in vitro models for investigating keratinocyte responses...

IN VITRO MODELS FOR INVESTIGATING

KERATINOCYTE RESPONSES TO

ULTRAVIOLET B RADIATION

Tara L. Fernandez

Bachelor of Biomedical Science (Honours)

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Faculty of Health

School of Biomedical Sciences

Institute of Health and Biomedical Innovation

Queensland University of Technology

2013

i Keywords

This thesis is dedicated in loving memory of:

Dr. Shila C. Fernandez

i Keywords

Keywords

Photobiology, keratinocytes, dermal fibroblasts, in vitro skin culture models,

epidermal regeneration, UVB radiation, epidermal-dermal interactions, insulin-like

growth factors, skin cancer, photodamage.

iii Abstract

Abstract

Australia experiences extreme levels of solar ultraviolet radiation (UVR), as

well as increasing rates of skin cancer incidence among the Australian population.

Strong associations between chronic unprotected sun exposure (in particular the

UVB radiation wavelength) and photocarcinogenesis have been established.

However, major knowledge gaps still exist in our understanding of the biology of the

cutaneous photoresponse, in particular the complex cellular and molecular mediators

involved in resisting and repairing UVB-induced damage. Due to the intricate nature

of human skin, the lack of complete, accessible and biologically-relevant

experimental models to investigate the human photoresponse has limited in vitro

investigations into these processes.

Keratinocytes are the primary cell type of the epidermis, which functions as a

barrier against environmental hazards. Due to their frequent exposure to genotoxic

insults like UVB radiation, keratinocytes are equipped with complex protective and

repair strategies against photodamage, including the formation of DNA photolesions.

Intercellular interactions between keratinocytes and dermal fibroblasts and the role of

this dermal-epidermal crosstalk in modulating keratinocyte responses to UVB

radiation have been relatively uncharacterised. These fibroblasts are known to

synthesize various factors with potent effects on basal keratinocytes, such as

stimulating proliferation, regulating epidermal regeneration and homeostasis.

Importantly, the association of these fibroblast-secreted factors with the acute

keratinocyte UVB radiation response and potentially their role in epidermal

photocarcinogenesis need to be further investigated.

The overriding aim of this thesis was therefore to characterise and develop 2-

dimensional (2D) and 3D in vitro skin models as platforms for investigating the

responses of human keratinocytes to UVB radiation. A tissue-engineered human skin

equivalent (HSE) model consisting of primary human keratinocytes cultured on a de-

epidermised dermal (DED) scaffold has been established in our laboratory as an

organotypic model to study aspects of skin biology. Importantly, this HSE-KC skin

model (comprised of a stratified epidermal layer with primary keratinocytes on a

iv Abstract

DED scaffold) has been previously demonstrated to retain several structural and

functional properties of the native epidermis. Hence, in this thesis, the

characterisation and validation of the HSE-KC skin model as a tool to study

keratinocyte responses to UVB radiation experimentally are reported. Significantly,

the HSE-KC was shown to possess several biological parallels to ex vivo skin, such

as the expression of several epidermal protein markers. Furthermore, histological and

immunohistochemical analysis of irradiated HSE-KC constructs showed the

generation of key markers of the epidermal photoresponse, including the formation

of DNA photolesions, apoptotic sunburn cells, increased synthesis of inflammatory

cytokines and shifts in epidermal proliferation and differentiation patterns.

To study the paracrine interactions between dermal fibroblasts and

keratinocytes, the novel application of a cell co-culture system to study the influence

of fibroblasts on modulating keratinocyte responses to UVB radiation is described

herein. Using this previously undescribed technique, I report the enhancement of

keratinocyte viability, an inhibition of UVB radiation-induced apoptosis and the

enhancement of DNA repair in cells co-cultured with fibroblasts prior to irradiation.

Next, this HSE-KC model was further developed and characterised as a model of

epidermal-dermal interactions during the acute UVB irradiation response via the

incorporation of human dermal fibroblasts into the DED component, termed the

HSE-KCF. This construct was utilised as a novel in vitro 3D model for studying the

influence of epidermal-dermal crosstalk on photodamage and repair in keratinocytes

post-irradiation. The protective effect of fibroblasts previously described in the

abovementioned 2D co-culture model was also observed in the epidermis of these

HSE-KCF models. Hence, the molecular mechanisms surrounding this fibroblast-

induced keratinocyte protection during the UVB irradiation response were further

analysed. Importantly, the presence of fibroblasts in the HSE-KCF skin constructs

modulated the expression and activation of elements of the UVB radiation-induced

apoptotic cascade including Bcl-2-associated death promoter (Bad) and caspase-3,

but not of cleaved poly (ADP-ribose) polymerase (PARP).

To further investigate this fibroblast-mediated protection of UVB-irradiated

keratinocytes, the effect of insulin-like growth factor-I (IGF-I) on cellular

photoresponses was also analysed. The insulin-like growth factor (IGF) system plays

a central role in dermal-epidermal interaction during the homeostatic maintenance of

v Abstract

the epidermis and during wound healing. In the studies presented in this thesis, the

modulation of keratinocyte photoresponses to UVB radiation by IGF-I-mediated

activation of the insulin-like growth factor receptor type 1 (IGF-IR) and the resulting

downstream pathways were reported. Significantly, IGF-IR activation: 1) enhanced

keratinocyte viability; 2) suppressed UVB radiation-induced apoptosis; 3)

accelerated the rate of UVR-induced photolesion removal; 4) increased the activation

of p53; 4) modulated cell cycle progression; and 5) enhanced the activation of DNA

damage response pathways. Notably, these results elucidate several mechanisms

through which the IGF-I system may regulate appropriate epidermal responses to

UVB radiation exposure, through the use of a novel in vitro photobiology culture

system. These findings have implications not only for broadening our understanding

of the involvement of fibroblast-keratinocyte interactions in the initiation of NMSCs,

but also as a potential therapeutic or protective strategy against cutaneous

photodamage and photocarcinogenesis.

In summary, this project has characterised and validated previously

undescribed primary cell-based in vitro platforms for photobiology research. The 2D

Transwell® and 3D organotypic HSE-KC and HSE-KCF described herein have

numerous possible applications in studying the biology of the cutaneous

photoresponse. Significantly, the impact of fibroblast-keratinocyte interactions, in

particular via the IGF-I system as reported in this thesis, has highlighted potential

targets for the possible development of novel therapeutic interventions against the

harmful effects of UVB radiation exposure.

vii

Table of Contents

KEYWORDS I

ABSTRACT III

TABLE OF CONTENTS .................................................................................................................. VII

LIST OF FIGURES ........................................................................................................................ XIII

LIST OF TABLES ............................................................................................................................ XV

LIST OF ABBREVIATIONS ........................................................................................................ XVII

STATEMENT OF ORIGINAL AUTHORSHIP ......................................................................... XXV

ACKNOWLEDGEMENTS ........................................................................................................ XXVII

PUBLICATIONS AND PRESENTATIONS ............................................................................... XXX

CHAPTER 1: LITERATURE REVIEW ........................................................................................... 1

1.1 Introduction .................................................................................................................................. 1

1.2 Ultraviolet radiation and skin cancer ........................................................................................... 1

1.3 UVR and the acute effects of its exposure in skin ....................................................................... 4

1.3.1 UVR-induced DNA photodamage .................................................................................... 6

1.3.2 Cellular UVB radiation-induced DNA damage response ................................................. 8

1.3.3 DNA photodamage repair mechanisms .......................................................................... 10

1.3.4 UVR-induced cell cycle arrest and apoptosis ................................................................. 11

1.3.5 The role of p53 in the cellular UV-response ................................................................... 13

1.3.6 UVR-induced inflammation and tanning ........................................................................ 13

1.3.7 UVR-induced immunosuppression ................................................................................. 14

1.4 Fibroblast-keratinocyte interactions during the UVR-response ................................................. 15

1.4.1 Epithelial-mesenchymal interactions in skin .................................................................. 15

1.4.2 Growth factors mediate epithelial-mesenchymal cross-talk ........................................... 16

1.5 The insulin-like growth factor system........................................................................................ 17

1.5.1 IGF-IR signalling pathways ............................................................................................ 19

1.5.2 IGF-I and its role in influencing keratinocyte responses to UVR ................................... 20

vii

1.5.3 A potential role of the IGF system in photocarcinogenesis ............................................ 22

1.6 Experimental models of photobiology ....................................................................................... 23

1.6.1 Cell culture systems ........................................................................................................ 24

1.6.2 Animal models ................................................................................................................ 26

1.6.3 In vivo clinical studies .................................................................................................... 28

1.6.4 In vitro skin models ........................................................................................................ 29

1.6.5 HSEs as in vitro photobiology models............................................................................ 31

1.6.6 HSE-DED as an organotypic model ............................................................................... 32

1.7 Summary and significance ......................................................................................................... 27

1.8 Project Hypotheses..................................................................................................................... 28

1.9 Project aims ................................................................................................................................ 28

CHAPTER 2: MATERIALS AND METHODS .............................................................................. 29

2.1 Introduction ................................................................................................................................ 29

2.2 Experimental procedures............................................................................................................ 29

2.2.1 Ex vivo skin tissue collection .......................................................................................... 29

2.2.2 Primary cell culture......................................................................................................... 30

2.2.3 Construction of human skin equivalent .......................................................................... 32

2.2.4 Co-culture of keratinocytes and dermal fibroblasts using a Transwell® cell

culture system ................................................................................................................. 34

2.2.5 UVB irradiation protocols .............................................................................................. 35

2.2.6 Histological analysis ....................................................................................................... 37

2.2.7 Immunohistochemical analysis ....................................................................................... 38

2.2.8 Immunofluorescent analysis ........................................................................................... 38

2.2.9 Image analysis ................................................................................................................ 39

2.2.10 Immunofluorescent analysis of Transwell® insert membranes ...................................... 39

2.2.11 TUNEL Assay for the detection of apoptotic cells ......................................................... 40

2.2.12 Assessment of cellular viability ...................................................................................... 40

2.2.13 Detection and quantification of secreted cytokines in 2D and 3D cultures .................... 41

2.2.14 Analysis of cell cycle phase by fluorescent-labelling of DNA content .......................... 42

2.2.15 Extraction of total RNA from HSE composites .............................................................. 43

2.2.16 Purification of total RNA from cell lysates .................................................................... 43

viii

2.2.17 Synthesis of double-stranded cDNA .............................................................................. 44

2.2.18 Primer design .................................................................................................................. 44

2.2.19 Analysis of differential gene expression using qRT-PCR .............................................. 44

2.2.20 Extraction of protein from HSE epidermal cell lysates .................................................. 45

2.2.21 Extraction of protein from Transwell® cell monolayers ................................................ 45

2.2.22 Protein separation of cell lysates using SDS-PAGE ....................................................... 46

2.2.23 Western immunoblotting ................................................................................................ 46

2.2.24 Statistical analysis .......................................................................................................... 47

CHAPTER 3: VALIDATION OF THE HSE-KC PHOTOBIOLOGY MODEL ......................... 49

3.1 Introduction................................................................................................................................ 49

3.2 Materials and methods ............................................................................................................... 53

3.2.1 Fixation of native skin samples ...................................................................................... 53

3.2.2 Construction and culture of the HSE-KC ....................................................................... 53

3.2.3 Irradiation of the HSE-KC .............................................................................................. 53

3.2.4 Histology ........................................................................................................................ 53

3.2.5 MTT assay of cell viability ............................................................................................. 53

3.2.6 Immunohistochemistry ................................................................................................... 53


3.2.8 TUNEL assay ................................................................................................................. 54

3.3 Results ....................................................................................................................................... 55

3.3.1 Immunohistochemical characterisation of the HSE-KC epidermis ................................ 55

3.3.2 Optimisation of UVB-irradiation protocol ..................................................................... 57

3.3.3 Assessment of cell viability in irradiated HSE-KC ........................................................ 58

3.3.4 Formation of CPDs in irradiated HSE-KC composites .................................................. 60

3.3.5 Formation of apoptotic keratinocytes in the irradiated HSE-KC .................................... 60

3.3.6 UVB-induced expression of p53 in the HSE-KC ........................................................... 61

3.3.7 Secretion of inflammatory cytokines by irradiated HSE-KC constructs ........................ 63

3.3.8 Removal of CPDs in HSE-KC post-irradiation .............................................................. 65

3.3.9 Expression of Ki-67 in irradiated HSE-KC .................................................................... 68

3.3.10 Keratinocyte differentiation ............................................................................................ 71

ix

3.4 Discussion .................................................................................................................................. 75

3.5 Conclusion ................................................................................................................................. 85

CHAPTER 4: FIBROBLAST-KERATINOCYTE INTERACTIONS AND THE ACUTE UVB

RESPONSE 87

4.1 Introduction ................................................................................................................................ 87

4.2 Materials and methods ............................................................................................................... 92

4.2.1 Primary human cell isolation and culture ....................................................................... 92

4.2.2 Transwell® fibroblast and keratinocyte co-cultures ....................................................... 92

4.2.3 Analysis of cellular viability ........................................................................................... 92

4.2.4 TUNEL assay for the detection of apoptosis .................................................................. 92


4.2.6 HSE-KC construction and culture .................................................................................. 92

4.2.7 Irradiation of keratinocyte monolayers on Transwell® inserts ....................................... 92

4.2.8 Optimisation of HSE-KCF culture protocol ................................................................... 93

4.2.9 Irradiation of the HSE-DED composites ........................................................................ 93

4.2.10 Histological analysis of tissues ....................................................................................... 94

4.2.11 Immunofluorescent analysis ........................................................................................... 94

4.2.12 Immunohistochemical analysis ....................................................................................... 94

4.2.13 Analysis of apoptotic pathways using ELISA ................................................................ 95

4.2.14 qRT-PCR analysis of gene expression ............................................................................ 95

4.2.15 Western immunoblotting analysis .................................................................................. 95

4.3 Results ........................................................................................................................................ 97

4.3.1 Optimisation of a Transwell® co-culture system photobiology model .......................... 97

4.3.2 Effects of fibroblast co-culture on cell viability in irradiated keratinocytes ................... 98

4.3.3 Effects of fibroblast co-culture on cell death in irradiated keratinocytes........................ 99

4.3.4 Fibroblast co-culture and the removal of UVB-induced DNA dimers in irradiated

keratinocytes ................................................................................................................. 105

4.3.5 Development and characterisation of the HSE-KCF skin model .................................. 109

4.3.6 Characterisation of the UVB response in HSE-KCF .................................................... 115

4.3.7 Mechanism of fibroblast-induced keratinocyte survival post-irradiation ..................... 125

4.3.8 Fibroblast-induced regulation of p53 in irradiated keratinocytes ................................. 130

x

4.4 Discussion ................................................................................................................................ 135

CHAPTER 5: INVESTIGATING THE ROLE OF IGF-I IN THE KERATINOCYTE UVB

RESPONSE 147

5.1 Introduction.............................................................................................................................. 147

5.2 Materials and methods ............................................................................................................. 151

5.2.1 Isolation and culture of primary human skin cells ........................................................ 151

5.2.2 Transwell® co-culture of keratinocytes and fibroblasts ............................................... 151

5.2.3 Irradiation of keratinocyte monolayers ......................................................................... 151

5.2.4 Quantification of IGF-I in cell culture supernatants ..................................................... 151

5.2.5 Testing the effects of exogenous IGF-I on irradiated keratinocytes ............................. 151

5.2.6 Testing the effects of fibroblast conditioned medium on irradiated keratinocytes ....... 152

5.2.7 Analysis of keratinocyte viability ................................................................................. 152

5.2.8 Analysis of IGF-IR-mediated cell signalling pathways using Western

immunoblotting ............................................................................................................ 153

5.2.9 Cell cycle analysis by flow cytometry .......................................................................... 153

5.2.10 Analysis of apoptosis in irradiated keratinocytes ......................................................... 153

5.2.11 Analysis of the formation of UVB-induced CPD photolesions in irradiated

keratinocytes ................................................................................................................. 154

5.2.12 Blocking IGF-IR function using a neutralisation antibody ........................................... 154

5.2.13 Analysis of differential gene expression using qRT-PCR ............................................ 154

5.2.14 UVB radiation-induced DNA damage response antibody array ................................... 154

5.3 Results ..................................................................................................................................... 157

5.3.1 In vitro concentration of IGF-I in 2D and 3D cultures ................................................. 157

5.3.2 Effect of IGF-I on irradiated keratinocyte viability ...................................................... 158

5.3.3 IGF-IR signalling in irradiated keratinocytes ............................................................... 160

5.3.4 Effect of IGF-I on UVB-induced apoptosis .................................................................. 162

5.3.5 Effects of the blocking of IGF-IR activation on cell death in irradiated

keratinocytes ................................................................................................................. 163

5.3.6 Effect of IGF-I on the repair of UVB-induced DNA damage ...................................... 166

5.3.7 Repair of UVB-induced CPDs with IGF-IR neutralisation in irradiated

keratinocytes ................................................................................................................. 167

5.3.8 Effect of IGF-I on p53 expression in irradiated keratinocytes ...................................... 169

xi

5.3.9 Effect of IGF-I on cell cycle phase ............................................................................... 171

5.3.10 DNA damage response proteins ................................................................................... 172

5.4 Discussion ................................................................................................................................ 176

CHAPTER 6: GENERAL DISCUSSION ...................................................................................... 187

BIBLIOGRAPHY ............................................................................................................................. 203

xiii List of figures

List of Figures

Figure 1.1. The structure of human skin. ................................................................................................ 2

Figure 1.2. UVR-induced skin cancers ................................................................................................... 4

Figure 1.3. Penetration of UVR wavelengths into human skin. .............................................................. 5

Figure 1.4. Effects of UVB irradiation on skin cells. .............................................................................. 6

Figure 1.5. Cell cycle checkpoint pathways initiated by UVB radiation-induced DNA damage ............ 9

Figure 1.6. Signalling cascades associated with IGF-IR activation ...................................................... 20

Figure 1.7. Downstream cell survival effects from IGF-IR activation. ................................................. 21

Figure 1.8. A potential role of the IGF system in photocarcinogenesis ................................................ 23

Figure 1.9. HSE-DED composites in culture ........................................................................................ 33

Figure 1.10. Comparison of histology between native skin and HSE-DED sections. ........................... 34

Figure 2.1. Timelines of 2D and 3D keratinocyte in vitro culture methods .......................................... 34

Figure 2.2. Transwell® co-culture of primary human keratinocytes and fibroblasts ............................ 35

Figure 2.3. UVB irradiation of cells and skin tissue samples ................................................................ 37

Figure 3.1. Comparison of cutaneous markers in HSE-KC and native skin ......................................... 56

Figure 3.2. Dose-response of HSE-KC to UVB radiation. .................................................................... 58

Figure 3.3. Epidermal viability following UVB-irradiation in HSE ..................................................... 59

Figure 3.4. UVB exposure induces the formation of CPDs in HSE-KC ............................................... 60

Figure 3.5. Apoptotic keratinocytes in irradiated HSE-KC ................................................................... 61

Figure 3.6. UVB induces p53 expression in irradiated HSEs................................................................ 62

Figure 3.7. Quantification of IL-6 and IL-8 concentrations in HSE-KC culture supernatants .............. 64

Figure 3.8. Detection of CPDs in irradiated HSE-KC over time........................................................... 66

Figure 3.9. Repair of CPDs in irradiated HSE-KC ............................................................................... 67

Figure 3.10. Detection of Ki-67 in irradiated HSE-KC ......................................................................... 69

Figure 3.11. Quantification of Ki-67 expression in irradiated and non-irradiated HSE-KC ................. 70

Figure 3.12. Time-course analysis of keratin 1/10/11 expression in irradiated and control HSE-

KC ........................................................................................................................................ 72

Figure 3.13. Quantification of keratin 1/10/11 expression in HSE-KC over time ................................ 73

Figure 3.14. Validation of the HSE-KC as a photobiology model ........................................................ 86

Figure 4.1. Irradiation of keratinocyte monolayers cultured in different co-culture conditions ............ 93

Figure 4.2. Cell viability of keratinocytes in UVB-irradiated Transwells®.......................................... 98

Figure 4.3. UVB-induced keratinocyte apoptosis in a 2D co-culture model ....................................... 101

Figure 4.4. Fibroblast co-culture inhibits apoptosis in irradiated keratinocyte monolayers ................ 102

Figure 4.5. Detection of cleaved caspase-3 in irradiated keratinocyte monolayers ............................. 104

xiv List of figures

Figure 4.6. Repair of CPD in irradiated keratinocyte monolayers in different culture conditions ...... 107

Figure 4.7. Fibroblasts enhance repair in irradiated keratinocyte monolayers .................................... 108

Figure 4.8. Optimisation of fibroblast seeding in the construction of HSE-KCF ............................... 110

Figure 4.9. Collagen IV expression in HSE-KCF and native skin ...................................................... 112

Figure 4.10. Expression of vimentin in native skin and HSE composites ........................................... 113

Figure 4.11. Histology of HSE-KCF in culture................................................................................... 114

Figure 4.12. Histology of irradiated HSE-KCF .................................................................................. 116

Figure 4.13. Quantification of IL-6 and IL-8 concentrations in HSE-KCF culture supernatants........ 117

