.5 ± 1.5 a 14.8 ± 1.8 a 12.9 ± 0.89 a 1102.3 ± 4.6 ab

P-12 20.3 ± 1.6 b 14.9 ± 1.1 a 13.0 ± 0.92 a 1203.6 ± 5.6 a

Ctr

0

22.4 ± 1.7 b 14.0 ± 1.2 ab 12.0 ± 0.93 b 996.3 ± 4.6 c

P-2 25.1 ± 1.6 a 15.3 ± 1.6 a 14.5 ± 1.3 a 1056.9 ± 8.7 b

P-3 23.6 ± 1.9 ab 15.2 ± 1.7 a 14.6 ± 1.1 a 1120.3 ± 5.6 ab

P-6 24 ± 1.4 a 13.0 ± 1.1 b 13.9 ± 1.0 ab 1233.6 ± 6.7 a

Ctr

200

15.6 ± 1.7 b 8.9 ± 0.9 b 7.8 ± 0.69 b 653.6 ± 4.5 c

P-16 18.1 ± 1.6 a 10.0 ± 0.88 ab 9.1 ± 0.63 a 829.0 ± 7.6 b

P-9 18.4 ± 1.6 a 10.1 ± 1.1ab 8.2 ± 0.37 ab 904.3 ± 8.9 a

P-12 18.5 ± 1.7 a 11.7 ± 1.0 a 8.7 ± 0.63 a 815.0 ± 9.1 b

Ctr

200

15.2 ± 1.6 b 8.6 ± 0.75 c 7.4 ± 0.84 c 645.2 ± 4.6 b

P-2 18.6 ± 1.9 a 11.0 ± 0.89 a 8.4 ± 0.45 ab 825.3 ± 5.6 a

P-3 18.7 ± 1.5 a 9.5 ± 0.72 b 8.0 ± 0.33 b 800.0 ± 7.1 a

P-6 18.8 ± 1.6 a 9.1 ± 0.65 b 9.5 ± 0.51 a 820.0 ± 6.5 a

Ctr

300

12.7 ± 1.2 b 5.5 ± 0.42 b 6.1 ± 0.46 b 532.3 ± 4.2 c

P-16 15.6 ± 1.6 a 5.0 ± 0.43 b 7.3 ± 0.28 a 680.0 ± 6.3 b

P-9 15.4 ± 1.4 a 6.5 ± 0.41 a 7.0 ± 0.39 ab 720.3 ± 7.1 ab

P-12 15.3 ± 1.3 a 7.0 ± 0.32 a 7.5 ± 0.62 a 815.0 ± 6.1 a

Ctr

300

12.1 ± 1.4 b 5.3 ± 0.36 c 5.9 ± 0.55 c 522.3 ± 8.1 c

P-2 15.9 ± 1.9 a 8.1 ± 0.37 a 6.4 ± 0.46 bc 753.0 ± 5.6 b

P-3 15.2 ± 1.5 a 7.1 ± 0.25 b 6.9 ± 0.38 bc 776.0 ± 6.1 ab

P-6 14.5 ± 1.8 ab 7.7 ± 0.29 ab 7.9 ± 0.64 a 820.0 ± 7.1 a


shows standard error mean, Ctr: Non-transgenic control

3.3.8.3 Transpiration Rate (E)

Maximum transpiration rate was observed in P-12 (13.0 mmol m-2 sec-1) followed by

P-9 (12.9 mmol m-2 sec-1) and P-16 (12.5 mmol m-2 sec-1) while transgenic lines P-2

and P-3 of cultivar Cardinal integrated with C-1 showed significantly higher

transpiration rate than control (12.0 mmol m-2 sec-1) plants in the absence of salt stress.

Moreover, mostly genotypes transformed with C-2 showed non-significant difference


76

compared to control plants (Table 3.20). Under 200 mM stress, all genotypes harboring

C-1 showed variable range (8.0 – 9.5 mmol m-2 sec-1) of transpiration rate and it was

significantly higher than control plants (7.8 mmol m-2 sec-1). All genotypes of cultivars

Kuroda and Cardinal transformed with C-2 showed significantly higher transpiration

rate as compared to control plants (Table 3.20). Transgenic lines were also assessed at

300 mM and the results revealed that transpiration rate was significantly higher

(ranging from 6.4 – 7.9 mmol m-2 sec-1) in transgenic plants (transformed with C-1)

than 6.1 and 5.9 mmol m-2 sec-1 in non-transformed plants (Table 3.19). Genotypes

transformed with C-2 were also analyzed at same level of salinity stress. Maximum (9.2

mmol m-2 sec-1) transpiration rate was exhibited by P-22 closely followed by 8.9, 8.4,

8.1, 8.0 and 7.0 mmol m-2 sec-1 in P-23, P-24, P-26, P-31 and P-29, respectively which

was significantly higher than non-transformed (6.4 and 6.8 mmol m-2 sec-1) plants.

3.3.8.4 Sub-Stomatal Conductance (Ci)

The maximum sub-stomatal conductance (1233.6 µmol mol-1) was observed in

transgenic line P-6 of potato cultivar Cardinal integrated with C-1 followed by 1203.6

µmol mol-1 in P-12 of cultivar Kuroda with same construct at 0 mM while rest of the

transgenic lines were non-significantly different to the control plants (Table 3.19).

Furthermore, a diverse range (815 – 904 µmol mol-1) of sub-stomatal conductance was

observed in transgenic lines of C-1 at 200 mM and this was again significantly higher

than control (653.6 µmol mol-1) plants. Remarkably, higher sub-stomatal conductance

(ranging from 645.2 – 903.67 µmol mol-1) was noted in transgenic lines integrated with

C-2 than control (621.67 µmol mol-1) subjected to 200 mM.

Among transformed (C-1) genotypes in response to 300 mM salinity stress,

maximum (820 µmol mol-1) sub-stomatal conductance was exhibited by P-6 followed

by P-12 (815 µmol mol-1), P-3 (776 µmol mol-1), P-2 (753 µmol mol-1) while

intermediate values of sub-stomatal conductance showed by rest of transgenic plants

but significantly higher than non-transgenic (532.3 µmol mol-1). Potato lines

transformed with C-2 were also tested on same treatments and similar significant trend

was obtained. A range of 690.3 – 870 µmol mol-1 was obtained at 300 mM and

significantly maintained to the respective non-transformed (581.67 µmol mol-1) plants.

The results showed that genotypes transformed with C-1 (HSR1) and C-2 (AVP1)

performed better than non-transformed plants regarding sub-stomatal conductance.


77

Table 3.20: Photosynthetic rate, Stomatal conductance, Transpiration rate and

Sub-stomatal conductance potential in all AVP1 (C-2) transformed tested

genotypes under different concentrations of salt

Cultivars Salt

in

(mM)

Photosynthesi

s rate (Pn)

µmol m-2 sec-1

Stomatal

conductance

(C) mmol m-2

Sec-1

Transpiration

rate (E) mmol

m-2 Sec-1

Sub-stomatal

conductance

(Ci) µmol mol-

1

Ctr

0

23.9 ± 2.3 bc 12.8 ± 1.3 bc 12.3 ± 0.55 bc 1120.3 ± 5.1 bc

P-22 25.6 ± 2.4 ab 13.8 ± 1.6 b 14.0 ± 0.63 b 1203.5 ± 6.2 b

P-23 24.6 ± 2.6 b 12.9 ± 1.1 bc 13.9 ± 0.35 b 1200.0 ± 4.3 b

P-24 28.6 ± 1.8 a 14.5 ± 1.4 ab 11.9 ± 0.66 c 1156.6 ± 5.5 bc

P-26 27.0 ± 1.6 a 15.6 ± 1.6 a 15.6 ± 0.56 a 1025.6 ± 4.9 c

P-29 26.6 ±1.8 a 12.1 ± 1.8 c 15.0 ± 0.52 ab 1236.9 ± 3.9 ab

P-31 22.2 ± 2.3 c 13.0 ± 1.1 bc 16.2 ± 0.36 a 1302.2 ± 4.3 a

Ctr 21.4 ± 2.8 b 13.0 ± 1.6 b 12.6 ± 1.2 b 1096.2 ± 6.1 b

P-33 23.6 ± 1.6 ab 14.2 ± 1.8 a 13.9 ± 0.25 a 1203.9 ± 4.3 a

P-37 25.6 ± 1.8 a 14.9 ± 1.3 a 14.1 ± 1.1 a 1185.9 ± 3.5 a

Ctr

200

16.0 ± 1.6 c 9.2 ± 0.98 b 8.6 ± 0.92 c 621.6 ± 4.1 c

P-22 19.4 ± 2.0 b 11.6 ± 0.88 a 9.1 ± 0.55 b 867.6 ± 3.9 a

P-23 20.7 ± 1.9 a 10.0 ± 0.75 ab 10.4 ± 0.34 a 903.6 ± 4.2 a

P-24 19.7 ± 1.3 ab 9.5 ± 0.63 b 10.7 ± 0.91 a 841.6 ± 3.2 ab

P-26 16.3 ± 1.4 c 8.3 ± 0.36 c 10.5 ± 0.74 a 792.3 ± 4.6 b

P-29 20.2 ± 1.5 a 8.8 ± 0.45 bc 10.0 ± 0.61 ab 790.0 ± 5.1 b

P-31 20.1 ± 2.1 a 10.5 ± 0.65 ab 9.6 ± 0.36 b 807.3 ± 6.2 b

Ctr 15.3 ± 1.6 b 8.7 ± 0.39 c 8.1 ± 0.22 b 612.5 ± 7.1 c

P-33 21.0 ± 1.7 a 10.1 ± 0.95 a 10.3 ± 0.36 a 840.1 ± 6.1 a

P-37 16.9 ± 1.6 b 9.5 ± 0.88 b 8.9 ± 0.24 b 645.2 ± 4.2 b

Ctr

300

12.0 ± 1.3 c 7.3 ± 0.87 b 6.8 ± 0.23 c 581.6 ± 3.2 d

P-22 15.7 ± 1.4 ab 7.8 ± 0.36 ab 9.2 ± 0.27 a 692.3 ± 5.2 c

P-23 16.3 ± 1.6 a 8.0 ± 0.39 a 8.9 ± 0.36 a 740.0 ± 3.2 b

P-24 15.3 ± 1.9 b 8.4 ± 0.90 a 8.4 ± 0.38 ab 799.6 ± 1.2 a

P-26 15.3 ± 1.4 b 8.3 ± 0.64 a 8.1 ± 0.90 b 870.3 ± 2.2 a

P-29 16.5 ± 1.6 a 8.3 ± 0.56 a 7.0 ± 0.21 c 857.6 ± 3.1 a

P-31 16.4 ± 1.6 a 8.7 ± 0.55 a 8.0 ± 0.32 b 785.3 ± 7.1 ab

Ctr 11.6 ± 1.3 b 6.9 ± 0.45 c 6.4 ± 0.20 b 572.6 ± 5.1 c

P-33 15.2 ± 1.2 a 8.1 ± 0.32 a 7.1 ± 0.27 a 721.3 ± 3.1 a

P-37 11.2 ± 1.1 b 7.5 ± 0.34 b 7.0 ± 0.23 a 690.3 ± 4.3 b


shows standard error mean, Ctr: Non-transgenic control


78

Figure 3.9 Salinity stress assays. A) Transgenic (T0) and non-transgenic potato lines

under salinity stress, B) Transgenic and non-transgenic plants at initial stage in

response to salt stress, C) non-transgenic plants at final stage after salt stress, D)

Transgenic potato plants at final stage after salt stress, E) Picture shows the difference

of non-transformed and transformed potato leaves after exposure to salinity stress.


79

3.3.8.5 Membrane Stability Index (MSI %)

Membrane stability index (%) of transgenic plants of C-1 & C-2 along with the control

exposed to different level of salinity stress were evaluated (Sec 3.2.8.1). It was observed

that MSI in transgenic plants was significantly higher than the control plants. No

significant difference was observed in transgenic and control plants when no stress was

applied. Maximum MSI was exhibited by P-16 followed by P-9, P-12, P-4 and P-6 of

C-1 which was significantly higher to the control plants at both 200 and 300 mM (Fig

3.10A). Moreover, genotypes transformed with C-2 were also tested for the

determination of MSI. The results revealed that P-22, P-24 and P-23 showed maximum

MSI while P-29 and P-26 exhibited intermediate and the least MSI was observed in P-

31 (Fig. 3.10B). Overall, all genotypes tested for MSI showed significantly higher value

than that of the control plants.


80

Figure 3.10 Membrane stability index of potato transgenic lines (T0) and control

plant. A) Transgenic lines transformed with C-1 (HSR1) B) Transgenic lines of C-2

(AVP1)

3.3.8.6 Estimation of Na+ and K+ Accumulation

Leaf samples of transgenic lines integrated with C-1 were tested for accumulation of

Na+ and K+ ions following treatment at three different levels (0, 200 and 300 mM) of

NaCl. The results revealed that at 0 mM, maximum Na+ accumulation was observed in

P-2 followed by P-6 and P-12 which was significantly higher to the control plants.

Similarly, transgenic lines P-37 and P-23 integrated with C-2 has shown maximum

values of Na+ compared to control plants (Fig 3.11A). Furthermore, transgenic potato

lines P-2 and P-6 of cultivar Cardinal showed higher accumulation of Na+ followed by

P-16 in response to 200 mM salt stress whereas least accumulation was observed in

non-transformed control plants (Fig 3.11B). At 300 mM, P-9 of cultivar Kuroda

B

0

10

20

30

40

50

60

70

80

90

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Mem

bra

ne

sta

bil

ity

in

dex

%

Potato lines

0 mM200 mM300 mM

0

10

20

30

40

50

60

70

80

90

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Mem

bra

ne

sta

bil

ity

in

dex

%

Potato lines

0 mM

200 mM

300 mM

B

A


81

integrated with C-1 showed the highest value of Na+ accumulation and least was

observed in control plants. Moreover, the transgenic line P-24 integrated with C-2 have

shown the maximum accumulation of Na+ at 300 mM which was significantly higher

than the non-transformed plants.

Figure 3.11 Accumulation of Sodium (Na+) contents after 0, 200 and 300 mM

stress in the transgenic potato lines (T0). A) Transgenic lines of C-1 (HSR1) B)

Transgenic lines of C-2 (AVP1)

Similarly, data for K+ accumulation was also recorded for both construct. The

obtained results showed that at 0 mM, maximum K+ contents was observed in P-12

(13.2 mg g-1 fw) followed by P-2 (12), P-16 (11.2) and P-9 (10.5 mg g-1 fw) which was

significantly higher to the control plants (Fig 3.12A). Similar significant results were

observed in transgenic plants integrated with C-2 compared to respective control plants

when no stress was applied. At 200 mM, transgenic lines (C-1) P-12 and P-16 were rich

0

2

4

6

8

10

12

14

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6So

diu

m (

Na

+)

ion

s (m

g g

-1F

W)

Potato lines

0 mM

200 mM

300 mM

0

2

4

6

8

10

12

14

16

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42So

diu

m (

Na

+)

ion

s (m

g g

-1F

W)

Potato lines

0 mM

200 mM

300 mM

A

B


82

in K+ contents followed by P-9 and P-2 while least accumulation of K+ was observed

in non-transformed control plants. Abundant K+ was observed in transgenic lines

(integrated with C-2) P-33, P-42 and P-24 followed by P-23 and P-22. Moreover, least

accumulation of K+ was observed in non-transformed control plants. At 300 mM

salinity stress, transgenic lines integrated with both C-1 & C-2 showed significantly

higher K+ as compared to control plants.

Figure 3.12 Potassium (K+) contents after salt stress. A) Transgenic lines

transformed with C-1 (HSR1) B) Transgenic lines of C-2 (AVP1)

0

5

10

15

20

25

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6Po

tass

ium

(K

+)

ion

s (m

g g

-1 F

W)

Potato lines

0 mM

200 mM

300 mM

0

5

10

15

20

25

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Po

tass

ium

(K

+)

ion

s (m

g g

-1 F

W)

Potato lines

0 mM200 mM300 mM

B

A


83

3.3.8.7 Determination of Na+/K+ Ratio in Transgenic Plants

Ratio of Na+ and K+ contents were also recorded after salt stress in both transformed

(C-1 & C-2) and non-transformed plants. At 0 mM, transgenic plants for both constructs

showed significantly higher ratio than control plants. Maximum ratio was obtained in

P-6 closely followed by P-9, P-16, P-12, P-2 and P-4, respectively while this order was

significantly higher than control plants. Similar significant results was noticed in C-2

transformed genotypes compared to non-transformed plants at 200 and 300 mM,

respectively.

Figure 3.13 Na+/K+ of transgenic and control plants after salt stress. A)

Transgenic lines transformed with C-1 (HSR1) B) Transgenic lines of C-2 (AVP1)

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Na

+/K

+(m

g g

-1F

W)

Potato lines

0 mM200 mM300 mM

A

0

0.2

0.4

0.6

0.8

1

1.2

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Na

+/K

+(m

g g

-1F

W)

Potato lines

0 mM200 mM300 mM

B


84

3.3.8.8 Total Amino Acids Determination

Estimation of leaf samples after salt stress showed high accumulation of total amino

acids in transgenic plants than non-transformed control plants. Although higher

accumulation was observed in transgenic plants integrated with both genes but non-

significant results were noted when no stress was applied. Transgenic lines of C-1

showed maximum accumulation of total amino acids in P-4, P-16 followed by P-6 and

P-9 while of C-2 transformed lines showed significantly higher of total amino acids in

P-27, P-22 and P-42 followed by P-33 and P-24 while least was exhibited in control

plants in response to both 200 and 300 mM, respectively.

Figure 3.14 Total free amino acids contents after salt stress. A) Transgenic lines

transformed with C-1 (HSR1) B) Transgenic lines of C-2 (AVP1)

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6To

tal

am

ino

aci

ds

(mg

-1 g

f-w

t)

Potato lines

0 mM

200 mM

300 mM

A

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

To

tal

am

ino

acid

s (m

g-1

g f

-wt)

Potato lines

0 mM

200 mM

300 mM

B


85

3.3.8.9 Estimation of Total Soluble Sugars

Accumulation of total soluble sugars in transgenic lines was higher than non-

transformed control plants under 0, 200 and 300 mM of salt stress. Transgenic lines P-

12, P-11 and P-9 transformed with C-1 construct showed abundant accumulation of

total soluble sugars. Intermediate accumulation was shown by P-16 and P-2 while P-6

exhibited least sugar contents at both levels (200 and 300 mM) of stress (Fig 3.15A).

Similar significant results were observed in plants harboring C-2 tested for sugar

contents. Maximum accumulation was observed in P-23, P-22 and P-24 of cultivar

Kuroda followed by P-31 and P-29, respectively (Fig 3.15B). Moreover, there was no

significant correlation observed in transgenic and control plants at 0 mM.

