in high-fat diet-induced obesity in rats through ellagic ... · meanwhile, ea supplementation...

©The Japan Endocrine Society

Original

Ellagic acid promotes browning of white adipose tissuesin high-fat diet-induced obesity in rats throughsuppressing white adipocyte maintaining genesLifeng Wang1), 2), 7) *, Yuanyuan Wei3) *, Chao Ning4), Minfang Zhang5), Ping Fan6), Dongyu Lei1), Jing Du1),Mengke Gale1), Yitong Ma7) and Yining Yang2), 7)

1) Department of Physiology, Basic Medicine College, Xinjiang Medical University, Urumqi, Xinjiang 830011, China2) Xinjiang Key Laboratory of Cardiovascular Disease Research, The First Affiliated Hospital of Xinjiang Medical University,

Urumqi, Xinjiang 830054, China3) Department of Physiology, School of Medicine, Chengdu University, Chengdu, Sichuan 610106, China4) Department of Medical Physiology & Biochemistry, Karamay College, Xinjiang Medical University, Karamay 834000, China5) Electron Microscopy Center, Central Laboratory of Xinjiang Medical University, Urumqi, Xinjiang 830054, China6) Heart Function Department, The First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang 830054, China7) Department of Cardiology, The First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang 830054, China

Abstract. Promoting brown adipose tissue (BAT) formation and function reduces obesity. Ellagic Acid (EA), locatedabundantly in plant extracts and fruits, has been shown to modulate formation and differentiation of adipocytes, although itsrole in the process of browning of white adipose tissue (WAT) has not been elucidated. In this study, fifty-six five-week oldSD rats were randomly assigned to receive normal diet (ND, 10% lipids) or high-fat diet (HFD, 60% lipid) with or withoutvarious dosages of EA for 24 weeks. Our results showed that high fat diet intake triggered overweight, glucose intoleranceand white adipocyte hypertrophy, the effects of which were mitigated by EA treatment. Meanwhile, EA supplementationreduced serum resistin levels, improved hepatic steatosis and serum lipid profile in DIO (high fat diet induced obesity) rats.Moreover, EA supplementation significantly decreased mRNA expression of Zfp423 and Aldh1a1, the key determinants ofWAT plasticity. EA also increased mRNA expression of brown adipocyte markers including UCP1, PRDM16, Cidea, PGC1α,Ppar-α; beige markers including CD137and TMEM26; mitochondrial biogenesis markers including TFAM in inguinal WAT(iWAT) when compared to their counterparts. EA treatment significantly improved mitochondrial function, as measured bycitrate synthase activity. More importantly, EA markedly elevated the expression of UCP1 in iWAT, which is a specific proteinof brown adipocyte. In conclusion, our results provided evidence that EA improved obesity-induced dyslipidemia and hepaticsteatosis in DIO rats via browning of iWAT through suppressing white adipocyte maintaining genes and promoting expressionof key thermogenic genes. These findings suggest that EA could be a promising therapeutic avenue to treat metabolicdiseases.

Key words: Ellagic acid, Obesity, Uncoupling protein 1, Browning of white adipose tissue

doi:10.1507/endocrj.EJ18-0467

OBESITY became the major independent risk factor forhypertension, dyslipidemia, type II diabetes and cardio‐vascular disease, and nonalcoholic fatty liver disease andhas become a major global health concern [1-3].

Submitted Nov. 5, 2018; Accepted Jun. 3, 2019 as EJ18-0467Released online in J-STAGE as advance publication Jul. 9, 2019Correspondence to: Yining Yang, MD, PhD, Department of Cardi‐ology, the First Affiliated Hospital of Xinjiang Medical University,No. 137, Rd. Liyu Mountain, Urumqi, 830054, Xinjiang, China.,Xinjiang Key Laboratory of Cardiovascular Disease Research, TheFirst Affiliated Hospital of Xinjiang Medical University, No. 137,Rd. Liyu Mountain, Urumqi, 830054, Xinjiang, China.E-mail: [email protected]*Both authors contribute equally to this work.

Although excess caloric intake and decreased energyexpenditure promote overall weight gain, visceraladiposity is particularly associated with metabolic disea‐ses [1]. As such, unique factors may control the develop‐ment and function of specific fat depots. WAT storesenergy in the form of triglycerides. Brown and beige fatcells are specialized to dissipate chemical energy in theform of heat and likely evolved to protect mammals fromhypothermia [4]. The strategies to induce BAT formationand/or browning of WAT are considered a potential andpromising therapeutic strategy to combat obesity and theassociated metabolic diseases [5].

This thermogenic function of brown and beige fat cellsare mediated predominantly by the presence of uncou‐

Endocrine Journal Advance Publication Endocrine Journal Advance Publication

pling protein 1 (UCP1), a protein that catalyzes a protonleak across the inner mitochondrial membrane [6]. Thekey characteristic of beige cells in WAT is the ectopicexpression of hallmark proteins for brown adipocytessuch as UCP1, PR domain-containing 16 (PRDM16),Cell death-inducing DFFA-like effector A (CIDEa), andperoxisome proliferator-activated receptor-γ co-activator1α (PGC1α) and peroxisome proliferator-activatedreceptor-α (PPAR-α) [7].

To date, there are no specific medical treatmentsapproved for obesity. Chemical medicines possess thesevere side effects [8]. Up-to-date, the best interventionfor obesity is lifestyle modification, although complianceis challenging. Recent evidence indicates that browningof white fat tissue propose a promising strategy for pre‐vention of obesity.

Dietary polyphenols have been extensively investiga‐ted for their effects on metabolic disease, such as obesity,type II diabetes, hyperglycemia, and insulin resistance inhumans and other animals [9, 10]. In a rat experimentalmodel of obesity, administration of epigallocatechingal‐late alleviated the severity of obesity [11]. Moreover,edible plants, such as bitter gourd [12] and resveratrol[13], have been shown to ameliorate glucose and lipidmetabolism disorders and improve high-fat diet-inducedobesity.

Ellagic acid (EA) is the highest content of polyphenolsin fruits, flowers and peels derived from a variety ofplants [14]. In previous study, we found that EA couldreduce adipogenesis through prevention of the inductionof Rb phosphorylation to inhibit the differentiation in3T3-L1 preadipocytes [15]. Panchal and colleaguesshowed that EA attenuates high-carbohydrate, high-fatdiet-induced metabolic syndrome in rats [16]. Okla andcoworkers showed that EA, the major polyphenols in theNAcy fraction of a muscadine grape phytochemical pow‐der (MGP), attenuated new fat cell formation and fattyacid biosynthesis in adipose tissues and decreased vis‐ceral fat mass in mice [17, 18]. However, the role for EAin browning of WAT has not been evaluated.