Figure 4.14. UVB-induced formation of CPDs in HSE-KCF ............................................................. 119

Figure 4.15. Rate of CPD repair in irradiated HSE-KC and HSE-KCF .............................................. 120

Figure 4.16. Effect of UVB on keratinocyte proliferation in the HSE-KCF ....................................... 122

Figure 4.17. Keratinocyte apoptosis in irradiated HSE-KC and HSE-KCF following UVB

irradiation. .......................................................................................................................... 124

Figure 4.18. Relative expression of Bad and phosphorylated-Bad in irradiated HSE-KC and

HSE-KCF ........................................................................................................................... 126

Figure 4.19. Relative expressions of cleaved PARP in irradiated HSE-KC and HSE-KCF ............... 128

Figure 4.20. Relative expressions of cleaved caspase-3 in irradiated HSE-KC and HSE-KCF .......... 129

Figure 4.21. Relative expression of p53 in HSE-KC and HSE-KCF after UVB irradiation. .............. 131

Figure 4.22. Relative levels of p53 protein in irradiated HSE-KC and HSE-KCF composites .......... 133

Figure 5.1. Experimental set up for testing the effects of IGF-I on irradiated keratinocytes .............. 152

Figure 5.2. Experimental set up for testing the effects of fibroblast conditioned medium on

irradiated keratinocytes ...................................................................................................... 152

Figure 5.3. Quantification of IGF-I concentration in cell culture supernatants ................................... 158

Figure 5.4. Effects of IGF-I treatment on the viability of irradiated keratinocyte monolayers ........... 159

Figure 5.5. Activation of IGF-IR-mediated signalling pathways in irradiated keratinocytes ............. 161

Figure 5.6. Effect of IGF-I on UVB-induced apoptosis in human keratinocytes ................................ 163

Figure 5.7. Effect of IGF-IR blocking antibody treatment on UVB-induced apoptosis in

irradiated keratinocytes ...................................................................................................... 165

Figure 5.8. Effect of IGF-I on the repair of UVB-induced CPDs in irradiated keratinocytes ............. 167

Figure 5.9. Effect of IGF-IR blocking antibody treatment on the formation of UVB-induced

DNA dimers in irradiated keratinocytes ............................................................................. 168

Figure 5.10. Relative gene and protein expressions of p53 in irradiated keratinocytes ...................... 170

Figure 5.11. Effect of growth factor pre-treatment on cell cycle phases in irradiated

keratinocytes ...................................................................................................................... 172

Figure 5.12. Expression of DNA damage response proteins in IGF-I-treated irradiated

keratinocytes ...................................................................................................................... 173

xv List of tables

List of Tables

Table 1.1.1. Characteristics of commonly used in vitro and in vivo models for studying skin

cancer biology. ..................................................................................................................... 25

xvii List of abbreviations

List of Abbreviations

(6-4)PP (6-4) pyrimidone photoproducts

°C degrees Celsius

µg/µL micrograms per microlitre

µg/mL micrograms per millilitre

µm micrometer

µM micromolar

µmol micromoles

2D two-dimensional

2-∆∆C

T relative comparative threshold cycle method

3D three-dimensional

3T3 3T3 mouse fibroblast cell line

8-oxo-dG 8-oxo-2'-deoxyguanosine

25(OH)D 25-hydroxyvitamin D3

ABAM antibiotic/antimycotic solution

ACTH adrenocorticotropic hormone

AKT protein kinase B

ANOVA analysis of variance

Arg arginine

Asp aspartic acid

ATM Ataxia telangiectasia mutated

ATR Ataxia telangiectasia mutated and Rad3-related protein

ATRIP ATR-interacting protein

Bad Bcl-2-associated death promoter

Bax Bcl-2-associated X protein

http://en.wikipedia.org/wiki/Ataxia_telangiectasia_mutated

http://en.wikipedia.org/wiki/Ataxia_telangiectasia_mutated

xviii List of abbreviations

BCC basal cell carcinoma

Bcl-2 B-cell lymphoma 2

b-FGF basic fibroblast growth factor

BM basement membrane

BSA bovine serum albumin

CDK cyclin dependent kinase

cdk-1 cyclin dependent kinase-1

cDNA complementary DNA

cm centimetres

CM conditioned medium

CMM cutaneous malignant melanoma

CO2 carbon dioxide

CPD cyclobutane pyrimidine dimer

CT threshold cycle

DAPI 4',6-diamidino-2-phenylindole

DED de-epidermised dermis

DMBA 7,12-dimethylbenz[α]anthracene

DMEM Dulbecco’s modified Eagles medium

DMEM/F-12 Dulbecco’s modified Eagles medium/ Ham’s F-12

DNA deoxyribonucleic acid

DNase I deoxyribonuclease I

dUTP 2´-deoxyuridine, 5´-triphosphate

ECM extracellular matrix

EDTA ethylenediamine tetra-acetic acid

EGF epidermal growth factor

ELISA enzyme-linked immunosorbent assay

ELK-1 E-twenty-six (ETS)-like transcription factor 1

xix List of abbreviations

ERK 1/2 extracellular signal-related kinase-1 and 2

FCS foetal calf serum

FGM full Green’s medium

Fib fibroblast

FKH fork head

g grams

G0 Gap zero (resting) phase

G1 Gap one (post-mitotic) phase

G2 Gap two (pre-mitotic) phase

GAPDH glyceraldehyde 3-phosphate dehydrogenase

GM-CSF granulocyte-macrophage colony-stimulating factor

Gy gray

HGF hepatocyte growth factor

HGF/SF hepatocyte growth factor/scatter factor

HRP horseradish peroxidase

HSE human skin equivalent

HSE-DED human skin equivalent- de-epidermised dermis

HSE-KC human skin equivalent (keratinocyte only)

HSE-KCF human skin equivalent (keratinocyte and fibroblast-populated DED)

IGF-2R insulin-like growth factor type-2 receptor

IGFBP insulin-like growth factor binding protein

IGF-I insulin-like growth factor-I

IGF-II insulin-like growth factor type-2

IGF-IR insulin-like growth factor type-1 receptor

IGF-IRα insulin-like growth factor receptor α subunit

IGF-IRβ insulin-like growth factor receptor β subunit

IgG immunoglobulin G

xx List of abbreviations

IL interleukin

IRS-1 insulin-receptor substrate type-1

JNK c-Jun N-terminal kinase

kb kilobases

kDa kilo Dalton

KGF keratinocyte growth factor

Leu leucine

m metres

M molar

MAPK mitogen-activated protein kinase

MC1R human melanocortin 1 receptor

MDM2 mouse double minute 2

MED minimal erythemal dose

MEK mitogen-activated protein kinase

mins minutes

MITF microphthalmia-associated transcription factor

mJ millijoules

mL millilitre

mm millimetres

MRN MRE11-RAD50-NBS1

mRNA messenger ribonucleic acid

mTOR mammalian target of rapamycin

MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-

sulfophenyl)-2H-tetrazolium)

MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

mw molecular weight

NER nuclear excision repair

http://cat.inist.fr/?aModele=afficheN&cpsidt=14622962

http://en.wikipedia.org/wiki/Di-


http://en.wikipedia.org/wiki/Thiazole

http://en.wikipedia.org/wiki/Phenyl

xxi List of abbreviations

ng/µL nanogram per microlitre

nm nanometers

NMSC non-melanoma skin cancer

N-terminal amino-terminal

p p-value

p-AKT phosphorylated AKT

PARP poly (ADP-ribose) polymerase

PBS phosphate buffered saline

PDK-1 pyruvate dehydrogenase lipoamide kinase isozyme 1

PFA paraformaldehyde

PGE2 prostaglandin E2

pH H+ ion concentration

PI3K phosphoinositol 3-kinase

p-IGF-IR phosphorylated IGF-IR

POMC pro-opiomelanocortin

PTEN phosphatase and tensin homolog

PTH-rp parathyroid hormone-related protein

PTP protein tyrosine phosphatases

Px passage number x

qRT-PCR quantitative real time polymerase chain reaction

Raf-1 raf proto-oncogene serine/threonine protein kinase-1

RNA ribonucleic acid

ROS reactive oxygen species

RTK receptor tyrosine kinase

S-phase synthesis phase

SCC squamous cell carcinoma

SCF stem cell factor

xxii List of abbreviations

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

SEM standard error of the mean

Ser serine

SFM serum-free medium

ssDNA single-stranded DNA

T time (hours)

T3 triiodothyronine

Tm melting temperature

TAE tris-acetate/ethylenediaminetetraacetic acid

t-AKT total-AKT

TBS-T tris-buffered saline Tween-20

t-ERK total extracellular signal-related kinase

TGF-β transforming growth factor β

Thr threonine

t-IGF-IR total insulin-like growth factor type-1 receptor

t-IGF-IR total insulin-like growth factor receptor

TMB 3,3',5,5'-tetramethylbenzidine

TNF-α tumour necrosis factor-α

TPA 12-O-tetradecanoylphorbol-13-acetate

TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling

Tyr tyrosine

TYR tyrosine kinase

U/mL units per millilitre

UVA ultraviolet radiation A

UVB ultraviolet radiation B

UVC ultraviolet radiation C

UVR ultraviolet radiation

http://en.wikipedia.org/wiki/12-O-Tetradecanoylphorbol-13-acetate

xxiii List of abbreviations

V volts

XP Xeroderma pigmentosum

α alpha

α-MSH alpha-melanocyte-stimulating hormone

β beta

xxv

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature: _________________________

Date: _________________________ 17 July 2013

QUT Verified Signature

xxvii

Acknowledgements

Firstly, I would like to extend my heartfelt gratitude to the wonderful supervisory

team who supported me through my PhD journey. Firstly, thank you Zee for the

opportunity to be a part of the TRR team and for all your guidance and advice. Your

accomplishments have been a great inspiration and your encouragement and belief in my

abilities certainly mean a lot. I am also very appreciative of the chances I’ve been given

for international conference travel, which have definitely been highlights of this journey.

A great big thank you, Derek, for all the generosity you’ve shown with your time,

practical help, looking through my many drafts and posters, keeping me on track and for

always delivering it all with a huge smile. Thanks for celebrating even the smallest of

my accomplishments. It was a big motivation having your unwavering support from start

to finish.

To Michael, you have been a wonderful mentor. Thank you so much for being

always enthusiastic and optimistic throughout my project, while always injecting a

healthy dose of reality when needed! I am very grateful for being included as an

honorary member of CRESH and the AusSun group and for all your advice and support.

Thank you Rebecca for being the human Google for all things HSE/skin related,

for all the knowledge and techniques you’ve passed on to me, for being genuinely

excited about my work and for always showering me with praise along the way. Your

friendship and guidance have definitely helped me keep my head above water.

Finally, thank you David for your insightful comments and for your signature

post-presentation questioning, which has certainly prepared me for even the toughest of

audiences! Your input and assistance (and lunch-time humour) are very much

appreciated.

I would like to extend my gratitude to the brilliant members of the TRR Skin

Group. A special thank you goes out to Jacqui and Emily for assisting me with qRT-PCR

and immunohistochemistry. You have all always been incredibly supportive of me and

so generous with ideas and constructive criticism. The many, MANY hours spent in the

Primary Room were only bearable thanks to the never-ending supply of laughs and good

conversation.

xxviii

My wonderful friends from the TRR group, I thank you for all your support and

many fond memories. Thank you Gary for the supply of IGF-I and sarcasm, Ali: thanks

for being a great pal and always making me laugh, Tony for your encouragement and

chats over beers, Dayle: thesis writing was a little less painful with you in the same boat,

Svenja for letting me be a part of your PhD project (ouch!), and Arnulf, thanks for

always cheering me on and being a great friend!

I would like to thank those who have generously contributed their time to making

this project a success: Leo de Boer, for assistance with cell imaging and FACS, to Elke

Hacker for being a fantastic source of guidance and advice towards this project, Clay

Winterford and the QIMR Histology team for your assistance with

immunohistochemistry, Dod and David for their hard work behind the scenes, Nicky

Gillott, Sharyn McCormack and Stella Winn for all your wonderful support and help.

To my buddy Abhishek ‘Beebs’ Kashyap, you have been a continuous source of

entertainment with your crazy sense of humour, our many ideas on how we can become

millionaires, and of course being my human guinea pig for my study on protein

consumption and (lack of) muscle growth. This journey would have been unbearable

without you sitting right there behind me, and for that you have my eternal gratitude.

And to the other member of the Wolfpack, my beloved friend: Manas ‘Chubes’

Sivaramakrishnan. Thanks for being right beside me through all the funniest, best, worst,

craziest (and slightly fuzzy) memories. Your zest for life and obsession with antioxidants

has helped keep me sane and youthful. You are truly an amazing person and your

friendship means the world to me!

My heartfelt thanks go to my family for being my pillar of strength. To my

parents, Ivan and Shila Fernandez, for always making me believe I have limitless

potential and for providing countless opportunities to make my dreams a reality. To

Devin Fernandez, my best friend and incredibly talented brother: knowing how proud

you are of me is what keeps me going. To my aunt, Mema, thank you for the continuous

supply of love and prayers, which were great sources of strength. Claudine Michael, you

are my rock and I could not have achieved this without your blind faith in my abilities,

being right beside me through this rollercoaster ride and your constant iChats. Your

resilience and philosophies on life will always be a huge inspiration to me. Uncle

Lawrence & Mama Yvonne: thanks for all your encouragement and for always being so

proud of me. Aunty Gill, thank you for being so supportive and genuinely excited about

all my academic endeavours and achievements.

xxix List of abbreviations

To my wonderful friends who have always been behind me despite the miles

between us. Thank you to Vanessa Low for all the years of loyal friendship, for sharing

in all my joys and for being a ray of hope through the tough times. Thank you, Ganeshini

Sri Kanthan for being a wonderful sister and for believing in my biology skills since we

were kids. Janita Kumar, thanks for cheering me on, the good advice and for being ever

ready to celebrate my arrival. To Zarina Muhammad for over a decade of love and

laughs and for being the biggest fan of my scientific pursuits.

Last but not least, I would like to acknowledge all the generous skin donors for the

donation of their tissues, as well as the research and clinical staff members that facilitate

skin collection; without their contributions, this project would not be possible.

xxx Presentations and publications

Publications and presentations

Fernandez T.L., Dawson, R. A., Van Lonkhuyzen, D. R., Kimlin, M. G., Upton, Z.

(2012) A tan in a test tube: in vitro models for investigating ultraviolet radiation-

induced damage in skin. Experimental Dermatology 21:404-10.

Fernandez T.L., Van Lonkhuyzen, D. R., Dawson, R. A., Leavesley, D., Kimlin, M.

G., Upton, Z. (2012) Human dermal fibroblasts protect against UVB radiation-

induced keratinocyte damage in a human skin equivalent model. Society for

Investigative Dermatology Meeting, Raleigh, North Carolina, 8-12 May (Poster

presentation)



induced keratinocyte damage in a human skin equivalent model. 6th Australian

Health and Medical Research Congress, Adelaide, 25 - 28 Nov (Poster presentation)



induced keratinocyte damage in a human skin equivalent model. Australasian Wound

& Tissue Repair Society Meeting – ‘Repair and regeneration’, Sydney, Australia,

22-24 May (Oral presentation)


G., Upton, Z. (2011) The human skin equivalent model: A tool for studying the

effects of UV radiation in skin. Molecular and experimental pathology society of

Australia Annual Conference, Brisbane, Australia 30 Nov – 2 Dec (Oral

presentation)


G., Upton, Z. (2011) Investigating the effects of UVB radiation on human skin – a

human skin equivalent model. Centre for Research Excellencein Sun and Health

(CRESH) Annual Scientific Meeting, Brisbane, Australia, 30 Nov (Oral presentation)

xxxi Presentations and publications


G., Upton, Z. (2011) The role of IGF-I in the responses of skin cells to UV radiation.

IGF-Oz – The Insulin-like Growth Factor System and Related Proteins in

Development and Disease, Parkville, Victoria, 27-28 Oct (Poster presentation)


G., Upton, Z. (2011) Investigating the effects of ultraviolet radiation on skin – a

human skin equivalent model. Institute of Health and Biomedical Innovation Inspires

Postgraduate Conference, Brisbane, Australia 22-24 Nov (Oral presentation)


G., Upton, Z. (2011) A human skin equivalent model for studying responses of skin

to ultraviolet radiation. AusBio GlaxoSmithKline Student Excellence State Finals,

Brisbane, Australia, 27 Sep (Oral presentation, State Finalist)



to ultraviolet radiation. Australian Society for Medical Research Postgraduate

Student Conference, Brisbane, Australia, 30-31 May (Poster presentation)


G., Upton, Z. (2011) Role of IGF-I in the responses of human keratinocytes to UVR.

Gordon Research Conference – ‘Insulin-like growth factors in physiology and

disease’, Ventura, California, USA, 27 Feb – 4 Mar (Poster presentation)


G., Upton, Z. Human skin equivalents: Applications of an in vitro cell-based model.

Institute of Health and Biomedical Innovation Research Showcase, Brisbane,

Australia (Oral presentation)



to ultraviolet radiation. AusBio GlaxoSmithKline Student Excellence State Finals,

Brisbane, Australia, 28 Sep (Oral presentation, State Finalist)


G., Upton, Z. (2010) Investigating the effects of ultraviolet radiation on skin – a

human skin equivalent model. Institute of Health and Biomedical Innovation Inspires

Postgraduate Conference, Gold Coast, Australia 22-24 Nov (Poster presentation).

1 Literature review

Chapter 1: Literature review

1.1 INTRODUCTION

Skin is the largest organ in the human body and forms the frontline of defence

against environmental hazards, including ultraviolet radiation (UVR). Accordingly,

skin possesses sophisticated systems to resist and repair UVR-induced damage.

Chronic exposure to UVR, coupled with the failure of these regenerative processes,

has been associated with photodamage and the onset of skin cancers. The molecular

mechanisms underpinning UVR exposure and the resultant damage to skin have been

the subject of extensive research but, to date, have yet to be fully characterised. The

future of photocarcinogenesis research is therefore highly-dependent on deepening

our understanding of the impact of UVR on cutaneous biology.

1.2 ULTRAVIOLET RADIATION AND SKIN CANCER

Human skin encompasses an avascular epidermis comprised of distinct

differentiated layers and a characteristic polarized pattern of keratinocyte growth,

with actively proliferating cells situated along the basement membrane (BM) (Figure

1.1). Pigment-producing melanocytes, Merkel cells and Langerhans cells are also

found in this epidermal layer. Underlying the epidermis is the dermis, predominantly

made up of connective tissue and with dermal fibroblasts as the major cell type of

this region. In addition, hair follicles, blood vessels, sweat ducts, sebaceous glands

and nerve endings are also present in the dermis.

Predisposing risk factors for the development of skin cancers include skin

colour, gender and genetic factors, such as mutations in the melanocortin 1 receptor

(MCIR), p16 (CDKN2A) and glutathione S-transferase (GST) genes (Ramsay et al.,

2001; Matichard et al., 2004; Goldstein et al., 2007). Both epidemiological and

experimental studies have demonstrated that excessive and unprotected exposure to

UVR triggers a cascade of biological processes in the skin, which is the main risk

factor associated with the onset of skin cancers (Matsumura and Ananthaswamy,

2002). An individual’s cumulative lifetime exposure to UVR is thought to be the

leading risk factor for developing all types of skin cancers (Armstrong and Kricker,

2 Literature review

2001). Solar keratoses are among the first pre-malignant skin changes resulting from

chronic UVR exposure (Holmes et al., 2007). Histologically, solar keratoses exhibit

hyperproliferative keratinocytes with atypical cellular and nuclear morphology and

an abnormal organisation at the epidermal-dermal junction (Schwartz, 1996). Genetic

analysis of solar keratoses reveal that more than half of the keratinocytes in these

lesions posses genetic mutations, particularly in the tumour suppressor gene, p53

(Nelson et al., 1994). As a result of these and other similar oncogenic mutations,

solar keratoses possess the propensity to develop into squamous cell carcinomas

(SCC).

Figure 1.1. The structure of human skin.

The epidermis and dermis, separated by the basement membrane (BM), make up the two major components of

skin. Actively proliferating keratinocytes and melanocytes lie along the epidermal-dermal junction, with

keratinocytes at varying stages of terminal differentiation making up the distinct epidermal layers (stratum

corneum, stratum lucidum, stratum granulosum, stratum spinosum and stratum basale). The papillary region of

the dermis features rete ridges, seen histologically as areas of epidermal thickening. The reticular region is

primarily composed of dense irregular connective tissue. Dermal fibroblasts generate connective tissue,

extracellular matrix proteins and a variety of factors critical for the maintenance of the epidermis. Figure © T.

Fernandez, 2012.