Figure 3.15 Total soluble sugar contents after salt stress in transgenic and non-

transformed potato plants. A) Transgenic lines transformed with C-1 (HSR1) B)


0

1

2

3

4

5

6

7

8

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

To

tal

solu

ble

su

ga

rs (

mg

-1f.

wt)

Potato lines

0 mM

200 mM

300 mM

A

0

1

2

3

4

5

6

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42To

tal

solu

ble

su

ga

rs (

mg

-1f.

wt)

Potato lines

0 mM

200 mM

300 mM

B


86

3.3.8.10 Estimation of Proline Contents

Proline contents of stressed leaf samples were measured (Section 3.2.8.5). The results

indicated that transgenic lines having high proline contents showed more tolerance than

non-transformed plants. Maximum proline contents were observed in P-16 (556.32 µg

g-1 f.wt) of cultivar Kuroda integrated with C-1 and was significantly higher than

control (398.65 µg g-1 f.wt) in the absence of salt stress. On the other hand cultivar

Cardinal transformed harboring C-2 has shown significantly higher accumulation of

proline contents in transgenic lines P-37 (582.65), P-33 (501.65) and P-42 (501.63 µg

g-1 f.wt) followed by transgenic lines P-24 (467.5), P-23 (399.65) and P-22 (367.25) of

cultivar Kuroda at 0 mM (Fig 3.16 A & B).

At 200 mM, all genotypes of both cultivars Kuroda and Cardinal transformed

with C-1 & C-2 showed significantly higher proline contents with respect to control

plants (Fig 3.16 A & B). Maximum proline contents were observed in transgenic lines

(transformed with C-1) P-4, P-6 and P-2 of cultivar Cardinal followed by P-16, P-12

and P-9, respectively. Similar kind of significant results were obtained in transgenic

lines integrated with C-2. Higher proline contents were observed in transgenic lines P-

42, P-37 and P-33 followed by P-24 and P-22, respectively as compared to the control

plants. Remarkably, more proline accumulation was observed in stressed plants at 200

and 300 mM compared to the plants without stress.


87

Figure 3.16 Estimation of total proline contents after salt stress in transgenic and

non-transformed potato plants. A) Transgenic lines transformed with C-1 (HSR1),

B) Transgenic lines of C-2 (AVP1)

3.3.8.11 Analyses of Starch Contents

Significantly higher starch contents were observed in transgenic lines than non-

transformed control plants under 0, 200 and 300 mM of salt stress. Transgenic lines P-

4, P-12, P-2 and P-9 of C-1 showed significant accumulation of starch contents

subjected to no stress. However, all the transformed genotypes showed significantly

higher starch contents than control plants (Fig 3.17 A) at both levels (200 and 300 mM)

of stresses. No significant difference was observed between transgenic and control

plants apart from P-23 (91.25 mg g-1 fw) and P-24 (90.32 mg g-1 fw) having

significantly higher starch contents than control plants at 0 mM. Highest starch value

0

100

200

300

400

500

600

700

800

900

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Pro

lin

e co

nte

nts

(µ

g g

-1f.

wt)

Potato lines

0 mM

200 mM

300 mM

B

0

100

200

300

400

500

600

700

800

900

1000

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Pro

lin

e co

nte

nts

(µ

g g

-1f.

wt)

Potato lines

0 mM

200 mM

300 mM

A


88

was observed in P-23 followed by P-33, P-24, P-37 and P-42, respectively at 200 Mm

(Fig 3.17 B).

Figure 3.17 Estimation of starch contents after salt stress in transgenic and non-

transformed potato plants. A) Transgenic lines transformed with C-1 (HSR1) B)


3.3.9 Biochemical Analyses of Transgenic Plants

3.3.9.1 Determination of Superoxide Dismutase (SOD)

Accumulation of SOD was also significantly higher in transgenic potato lines than non-

transformed plants. A narrow (111.23 – 142.23 unit g-1 f-wt) range of SOD was noted

in transgenic lines containing C-1 and significantly higher than control plants (Fig 3.18

A) in response to no salt stress. Transgenic lines P-37 and P-23 integrated with C-2

have shown highly significant accumulation of SOD while rest of the lines exhibited

intermediate but significant to the control plants at 0 mM. Transgenic line P-9 of

cultivar Kuroda integrated with C-1 showed the best SOD accumulation 196.49, 230.21

0

20

40

60

80

100

120

140

160

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Sta

rch

co

nte

nts

(m

g g

-1fw

)

Potato lines

0 mM200 mM300 mM

A

0

20

40

60

80

100

120

140

160

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Sta

rch

co

nte

nts

(m

g g

-1fw

)

Potato lines

0 mM200 mM300 mM

B


89

unit g-1 f-wt at 200 and 300 mM, respectively followed by transgenic line P-16 of same

cultivar which showed 195.59 and 220.8 unit g-1 f-wt at 200 and 300 mM. Similar

significant trend of SOD accumulation was noted in both cultivars Cardinal and Kuroda

integrated with C-2 in response to 200 and 300 mM (Fig 3.18 B).

Figure 3.18 Estimation of SOD production in response to salt stress in transgenic

and non-transformed potato plants. A) Transgenic lines transformed with C-1

(HSR1, B) Transgenic lines of C-2 (AVP1).

0

50

100

150

200

250

300

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6Su

per

oxid

e d

ism

uta

se (

un

it/g

f-w

t)

Potato lines

0 mM

200 mM

300 mM

0

50

100

150

200

250

300

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Su

per

oxid

e d

ism

uta

se (

un

it/g

f-w

t)

Potato lines

0 mM200 mM300 mM

A

B


90

3.3.9.2 Determination of Peroxidase (POD)

Maximum POD (0.25 unit g-1 f-wt) was observed in transgenic line P-6 of Cardinal

and minimum (0.20 unit g-1 f-wt) was observed in P-12 of Kuroda when exposed to no

stress (Fig 3.19 A & B). At 200 mM, transgenic lines P-2 of C-1 and P-37, P-22

integrated with C-2 of Cardinal and Kuroda showed significantly better POD (0.61 and

0.53 unit g-1 f-wt, respectively) value as compared to the non-transgenic control. At 300

mM, maximum POD was observed in transgenic line P-4 of cultivar Cardinal integrated

with C-1 and least was observed in P-9 of cultivar Cardinal. Furthermore, transgenic

line P-24 of Kuroda harboring C-2 construct also maintained better POD as compared

to non-transgenic control at 300 mM (Fig 3.19 B).

Figure 3.19 Estimation of POD production in response to salt stress in transgenic

potato plants. A) Transgenic lines transformed with C-1 (HSR1), B) Transgenic lines

of C-2 (AVP1).

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Per

oxid

ase

(u

nit

g-1

f-w

t)

Potato lines

0 mM200 mM300 mM

A

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Per

oxid

ase

(u

nit

g-1

f-w

t)

Potato lines

0 mM

200 mM

300 mM

B


91

3.3.9.3 Estimation of APX in Transgenic Potato

The results showed that plants transformed with C-1 have higher accumulation of

enzyme than non-transformed control in response to all levels of stress. Maximum

accumulation of APX was observed in P-12 (3.92 unit g-1 f-wt) of cultivar Kuroda

harboring C-1 and least was noted in P-9 (2.3 unit g-1 f-wt) of same cultivar but

significantly higher to the control plants when no stress was applied. At 200 mM

salinity of NaCl, comparing the transgenic and control of Kuroda, maximum APX (5.34

unit g-1 f-wt) was noted in the P-12 of C-1 construct and minimum (2.58 unit g-1 f-wt)

in the control. At 300 mM salinity level, maximum APX value (6.2 unit g-1 f-wt) was

recorded in P-12 of C-1 and P-24 (6.3 unit g-1 f-wt) of C-2 and it was significantly

higher than the control.

Figure 3.20 Estimation of Ascorbic peroxidase (APX) production in response to

salt stress in transgenic and non-transformed potato plants. A) Transgenic lines

for HSR1, B) Transgenic lines for AVP1.

0

1

2

3

4

5

6

7

8

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Asc

orb

ic p

erox

idase

(u

nit

/g f

-wt)

Potato lines

0 mM200 mM300 mM

A

0

1

2

3

4

5

6

7

8

9

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Asc

orb

ic p

erox

idase

(u

nit

/g f

-wt)

Potato lines

0 mM

200 mM

300 mM

B


92

3.3.9.4 Estimation of Catalase

Catalase enzyme was estimated to confer the tolerance of transgenic potato lines than

non-transformed plants. Plants transformed with C-1 showed more tolerance as they

accumulate more catalase than control plants. Transgenic lines P-16, P-2 and P-6

showed significantly higher accumulation followed by P-9, P-12 and P-2 while

significantly lower accumulation was observed in non-transformed plants. Transgenic

lines P-24, P-31 and P-23 harboring C-2 were considered better than rest of the

transgenic lines as they demonstrated maximum accumulation of enzyme than non-

transformed plants.

Figure 3.21 Estimation of Catalase accumulation in response to salt stress in

transgenic and non-transformed potato plants. A) Transgenic lines for HSR1, B)

Transgenic lines for AVP1.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Ctr P-16 P-9 P-12 Ctr P-2 P-4 P-6

Ca

tala

se (

un

it g

-1 f-w

t)

Potato lines

0 mM200 mM300 mM

0

0.2

0.4

0.6

0.8

1

1.2

Ctr P-22 P-23 P-24 Ctr P-33 P-37 P-42

Ca

tala

se (

un

it g

-1 f-w

t)

Potato lines

0 mM

200 mM

300 mM

B

A


93

3.3.10 Screening of Water Stressed Transgenic Potato Lines under

Tunnel

All important agronomic quantitative parameters i.e. number of tubers, tuber weight

and plant biomass were noted during the course of study. Interaction among water stress

treatments x potato lines was statistically significant for all observed agronomic

parameters at P<0.05. Visually it was observed that transgenic lines showed better

growth when compared with non-transgenic line. Figure 3.22 and 3.23 show the

phenotype of transgenic versus respective non-transgenic tubers at different irrigations

levels. Both stress irrigation levels (75 % and 50 %) showed significant effect on all

examined parameters. The effect was more on non-transgenic control as compared to

transgenic lines of both cultivars having targeted genes.

3.3.10.1 Number of Tubers Plant-1

Data results of the table 3.21 showed that that there was significant difference in the

number of tubers of transgenic lines at different irrigation levels. At 100% irrigation

level, in the transgenic line P-6 and P-22, maximum tubers (13.3 & 12.3) per plant were

counted in C-1 and C-2 respectively. These were non significant with other transgenic

plants. At 75% irrigation level also P-6 and P22 have shown maximum tubers (11.0) as

compared to control plants for both the construct, respectively. At 50% irrigation level,

P-12 integrated with C-1 showed significantly higher tubers (9.0) than control (6.3)

plant. Similar trend was observed in P-22 and P-33 transformed with C-2 under same

stress level (3.21).


94

Table 3.21 Mean comparison for tubers plant -1 of potato among transgenic and

non transgenic grown at different irrigations

Line # Genes Irrigation

100% 75% 50%

P-0

P-2

P-4

P-6

P-12

NTC

C-1

9.6 ± 0.33 b 7.3 ± 0.33 b 6.3 ± 0.33 c

11.3 ± 0.88 ab 10.3 ± 0.33 a 8.0 ± 0.57 ab

12.0 ± 1.15 ab 10.3 ± 0.88 a 6.6 ± 0.33 bc

13.3 ± 0.88 a 11.0 ± 0.57 a 8.0 ± 0.57 ab

11.3 ± 1.45 ab 9.6 ± 0.66 a 9.0 ± 0.57 a

P-0

P-22

P-23

P-24

P-33

NTC

C-2

9.0 ± 0.69 b 6.6 ± 0.33 c 6.3 ± 0.33 b

12.3 ± 0.72 a 11.0 ± 0.33 a 8.6 ± 0.88 a

11.0 ± 1.01 ab 9.6 ± 0.33 b 7.6 ± 0.33 ab

11.6 ± 0.56 ab 9.3 ± 0.57 b 7.3 ± 0.33 ab

11.6 ± 2.3 ab 10.3 ± 0.33 ab 8.6 ± 0.88 a



3.3.10.2 Tubers Weight (g) Plant-1

The data table 3.22 shows the tuber weight (g) of transgenic lines and control. The

transgenic line P-2 integrated with C-1 gene showed the best tuber weight 330 and

285.6 g at 75 and 50% irrigation, respectively followed by transgenic line P-23 of C-2

gene having tuber weight 318 and 261.6 g at 75 and 50 % irrigation, respectively.

However, tuber weight (243.3 and 203 g) was significantly reduced in non-transgenic

control at 75 and 50 % irrigations, respectively (Table 3.22).


95

Table 3.22 Mean comparison for tubers weight plant -1 of potato among

transgenic and non transgenic grown at different irrigations


100% 75% 50%

P-0

P-2

P-4

P-6

P-12

NTC

C-1

316.3 ± 2.9 c 245.6 ± 2.6 d 219.3 ± 3.1 d

363.0 ± 2.3 a 330.0 ± 2.1 a 285.6 ± 2.8 a

362.3 ± 1.4 a 307.6 ± 1.4 b 257.6 ± 0.8 c

349.3 ± 1.4 b 296.0 ± 1.7 c 265.0 ± 2.3 b

354.3 ± 1.7 ab 301.3 ± 2.0 bc 268.6 ± 1.4 b

P-0

P-22

P-23

P-24

P-33

NTC

C-2

302.6 ± 1.9 c 243.3 ± 2.0 d 210.3 ± 1.5 c

352.3 ± 1.6 ab 286.3 ± 3.0 c 237.3 ± 1.15 b

388.3 ± 2.1 a 318.0 ± 1.4 a 261.6 ± 1.52 a

357.0 ± 2.2 ab 303.3 ± 2.7 b 241.0 ± 1.45 b

350.3 ± 1.6 b 290.6 ± 0.88 c 257.3 ± 2.0 a


shows the standard error mean. NTC: Non transgenic control, C-1: (HSR1), C-2: (AVP1)

3.3.10.3 Plant Biomass (g) Plant-1

The maximum biomass (145.3 g) was observed in transgenic line P-6 integrated with C-1

gene followed by 140.3 g in transgenic line P-4 with same gene (C-1) at 75% irrigations.

On the other hand, transgenic line P-22 with C-2 also showed significantly better biomass

(139 g) compared to biomass weight (117.3 g) of non-transgenic line at 75% irrigation level

(Table 3.23). Non-transgenic line showed significantly reduced biomass (122.3 g) at 75%

irrigation. At 50% irrigation, all the transgenic lines having HSR1 (C-1) gene showed the

significantly better plant biomass, as compared to biomass (97.0 g) of non-transgenic

control.


96

Table 3.23 Mean comparison for biomass plant -1 of potato among transgenic and

non transgenic grown at different irrigations


100% 75% 50%

P-0

P-2

P-4

P-6

P-12

NTC

C-1

149.0 ± 2.5 b 122.3 ± 1.4 c 97.0 ± 2.6 b

161.6 ± 1.1 a 138.3 ± 1.7 b 112.6 ± 1.4 a

168.0 ± 1.1 a 140.3 ± 0.8 ab 112.6 ± 2.3 a

166.6 ± 1.7 a 145.3 ± 2.9 a 106.6 ± 2.4 a

160.6 ± 1.2 a 137.6 ± 1.4 b 109.0 ± 1.5 a

P-0

P-22

P-23

P-24

P-33

NTC

C-2

147.0 ± 1.6 b 117.3 ± 0.88 c 74.3 ± 2.33 b

160.0 ± 1.6 a 139.0 ± 1.76 a 92.0 ± 1.15 a

161.0 ± 1.1 a 131.6 ± 0.57 b 91.0 ± 1.76 a

163.6 ± 0.9 a 137.0 ± 3.2 ab 91.0 ± 1.20 a

157.6 ± 1.7 a 132.6 ± 0.88 b 87.6 ± 2.84 a




97

Figure 3.22 A) Field experiment of transgenic (HSR1) potato plants under water

stress. B) Transgenic and non-transformed potato plants grown at 100% irrigation C)

Transgenic and non-transformed potato plants grown at 75% irrigation, D) Transgenic

and non-transformed potato plants grown at 50% irrigation

Figure 3.23 A) Transgenic and non-transformed potato plants grown at 100%

irrigation. B) Transgenic and non-transformed potato plants grown at 75% irrigation,

C) Transgenic and non-transformed potato plants grown at 50% irrigation


98

3.4 Discussion

Agrobacterium-mediated transformation of potato using leaves and potato tuber discs

have been the most common approaches for the development of transgenic plants

resistance, to herbicides insect and diseases [174, 175]. However, all these procedures

have limitations, such as low frequency of transformation, and more importantly, the

high rate of somaclonal variation occurrence (due to changes in ploidy level) mainly

due to harsh and lengthy tissue culture [176, 177]. An improved and efficient method

of genetic transformation of two commercially important potato cultivars Kuroda and

Cardinal, using longitudinally cut internodal explants have been established. These

cultivars were used due to its efficient in vitro regeneration. The culture media was

supplemented with ZR, MSV1 and JHMS (Table 2.1) as a cytokinin which decreases

the duration of culture on callus inducing medium and recruit a large number of buds

rapidly before the induction of somaclonal variation [178]. Almost 30% transformation

efficiency was obtained in both the cultivars by using internodal segments. Moreover,

the efficiency of this protocol is likely to be independent of the variety used as nearly

similar rate of regeneration of transgenic plants has been observed in both varieties.

Newell et al. [179] generated Russet Burbank plants expressing the CP gene in a

transformation system with low efficiency. Compared to our results of 2-4 regenerated

shoots per explant, on average 0.1-0.3 shoots per explant were reported by Bukovinszki

et al. [180].

Furthermore, Arabidopsis vacuolar H+-pyrophosphatase (AVP1) and synthetic

HSR1, a transcription factor, genes were used to develop salt tolerance potato plants.

Total of 57 putative transgenic plants were generated from 3 independent batches

(Table 3.2). These putative transgenic potato plants were further subjected to PCR

analysis. Of the 57 transgenic plants, 11 were positive for HSR1 and 13 plants showed

the integration of AVP1. Figure 3.5 & 3.6 indicated the amplified products of synthetic

HSR1 and AVP1 in the transgenic lines. Transgene analysis through PCR is a routine

practice and performed previously by number of scientists [181, 182]. Results of

Southern analysis in the present study showed the varied copy number (1-4) in the

genome of different potato lines. No hybridized band was present in respective non-

transgenic control plants (Fig. 3.7A & B). The Southern analysis of the selected

transgenic lines demonstrated that all the lines have low copies of transgene inserted.

Zhao et al. [183] reported number of integration sites ranged 1 to 7 of LEA gene in


99

transgenic plants. Our results correlates with the findings of Hashmi et al. [184] and

Wu et al. [185] who showed the integration of 1-5 or multiple copies of transgenes in

the plant genome.

Casu et al. [186] reported the association of the transgenic resistance with high

transgene copy number and low steady state expression level of the transgene, while

susceptibility correlates with the low copy number and high steady state transcription

level. In our experiments, tolerance to abiotic stress did not correlate directly with the

copy numbers as the tolerant lines had different copy number, whereas some lines had

the same copy number but different tolerant phenotypes. These results are in agreement

with the other results which showed that in most of the cases the frequency of tolerance

showed by a particular transgenic line is independent of the number of transgene copy

inserted in that particular line and a single copy is sufficient to confer resistance [187].