Here in this study, we sought to delineate the role ofEA in browning of WAT to explore the potential mecha‐nism involved. Our data show that EA induces browningof white fat, a process probably mediated by altering thewhite adipocytes maintaining genes expression ofZpf423 and Aldh1a1.

Materials and Methods

Animal modelsAnimal procedures were approved by The Medical

Experimental Animal Center of Xinjiang Medical Uni‐versity. Male SD rats (5 weeks old, 200 ± 20 g, n = 56)

were purchased from The Medical Experimental AnimalCenter of Xinjiang Medical University. Given the estro‐genic effects of the female, we used only male rats in ourstudy to avoid potential obesogenous effects of estrogenon the body fat distribution in rats. After acclimatizationfor a week, rats were randomly divided into sevengroups: normal diet-fed rats (ND; 10% kcal as fat; n = 8,Medical Experimental Animal Center, Xinjiang, China);high fat-diet rats (HFD; 60% kcal as fat; n = 8, Huafufei;Beijing, China); high fat diet-fed rats supplemented withhigh dose ellagic acid (HF + HDEA; n = 8; 30 mg/kg/d;Sigma, USA), high fat diet-fed rats with low dose ellagicacid (HF + LDEA; n = 8; 10 mg/kg/d; Sigma, USA);High fat diet-fed rats treated with the following knownanti-obesity drugs as positive control: Metformin Hydro‐chloride Extended-release Tablets (HF + DMBG; n = 8;89.25 mg/kg/d food; SFDA approval number:H20023370; Shiguibao pharmaceutical co. LTD; Shang‐hai; China) and Orlistat Capsules (HF + Orl; n = 7–8;37.8 mg/kg/d; SFDA approval number: H20143119;New time pharmaceutical co., LTD; Shandong, China)and Tiopronin enteric-coated tablets (HF + Tio; n = 7–8;47.25 mg/kg/d; SFDA approval number: H41020799;Xinyi pharmaceutical co. LTD; Henan, China). All theabove drugs were delivered to animals by oral gavage.Rats were housed in a 12-h light/12-h dark cycle andwith controlled humidity (50 ± 10%) and temperature(21 ± 2°C) in pathogen-free cages with provided foodand water ad libitum for 24 weeks. Body weight wasmeasured at a fixed time weekly and food intake wasmonitored twice a week in the whole study.

Intraperitoneal glucosetolerance test (IPGTT) andinsulin tolerance test (IPITT)

At the end of the intervention, the IPGTT and theIPITT were performed. For IPGTT, rats were fasted for12 h and then injected intraperitoneally with glucose sol‐ution (1.5 g/kg body wt; C150623D; Celun pharmaceuti‐cal co. LTD; Hubei, China). For IPITT, rats were fastedfor 4 h followed by intraperitoneal insulin injection (0.75IU/kg body wt; 8026589, Novo nordisk (China) pharma‐ceutical co. LTD). Blood glucose levels were measuredfrom tail vein at 0, 30, 60, 90, and 120 min with a glu‐cometer (Roche, Basel, Switzerland). In addition, thearea under the curve (AUC) of glucose concentrationwas calculated for both the IPGTT and the IPITT.

Blood and tissue collection and analysisAfter the 24-week protocol, animals were fasted for 12

hrs and then deeply anesthetized (intraperitoneal sodiumpentobarbital, 150 mg/g). Blood samples were collectedby abdominal aortic artery. The plasma was separated bycentrifugation at 4°C (3,000 r, 15 min) after placing 30

2 Wang et al.


min at room temperature; then the plasma was stored at–20°C until further biochemical analysis for determina‐tion of serum resistin, adiponectin, total cholesterol (TC),triglycerides (TG), low density lipoprotein cholesterol(LDL-C) and high densitylipoprotein cholesterol (HDL-C) by automatic biochemical analyzer (BS-320, Mindray,Shenzhen, China).

The subcutaneous inguinal fat pad, located in the mid‐thigh and the lower part of the rib cage, was consideredas the sWAT. All fat pads (epididymal, perirenal, retro‐peritoneal and inguinal) and liver were carefully dissec‐ted and weighed. The weight of all fad pads is used forcalculating the adiposity index determined as the ratiobetween the sums of all fat pads masses divided by thebody weight, represented as a percentage. sWAT (ingui‐nal White adipose tissue, iWAT) was also prepared forroutine histopathology or frozen to RT-qPCR analyses.

Histological and immunostaining analysisDissected liver and adipose tissue mass were fixed in

4% paraformaldehyde and embedded in paraffin.Paraffin-embedded tissues were cut at 3 μm and thecutting and largest slides were stained using forhematoxylin-eosin (HE) or immunohistochemistry forUCP-1 (Ab10983; Abcam). We analyzed each slideusing a digital image system (CX41; OLYMPUS, Japan).

Quantitative real-time PCRTotal RNA was isolated from iWAT and interscapular

fat depots respectively using Trizol (1596-026, Invitro‐gen; China) according to the manufacturer’s instructions.The purity and concentration of RNA were detected byNucleic acid quantitative analyzer (Thermo). cDNA wassynthesized by reverse transcriptional PCR following themanufacturer’s instructions. Each cDNA sample triplica‐ted and analyzed by quantitative real-time PCR that wasaccomplished on the Real-time instrument (ABI-7300,ABI, China) using SYBR Green PCR kit (#K0223;Thermo, USA) and gene-specific primers. The expres‐sion levels of target genes were normalized to the β-actinand Gapdh (see Table 1 for primer sequences).