3 Literature review

Australia has the highest rates of skin cancer in the world (Australian Institute

of Health and Welfare, 2007). Alarmingly, it is estimated that 450 000 Australians

are diagnosed with a form of skin cancer annually (Australian Institute of Health and

Welfare, 2008). As a result, this disease is the largest financial burden on the

Australian health care system as compared to other cancers (Australian Institute of

Health and Welfare, 2005). The main categories of skin cancers are melanomas, or

cancers involving malignant transformations in melanocytes, and those that result

from the transformation of keratinocytes, or non-melanoma skin cancers (NMSCs)

(Figure 1.2). Cutaneous malignant melanomas (CMM) account for about 4% of all

skin cancers (Boscoe and Schymura, 2006). Despite being relatively less common,

they are associated with the greatest mortality rates (Tsao et al., 2004). This is

correlated with an increased likelihood of melanoma metastasis in CMM patients

(Pollack et al., 2011). While it is believed that chronic UVR exposure leading to

oncogenic transformations in melanocytes forms the basis of CMM development, the

precise biological connection between UVR exposure and the risk of CMM has yet

to be established. For instance, it has yet to be determined whether the cumulative

effect of UVR exposure or childhood incidences of sunburn, play a greater role in the

development of CMMs (Zanetti et al., 1992).

Basal cell carcinomas (BCCs) and SCCs, on the other hand, are among the

most frequently diagnosed malignancies worldwide (Gallagher et al., 2007).

Epithelial in origin, these NMSCs occur as a result of neoplastic changes in

keratinocytes following chronic exposure to skin irritants, including UVR.

Histological and genetic analysis of NMSC tumours shows aberrant keratinocyte

proliferation, growth and keratinisation patterns (Ponec et al., 1988a; Lodygin et al.,

2003; Mancuso et al., 2004). These neoplasms commonly occur on sun-exposed

regions of the body such as the face, neck and head and represent the majority of skin

cancer incidences (Rass and Reichrath, 2008). Both BCCs and SCCs show strong

similarities in the genetic alterations of major oncogenes and tumour suppressor

genes in transformed keratinocytes (Wang et al., 2011).

4 Literature review

Figure 1.2. UVR-induced skin cancers

The photographs represent the clinical manifestations of (A) BCC, (B) SCC and (C) CMM in skin cancer

patients. Images were obtained from the Australasian College of Dermatologists website

(http://www.dermcoll.asn.au/public/a-z_of_skin-types_of_skin_cancers.asp).

1.3 UVR AND THE ACUTE EFFECTS OF ITS EXPOSURE IN SKIN

Sunlight is comprised of a continuous spectrum made up largely of visible and

infrared light, with about 10% consisting of UVR, radio, microwave and X-rays

(Holzle and Honigsmann, 2005). Solar-emitted UVR is predominantly long

wavelength ultraviolet A (UVA) (320 to 400 nm) radiation, followed by the UVB

(290 to 320 nm) and UVC wavelengths (254 nm). It is believed that both the

penetration of both the UVA and UVB wavelengths into skin during sun exposure

are responsible for the onset of short and long-term biological and clinical

consequences. These three UVR wavelengths penetrate into different depths of the

epidermis and dermis (Figure 1.3). The UVA wavelength permeates into dermis,

while UVB radiation mostly effects the epidermis through damage to the

keratinocytes at the dermal-epidermal junction (Bernerd et al., 2000). The UVC

wavelength, which only passes through the stratum corneum, is filtered by oxygen

and ozone in the atmosphere, and is not a major component of terrestrial solar UVR.

The major mode of action involved in cutaneous cell damage as a result of UVA

exposure is the generation of reactive oxygen species (ROS) (Tyrrell and Keyse,

1990). The damaging effects of UVB exposure are detailed in the following sections.

http://www.dermcoll.asn.au/public/a-z_of_skin-types_of_skin_cancers.asp

5 Literature review

Figure 1.3. Penetration of UVR wavelengths into human skin.

The UVB and UVA wavelengths, which make up the majority of UVR in sunlight are able to penetrate the skin,

affecting epidermal cells in the stratum granulosum, stratum spinosum, transitional zone and stratum basale. The

majority of the UVC wavelength is absorbed by atmospheric ozone, with artificial sources observed to only pass

through the stratum corneum. The image on the left shows a histological section of native human skin, with green

arrows on the right depicting the relative depths of UVR wavelength penetration. The scale bar represents 50 µm.

Figure © T. Fernandez, 2012.

The UVB radiation wavelength is readily absorbed by DNA, proteins and cell

membranes causing both harmful and beneficial effects. Exposure to UVB radiation

is responsible for the production of 25-hydroxyvitamin D3 (25(OH)D), a steroid

hormone crucial for normal bone and muscle function (Bogh et al., 2010). High

doses of UVR, however, have detrimental effects in the cell’s genetic material and

induce the generation of reactive oxygen species, the cross-linking of various cellular

proteins and the peroxidation of lipids (Setlow and Carrier, 1966). Consequently, this

triggers an inflammatory response in the form of erythema, or sunburn. The amount

of UVR that can be absorbed by the skin before the onset of erythema is known as

the minimal erythemal dose (MED), with this measurement being approximately 100

mJ/cm2

for UVB radiation (Poon et al., 2003). The cutaneous effects of UVB

irradiation on the skin are summarised in Figure 1.4.

6 Literature review

Figure 1.4. Effects of UVB irradiation on skin cells.

Exposure to UVB radiation results in the secretion of various inflammatory factors such as interleukins 1, 6, 8

(IL-1/6/8), granulocyte-macrophage colony-stimulating factor (GM-CSF) and tumour necrosis factor alpha (TNF-

α) (Yoshizumi et al., 2008). Additionally, keratinocytes secrete melanocyte activating factors such as alpha-

melanocyte stimulating hormone (α-MSH), adrenocorticotropic hormone (ACTH) and prostaglandin E2 (PGE2)

(Gordon et al., 1989). Melanocytes respond by increasing the activity of tyrosinase (TYR) and the synthesis of

melanin-containing melanosomes (Yamaguchi et al., 2007). Dermal fibroblasts produce a variety of paracrine

factors which act in the orchestration and regulation of epidermal regeneration such as basic fibroblast growth

factor (bFGF) (Berking et al., 2001), stem cell factor (SCF) (Imokawa et al., 1998), hepatocyte growth factor

(HGF) (Imokawa et al., 1998), insulin-like growth factor (IGF) (Tavakkol et al., 1992) and keratinocyte growth

factor (KGF) (Kovacs et al., 2009). Damage to DNA in UVB radiation-exposed cells via the production of

DNA lesions and reactive oxygen species occurs. Severely damaged cells undergo apoptosis, with the

characteristic activation of caspases and DNA fragmentation. Alterations in the expression patterns of various

epidermal proteins are also observed in the period following UVB irradiation. Figure © T. Fernandez, 2012.

1.3.1 UVR-induced DNA photodamage

Damage to DNA as a result of UVR exposure is known to be one of the

initiating factors in photocarcinogenesis (Ley and Fourtanier, 1997). In irradiated

cells, DNA acts as a chromophore, directly absorbing photons of UVR, thus resulting

in the formation of mutagenic DNA lesions (Regan and Setlow, 1974). This occurs

when two adjacent pyrimidine bases on the same DNA strand form dimeric

photoproducts. The more common form of these pyrimidine dimers are cyclobutane

pyrimidine dimers (CPDs), as a result of carbon atoms at the C5 and C6 positions of

7 Literature review

thymine or cytosine bases forming covalent bonds and producing a four-membered

ring (Protic-Sabljic et al., 1986). Similarly, (6-4) pyrimidine-pyrimidone dimers ((6-

4)PPs) are formed from the covalent bonding of carbon atoms at the C4 and C6

positions, frequently between the TC and CC dinucleotides (Franklin et al., 1985).

This particular dimer can be converted to a third form of carcinogenic photoproduct,

the Dewar valence isomer, following photoisomerisation in the presence of UVA at

320 nm (Perdiz et al., 2000). The significance of these DNA insults as a result of

UVR exposure is the physical hindrances they create to replication and transcription

processes (Costa, 2003). Of these DNA lesions, (6-4)PPs are among the least

mutagenic and have been shown to be more efficiently repaired by the cells’ DNA

repair mechanisms, with up to 90% of these dimers being repaired three hours after

irradiation (Nakagawa, 1998).

In contrast, CPD photoproducts are thought to be a primary contributor to

mutations in skin cells, resulting in the transition of C to T and CC to TT

dinucleotide transitions, commonly known as the UV ‘signature’ mutations. Other

types of UVR-induced DNA damage include the formation of protein-DNA cross-

links, single strand DNA breaks and thymine glycol lesions (Ichihashi et al., 2003).

The hazards of UVA and UVB radiation exposure also lie in their ability to

form ROS, thus indirectly damaging DNA, proteins and lipids (Danpure, 1976).

Reactions with UVR and endogenous cellular porphyrins, riboflavin and quinines,

generate highly-reactive, DNA-damaging ROS molecules (Scharffetter-Kochanek et

al., 1997). These include superoxide anions, singlet oxygen and hydrogen peroxide,

which cause downstream single-strand breaks, DNA-proteins cross-links and altered

bases (Phillipson, 2002). One of the most frequently occurring altered base

phenomena is the oxidation of guanine to form 7,8-dihydro-8-oxoguanine (8-oxo-

dG), hence making its presence a ubiquitous marker of cellular oxidative stress

(Cadet, 2000). The presence of 8 oxo-dG alterations in DNA has been shown to be

premutagenic and is thought to contribute to the photocarcinogenic process (Kasai

and Nishimura, 1984). The other major DNA lesions generated from oxidative

damage include thymine glycol, pyrimidine hydrates and urea (Scharffetter-

Kochanek et al., 1997).

8 Literature review

1.3.2 Cellular UVB radiation-induced DNA damage response

Cells possess complex and multifaceted responses to sense and repair DNA

damage, in order to minimise the risk of propagating mutations during cellular

replication. Upon the detection of damaged DNA, the activation of cell cycle

checkpoints and arrest coupled with the initiation of DNA repair pathways or

apoptosis are orchestrated to preserve genomic integrity (Zhou and Elledge, 2000).

Cell cycle checkpoints serve as regulatory pathways which control the cell cycle by

establishing the proper completion of one phase before the transition to the next. The

cell cycle checkpoint pathways principally associated with UVB radiation-induced

DNA damage are depicted diagrammatically in Figure 1.5. Central mediators of

these checkpoint pathways include the ataxia telangiectasia mutated (ATM) and

ATM and Rad3-related (ATR) protein kinases, which respond to DNA damage via

their phosphorylation and subsequent activation (Morgan and Kastan, 1997). The

principle regulator in the photodamage response is ATR, which functions by

blocking DNA replication predominantly at the G1 checkpoint (Bender et al., 1997;

Zhou and Elledge, 2000). ATM and ATR activation result in the downstream

phosphorylation of the signal transducers Chk1 and Chk2, a process which is

required for the phosphorylation and proteosomal degradation of the cyclin

dependent kinase, cdc25C and the activation of p53 (discussed further in Section

1.3.5) (Su, 2006). Besides causing G1/S arrest, this process also activates elements

such as histone H2A.X, which within minutes of sensing damage, initiates chromatin

remodelling for DNA repair (Bao, 2011).

9 Literature review

Figure 1.5. Cell cycle checkpoint pathways initiated by UVB radiation-induced DNA damage

In response to UVB radiation-induced DNA damage, the phosphorylation of ATR and its interaction with ATRIP

initiate different pathways which aid in cell cycle arrest and the repair of DNA damage through such pathways as

the phosphorylation of the histone H2A.X (Kawasumi et al., 2011; Nam and Cortez, 2011). The G1 cell cycle

checkpoint prevents damaged DNA from being replicated and is largely triggered by the activation of p53.

Besides upregulating genes involved in the DNA damage response including MDM2, GADD45a and p21/Cip,

phospho-p53 causes the accumulation of p21 which suppresses Cdk2/Cyclin E kinase activity, thereby causing

cell cycle arrest at G1. Cellular entry into mitosis is also controlled by the activity of the cyclin dependent kinase

cdc25, which is regulated by the phosphorylation of kinase Chk-1. The phosphorylation of the dual specificity

phosphatase cdc25C creates a binding site for 14-3-3 proteins. The formation of the cdc25C/14-3-3 complex

maintains the Cdc2/Cyclin B1 in its inactive state, hence blocking cellular entry into mitosis at the G2 checkpoint

(Peng et al., 1997).

The synthesis phase (S-phase) checkpoint controls cell cycle progression

following DNA damage by suppressing the rate of DNA synthesis. Relatively little is

known of the precise mediators of this checkpoint, though the Chk1/2-regulated

phosphorylation of cdc25C is thought to inactivate the S-phase cyclin E/CDK2

14-3-3

UVB

DNA damage

Chk-1

P

ATR

P ATRIP

cdc25C

P

H2A.X

P

Cdc2/

Cyclin B1

p53

P

p21

Cdk2/

Cyclin E

cdc25C

P

DNA repair

G1 arrest G2 arrest

10 Literature review

complex, thus arresting the cell cycle (Hakem, 2008). The G2/M DNA damage

checkpoint suspends the cell cycle prior to chromosome segregation, thus preventing

mitotic entry of damaged cells. At this checkpoint, the Chk1/2 kinases phosphorylate

cdc25C at Serine 216 thus creating a binding site for 14-3-3 proteins (Peng et al.,

1997). This in turn results in the maintenance of the Cdc2/Cyclin B1 complex in its

inactive state, and the subsequent blockage of the cell cycle progression into mitosis

(O'Driscoll and Jeggo, 2006). Upon the completion of DNA repair, cells are able to

resume cell cycle progression and cellular functions. However, unsuccessful DNA

repair leads to cellular senescence or p53-mediated apoptosis in order to prevent the

replication of damaged cells (Chipuk and Green, 2006; Lewis, 2008; Handayaningsih

et al., 2012).

1.3.3 DNA photodamage repair mechanisms

Due to the deleterious effects of UVR on DNA, mammalian cells are equipped

with several sophisticated protective DNA repair mechanisms to eliminate this

damage. A combination of repair pathways including direct repair, mismatch repair,

double-stranded break repair, base excision repair and the nucleotide excision repair

(NER) systems are activated, depending on the type and extent of photodamage

(Sancar et al., 2004). The NER mechanism is central to the removal of both CPDs

and (6-4)PPs (Suzuki et al., 1978). This complex and versatile mechanism is able to

both sense and restore distortions in the DNA helix (de Laat, 1999). This is achieved

via either the more robust global genome NER, which can repair lesions over the

whole genome, or the faster transcription-coupled NER system which senses the

presence of lesions at a transcription level (Ogi et al., 2010). Both systems operate by

recruiting repair complexes to the site of the damage, excising about 10 to 20

nucleotides around the lesion, and then replacing the excised regions with the correct

sequence. The significance of these repair systems is made evident in patients

suffering from Xeroderma pigmentosum (XP), a disease resulting from genetic

defects in aspects of the NER complex, resulting in faulty UVR-induced DNA

damage repair. Studies on patients with this autosomal recessive genetic disorder

have demonstrated the connection between UVR exposure and the onset of skin

cancers (Kraemer et al., 1994; Tang et al., 2000; Lehmann, 2003). It has been found

that XP patients have an approximately 1000-fold increased risk of developing skin

cancer than those without the disease (Cleaver, 2000). In fact, UVR is known as a


‘complete carcinogen’, as it directly induces mutations in DNA, and also triggers a

variety of cellular processes in skin such as the suppression of the natural anti-

tumour immune responses which creates a favourable environment for malignant cell

proliferation (de Gruijl, 2002).

Damage recognition systems are responsible for sensing and activating these

repair mechanisms, detecting even subtle alterations to DNA, proteins and lipids. For

example, the generation of reactive oxygen species causes the oxidation of certain

cellular proteins, thus altering their conformation and function. A well documented

example is the UVR-induced oxidation and inactivation of protein tyrosine

phosphatases (PTPs) which initiate several phosphotyrosine-dependent signal

transduction pathways (Gross, 1999). This PTP inactivation by UVR has been shown

to activate the epidermal growth factor (EGF) receptor, thus triggering various

proinflammatory and proliferative effects in keratinocytes (Knebel, 1996). Cellular

surveillance machinery for detecting protein damage, for instance, intracellular

pattern recognition receptors, may also aid in damage recognition and repair

induction (Meylan, 2006). The generation of damaged, single-stranded DNA

(ssDNA), has also been implicated as a mediator of cell cycle arrest and the

activation of DNA repair. The presence of ssDNA in the nucleus is usually detected

by sensor protein complexes such as MreII/Rad50/Nbs1 (MRN) and ataxia

telangiectasia mutated and Rad4-related interacting protein (ATRIP), which bind to

the damaged DNA activating and recruiting DNA repair complexes via multiple

signalling mechanisms (Zou, 2003).

1.3.4 UVR-induced cell cycle arrest and apoptosis

Although intricate cellular DNA repair mechanisms are usually able to restore

most UVR-induced damage, it is likely that high doses of radiation or the

accumulation of unrepaired damage can ultimately lead to the onset of skin

carcinogenesis (Van Steeg and Kraemer, 1999). Thus, to prevent potentially

oncogenic mutations from being propagated to daughter cells, damaged cells activate

cell cycle arrest or cell death responses (Cox and Lane, 1995). Growth arrest allows

for DNA repair processes to remove photoproducts prior to cell proliferation (Jeggo

and Löbrich, 2006). However, in the case of severe DNA damage, the cell proceeds

to undergo a process of self-destruction. This can occur via one of three closely-

related cell death pathways: apoptosis, terminal differentiation or necrosis.


Exposure of skin to physical trauma or toxic chemicals can result in the

deterioration of cell membranes and organelles followed by cell death in a process

known as necrosis (Gold et al., 1994). The morphological characteristics of necrotic

cells include cellular swelling, the disruption of the cell membrane and chromatin

condensation before cellular and nuclear lysis (Wyllie, 1980). It has been shown

experimentally that high doses of UVR exposure can cause keratinocytes to undergo

necrosis, releasing proinflammatory cytokines to activate the inflammatory immune

response (Caricchio, 2003). These responses only occur at excessively high doses of

UVR exposure (in excess of 80 mJ/cm2), which are significantly above the average

MED of 25 mJ/cm2 (Tadokoro, 2003). At physiologically-relevant UVR doses,

however, the accumulation of DNA mutations generally causes keratinocytes to

undergo apoptosis or terminal differentiation (Zhuang et al., 2000).

The phenomenon of apoptosis, or the active, energy dependent, genetically-

programmed cellular self-destruction mechanism, was first discovered as a

morphologically distinct pattern of cell death, dissimilar from that observed in

necrosis (Kerr, 1971). Apoptotic keratinocytes formed as a consequence of UVR

exposure are known as ‘sunburn cells’, and are characteristic markers of UVR-

induced damage. At biologically-relevant doses of UV irradiation, it has been

proposed that intrinsic pathways of apoptosis are the principle mode of removing

damaged keratinocytes (Assefa, 2005). The process of apoptosis is vital in the

maintenance of skin homeostasis, particularly facilitating the constant turnover of

keratinocytes required to maintain a constant epidermal barrier. Terminal

differentiation in keratinocytes is a similar form of programmed cell death, in which

basal proliferative keratinocytes at the dermal-epidermal junction undergo an

irreversible series of changes, ultimately differentiating into corneocytes that

constitute the stratum corneum. Following UVR exposure, this thickening of the

stratum corneum is also observed, a consequence of increased keratinocyte

differentiation (Kligman et al., 1985; Kligman, 1996). This protective response is

believed to scatter the penetrating UVR, thus reducing the intensity of radiation

reaching the basal keratinocytes. The thickening of the epidermis is supported by an

upregulation of genes associated with differentiation, such as involucrin, calgranulin

and elafin (Li et al., 2001).


1.3.5 The role of p53 in the cellular UV-response

The nuclear phosphoprotein gene, p53, is the most commonly mutated gene

among human cancers and disruptions to its normal function have been implicated in

a wide variety of sporadic and inherited malignancies (Levine et al., 1991). In terms

of the UVR response, this tumour suppressor gene is known to play a pivotal role in

both the regulation of Gap-1 phase (G1) cell cycle arrest and in the initiation of

apoptotic pathways (Livingstone et al., 1992). Accordingly, exposure to UVR has

been shown to upregulate both the transcription of p53, as well as its activation via

the phosphorylation of serine 15 and serine 20 (Unger et al., 1999). The p53-

regulated expression of the cyclin-dependent kinase (CDK) inhibitor

p21/WAF1/CIP1 has been implicated in orchestrating the G1 phase arrest (Poon et

al., 1996). Additionally, p53 is also capable of upregulating key apoptotic genes such

as Fas/Apo-1 and Bax (O'Grady et al., 1998). This is coupled with the p53-induced

downregulation of cell survival genes like Bcl-2. The maintenance of genomic

stability and the safeguarding of DNA integrity during replication are also influenced

by the downstream upregulation of GADD45 (Carrier et al., 1994).

Furthermore, p53 has been shown to counteract ROS-damage by upregulating

the expression of proteins with antioxidant activity such as N-acetylcysteine

(Sablina, 2005). To protect against further photodamage, studies also reveal the

contribution of p53-mediated activity in the regulation of melanogenesis (Cui, 2007).

Binding of p53 directly to pro-opiomelanocortin (POMC), a precursor polypeptide

which is ultimately processed to form α-MSH, is a potent stimulator of melanin

production. Hence, p53 and its associated molecular interactors are critical in the

inhibition of photocarcinogenesis.