Rovere et al. [188] also have reported the similar findings. Therefore, no conclusion

can be made as to whether the presence of more than one copy of the transgene would

increase or decrease the occurrence of resistance.

Being one of the most important abiotic stresses, salinity creates a severe

agricultural problem and prevails in many parts of the world. Approximately 800 M Ha

of land has been reported as salt-affected either by salinity alone (397 M Ha) or by the

concomitant condition of sodicity (434 M Ha) [223]. The decline in growth and crop

yield are the primary results of high salinity stress while additionally, interruption in

plant metabolism comprising of water potential reduction, ionic toxicity, closure of

stomata and reduction in CO2 absorption [224] are also reported consequences of

salinity problem. Several productive approaches have been made in order to escape the

adverse effects of stress including plant cell’s adaptation to adverse salinity comprising

of osmotic regulation and compartmentation of toxic ions but scientific evidence

supports the concept that salinity also prompts oxidative stress resulting in structural

injury to both membranes and photosynthetic apparatus.

Variable chemical and physical composition of soil and seasonal fluctuation

sometimes offer a problem to screen a large number of transformed genotypes for

drought and salinity tolerance in the field [225, 226]. Rahman et al. [151] reported that

for the evaluation of potato transgenic lines, in vitro screening of genotypes based on

PEG and salt stress has replaced expensive, labor-intensive and challenging field-based


100

screening approaches because in parallel studies, the results of drought and salinity

stress on in vitro potato growth are in accordance to that observed under field conditions

[227, 228]. Fewer reports are available about the effects of PEG and NaCl on in vitro

potato growth affecting different agronomic parameters. Although, NaCl (200 mM)

negatively affects the shoot length of potato genotypes as compared to other

concentration (0, 50 and 100 mM) but in present study transgenic lines P-9, P-22, P-23,

P-11 and P-12 integrated with synthetic HSR1 showed significantly higher shoot length

compared to the control plants (Sec 3.2.6.1 & Table 3.3).

The findings of the present study were consistent with the report of Deblonde

and Ledent [229] that drought and salinity is known to adversely affect shoot length,

root length and other agronomic parameters. Our findings are in agreement with the

results reported by Gopal and Iwama [228] that shoot length reduced with respect to

increasing level of stress inducing agents but significantly higher than the control

plants. Most of the transgenic potato lines transformed with synthetic HSR1 and AVP1

have shown high level of tolerance against different levels of NaCl and PEG stress (Fig

3.8). Being a susceptible crop, 100 mM of salinity leads to reduction in plant growth of

about 50% while complete inhibition of potato growth is the result of 200 mM of NaCl.

Mungala et al. [230] concluded that abiotic stress affects rooting system, produce

necrosis and ultimately leads to cell death which is in contrast to our results which could

be associated with the transformation of synthetic HSR1 and AVP1 in order to elevate

the tolerance potential in potato genotypes against abiotic stress. Transgenic lines P-22,

P-23, P-24, P-11, P-12, and P-16 transformed with synthetic HSR1 maintained

significantly higher leaf area index than respective control plants in response to

different levels of salt and PEG (Table 3.8). These results are supported by a parallel

study reported by Bernal et al. [48] who revealed that reduction in leaf size and tuber

yield is considered due to the devastating effects of salt and drought. In the present

study, salinity and PEG induced stress had no negative effect on leaf area index in

studied genotypes transformed with both synthetic HSR1 and AVP1 which indicating

that transgenic lines of potato have potential to tolerate abiotic stress. Similar results

were reported by Mungala et al. [230] in Amaranthus tricolor and by Parvaiz and

Satyawati [231] in halophyte Plantago coronopus. In the present study, transgenic

potato lines exhibited higher chlorophyll contents (leaf greenness), exhibition of a

healthy rooting system and foliar development under salt stress compared to non-


101

transgenic control (Fig. 3.8). Development of several metabolites and its accumulation

in different parts of the plant could be the reason for this appearance which could be

attributed to the over-expression of synthetic HSR1 and AVP1 (Fig. 3.18 - 3.21). On the

basis of above, it is hypothesize that integration of HSR1 and AVP1 enhanced important

agronomic parameters in transgenic plants of potato which suggest that transcription

factors and proton pumps may be involved in the improvement of plant growth by

increasing its metabolic activities (SOD, APX, POD and CAT) as previously reported

for other transgenic plants expressing DREB genes. Koyro [232] explained that canopy

expansion, shoot length, root length, leaf area index, chlorophyll fluorescence, and leaf

relative water contents are considered as promising parameters which are directly

associated with the drought and salinity stress, especially for in vitro screening of potato

transgenic lines. Frusciante et al. [233] reported in vitro screening of potato genotypes

on the basis of shoot length, root length, leaf area and fresh and dry shoot weight for

salinity tolerance and concluded that in vitro screening of potato genotypes was as

efficient as field-based screening. In order to recognize the proper parental lines, in

vitro screening is supposed to be the suitable approach for potato breeding programs.

In the present study, although a decline in net photosynthetic rate, transpiration

rate and stomatal conductance was observed under salt stress in all tested potato

transgenic lines but these were significantly higher than control plants (Table 3.19 &

3.20). This reduction in photosynthetic rate could be due to the reduced leaf area or leaf

senescence which leads to the inhibition in light intervention and carbon fixation per

unit leaf area. Additionally, stomatal closure or photo-oxidation, which is responsible

for the injuries of photosynthetic machinery can also be the reason [234]. However,

AVP1 over-expressing transgenic potato lines P-23, P-26 and P-31 sustained higher

photosynthetic rate, stomatal conductance and transpiration rate under 0, 200 and 300

mM of salt stress than respective non-transgenic line (Table 3.20). The findings of our

results are in accordance with the function of AVP1 as it is responsible for

compartmentation of Na+ into the vacuole and production of compatible solutes, which

protect photosynthetic apparatus from Na+ toxicity and dehydration during salt and

drought stress [235]. They also revealed that photosynthetic capability was significantly

higher in transgenic alfalfa over-expressing AVP1 than in wild type under salt and

drought stress. Zhao et al. [95] showed higher photosynthetic rate in transgenic rice that

could be associated with the minimum production of H2O2 after over-expression of the


102

Suaeda salsa Na+/H+ antiporter (SsNHX1) and AVP1. Varietal/genotypic differences in

stomatal conductance, transpiration and rate of photosynthesis in different crop species

have been reported by Bao et al. [236]. Manavalan et al. [237] reported that genotypes

susceptible to salt stress can be evaluated on the basis of stomatal conductance,

transpiration and photosynthesis rates. Higher photosynthetic rate can directly

contributed to the better growth and tuber yield.

Transpiration, is a function of plant in which substantial amount of water

evaporate in order to regulate the photosynthetic rate, stomatal conductance, CO2 in

flow and regulation of water potential in leaf cells. Ashraf and Harris [238] reported

that plants with higher stomatal conductance normally sustained a higher turgor

pressure and a lower osmotic potential which suggests a progressive association exists

among photosynthesis, stomatal conductance and transpiration rate. Similar kind of

relationship was found in the present study which indicated that transgenic potato lines

integrated with AVP1 and these specific qualities provide a base of physiological

markers for salt tolerance in potato. Iqbal and Ashraf [239] reported that over-

expression of PaSOD in transgenic potato enhances photosynthetic performance under

abiotic stress.

Vinocur and Altman [110] concluded that stress problems can be controlled by

means of transcriptional activation or repression of genes through an array of

transcription factors (TF). Thus, transcription factors appear to be potential genes for

stress tolerance engineering of potato varieties. In our study potato genotypes

transformed with HSR1, a transcription factor, showed a high degree of tolerance than

control plants. Maximum photosynthetic rate, stomatal conductance and transpiration

rate was observed in P-9, P-12 and P-2 than control. It is quite possible that HSR1

stimulates the expression of several target genes that are responsible for monitoring

associated characters such as osmoprotection and other metabolic activities. Our results

are in line with Pal et al. [240] who observed that over-expression of StDREB2 a

transcription factor in transgenic potato plants resulted in enhanced tolerance to salt

stress. Study conducted by Bouaziz et al. [241] supported our findings that leaf water

content, decline in stomatal conductance and transpiration rate ultimately limits

photosynthesis and leaf growth in response to salinity. However, increased salt

tolerance potential has been observed in potato genotypes expressing DREB1A gene. In

the same context, Fidalgo et al. [242] disclosed another stress inducible transcription


103

factor GmDREB1 responsible for salt tolerance in transgenic alfalfa. Over-expression

of chloroplast Cu/Zn SOD appeared to be responsible for significant improvement in

the photosynthetic rate under chilling stress in transgenic tobacco and potato plants.

Proline behaves as an arbitrator for the sake of osmotic balance and avoid

compatible solutes such as proteins and cell membranes from adverse effects of abiotic

stress [243]. Being frequently associated with tolerance capability, its accumulation in

response to stress is considered as biochemical marker for selecting salt tolerant potato

lines [244]. Hasanuzzaman et al. [245] observed higher tuber yield of transgenic potato

lines which exhibited more proline accumulation as compared to non-transgenic plants

when exposed to salinity stress suggesting that proline can act as an osmoprotectant. In

the present study potato transgenic lines P-2, P-4, P-6 harboring synthetic HSR1 showed

higher proline accumulation compared to non-transgenic plants under salt stress of 200

and 300 mM (Fig. 3.16A). Similar genotypic response to salinity stress regarding

proline accumulation has been reported by Pal et al. [240] who revealed that potato

genotypes transformed with StDREB2, can improve tolerance in transgenic potato lines

after exposure to salt stress conditions. Our study is also in agreement with Hmida-

Sayari et al. [246] who reported higher proline accumulation in potato genotypes under

salt stress.

The findings of present study showed that transgenic potato lines transformed

with AVP1 gene have capability to maintain higher proline accumulation in leaves

under stress conditions. Among these, P-26, P-29 and P-31 showed distinguished

response (Fig. 3.12B) with respect to non-transformed plants which is in line with the

study reported by Hassan et al. [247] that significantly higher proline accumulation was

observed in the leaves of transgenic plants with increasing level of salinity. Patel and

Pandey [248] reported 10 times more proline accumulation in transgenic tobacco plants

overexpressing the mothbean P5CS. Similarly, over-production of proline was

observed in rice plant transformed with the same gene resulting in increased foliar size

under abiotic stress [249]. Transgenic Arabidopsis plants over-expressing CBF3, a

transcription factor showed higher proline contents than non-transgenic plants [250].

Gilmour et al. [251] reported that transgenic wheat plants exhibited maximum proline

contents and enhanced tolerance to salt stress. Tobacco cells transformed with NtHAL3

gene showed improved proline synthesis and increased salt and lithium tolerance [252].

This substantial production of proline in potato via genetic engineering offers an


104

opportunity for the improvement of breeding programs in order to develop drought and

salt tolerance [253].

Transgenic plants integrated with synthetic HSR1 showed significantly higher

accumulation of starch contents compared to control plants (Section 3.3.8.11 & Fig

3.17A) which is supported by the study of Ahmad et al. [254] and Veramendi et al.

[255] who reported the increased trend of starch contents in transgenic plants under salt

stress. The maintenance of a high cytosolic K+/Na+ ratio and regulation of ion

homeostasis is considered important for salt tolerance [256]. In the present study, a

trend of increased Na+ content was observed in all plants along with increasing

concentration of NaCl, which is supposed to be the normal phenomenon that happens

in all plants. Potato genotypes (P-9, P-16 and P-2) transformed with HSR1 maintained

higher Na+ intake than respective control plants. Similar kind of trend was found in P-

24, P-23 and P-22 harboring AVP1 which is supported by Bassil et al. [256] who

reported the increased concentration of Na+ in the shoot and lamina with soaring

concentration of salts. The maximum accumulation of Na+ ion in transgenic plants

might be the strong reason for the osmotic adjustment in synthetic HSR1 and AVP1

transformed potato plants. However, instead of Na+ ion, K+ is supposed to originally act

as an essential co-factor for many other enzymes to the avoidance of different

environmental stresses. In the present study, abundant accumulation of K+ was found

in genotypes P-9, P-2 and P-12 transformed with synthetic HSR1 and this was in

agreement with the study reported by Qadar [257] that transgenic melon and tomato

plants over-expressing HAL1 exhibited a potential of salt tolerance due to retaining

more K+ than the non-transformed plants. These findings are in accordance with the

results reported by Chen et al. [115] who showed that maize plants over-expressing

OsNHX1 gene from rice and over-expressed in maize exhibited higher tendency of Na+

and K+ in transgenic leaves than control plants in response to 100 – 200 mM NaCl.

Moreover, some contradictory reports are also present in which decline in K+ content

in different species of potato was observed. Higher external Na+ concentration is

perhaps the motivation for the reduction in K+ accumulation in response to NaCl [135].

Gisbert et al [258] discovered a competition between Na+ and K+ uptake via

Na+- K+ co-transporters in which Na+ may block the K+ regulatory transporters of root

cells under salinity stress. This threat could be the reason for toxic levels of Na+ as well

as insufficient K+ uptake for enzymatic reactions and osmotic adjustment. It is needed


105

to sustain higher K+ accumulation up to 100 to 200 mM as it plays a vital role in

maintaining turgor, metabolic reactions and osmotic adjustment. So, Na+/K+ ratio is

supposed to be a promising parameter to check the tolerance potential in plants in

response to salinity stress. Maximum Na+/K+ ratio was obtained in P-6, P-9, P-16 and

P-12 potato plants transformed with HSR1 (Sec 3.3.8.7 & Fig 3.13A). These transgenic

lines avoided the salinity stress and showed better growth than non-transformed lines.

These results are in contrast to Zhu [259] who reported a decline in Na+/K+ ratio in

different species of tomato. It is quite possible that the alteration of ion ratios in

transgenic plants could result from the influx of Na+ through the same pathways that

also functions for the uptake of K+ [260]. Similar kind of results were obtained in potato

plants transformed with AVP1 gene. On the basis of above, we infer that potato lines P-

29, P-23 and P-31 (Fig 3.13B) exhibited higher Na+/K+ ratio which supports the

findings of Gaxiola et al. [69] and Pasapula et al. [102] who reported higher Na+/K+

ratio in AVP1 transgenic plants and ultimately more tolerance potential compared to

control plants.

Amino acids accumulation was observed in response to abiotic stress in

transgenic plants. Variations exists in role played by the amino acids as it motivate

different osmolytes, regulation of ion transport modulating stomatal opening and also

detoxify the heavy metals. Exogenous amino acids can modulate membrane

permeability and ions uptake and probably this is the major component by which amino

acids help in mitigating drought or salt effects. In the present study transgenic lines P-

4, P-6, P-29 and P-31 showed significantly higher accumulation of total amino acids

(Sec 3.3.8.8, Fig 3.14A & B). These findings are consistent with the results of

Blumwald and Grover [261] who reported that over-expression of AVP1 transgenic

tomato and rice exhibited higher amounts of amino acids and soluble sugars. Similarly

transgenic lines P-12, P-11, P-9, P-23, P-22 and P-24 showed higher total soluble sugars

(Sec 3.3.8.9, Fig 3.15A & B) and ultimately showed prominent salt tolerance behavior

in response to different levels of salt stress. These findings are in line with the findings

of Mittler [261] who explained the function of soluble sugars as osmoprotectants to

avoid the ionic toxicity in the shoots of plants subjected to salt stress.

It is needed to effectively eliminate the reactive oxygen species (ROS) produced

in aerobic organisms in a reaction to abiotic stress [262]. There are different kinds of

ROS, some are extremely toxic which are likely to be excluded depending on their


106

nature [263]. To avoid the toxic level of ROS and protect the cells from oxidative injury,

a complex antioxidant defense system comprising of enzymatic (SOD, POD, APX and

CAT) and non-enzymatic metabolites have been developed [264]. Interestingly, a

balance among antioxidant enzymes is required in order to suppress the toxic effects of

ROS within the plant cells [265].

Transgenic potato plants showed varied SOD accumulation, the highest was

observed in P-9 closely followed by P-16, P-4, P-6, P-8 and significantly lower value

was observed in non-transgenic control plants (Sec 3.3.9.1 & Fig 3.18 A). Similar

genotypic response was obtained in transgenic lines transformed with AVP1 in response

to salt stress. These results showed that a significant accumulation of SOD was noticed

in leaves subjected to salt stress which are in accordance with the already documented

study of increased SOD activity in plants exposed to salinity [266]. These results are

also supported by the Daneshmand et al. [204] and Benavides et al. [267] who reported

an increased trend in SOD activity in wild species of potato exposed to salinity. Similar

results related to enhanced activity of SOD were obtained from experiments with salt-

sensitive and salt-tolerant maize cultivars, mulberry [268], spinach [269], apple [270],

Cassia angustifolia [271], naked oat [272] and aquatic macrophytes [273] under salt

stress. On the basis of above facts we infer that over-expression of AVP1 and synthetic

HSR1 in transgenic potato could be responsible for the protection of interaction between

ROS and a wide range of molecules associated with pigment co-oxidation, lipid

peroxidation, membrane destruction, protein denaturation and DNA mutation which

ultimately leads to the salt tolerance [270].

However, maximum accumulation of peroxidase (POD) was observed in potato

transgenic lines P-4, P-16 and P-6 compared to the control plants (Sec 3.3.9.2 & Fig

3.19 A) which is supported by results of Bouaziz et al. [241] who observed increased

trend of POD activity in different potato cultivars in response to salt stress. Although

POD activity was supposed to be increased under salt stress but some contradictory

reports also revealed that POD enzyme activity increased in both salt-tolerant and salt-

sensitive plants under salt stress [47, 264, 271]. The data propose the involvement of

HSR1 and AVP1 in regulation of salt stress tolerance in potato by the stimulation of

different downstream gene expression. Similar results were obtained in the genotypes

transformed with AVP1 which showed significantly higher POD activity compared to

the control plants.


107

In this study, APX activity in transgenic lines P-12, P-4 and P-6 increased under

salt stress. Compared to this observation, enhanced activity of APX has been noticed in

one variety of Azolla [274], spinach [269] and Portulaca oleracea [263] under salt

stress. In addition to this, Neto et al. [264] reported that APX activity was significantly

higher in maize plants as compared to the controls when exposed to salinity stress.

Interestingly, in transgenic plants, enhanced APX activity was considered to be more

related to the protection of plants against oxidative stress than increased SOD activity

[275]. Similarly, genotypes transformed with AVP1 maintained significantly higher

APX activity than respective non-transformed plants. These findings are supported by

a study reported by Zhang et al. [276] that maximum accumulation of APX activity was

observed in transgenic potato plants over-expressing the strawberry D-galacturonic

acid reductase (GalUR) gene subjected to various abiotic stresses under in vitro

conditions.