Western blot analysisSamples of iWAT and interscapular fat depots were

homogenized and lysed in RIPA lysis buffer (Solarbio).The concentration of protein was assessed using BCAprotein assay kit (Thermo). We mixed protein withLaemmli sample buffer according to the proportion of1:3 and heated at 100°C for 10 min. Proteins (50 μg/lane) was subjected to 10% sodium dodecyl sulfate poly‐acrylamide gel electrophoresis (SDS-PAGE) and trans‐ferred electrophoretically to Polyvinylidene Fluoride(PVDF) membranes (Millipore). Membranes wereblocked with 10% skimmed milk powder in Tris-buffered saline Tween (TBST). Membranes were washedin TBST for 5 min and repeated 3 times and thenincubated overnight at 4°C with rabbit polyclonal anti-uncoupling Protein-1 (anti-UCP1), rabbit polyclonal

Table 1 Sequences of primers used in qRT-PCR

Gene Forward Reverse

UCP-1 TGGCATCCAGAGGCAAATC GCATTGTAGGTCCCAGTGTAG

PGC-1α AGGACACGAGGAAAGGAAGAC GGTAGCACTGGCTTGAATCTG

PPARγ GTTGACACAGAGATGCCATTC CGCACTTTGGTATTCTTGGAG

C/EBP-α TCGCTCCTCCATCTACATTC TCCCTGTCTTCTACCACTTG

C/EBP-β TCAGCACGCTGCGGAACTTG TGTTGCGTCAGTCCCGTGTC

β-actin CTGAACCCTAAGGCCAACCG GACCAGAGGCATACAGGGACAA

Zfp423 TCTACTCCTGCCCTTACTG GTACTCGCCGTTAGAGATG

Tmem26 AAGCAGCGACAGTAACAGAG ATGAGATTGGCACCACCTTC

Tfam GGGATTGGGCACAAGAAG GCATTCAGTGGGCAGAAG

Prdm16 CGCAGTTCCTGGTGACTACG CCTCCTGGCTTTCGCCTTAC

Ppar-α TGGACTTGAATGACCAGGTTAC ATGGCTTCCTCAGGTTCTTTAG

Nrf-1 CTTTCAGTCCTTCTGGCAGTAG GGAGTCTTCATCAGCACTTAGC

Cidea GTTTATGCGGGCGCTTATG TTCTCTTGCGGGAATCCTG

CD137 AGAAGCCTTGCTCCTCTACC AACCCTGCTCCGTTAGTTCC

Aldh1a1 GGAACACGGTGGTCGTCAAG CGCAGTTGGCCCATAACCAG

Gapdh GGAGTCTACTGGCGTCTTCAC ATGAGCCCTTCCACGATGC

Ellagic acid promote browning of WAT 3


anti-peroxisome proliferators activated receptor gammaco-activator-1 alpha (anti-PGC 1α), rabbit polyclonalanti-peroxisome proliferator-activated receptor gamma(anti-PPARγ), rabbit polyclonal anti-CCAAT/enhancerbinding protein alpha (anti-C/EBP α), rabbit polyclonalCCAAT/enhancer binding protein beta (anti-C/EBPβ)(abcam, Cambridge, MA, USA), rabbit polyclonal anti-actin (Abcam, Cambridge, MA, USA). Bound antibodieswere visualized with horseradish peroxidase (HRP) goatanti-rabbit IgG, goat anti-mouse IgG (Beyotime). Blotswere developed with IMS image analysis system(JRDUN).

Adipose tissue citrate synthase activitySamples of iWAT and interscapular fat depots were

homogenized in protein extraction buffer (50 mM Tris-HCl, 100 mM NaCl, 250 mM mannitol, 1 mM EDTA, 1mM EGTA, 1 mM DTT, 10% (vol/vol) glycerol, 1%(vol/vol) Triton and protease inhibitors) to obtain proteinlysates. The lipid layer was removed by centrifugationand protein concentration was determined using the BCAProtein Assay (Thermo Fisher Scientific Inc.). Proteinlysate (8 μg) was used for the assay of citrate synthaseactivity following the manufacturer’s protocol (Sigma).

Statistical analysisData are presented as the means ± SD. Differences

between the groups were analyzed using Student’s t-testor one way ANOVA followed by Dunnett’s multiplecomparisons test by GraphPad Prism version 5.0 forWindows (GraphPad Software, La Jolla CaliforniaUSA). P < 0.05 was regarded as statistically significant.

Results

EA prevents body weight gain, WAT mass expansion,impaired glucose and insulin tolerance in HFD rats

At the beginning of the experiment, ND and HFDgroups had no difference in their initial BW (bodyweight). After two week of dietary administration, theHFD group had a higher BW than the ND group, which

continued to increase. As shown in Table 2, seven groupsrats were fed either a ND or a HFD for 24 weeks, theweight gain in HFD group rats increased robustly com‐pared with the ND groups (p < 0.05; Fig. 1A, Table 2).Treatment with HDEA, LDEA, DMBG, Orlistat (Orl)and Tiopronin (Tio) prevented the HFD-induced BW (p< 0.05 vs. HFD; Fig. 1A, Table 2). Average food intakewas no difference in seven groups at any time point inthe study (p > 0.05; Fig. 1B Table 2).

The HFD group had a higher adiposity index than theND group. The treatments tackled this metabolic im‐pairment as HDEA, LDEA, DMBG, Orlistat (Orl) andTiopronin (Tio) had a reduced adiposity index whencompared to the untreated HFD group (p < 0.05). Theseresults are demonstrated in Table 2.

The HFD significantly uplifted fasting plasma levelsof glucose (p < 0.001 vs. ND; Fig. 1C). Meanwhile, HFDalso increased plasma glucose level 30 min after intra‐peritoneal injection of glucose in the glucose tolerancetest (p < 0.001; Fig. 1C), and same trend showed in thearea under the curve (AUC) of plasma glucose (p <0.001; Fig. 1D). Both high and low dosage of EA inhibi‐ted the HFD-induced increase in blood glucose in IPGTT(p < 0.001; Fig. 1C and D). Next, we performed IPITT toestimate relative insulin sensitivity. Results of IPITTshowed HFD feeding caused impaired insulin sensitivityin mice. Treatment of EA maintained insulin sensitivityin mice fed a HFD for 24 weeks (p < 0.05 and p < 0.001,respectively; Fig. 1E and 1F).

Blood parameters were monitored by biochemistry testperformed at the end of 24 weeks of the experiment. HF+ HDEA in our study did not significantly alter LDL-c(p = 0.3055) and TG (p = 0.076; Table 3). But TCincreased in HF + HDEA and orlistat groups (p < 0.05;Table 3). And we observes a significant rise of HDLC intreatment of HF + HDEA, HF + LDEA at 24 weeks vs.HFD (p < 0.05; Table 3).