1.3.6 UVR-induced inflammation and tanning

Inflammation during the sunburn reaction is a key feature of the acute UV

response. However, the process of sunburn initiation and the factors that influence its

severity have yet to be precisely defined. It has been shown that the cutaneous

expression of proinflammatory cytokines, such as TNF-α, interleukins, growth

factors and endothelin-1 are upregulated as a result of UV irradiation (Figure 1.4).

These act in concert to activate systemic inflammatory and local epidermal responses

to counteract cellular damage (Kuhn et al., 1999). This response peaks within the

first two days after irradiation, in which a spike in the proliferation of both epidermal


and dermal cells occurs. The transient p53-regulated cell cycle arrest phase is

therefore pivotal in ensuring the repair of DNA damage before this proliferative burst

to prevent potentially carcinogenic cell divisions.

Cytokines, hormones and various other bioregulators are also responsible for

stimulating the production of photoprotective melanin, through the process of

melanogenesis (Duval, 2001; Matsumura and Ananthaswamy, 2002). The epidermal-

melanin unit is composed of one melanocyte to about 30 keratinocytes (Fitzpatrick

and Breathnach, 1963). Shortly after irradiation, melanin granules are redistributed in

keratinocytes, forming ‘nuclear caps’ above the nuclei to help protect against further

DNA damage (Lin and Fisher, 2007). A delayed tanning response involving the

further activation and proliferation of melanocytes occurs next, which is also

associated with enhanced melanocyte tyrosinase activity, increased melanin synthesis

and the elongation and branching of melanocyte dendrites. In view of this, the

actions of tyrosinase and tyrosinase-related proteins present on the melanosomal

membrane, and melanogenic regulatory proteins like the microphthalmia-associated

transcription factor (MITF) and the melanocortin 1 receptor (MC1R) are also

important stimulators of melanin production (Liu and Fisher, 2010). Inhibitors of

melanogenesis, such as serotonin and melatonin, act as negative regulators via the

control of melanocyte proliferation and melanocyte responses to α-MSH

respectively (Slominski et al., 2002). These complex and highly-interconnected

processes are still being investigated using a number of in vitro models.

1.3.7 UVR-induced immunosuppression

The inflammatory reactions to UVR have been well-documented on a cellular

and molecular level. On the other hand, sub-erythemal doses of both UVA and UVB

radiation have also been shown to produce an immunosuppressive response. Trans

urocanic acid, a histidine derivative in the stratum corneum, helps to absorb some of

the penetrating UVB wavelength. The isomerised cis form of trans urocanic acid,

together with the generation of CPDs has been demonstrated to cause a local

immunosuppressive effect (De Fabo, 1983). Moreover, UV-irradiated keratinocytes

have been shown to secrete soluble immunosuppressive mediators, such as IL-10,

which may add to the suppression of immunity on a systemic scale (Nishigori et al.,

1996). Cellular and molecular modulators of this phenomenon have yet to be fully

defined. However, clinical data suggests that the dampening of local and systemic


immunity by UV exposure may have important implications in skin cancer

development (Hoxtell et al., 1977).

1.4 FIBROBLAST-KERATINOCYTE INTERACTIONS DURING THE UVR-

RESPONSE

1.4.1 Epithelial-mesenchymal interactions in skin

Interactions between the epithelium and the mesenchyme are critical during

development and organogenesis (Kong et al., 2006). In fact, this close connection

extends to homeostatic maintenance, growth and repair of the adult cutaneous

epithelium, especially in supporting its constant renewal via proliferation, migration

and differentiation (Billingham and Silvers, 1967). It is known that dermal

fibroblasts not only promote the growth and stratification of keratinocytes, but also

play a role in preserving the organisation of the epidermis (Boyce, 1988). Studies

monitoring the development of chick skin show a strong dependency on

mesenchymal signals for epidermal morphogenesis, differentiation patterns (via

keratin synthesis) and the formation of skin appendages (Cadi et al., 1983). This is

also supported by observations from experiments with adult keratinocytes, showing

that diseased fibroblasts isolated from patients with psoriasis could induce

hyperproliferation in these cells (Saiag et al., 1985). Due to the complexity of this

communication spanning numerous systems and pathways, the precise inductive

signals that orchestrate cross-talk in normal and diseased tissue are still not

completely understood. Extensive experimental evidence indicates, however, that

cell and matrix adhesion molecules, diffusible agents (such as retinoids) and growth

factors are among the key players involved (Boukamp et al., 1990; Brockes, 1990;

Yamaguchi et al., 2005).

The BM at the epidermal-dermal junction is a major facilitator of these

interactions, in part through the action of cellular adhesion, the extracellular matrix

(ECM) and its components. Cell attachment has been shown to be closely-linked to

changes in cellular behaviour by altering morphology, cytoskeleton organization and

receptor clustering (O'Toole et al., 1997; Egles et al., 2010). Matrix components like

laminin, fibronectin and syndecans interact with adhesion molecules on keratinocytes

including integrins, cadherins and selectins, which then affect various aspects of

cutaneous development and homeostasis (Cabrijan and Lipozencic, 2011). Indeed,

blocking these interactions results in the disruption of certain epidermal-


mesenchymal signalling pathways (Hirai et al., 1989). The roles of matrix molecules

and growth factors in modulating epithelial function are also inextricably linked.

Components of the extracellular matrix can bind and sequester growth factors to

induce cellular responses (Akhurst et al., 1990). Additionally, the expression of these

matrix molecules themselves has been associated with the actions and functionality

of growth factors in inducing downstream effects on epithelial cells (Upton et al.,

1999; Kricker et al., 2003).

1.4.2 Growth factors mediate epithelial-mesenchymal cross-talk

As mentioned previously, growth factors directly affect several aspects of the

developing and adult epithelium by regulating proliferation, differentiation,

migration, ECM production and numerous other processes (Aaronson et al., 1990;

Wenczak et al., 1992; Beer et al., 2000; Beyer et al., 2003). The secretion of

mitogenic growth factors in the mesenchyme activates epithelial cells in a paracrine

manner. This interaction is vital in regulating and directing repair, maintenance and

regeneration in skin, and is believed to be conserved from embryogenesis

(Briggaman, 1982).

In terms of activating keratinocyte proliferation, fibroblast-synthesized KGF,

HGF, EGF, interleukins-6 (IL-6) and -8 (IL-8) are among the principal mediators of

epidermal regeneration (Mackenzie and Fusenig, 1983). Also central to epidermal-

mesenchymal communication system is the insulin-like growth factor (IGF) family.

The potent effects of this system, in particular through the actions of insulin-like

growth factor I (IGF-I), have been extensively studied by our research group in

various epithelial tissues including the skin and breast (Noble et al., 2003; Hyde et

al., 2004; Ainscough et al., 2006; Dawson et al., 2006; Van Lonkhuyzen et al., 2007;

Hollier et al., 2008). Interactions between IGF-I and the ECM protein vitronectin and

keratinocytes have been shown to significantly enhance epidermal repair in a wound

healing context and have been used in the development of a novel wound healing

therapeutic (Van Lonkhuyzen et al., 2007; Upton et al., 2008; Upton et al., 2011; Xie

et al., 2011). With several parallels existing between the healing wound and

epidermal regeneration following UVR-damage, the potential of the IGF system in

enhancing the photorepair response was therefore studied.


1.5 THE INSULIN-LIKE GROWTH FACTOR SYSTEM

The action of the IGF family is well-known as being integral to many epithelial

processes, such as migration, proliferation, attachment and invasion (Ando, 1993). It

is also involved in many pathological conditions, such as chronic inflammation,

impaired wound healing and cancer (Samani, 2007). The IGF system consists of the

single-chain polypeptide ligands IGF-I and IGF-II, which bind to cell surface

receptors, namely, the insulin-like growth factor receptor type 1 (IGF-IR), insulin-

like growth factor receptor type 2 (IGF-2R) and the insulin receptor (IR) via

autocrine, endocrine and paracrine pathways (Perona, 2006). Both IGF-I and IGF-II

are present at varying concentrations in most tissues, as well as in blood plasma with

concentrations of approximately 20 to 100 nM (Daughaday and Rotwein, 1989;

Humbel, 1990). The bioavailability of IGFs is tightly regulated by six IGF binding

proteins (IGFBPs).

The IGF-IR is expressed ubiquitously in most cell types throughout the body

(Sjögren, 2002). Ligand-receptor binding activates a range of signal transduction

pathways within the cell, such as the phosphatidylinositide 3-kinase (PI3-K) and

mitogen activated-kinase (MAPK) pathways, which have known regulatory roles in a

variety of cell types in vivo (Werner, 2008). The IGF system has a potent mitogenic

and anti-apoptotic effect on cells and is involved in somatic growth processes

(Rotwein, 1999). These properties are reflected in malignant tumour cells which

ubiquitously over-express IGF-IRs, thus enhancing tumour growth and progression

(Lopez, 2002). Experimental evidence has also shown that cells which under-express

IGF-IR are more susceptible to the induction of apoptotic cell death following

exposure to stress factors (Li, 2009).

The IGF-IR is a transmembrane tyrosine kinase receptor that is structurally and

functionally related to the insulin receptor (Abbott, 1992). The three ligands that bind

to the IGF-IR are IGF-I, IGF-II and insulin. Cysteine-rich domains of the α-subunits

on the IGF-IR determine ligand-binding affinity and specificity. Of the ligands, IGF-

I has the greatest affinity, while that of insulin is 100-fold lower (Gustafson, 1990).

Ligand-receptor binding activates the IGF-IR, causing the phosphorylation of two

main cytoplasmic membrane substrates, insulin receptor substrate I (IRS-I) and Shc,

which in turn activates downstream signal transduction cascades (Kaulfuss, 2009).

The major regulatory mechanisms in place to regulate and control the IGF-I


stimulation of IGF-IR are the down-regulation of IGF-IR expression following IGF-I

stimulation, and the presence of IGF-binding proteins (IGFBPs) which competitively

bind to IGF-I.

The IGF ligands, IGF-I and IGF-II, are small (approximately 7.5 kDa) poly-

peptides which are structurally similar to insulin. They have a diverse range of

mitogenic and metabolic effects in multiple cell and tissue types. The IGFs have the

ability to exert both systemic and local effects via autocrine and paracrine actions

(Butler, 2001). The IGF system is tightly regulated through the action of the six

binding proteins (IGFBP-1 to IGFBP-6), which possess similar structures, but have

individually distinct functional properties (Perks, 2008). Most of the IGF ligands

found in the circulation or the ECM are bound to IGFBPs with high affinities

(Baxter, 1994). An interesting characteristic of IGFBPs is their ability to modulate

cell survival independent of IGF-I interactions (Wheatcroft, 2009). Most IGFBPs

have been demonstrated to possess intrinsic properties which allow them to affect

aspects of cell growth, adhesion, migration and apoptosis (Perks, 2008).

Circulating IGF-I is predominantly synthesized by the liver, with other tissues

capable of its local production (Sjögren et al., 1999). In skin, IGF-I is synthesized

mainly by dermal fibroblasts and at lower levels by epidermal melanocytes, together

acting in a paracrine manner on basal proliferating keratinocytes (Flier et al., 1986;

Martin, 1990; Philpott et al., 1994). During tissue repair and remodelling, fibroblasts

synthesize IGF-I to increase keratinocyte proliferation for tissue repair and

remodelling (Gartner et al., 1992). The complexities of IGF-I-mediated crosstalk

between keratinocytes and other dermal and epidermal cell types require further

study. Parathyroid hormone-related protein (PTH-rp), secreted by keratinocytes, is

thought to influence the upregulation of IGF-I in fibroblasts (Shin, 1997). Also

produced by basal keratinocytes, IGFBP3 is thought to moderate the pro-survival

effect of fibroblast-secreted IGF-I (Hollowood, 2000). It has been reported that

IGFBP-3 transcription is upregulated following cellular stress via a p53-mediated

mechanism, with this binding protein also able to independently initiate apoptosis in

UV-damaged keratinocytes (Williams, 2000). In addition to stimulating changes to

keratinocyte behaviour, IGF-I also enhances the survival, migration and synthesis of

melanin in melanocytes following UV-irradiation (Archambault et al., 1995;

Edmondson, 1999). Taken together, this evidence suggests that IGF-I regulated


mechanisms may be a fundamental part of the skin’s protective strategies against

UV-damage.

1.5.1 IGF-IR signalling pathways

Intrinsic tyrosine kinase activity of the IGF-IR is induced by the IGF-I ligand

binding to this receptor and its resultant conformational change (Figure 1.6). This

then causes the autophosphorylation of tyrosines in the juxtamembrane domain,

which represent a docking site for IRS 1/2 and Shc, thus initiating the transmission of

the IGF-IR signal (Samani, 2007). Phosphorylated IRS 1/2 interacts with the

regulatory subunit of PI3-K, p85, which leads to the subsequent phosphorylation of

protein kinase B (AKT) (Butler et al., 1998b; Doepfner et al., 2007). Next, the

activation of the mammalian target of rapamycin (mTOR) by phospho-AKT

stimulates protein synthesis and the inhibition of pro-apoptotic signals in the cell, via

the inactivation of the pro-apoptotic protein Bad (Vaira et al., 2006; Tao et al.,

2007).

Additionally, the phosphorylation of IRS-1 or Shc can also recruit Ras, thus

activating the extracellular signal-regulated kinase (ERK) signalling pathway, and

consequently promoting cellular proliferation, growth and survival (Butler et al.,

1998a). Furthermore, the c-Jun N-terminal kinases (JNK) and p38 MAPK pathways

have also been shown to be activated by IGF-IR ligand-binding (Cheng and

Feldman, 1998; Vincent and Feldman, 2002). The downstream effects of the

activation of these pathways include the recruitment of transcription factors,

including jun, fos and E twenty-six (ETS)-like transcription factor 1 (ELK-1), which

upregulate the transcription of genes associated with mitogenesis (Hermanto et al.,

2000). Therefore, it is not surprising that the dysregulation or hyperactivation of

these pathways have been linked to the development of various cancers (Surmacz,

2000; Burroughs et al., 2002). Accordingly, the molecular events surrounding the

activation of the IGF system are tightly regulated by processes such as

phosphorylation, dephosphorylation and degradation of the signalling proteins

involved (Vincent and Feldman, 2002).


Figure 1.6. Signalling cascades associated with IGF-IR activation

The insulin-like growth factor receptor type-1 (IGF-IR) is activated by binding with its ligand, insulin-like growth

factor-I (IGF-I), upon its release from insulin-like growth factor binding protein (IGFBP) and extracellular matrix

(ECM) interactions. This then stimulates its intrinsic tyrosine kinase activity in the intracellular region.

Complexes such as Shc/SHP-2 and IRS 1/2 form substrates which autophosphorylate and trigger downstream

Ras/Raf/MEK/ERK and PI3K/AKT pathways. The latter serves as a central regulator of cellular synthesis and

proliferation, as well as the inhibition of apoptosis through blocking the activities of pro-apoptotic factors such as

Bad. Together with ERK, the JNK and p38 MAPK pathways are also activated by IGF-IR, which through the

recruitment of transcription factors such as ELK-1, jun and fos, upregulate the transcription of genes associated

with mitogenesis.

1.5.2 IGF-I and its role in influencing keratinocyte responses to UVR

To further research the role of the IGF system in photobiology, a number of

studies have been conducted characterising the impact of this growth factor on

irradiated keratinocytes. The findings of these studies include that protection against

UVB radiation-induced keratinocyte apoptosis has been found to be associated with

an increased synthesis of IGF-I and the IGF-IR, together with a decrease in pro-

apoptotic factors and an amplification of pro-survival factors (Figure 1.7) (Kulik,

1997; Assmann, 2009). This apoptosis-prevention mediated by IGF-I is known to be

activated by the PI3-kinase and MAPK pathways (LeRoith et al., 1995).

Furthermore, studies on irradiated primary human keratinocytes demonstrate that


IGF-IR activation not only promotes post-mitotic cell survival, but also arrests cell

proliferation to facilitate DNA repair (Kuhn et al., 1999; Heron-Milhavet et al.,

2001; Decraene, 2002). On top of this, the phosphorylation of p53 and the

subsequent activation of various signalling cascades are significantly dependent on

the functional status of the IGF-IR (Lewis, 2008). Diminished p53 activity (as a

result of mutations) is thought to be closely linked to photocarcinogenesis

(Greenblatt et al., 1994). This then further supports the theory that IGF-IR activation

may be important during cancer development, as discussed in 1.5.3.

Figure 1.7. Downstream cell survival effects from IGF-IR activation.

Binding of the IGF-I ligand to IGF-IR results in the autophosphorylation of the tyrosine residues on the

intracellular region of the receptor. Once phosphorylated (denoted by ‘P’), this forms a docking site for IRS.

Phosphorylated IRS activates PI3-K which leads to the downstream activation of other effector proteins such as

phosphoinositide-dependent kinase-1 (PDK-1) and AKT. The PI3-kinase/Akt pathway increases the levels of

anti-apoptotic proteins including Bcl-2 and Bcl-x. The activation of Akt also inhibits apoptosis through the

inactivation of pro-apoptotic factors such as caspases, Bad, members of the Forkhead (FKH) family and glycogen

synthase kinase 3 beta (GSK-3β).

http://www.google.com.au/url?sa=t&rct=j&q=pdk-1&source=web&cd=2&ved=0CC4QFjAB&url=http%3A%2F%2Fen.wikipedia.org%2Fwiki%2FPhosphoinositide-dependent_kinase-1&ei=X4I0T6ahO4zBiQeYwNyNAg&usg=AFQjCNGVPEeMqVbfiFWOvOfzCndjx6ih-Q


1.5.3 A potential role of the IGF system in photocarcinogenesis

In light of this evidence, a new school of thought has emerged regarding the

influence of the IGF system on NMSC development. The IGF system has highly

proliferative and growth-promoting cellular effects which suggest that its

overexpression may be linked to tumorigenesis (DiGiovanni et al., 2000). Indeed,

this has been shown to be true in several epithelial cancers including that of the lung,

breast and colon (Donovan, 2008; Dziadziuszko, 2008; Lann, 2008). However, it is

also likely that the dysregulation of IGF-I-induced cell survival pathways may lead

to the proliferation of cells before the complete removal of photolesions, thus

representing a critical step in photocarcinogenesis (Lewis et al., 2010).

As illustrated in Figure 1.8, alterations to the activation status of IGF-IR at the

time of UV-exposure may result in inappropriate keratinocyte responses to UVR.

Dermal fibroblasts isolated from geriatric adults display characteristics of cellular

senescence and have been shown to have an impaired ability to synthesize IGF-I

(Ferber et al., 1993). Therefore, a connection between a reduced supply of IGF-I to

initiate keratinocyte photorepair and the elevated incidence of NMSCs occurring in

older individuals may exist (Green, 1990). Experimental evidence using cultured

keratinocytes also shed light on the possible mechanistic aspects of the connection

between IGF-IR activation and UV-damage (Lewis et al., 2010). In this study,

irradiated keratinocytes without IGF-IR activation continued to display mitotic

activity despite harbouring unrepaired UVB radiation-induced damage. Finally,

epidemiological evidence from patients undergoing insulin therapy provides further

clinical supporting evidence. In patients with type 2 diabetes mellitus being treated

with exogenous insulin therapy, elevated serum insulin levels (and hence, greater

levels of IGF-IR activation) have been correlated with a decreased incidence in

NMSC development (Chuang et al., 2005).


Figure 1.8. A potential role of the IGF system in photocarcinogenesis

(A) In skin, dermal fibroblasts secrete a variety of factors, including IGF-I (yellow arrow) to activate various

physiological and repair processes in epithelial keratinocytes. (B) Following exposure to UVB radiation, studies

have shown that IGF-I plays an important role in ensuring that keratinocytes harbouring DNA damage undergo

appropriate cell cycle arrest, repair or apoptotic pathways to prevent the replication of damaged cells. (C) In

situations whereby the fibroblast-expression of IGF-I is compromised, such as in aging skin, diminished IGF-IR

activation may lead to inappropriate keratinocyte responses to UVB radiation-induced damage. (D) Keratinocytes

harbouring genetic damage may be allowed to divide and multiply, thus forming a critical initiating factor in non-

melanoma skin cancer (NMSC) development.

As yet, however, the precise significance of the IGF family during the acute

epidermal response to UVB radiation requires further investigation to establish more

concrete associations. Furthermore, understanding the role of IGF-I as a facilitator of

epidermal-mesenchymal interplay on endocrine, paracrine and autocrine levels in

skin is an essential next step.

1.6 EXPERIMENTAL MODELS OF PHOTOBIOLOGY

The ability to model human skin experimentally is fundamental in enhancing

our understanding of the mechanisms underlying skin cancer development.

Traditional in vivo and in vitro systems that take advantage of increasingly elegant

cell culture and animal systems have provided valuable insights into the cellular

responses to UVR exposure. Nonetheless, incorporating the intricate biology of

human skin into a physiologically-relevant experimental platform remains a

significant challenge. The advantages and limitations of currently-used in vitro

systems are discussed in the following sections and summarised in Table 1.1.1.