Our findings are contradictory to the study reported by Fidalgo et al. [242] that

catalase (CAT) activity significantly decreased with severity and long term exposure of

the NaCl. Potato genotypes over-expressing synthetic HSR1 exhibited significantly

higher CAT activity than non-transformed plants even in response to severe (300 mM)

NaCl stress. In present study, higher CAT activity was observed in P-16 followed by

P-2 and P-6, respectively. The elevated activity in our study could be due to the

synthesis of new enzyme. Similarly higher CAT activity was also observed in

genotypes P-24, P-31 and P-23 transformed with AVP1 compared to the respective non-

transgenic plants. These findings are in line with the results reported by Kumar et al.

[277] who observed significantly higher accumulation of CAT in all lines tested after

exposure to 255 mM of NaCl. Catalase is hypothesized to be the most important H2O2-

scavanging enzyme in leaves and it could be associated with our findings that salt

tolerance potential in potato genotypes transformed with synthetic HSR1 and AVP1 is

due to higher CAT activity which ultimately decreases the H2O2 content in the cell, thus

increases the membrane stability in response to salt stress.

Solanum tuberosum is a drough-sensitive species incapable of water shortage

acclimation. A brief exposure to drought can significantly reduce its yields, while hard

drought can completely destroy entire crops. Thus, gains in drought tolerance of even

a few degrees would be of considerable benefit relative to abiotic stress damage.


108

Potato plants transformed with genes (HSR1 & AVP1) associated with abiotic stress

tolerance showed enhanced tolerance of drought and salt stress under both natural and

controlled environment conditions. Lines transformed with HSR1 and AVP1 most

consistently combined acceptable agronomic performance and yields under stressed

conditions with superior stress tolerance. There was, however, no single line that

performed well under non-stressed conditions that was also consistently superior under

abiotic stress (drought) tested in this project.

Under stress condition, transgenic potato lines showed significantly varied

response to potato yield components (Table 3.21, 3.22 & 3.23) because synthetic HSR1

and AVP1 played a role in facilitating auxin transport and the regulation of auxin related

developmental processes such as root and shoot developments in addition its

established role in maintenance of vacuolar pH [87]. Li et al. [87] reported that AVP1

over-expressing transgenic rice plants had more rosette leaves and significantly greater

leaf area than wild type under normal condition. These plants also had enhanced root

growth and dry weight compared with wild type.

In summary, we achieved significant increases in abiotic stress tolerance

through genetic modification of potato. The synthetic HSR1 and AVP1 genes all showed

potential to protect the potato crop against more than one form of stress. Since abiotic

stress is complex our results suggest stacking of stress and cell cycle associated genes

could lead to dramatic increases in both stress tolerance and growth and development.

By contrast, as stress levels increased so did the relative yield benefit observed in the

transformed lines. These results are encouraging as even a small degree of enhancement

of stress tolerance has the potential to produce significant economic benefits in high

value/ high risk crops such as potato.

3.5 Conclusions

This research involved the development of simple and reproducible practices for the

genetic improvement of potato for abiotic stress tolerance through genetic engineering.

The abiotic stress tolerant potato developed during the course of this study can further

be exploited to incorporate other genes encoding transcription factors and proton pumps

for developing broad spectrum tolerance against abiotic stress. Moreover, this study has

developed the way for the selection and improvement of potato cultivars i.e. Kuroda


109

and Cardinal for incorporation of genes for insect, diseases and abiotic stress resistance

and for other quality traits like nutritional improvement etc.

4. References

[1] A. Dobermann and R. Nelson, "Opportunities and Solutions for Sustainable

Food Production, Background paper for the High-Level Panel of Eminent

Persons on the Post-2015 Development Agenda. Prepared by the co-chairs of

the Sustainable Development Solutions Network Thematic Group on

Sustainable Agriculture and Food Production" 2013.

[2] M. Perniola, S. Lovelli, M. Arcieri, and M. Amato, Sustainability in Cereal

Crop Production in Mediterranean Environments, 2015 edition. New York:

Springer, 2015.

[3] T. A. Branch, O. P. Jensen, D. Ricard, Y. Ye, and R. Hilborn, "Contrasting

global trends in marine fishery status obtained from catches and from stock

assessments," Conserv. Biol., vol. 25, pp. 777-786, 2011.

[4] A. Rehman, L. Jingdong, and Y. Du, "Last Five Years Pakistan Economic

Growth Rate (GDP) and its Comparison with China, India and Bangladesh," Int.

J. Sci. Tec. Res., vol. 4, pp. 81-84, 2014.

[5] S. H. Ahmad, A. S. M. Z. Qureshi, and M. R. Saleem, Drought mitigation in

Pakistan: current status and options for future strategies, 2004 edition. IWMI,

2004.

[6] E. M. Goss, J. F. Tabima, D. E. Cooke, S. Restrepo, W. E. Fry, G. A. Forbes, et

al., "The Irish potato famine pathogen Phytophthora infestans originated in

central Mexico rather than the Andes," P. Natl. Acad. Sci., vol. 111, no. 24, pp.

8791-8796. 2014.

[7] P. R. Birch, G. Bryan, B. Fenton, E. M. Gilroy, I. Hein, J. T. Jones, et al., "Crops

that feed the world 8: Potato: are the trends of increased global production

sustainable?," Food Security. vol. 4, no. 4, pp. 477-508, 2012.

[8] H. Peng, D. Peng, H. Long, W. He, F. Qiao, G. Wang, et al., "Characterisation

and functional importance of β-1, 4-endoglucanases from the potato rot

nematode, Ditylenchus destructor," Nematology, vol. 16, no. 5, pp. 505-517,

2014.

[9] A. Hussain and J. K. Routray, "Status and factors of food security in Pakistan,"

Int. J. Dev., vol. 11, pp. 164-185, 2012.

[10] I. Ahmad, M. Soomro, S. Khalid, S. Iftikhar, A. Munir, K. Burney, et al.,

"Recent distributional trends of potato diseases in Pakistan," in Proceedings of

the 1995 Research and development of potato production in Pakistan,

Islamabad, 1995, pp. 117-125.

4. References

111

[11] W. Tim and J. V. Braun," Climate change impacts on global food security"

Sciences. vol. 341, no. 6145, pp. 508-5013, 2013.

[12] F. FAO, World Food and Agriculture, 2013 edition. Rome: pp. 289-294.

[13] M. Zangeneh, M. Omid, and A. Akram, "A comparative study on energy use

and cost analysis of potato production under different farming technologies in

Hamadan province of Iran," Energy, vol. 35, no. 7,pp. 2927-2933, 2010.

[14] S. Pater, M. Caspers, M. Kottenhagen, H. Meima, R. T. Stege, and N. Vetten,

"Manipulation of starch granule size distribution in potato tubers by modulation

of plastid division," Plant Biotechnol. J., vol. 4, no. 1, pp. 123-134, 2006.

[15] D. P. Wiesenborn, P. H. Orr, H. H. Casper, and B. K. Tacke, "Potato starch

paste behavior as related to some physical/chemical properties," J. Food Sci.,

vol. 59, no. 3, pp. 644-648, 1994.

[16] M. Ashraf, M. S. A. Ahmad, M. Öztürk, and A. Aksoy, Crop Improvement

through different means: Challenges and Prospects, 2012 edition. Netherland:

Springer, 2012.

[17] J. Ma, Z. S. Xu, F. Wang, G. F. Tan, M. Y. Li, and A. S. Xiong, "Genome-wide

analysis of HSF family transcription factors and their responses to abiotic

stresses in two Chinese cabbage varieties," Acta Physiol. Plant., vol. 36, no. 2,

pp. 513-523, 2014.

[18] L. P. Manavalan, S. K Guttikonda, L. S. P. Tran and H. T. Nyugen,"

Physiological and molecular approaches to improve drought resistance in

Soybean," Plant Cell Physiol., vol. 50, no. 7, pp. 1260-1276, 2009.

[19] A. A. Albacete, C. Martínez-Andújar, and F. Pérez-Alfocea, "Hormonal and

metabolic regulation of source–sink relations under salinity and drought: From

plant survival to crop yield stability," Biotechnol. Adv., vol. 32, no. 1, pp. 12-

30, 2014.

[20] M. Katsuhara, N. Tsuji, M. Shibasaka, and S. K. Panda, "Osmotic stress

decreases PIP aquaporin transcripts in barley roots but H2O2 is not involved in

this process," J. Plant Res., vol. 127, no. 6, pp. 787-792, 2014.

[21] H. Xin, F. Qin, and L. S. P. Tran, Transcription Factors Involved in

Environmental Stress Responses in Plants, 2012 edition. New York: Springer,

2012.

[22] M. G. Pitman and A. Läuchli, Global impact of salinity and agricultural

ecosystems, 2002 edition. Netherland: Springer, 2002.

[23] M. Qadir, A. Noble, S. Schubert, R. Thomas, and A. Arslan, "Sodicity‐induced

land degradation and its sustainable management: Problems and prospects,"

Land Degrad. Dev., vol. 17, no. 6, pp. 661-676, 2006.

4. References

112

[24] M. Qadir and J. Oster, "Crop and irrigation management strategies for saline-

sodic soils and waters aimed at environmentally sustainable agriculture," Sci.

Total Environ., vol. 323, no. 1-3, pp. 1-19, 2004.

[25] J. Corbishley and D. Pearce,"Growing trees on salt-affected land" ACIAR

Impact Assessment Series Report No. 51, July 2007.

[26] G. Yang, R. Zhou, T. Tang, X. Chen, J. Ouyang, L. He, et al., "Gene expression

profiles in response to salt stress in Hibiscus tiliaceus," Plant Mol. Biol. Rep.,

vol. 29, no. 3, pp. 609-617, 2011.

[27] N. Zhang, H. J. Si, G. Wen, H. H. Du, B. L. Liu, and D. Wang, "Enhanced

drought and salinity tolerance in transgenic potato plants with a BADH gene

from spinach," Plant Biotechnol. Rep., vol. 5, no.1, pp. 71-77, 2011.

[28] J. Martinez-Beltran and C. L. Manzur, "Overview of salinity problems in the

world and FAO strategies to address the problem," in Proceedings of the 2005

international salinity forum, Riverside, California, 2005, pp. 311-313.

[29] M. Qadir, B. Sharma, A. Bruggeman, R. Choukr-Allah, and F. Karajeh,"Non-

conventional water resources and opportunities for water augmentation to

achieve food security in water scarce countries," Agr. Water Manage., vol. 87,

pp. 2-22, 2007.

[30] B. R. Sharma and P. Minhas, "Strategies for managing saline/alkali waters for

sustainable agricultural production in South Asia," Agr. Water Manage., vol.

78, no. 1, pp. 136-151, 2005.

[31] M. Latif and M. Z. Ahmad, "Groundwater and soil salinity variations in a canal

command area in Pakistan," Irrigation Drain., vol. 58, no. 4, pp. 456-468, 2009.

[32] B. Ahmed, T. Yamamoto, V. Rasiah, M. Inoue, and H. Anyoji, "The impact of

saline water irrigation management options in a dune sand on available soil

water and its salinity," Agr. Water Manage., vol. 88, no. 1-3, pp. 63-72, 2007.

[33] N. Kalra, D. Chakraborty, P. Ramesh Kumar, M. Jolly, and P. Sharma, "An

approach to bridging yield gaps, combining response to water and other

resource inputs for wheat in northern India, using research trials and farmers’

fields data," Agr. Water Manage., vol. 93, no. 1-2, pp. 54-64, 2007.

[34] L. Karlberg, J. Rockström, J. G. Annandale, and J. M. Steyn, "Low-cost drip

irrigation-A suitable technology for southern Africa?: An example with

tomatoes using saline irrigation water," Agr. Water Manage., vol. 89, no. 1-2,

pp. 59-70, 2007.

[35] M. K. Bartlett, Y. Zhang, N. Kreidler, S. Sun, R. Ardy, K. Cao, et al., "Global

analysis of plasticity in turgor loss point, a key drought tolerance trait," Ecol.

Lett., vol. 17, no. 12, pp. 1580-1590, 2014.

[36] D. A. Wilhite, "Views-A comment-breaking the hydro-illogical cycle: changing

the paradigm for drought management," Earth, vol. 57, no. 7, pp. 70, 2012.

4. References

113

[37] C. Boisvenue and C. Running, "Impacts of climate change on natural forest

productivity – evidence since the middle of the 20th century," Glob. Change

Biol., vol. 12, no. 5, pp. 862-882, 2006.

[38] Y. Ding, M. J. Hayes and M. Widhalm, "Measuring economic impacts of

drought: a review and discussion," Disaster Prevention and Management: Int.

J., vol. 20 no. 4, pp. 434-446, 2011.

[39] W. J. James, S. J. Halvorson and D. Mustafa," Water management in the Indus

basin of Pakistan: A half-century perspective," Int. J. Water Res. Dev., vol. 16,

no. 3, pp. 391-406, 2000.

[40] S. Witt, L. Galicia, J. Lisec, J. Cairns, A. Tiessen, J. L. Araus, et al., "Metabolic

and phenotypic responses of greenhouse-grown maize hybrids to

experimentally controlled drought stress," Mol. Plant, vol. 5, no. 2, pp. 401-417,

2012.

[41] P. H. Gowda, R. L. Baumhardt, A. M. Esparza, T. H. Marek, and T. A. Howell,

"Suitability of cotton as an alternative crop in the Ogallala Aquifer region,"

Agron. J., vol. 99, no. 6, pp. 1397-1403, 2007.

[42] M. Mahmoodabadi, N. Yazdanpanah, L. R. Sinobas, E. Pazira, and A. Neshat,

"Reclamation of calcareous saline sodic soil with different amendments (I):

Redistribution of soluble cations within the soil profile," Agr. Water Manage.,

vol. 120, pp. 30-38, 2013.

[43] A. A. Rahi, S. M. Mehdi, M. K. Rasheed, B. Butt, R. Ullah, A. A. Sheikh, et al.,

"Evaluating the Salinity Tolerance of Maize (Zea mays L.) Genotype under

Brackish Water Application in Punjab-Pakistan," Life Sci. J., vol. 10, no. 3, pp.

913-919, 2013.

[44] E. Kelly and J. O'Hagan, "Geographic clustering of economic activity: The case

of prominent western visual artists," J. Clust. Econ., vol. 31, no. 2, pp. 109-128,

2006.

[45] M. A. Iqbal and A. Iqbal, "A Study on Dwindling Agricultural Water

Availability in Irrigated Plains of Pakistan and Drip Irrigation as a Future Life

Line," Am-Eurasian. J. Agric. Environ. Sci., vol. 15, no. 2, pp. 184-190, 2015.

[46] L. Mejía-Teniente, F. d. D. Durán-Flores, A. M. Chapa-Oliver, I. Torres-

Pacheco, A. Cruz-Hernández, M. M. González-Chavira, et al., "Oxidative and

molecular responses in Capsicum annuum L. after hydrogen peroxide, salicylic

acid and chitosan foliar applications,"Int. J. Mol. Sci., vol. 14, no. 5, pp. 10178-

10196, 2013.

[47] H. Rahnama and H. Ebrahimzadeh, "The effect of NaCl on antioxidant enzyme

activities in potato seedlings," Biol. Plantarum., vol. 49, no. 1, pp. 93-97, 2005.

[48] E. I. S. Bernal, M. A. C. Escobar, A. R. León, and H. M. O. Escobar,

"Physiological Behavior of Potato cv. Tollocan at Diverse Types of Salinity," J.

Plant Studies, vol. 2, no. 1, pp. 120-134, 2013.

4. References

114

[49] G. Kaur, H. P. Singh, D. R. Batish, and R. K. Kohli, "Pb-inhibited mitotic

activity in onion roots involves DNA damage and disruption of oxidative

metabolism," Ecotoxicology, vol. 23, no. 7, pp. 1292-1304, 2014.

[50] N. Mantri, V. Patade, and E. Pang, Recent Advances in Rapid and Sensitive

Screening for Abiotic Stress Tolerance, 2014 edition. New York: Springer,

2014.

[51] F. Squeo, F. J. Rada R, A. Azócar, and G. Goldstein, "Freezing tolerance and

avoidance in tropical Andean plants: Is it equally represented in species with

different plant height?," Oecologia, vol. 86, no. 3, pp. 378-382, 2013.

[52] S. Puijalon, T. J. Bouma, C. J. Douady, J. van Groenendael, N. P. Anten, E.

Martel, et al., "Plant resistance to mechanical stress: evidence of an avoidance–

tolerance trade‐off," New Phytol., vol. 191, no. 4, pp. 1141-1149, 2011.

[53] I. Ruberti, G. Sessa, A. Ciolfi, M. Possenti, M. Carabelli, and G. Morelli, "Plant

adaptation to dynamically changing environment: the shade avoidance

response," Biotechnol. Adv., vol. 30, no. 5, pp. 1047-1058, 2012.

[54] P. K. Agarwal, P. Agarwal, M. Reddy, and S. K. Sopory, "Role of DREB

transcription factors in abiotic and biotic stress tolerance in plants," Plant Cell

Rep., vol. 25, no. 12, pp. 1263-1274, 2006.

[55] H. Shou,"Crop improvement through genetic engineering: development of

transformation technologies and production of stress tolerant transgenic crops,"

(2003). Retrospective Theses and Dissertations. Paper 1463.

[56] D. d. Koeyer, C. HaiXia, V. Gustafson, J. Bradeen, and C. Kole, Molecular

breeding for potato improvement, 2011 edition. New Hampshire: Science,

2011.

[57] B. Xoconostle-Cazares, F. A. Ramirez-Ortega, L. Flores-Elenes, and R. Ruiz-

Medrano, "Drought tolerance in crop plants," Am. J. Plant Phys., vol. 5, no. 5,

pp. 241-256, 2010.

[58] B. Björn, P. L. Keizer, M. J. Paulo, R. G. Visser, F. A. van Eeuwijk, and H. J.

van Eck, "Identification of agronomically important QTL in tetraploid potato

cultivars using a marker–trait association analysis," Theor. Appl. Genet., vol.

127, no. 3, pp. 731-748, 2014.

[59] M. Qaim and S. Kauser, "Genetically modified crops and food security," Plos

One., vol. 8, no. 6, 2013.

[60] H. Hu and L. Xiong, "Genetic engineering and breeding of drought-resistant

crops," Annu. Rev. Plant Biol., vol. 65, pp. 715-741, 2014.

[61] R. C. Rabara, P. Tripathi, and P. J. Rushton, "The potential of transcription

factor-based genetic engineering in improving crop tolerance to drought," J.

Integ. Biol., vol. 18, no. 10, pp. 601-614, 2014.

4. References

115

[62] M. K. Rai and N. Shekhawat, "Recent advances in genetic engineering for

improvement of fruit crops," Plant Cell, Tiss. Org., vol. 116, no. 1, pp. 1-15,

2014.

[63] A. L. Dann and C. R. Wilson, "Comparative assessment of genetic and

epigenetic variation among regenerants of potato (Solanum tuberosum) derived

from long-term nodal tissue-culture and cell selection," Plant Cell Rep., vol.

30,no. 4, pp. 631-639, 2011.

[64] S. Kothari, A. Joshi, S. Kachhwaha, and N. Ochoa-Alejo, "Chilli peppers-a

review on tissue culture and transgenesis," Biotec. Adv., vol. 28, no. 1, pp. 35-

48, 2010.