Treatment with EA mitigated HFD-induced increasein resistin without affection of adiponectin

As shown in Fig. 2, serum levels of resistin were sig‐

Table 2 Parameters of seven groups male SD rats fed a ND or HFD for 25 weeks

Parameter ND HFD HFD + HDEA HFD + LDEA HFD + DMBG HFD + Orl HFD + Tio

Body weight (g) 410.49 ± 22.33 559.45 ± 29.46* 417.06 ± 42.93# 395.61 ± 30.83# 412.07 ± 49.26# 408.09 ± 52.18# 395.93 ± 63.49#

Adiposity index 3.33 ± 0.06 6.26 ± 0.2* 3.96 ± 0.16# 4.17 ± 0.13# 4.89 ± 0.08# 4.31 ± 0.14# 3.82 ± 0.08#

The thickness of rightperirenal fat (cm) 0.03 ± 0.01 0.22 ± 0.03** 0.05 ± 0.02# 0.06 ± 0.05# 0.05 ± 0.04# 0.01 ± 0.01## 0.08 ± 0.05

Average daily foodintake (g) 37.27 ± 5.25 29.98 ± 4.97 27.13 ± 4.33 28.37 ± 4.90 30.26 ± 5.24 29.79 ± 4.16 30.59 ± 5.28

Liver weight (g) 14.25 ± 2.22 16.73 ± 2.27* 12.28 ± 1.84## 13.67 ± 1.26# 14.23 ± 1.23# 14.20 ± 1.79# 14.04 ± 1.96#

Values are expressed as Means ± SD.* p < 0.05, ** p < 0.01 vs. ND group; # p < 0.05, ## p < 0.01 vs. HFD group.

4 Wang et al.


nificantly increased (p < 0.05) when fed HFD comparedto the ND group, and high dose but not low dose EAtreatment blocked the increase the serum resistin levelscaused by DIO (Fig. 2A). As for adiponectin, HFD ten‐ded to decrease the level but no statistical significancewas reached. Neither high nor low dose EA treatmentaltered the serum adiponectin levels (Fig. 2B).

Treatment with EA ameliorated HFD-induced tissuelipid accumulation

Tissue weight of liver was significantly increased inHFD. However, the treatments of HF + HDEA and HF +LDEA had a decreased liver weight when compared withHFD rats (p < 0.01; Fig. 3A). Consistently, H&E stainingshowed that HFD induced lipid accumulation and cellenlargement in iWAT and BAT, which were ameliorated

Fig. 1 EA inhibited high fat diet-induced body weight gain, adipose tissue expansion, glucose intolerance and insulin intoleranceA). Body weight of seven groups male SD rats fed a ND or HFD for 24 weeks (n = 7–8). B). The daily food intake during a 24weeks of ND or HFD. C). Plasma glucose levels during IPGTT after fasting for 12 hrs in seven animal groups (n = 7–8) fed withND or HFD for 24 weeks. D). Quantitative analysis of the AUC of glucose during the IPGTT using the trapezoidal rule (n = 7–8).E). Plasma glucose levels during IPITT following food withdrawal 3 hrs in seven animal groups (n = 7–8) fed with ND or HFD for24 weeks. F). Quantitative analysis of the AUC of glucose during the IPITT using the trapezoidal rule (n = 7–8). Values areexpressed as Means ± SD. * p < 0.05 vs. ND group, *** p < 0.001 vs. ND group; # p < 0.05, ### p < 0.001 vs. HFD group.



in HF + HDEA (Fig. 3B–D). Meanwhile, H&E stainingrevealed greater steatosis (fat deposition in the pericen‐tral areas) in livers of HFD rats. Interestingly, HFD-induced fat accumulation in the pericentral area wasovertly attenuated by HDEA and LDEA (Fig. 3B, 3E).

Intervention with EA markedly increases browningof WAT depots and restrain key proteins of whiteadipogenenic factors expression in iWAT

Reportedly, the browning of WAT can improve meta‐bolic profile, exerting protection the rats from high-fatdiet-induced obesity. Adipose tissue mass accumulationresults from proliferation and differentiation of adipo‐cytes, in which several key proteins of adipogenesis wereincluded. To determine whether alterations in brown fatspecific genes expression contributed to the protectiveeffect of glucose tolerance and body composition afterintervention with EA, we investigated the occurrence ofbrowning in inguinal fat depots and key proteins of adi‐pogenesis.

We firstly analyzed the expression of brown adipocytemarker genes in inguinal fat depot. The mRNA and pro‐tein level of UCP-1 (p < 0.001; Fig. 4A, 5A–B), PGC-1α(p < 0.001; Fig. 4B, 5A, 5C) were significantly reduced

in HFD vs. ND rats. But PPARγ (p < 0.001; Fig. 4C, 5D,5E), C/EBP-β (p < 0.001; Fig. 4D, 5D, 5F) and C/EBP-α(p < 0.001; Fig. 4E, 5D, 5G) were significantly elevatedin HFD when compare with ND rats. The reducingexpression levels of two brown fat markers, UCP-1 andPGC-1α, were recovered with high and low dosage treat‐ment of EA compared with the HF group (p < 0.01 orp < 0.001; Fig. 4A–B, 5A–C), and PPARγ, C/EBP-β andC/EBP-α were significantly reduced by the same treat‐ment (p < 0.001; Fig. 4C–E, 5D–G).

We also examined the potential effect of EA onZfp423 and Aldh1a1, the key determinants of WAT plas‐ticity, in inguinal fat pads [4, 19]. Our data revealed thatHFD increased Zfp423 (p < 0.05) and Aldh1a1 (p <0.001) gene expression, the effects of which were attenu‐ated significantly with the administration of high dose ofEA (Zfp423: p < 0.01; Aldh1a1 p < 0.05) (Fig. 4F–G).

To further clarify the function of EA on WAT brown‐ing, we measured mRNA expression of known BATmarkers including cell-death activator (Cidea), Ppar-α,PR domain–containing 16 (Prdm16) in the inguinal fatpad depot. HFD could not affect gene expression ofPpar-α and Prdm16, but HDEA could increase theirexpression (Ppar-α: p < 0.001, Fig. 4H; Prdm16: p <

Table 3 The serum lipid levels of TG, TC, HDL-C and LDL-C on rats in seven groups

Groups HDL-C (mmol·L–1) LDL-C (mmol·L–1) TC (mmol·L–1) TG (mmol·L–1)

ND 2.96 ± 0.37 0.38 ± 0.30 0.28 ± 0.16 6.59 ± 4.54

HFD 2.9 ± 0.59 0.81 ± 0.16* 1.37 ± 0.25* 9.86 ± 0.26*

HF + HDEA 3.97 ± 0.42*# 0.92 ± 0.15 1.64 ± 0.15# 9.20 ± 0.42

HF + LDEA 3.51 ± 0.38*# 1.00 ± 0.12 1.54 ± 0.1 9.07 ± 0.52

HF + DMBG 2.93 ± 0.42 0.67 ± 0.39 1.32 ± 0.23 9.55 ± 1.16

HF + Orl 3.43 ± 0.45*# 0.86 ± 0.18 1.65 ± 0.26# 9.70 ± 0.97

HF + Tio 3.62 ± 0.65*# 0.83 ± 0.15 1.57 ± 0.28 10.40 ± 2.59

Values are expressed as Means ± SD. * p < 0.05 vs. ND group; # p < 0.05 vs. HFD group.