1.6.1 Cell culture systems

One of the most extensively-used and easily-accessible models for

photobiology and photocarcinogenesis research involves the use of 2-dimensional

(2D) cell cultures. The ease of use, cost-effectiveness and the diversity of cell lines

available make such systems highly attractive to researchers. Both cancer cell lines,

including BCC (Yang, 2011), SCC (Wood, 2011) and melanomas (Kosztka, 2011)

and continuous non-malignant cells like HaCaT keratinocytes (Thumiger et al.,

2005) are utilised experimentally. Cell lines have a wide-spread range of applications

in photobiological studies, particularly in the preclinical developmental and

screening stages for developing potential photoprotective and anticancer agents

(Zattra et al., 2009; Yoshihisa, 2010).

Fundamentally, however, studies employing conventional cell monolayer

systems possess several intrinsic limitations, particularly in their application to

primary cell culture. The maintenance of primary keratinocytes in culture involves

the presence of an irradiated mouse fibroblast feeder layer to encourage attachment

and stimulate proliferation (Rheinwald, 1975; Alitalo et al., 1982). This then poses a

challenge for isolating ‘fibroblast-free’ keratinocyte populations as the two cell types

are normally grown on a single monolayer. The immortalized human keratinocyte

cell line, HaCaT, has been extensively used in the monolayer format for applications

such as Vitamin D studies (Lehmann, 1997; Park et al., 2011), as well as in

conjunction with 3D skin organotypic models (Schoop et al., 1999; Gotz et al.,

2012). However, in the context of photobiology studies, HaCaT cells demonstrate

significant differences compared to normal human keratinocytes in terms of survival

after irradiation (Thumiger et al., 2005). Therefore, this limits their use in the study

of keratinocyte regeneration post-irradiation, under physiological conditions.

Importantly, monolayer cultures do not adequately reflect the complex

architecture (Figure 1.1) and the diverse array of intercellular interactions occurring

in native skin. Such systems are therefore limited in their ability to model epidermal-

mesenchymal paracrine interactions. Another consideration of 2D culture systems is

that artificially-treated tissue culture vessels may lack vital components of the native

cellular microenvironment, which can alter cells’ responses to irradiation.


Table 1.1.1. Characteristics of commonly used in vitro and in vivo models for studying skin cancer biology.

Relative differences between models are represented by (present), − (absent) and from least (+/$) to most (+++/$$$), as summarised from text. Table modified from (Fernandez et al., 2012b).

In vitro models In vivo models

Primary cell

culture

Cell line

culture

Ex vivo skin

explants

HSE-DED

model

HSE (synthetic

scaffold)

Pigmented HSE Mouse models Recruited

volunteers

Experimental considerations

Costs involved $ $ $ $ $$ $ $$$ $$$

Lifespan of culture + NA + + + + +++ NA

Specialised facilities −

Specialised skills ++ + ++ ++ ++ ++ +++ +++

Ethical considerations ++ NA ++ ++ ++ ++ +++ +++

Inter-sample variation +++ + +++ +++ +++ +++ ++ +++

Sample processing time ++ + ++ ++ ++ ++ +++ +++

Limitations to treatments + + ++ ++ ++ ++ +++ +++

Physiological relevance to human biology and pathology

3D tissue environment − −

Cell population heterogeneity − −

Primary skin tissue − − (xenografts)

Immune component − − − − Available

Phylogenetic similarity +++ +++ +++ +++ +++ +++ ++ +++

Carcinogenesis mechanism +++ ++ +++ ++ ++ +++ + +++

Use as pre-clinical model −


As described in 1.4.1, elements of the ECM coupled with the tissue

organisation are known to be integral in the maintenance of cellular homeostasis

(Dawson, 1996; Cheng, 2011). In keratinocytes, the disruption of any of these factors

(such as in the absence of a fibroblast feeder layer) may result in the inappropriate

initiation of a wound-healing response such as premature differentiation (Dawson,

1996). In the long-term, due to potential modifications to cell morphology and

signalling processes, repeated subculture is also known to alter the UV-response

(Briske-Anderson et al., 1997; Chang-Liu and Woloschak, 1997). While this can be

overcome to some extent by pre-coating cell culture surfaces with ECM components

(Hollier et al., 2005), the use of most traditional 2D systems may not always be fully

representative of the in vivo situation.

2D co-culture systems

Co-culture systems, such as the use of Transwell® tissue culture plates,

overcomes some of the limitations of monolayer culture by allowing the

simultaneous cultivation of two cell types that are physically separated but that share

a common growth medium. These co-culture systems have been described in the

cultivation of both primary keratinocytes and malignant cells (De Luca et al., 1988;

Wei et al., 1999; Papini et al., 2003). Such models have advantages over

keratinocytes grown on mouse feeder layers in that ‘pure’ cultures of keratinocytes

can be isolated since they are physically separated from the mesenchymal cells. This

is of particular benefit in preventing contamination from other cell types when

extracting keratinocyte RNA or proteins, for instance. Furthermore, because

keratinocytes are grown on membranes in detachable inserts, this allows for the

removal of inserts to expose individual monolayers of cells to UVR in the case of

photobiology studies.

1.6.2 Animal models

Whole organism models have empowered researchers with the ability to

investigate complex local and systemic processes in an in vivo setting (Ha et al.,

2005). Despite this, to date no one particular animal model faithfully represents the

molecular pathogenesis and aetiology of human skin cancers. The potential for

genetic and immunologic alteration in the animal model of choice is also highly

beneficial for dissecting the mechanisms of photocarcinogenesis. Accordingly,

certain mouse strains have been developed with specific parallels to human


photocarcinogenesis pathways. For example, the SKH-1 albino mouse strain has

been extensively applied in elucidating the mechanisms of SCC initiation and

progression due to similarities in the genetic profile of skin tumours and

tumorigenesis compared to humans (Verkler et al., 2008). Likewise, the hepatocyte

growth factor/scatter factor (HGF/SF) transgenic mouse strain is not only

histologically similar to human skin, but also displays similar patterns of melanoma

development, progression and the associated gene alterations (Takayama, 1996;

Noonan et al., 2003). Another approach in maintaining biological relevance to

humans involves xenografting human tissue onto immunodeficient mice to analyse,

for instance, the factors influencing tumour invasion (Walsh, 2011). A two-stage

carcinogenesis protocol is usually used in inducing mouse tumours. This involves

firstly initiating cancer cells with UVR treatment together with a chemical

carcinogen such as 7,12-Dimethylbenz(a)anthracene (DMBA) (Sauter, 1998) as

UVR exposure alone does not directly act as a cancer initiator and promoter in

mouse skin (Halliday, 2005). Next, the repeated administration of a tumour-

promoting agent, commonly 12-O-tetradecanoylphorbol-13-acetate (TPA), induces

the amplification of the initiated cancer stem cell population (Kemp, 2005). This

technique may therefore diverge from the pathways of human photocarcinogenesis.

Additionally, murine tumours manifest mainly as non-epithelial sarcomas and

lymphomas as opposed to the majority of human tumours which are epithelial in

origin (Artandi et al., 2000). Mice also differ to humans in their skin biology, for

example, possessing different growth fractions of actively proliferating basal

keratinocytes, of around 60% (Potten, 1974), as compared to approximately 20% in

human keratinocytes (Heenen et al., 1998).

Besides mice, fish models such as the Xiphophorus, zebrafish and medaka have

been frequently used, in particular to study factors influencing the development of

CMM (Stanton, 1965; Naruse et al., 2004; Geiger et al., 2008). This model holds

considerable potential for the screening for future genetic and chemical inhibitors

and modifiers of melanoma progression. Critically, however, due to the evolutionary

separation from humans, results obtained from non-mammalian systems such as

these may not necessarily be directly translated to humans. In the case of resistance

to UVR-damage, for instance, Xiphophorus possess certain unique innate defences


including DNA photolyase which is photoactivated to repair nuclear DNA lesions

(Ahmed and Setlow, 1993).

On the other hand, several considerations need to be made before adopting the

use of animal models. Besides the ethical considerations, several cardinal anatomical

differences exist between the skin biology of most animal models and humans. For

example, the abundance of fur, relatively thinner dermal and epidermal layers,

distinct localisations of melanocytes and metabolic rates separate mice models from

humans (Khavari, 2006). To summarise, skin cancers are not naturally occurring in

many commonly-used laboratory animals and have to be artificially-induced

chemically, often with non-physiological doses of UVR (Halliday, 2005). Among

species in which skin malignancies are naturally occurring, the zebrafish and medaka

fish models are frequently employed, and have been instrumental in studies into the

biology of melanoma development (Naruse et al., 2004; Fernandez et al., 2012a).

However, the evolutionary separation between humans and distinctive DNA repair

mechanisms in these fish species, limit their use as a comparative model (Mitchell,

2010). Moreover, there has been a global shift towards more stringent laws

regulating and limiting the use of laboratory animals as testing models (Ponec,

2002). Indeed, recent amendments to the European Union Cosmetic Directive

prohibit the testing of therapeutic or cosmetic products on animals (Adler et al.,

2011). Therefore, there is an urgent need for reproducible and effective alternative in

vitro skin models.

1.6.3 In vivo clinical studies

Examining cutaneous and systemic changes in consenting volunteers is the

gold standard model of photobiology research. Indeed, studies into the local immune

response (Brink et al., 2000a), DNA damage (Snellman et al., 2003) and gene

expression (Beattie et al., 2005) have been carried out in vivo on participants.

However, major ethical concerns regarding the use of human volunteers limit such

studies due to the risks involved and the requirement for painful skin biopsies.

Further limitations include the number of UVR treatments per participant and the

dosage that can be safely administered. In order to overcome these issues, a number

of skin substitute research models have been established.


1.6.4 In vitro skin models

Skin explant models

Explant cultures consisting of ex vivo human skin tissue are a simple yet

versatile model that have been widely adopted to monitor keratinocyte damage and

the efficacy of photoprotective treatment with UVR (Arad, 2007). Such ex vivo

cultures are also advantageous for analysing complex processes such as

melanogenesis (Dong et al., 2010) and UVR-induced modulation of the cutaneous

endocrine system (Ito et al., 2005), as the native skin biology is retained. Explant

keratinocytes in culture conditions have been demonstrated to be capable of many

processes associated with metabolism, proliferation and DNA repair after irradiation

(Reus, 2011). Nonetheless, a major drawback of this system is the limited lifespan of

the explant cultures in vitro. The viability of cells within the excised tissue decreases

rapidly with an associated increase in apoptosis (Reus, 2011). Under culture

conditions, explants have a lifespan of around five days before displaying a marked

drop in cell proliferation and the thickening of the stratum corneum from increased

terminal differentiation is observed (Onuma, 2001). Besides this, there is a limited

capacity for post-irradiation regeneration, with only about 5% of the total

keratinocyte population shown to be actively proliferating in ex vivo explant models

(Onuma, 2001).

Tissue-engineered models

The method of isolating and culturing primary human keratinocytes represents

a major cornerstone in the evolution of tissue-engineered skin equivalent models.

Cultivated keratinocytes are reconstituted onto either naturally-derived or synthetic

dermal scaffolds, thus creating a 3-dimensional (3D) human skin equivalent (HSE)

organotypic model, encompassing both the epidermal and dermal elements. These

skin composites were initially developed in clinical practice during the 1980s for

grafting onto victims of burns who sustained extensive full-thickness skin damage

(Burke, 1981; Chakrabarty, 1999). Since its inception, the HSE has also evolved into

a powerful research tool with numerous applications in skin biology research (Ponec,

2002; Supp and Boyce, 2005; MacNeil, 2007). These models have been used to

study aspects of skin pigmentation (Hedley et al., 2002; Bernerd et al., 2012), wound

healing (Falanga et al., 2002), cancer progression (Meier et al., 2000) and various

cellular interactions (Harrison et al., 2006a).


Fundamentally, most HSEs retain the native structural and cellular

organisation. The key function of the scaffold component is to mimic the dermis and

ECM, which is lacking in many simple 2D models (Morita, 2002). Synthetic

biomaterials have been applied for this purpose, which include the use of chitosan-

gelatin-hyaluronic acid (Liu et al., 2004), collagen (Valenta, 2004) and fibrin

(Mazlyzam, 2007). Natural polymers are usually preferred over synthetic compounds

that may affect cell proliferation due to a lack of biocompatibility. Dermal substitutes

like Alloderm™ (Lifecell Corporation, Branchberg, NJ), Biobrane™ (Dow

Hickham/Bertek Pharmac., Sugar Land, Tx) and Integra™ (Integra LifeScience,

Plainsborough, NJ) are commercially-available, but have mixed results in terms of

cellular interactions with the dermal matrix (Schafer et al., 1989). Cell-based skin

substitutes, such as EpiDerm (MatTek), which are comprised of both the epidermal

and dermal components, are also obtainable. It has been documented, however, that

HSEs consisting of biopolymer or animal-derived dermal components, such as rat

tail collagen, have altered tissue microenvironments in terms of the presence of

glycosaminoglycans, proteoglycans, lipids and fibrin (El Ghalbzouri et al., 2009).

Attempts to create pigmented bioengineered skin equivalents to investigate

melanocyte biology and interactions with keratinocytes have progressed significantly

in recent years. Early work conducted on the isolation and culture of primary human

melanocytes (Eisinger and Marko, 1982; Marko et al., 1982) have led to the

development of specialised culture mediums and conditions for the propagation of

these cells (Halaban et al., 1988; Medrano and Nordlund, 1990; Na et al., 2006; Li et

al., 2012). The pigmentary system, however, is still a challenge to recreate

structurally and functionally in vitro. Proliferation and functional characteristics of

melanocytes (migration, melanogenesis and dendrite formation) in vivo are highly

regulated by signals from ECM molecules, UVR-exposure and various paracrine

factors, especially those secreted by surrounding keratinocytes (Yaar and Gilchrest,

1991; Scott et al., 1997). In cultures solely consisting of melanocytes, it is not

surprising therefore, that these cells are observed to have altered morphologies and

functionality (Shin et al., 2012). Cultured melanocytes often lose dendrites and

become hyperproliferative, thus losing intrinsic properties of native cells (Herlyn et

al., 1988).


Pigmented HSEs consisting of a keratinocyte and melanocyte epidermal layer

constructed on collagen gels (Archambault et al., 1995; Bessou et al., 1997), and de-

epidermised dermal (DED) scaffolds (Todd et al., 1993; Bessou et al., 1996; Bernerd

et al., 2012) have been applied to model reactions to UVR and pigmentation. Indeed,

the incorporation of melanocytes into both 2D and 3D culture systems has aided in

the discovery of many regulators and pathways involved in skin pigmentation

(Hedley et al., 2002; Smith-Thomas et al., 2004; Balafa et al., 2005). However,

limitations in the pigmented skin models and technical difficulties have been

encountered in these studies. Varying results regarding the proliferation-potential,

survival and differentiation status of melanocytes in the HSE, as well as the

consistency of the melanocyte to keratinocyte ratio have been reported (Bertaux et

al., 1988; Nakazawa et al., 1997; Zhao et al., 2012). This has been attributed to the

seeding ratio, culture conditions and variation between melanocyte donor skin types

(Nakazawa, 1998). It has proven to be even more challenging to maintain native

melanocyte biology with high seeding densities of melanocytes and other culture

conditions being linked to melanocyte hyperproliferation and a shift towards a

neoplastic phenotype (Larue et al., 1992; Oba-Shinjo et al., 2006). Overall, while

pigmented HSEs have potential as a powerful model for studying melanocyte

biology and function, considerable work needs to be conducted into preserving the

delicate equilibrium of the melanocyte microenvironment to maintain the consistency

and reliability of results obtained.

Commercially-available HSE composites are advantageous as they negate the

need for ethical approval, access to human tissue donors and laborious primary cell

isolation and culture methods. In Australia, however, strict quarantine restrictions

limit the entry of human cell-based materials, thus making such commercial products

unattainable to researchers (Poumay, 2004). Ultimately, due to logistical issues and

high costs involved, the import of such skin cultures may not be viable as a globally-

accepted research tool.

1.6.5 HSEs as in vitro photobiology models

The structure, cellular organisation, biochemistry and cell-cell interactions in

native skin each play a vital role in the cutaneous responses to irradiation. Therefore,

an experimental model which reflects these properties as faithfully as possible to the

in vivo situation would generate the most physiologically-relevant data on cutaneous


photodamage. The classic markers of UVB radiation-induced skin damage, such as

alterations to keratinocyte cell viability (Gujuluva et al., 1994), proliferation (El-

Abaseri, 2006) and apoptosis (Zhuang et al., 2000) and the formation of CPDs, have

been detected in HSE models. Likewise, UVB radiation-induced expression changes

in the epidermal proteins like keratins (Smith and Rees, 1994), filaggrin, loricrin,

transglutaminase type 1 and involucrin (Lee et al., 2002) have also been observed in

various irradiated HSE models (Bernerd, 1997). Keratin expression patterns can be

used as a useful marker of a range of characteristics of the epidermis, including

keratinocyte differentiation and thickening in response to UVR (Baba et al., 2005).

Keratin 10 is expressed by keratinocytes in the early stages of differentiation and its

expression has been shown to diminish in the days following UVB irradiation

(Bernerd, 1997). During the regenerative period, the expression of keratin 10

progressively resumes, and thus can also be used as a marker of epidermal repair.

Other keratinocyte differentiation markers that are modulated by irradiation are

filaggrin and loricrin. Filaggrin is a precursor for the generation of urocanic acid

(UCA), a UVB radiation-absorbing substance which reduces the amount of radiation

that can penetrate the epidermis (Zenisek, 1955). Both filaggrin and loricrin (found

in the cornified cell envelope of terminally-differentiated keratinocytes) in HSE

show a similar pattern of post-irradiation decrease, followed by a gradual increase

over about 10 days (Bernerd, 1997). Importantly, the previously used HSE models

possess the capacity for post-irradiation repair and regeneration, with epidermal

normalisation taking place over a period of around 1 to 2 weeks in vitro (Bernerd,

1997).

1.6.6 HSE-DED as an organotypic model

To create a physiologically-relevant in vitro representation of human skin, it is

fundamental to recreate a tissue environment that recapitulates as closely as possible

the morphology, function and cell-cell interactions that occur in vivo. In view of this,

a DED scaffold, derived from ex vivo tissue has been chosen to create this

organotypic model for the studies in this thesis. The HSE-DED consists of primary

human skin cells grown on a DED base and cultured at the air-liquid interface to

promote epidermal formation (Figure 1.9). Importantly, the HSE-DED has been

found to closely approximate native skin both in terms of the morphology and

biochemistry of the dermis and epidermis (Chakrabarty, 1999; Ponec, 2002; Huang,


2004; Poumay, 2004; Welss et al., 2004; Harrison et al., 2006b). This system has

been established as a model of cutaneous wound healing in our research group

(Kairuz et al., 2007; Xie et al., 2010; Xie et al., 2011). In particular, the HSE-DED

has been used in the evaluation of potential therapeutics to promote

reepithelialisation via enhancing keratinocyte proliferation and migration (Xie et al.,

2011). Additionally, it has been used to investigate regeneration following burn

injury, the impact of hyperbaric oxygen therapy on wound healing and in the

development of chemically-defined culture media (Topping, 2006; Kairuz et al.,

2007; Borg et al., 2009; Mujaj et al., 2010).

Figure 1.9. HSE-DED composites in culture

Human skin equivalent on de-epidermised dermal scaffold (HSE-DED) composites are cultured at the air-liquid

interface of media to promote the maturation of the epidermal component. The scale bar represents 1.5 cm.

Briefly, construction of this model involves the decellularization of ex vivo skin

tissue while preserving BM components and the organization of collagen in the

dermis (Ghosh et al., 1997; Huang, 2004). Primary keratinocytes and fibroblasts are

isolated and cultured and are then seeded back onto the DED (Black, 2005). The

processing of the DED removes cells from the tissue while retaining essential ECM

factors. This is important as cellular interactions with the BM are known to be

paramount in regulating the function and viability of basal keratinocytes and

underlying dermal fibroblasts (Jones, 1995). Experimental evidence shows that

keratinocytes grown on HSE composites lacking a complete BM, such as in artificial

matrices, exhibited lower levels of attachment, proliferation, atypical epidermal

architecture and significantly greater numbers of apoptotic cells (Chakrabarty, 1999;


Segal, 2008). Once primary cells are seeded onto the DED scaffold, the initial

presence of BM proteins enhances subsequent retention and remodelling of the BM

layer by cells to mimic the in vivo situation (Ralston et al., 1999). It has been

observed that elements of the BM including collagens IV, VII and laminin, are

maintained with the use of the DED (Medalie et al., 1996).

Keratinocytes in HSE-DEDs when in contact with air have been shown to

differentiate and form a mature epidermis (Prunieras et al., 1983). Moreover, multi-

photon microscopy has revealed that the epidermal microtopology and architecture in

the HSE-DED cultured at the interface of air and culture medium is akin to that of

native skin, with the preservation of structural features such as rete ridges (Xie et al.,

2010). Other epidermal markers, such as the presence of the natural epidermal layers

and the expression of keratins 1/10/11, 6, 14, 16, loricrin, involucrin and filaggrin

have also been identified in the HSE-DED (Monteiro-Riviere et al., 1997; Parnigotto

et al., 1998; Ponec et al., 2000). The stratum corneum is absent in submerged and

conventional 2D keratinocyte cultures and hence deviate from the native epidermal

organisation (Parnigotto et al., 1998). Lamellar bodies, which play a critical role in

maintaining the skin’s barrier against irritants, were also found to be present in the

HSE-DED (Fartasch and Ponec, 1994). A histological comparison between native

skin and HSE-DED tissue sections is shown in Figure 1.10.