[65] S. Mohan Jain, "Tissue culture-derived variation in crop improvement,"

Euphytica, vol. 118, no. 2, pp. 153-166, 2001.

[66] M. C. Hatzell, R. D. Cusick, and B. E. Logan, "Capacitive mixing power

production from salinity gradient energy enhanced through exoelectrogen-

generated ionic currents," Energy Environ. Sci., vol. 7, no. 3, pp. 1159-1165,

2014.

[67] T. Fester, J. Giebler, L. Y. Wick, D. Schlosser, and M. Kästner, "Plant–microbe

interactions as drivers of ecosystem functions relevant for the biodegradation of

organic contaminants," Curr. Opin. Biotech., vol. 27, pp. 168-175, 2014.

[68] P. Mäser, S. Thomine, J. I. Schroeder, J. M. Ward, K. Hirschi, H. Sze, et al.,

"Phylogenetic relationships within cation transporter families of Arabidopsis,"

Plant Physiol., vol. 126, no. 4, pp. 1646-1667, 2001.

[69] R. A. Gaxiola, J. Li, S. Undurraga, L. M. Dang, G. J. Allen, S. L. Alper, et al.,

"Drought-and salt-tolerant plants result from overexpression of the AVP1 H+-

pump," P. Natl. Acad. Sci., vol. 98, no. 20, pp. 11444-11449.

[70] N. Bibi, K. Fan, M. Dawood, G. Nawaz, S. Yuan, and W. Xuede, "Exogenous

application of epibrassinolide attenuated Verticillium wilt in upland cotton by

modulating the carbohydrates metabolism, plasma membrane ATPases and

intracellular osmolytes," Plant Growth Regul., vol. 73, no. 2, pp. 155-164, 2014.

[71] A. K. Spartz, H. Ren, M. Y. Park, K. N. Grandt, S. H. Lee, A. S. Murphy, et al.,

"SAUR Inhibition of PP2C-D Phosphatases activates Plasma Membrane H+-

ATPases to Promote Cell Expansion in Arabidopsis," Plant Cell, vol. 27, no. 5,

pp. 2129-2142, 2014.

[72] I. Pottosin, A. M. Velarde-Buendía, J. Bose, A. T. Fuglsang, and S. Shabala,

"Polyamines cause plasma membrane depolarization, activate Ca2+ and

modulate H+-ATPase pump activity in pea roots," J. Exp. Bot., vol. 65, no. 9,

pp. 2463-2472, 2014.

[73] K. B. Axelsen and M. G. Palmgren, "Inventory of the superfamily of P-type ion

pumps in Arabidopsis," Plant Physiol., vol. 126, no. 2, pp. 696-706, 2001.

4. References

116

[74] X. Wang, Y. Cai, H. Wang, Y. Zeng, X. Zhuang, B. Li, et al., "Trans-Golgi

Network-Located AP1 Gamma Adaptins Mediate Dileucine Motif-Directed

Vacuolar Targeting in Arabidopsis," Plant Cell, vol. 26, no. 10, pp. 4102-4118,

2014.

[75] G. H. Sun-Wada and Y. Wada, "Vacuolar-type proton pump ATPases: roles of

subunit isoforms in physiology and pathology," Histol. Histopathol., vol. 25,

no. 12, pp. 1611-1620, 2010.

[76] M. Sagermann, T. H. Stevens, and B. W. Matthews, "Crystal structure of the

regulatory subunit H of the V-type ATPase of Saccharomyces cerevisiae," P.

Natl. Acad. Sci., vol. 98, no. 13, pp. 7134-7139, 2001.

[77] S. Ng, I. De Clercq, O. Van Aken, S. R. Law, A. Ivanova, P. Willems, et al.,

"Anterograde and Retrograde Regulation of Nuclear Genes Encoding

Mitochondrial Proteins during Growth, Development, and Stress," Mol. Plant,

vol. 7, no. 7, pp. 1075-1093, 2014.

[78] K. J. Parra, C. Y. Chan, and J. Chen, "Saccharomyces cerevisiae Vacuolar H+-

ATPase Regulation by Disassembly and Reassembly: One Structure and

Multiple Signals," Euk. Cell, vol. 13, no. 6, pp. 706-714, 2014.

[79] M. Faraco, C. Spelt, M. Bliek, W. Verweij, A. Hoshino, L. Espen, et al.,

"Hyperacidification of vacuoles by the combined action of two different P-

ATPases in the tonoplast determines flower color," Cell Rep., vol. 6, no. 1, pp.

32-43, 2014.

[80] Y. Benitez-Alfonso, "Symplastic intercellular transport from a developmental

perspective," J. Exp. Bot., vol. 65, no. 7, pp. 1857-1863, 2014.

[81] S. Wolf, K. Hématy, and H. Höfte, "Growth control and cell wall signaling in

plants," Annu. Rev. Plant Biol., vol. 63, pp. 381-407, 2012.

[82] K. Imada, T. Minamino, M. Kinoshita, Y. Furukawa, and K. Namba, "Structural

insight into the regulatory mechanisms of interactions of the flagellar type III

chaperone FliT with its binding partners," P. Natl. Acad. Sci., vol. 107, no. 19,

pp. 8812-8817, 2010.

[83] C. Orlandi, K. Xie, I. Masuho, A. Fajardo-Serrano, R. Lujan, and K. A.

Martemyanov, "Orphan Receptor GPR158 Is an Allosteric Modulator of RGS7

Catalytic activity with an essential role in Dictating its Expression and

Localization in the Brain," J. Biol. Chem., vol. 290, pp. 13622-13639, 2015.

[84] C. H. Slamovits, N. Okamoto, L. Burri, E. R. James, and P. J. Keeling, "A

bacterial proteorhodopsin proton pump in marine eukaryotes," Nat. Comm., vol.

2, 2011.

[85] H. Yang, X. Zhang, R. A. Gaxiola, G. Xu, W. A. Peer, and A. S. Murphy, "Over-

expression of the Arabidopsis proton-pyrophosphatase AVP1 enhances

transplant survival, root mass, and fruit development under limiting phosphorus

conditions," J. Exp. Bot., 2014.

4. References

117

[86] B. Rieder and H. E. Neuhaus, "Identification of an Arabidopsis Plasma

Membrane–Located ATP Transporter Important for Anther Development,"

Plant Cell, vol. 23, no. 5, pp. 1932-1944, 2011.

[87] J. Li, H. Yang, W. Ann Peer, G. Richter, J. Blakeslee, A. Bandyopadhyay, et

al.,"Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ

development," Science, vol. 310, no. 5745, 2005.

[88] M. J. Seufferheld, K. M. Kim, J. Whitfield, A. Valerio, and G. Caetano-Anollés,

"Evolution of vacuolar proton pyrophosphatase domains and volutin granules:

clues into the early evolutionary origin of the acidocalcisome," Biol Direct., vol.

6, 2011.

[89] H. G. Jones, a quantitative approach to plant environment interaction, 2014

edition. New York: Cambridge University Press, 2014.

[90] Z. Wang, P. J. Sapienza, T. Abeysinghe, C. Luzum, A. L. Lee, J. S. Finer-

Moore, et al., "Mg2+ binds to the surface of thymidylate synthase and affects

hydride transfer at the interior active site," J. Am. Chem. Soc., vol. 135, no. 20,

pp. 7583-7592, 2013.

[91] A. Jain, V. Saini, and D. Veer Kohli, "Edible Transgenic Plant Vaccines for

Different Diseases," Curr. Pharm. Biotec., vol. 14, pp. no. 6, 594-614, 2013.

[92] Y. J. Pan, C. H. Lee, S. H. Hsu, Y. T. Huang, T. Liu, Y. Chen, et al., "The

transmembrane domain 6 of vacuolar H+-pyrophosphatase mediates protein

targeting and proton transport," Biochim. Biophys. Acta, vol. 1807, no. 1, pp.

59-67, 2011.

[93] H. S. Yoon, S. Y. Kim, and I. S. Kim, "Stress response of plant H+-PPase-

expressing transgenic Escherichia coli and Saccharomyces cerevisiae: a

potentially useful mechanism for the development of stress-tolerant organisms,"

J. Appl. Genet., vol. 54, no. 1, pp. 129-133, 2013.

[94] S. Park, N. H. Cheng, J. K. Pittman, K. S. Yoo, J. Park, R. H. Smith, et al.,

"Increased calcium levels and prolonged shelf life in tomatoes expressing

Arabidopsis H+/Ca2+ transporters,"Plant Physiol., vol. 139, no. 3, pp. 1194-

1206, 2005.

[95] F. Zhao, Z. Wang, Q. Zhang, Y. Zhao, and H. Zhang, "Analysis of the

physiological mechanism of salt-tolerant transgenic rice carrying a vacuolar

Na+/H+ antiporter gene from Suaeda salsa," J. Plant Res., vol. 119, pp. 95-104,

2006.

[96] F. Brini, M. Hanin, V. Lumbreras, I. Amara, H. Khoudi, A. Hassairi, et al.,

"Overexpression of wheat dehydrin DHN-5 enhances tolerance to salt and

osmotic stress in Arabidopsis thaliana," Plant Cell Rep., vol. 26, no. 2, pp. 2017-

2026, 2007.

[97] S. Asad, Z. Mukhtar, F. Nazir, J. A. Hashmi, S. Mansoor, Y. Zafar, et al.,

"Silicon carbide whisker-mediated embryogenic callus transformation of cotton

4. References

118

(Gossypium hirsutum L.) and regeneration of salt tolerant plants," Mol.

Biotech., vol. 40, 2008.

[98] B. Li, A. Wei, C. Song, N. Li, and J. Zhang, "Heterologous expression of the

TsVP gene improves the drought resistance of maize," Plant Biotech. J., vol. 6,

pp. no. 2, 146-159, 2008.

[99] X. Ma, H. Dong, and W. Li, "Genetic improvement of cotton tolerance to

salinity stress," Afri. J. Agr. Res., vol. 6, no. 33, pp. 6797-6803, 2011.

[100] M. Ibrahim, S. A. Khan, Z. Yusuf, S. Mansoor, A. Yusuf and Z. Mukhtar,

"Expression of a full length Arbidopsis vacuolar H+-pyrophosphatase (AVP1)

gene in tobacco (Nicotiana tabbacum) to increase tolerance to drought and salt

stresses," J. Phytol., vol. 1, no. 6, pp. 276-284, 2009.

[101] S. L. Lv, L. J. Lian, P. L. Tao, Z. X. Li, K. W. Zhang, and J. R. Zhang,

"Overexpression of Thellungiella halophila H+-PPase (TsVP) in cotton

enhances drought stress resistance of plants," Planta, vol. 229, no. 4, pp. 899-

910, 2009.

[102] V. Pasapula, G. Shen, S. Kuppu, J. Paez‐Valencia, M. Mendoza, P. Hou, et al.,

"Expression of an Arabidopsis vacuolar H+‐pyrophosphatase gene (AVP1) in

cotton improves drought‐and salt tolerance and increases fibre yield in the field

conditions," Plant Biotech. J., vol. 9, no. 1, pp. 88-99, 2011.

[103] D. Golldack, I. Lüking, and O. Yang, "Plant tolerance to drought and salinity:

stress regulating transcription factors and their functional significance in the

cellular transcriptional network," Plant Cell Rep., vol. 30, no. 8, pp. 1383-1391,

2011.

[104] L. Liu, M. J. White, and T. H. MacRae, "Transcription factors and their genes

in higher plants," Eur. J. Biochem., vol. 262, no. 2, pp. 247-257, 2001.

[105] K. Nakashima, H. Takasaki, J. Mizoi, K. Shinozaki, and K. Yamaguchi-

Shinozaki, "NAC transcription factors in plant abiotic stress responses,"

Biochim. Biophys. Acta., vol. 1819, no. 2, pp. 97-103, 2011.

[106] C. Dubos, R. Stracke, E. Grotewold, B. Weisshaar, C. Martin, and L. Lepiniec,

"MYB transcription factors in Arabidopsis," Trends Plant Sci., vol. 15, no. 10,

pp. 573-581, 2010.

[107] M. Akhtar, A. Jaiswal, J. Jaiswal, M. Qureshi, M. Tufchi, and N. Singh,

"Cloning and characterization of cold, salt and drought inducible C-repeat

binding factor gene from a highly cold adapted ecotype of Lepidium latifolium

L," Physiol. Mol. Biol. Plants, vol. 19, no. 221, 2013.

[108] N. Tuteja, S. Gill, and R. Tuteja, Omics and Plant Abiotic Stress Tolerance,

2011 edition. Bentham Science, 2011.

[109] D. Bartels and R. Sunkar, "Drought and salt tolerance in plants," Crit. Rev. Plant

Sci, vol. 24, no. 1, pp. 23-58, 2005.

4. References

119

[110] B. Vinocur and A. Altman, "Recent advances in engineering plant tolerance to

abiotic stress: achievements and limitations," Curr. Opin. Biotech., vol. 16, no.

2, pp. 123-132, 2005.

[111] T. Umezawa, M. Fujita, Y. Fujita, K. Yamaguchi-Shinozaki, and K. Shinozaki,

"Engineering drought tolerance in plants: discovering and tailoring genes to

unlock the future," Curr. Opin. Biotech., vol. 17, no. 2, pp. 113-122, 2006.

[112] Y. Sakuma, K. Maruyama, Y. Osakabe, F. Qin, M. Seki, K. Shinozaki, et al.,

"Functional analysis of an Arabidopsis transcription factor, DREB2A, involved

in drought-responsive gene expression," Plant Cell, vol. 18, no. 5, pp. 1292-

1309, 2006.

[113] Y. G. Shen, W. K. Zhang, S. J. He, J. S. Zhang, Q. Liu, and S. Y. Chen, "An

EREBP/AP2-type protein in Triticum aestivum was a DRE-binding

transcription factor induced by cold, dehydration and ABA stress," Theor. Appl.

Genet., vol. 106, no. 5, pp. 923-930, 2003.

[114] X. Sun, Y. Li, H. Cai, X. Bai, W. Ji, X. Ding, et al., "The Arabidopsis AtbZIP1

transcription factor is a positive regulator of plant tolerance to salt, osmotic and

drought stresses," J. Plant Res., vol. 125, no. 3, pp. 429-438, 2012.

[115] H. Chen, R. An, J. H. Tang, X. H. Cui, F. S. Hao, J. Chen, et al., "Over-

expression of a vacuolar Na+/H+ antiporter gene improves salt tolerance in an

upland rice," Mol. Breeding, vol. 19, no. 3, pp. 215-225, 2007.

[116] D. Shin, S. J. Moon, S. Han, B. G. Kim, S. R. Park, S. K. Lee, et al., "Expression

of StMYB1R-1, a novel potato single MYB-like domain transcription factor,

increases drought tolerance," Plant Physiol., vol. 155, no. 1, pp. 421-432, 2011.

[117] M. Iorizzo, D. S. Mollov, D. Carputo, and J. M. Bradeen, "Disease resistance

gene transcription in transgenic potato is unaltered by temperature extremes and

plant physiological age," Eur. J. Plant Pathol., vol. 130, no. 4, pp. 469-476,

2011.

[118] C. Lata and M. Prasad, "Role of DREBs in regulation of abiotic stress responses

in plants," J. Exp. Bot., vol. 62, no. 14, pp. 4731-4748, 2011.

[119] V. Chinnusamy, A. Jagendorf, and J. K. Zhu, "Understanding and improving

salt tolerance in plants," Crop Sci., vol. 45, no. 2, pp. 437-448, 2005.

[120] S. Hohmann and W. H. Mager, Yeast stress responses, 2003 edition. New York:

Springer, 2003.

[121] G. Wettstein, P. Bellaye, O. Micheau, and P. Bonniaud, "Small heat shock

proteins and the cytoskeleton: An essential interplay for cell integrity?," Int. J.

Biochem. Cell Biol., vol. 44, no. 10, 2012.

[122] K. V. Prasanth and D. L. Spector, "Eukaryotic regulatory RNAs: an answer to

the ‘genome complexity’conundrum," Gene. Dev., vol. 21, no. 1, pp. 11-42,

2007.

4. References

120

[123] X. J. Yang, "Multisite protein modification and intramolecular signaling,"

Oncogene, vol. 24, pp. 1653-1662, 2004.

[124] M. Falaleeva and S. Stamm, "Processing of snoRNAs as a new source of

regulatory non‐coding RNAs," Bioessays, vol. 35, no. 1, pp. 46-54, 2013.

[125] N. A. Ivica, B. Obermayer, G. W. Campbell, S. Rajamani, U. Gerland, and I. A.

Chen, "The paradox of dual roles in the RNA world: resolving the conflict

between stable folding and templating ability," J. Mol. Evol., vol. 77, no. 3, pp.

55-63, 2013.

[126] J. E. Wilusz, H. Sunwoo, and D. L. Spector, "Long noncoding RNAs: functional

surprises from the RNA world," Genes Dev., vol. 23, no. 13, pp. 1494-1504,

2009.

[127] J. Feng, C. Bi, B. S. Clark, R. Mady, P. Shah, and J. D. Kohtz, "The Evf-2

noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and

functions as a Dlx-2 transcriptional coactivator," Genes Dev., vol. 20, pp. 1470-

1484, 2006.

[128] A. M. Khalil, M. Guttman, M. Huarte, M. Garber, A. Raj, D. R. Morales, et al.,

"Many human large intergenic noncoding RNAs associate with chromatin-

modifying complexes and affect gene expression," P. Natl. Acad. Sci., vol. 106,

no. 28, pp. 11667-11672, 2009.

[129] I. A. Mitchell Guttman, M. Garber, C. French, M. F. Lin, D. Feldser, M. Huarte,

et al., "Chromatin signature reveals over a thousand highly conserved large non-

coding RNAs in mammals," Nature, vol. 458, pp. 223-227, 2009.

[130] D. S. Kim, Y. Lee, and Y. Hahn, "Evidence for bacterial origin of heat shock

RNA-1," RNA, vol. 16, no. 2, pp. 274-279, 2010.

[131] I. Shamovsky, M. Ivannikov, E. S. Kandel, D. Gershon, and E. Nudler, "RNA-

mediated response to heat shock in mammalian cells," Nature, vol. 440, pp. 556-

560, 2006.

[132] J. A. Goodrich and J. F. Kugel, "Non-coding-RNA regulators of RNA

polymerase II transcription," Nature Rev. Mol. Cell Biol., vol. 7, pp. 612-616,

2006.

[133] I. Shamovsky and E. Nudler, "Isolation and characterization of the heat shock

RNA 1," Methods Mol. Biol., vol. 540, pp. 265-279, 2009.

[134] F. Martínez, A. Arif, S. G. Nebauer, E. Bueso, R. Ali, C. Montesinos, et al., "A

fungal transcription factor gene is expressed in plants from its own promoter

and improves drought tolerance," Planta, vol. 242, no. 1, pp. 1-14, 2015.

[135] E. Blumwald, "Sodium transport and salt tolerance in plants," Curr. Opin. Cell

Biol., vol. 12, no. 4, pp. 431-434, 2000.