Fig. 2 The effect of EA on the serum resistin (A) and adiponectin (B). Data were expressed as mean ± S.D. n = 6 rats. * p < 0.05 vs. ND;#p < 0.05 vs. HFD

6 Wang et al.


0.01, Fig. 4I). Meanwhile, the increase of Cidea expres‐sion triggered by HFD were blocked by the HDEA (p <0.01, Fig. 4J).

For beige marker CD137 and transmembrane protein26 (TMEM26), DIO failed to alter their expressionalthough administration of HDEA significantly increased

their levels (p < 0.01, Fig. 4K–L).The mitochondrial biogenesis related genes were also

measured. HFD decreased the levels of nuclear respira‐tory factor 1 (Nrf1) (Fig. 4M, p < 0.001), the effect ofwhich was unaffected by HDEA. Meanwhile, adminis‐tration of HFDA increased the gene expression of mito‐

Fig. 3 EA attenuated obesity-related adipocytes hypertrophy and hepatic steatosisA). Liver weight of rats in seven groups. Values are expressed as Means ± SD. B). Representative H&E staining of iWAT, BATand liver in seven animal groups (n = 7–8) fed with ND or HFD for 24 weeks. Original magnification: ×200. C). Proportion of cellsize in iWAT from these seven groups of the rats. D). Proportion of cell size in BAT from these seven groups of the rats. E). Lipiddroplet size in liver from these seven groups of the rats. All data are expressed as mean ± SD. * p < 0.05, *** p < 0.001 vs. ND. # p< 0.05, ##p < 0.01, ### p < 0.001 vs. HFD.



Fig. 4 EA promoted browning of iWATA–B). Relative mRNA expression of browning markers of iWAT from all groups (n = 7–8). UCP-1 (A), PGC1-α (B). C–E).Relative mRNA expression of white adipogenic factors in iWAT from all groups (n = 7–8). mRNA abundance was measured byqRT-PCR and expressed as fold increase compared with ND group. PPARγ (C), C/EBPβ (D), C/EBPα (E). F–G). Relative mRNAexpression of the key determinants of iWAT plasticity, Zfp423 (F) and Aldh1a1 (G) in iWAT. H–I). Relative mRNA expression ofknown BAT markers: Ppar-α (H), Prdm16 (I), Cidea (J). K–L). Relative mRNA expression of beige marker CD137 (K) andTMEM26 (L). M–N). Relative mRNA expression of the mitochondrial biogenesis related genes: Nrf1 (M) and Tfam (N). Valuesare expressed as Means ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. ND group. # p < 0.05, ## p < 0.01, ### p < 0.001 vs. HFD group.

8 Wang et al.


chondrial transcription factor (Tfam) (Fig. 4N, p <0.001), despite HFD had little effect on Nrf1 geneexpression.

Intervention with EA activated brown adipose tissuefunction in rats fed HF diet

Since intervention with EA increased browning of

Fig. 5 The effect of EA onprotein expression in iWAT under HFD feedingA). Western blot analysis performed in iWAT of rats fed an HFD with EA treatment, by using polyclonal antibodies to UCP-1 orPGC-1α. B–C). Densitometric scanning analyses of UCP-1 or PGC-1α by using β-actin as loading control. D). Western blot forPPARγ, C/EBP-β and C/EBP-α in iWAT of rats fed an HFD treated with EA. E–G). Densitometric scanning analyses of PPARγ,C/EBP-β and C/EBP-α by using β-actin as loading control. Values are expressed as Means ± SD. * p < 0.05, ** p < 0.01, *** p <0.001 vs. ND group. #p < 0.05, ## p < 0.01, ### p < 0.001 vs. HFD group.



WAT depots, we next assessed mRNA expression levelsof genes related to proliferation and differentiation andenergy expenditure in BAT. With the HFD, UCP-1 andPGC-1α were significantly downregulated in BAT. How‐ever, with the administration of HDEA mitigated thedecreasing of the mRNA expression levels (p < 0.001,Fig. 6A–B).

Intervention with EA activated a thermogenicprogram in WAT

To test whether Intervention with EA altered iWAT

function, we assayed mitochondrial activity using citratesynthase activity, the rate-limiting step of the tricarbox‐ylic acid cycle [4]. Citrate synthase activity was signifi‐cantly reduced in iWAT of HFD group but not in BAT ascompared to those in WT mice. The impairment of cit‐rate synthase activity was attenuated by administration ofEA (Fig. 7A). The increase in UCP-1 expression iniWAT was confirmed by immunohistochemistry staining(Fig. 7B).

Fig. 6 EA increased function of brown adipose tissue under high fat diet (HFD)-feedingA–B). Relative mRNA expression levels of genes related to thermogenesis in BAT of all groups (n = 7–8). Values are expressed asMeans ± SD. *** p < 0.001 vs. ND group; ## p < 0.01, ### p < 0.001 vs. HFD group.

Fig. 7 EA activates a browning program in iWATA). Citrate synthase activity in iWAT and BAT (n = 6). B). Representative UCP-1 staining of iWAT of the groups. Originalmagnification ×400. Values are expressed as Means ± SD. * p < 0.05 vs. ND group; ## p < 0.05 vs. HFD group.

10 Wang et al.


Discussion

The salient findings from this study revealed that oraladministration of EA for 24 weeks can prevent diet-induced obesity (DIO). These results have unraveled thepotential therapeutic role of EA in obesity through appa‐rent reduction in BW without influencing food intake,expansion of visceral fat mass, and sizes of adipocytes inDIO rats likely through a mechanism related to browningof WAT. In our hands, impaired glucose, insulin resist‐ance and hepatic steatosis were improved with adminis‐tration of EA in conjunction with reduced serum resistinlevels, improved hepatic steatosis and serum lipid profilein DIO rats. Nevertheless, treatment with HDEAenhanced gene expression of markers from brown/beigeadipocytes (UCP1, Ppar-α; PGC1-α, Cide a, PRDM16,CD137 and TEMEM26) and mitochondrial biogenesisrelated gene (Tfam) in the iWAT, suggesting browning inthis site. HDEA treatment increased mitochondrial cit‐rate synthase enzyme activity in iWAT but not BAT.Moreover, EA markedly elevated the expression ofUCP1 in iWAT. These observations were in compliancewith the presence of UCP1 positive beige adipocytes iniWAT, confirming the browning phenomenon with theHDEA treatment.