Figure 1.10. Comparison of histology between native skin and HSE-DED sections.

The histology of HSE-DED (B) shows similarities to that of native skin (A), stained with haematoxylin and eosin.

The epidermis in the HSE-DED shows the preservation of keratinocyte organisation patterns as in native skin,

including the presence of the stratum corneum. The arrow indicates the presence of rete ridges at the dermal-

epidermal junction.


While HSE models with synthetic dermal scaffolds have been used in

photobiology as described previously, the model proposed for use in the studies in

this thesis, consisting of a DED and a reconstructed epidermis has yet to be fully

characterised as a potential research tool for studying the effects of UVR. The HSE-

DED possesses an ex vivo dermal component which, as an in vitro model, more

closely mimics the in vivo situation as compared to synthetic scaffolds (Topping,

2006). Specifically, the DED together with the preservation of elements of the BM

are considered to be advantageous in terms of promoting and maintaining a

multilayered epidermis (Chakrabarty, 1999; Pianigiani et al., 1999). Moreover,

structural and organisational aspects of the DED and HSE epidermis have been

shown to be very similar to native skin, which is critical in particular for

photobiology studies to model the path of UVR in skin (Dawson, 1996). As a major

aim of this study was to investigate how dermal fibroblasts influence epithelial

responses to UVB radiation, this cell-based platform was adopted to model this

crosstalk in a physiologically-relevant setting.

27

1.7 SUMMARY AND SIGNIFICANCE

The development of more sophisticated preventative and treatment strategies

against skin cancer is closely linked with advancing our understanding on the

biology of photocarcinogenesis. While the long-term clinical implications of UVR

exposure and the resulting damage to the skin on a cellular level have been well-

documented, the mechanisms behind this photodamage have yet to be fully

understood. In particular, the paracrine interactions between mesenchymal and

epidermal cells and their role in the development of NMSCs have not been defined.

In part this is a result of limitations in current experimental models, including cell

culture and animal models (Table 1.1.1.). However, advancements in tissue-

engineering techniques have led to the application of increasingly elegant HSE

constructs to model native skin in the study of cellular responses to UVR.

The significance of the HSE-DED model lies in the ability to detect specific

markers of photodamage in irradiated primary skin cells grown in a physiologically-

relevant model. This allows flexibility to study cellular alterations at a range of

different UV doses and post-irradiation time points with varying combinations of

incorporated skin cell types. Besides providing an alternative to animal models for

studying the mechanisms surrounding cellular responses to UVR, the HSE-DED

model can provide an accessible substitute for commercially-available skin

substitutes and 2D culture systems. Importantly, this represents a biologically-

relevant platform for investigating paracrine interactions between epidermal and

dermal cells to more accurately understand the role that this interplay has on the

development of NMSCs. With the incidence of skin cancers on the rise both globally

and nationally, the HSE-DED model of photobiology may aid in the urgent need to

bridge current knowledge gaps in the field. Moreover, this system can be applied to

creating improved treatment and preventative strategies against skin damage, thus

reducing the risk of skin cancer development.

28

1.8 PROJECT HYPOTHESES

The underlying hypotheses of this project are as outlined below. Firstly, it was

hypothesized that a human cell-based in vitro skin equivalent model can be utilised

as a physiologically-relevant platform for photobiological studies. Next, it was

hypothesized that dermal fibroblasts influence the responses of epithelial

keratinocytes to UVB radiation by enhancing cell survival and repair processes. I

was also hypothesized in the studies reported herein that the IGF system may play an

important role in this crosstalk during the acute response to UVB radiation.

1.9 PROJECT AIMS

The following outline the major aims of the research conducted in this project:

1. Validation of 2D and 3D in vitro models of cutaneous photobiology to

study keratinocyte responses to UVB radiation.

2. Investigation of the influence of paracrine interactions between dermal

fibroblasts and keratinocytes during the acute UVB irradiation response.

3. Studying the role of IGF-I in the fibroblast-mediated protection from UVB

radiation-damage in keratinocytes.

29

Chapter 2: Materials and methods

2.1 INTRODUCTION

The protocols and materials used throughout this project have been detailed in

this Chapter. Any specific deviations to the procedures outlined in the following

sections are described where they appear. Where not specified, laboratory grade

general regents were purchased from commercial suppliers. Technical details on

specialised experimental procedures are also described in this Chapter.

2.2 EXPERIMENTAL PROCEDURES

2.2.1 Ex vivo skin tissue collection

Human skin tissue (from surgical discard) was obtained from informed and

consenting donors undergoing elective abdominoplasty and breast reduction surgical

procedures. Ethical approval for the collection of human tissue samples was granted

by the Queensland University of Technology, as well as the Institute of Health and

Biomedical Innovation and the hospitals from which patient samples were obtained.

These included ethical approval for sample collection from St Andrew’s War

Memorial Hospital (Approval number: 2004/46) and the Princess Alexandra and

Brisbane Private Hospitals (Approval number: QUT 3865H). Donor skin tissue from

surgical discards was superficially cleaned with isopropyl alcohol-impregnated wipes

and subcutaneous fat was subsequently removed using a scalpel blade. Split-

thickness skin grafts (of approximately 1 mm thickness) were sectioned using a

surgical dermatome. Skin tissue was collected in sterile transport medium containing

antibiotic/antimycotic solution (ABAM) (10,000 U/mL penicillin G, 10,000 µg/mL

streptomycin sulphate and 25 µg/mL amphotericin B in 0.85% sterile saline

(Invitrogen)). All subsequent processing of ex vivo skin tissue was conducted under

sterile conditions.

30

Processing of skin tissue samples

Pieces of donor skin tissue were treated with serial antimycotic and

antimicrobial washes to prevent fungal and bacterial culture contamination. Skin was

immersed in a wash medium (4% ABAM in 500 mL phosphate buffered saline

(PBS) with 160 mg gentamicin sulphate) for five minutes, followed by a second

wash (2% ABAM in 500 mL PBS with 80 mg gentamicin sulphate), and a final wash

in 1% ABAM in 500 mL PBS for five minutes each. Thinner regions of skin tissue

were cut into approximately 3 mm by 3 mm pieces for skin cell isolation and culture

as described in the next section. Other pieces of skin with thicker, more uniform

dermal thicknesses were cut into approximately 15 mm by 15 mm squares for use as

a dermal scaffold, as outlined in Section 2.2.3.

Fixation of control native skin samples

Ex vivo native skin samples were obtained to use as comparative controls. Skin

tissue obtained in 2.2.1 was immersed in 10% neutral buffered formalin (United

Biosciences, Queensland, Australia) overnight at 4°C. Fixed skin tissues were then

transferred to tissue processing cassettes before being immersed in 70% ethanol.

Subsequent processing for histological and immunohistochemical studies was

performed as described in 2.2.6.

2.2.2 Primary cell culture

Isolation of keratinocytes from ex vivo tissue

A modification of the protocol originally described by Rheinwald and Green

(1975) was used for the isolation of primary keratinocytes. Briefly, after processing,

3 mm by 3 mm pieces of skin tissue were incubated in 0.125% trypsin solution

(Invitrogen) in PBS at 4°C overnight to digest skin at the dermal-epidermal junction.

After enzymatic digestion, the epidermis was physically detached from the dermis

using forceps. Cells at the epidermal-dermal junction were gently scraped off using a

scalpel blade. Collected cells were then resuspended in Full Green’s medium (FGM)

(Rheinwald, 1975), consisting of Dulbecco's Modified Eagle Medium (DMEM) with

Ham’s F12 Medium (in a 3:1 ratio). The following additives were also added: 10%

foetal calf serum (FCS) (Hyclone); 10 ng/mL human recombinant epidermal growth

Chapter 2: Materials and methods 31

factor (EGF) (Invitrogen); 1% v/v penicillin/streptomycin solution (Invitrogen); 1

µg/mL insulin (Sigma-Aldrich, Australia); 0.2 µM triiodothyronine (T3) (Sigma-

Aldrich); 0.01% non-essential amino acids solution (Invitrogen); 5 µg/mL transferrin

(Sigma-Aldrich); 180 mM adenine (Sigma-Aldrich); 0.4 µg/mL hydrocortisone

(Sigma-Aldrich) and 0.1 µg/mL cholera toxin (Sigma-Aldrich) (Chakrabarty, 1999).

The freshly-isolated cell suspension was centrifuged at 1000 rpm for 5 minutes and

resuspended in fresh FGM, before being passed through a 70 µm cell strainer. Cell

numbers were then counted using a haemocytometer (Neubauer) and the live:dead

cell ratio assessed using Trypan blue (Sigma) staining.

Culture of human keratinocytes

Keratinocytes were cultured using a protocol based on the original technique

described by Rheinwald and Green. Primary keratinocytes were co-cultured on a pre-

seeded feeder layer of the murine 3T3 fibroblast cell line (J2 clone, American Type

Culture Collection, Manassas, VA, USA). These 3T3 fibroblasts were cultured

routinely in DMEM supplemented with 5% FCS, 1% v/v penicillin/streptomycin

solution (Invitrogen) and 2 mM L-glutamine (Invitrogen) at 37°C with 5% CO2.

Before being seeded as a feeder layer, the 3T3 fibroblasts were trypsinised,

resuspended in FGM and irradiated with 50 Gy gamma radiation (Australian Red

Cross Blood Service, Brisbane, Australia). The irradiated 3T3 fibroblasts were

seeded at a density of 2 x 106 cells per 75 cm

2 (T75) tissue culture flask in 10 mL

FGM and were incubated at 37°C with 5% CO2 for 24 hours prior to the addition of

2 x 106 freshly-isolated epidermal cells. Primary cell cultures were maintained at

37°C with 5% CO2. The cell culture medium (FGM) was replaced every two to three

days, until the keratinocytes reached a confluency of about 80%. This usually took

around seven to nine days.

Culture of primary human dermal fibroblasts

After the removal of the epidermis for keratinocyte isolation (as outlined in the

previous section), the remaining dermal tissue was finely minced using a scalpel

blade into approximately 0.5 mm x 0.5 mm pieces and was then enzymatically-

digested in 0.05% collagenase A (Type I) (Invitrogen) in DMEM at 37°C, 5% CO2

overnight. This digested dermal tissue in solution was then centrifuged at 2000 rpm

for 10 minutes. The tissue was resuspended in DMEM supplemented with 10% FCS,

1% v/v penicillin/streptomycin solution and 2 mM L-glutamine and cultured in a T75

32 Materials and methods

cell culture flask. Dermal fibroblast cultures were passaged upon reaching a

confluence of approximately 80%, and passage 2-5 (P2-5) cells were used for all

further experiments.

2.2.3 Construction of human skin equivalent

Preparation of de-epidermised dermal scaffold

The de-epidermised dermis (DED) from ex vivo skin tissue was prepared using

previously-reported methods (Dawson et al., 2006). In brief, larger pieces of ex vivo

skin tissue (1.5 cm x 1.5 cm) were decellularised by immersion in sterile hypertonic

1 M sodium chloride solution (Sigma-Aldrich) and incubated overnight at 37°C to

decellularise the tissue. The non-viable epidermis was then separated from the

dermis using forceps and discarded. The remaining DED was immersed in three

successive antibiotic washes for 24 hours each, as described in Section 2.2.1, and

stored at 4°C until further use. Before the construction of the HSE, the DED was

submerged into the experimental medium of choice for 4 hours at 37°C to allow for

diffusion and equilibration of the medium in the DED.

Construction of HSE-KC

The HSE composites were constructed using a previously described protocol

(Topping, 2006; Xie et al., 2010). The DED tissue (outlined in the previous section)

was immersed in FGM for 4 hours at 37°C, before being placed into the wells of a

24-well tissue culture plate (Nagle Nunc International, Roskilde, Denmark) with the

papillary surface facing upwards. Sterile stainless steel rings with 6.7 mm internal

diameter silicone washer bases (Aix Scientific, Aachen, Germany) were rinsed in

PBS and positioned centrally onto the papillary surface of the DED (Topping, 2006).

Primary keratinocytes at Passage 1 (P1) were trypsinised upon reaching 80%

confluence and resuspended at a concentration of 1 x 105 cells/mL in FGM. Next,

200 µL of this P1 cell suspension was added to the internal well of each stainless steel

ring. The external space between the ring and the well was topped up with FGM. The

HSE-KC constructs were cultured with the rings containing keratinocyte suspensions

for 48 hours at 37°C with 5% CO2. To culture HSE composites at the air-liquid

interface, sterile stainless steel grid inserts with 1 mm diameter circular pores were

placed into 6-well tissue culture plates (Nunc). The stainless steel rings were then

removed from the surface of the DED and the newly formed HSE-KC constructs

were placed on top of these grid inserts. Approximately 6 mL of FGM was then


added to the wells such that the DED was partially submerged and the upper

epidermal surface was at the air-liquid interface. The HSE-KC composites were then

cultured for 9 days at 37°C with 5% CO2, and the medium was replenished every two

to three days, maintaining the surface of the HSE-KC epidermis at the air-liquid

interface.

Construction of HSE-KCF

The HSE-KCF model was constructed using a similar protocol to that

described in the previous section. Briefly, dermal fibroblasts at P2-5 (as described in

Section 2.2.2) were trypsinised and resuspended in FGM. Next, 1 x 104 cells in 200

µL of medium was added to the internal well of the stainless steel rings on the

papillary surface of the DED. These were cultured for 48 hours at 37°C with 5%

CO2. Half of the medium was then aspirated from the stainless steel wells and 2 x 104

keratinocytes at P1 in 100 µL were added to the wells. The composites were then

cultured for a further 48 hours at 37°C with 5% CO2, before the rings were removed

and HSE-KCF composites transferred to stainless steel grids within 6-well tissue

culture plates, with the papillary surface at the air-liquid interface. The HSE-KCF

composites were cultured in these conditions for 9 days at 37°C with 5% CO2, with

the medium replenished or replaced every two to three days. A diagram outlining the

timelines of the HSE-KC and HSE-KCF construction is depicted in Figure 2.1.

34

Figure 2.1. Timelines of 2D and 3D keratinocyte in vitro culture methods

This diagram illustrates the timelines associated with the construction of the 3D HSE-KC skin culture (Section

2.2.3) and the 2D co-culture method described in Section 2.2.4. The first step of method of HSE construction is

the isolation and culture of primary keratinocytes, a process taking about seven days. For the HSE models, the

keratinocytes are seeded onto the DED scaffold for 2 days before being raised to the air-liquid interface for 9

days to promote epidermogenesis. Upon the maturation of the epidermis, the composites are then exposed to

UVB radiation. Samples are then harvested during the five-day post-irradiation period to study the acute effects

of UVB irradiation on these composites. However, HSE samples may be maintained in culture for up to three

weeks (Ng and Ikeda, 2011). For the Transwell® co-cultures, keratinocyte monolayers are irradiated after the

two-day seeding period with samples harvested during the post-irradiation period for further analysis.

2.2.4 Co-culture of keratinocytes and dermal fibroblasts using a Transwell® cell

culture system

The co-culture of primary keratinocytes and fibroblasts using Transwell® cell

culture plates (Corning, Costar, Cambridge, MA, USA) followed a modified protocol

previously described by Kandyba and colleagues (2008). Primary dermal fibroblasts

(P2-5) were seeded at a density of 5 x 104 cells in 900 µL FGM per well into the

bottom wells of the 12-well co-culture plates. Fibroblasts were maintained in culture

for 24 hours at 37°C with 5% CO2. Transwell® inserts with 0.4 µm pore size

polyester membranes were then inserted into these wells, and 3 x 105 P1 primary

keratinocytes in 400 µL FGM were added to each insert and then returned to the

culture conditions (Figure 2.2). After 24 hours from the time of keratinocyte seeding,

the FGM was aspirated, and both the insert membranes and the bottom wells were

washed once in warmed PBS. The medium was then replaced with serum-free

medium (SFM), consisting of FGM without FCS, hydrocortisone, insulin, EGF,

hydrocortisone and T3. Growth factors used in subsequent studies were diluted to the

appropriate concentrations in this SFM. In experiments on keratinocyte monolayers

cultured without the presence of fibroblasts, Transwell inserts were removed at day 2


post-keratinocyte seeding and transferred to fresh 12-well plates without cells in the

lower chambers. Keratinocyte monolayers were exposed to UVB radiation as

described in Section 2.2.5.

Figure 2.2. Transwell® co-culture of primary human keratinocytes and fibroblasts

Schematic diagram showing the co-culture of fibroblasts (Fib) in lower well and keratinocytes (KC) cultured on a

membrane in the upper insert well (A). Both cell types share common medium (FGM or SFM) through the

membrane with 0.4 µm diameter pores. In experiments requiring the culture of keratinocytes only, inserts were

transferred to new wells in the absence of fibroblasts upon reaching confluency (B). For the UVB irradiation of

keratinocytes (C), inserts were removed from the wells and exposed to UVB radiation as described in Section

2.2.5.

2.2.5 UVB irradiation protocols

Irradiation of HSE composites with UVB radiation

The HSE composites were irradiated with single doses of UVB radiation using

a TL40 medical UVB bulb (Philips) with a stabilised power supply inside a Class II

Biological Safety Cabinet (Figure 2.3). The UVB bulb was encased in a layer of

cellulose acetate (Kodacel TA-407 clear 0.015 inch, Eastman-Kodak), thus

efficiently blocking any contaminating wavelengths below 290 nm (Therrien et al.,

1999). The precise output of UVB radiation transmitted was assessed using a 0.5 m

focal length action double spectroradiometer (Princeton Scientific Instruments, New

Jersey, USA) calibrated to deliver 9.27 mJ/cm2/min UVB radiation, at a distance of 6

cm from the external surface of the bulb. The HSE constructs were transferred to

Petri dishes containing a thin layer of pre-warmed PBS to 37˚C with the epidermal

surface facing upwards. All UVB irradiation treatments were conducted in PBS as

the exposure of cell culture medium to UVR has been demonstrated to result in the

generation of cytotoxic photoproducts (Wang, 1976; Zigler et al., 1985). To exclude

the effects of heat and visible light, the HSE composites were irradiated in the dark

and the temperature at the surface of the HSE was monitored and found to be


constant at room temperature of about 23°C. The irradiation protocol for a 50 mJ/cm2

dose, as used in this project, required HSEs to be placed in the irradiation set-up for a

period of 5 minutes and 24 seconds. Non-irradiated controls were treated to the same

experimental conditions for this duration, but in the absence of a UVB radiation

source.

37

Figure 2.3. UVB irradiation of cells and skin tissue samples

Diagrammatic representation of the UVB irradiation method. A medical UVB lamp was set up inside a Class II

Biological Safety Cabinet to maintain sterile conditions during irradiation. The distance from the surface of the

lamp to the surface of the samples (as indicated by the arrow) was fixed at 6 cm, based on the calibrated output of

the lamp. Non-irradiated controls were placed under the same irradiation conditions, but in the absence of a

UVB-emitting source.

Irradiation of keratinocyte monolayers in Transwell® co-cultures

To irradiate keratinocyte monolayers in the co-culture studies, the Transwell®

inserts (from 2.2.4) were removed from their respective cell culture wells, washed

once in 100 µl of pre-warmed PBS and exposed to UVB radiation (as described in

2.2.5), under 50 µL PBS. After UVB irradiation, this layer of PBS was removed and

fresh culture medium was replaced into the inserts and wells. Co-culture plates were

then returned to culture conditions before samples were harvested at specific time

points post-irradiation.

2.2.6 Histological analysis

Sections of HSE and native skin tissue were analysed histologically using a

routine haematoxylin and eosin staining method. Briefly, tissues were fixed in 10%

neutral buffered formalin (United Biosciences, Queensland, Australia) overnight at

4°C. Fixed HSE composites were cut in half using a scalpel blade and transferred to

tissue processing cassettes before being immersed in 70% ethanol. The tissues were

then paraffinised using an automated vacuum tissue processor (Excelsior ES, Thermo

Scientific), embedded in paraffin using a tissue embedder (Shandon Histocentre 3,

Thermo Electron Corporation) and 3 µm sections were cut using a rotary microtome

(Leica RM2245, Leica Microsystems, Australia). Tissue sections were deparaffinised

in xylene (Merck), washed in a graded ethanol series and rehydrated in distilled


water. The sections were then stained with Harris haematoxylin (HD Scientific,

Australia) and alcoholic eosin phloxine (HD Scientific) following a standard

haematoxylin and eosin staining protocol (Coleman et al., 2012). Stained sections

were mounted with Pertex® mounting medium (Medite, Burgdorf, Germany) and

glass coverslips (#1.5, HD Scientific). Stained sections were imaged using an

Olympus BX41 microscope with attached digital camera (Micropublisher, 3.3 RTV,

QImaging).