[136] S. Merchan, L. Pedelini, G. Hueso, A. Calzada, R. Serrano, and L. Yenush,

"Genetic alterations leading to increases in internal potassium concentrations

4. References

121

are detrimental for DNA integrity in Saccharomyces cerevisiae," Genes Cells,

vol. 16, no. 2, pp. 152-165, 2011.

[137] S. Y. Hong, L. V. Roze, and J. E. Linz, "Oxidative stress-related transcription

factors in the regulation of secondary metabolism," Toxins, vol. 5, no. 4, pp.

683-702, 2013.

[138] J. Hou, T. Österlund, Z. Liu, D. Petranovic, and J. Nielsen, "Heat shock response

improves heterologous protein secretion in Saccharomyces cerevisiae," Appl.

Microbiol. Biot., vol. 97, no. 8, pp. 3559-3568, 2013.

[139] N. Askari, Y. Wang, and G. J. de Klerk, "In tissue culture of Lilium explants

may become heavily contaminated by the standard initiation procedure," Prop.

Orn. Plants, vol. 14, no. 2, pp. 49-56, 2014.

[140] L. De Filippis, Crop Improvement Through Tissue Culture, 2014 edition. New

York: Springer, 2014.

[141] B. Ruffoni and M. Savona, "Physiological and biochemical analysis of growth

abnormalities associated with plant tissue culture," Hort. Environ. Biotec., vol.

54, no. 3, pp. 191-205, 2013.

[142] F. R. Bhuiyan, "In vitro Meristem Culture and Regeneration of Three Potato

Varieties of Bangladesh," Res. Biotec., vol. 4, no. 3, pp. 29-37, 2013.

[143] A. Cingel, B. Vinterhalter, D. Vinterhalter, A. Smigocki, and S. Ninkovi,

"Agrobacterium-mediated transformation of two Serbian potato cultivars

(Solanum tuberosum L. cv. Draga cevka and cv. Jelica)," Afr. J. Biotechnol.,

vol. 9, no. 30, pp. 4644-4650, 2010.

[144] K. R. Jo, C. J. Kim, S. J. Kim, T. Y. Kim, M. Bergervoet, M. A. Jongsma, et al.,

"Development of late blight resistant potatoes by cisgene stacking," BMC

Biotech., vol. 14, no. 50, 2014.

[145] P. Lakshmanan, R. J. Geijskes, L. Wang, A. Elliott, C. P. Grof, N. Berding, et

al., "Developmental and hormonal regulation of direct shoot organogenesis and

somatic embryogenesis in sugarcane (Saccharum spp. interspecific hybrids) leaf

culture," Plant Cell Rep., vol. 25, no. 10, pp. 1007-1015, 2006.

[146] M. K. Thornton, J. Lee, R. John, N. L. Olsen, and D. A. Navarre, "Influence of

growth regulators on plant growth, yield, and skin color of specialty potatoes,"

Am. J. Potato Res., pp. 1-13, 2013.

[147] M. Rani, S. Kumar, S. Shukla, M. Sachan, and B. Sharkar, "Comparative Study

of Effect of Different Tissue Culture Media on the Propagation of Potato," J.

Microbiol. Biotechnol., vol. 1, no. 3, pp. 12-14, 2013.

[148] M. Sabeti, R. Zarghami, and M. Ebrahim Zadeh, "Effects of explants and

growth regulators on callogenesis and somatic embryogenesis of Agria potato

cultivar," Int. J. Agr. Sci., vol. 3, no. 3, pp. 213-221, 2013.

4. References

122

[149] S. Vinoth, P. Gurusaravanan, and N. Jayabalan, "Optimization of somatic

embryogenesis protocol in Lycopersicon esculentum L. using plant growth

regulators and seaweed extracts," J. Appl. Phycol., vol. 26, no. 3, pp. 1527-

1537, 2014.

[150] A. Badoni and J. Chauhan, "Effect of Growth Regulators on Meristem-tip

Development and in vitro Multiplication of Potato Cultivar ‘Kufri Himalini’,"

Nature Sci., vol. 7, no. 9, pp. 31-34, 2009.

[151] M. Rahman, A. Shamsuddin, and U. Asad, "In vitro regeneration from mature

embryos in spring wheat," Int. J. Sustain. Crop Prod., vol. 3, no. 2, pp. 76-80,

2008.

[152] H. Dagla, "Plant tissue culture," Resonance, vol. 17, pp. 759-767, 2012.

[153] G. Khadiga, S. M. Rasheid, and M. K. Mutasim, "Effect of cultivar and growth

regulator on in vitro micropropagation of potato (Solanum tuberosum L)," Am-

Eurasian. J. Sus. Agr., vol. 3, no. 3, pp. 487-492, 2009.

[154] M. J. M. M. Armin, M. Asgharipour, and S. K. Yazdi, "Effects of different plant

growth regulators and potting mixes on micro-propagation and mini-

tuberization of potato plantlets," Adv. Environ. Biol., vol. 5, no. 4, pp. 631-638,

2011.

[155] I. S. Curtis, J. Gonzalez-Ramos, and T. E. Mirkov, "Potato transformation

compositions, systems, methods, microorganisms, and plants," U.S. Patent

20120311734A1, Dec. 6, 2012.

[156] S. Shekhar, L. Agrawal, A. K. Buragohain, A. Datta, S. Chakraborty, and N.

Chakraborty, "Genotype Independent Regeneration and Agrobacterium‐mediated Genetic Transformation of Sweet Potato (Ipomoea batatas L.)," Plant

Tiss. Cult. Biotechnol., vol. 23, pp. 87‐100, 2013.

[157] O. Danci, M. Danci, and F. Berbentea, "Studies regarding potato

micropropagation by single node culture.," Res. J. Agr. Sci., vol. 40, no. 3, pp.

21-24, 2008.

[158] J. Amudha and G. Balasubramani, "Recent molecular advances to combat

abiotic stress tolerance in crop plants," Biotech. Mol. Biol. Rev., vol. 6, no. 2,

pp. 31-58, 2011.

[159] N. J. Atkinson and P. E. Urwin, "The interaction of plant biotic and abiotic

stresses: from genes to the field," J. Exp. Bot., vol. 63, no. 10, pp. 3523-3543,

2012.

[160] S. B. Preuss, R. Meister, Q. Xu, C. P. Urwin, F. A. Tripodi, S. E. Screen, et al.,

"Expression of the Arabidopsis thaliana BBX32 gene in soybean increases grain

yield," PloS one, vol. 7, 2012.

[161] T. Hirayama and K. Shinozaki, "Research on plant abiotic stress responses in

the post‐genome era: past, present and future," Plant J., vol. 61, no. 6, pp. 1041-

1052, 2010.

4. References

123

[162] A. Kapus, "Membrane Structure and the Transport of Small Molecules and

Ions," 2003 edition. John Wiley & Sons, Inc, 2003.

[163] F. Alemán, F. Caballero, R. Ródenas, R. M. Rivero, V. Martínez, and F. Rubio,

"The F130S point mutation in the Arabidopsis high-affinity K+ transporter

AtHAK5 increases K+ over Na+ and Cs+ selectivity and confers Na+ and Cs+

tolerance to yeast under heterologous expression," Front. Plant Sci., vol. 5,

2014.

[164] W. J. Percey, L. Shabala, M. C. Breadmore, R. M. Guijt, J. Bose, and S. Shabala,

"Ion transport in broad bean leaf mesophyll under saline conditions,"Planta, vol.

240, no. 4, pp. 729-743, 2014.

[165] F. Bayat, B. Shiran, D. Belyaev, N. Yur’eva, G. Sobol’kova, H. Alizadeh, et al.,

"Potato plants bearing a vacuolar Na+/H+ antiporter HvNHX2 from barley are

characterized by improved salt tolerance," Russ. J. Plant Physl., vol. 57, no. 5

pp. 696-706, 2010.

[166] W. J. Chen and T. Zhu, "Networks of transcription factors with roles in

environmental stress response," Trends Plant Sci., vol. 9, no. 12, pp. 591-596,

2004.

[167] U. Bechtold, W. S. Albihlal, T. Lawson, M. J. Fryer, P. A. Sparrow, F. Richard,

et al.,"Arabidopsis Heat Shock Transcription FactorA1b overexpression

enhances water productivity, resistance to drought, and infection," J. Exp. Bot.,

vol. 64, no. 11, pp. 3467-3481, 2013.

[168] D. T. Le, R. Nishiyama, Y. Watanabe, K. Mochida, K. Yamaguchi-Shinozaki,

K. Shinozaki, et al., "Genome-wide survey and expression analysis of the plant-

specific NAC transcription factor family in soybean during development and

dehydration stress," DNA Res., pp. 1-14, 2011.

[169] C. A. Penfold and V. B. Wollaston, "Modelling transcriptional networks in leaf

senescence," J. Exp. Bot., vol. 65, no. 14, pp. 3859-3873, 2014.

[170] S. Kidokoro, K. Watanabe, T. Ohori, T. Moriwaki, K. Maruyama, J. Mizoi, et

al., "Soybean DREB1/CBF‐type transcription factors function in heat and

drought as well as cold stress‐responsive gene expression," Plant J., vol. 81, no.

3, pp. 505-518, 2015.

[171] F. Xu, D. Lu, C. Qiu, Y. Li, S. Wang, S. Liu, et al., "Cost Calculation of Factory

Seedling of Virus-free Potato Tissue Culture Seedlings," Chin. Potato J., vol. 2,

2010.

[172] M. J. Iqbal, N. Aziz, N. Saeed, Y. Zafar, and K. Malik, "Genetic diversity

evaluation of some elite cotton varieties by RAPD analysis," Theor. Appl.

Genet., vol. 94, no. 1, pp. 139-144, 1997.

[173] J. Sambrook and W. Russell David, Molecular cloning, 2001 edition. New

York: Cold spring harbor laboratory press, 2001.

4. References

124

[174] P. Ahmad, M. Ashraf, M. Younis, X. Hu, A. Kumar, N. A. Akram, et al., "Role

of transgenic plants in agriculture and biopharming," Biotec., Adv., vol. 30, no.

3, pp. 524-540, 2012.

[175] K. K. Sharma, S. R. Dumbala, and P. Bhatnagar-Mathur, Biotech Approaches

for Crop Improvement in the Semi-arid Tropics, 2014 edition. New York:

Springer, 2014.

[176] R. H. Smith, Plant tissue culture: techniques and experiments, 2013 edition.

London: Elseveir, 2013.

[177] J. Smitz, M. M. Dolmans, J. Donnez, J. Fortune, O. Hovatta, K. Jewgenow, et

al., "Current achievements and future research directions in ovarian tissue

culture, in vitro follicle development and transplantation: implications for

fertility preservation," Hum. Reprod. Update, vol. 16, no. 4, pp. 395-414, 2010.

[178] T. Ogawa, S. Nakamura, M. Sayama, and K. Ohshima, "Attenuated mutants of

Potato virus Y necrotic strain produced by nitrous acid treatment and

mutagenesis-in-tissue culture methods," Eur. J. Plant Pathol., vol. 135, no. 4,

pp. 745-760, 2013.

[179] E. W. Newell, N. Sigal, S. C. Bendall, G. P. Nolan, and M. M. Davis,

"Cytometry by Time-of-Flight Shows Combinatorial Cytokine Expression and

Virus-Specific Cell Niches within a Continuum of CD8+ T Cell Phenotypes,"

Immunity, vol. 36, no. 1, pp. 142-152, 2012.

[180] Á. Bukovinszki, Z. Divéki, M. Csányi, L. Palkovics, and E. Balázs,

"Engineering resistance to PVY in different potato cultivars in a marker-free

transformation system using a ‘shooter mutant’ A. tumefaciens," Plant Cell

Rep., vol. 26, no. 4, pp. 459-465, 2007.

[181] A. Ballester, M. Cervera, and L. Peña, "Selectable marker-free transgenic

orange plants recovered under non-selective conditions and through PCR

analysis of all regenerants," Plant Cell Tiss. Organ Cult., vol. 102, no. 3, pp.

329-336, 2010.

[182] A. A. Bazzini, M. T. Lee, and A. J. Giraldez, "Ribosome profiling shows that

miR-430 reduces translation before causing mRNA decay in zebrafish,"

Science, vol. 336, pp. 233-237, 2012.

[183] X. Zhao, L. P. Zhan, and X. Z. Zou, "Improvement of cold tolerance of the half-

high bush Northland blueberry by transformation with the LEA gene from

Tamarix androssowii," Plant Growth Regul., vol. 63, no. 1, pp. 13-22, 2011.

[184] J. A. Hashmi, Y. Zafar, M. Arshad, S. Mansoor, and S. Asad, "Engineering

cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using

viral truncated AC1 DNA sequences," Virus Genes, vol. 42, no. 2, pp. 286-296,

2011.

[185] H. Wu, A. C. D'Alessio, S. Ito, Z. Wang, K. Cui, K. Zhao, et al., "Genome-wide

analysis of 5-hydroxymethylcytosine distribution reveals its dual function in

4. References

125

transcriptional regulation in mouse embryonic stem cells," Genes Dev., vol. 25,

pp. 679-684, 2011.

[186] R. E. Casu, A. Selivanova, and J. M. Perroux, "High-throughput assessment of

transgene copy number in sugarcane using real-time quantitative PCR," Plant

Cell Rep., vol. 31, no. 1, pp. 167-177, 2012.

[187] X. Fu, S. Fontana, B. B. Bong, P. Tinjuangjun, D. Sudhakar, R. M. Twyman, et

al., "Linear transgene constructs lacking vector backbone sequences generate

low-copy-number transgenic plants with simple integration patterns,"

Transgenic Res., vol. 9, no. 1, pp. 11-19, 2000.

[188] C. V. Rovere, S. Asurmendi, and H. Hopp, "Transgenic resistance in potato

plants expressing potato leaf roll virus (PLRV) replicase gene sequences is

RNA-mediated and suggests the involvement of post-transcriptional gene

silencing," Virology, vol. 146, no. 7, pp. 1337-1353, 2001.

[189] M. Y. Ashraf, N. Iqbal, M. Ashraf, and J. Akhter, "Modulation of physiological

and biochemical metabolites in salt stressed rice by foliar application of Zinc,"

J. Plant Nut., vol. 37, no. 3, pp. 447-457, 2014.

[190] A. Anand, S. Khetarpal, and M. P. Singh, "Physiological Response of Maize

Under Rising Atmospheric CO2 and Temperature, 2014 edition. India: Springer,

2014.

[191] M. Guerfel, O. Baccouri, D. Boujnah, W. Chaïbi, and M. Zarrouk, "Impacts of

water stress on gas exchange, water relations, chlorophyll content and leaf

structure in the two main Tunisian olive (Olea europaea L.) cultivars," Sci.

Hortic., vol. 119, no. 3, pp. 257-263, 2009.

[192] A. E. Carmo-Silva, M. A. Gore, P. Andrade-Sanchez, A. N. French, D. J.

Hunsaker, and M. E. Salvucci, "Decreased CO2 availability and inactivation of

Rubisco limit photosynthesis in cotton plants under heat and drought stress in

the field," Environ. Exp. Bot., vol. 83, pp. 1-11, 2012.

[193] I. Aranjuelo, G. Molero, G. Erice, J. C. Avice, and S. Nogués, "Plant physiology

and proteomics reveals the leaf response to drought in alfalfa (Medicago sativa

L.)," J. Exp. Bot., vol. 62, no. 1, pp. 111-123, 2011.

[194] M. Chaves, J. Flexas, and C. Pinheiro, "Photosynthesis under drought and salt

stress: regulation mechanisms from whole plant to cell," Ann. Bot., vol. 103,

no. 4, pp. 551-560, 2009.

[195] Y. Jiang and B. Huang, "Drought and heat stress injury to two cool-season

turfgrasses in relation to antioxidant metabolism and lipid peroxidation," Crop

Sci., vol. 41, no. 2, pp. 436-442, 2001.

[196] C. A. Jaleel, P. Manivannan, A. Wahid, M. Farooq, H. J. Al-Juburi, R.

Somasundaram, et al., "Drought stress in plants: a review on morphological

characteristics and pigments composition," Int. J. Agric. Biol., vol. 11, no. 1,

pp. 100-105, 2009.

4. References

126

[197] E. Sánchez-Rodríguez, M. d. M. Rubio-Wilhelmi, B. Blasco, R. Leyva, L.

Romero, and J. M. Ruiz, "Antioxidant response resides in the shoot in reciprocal

grafts of drought-tolerant and drought-sensitive cultivars in tomato under water

stress," Plant Sci., vol. 188, pp. 89-96, 2012.

[198] Y. Osakabe, K. Osakabe, K. Shinozoki and L. S. P. Tran, "Response of plants

to water stress" Front. Plant Sci., vol. 5, no. 86, 2014.

[199] I. Türkan and T. Demiral, "Recent developments in understanding salinity

tolerance," Environ. Exp. Bot., vol. 67, no. 1, pp. 2-9, 2009.

[200] M. Brosché and J. Kangasjärvi, "Low antioxidant concentrations impact on

multiple signalling pathways in Arabidopsis thaliana partly through NPR1," J.

Exp. Bot., vol. 63, pp. 1849-1861, 2012.

[201] Y. P. Lee, S. H. Kim, J. W. Bang, H. S. Lee, S. S. Kwak, and S. Y. Kwon,

"Enhanced tolerance to oxidative stress in transgenic tobacco plants expressing

three antioxidant enzymes in chloroplasts," Plant Cell Rep., vol. 26, no. 5, pp.

591-598, 2007.

[202] J. H. Liaoa, J. S. Leeb and S. H. Chioua, C-termianl lysine truncation increases

thermostability and enhances chaperone-like function of porcine B-crystalline"

Biochem. Bioph. Res. Com., vol. 297, no. 2, pp. 309-316.

[203] K. Apel and H. Hirt, "Reactive oxygen species: metabolism, oxidative stress,

and signal transduction," Annu. Rev. Plant Biol., vol. 55, pp. 373-399, 2004.

[204] F. Daneshmand, M. J. Arvin, and K. M. Kalantari, "Physiological responses to

NaCl stress in three wild species of potato in vitro," Acta Physiol. Plant., vol.

32, no. 91, 2010.

[205] R. Mittler, S. Vanderauwera, M. Gollery, and F. Van Breusegem, "Reactive

oxygen gene network of plants," Trends Plant Sci., vol. 9, no. 10, pp. 490-498,

2004.

[206] F. Parveen, M. Khatun, and A. Islam, "Micropropagation of Environmental

Stress Tolerant Local Potato (Solanum tuberosum L.) Varieties of Bangladesh,"

Plant Tiss. Cult. Biotechnol., vol. 24, no. 1, pp. 101-109, 2014.

[207] D. Levy, W. K. Coleman, and R. E. Veilleux, "Adaptation of Potato to Water

Shortage: Irrigation Management and Enhancement of Tolerance to Drought

and Salinity," Am. J. Potato Res., vol. 90, no. 2, pp. 1-21, 2013.

[208] L. Borgo, C. J. Marur, and L. G. E. Vieira, "Effects of high proline accumulation

on chloroplast and mitochondrial ultrastructure and on osmotic adjustment in

tobacco plants," Acta Sci. Agron., vol. 37, no. 2, pp. 191-199, 2015.