Reduced BW in EA treated groups is consistent withthe reduced adiposity index, WAT cell size and the con‐sequent improvement in insulin resistance. The enlargedadipocytes in HF group were in accordance with hyper‐insulinemia found because of the disrupted adipoinsularaxis, caused by the chronic HF diet intake [20]. Hence,hyperinsulinemia impaired the pancreatic islet functionwith time, in addition to its stimulating effect on lipogen‐esis, resulting in adipocyte hypertrophy, along with,however, inhibition of adipocyte hyperplasia and white/brown plasticity [21].

It is known that liver is one of the target sites of resis‐tin. In the current study, HDEA reduce plasma resistinlevels induced by HFD. Gene ablation of resistin inleptin-deficient mice improved hyperlipidemia and hep‐atic steatosis [22]. Yoshimura and colleagues showedthat EA improved hepatic steatosis and serum lipid com‐position through reduction of serum resistin levels [23].Our result also showed that the supplementation of EAdecreased the rise of serum resistin levels brought byHFD. However, EA fail to affect adiponectin level,which is consistent with the work from Yoshimura Y. andthe colleague [23, 24]. So it is thus plausible to speculatethat the HDEA may improve the hepatic steatosisthrough inhibition of resistin secretion.

Liu and coworkers displayed similar trend of elevatedblood level of high-density lipoprotein with EA treat‐ment, which may be responsible for restored cognitive

performance related to age-related overweight partici‐pants [25]. This indicated that beneficial metaboliceffects of EA were associated with improvement of lipidspectrum. In previous study, we found that EA treatmentretards adipogenesis through inhibition of differentiationin 3T3-L1 adipocytes [15]. Gourineni V. et al. showedthat the non-anthocyanin (NAcy) fraction of muscadinegrape phytochemicals (MGP) decreased visceral fat massin mice [17]. EA, the major polyphenols in NAcy frac‐tion, dramatically suppressed lipid accumulation in adose-dependent manner in vitro using the human adipo‐genic stem cell (hASCs) model. Meanwhile, EA attenu‐ated new fat cell formation and FA biosynthesis inadipose tissues. It also decreased synthesis of TG and FAas well as FA oxidation in livers from HFD fed mice[18]. EA exerted distinct lipid-lowering properties todecrease biosynthesis of FA in both adipocytes andhepatocytes, although it augmented FA oxidation only inhepatocytes [18]. Selvi and associates recently revealedthat EA inhibited adipogenesis through hinderingcoactivator-associated argininemethyltransferase 1(CARM1) [26], which is required for adipogenesis [27],to negatively regulatehistone 3 arginine 17methylation(H3R17me2).

Adipocyte browning has drawn some recent attentionto counter adverse metabolic consequences of obesity[28-31]. Transcriptional factor Zfp423 (C2H2 zinc-fingerprotein), a white adipocytes identity maintaining gene, ishighly expressed in WAT than BAT. Zfp423, which func‐tions in part through coactivation of Smad proteins in thebone morphogenic protein (BMP) signaling cascade, reg‐ulates preadipocyte levels of Ppar-γ and adipogenesis.Inducible genetic ablation of Zfp423 in white adipocytesof adult animals leads to a conversion of mature whiteadipocytes into functional beige adipocytes, fosteringresistance and reversal of diet-induced obesity andimpaired glucose homeostasis [19]. Mechanistically,Zfp423 acts in adipocytes to inhibit the activity of tran‐scriptional regulators Ebf2 and suppress Prdm16 activa‐tion. These data have identified the role for Zfp423 as amolecular brake on adipocyte thermogenesis and sugges‐ted a therapeutic strategy to unlock the thermogenicpotential of white adipocytes in obesity [19]. Retinalde‐hyde dehydrogenases 1a1 (Aldh1a1) was primarilyexpressed in visceral WAT, and its expression level washighly associated with obesity [4]. Florian W K. et al.showed that deficiency of the Aldh1a1 gene induced aBAT-like transcriptional program in WAT that droveuncoupled respiration and adaptive thermogenesis. WAT-selective Aldh1a1 knockdown conferred this BAT pro‐gram in obese mice, limiting weight gain and improvingglucose homeostasis [4]. EA supplementation signifi‐cantly decreased mRNA expression of Zfp423 and



Aldh1a1, which may decipher the possible mechanism(s)behind EA-induced promotion of browning of WAT.

Our current study also revealed that EA interventioneffectively improved mRNA levels and protein expres‐sion of UCP-1 and PGC-1α in conjunction withdecreased levels of PPARγ, C/EBP-β and C/EBP-α iniWAT in the face of HFD intake. Meanwhile, the loss ofUCP-1 and PGC-1α in DIO was significantly attenuatedwith EA treatment in interscapular brown fat, in closeassociation with the function of brown adipose tissues[30]. PGC-1α serves as a target of UCP-1, closely associ‐ated with browning of WAT [32, 33]. Recent studieshave unveiled a role of dietary polyphenols in preventionof obesity and obesity-related chronic diseases. Resvera‐trol, a natural polyphenol present in the skin of grapesand other plants, significantly increased mRNA and/orprotein expression of brown adipocyte markers includingUCP1 and PGC-1α in differentiated iWAT stromal vas‐cular cells (SVC), suggesting that resveratrol inducedbrown-like adipocyte formation in vitro. The UCP-1 pro‐tein content was 1.5-fold higher in the resveratrol groupthan that of the control group [34]. These observations ofEA-promoted brown adipose tissue were consistent withearlier reports [32-34].

It is noteworthy that HFD treated animals did notshow altered PRDM16, Ppar-α, TMEM26, CD137, Tfamgenes levels. However, administration of HDEA signifi‐cantly increased their expression. PRDM16 is involvedin the development and function of classical brown andbeige adipocytes [7]. Paul Cohen, et al. reported thatAdipo-PRDM16 KO mice showed reduced expression ofa broad panel of thermogenic (Pgc1a, and Ucp1), brownadipose identity (Cidea and Ppar-α) [7]. Cide-a andUCP1 are both localized to the mitochondria, andCIDEA was identified as a likely inhibitor ofUCP-1activity by forming a complex with it [21],besides being positively related to the size of lipid [35].Hence, HDEA treatment showed lowered Cide-a geneexpression accompanied by an enhanced UCP1 geneexpression.