2.2.7 Immunohistochemical analysis

Immunohistochemical analysis was performed as previously documented

(Topping, 2006). Briefly, paraffin sections of irradiated HSEs, of 3 µm thickness

were mounted onto Superfrost® Plus microscope slides (Menzel-Glässer). Sections

were then deparaffinised and rehydrated as described in the previous section. Heat-

induced epitope retrieval (HIER) in either tris-ethylenediaminetetraacetic acid

(EDTA) buffer at pH 9.0, or sodium citrate buffer at pH 6.0 for 4 minutes at 97°C,

followed by 10 minutes at 70°C in a decloaking chamber was used to pre-treat

sections. Endogenous peroxidases were blocked with hydrogen peroxide solution

(Biocare Medical, Pike Lake, CA, USA), and non-specific antibody binding was

blocked with blocking reagent (Biocare Medical). Primary antibodies were diluted in

sample diluent solution (Biocare Medical) and incubated for either 60 minutes at

37°C, or overnight at 4°C in a humidified chamber. Primary antibody binding was

detected using a mouse probe secondary antibody (Biocare Medical) and

3,3’diaminobenzidine (DAB) chromogen (Biocare Medical). The sections were

counterstained with haematoxylin Gill 1 (G1) nuclear stain (HD Scientific). The

sections were then dehydrated in graded alcohols and xylene washes with the stained

tissue sections mounted and coverslipped as described in the previous section.

2.2.8 Immunofluorescent analysis

The fluorescent detection of antibody-labelled tissue sections was used to

visualise the presence of specific targets. Formalin-fixed paraffin-embedded tissue

sections were rehydrated and treated with HIER as described in the previous section.

Following the incubation with the primary antibody, the sections were washed

thoroughly. Primary antibody binding was visualised using fluorescently-labelled

secondary antibodies (Alexa Fluor®, Invitrogen) at 1:5000 dilutions in an antibody

diluent solution (MAXBind™, Active Motif) for 60 minutes at 37°C in a humidified


chamber, protected from light. Following the wash steps, the sections were incubated

with PBS containing 0.5 µg/mL 4',6-diamidino-2-phenylindole (DAPI) solution for

10 minutes at room temperature to label all cell nuclei within the tissue. The tissues

were then washed once in PBS and mounted onto microscope slides in anti-fade

mounting medium (Prolong® Gold, Invitrogen). The sections were mounted under

glass coverslips (#1.5, HD Scientific). The immunofluorescently-labelled tissues

were then imaged using either fluorescence microscopy (Eclipse, Nikon, Japan) or

confocal microscopy (TCS SP5, Leica).

2.2.9 Image analysis

Digital image analyses of stained and antibody-labelled tissue sections and cell

monolayers were conducted using ImageJ software (public domain software

downloaded from http://rsb.info.nih.gov/ij/ (Abramoff, 2004).

2.2.10 Immunofluorescent analysis of Transwell® insert membranes

Immunofluorescence was used to detect specific target antigens in keratinocyte

monolayers grown in Transwell® co-cultures. At various time points following

irradiation, the Transwell® inserts were removed from the cell culture plates and

were washed in cold PBS. The cells on the membrane were fixed by immersing the

inserts in 4% paraformaldehyde (PFA) solution for 30 minutes at room temperature

(Lanier and Warner, 1981). The membranes were cut out from the insert casing using

a scalpel blade and stored submerged in cold PBS at 4°C until the staining procedure.

Keratinocytes on the membrane were permeabilised with 0.2% Tween-20 (Merck,

Australia) in PBS for 60 minutes at room temperature. Cells were then washed in

PBS containing 1% bovine serum albumin (Sigma-Aldrich) and blocked with a

blocking medium (Active Motif, Carlsbad, CA, USA) for 60 minutes at 37°C.

Primary antibodies were diluted in staining medium (MAXbind™, Active Motif) and

incubated with the antibody solution for 60 minutes at 37°C in a humidified

chamber. The membranes were then washed in PBS containing 1% bovine serum

albumin before the addition of fluorescent secondary antibodies (diluted 1:1000 in

staining medium). The membranes were incubated with secondary antibodies for 60

minutes at 37°C in a humidified chamber, protected from light. The insert

membranes were washed to remove residual secondary antibody and immersed in

PBS containing 0.5 µg/mL DAPI solution for 10 minutes in the dark at room

temperature. The membranes were then washed once in PBS and mounted onto

http://www.sciencedirect.com/science?_ob=RedirectURL&_method=externObjLink&_locator=url&_issn=00224804&_origin=article&_zone=art_page&_plusSign=%2B&_targetURL=http%253A%252F%252Frsb.info.nih.gov%252Fij%252F


microscope slides in anti-fade mounting medium (Prolong® Gold, Invitrogen). Glass

coverslips (#1.5, HD Scientific) were placed on top of the membranes and the

mounting medium was left to set at room temperature in the dark for at least six

hours. Immunofluorescently-labelled membranes were imaged using fluorescence

microscopy (Eclipse, Nikon, Japan).

2.2.11 TUNEL Assay for the detection of apoptotic cells

Detection of apoptotic keratinocytes in irradiated HSE

Tissue sections of irradiated HSE composites were probed for the presence of

apoptotic cells using a terminal deoxynucleotidyl transferase dUTP nick end labeling

(TUNEL) assay (Roche Applied Science, Penzberg, Germany) according to the

manufacturer’s protocol. Briefly, the sections were deparaffinised and rehydrated as

described in 2.2.6. The tissues were permeabilised with 20 µg/mL Proteinase K

solution (Ambion, Life Technologies) for 20 minutes at 37°C. As a positive control,

tissue sections were pre-treated with 2 U DNase I (Invitrogen). The negative controls

were treated using the same protocol, but without the addition of the terminal

deoxynucleotidyl transferase enzyme. The sections were then incubated with the

TUNEL enzyme label solution for 60 minutes at 37°C, protected from light. The cell

nuclei were counterstained with DAPI solution for ten minutes at room temperature.

The sections were imaged using fluorescence microscopy (Eclipse, Nikon) at an

excitation wavelength of 450 to 500 nm and a detection range from 515 to 565 nm.

Detection of apoptotic keratinocytes in irradiated 2D co-cultures

Apoptotic keratinocytes were detected in irradiated Transwell® insert

membranes using the protocol detailed in 2.2.11. Prior to the TUNEL assay being

performed, cell monolayers in the Transwell® inserts were fixed in 4% PFA for 30

minutes at room temperature. The insert membranes were cut out of the insert casing

(as described in 2.2.10) and stored in PBS at 4°C until the assay was performed.

2.2.12 Assessment of cellular viability

Cellular viability assays in HSE

Metabolically active cells in UVB-irradiated HSE composites were detected

using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)

assay (Denizot and Lang, 1986). Briefly, the HSE composites were immersed in 1

mL of 0.5 mg/mL MTT solution in PBS (Sigma-Aldrich) and incubated for 90



http://en.wikipedia.org/wiki/Thiazole

http://en.wikipedia.org/wiki/Phenyl


minutes at 37°C. The MTT reaction results in a colorimetric change from yellow to

purple. This colour change in the epidermis of the HSE composites was imaged

using a digital camera.

Cellular viability assays in 2D co-cultures

Keratinocyte monolayers cultured on Transwell® insert membranes were

assayed for cell viability using a CellTitre 96® AQueous Assay (Promega). After

exposure to UVB radiation, 200 µL of cell culture medium from the Transwell®

insert, and 900 µL of medium from the lower chamber were removed from all the

wells. Next, 40 µL of (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-

(4-sulfophenyl)-2H-tetrazolium) (MTS) reagent was added to the insert and mixed

with cell culture medium. Cell monolayers were incubated with the reagent for two

hours at 37°C with 5% CO2 and protected from light. Controls consisted of cell

culture medium only treated with MTS under the same incubation conditions.

Following incubation, 100 µL samples of the cell culture medium was transferred

into a 96-well plate. The absorbances of the solutions were read at 490 nm using a

Beckman Coulter microplate reader (Beckman Coulter, Fullerton, CA, USA). Blank

readings were obtained from the negative control samples.

2.2.13 Detection and quantification of secreted cytokines in 2D and 3D cultures

Analysis of IL-6 concentrations in cell culture medium and cell lysates

An enzyme-linked-immunoassay (ELISA) kit for the detection of human IL-6

was used as per the manufacturer’s instructions (Quantikine®, R&D Systems, MN,

USA). Briefly, 1 mL SFM cell culture supernatant samples were obtained from HSE

cultures and 2D co-cultures prior to and after UVB irradiation as described in 2.2.5.

For the Transwell® co-cultures, the medium in the insert and the well were mixed

thoroughly before the sample was obtained. The medium was centrifuged and the

supernatant collected to remove cell debris. Samples were stored at -80°C until the

assay was performed. Serial dilutions of recombinant IL-6 standards with known

concentrations were prepared. Assay diluent was then added to all wells of a 96-well

plate which was pre-bound with a mouse monoclonal antibody against human IL-6.

Following this, 100 µL serial dilutions of standards and samples were added to

duplicate wells in the plate and were incubated for two hours at room temperature.

The samples were then aspirated and the wells were washed with the provided wash

buffer. A secondary polyclonal antibody conjugated to horse radish peroxidase was


added and the plate was incubated for a further two hours at room temperature.

Following a similar wash step, all wells were incubated with a substrate containing

hydrogen peroxide and tetramethylbenzidine chromogen for 20 minutes in the dark.

The reaction was stopped by the addition of 50 µl of 2 M sulphuric acid. The optical

densities of the reactions were read at 450 nm using a microplate reader (Beckman

Coulter, Fullerton, CA, USA).

Analysis of IL-8 concentrations in cell culture medium and cell lysates

An IL-8 ELISA kit for the detection of human CXCL8/IL-8 was used as per

the manufacturer’s instructions (Quantikine®, R&D Systems, MN, USA). Cell

culture and cell lysates samples were collected as described in the previous section

and the assay protocol was performed as previously described. The ELISA reactions

comprised of 50 µL standards and diluted samples. A one-hour incubation step with

the conjugated secondary antibody was performed. The absorbances at the reaction

end-point were read at 450 nm following the immunoassay protocol.

2.2.14 Analysis of cell cycle phase by fluorescent-labelling of DNA content

The ratios of cells at different cell cycle phases following irradiation were

assessed using flow cytometry. The method of fluorescently-labelling cellular DNA

content allows for the estimation of the cells’ cycle phases (Nunez, 2001). Briefly,

cell culture medium was removed from the inserts and the membranes were washed

with PBS. Keratinocyte monolayers were trypsinised and these cell suspensions were

centrifuged at 1500 rpm for 5 minutes. The pellets were resuspended in ice cold PBS

and micro-centrifuged at 6000 rpm for 5 minutes, with this wash process repeated

twice. The cell pellets were then fixed by resuspending in ice cold 70% ethanol and

stored at -20°C until the DNA staining protocol was performed. Prior to staining, cell

pellets were washed twice in cold PBS as mentioned previously. Cells were then

resuspended in a solution containing 5 mL 0.01% Triton-X (in PBS), 100 µL of 10

mg/mL Rnase A (Sigma) and 100 L of 1 mg/mL propidium iodide (PI) (Sigma).

Cell suspensions were incubated in this solution for 15 minutes at 37°C, protected

from light. Keratinocytes were then filtered through a 37 µm nylon mesh (BD

Biosciences) to prevent cellular aggregation. Cell fluorescence was then measured

using a flow cytometer (Cytomics FC500, Beckman Coulter). Histograms from the

fluorescent output were analysed using the MXP Analysis Software (Beckman


Coulter) to determine the proportion of cells in G1, S, G2/M phases and apoptotic

cells present in the total cell population.

2.2.15 Extraction of total RNA from HSE composites

The RNA profile of HSE keratinocytes was analysed prior to and following

UVB irradiation. The total RNA was extracted from the HSE epidermis using a

previously-reported technique for the isolation of high-quality RNA from skin

(Clemmensen et al., 2009). The composites were immersed papillary-side down in

3.8% ammonium thiocyanate solution in PBS (Sigma), at pH 7.4 and at room

temperature for approximately ten minutes. Upon epidermal separation, the

epidermis was peeled off with forceps and immersed in 250 µL of TRI-reagent®

(Zymo). Cells in the epidermis were lysed by gently pipetting the tissue in TRI-

reagent® on ice. The papillary surfaces of the HSE composites were also scraped

into the Trizol reagent using a scalpel blade to ensure the lysis of the epidermal

keratinocytes.

2.2.16 Purification of total RNA from cell lysates

The total RNA extracted from the HSE composites (as outlined in 2.2.15) was

purified using a Direct-Zol II RNA Mini-prep kit (Zymo Research Corporation,

Irvine, CA, USA), following the manufacturer’s supplied protocol. Briefly, 100%

ethanol was added to cell homogenates in TRI-reagent® as mentioned previously at a

ratio of 1:1. This mixture was loaded onto the supplied columns and centrifuged,

with the first flow through discarded. An in-column DNase I digestion was then

performed using 1 unit of DNase I per column, incubated at 37°C for 15 minutes.

The column was washed with wash buffers and the total RNA was eluted in 25 µL of

DNase/RNase-free water. The concentration of the eluted RNA was determined

using a Nanodrop spectrophotometer (Thermo Scientific). The purity of the extracted

RNA was determined via the ratio of the absorbance at 260/280 nm and 260/230 nm,

with ratios of approximately 2 indicating high-quality RNA samples. Next, RNA

stability was assessed by separating 1 µL of sample on a 1.5% agarose/tris-

acetate/EDTA (TAE) gel electrophoresed at 115 V for 30 minutes. The presence of

two distinct 18S and 28S ribosomal RNA bands (with the 28S band about twice as

intense as the 18S band) indicated stable RNA samples. The RNA samples were

stored at -80°C until further use.


2.2.17 Synthesis of double-stranded cDNA

First strand DNA synthesis was performed using SuperScript™ III First-Strand

Synthesis SuperMix for qRT-PCR (Invitrogen); following the manufacturer’s

supplied protocol. Briefly, standard reactions of 10 µL of the supplied reaction mix,

1 µg of RNA, 2 µL of reverse transcriptase enzyme mix and water to a final volume

of 20 µL were prepared. Reactions were performed on a thermal cycler machine (MJ

Research PTC-200 Thermo Cycler) at 25°C for 10 minutes, 55°C for 30 minutes,

85°C for 5 minutes and 4°C for 15 minutes. Two units of RNase H was then added to

each tube and the reaction incubated for 20 minutes at 37°C, and the reaction

terminated at 4°C. The resulting cDNA samples were diluted 1:10 in nuclease free

water and stored at -20°C until use in quantitative real-time PCR (qRT-PCR)

analysis.

2.2.18 Primer design

Primer-basic local alignment software (Primer-BLAST), available through the

National Centre for Biotechnology Information (accessible at

www.ncbi.nlm.nih.gov/tools.primer-blast/) was used to design primers for qRT-PCR.

The parameters used to define primer sequences included a minimum primer melting

temperature (Tm) of between 57°C and 63°C, with a maximum of 3°C difference

between primer Tm and an amplicon length between 70 and 150 base pairs. The

resulting PCR primers were purchased from Sigma with 25 nmol concentrations and

desalted purity.

2.2.19 Analysis of differential gene expression using qRT-PCR

Different expressions of specific genes of interest were determined using qRT-

PCR. Reactions of 20 µL volumes were set up in a 96-well plate format and run on

an ABI Prism 7500 Real-Time PCR System (Applied Biosystems). Each reaction

included 10 µL SYBR Green Master Mix (Life Technologies), 0.2 µM of both

forward and reverse primers, and 20 ng cDNA templates and made to 20 µL with

water. A two-step cycling protocol was used with a denaturation step at 95°C for 10

minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for one minute. To

confirm amplification of the correct sequence, post-amplification melt curve analysis

was conducted using the High Resolution Melting (HRM) Software (Applied

Biosystems) to determine the melting temperature (Tm) of the amplified PCR


product. The results were analysed using the 7500 Real-Time PCR Analysis

software, v2.0 (Applied Biosystems), using the ‘automatic’ function for baseline and

threshold values. Target gene expression was normalised to the S26 ribosomal

subunit (Forward: 5’CGCAGCAGTCAGGGACAT3’ Reverse:

5’AGCACCCGCAGGTCTAAATC3’) as it has been found to be most consistent as

a housekeeping gene in primary human keratinocytes (Bonnet-Duquennoy et al.,

2006). The relative comparative threshold cycle (CT) method (2-∆∆C

T) was used to

determine relative gene expression differences between the genes of interest.

2.2.20 Extraction of protein from HSE epidermal cell lysates

The epidermis was separated from the dermal component of the HSE

composites using the epidermal separation protocol detailed in 2.2.15. The epidermal

tissue was immersed in Radio Immuno-precipitation Assay (RIPA) buffer containing

25 mM Tris, HCl (pH 7.6), 150 mM NaCl, 1% Nonidet P-40 (NP-40), 1% sodium

deoxycholate, 0.1% SDS (Thermo Scientific) with 2 mM Na3VO4, 10 mM NaF and a

complete protease inhibitor cocktail (Roche Diagnostics). The papillary surface of

the HSE was gently scraped with a scalpel blade into the cell lysis buffer to collect

residual epidermal cells. The epidermis was first passed through a 1 mL pipette tip at

least ten times on ice, mixed with a vortex for 20 seconds and kept on ice for ten

minutes. This was repeated three times to lyse cells. Residual epidermal tissue,

consisting mainly of the stratum corneum, was then removed. Cell lysates were

subsequently passed through a syringe with a 26-gauge needle at least five times

before being centrifuged at 14 000 g for 20 minutes at 4°C. The supernatants were

collected and the protein concentration in the samples determined using a

bicinchoninic acid (BCA) assay kit (Pierce, Rockford, IL, USA). Cell lysates were

stored at -80°C until further use.

2.2.21 Extraction of protein from Transwell® cell monolayers

Spent growth medium from keratinocytes cultured on Transwell system

membranes was removed and the monolayers washed twice with PBS to remove

traces of medium that may interfere with downstream applications. The cells were

then lysed in RIPA buffer (Thermo Scientific) supplemented with 2 mM Na3VO4, 10

mM NaF and a complete protease inhibitor cocktail (Roche Diagnostics) as described

in 2.2.20. The cell lysates were homogenised by passing through a 26-gauge needle

at least five times prior to centrifugation at 14 000 g for 20 minutes at 4°C. The


supernatants were collected and the protein concentration in the samples determined

using a bicinchoninic acid (BCA) assay kit (Pierce, Rockford, IL, USA). Cell lysates

were stored at -80°C until further use.

2.2.22 Protein separation of cell lysates using SDS-PAGE

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was

used to size-separate proteins contained in the cell lysate samples prepared in 2.2.20.

Pre-cast SDS-PAGE gels (NuPAGE® SDS-PAGE gel systems, Life Technologies)

containing 10% resolving gel and 4% stacking gel regions were used to enhance

band resolution. Samples containing 20 µg of total protein were pre-treated with 4x

sample loading buffer (Invitrogen) and a reducing agent (Invitrogen) for 10 minutes

at 70°C. The gels were placed in running buffer (NuPAGE®, Life Technologies) and

the samples (including a pre-stained broad range molecular weight marker (BioRad))

were loaded into SDS-PAGE gel wells. The samples were then subjected to

electrophoresis at 200 V for 35 minutes at 4°C.

2.2.23 Western immunoblotting

Following SDS-PAGE protein resolution, size-separated proteins on the gel

were transferred onto nitrocellulose membranes (BioTrace®NT, Pall Corporation,

FL, USA) using a semi-dry transfer technique. Briefly, the membrane was

sandwiched between the SDS-PAGE gel and filter paper. This was then immersed in

transfer buffer (3.03 g/L Tris Base, 14.4 g/L glycine and 20% ethanol) and placed

within a semi-dry electrophoresis machine (BioRad Trans-blot SD semi-dry transfer

cell). Transfers were run at 45 mA per gel, for a maximum of 90 minutes. After the

transfer, the nitrocellulose membranes were blocked with Odyssey blocking buffer

(LI-COR®). Primary antibody dilutions (1:10000) were performed in Odyssey

blocking buffer and incubated on the membranes overnight at 4°C. The membranes

were then washed in Tris-buffered saline Tween-20 (TBS-T) for five three-minute

washes. The fluorescently-labelled secondary antibodies were diluted 1:20000 in

Odyssey blocking buffer and incubated on the membranes for one hour at room

temperature. Fluorescently-labelled bands were then imaged using an Odyssey®

Infrared Imaging System (LI-COR®). The acquired images were analysed using

Image Studio Software (LI-COR®) for the quantification of band fluorescence

intensity.


2.2.24 Statistical analysis

Data analysis was performed using one-way analysis of variance (ANOVA)

with Tukey’s post-hoc analysis, unless otherwise stated. Statistically significant

differences were considered to exist at p<0.05.