[209] S. H. Wani, N. B. Singh, A. Haribhushan, and J. I. Mir, "Compatible Solute

Engineering in Plants for Abiotic Stress Tolerance-Role of Glycine Betaine,"

Curr. Gen., vol. 14, p. 157, 2013.

http://www.sciencedirect.com/science/article/pii/S0006291X0202185X






4. References

127

[210] A. Hmida-Sayari, R. Gargouri-Bouzid, A. Bidani, L. Jaoua, A. Savouré, and S.

Jaoua, "Overexpression of 1-pyrroline-5-carboxylate synthetase increases

proline production and confers salt tolerance in transgenic potato plants," Plant

Sci., vol. 169, no. 4, pp. 746-752, 2005.

[211] D. Goel, A. Singh, V. Yadav, S. Babbar, and K. Bansal, "Overexpression of

osmotin gene confers tolerance to salt and drought stresses in transgenic tomato

(Solanum lycopersicum L.)," Protoplasma, vol. 245, no. 1, pp. 133-141, 2010.

[212] M. Amin, S. M. Elias, A. Hossain, A. Ferdousi, M. S. Rahman, N. Tuteja, et al.,

"Over-expression of a Dead-box helicase, PDH45, confers both seedling and

reproductive stage salinity tolerance to rice (Oryza sativa L.)," Mol. Breeding,

vol. 30, no. 1, pp. 345-354, 2012.

[213] R. Sairam and D. Saxena, "Oxidative stress and antioxidants in wheat

genotypes: possible mechanism of water stress tolerance," J. Agron. Crop Sci.,

vol. 184, no. 1, pp. 55-61, 2000.

[214] T. Flowers and M. Hajibagheri, "Salinity tolerance in Hordeum vulgare: ion

concentrations in root cells of cultivars differing in salt tolerance," Plant Soil,

vol. 231, no. 1, pp. 1-9, 2001.

[215] D. D. Van Slyke, R. A. Phillips, P. B. Hamilton, R. M. Archibald, P. H. Futcher,

and A. Hiller, "Glutamine as source material of urinary ammonia," J. Biol.

Chem., vol. 150, no. 1943, pp. 481-482, 1943.

[216] L. Bates, R. Waldren, and I. Teare, "Rapid determination of free proline for

water-stress studies," Plant Soil, vol. 39, no. 1, pp. 205-207, 1973.

[217] M. Dubois, K. A. Gilles, J. K. Hamilton, P. Rebers, and F. Smith, "Colorimetric

method for determination of sugars and related substances," Anal. Chem., vol.

28, no. 3, pp. 350-356, 1956.

[218] A. M. Smith and S. C. Zeeman, "Quantification of starch in plant tissues," Nat.

Prot., vol. 1, no. 3, pp. 1342-1345, 2006.

[219] V. Dixit, V. Pandey, and R. Shyam, "Differential antioxidative responses to

cadmium in roots and leaves of pea (Pisum sativum L. cv. Azad)," J. Exp. Bot.,

vol. 52, no. 358, pp. 1101-1109, 2001.

[220] C. N. Giannopolitis and S. K. Ries, "Superoxide dismutases I. Occurrence in

higher plants," Plant Physiol., vol. 59, no. 2, pp. 309-314, 1977.

[221] A. Maehly, "Plant peroxidase," Method. Enzymol., vol. 2, no. 2, pp. 801-813,

1955.

[222] I. Cakmak, C. Hengeler, and H. Marschner, "Partitioning of shoot and root dry

matter and carbohydrates in bean plants suffering from phosphorus, potassium

and magnesium deficiency," J. Exp. Bot., vol. 45, no. 9, pp. 1245-1250, 1994.

[223] R. Munns, "Genes and salt tolerance: bringing them together," New Phytol., vol.

167, no. 3, pp. 645-663, 2005.

4. References

128

[224] J. A. Hernández and M. S. Almansa, "Short‐term effects of salt stress on

antioxidant systems and leaf water relations of pea leaves," Physiol. Plantarum.,

vol. 115, no. 2, pp. 251-257, 2002.

[225] M. S. A. Ahmad, F. Javed, and M. Ashraf, "Iso-osmotic effect of NaCl and PEG

on growth, cations and free proline accumulation in callus tissue of two indica

rice (Oryza sativa L.) genotypes," Plant Growth Regul., vol. 53, no. 53, pp. 53-

63, 2007.

[226] R. A. Shibli, M. Kushad, G. G. Yousef, and M. A. Lila, "Physiological and

biochemical responses of tomato microshoots to induced salinity stress with

associated ethylene accumulation," Plant Growth Regul., vol. 51, no. 2, pp. 159-

169, 2007.

[227] K. Aghaei, A. A. Ehsanpour, and S. Komatsu, "Potato responds to salt stress by

increased activity of antioxidant enzymes," J. Integ. Plant Biol., vol. 51, no. 12,

pp. 1095-1103, 2009.

[228] J. Gopal and K. Iwama, "In vitro screening of potato against water-stress

mediated through sorbitol and polyethylene glycol," Plant Cell Rep., vol. 26,

no. 5, pp. 693-700, 2007.

[229] P. Deblonde and J. F. Ledent, "Effects of moderate drought conditions on green

leaf number, stem height, leaf length and tuber yield of potato cultivars," Eur.

J. Agron., vol. 14, no. 1, pp. 31-41, 2001.

[230] A. J. Mungala, T. Radhakrishnan, and J. R. Dobaria, "In vitro screening of 123

Indian peanut cultivars for sodium chloride induced salinity tolerance," World

J. Agr. Sci., vol. 4, no. 5, pp. 574-582, 2008.

[231] A. Parvaiz and S. Satyawati, "Salt stress and phyto-biochemical responses of

plants-a review," Plant Soil Environ., vol. 54, no. 3, pp. 89-99, 2008.

[232] H. W. Koyro, "Effect of salinity on growth, photosynthesis, water relations and

solute composition of the potential cash crop halophyte (Plantago coronopus

L.)," Environ. Exp. Bot., vol. 56, no. 2, pp. 136-146, 2006.

[233] L. Frusciante, A. Barone, D. Carputo, and P. Ranalli, "Breeding and

physiological aspects of potato cultivation in the Mediterranean region," Potato

Res., vol. 42, no. 2, pp. 265-277, 1999.

[234] Y. Zhang and D. J. Donnelly, "In vitro bioassays for salinity tolerance screening

of potato," Potato Res., vol. 40, no. 3, pp. 285-295, 1997.

[235] C. H. Foyer, J. Neukermans, G. Queval, G. Noctor, and J. Harbinson,

"Photosynthetic control of electron transport and the regulation of gene

expression," J. Exp. Bot., vol. 63, no. 4, pp. 1637-1661, 2012.

[236] A. K. Bao, S. M. Wang, G. Q. Wu, J. J. Xi, J. L. Zhang, and C. M. Wang,

"Overexpression of the Arabidopsis-PPase enhanced resistance to salt and

drought stress in transgenic alfalfa (Medicago sativa L.)," Plant Sci., vol. 176,

no. 2, pp. 232-240, 2009.

4. References

129

[237] L. P. Manavalan, S. K. Guttikonda, L.-S. P. Tran, and H. T. Nguyen,

"Physiological and molecular approaches to improve drought resistance in

soybean," Plant Cell Physiol., vol. 50, no. 7, pp. 1260-1276, 2009.

[238] M. Ashraf and P. Harris, "Photosynthesis under stressful environments: An

overview," Photosynthetica, vol. 51, no. 2, pp. 163-190, 2013.

[239] M. Iqbal and M. Ashraf, "Changes in growth, photosynthetic capacity and ionic

relations in spring wheat (Triticum aestivum L.) due to pre-sowing seed

treatment with polyamines," Plant Growth Regul., vol. 46, no. 1, pp. 19-30,

2005.

[240] A. Pal, K. Acharya, S. Vats, S. Kumar, and P. S. Ahuja, "Over-expression of

PaSOD in transgenic potato enhances photosynthetic performance under

drought," Biol. Plantarum, vol. 57, no. 2, pp. 359-364, 2013.

[241] D. Bouaziz, J. Pirrello, M. Charfeddine, A. Hammami, R. Jbir, A. Dhieb, et al.,

"Overexpression of StDREB1 transcription factor increases tolerance to salt in

transgenic potato plants," Mol. Biotec., vol. 54, no. 3, pp. 803-817, 2013.

[242] F. Fidalgo, A. Santos, I. Santos, and R. Salema, "Effects of long‐term salt stress

on antioxidant defence systems, leaf water relations and chloroplast

ultrastructure of potato plants," Ann. Appl. Biol., vol. 145, no. 2, pp. 185-192,

2004.

[243] B. Behnam, A. Kikuchi, F. Celebi-Toprak, M. Kasuga, K. Yamaguchi-

Shinozaki, and K. N. Watanabe, "Arabidopsis rd29A:: DREB1A enhances

freezing tolerance in transgenic potato," Plant Cell Rep., vol. 26, pp. 1275-1282,

2007.

[244] M. Ashraf and M. Foolad, "Roles of glycine betaine and proline in improving

plant abiotic stress resistance," Environ. Exp. Bot., vol. 59, no. 2, pp. 206-216,

2007.

[245] M. Hasanuzzaman, K. Nahar, M. M. Alam, R. Roychowdhury and M. Fujita,"

Physiological, Biochemical, and Molecular Mechanisms of Heat Stress

Tolerance in Plants," Int. J. Mol. Sci., vol. 14. no. 5, pp. 9643-9684. 2013.

[246] A. Hmida-Sayari, R. Gargouri-Bouzid, A. Bidani, L. Jaoua, A. Savouré, and S.

Jaoua, "Overexpression of 1-pyrroline-5-carboxylate synthetase increases

proline production and confers salt tolerance in transgenic potato plants," Plant

Sci., vol. 169, no. 4, pp. 746-752, 2005.

[247] N. Hassan, M. Serag, F. El‐Feky, and M. Nemat Alla, "In vitro selection of

mung bean and tomato for improving tolerance to NaCl," Ann. Appl. Biol., vol.

152, no. 3, pp. 319-330, 2008.

[248] A. Patel and A. Pandey, "Growth, water status and nutrient accumulation of

seedlings of Holoptelea integrifolia (Roxb.) Planch in response to soil salinity,"

Plant Soil Environ., vol. 54, no. 9, pp. 367-373, 2008.

4. References

130

[249] Z. Hong, K. Lakkineni, Z. Zhang, and D. P. S. Verma, "Removal of feedback

inhibition of 1-pyrroline-5-carboxylate synthetase results in increased proline

accumulation and protection of plants from osmotic stress," Plant Physiol., vol.

122, no. 4, pp. 1129-1136, 2000.

[250] K. Miura, J. B. Jin, J. Lee, C. Y. Yoo, V. Stirm, T. Miura, et al., "SIZ1-mediated

sumoylation of ICE1 controls CBF3/DREB1A expression and freezing

tolerance in Arabidopsis," Plant Cell, vol. 19, no. 4, pp. 1403-1414, 2007.

[251] S. J. Gilmour, A. M. Sebolt, M. P. Salazar, J. D. Everard, and M. F. Thomashow,

"Overexpression of the Arabidopsis CBF3transcriptional activator mimics

multiple biochemical changes associated with cold acclimation," Plant Physiol.,

vol. 124, no. 4, pp. 1854-1865, 2000.

[252] W. A. Sawahel and A. H. Hassan, "Generation of transgenic wheat plants

producing high levels of the osmoprotectant proline," Biotechnol. Lett., vol. 24,

no. 9, pp. 721-725, 2002.

[253] C. Yonamine, L. Troncone, and M. Camillo, "Blockade of neuronal nitric oxide

synthase abolishes the toxic effects of Tx2-5, a lethal Phoneutria nigriventer

spider toxin," Toxicon, vol. 44, no. 2, pp. 169-172, 2004.

[254] Z. Ahmed, I. J. Tetlow, R. Ahmed, M. K. Morell, and M. J. Emes, "Protein–

protein interactions among enzymes of starch biosynthesis in high-amylose

barley genotypes reveal differential roles of heteromeric enzyme complexes in

the synthesis of A and B granules," Plant Sci., vol. 233, pp. 95-106, 2015.

[255] J. Veramendi, U. Roessner, A. Renz, L. Willmitzer, and R. N. Trethewey,

"Antisense repression of hexokinase 1 leads to an overaccumulation of starch in

leaves of transgenic potato plants but not to significant changes in tuber

carbohydrate metabolism," Plant Physiol., vol. 121, no. 1, pp. 123-134, 1999.

[256] E. Bassil, H. Tajima, Y. C. Liang, M. A. Ohto, K. Ushijima, R. Nakano, et al.,

"The Arabidopsis Na+/H+ antiporters NHX1 and NHX2 control vacuolar pH and

K+ homeostasis to regulate growth, flower development, and reproduction,"

Plant Cell, vol. 23, no. 9, pp. 3482-3497, 2011.

[257] A. Qadar, "Alleviation of sodicity stress on rice genotypes by Phosphorus

fertilization," Plant Soil, vol. 203, no. 2, pp. 269-277, 1998.

[258] C. Gisbert, A. M. Rus, M. C. Boları́n, J. M. López-Coronado, I. Arrillaga, C.

Montesinos, et al., "The yeast HAL1 gene improves salt tolerance of transgenic

tomato," Plant Physiol., vol. 123, no. 1, pp. 393-402, 2000.

[259] J. K. Zhu, "Plant salt tolerance," Trends Plant Sci., vol. 6, no. 2, pp. 66-71, 2001.

[260] J. K. Tiwari, A. D. Munshi, R. Kumar, R. N. Pandey, A. Arora, J. S. Bhat, et

al., "Effect of salt stress on cucumber: Na+–K+ ratio, osmolyte concentration,

phenols and chlorophyll content," Acta Physiol. Plant., vol. 32, no. 1, pp. 103-

114, 2010.

4. References

131

[261] R. Mittler, and E. Blumwald, " The roles of ROS and ABA in systemic acquired

acclimation", Plant Cell, vol. 27, no. 1, pp. 64-70, 2015.

[262] D. Evers, C. Schmit, Y. Mailliet, and J. Hausman, "Growth characteristics and

biochemical changes of poplar shoots in vitro under sodium chloride stress," J.

Plant Physiol., vol. 151, no. 6, pp. 748-753, 1997.

[263] I. Yazici, I. Türkan, A. H. Sekmen, and T. Demiral, "Salinity tolerance of

purslane (Portulaca oleracea L.) is achieved by enhanced antioxidative system,

lower level of lipid peroxidation and proline accumulation," Environ. Exp. Bot.,

vol. 61, no. 1, pp. 49-57, 2007.

[264] A. D. Neto, J. T. Prisco, J. Enéas-Filho, C. E. B. d. Abreu, and E. Gomes-Filho,

"Effect of salt stress on antioxidative enzymes and lipid peroxidation in leaves

and roots of salt-tolerant and salt-sensitive maize genotypes," Environ. Exp.

Bot., vol. 56, no. 1, pp. 87-94, 2006.

[265] N. Misra and A. K. Gupta, "Effect of salt stress on proline metabolism in two

high yielding genotypes of green gram," Plant Sci., vol. 169, no. 2, pp. 331-339,

2005.

[266] O. Ozden, S. H. Park, H. S. Kim, H. Jiang, M. C. Coleman, D. R. Spitz, et al.,

"Acetylation of MnSOD directs enzymatic activity responding to cellular

nutrient status or oxidative stress," Aging, vol. 3, no. 2, pp. 102-107, 2011.

[267] M. P. Benavídes, P. L. Marconi, S. M. Gallego, M. E. Comba, and M. L.

Tomaro, "Relationship between antioxidant defence systems and salt tolerance

in Solanum tuberosum," Funct. Plant Biol., vol. 27, no. 3, pp. 273-278, 2000.

[268] C. Sudhakar, A. Lakshmi, and S. Giridarakumar, "Changes in the antioxidant

enzyme efficacy in two high yielding genotypes of mulberry (Morus alba L.)

under NaCl salinity," Plant Sci., vol. 161, no. 3, pp. 613-619, 2001.

[269] F. Eraslan, A. Inal, D. J. Pilbeam, and A. Gunes, "Interactive effects of salicylic

acid and silicon on oxidative damage and antioxidant activity in spinach

(Spinacia oleracea L. cv. Matador) grown under boron toxicity and salinity,"

Plant Growth Regul., vol. 55, no. 207, 2008.

[270] A. Molassiotis, T. Sotiropoulos, G. Tanou, G. Diamantidis, and I. Therios,

"Boron-induced oxidative damage and antioxidant and nucleolytic responses in

shoot tips culture of the apple rootstock EM 9 (Malus domestica Borkh)," Env.

Exp. Bot., vol. 56, no. 1, pp. 54-62, 2006.

[271] S. Agarwal and V. Pandey,"Antioxidant enzyme responses to NaCl stress in

Cassia angustifolia," Biol. Plantarum, vol. 48, no. 4, pp. 555-560, 2004.

[272] Q. Xu, X. Xu, Y. Zhao, K. Jiao, S. J. Herbert, and L. Hao, "Salicylic acid,

hydrogen peroxide and calcium-induced saline tolerance associated with

endogenous hydrogen peroxide homeostasis in naked oat seedlings," Plant

Growth Regul., vol. 54, no. 3, pp. 249-259, 2008.

4. References

132

[273] N. Rout and B. Shaw, "Salt tolerance in aquatic macrophytes: possible

involvement of the antioxidative enzymes," Plant Sci., vol. 160, no. 3, pp. 415-

423, 2001.

[274] A. Masood, N. A. Shah, M. Zeeshan, and G. Abraham, "Differential response

of antioxidant enzymes to salinity stress in two varieties of Azolla (Azolla

pinnata and Azolla filiculoides)," Environ. Exp. Bot., vol. 58, no. 1-3, pp. 216-

222, 2006.

[275] S. Kwon, Y. Jeong, H. Lee, J. Kim, K. Cho, R. Allen, et al., "Enhanced

tolerances of transgenic tobacco plants expressing both superoxide dismutase

and ascorbate peroxidase in chloroplasts against methyl viologen‐mediated

oxidative stress," Plant, Cell Environ., vol. 25, no. 7, pp. 873-882, 2002.

[276] Y. Y. Zhang, H. X. Li, W. B. Shu, C. J. Zhang, and Z. B. Ye, "RNA interference

of a mitochondrial APX gene improves vitamin C accumulation in tomato fruit,"

Sci. Hortic., vol. 129, no. 2, pp. 220-226, 2011.

[277] S. Kumar, J. Malik, P. Thakur, S. Kaistha, K. D. Sharma, H. Upadhyaya, et al.,

"Growth and metabolic responses of contrasting chickpea (Cicer arietinum L.)

genotypes to chilling stress at reproductive phase," Acta Physiol. Plantarum,

vol. 33, no. 3, pp. 779-787, 2011.

Appendices

Appendix # 1

Restriction Reaction

DNA 2 μl (1 μg/μl),

HindIII 2 μl (10U μl-1)

EcoRI 2 μl (10U μl-1)

Tango 2X buffer 2 μl,

Total volume 20 μl.