TFAM and NRF-1 are crucial genes for mitochondrialbiogenesis. The coupling between the nucleus andmitochondria is governed by Nrf-1, which then signalsTFAM to activate mitochondrial DNA duplication [36].The HDEA treatment was found to facilitate TFAM genelevels without affecting the level of Nrf-1. Citrate syn‐thase is the rate-limiting enzyme in the tricarboxylic acidcycle [4]. The impaired enzyme activity in HFD wasameliorated by HDEA treatment. These observationswere in consistence with the presence of UCP1 positive

beige adipocytes in iWAT, which provide the evidencefor the role of EA on increasing thermogenic capacity inwhite fat, confirming the effect of the HDEA treatmenton browning.

Several experimental limitations prevail in our presentstudy. First and foremost, there is emerging evidence forproven health benefits for urolithin A, EA-derived gutmicrobial metabolite of unabsorbed ellagic acid and ella‐gitannins [37, 38]. It remains to be determined if it isurolithins rather than EA to account for a better strategyin the browning of iWAT. The absorbed EA is convertedto methyl esters, dimethyl esters, and glucuronides,which are eliminated through urination within 1–5 h afteringestion [39, 40]. Neither tissue nor plasma EA levelwas monitored to correlate the dose of EA and browningof iWAT. Body temperature or energy expenditure andthe mitochondria numbers should also be evaluated inwhite adipose tissue (WAT) to fully depict the functionof dosed EA. Further studies need to be carried to clarifythe direct mechanism of the effect of EA on insulin sen‐sitivity and reduced body weight or browning relatedgene expression profiles.

In conclusion, data from our study demonstrated thatEA offers some promises for HFD-induced hyperglyce‐mic, insulin resistance with altering the plasticity ofWAT. These results suggest a role for EA in altered met‐abolic profile through improving metabolic activity ofadipose tissue, which is expected to have a significantimpact on adiposity, glucose tolerance, and resistance toHFD through promoting the browning of WAT via alter‐ing the related gene profiles. EA reduces the expressionof key determinants of WAT plasticity while increasingexpression of brown/beige fat marker proteins, promot‐ing browning of white adipose tissue to improve obesity-induced dyslipidemia and hepatic steatosis in DIO rats.Further studies are warranted to reveal the in-depthmechanisms underneath browning of iWAT. More impor‐tantly, translational studies involving clinical trials andcommunity intervention are needed to further consolidatethe anti-obesity and/or anti-diabetic benefits of EA andother dietary resources with rich bioactive compounds.

Acknowledgments

This study was supported financially by Natural Sci‐ence Foundation of China (NSFC No. 81460636) andChina’s Post-Doc Foundation (BSH 5021). We thankMedical Experimental Animal Center of Xinjiang Medi‐cal University for providing laboratory and SD rats. Theauthors declare no conflicts of interest.

12 Wang et al.


References

1. Flegal KM, Kruszon-Moran D, Carroll MD, Fryar CD,Ogden CL (2016) Trends in obesity among adults in theUnited States, 2005 to 2014. JAMA 315: 2284–2291.

2. Jia W (2015) Obesity in China: its characteristics, diag‐nostic criteria, and implications. Front Med 9: 129–133.

3. Wang S, Ren J (2018) Obesity paradox in aging: fromprevalence to pathophysiology. Prog Cardiovasc Dis 61:182–189.

4. Kiefer FW, Vernochet C, O’Brien P, Spoerl S, Brown JD,et al. (2012) Retinaldehyde dehydrogenase 1 regulates athermogenic program in white adipose tissue. Nat Med 18:918–925.

5. Cypess AM, Kahn CR (2010) Brown fat as a therapy forobesity and diabetes. Curr Opin Endocrinol DiabetesObes 17: 143–149.

6. Abdullahi A, Jeschke MG (2017) Taming the flames: tar‐geting white adipose tissue browning in hypermetabolicconditions. Endocr Rev 38: 538–549.

7. Cohen P, Levy JD, Zhang Y, Frontini A, Kolodin DP, etal. (2014) Ablation of PRDM16 and beige adipose causesmetabolic dysfunction and a subcutaneous to visceral fatswitch. Cell 156: 304–316.

8. Derosa G, Maffioli P (2012) Anti-obesity drugs: a reviewabout their effects and their safety. Expert Opin Drug Saf11: 459–471.

9. Yang CS, Zhang J, Zhang L, Huang J, Wang Y (2016)Mechanisms of body weight reduction and metabolic syn‐drome alleviation by tea. Mol Nutr Food Res 60: 160–174.

10. Legeay S, Rodier M, Fillon L, Faure S, Clere N (2015)Epigallocatechin gallate: a review of its beneficial proper‐ties to prevent metabolic syndrome. Nutrients 7: 5443–5468.

11. Neyrinck AM, Van Hee VF, Bindels LB, De Backer F,Cani PD, et al. (2013) Polyphenol-rich extract of pome‐granate peel alleviates tissue inflammation and hyper‐cholesterolaemia in high-fat diet-induced obese mice:potential implication of the gut microbiota. Br J Nutr 109:802–809.

12. Alam MA, Uddin R, Subhan N, Rahman MM, Jain P, etal. (2015) Beneficial role of bitter melon supplementationin obesity and related complications in metabolic syn‐drome. J Lipids 2015: 496169.

13. Chen S, Zhao X, Ran L, Wan J, Wang X, et al. (2015)Resveratrol improves insulin resistance, glucose and lipidmetabolism in patients with non-alcoholic fatty liver dis‐ease: a randomized controlled trial. Dig Liver Dis 47:226–232.

14. Shaygannia E, Bahmani M, Zamanzad B, Rafieian-KopaeiM (2016) A review study on Punica granatum L. J EvidBased Complementary Altern Med 21: 221–227.

15. Wang L, Li L, Ran X, Long M, Zhang M, et al. (2013)Ellagic acid reduces adipogenesis through inhibition ofdifferentiation-prevention of the induction of Rb phos‐phorylation in 3T3-L1 adipocytes. Evid Based Comple‐ment Alternat Med 2013: 287534.

16. Panchal SK, Ward L, Brown L (2013) Ellagic acid attenu‐ates high-carbohydrate, high-fat diet-induced metabolicsyndrome in rats. Eur J Nutr 52: 559–568.