The digestion mixture was incubated at 37 °C for 1 h. Tango 2X buffer was used

because both enzymes showed 50-100% activity in this buffer.

Agarose-Gel Electrophoresis

Mix DNA with 6X loading dye and electrophoress in 1% [w/v] agarose gel containing

ethidium bromide (0.5 μg/ml). Prepare gel in a midigel apparatus (18 x 15 cm),

containing 0.5X TAE (20 mM trisacetate and 0.5 mM EDTA [pH 8.0]) buffer. Run

TAE gel approximately at 100 volts. View the ethidium-stained DNA using a short

wavelength ultraviolet (UV) transilluminator (Eagle Eye-Stratagene) and estimate the

fragment length by comparison with a co electrophoresed 1 kbp DNA ladder

(Fermentas, Catalogue # SM0313).

Appendix # 2

DNA Gel Extraction and Purification

DNA was purified by using Wizard® SV Gel and PCR Clean-Up System (Promega,

catalogue # A9282) by following the manufacturer’s instructions as given below:

Weigh a 1.5 ml microcentrifuge tube for each DNA fragment to be isolated and record

the weight. Excise the DNA fragment of interest in a minimal volume of agarose using

a clean scalpel or razor blade. Transfer the gel slice to the weighed microcentrifuge tube

and record the weight. Subtract the weight of the empty tube from the total weight to

obtain the weight of the gel slice. Add membrane binding solution at a ratio of 10μl of

solution per 10 mg of agarose gel slice. Vortex the mixture (see Note 4) and incubate

at 50–65 °C for 10 minutes or until the gel slice is completely dissolved. Vortex the

Appendices

134

tube every few minutes to increase the rate of agarose gel melting. Centrifuge the tube

briefly at room temperature to ensure the contents are at the bottom of the tube. Place

one SV minicolumn in a collection tube for each dissolved gel slice or PCR

amplification. Transfer the dissolved gel mixture or prepared PCR product to the SV

minicolumn assembly and incubate for 1 minute at room temperature. Centrifuge the

SV minicolumn assembly in a microcentrifuge at 16,000 × g (14,000 rpm) for 1 minute.

Remove the SV minicolumn from the spin column assembly and discard the liquid in

the collection tube. Return the SV minicolumn to the collection tube. Wash the column

by adding 700 μl of membrane wash solution, previously diluted with 95 % ethanol, to

the SV minicolumn. Centrifuge the SV minicolumn assembly for 1 minute at 16,000 ×

g (14,000 rpm). Empty the collection tube as before and place the SV minicolumn back

in the collection tube. Repeat the wash with 500 μl of membrane wash solution and

centrifuge the SV minicolumn assembly for 5 minutes at 16,000 × g. Remove the SV

minicolumn assembly from the centrifuge, being careful not to wet the bottom of the

column with the flowthrough. Empty the collection tube and recentrifuge the column

assembly for 1 minute with the microcentrifuge lid open to allow evaporation of any

residual ethanol. Carefully transfer the SV minicolumn to a clean 1.5 ml

microcentrifuge tube. Apply 50 μl of nuclease-free water directly to the center of the

column without touching the membrane with the pipette tip. Incubate at room

temperature for 1 minute. Centrifuge for 1 minute at 16,000 × g (14,000 rpm). Discard

the SV minicolumn and store the microcentrifuge tube containing the eluted DNA at

4°C or –20°C.

Appendix # 3

Ligation Reaction

Linear vector DNA 20-100 ng

Insert DNA 1:1 to 5:1 molar ration over vector

10X T4 DNA Ligase Buffer 2 μl

Water, nuclease-free 20 μl

Total volume 20 μl

Appendices

135

Appendix # 4

Preparation of Heat Shock Competent Escherchia coli Cells

Pick a single colony from a freshly grown plate of E. coli and inoculate 20 ml LB liquid

medium with it in a 50 ml flask. Incubate at 37 °C for 16 h with vigorous shaking. The

next day add 2 ml of the overnight culture to 250 ml LB liquid in 1 L flask and incubate

with vigorous shaking at 37°C until an OD600 of 0.5-1 has reached. Chill the culture

on ice for 30 minutes, transfer aseptically to sterile disposable 50 ml propylene tubes

and centrifuge at 4,000 rpm at 4 °C for 5 minutes to pellet the cells. Re-suspend the

pellet in 20 ml of 0.1 M MgCl2 and centrifuge again at 4,000 rpm at 4°C for 5 minutes.

Again resuspend in 20 ml of 0.1 M CaCl2, incubate at ice for 30 minutes and centrifuge.

Finally resuspend the pellet in 3-4 ml of 0.1 M CaCl2 and filter-sterilised cold glycerol

(in approx. 3:1 ratio). Store cells in aliquots of 200 μL at -80°C.

Appendix # 5

Heat shock method

Add DNA or ligation mixture to thawed competent cells (200 μL), mix gently and

incubate on ice for 30 min. Give heat shock to cells at 42°C in a dry bath for 1-2 min.

Transfer cells to ice and incubate for ten minutes. Add 1 ml of LB liquid medium to

each tube and place in a shaker at 37 °C for 1 hour. Spread transformed cells on solid

LB medium plates with appropriate antibiotics and incubate at 37°C in an incubator for

16 hours.

Appendix # 6

Plasmid Isolation from E. coli by miniprep method

Using a sterile tooth pick, pick a single bacterial colony from a plate and inoculate into

5 ml of LB broth with appropriate antibiotic selection in a sterile culture tube. Incubate

overnight at 37°C with shaking. After 16 h incubation decant culture into a 1.5 ml

microcentrifuge tube. Centrifuge at full speed for two minutes in a microfuge to harvest

the cells. Discard the supernatant and re-suspend the pellet in 100 μl re-suspension

solution (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 μg/ml RNase A) by vortexing.

Add 200 μl lysis solution (1% [w/v] SDS, 0.2 M NaOH) mix gently and incubate at

room temperature for five minutes. Then add 200 μl neutralization solution (3.0 M

potassium acetate [pH 5.5]), mix thoroughly and centrifuge at 14,000 rpm for 10

minutes in a microfuge. Transfer the supernatant to a new microcentrifuge tube and add

Appendices

136

two volumes of chilled absolute ethanol. Mix to precipitate the DNA and centrifuge for

10 minutes to pellet the DNA. Then wash DNA pellet with 70% ethanol, air dry and

dissolve in sterile distilled water.

Appendix # 7

Preparation of Glycerol Stocks

In 1.5 ml centrifuge tube add 300 μl filter sterilised glycerol and 700 μl of cell culture,

mix it and store at -80 ̊C freezer. To recover bacterial cultures from glycerol stocks,

take a small amount of the culture and streak using a sterile loop on culture plates with

solid growth media and suitable antibiotics and incubate at suitable temperatures.

Appendix # 8

Preparation of Electro Competent Agrobacterium-tumefaciens Cells

Pick a single colony from a freshly grown plate of Agrobacterium tumefaciens (strain

LBA 4404) using a sterile toothpick and inoculate into 20 ml LB liquid medium with

50 μg/ml rifampicin and 10 μg/ml tetracycline in a 50 ml autoclaved flask. Place it in a

shaker (160 rotations per minute) at 28 °C for 48 hours. Use 5 ml of the culture to

inoculate 250 ml LB liquid medium containing 50 mg/L rifampicin and 10 mg/L

tetracycline into a 1 L flask. Place it in a shaker at 28 °C until the OD600 of cells has

reached 0.5-1. Transfer the cells aseptically to ice cold 50 ml propylene tubes, incubate

on ice for 10 minutes and centrifuge at 5,000 rpm for 10 minutes at 4°C. Re-suspend

the pellet in 50 ml of cold sterile distilled water and centrifuge. Again re-suspend cells

in cold sterile distilled water and repeat this wash. Re-suspend the cells in 10 ml cold

sterile distilled water containing filter sterilized cold 10 % [v/v] glycerol and centrifuge.

Repeat this wash and finally re-suspend the cells in 3-4 ml of filter sterilized cold 10 %

[v/v] glycerol, aliquot in 1.5 ml microcentrifuge tubes and store at –80°C.

Appendix # 9

Electroporation Method

Use 2 μl of the plasmid for electro-transformation by electro cell manipulator 600 (BTX

San Diego, California). Place electroporation cuvettes of 1 mm gap on ice. Thaw the

vials of frozen electro-competent cells of Agrobacterium on ice. Mix 2 μg DNA plasmid

in 100 μl of electro competent cells and place on ice. Use following conditions for

electroporation as recommended by the manufacturer:

Appendices

137

Mode T 2.5 KV

Resistance R R5 (129 ohm)

Charging voltage 1.44 KV

Transfer the electro-competent cells containing the DNA mixture to electroporation

cuvette. Give the pulse and immediately add 1 ml of liquid LB medium, mix gently and

then transfer to 1.5 ml tube. Incubate it at 28 °C for two hours. Pellet the transformed

cells on LB agar plate having 10 μg/ml tetracycline and 50 μg/ml rifampicin or

appropriate antibiotic with reference to construct specific selection marker and were

placed at 28 °C for 48 hours. Pick a single colony using a sterile tooth pick from a plate

and inoculate into 5 ml of LB broth with appropriate antibiotic selection in a sterile

culture tube. Incubate the tube for 48 hours at 28 °C with shaking.

Appendix # 10

DNA Extraction, C-TAB Method

15 ml of 2X CTAB DNA extraction buffer (2% Cetyl triethylammonium bromide, 100

mM Tris-HCL, pH 8.0, 20 mM EDTA, 1.4 M NaCl, 1% PVP) with 2% 2-

mercaptoethanol was preheated at 65 °C for 30 min. About 2 gm of fresh leaves were

ground to make a fine powder in pre-cooled pestle mortar with liquid N2. The grinded

powder was transferred to a 50 ml sterile polypropylene tube, added 15-20 ml

(preheated at 65 °C) 2 X CTAB buffer to the tubes before the frozen powder started

thawing. The mixture was inverted gently several times to make sure a good mixing of

the paste and incubated in water bath containing hot water with occasional swirling at

65 °C for 30 min. After incubation, tubes were taken out of the water bath and allowed

to cool at room temperature for some time and added equal volume (15 ml) of

chloroform: isoamylalcohol (24:1). The mixture was inverted gently to mix the

solutions and centrifuged at 9000 rpm for 15 min at 4 °C (Eppendorf centrifuge 5810,

Germany). The supernatant (top aqueous phase) was transferred to a new tube and the

remaining phase was discarded. Two-third (0.6 ml) cold isopropanol was added to

precipitate the DNA and mixed it gently. The DNA samples were incubated at -20 °C

for 30 min. After incubation, chilled tubes were again spun at 9000 rpm for 10 min at

4 °C. The top aqueous phase was discarded and DNA pellet was obtained. DNA pellet

was washed with 70% cold ethanol. Air-dried the DNA pellet overnight and dissolved

in 1 ml nuclease free water. Dissolved DNA was treated with 5 μl of RNase (10 mg ml-

1) and incubated for 1 h at 37 °C. Afterwards, the RNase was removed by mixing an

Appendices

138

equal volume of chloroform-isoamylalcohol (24:1) followed by centrifugation at 13000

rpm at room temperature for 10 min. Supernatant was transferred to fresh tubes and

DNA was precipitated by adding 0.6 volume isopropanol and 1/10 volume of 3 M

sodium acetate. After spinning at 13000 rpm for 10 min, the pellet was obtained and

washed with 70% ethanol, again air-dried and resuspended in 200 μl deionized water.

The concentration of DNA was determined using spectrophotometer (SmartSpec Plus

BIORAD, USA). The conversion factor was O.D260 1=50 μg ml-1 and the absorbance

readings were taken at 260 nm wavelength. Every sample was diluted 10/100 in simple

distilled water before loading the sample in the cuvette (trUView Cuvette-BIORAD)

and dilution factor was set in the machine. The reading of machine was blanked by

loading the water, used for DNA dilution to subtract the background reading.

Appendix # 11

Phenol-chloroform Extraction of DNA

To remove proteins from DNA solutions, phenol:chloroform (1:1) extraction is used.

Add an equal volume of phenol:chloroform with the DNA solution and vortex until the

mixture turn milky. Centrifuge at 14,000 rpm for 10 minutes and transfer the upper

aqueous phase to a clean tube without disturbing the interface between the two phases.

Add 1/10 volume 3 M sodium acetate (pH 5.4) and 2.5 volumes chilled absolute

ethanol. Mix well and place at -20 °C for one hour. Centrifuge at maximum speed in a

microfuge. Wash DNA pellet with 70 % ethanol, air dry and dissolve in sterile distilled

water.

Appendix # 12

Depurination and Probe preparation

Depurination of DNA samples was done by submerging the gel in glass tray contained

250 ml depurination solution (0.25 M HCl) twice for 20 min and placed on an orbital

shaker and rinsed briefly with deionized water. The gel was rinsed with distilled water

twice in denaturation solution (1.5 M NaCl and 0.5 N NaOH) for 15 min in order to

denature the DNA and washed twice with deionized water. Afterwards, neutralization

was carried out by saturating the gel twice in neutralization solution (1 M Tris (pH 7.4),

1.5 M NaCl) for 15 min. By capillary method, DNA in the gel was transferred on nylon

membrane (Hybond-Amersham) using 10 X SSC (150 mM sodium citrate and 1.5 M

NaCl) as transferred buffer for almost 20 h. After removal of the membrane from gel,

Appendices

139

it was crosslinked in UV crosslinker (CL-1000 Ultraviolet Crosslinker-UVP) at 120 mJ

cm-2 energy. The membrane was supplemented with 0.2 ml cm-2 pre-hybridization

solution [6X SSC, 5X Denhardt’s solution (0.1% each of BSA, Ficol and PVP), 50%

deionized formimide, 0.5% SDS and 50 μg ml-1 salmon sperm DNA] in a hybridizer

for 2-4 h at 42 °C in order to block the attachment of probe to non-specific nucleic acid

binding sites.

Following the manufacturer’s instructions, Biotin DecaLabel DNA Labeling kit

(Fermentas, Germany) was used for labeling the purified DNA products of specific

genes. For probe making, a reaction mixture was prepared in 1.5 ml microcentrifuge

tube supplemented with 1 μg DNA template, 10 μl decanucleotide in 5X reaction buffer

and total of 44 μl of volume was made up by nuclease free water. The reaction mixture

was mixed gently, spinned down and DNA was denatured in a boiling water bath for 5-

10 min. After cooling the tube immediately on ice, added 5 μl biotin labeling mixture

and 1 μl DNA, mixed briefly by vortexing and spinned down quickly. Moreover, tube

was incubated at 37 °C for 1 to 20 h and the reaction was stopped by adding 1 μl 0.5 M

EDTA (pH 8.0) to reaction. Probe labeled with DNA was again denatured at 100 °C for

5 min, chilled on ice and mixed to the pre-hybridization solution (25-100 ηg ml-1). After

the treatment of pre hybridization solution for 2-4 h, the membrane was suplemented

with hybridization solution (60 μl cm-2) in the hybridization tubes and incubated

overnight in a hybridizer at 42 °C. The membrane was washed twice with 2X SSC and

0.1% SDS for 10 min then twice with 0.1X SSC and 0.1% SDS at 65 °C for 20 min,

respectively. Afterwards the membrane was floated in 30 ml Blocking/Washing Buffer

(provided by the manufacturer) for 5 min at room to detect the biotin-labeled DNA.

Blocking of non-specific binding sites was carried out by treating with 30 ml Blocking

Solution for 30 min and was incubated for 30 min in Streptavidin-AP conjugate diluted

in 20 ml blocking solution. The next washing was of 60 ml Blocking/Washing buffer

twice for 15 min and incubated for 10 min in 20 ml Detection Buffer. Finally, the

membrane was incubated in 10 ml Substrate Solution at room temperature in the dark

until blue-purple precipitate became visible. After discarding the Substrate Solution,

the reaction was finished by washing the membrane with distilled water for few

seconds.

Appendices

140

Appendix # 13

IRGA Specifications

Molar flow of air per unit leaf area 403.3 mmol m-2s-1, atmospheric pressure 99.9 kPa,

water vapor pressure inside the chamber 6.0 to 8.9 mbar, PAR at leaf surface up to

1160-1350 µmol m-2s-1, temperature of leaf from 35 to 42 °C, ambient temperature from

35 to 40 °C, ambient CO2 concentration of 350 µmol mol-1.

Appendix # 14

Leaf Membrane Stability Index

Stressed potato leaves of weight (0.2 g) were engaged in a tube having 10 ml of distilled

water. Tube containing leaves was heated at 40 °C in a water bath for 30 min and

electrical conductivity (C1) was determined using EC meter. Same procedure was

repeated for another set of leaves but this time incubated at 100 °C for 15 min and EC

(C2) was recorded.

Appendix # 15

Estimation of Na+ and K+ contents

Leaves were rinsed with deionized water for 10 sec, and then washed with cold LiNO3

isotonic solution. The leaves from transgenic and non-transformed control plants were

dried at 80 °C for 48 h. About 2 g material from dried plant tissue was weighed. Na+

and K+ were extracted from these tissues treated with 100 mM acetic acid at 90 °C for

at least 2 h.

Appendix # 16

Estimation of total amino acids

Salt stressed leaves of about 0.5 g were sliced and leaf extract was obtained by treating

with phosphate buffer (0.2 M) having pH 7.0. Leaf extract (1 mL) was mixed with 1

mL of pyridine (10%) and 1mL of ninhydrin (2%) solution in 25 ml test tube. Then the

sample mixture was heated in boiling water bath for about 30 min and volume of the

mixture was made up to 50 mL with distilled water.

Appendices

141

Appendix # 17

Proline Estimation

Plant extract (100 µl) was mixed with 1 ml of glacial acetic acid and ninhydrin reagent

(1.25 g ninhydrin warmed and dissolved in 30 ml glacial acetic acid, after cooling at

room temperature, 20 ml of 6M phosphoric acid was added) and heated for 1 h at 100

°C. Reaction was then terminated by placing the tubes in an ice bath then 4 ml of toluene

was added. The chromophore-containing toluene was separated from the aqueous phase

and warmed to room temperature, and its optical density was measured at 520 nm. The

amount of proline was determined from a standard curve.

Appendix # 18

Estimation of total soluble sugar

25 µl of the leaf cellular extract was taken into a tube containing 50 µl of 80% phenol

and 5 ml of concentrated sulfuric acid was then added with rapid mixing. The tubes

were allowed to stand for 10 min, and then shaken and placed in a water bath at 28 °C

for 15 min. The absorbance of the yellow-orange solution was measured at 490 nm for

total soluble sugars.

Appendix # 19

Estimation of Starch

Plant material (0.2–0.5 g) was harvested into tubes and freeze instantly in liquid

nitrogen. Sample volumes of between 0.02 and 0.2 ml are mixed with the assay reagents

and water in a 1 cm wide cuvette to give a final volume of 1 ml containing the reagents

for spectrophotometric assay. Moreover, its optical density was recorded at 340 nm.

Appendices

142

improvement of potato (solanum tuberosum l.) for abiotic...

Documents