17. Gourineni V, Shay NF, Chung S, Sandhu AK, Gu L(2012) Muscadine grape (Vitis rotundifolia) and wine phy‐tochemicals prevented obesity-associated metabolic com‐plications in C57BL/6J mice. J Agric Food Chem 60:7674–7681.

18. Okla M, Kang I, Kim DM, Gourineni V, Shay N, et al.(2015) Ellagic acid modulates lipid accumulation in pri‐mary human adipocytes and human hepatoma Huh7 cellsvia discrete mechanisms. J Nutr Biochem 26: 82–90.

19. Shao M, Ishibashi J, Kusminski CM, Wang QA, Hepler C,et al. (2016) Zfp423 maintains white adipocyte identitythrough suppression of the beige cell thermogenic geneprogram. Cell Metab 23: 1167–1184.

20. Rachid TL, Silva-Veiga FM, Graus-Nunes F, Bringhenti I,Mandarim-de-Lacerda CA, et al. (2018) Differentialactions of PPAR-alpha and PPAR-beta/delta on beige adi‐pocyte formation: a study in the subcutaneous white adi‐pose tissue of obese male mice. PLoS One 13: e0191365.

21. Zhou Z, Yon Toh S, Chen Z, Guo K, Ng CP, et al. (2003)Cidea-deficient mice have lean phenotype and are resist‐ant to obesity. Nat Genet 35: 49–56.

22. Singhal NS, Patel RT, Qi Y, Lee YS, Ahima RS (2008)Loss of resistin ameliorates hyperlipidemia and hepaticsteatosis in leptin-deficient mice. Am J Physiol EndocrinolMetab 295: E331–E338.

23. Yoshimura Y, Nishii S, Zaima N, Moriyama T, KawamuraY (2013) Ellagic acid improves hepatic steatosis andserum lipid composition through reduction of serum resis‐tin levels and transcriptional activation of hepatic ppara inobese, diabetic KK-A(y) mice. Biochem Biophys ResCommun 434: 486–491.

24. Makino-Wakagi Y, Yoshimura Y, Uzawa Y, Zaima N,Moriyama T, et al. (2012) Ellagic acid in pomegranatesuppresses resistin secretion by a novel regulatory mecha‐nism involving the degradation of intracellular resistinprotein in adipocytes. Biochem Biophys Res Commun 417:880–885.

25. Liu Y, Yu S, Wang F, Yu H, Li X, et al. (2018) Chronicadministration of ellagic acid improved the cognition inmale middle-aged overweight. Appl Physiol Nutr Metab43: 266–273.

26. Selvi BR, Batta K, Kishore AH, Mantelingu K, Varier RA,et al. (2010) Identification of a novel inhibitor ofcoactivator-associated arginine methyltransferase 1(CARM1)-mediated methylation of histone H3 Arg-17. JBiol Chem 285: 7143–7152.

27. Yadav N, Cheng D, Richard S, Morel M, Iyer VR, et al.(2008) CARM1 promotes adipocyte differentiation bycoactivating PPARgamma. EMBO Rep 9: 193–198.

28. Seale P, Conroe HM, Estall J, Kajimura S, Frontini A, etal. (2011) Prdm16 determines the thermogenic program ofsubcutaneous white adipose tissue in mice. J Clin Invest



121: 96–105.29. Leonardsson G, Steel JH, Christian M, Pocock V,

Milligan S, et al. (2004) Nuclear receptor corepressorRIP140 regulates fat accumulation. Proc Natl Acad Sci US A 101: 8437–8442.

30. Guan L, Gong D, Yang S, Shen N, Zhang S, et al. (2018)Genipin ameliorates diet-induced obesity via promotinglipid mobilization and browning of white adipose tissue inrats. Phytother Res 32: 723–732.

31. Chen LH, Chien YW, Liang CT, Chan CH, Fan MH, et al.(2017) Green tea extract induces genes related to brown‐ing of white adipose tissue and limits weight-gain in highenergy diet-fed rat. Food Nutr Res 61: 1347480.

32. Bostrom P, Wu J, Jedrychowski MP, Korde A, Ye L, et al.(2012) A PGC1-alpha-dependent myokine that drivesbrown-fat-like development of white fat and thermogene‐sis. Nature 481: 463–468.

33. Lira VA, Benton CR, Yan Z, Bonen A (2010) PGC-1alpharegulation by exercise training and its influences on mus‐cle function and insulin sensitivity. Am J Physiol Endocri‐nol Metab 299: E145–E161.

34. Wang S, Liang X, Yang Q, Fu X, Rogers CJ, et al. (2015)Resveratrol induces brown-like adipocyte formation inwhite fat through activation of AMP-activated protein kin‐ase (AMPK) alpha1. Int J Obes (Lond) 39: 967–976.

35. Barneda D, Frontini A, Cinti S, Christian M (2013)

Dynamic changes in lipid droplet-associated proteins inthe “browning” of white adipose tissues. Biochim BiophysActa 1831: 924–933.

36. Gleyzer N, Vercauteren K, Scarpulla RC (2005) Control ofmitochondrial transcription specificity factors (TFB1Mand TFB2M) by nuclear respiratory factors (NRF-1 andNRF-2) and PGC-1 family coactivators. Mol Cell Biol 25:1354–1366.

37. Bialonska D, Kasimsetty SG, Khan SI, Ferreira D (2009)Urolithins, intestinal microbial metabolites of pomegran‐ate ellagitannins, exhibit potent antioxidant activity in acell-based assay. J Agric Food Chem 57: 10181–10186.

38. Larrosa M, Gonzalez-Sarrias A, Yanez-Gascon MJ, SelmaMV, Azorin-Ortuno M, et al. (2010) Anti-inflammatoryproperties of a pomegranate extract and its metaboliteurolithin-A in a colitis rat model and the effect of coloninflammation on phenolic metabolism. J Nutr Biochem 21:717–725.

39. Seeram NP, Henning SM, Zhang Y, Suchard M, Li Z, etal. (2006) Pomegranate juice ellagitannin metabolites arepresent in human plasma and some persist in urine for upto 48 hours. J Nutr 136: 2481–2485.

40. Garcia-Villalba R, Beltran D, Espin JC, Selma MV,Tomas-Barberan FA (2013) Time course production ofurolithins from ellagic acid by human gut microbiota. JAgric Food Chem 61: 8797–8806.

14 Wang et al.

in high-fat diet-induced obesity in rats through ellagic ... · meanwhile, ea supplementation...

Documents