Chapter 3: Validation of the HSE-KC photobiology model 49

Chapter 3: Validation of the HSE-KC

photobiology model

3.1 INTRODUCTION

A wide variety of in vitro skin models have been employed to investigate the

effects of UVR on skin, including an array of animal models, cell lines and

bioengineered skin constructs (Fernandez et al., 2012b). Nevertheless, there is still an

urgent need for more cost-effective and easily accessible experimental models

capable of more accurately representing the structural and functional aspects of

native skin for photobiology studies. The human epidermis possesses a highly

specialised spatial organisation and structure, which is a critical property in

maintaining its barrier function. Consequently, the intricacies of the epidermis, such

as the presence of the basal, spinous, granular and cornified keratinocyte layers, have

posed a challenge to recreate in vitro. With each of these layers defined by the

differentiation status, polarity, morphology and functionality of the keratinocytes

within it, the importance of incorporating these features into in vitro skin models for

representing and predicting epidermal physiology is evident. Hence, the development

of improved cutaneous biology models represents a fundamental requirement for

advancing our knowledge of UVR-induced damage, repair and regeneration

pathways and their relevance to photocarcinogenesis. Therefore, the first aim of this

study was to characterise a 3D HSE-KC tissue-engineered skin model (consisting of

primary human keratinocytes cultured on an ex vivo DED scaffold) as an in vitro

platform for studying acute epidermal responses to UVB radiation.

Increasingly elegant organotypic skin models have been developed for a range

of different experimental applications, including photobiology, toxicology studies

and cutaneous biology research (Archambault et al., 1995; Hudon et al., 2003;

Bechetoille et al., 2007). The incorporation of different cell types from dermal or

epidermal origins into a 3D scaffold has resulted in the creation of pigmented and

vascularised skin equivalent cultures, along with skin constructs with an integrated

immune component (Topol et al., 1986; Hudon et al., 2003; Laubach et al., 2011;

Liu et al., 2011). Besides the varied combinations of cell types incorporated into the

50 Validation of the HSE-KC photobiology model

epidermis, this array of skin substitutes also makes use of a range of natural and

synthetic dermal substrates, each with its own advantages and disadvantages, as

discussed in 1.6.4.

Our laboratory has previously reported the use of a HSE-KC skin culture

model for studying epithelial biology in applications such as tissue regeneration

during wound healing (Topping, 2006; Rayment et al., 2008; Xie et al., 2010).

Critically, the HSE-KC retains vital structural, functional and organisational

properties of the native dermis and epidermis, which may be lacking in other in vitro

models (Xie et al., 2010). Accordingly, a 3D HSE-KC model and its application in

mapping epidermal responses to UVB radiation are detailed in this Chapter.

Significantly, this study represents a previously unexplored method for

characterising UVB radiation-induced changes to human-derived keratinocytes in

vitro.

Many aspects of the epidermal microenvironment, for instance, elements of the

BM and ECM as well as the structural and organisational properties of the epidermis

are known to directly modulate keratinocyte responses to UVB radiation (Amano,

2009). In particular, the distinctive multilayered structure of the epidermis is thought

to be critical for blocking the penetration of harmful UVR, thus minimising DNA

damage to the actively proliferating basal cells (Everett et al., 1966). The HSE-KC,

proposed as a photobiology skin model in this project, was firstly characterised to

analyse the expression of key features of the native epidermis in these constructs, in

comparison to that observed in samples of ex vivo skin tissue. Indeed, investigating

the preservation of morphological and biological cutaneous markers in the HSE-KC

known to be essential in the skin’s UV response was an essential first step in

validating this model as a physiologically-relevant tool for photobiological studies.

The next stage of validation involved the identification of key photodamage

markers in HSE-KC composites exposed to UVB radiation. The generation of CPD

DNA photolesions in the nuclei of irradiated keratinocytes is known to be a

characteristic feature of UVB radiation-induced DNA damage (You et al., 2000).

These premutagenic molecular lesions arising from the formation of C=C double

bonds in thymine or cytosine bases, result in structural DNA modifications which

can interfere with its replication (Ruven et al., 1993; Vreeswijk et al., 1994). Hence,

the subsequent repair of these DNA photolesions has been shown to be among the


most critical processes in protecting against photocarcinogenesis (Svobodova et al.,

2012). The formation of apoptotic keratinocytes, also known as sunburn cells, is

another distinctive marker of UVB radiation-induced epidermal damage, often used

as a qualitative and quantitative measure of acute photodamage (Young, 1987;

Weatherhead et al., 2011). Also, central to the early responses of skin to UV-

exposure is the induction of the cutaneous inflammatory response (Young, 2006; Bijl

et al., 2007). While clinical features of sunburn such as erythema and enhanced

melanogenesis are not able to be detected in the avascular and unpigmented HSE-

KC, DNA damage and immunomodulatory factors secreted by irradiated

keratinocytes that initiate these inflammatory effects can be analysed (Kondo et al.,

1993; Enk et al., 1995; Nishigori et al., 1996). Accordingly, these detectable markers

of UVB radiation-induced damage, which have been well-documented in vivo and in

vitro (reviewed in 1.3), were investigated using the irradiated HSE-KC model in this

Chapter (Young, 1987; Miyauchi-Hashimoto et al., 1996; Svobodova et al., 2006).

During the acute phase of UVB photodamage, the activation of cellular repair

mechanisms to remove UVB radiation-induced DNA photolesions is an innate

feature of the native epidermis (reviewed in 1.3.3). Repair and regeneration

processes are an essential component in maintaining the integrity of the epidermal

barrier, while preventing the oncogenic transformation of proliferative cells (Liu et

al., 1983; Kraemer et al., 1990; Bernerd, 2005; Mouret et al., 2008). In irradiated

keratinocytes, many of these repair pathways are known to be orchestrated by the

activity of the p53 tumour suppressor protein (Cui, 2007).

Hence, in addition to the generation of UVB photodamage in the HSE-KC, this

study also investigates whether keratinocytes in the HSE-KC epidermis retained their

ability to repair this damage. This included the removal of CPD photolesions, as well

as shifts in keratinocyte proliferation and differentiation following UVB radiation

exposure. Other changes, such as the modification of epidermal protein expression,

are known to occur in the post-irradiation period (Bernerd and Asselineau, 1997).

For example, an increase in the number of terminally differentiating keratinocytes

following irradiation results in the associated rise in the expression levels of specific

keratins such as keratins 1, 10 and 11 (Fuchs et al., 1987). Hence, UVB radiation-

induced alterations were analysed on both an epidermal tissue level, as well as at the

cellular level in the irradiated HSE-KC constructs.


Broadly, the aims of this Chapter were therefore to:

1) Compare the expression of various epidermal markers between native skin

and HSE-KC samples;

2) Characterise the responses of the HSE-KC to UVB radiation; and

3) Identify epidermal changes over time during the acute UVB radiation

response using the HSE-KC model.


3.2 MATERIALS AND METHODS

The description of protocols and methods used in this section are outlined in

Chapter 2. Details surrounding specific materials utilised are described in the

following sub-sections.

3.2.1 Fixation of native skin samples

Ex vivo native skin samples used in comparative studies were obtained, fixed

and processed as detailed in 2.2.1. For immunohistochemical studies, native skin

samples and reconstructed HSE-KC tissue from the same patient donor were used.

3.2.2 Construction and culture of the HSE-KC

The isolation and culture of primary human keratinocytes and the construction

of the HSE-KC model has been detailed previously in 2.2.1 to 2.2.3.

3.2.3 Irradiation of the HSE-KC

All HSE-KC were irradiated with specific doses of UVB radiation as per the

irradiation protocol described in 2.2.5.

3.2.4 Histology

All histology was performed as per routine haematoxylin and eosin staining

protocols, previously outlined in 2.2.6.

3.2.5 MTT assay of cell viability

Viable keratinocytes on the irradiated and non-irradiated HSE-KC were

visualised using the protocol described in 2.2.12 and photographed using a digital

camera.

3.2.6 Immunohistochemistry

Immunohistochemistry was performed as per previously described protocols

(2.2.7). The following primary antibodies were used in the detection of tissue

markers: mouse monoclonal anti-cytokeratin 1/10/11 (USBioLogical), mouse

monoclonal anti-cytokeratin 2e (Abcam), mouse monoclonal anti-cytokeratin 14

(Novus Biologicals), mouse monoclonal anti-filaggrin antibody (Santa Cruz

Biotechnology), mouse monoclonal anti-thymine dimer antibody (clone KTM53,

Kamiya Biomedical Company), mouse monoclonal anti-human p53 (clone DO-7,

Dako), monoclonal antibody against human collagen IV (Clone CIV22, Dako) and


monoclonal mouse anti-human Ki-67 (Dako). All tissue sections were pre-treated

with HIER as previously described (2.2.7). Antibody-binding was visualised using

DAB, and tissue counterstained with haematoxylin G1.


The concentrations of IL-6 and IL-8 in cell culture medium samples obtained

from the irradiated Transwell® culture inserts, HSE-KC and HSE-KCF cultures were

quantified using an ELISA technique, as described in 2.2.13.

3.2.8 TUNEL assay

The TUNEL assay for the in situ detection of cells undergoing apoptosis was

performed using the method described in 2.2.11.


3.3 RESULTS

3.3.1 Immunohistochemical characterisation of the HSE-KC epidermis

The human epidermis is comprised of distinct differentiated layers and a

characteristic polarized pattern of keratinocyte growth, with actively proliferating

cells situated at the dermal-epidermal junction. The expression of various

keratinocyte differentiation markers in ex vivo skin and HSE-KC tissues (from the

same donor) were analysed using immunohistochemistry (Figure 3.1). The

expression of keratins 1/10/11 was examined as these are known markers of

terminally-differentiated keratinocytes in the epidermis (Freedberg et al., 2001). In

both native and reconstructed skin sections, keratinocytes expressing keratin 1/10/11

were present throughout the middle layers of the epidermis, with the exception of the

stratum corneum and the stratum basale (Figure 3.1A).

Cytokeratin 2e has been shown to be expressed in the keratinocytes of the

upper spinous and granular cells of the native epidermis (Collin et al., 1992; Smith et

al., 1999). Similar expression patterns of cytokeratin 2e were detected in both the

native skin and HSE-KC samples (Figure 3.1B). However, a more intense and

uniform distribution of this keratin was observed in the ex vivo skin samples relative

to the HSE-KC. Similarly, the presence of keratin 14 (Figure 3.1C) appeared to be

more strongly detected around the basal keratinocytes in native skin as compared to

the immunostaining observed in HSE-KC. In ex vivo tissue, there was a gradual

decrease in the expression of keratin 14 from the suprabasal cell layers towards the

stratum corneum. In the HSE-KC, on the other hand, there was a more uniform

distribution and slightly diminished expression of keratin 14 among the basal and

suprabasal cells.

Filaggrin is a late differentiation epidermal protein with an expression highly

localised to the stratum corneum in vivo (Sandilands et al., 2009). Positive

immunostaining of filaggrin was detected in the cornified envelope of keratinocytes

within the stratum corneum in both HSE-KC and skin tissue samples alike (Figure

3.1D). In the HSE-KC, however, the stratum corneum appeared to be more densely

packed in comparison to that of native skin. In addition, filaggrin in the skin

equivalent model was observed to be more strongly expressed at the junction of the

stratum corneum and stratum lucidum.


Figure 3.1. Comparison of cutaneous markers in HSE-KC and native skin

Immunohistochemical analysis was conducted to detect the expression of various epidermal and BM markers on

both HSE-KC composites (left column) and native skin sections (right column). (A) Expression of keratin

1/10/11 shows the presence of differentiated keratinocytes in the stratum spinosum, stratum lucidum and stratum

granulosum within the epidermis. (B) Cytokeratin 2e expression in HSE-KC and native skin show localisation

within the upper suprabasal keratinocytes. (C) Keratin 14 was detected in basal and suprabasal keratinocytes in

both sections of HSE-KC and native skin, with the latter showing a more intense immunoreactivity in the stratum

basal. (D) Expression of filaggrin was limited to the stratum corneum in both HSE-KC and ex vivo skin. (E)

Collagen IV was detected at the epidermal-dermal junction and lining dermal structures in both the skin

equivalents and native skin. Images are representative of immunohistochemical analyses of native skin and HSE-

KC constructs from three independent skin donor samples. The scale bar shown (bottom right hand corner)

represents 50 µm in length.


The presence of type IV collagen, a major constituent of the BM zone in skin,

was detected at the dermal-epidermal junction in both the HSE-KC and skin tissue

samples (Figure 3.1E). Besides separating the epidermis and dermis, collagen IV is

also known to line sweat glands and blood vessels, which accounts for its positive

immunostaining in these structures within the dermis and DED (Konomi et al.,

1984).

Overall, the immunohistochemical study of epidermal and BM markers show

strong parallels in the expression and localisation of these markers between the HSE-

KC and native skin.

3.3.2 Optimisation of UVB-irradiation protocol

Several previously documented studies investigating UVB radiation responses

and photocarcinogenesis involve the use of excessive doses of radiation (Tadokoro,

2003; Garcia et al., 2010; Jeong et al., 2012). In view of our aim to develop a

biologically relevant photobiology model, therefore, we treated the HSE-KC

composites with a range of UV doses known to be experienced from solar UVR in

Australia (Kimlin et al., 1998; Kimlin and Parisi, 2001). This dose optimisation

study aimed to generate histological markers of UVB photodamage in irradiated

HSE-KC, while at the same time, maintaining enough viable epidermal cells to

support post-irradiation regeneration.

The histological analysis of irradiated HSE-KC tissues indicates a marked

increase in the morphological characteristics of epidermal damage with increasing

doses of UVB radiation (Figure 3.2). Composites exposed to 1 MED of UVB

radiation developed ‘sunburn cells’ located in the suprabasal layer of the epidermis

(Figure 3.2C). These apoptotic keratinocytes are characterised by the presence of

pyknotic nuclei and cytoplasmic shrinkage (Häcker, 2000). The presence of

apoptotic cells were not observed in haematoxylin and eosin-stained sections of non-

irradiated controls and HSE exposed to suberythemal (below 1 MED) doses of UVB

radiation. In composites exposed to an excess of 3 MED UVB radiation and above, a

proportion of the suprabasal keratinocytes also displayed cytoplasmic swelling,

strongly suggesting radiation-induced necrosis (Figure 3.2 D to F) (Caricchio, 2003).

In tissue exposed to 5 and 10 MED UVB radiation, the basal keratinocytes displayed


high levels of cell death at 24 hours post-irradiation, resulting in separation at the

epidermal-dermal junction during histological processing (Figure 3.2 D and E).

The histology of irradiated HSE-KC therefore suggests that UVB radiation

doses below 3 MED induce histological markers of photodamage without the

complete destruction of the proliferative stratum basale as a result of UVB-induced

cell death.

Figure 3.2. Dose-response of HSE-KC to UVB radiation.

Haematoxylin and eosin staining of UVB-irradiated HSE-KC sections subjected to increasing doses of UVB are

shown. Stained sections of (A) non-irradiated HSE-KC controls, and skin equivalents exposed to a single dose of

(B) 0.5 MED, (C) 1 MED, (D) 3 MED, (E) 5 MED and (F) 10 MED at 24 hours post-exposure were imaged.

Arrows indicate cells showing morphological characteristics of apoptotic keratinocytes. The circled region shows

the presence of keratinocytes showing signs of cytoplasmic swelling, which is indicative of radiation-induced

necrosis. Irradiation with UVB doses in excess of 3 MED (75 mJ/cm2) results in the destruction of basal

keratinocytes and epidermal-dermal separation during histological processing. Scale bar represents 50 µm.

Histology is representative of experimental triplicates conducted on three independent skin donors.

3.3.3 Assessment of cell viability in irradiated HSE-KC

Metabolically active epidermal cells in the irradiated HSE-KC composites

were visualised using an MTT assay which results in a colorimetric change from

yellow to purple in viable tissue. These MTT-stained regions were then digitally-

photographed to determine the relative differences in cell viability between different


doses of UVB and time-points after exposure. Figure 3.3 shows images captured of

MTT-stained HSE composites exposed to increasing doses of UVB (A to F). At

UVB exposures of 3, 5 and 10 MED, a slightly decreased intensity of MTT stain was

observed in the epidermis at 24 hours post-irradiation. There were no significant

differences in the diameter of the circular areas where keratinocytes were originally

seeded onto the DED with increasing UVB dose. Figures G to L show HSEs exposed

to a single 2 MED UVB dose at Day 0 (G) and returned to culture conditions over a

period of five days (H to L) to assess whether keratinocytes remained viable in

culture post-irradiation. Visualisation of the MTT-stained epidermal layers in these

composites shows no observable differences in intensity or area over the five days.

Figure 3.3. Epidermal viability following UVB-irradiation in HSE

The viability of cells within the HSE-KC epidermis following UVB exposure was analysed using an MTT assay.

At 24 hours post-irradiation, metabolically active keratinocytes (purple staining) were visualised in HSEs

exposed to a single dose of (A) 0 MED, (B) 0.5 MED, (C) 1 MED, (D) 3 MED, (E) 5 MED and (F) 10 MED

UVB. Skin composites exposed to a single 2 MED UVB dose and kept in culture conditions post-irradiation were

assayed at (G) Days 0, (H) 1, (I) 2, (J) 3, (K) 4 and (L) 5. Images are representative of triplicate experiments

conducted on three independent skin donors. Red scale bar represents 1.6 cm.

60

3.3.4 Formation of CPDs in irradiated HSE-KC composites

One of the primary markers of UVB-induced damage in keratinocytes is the

formation of CPD molecular lesions in the DNA as a result of a photochemical

reaction forming covalent bonds in pyrimidines (as described in 1.3.1). The

formation of these dimers was probed in HSE-KCs exposed to a single 2 MED dose

of UVB radiation using immunohistochemical analysis (Figure 3.4). At 24 hours

post-irradiation, strong positive nuclear staining was observed in the basal and

suprabasal keratinocytes, indicating the presence of CPDs within these regions.

Figure 3.4. UVB exposure induces the formation of CPDs in HSE-KC

Immunohistochemical analysis was used to detect the presence of UVB-induced CPDs in the nuclei of cells in the

epidermis of HSE-KC at 24 hours after UVB treatment. The figure shows sections of (A) non-irradiated HSEs,

antibody-probed sections of HSE-KC exposed to 2 MED of UVB at (B) 100x and (C) 200x magnification

respectively. The presence of CPDs, indicated by brown staining, was observed predominantly within the nuclei

of basal and suprabasal cells of the epidermis. Black and red scale bars represent 50 µm. Images from

immunohistochemical analyses are representative of experimental triplicates conducted on three independent skin

donors.

3.3.5 Formation of apoptotic keratinocytes in the irradiated HSE-KC

Keratinocytes that have sustained irreparable DNA damage as a result of UVB

damage undergo apoptosis to prevent the propagation of cells harbouring

photolesions (Young, 1987). The TUNEL assay (2.2.11) was employed to detect

DNA fragmentation, a characteristic marker of the UVB-induced apoptotic pathway.

At 24 hours after a single 2 MED UVB dose, the in situ TUNEL assay showed the

presence of epidermal keratinocytes undergoing apoptosis (Figure 3.5). Magnified

and merged images demonstrate the specific nuclear localisation of DNA

fragmentation, which is fluorescently-labelled during the TUNEL reaction. Cells

undergoing apoptosis were present in the stratum basale, with the majority localised


among the suprabasal keratinocyte populations. An average of 19.9 ± 4.1% of the

total number of epidermal nuclei was found to be TUNEL-positive at 24 hours post-

irradiation.

Figure 3.5. Apoptotic keratinocytes in irradiated HSE-KC

Apoptotic keratinocytes were detected in HSE-KC, 24 hours following a single exposure of 2 MED UVB (A left

to right). The first column indicates sections stained with DAPI nuclear marker. Blue fluorescence indicates

keratinocytes in the epidermis of HSE-KC. The second column shows TUNEL positive cells, indicated by the

presence of green fluorescence. The final column shows merged images. The white dotted line indicates the

epidermal-dermal junction in the skin equivalents. A region of these sections has been magnified (B left to

right), showing clearly the nuclear localisation of DNA fragmentation as detected by the TUNEL reaction.

Yellow lines indicate the scale of 50 µm. Images from the TUNEL assay analysis are representative of

experimental triplicates conducted on three independent skin donors.

3.3.6 UVB-induced expression of p53 in the HSE-KC

The expression of p53 by keratinocytes subsequent to UVB exposure is known

to be critical for regulating cellular regeneration and suppressing oncogenesis

(Maltzman and Czyzyk, 1984; Levine et al., 1991; Will, 2000). Keratinocyte

expression of p53 was detected in irradiated HSE-KC using immunohistochemical

analysis and shown to progressively increase during the acute phase of UVB-induced

damage (Figure 3.6). Sections from HSE-KCs sacrificed at 0, 3, 6 and 24 hours after

DAPI TUNEL Merged

4x

40x


a single dose of 2 MED UVB display p53-positive nuclei, particularly in the

proliferative basal layer and the lower suprabasal layers of the HSE epidermis. A

weak, diffuse cytoplasmic staining was also observed; this gradually intensified in

the hours following UV exposure. Magnified views of the p53-expressing

keratinocytes reveal a shift in the localisation patterns of p53 within the cell nuclei.

At 6 hours post-irradiation, p53 was detected in a speckled manner throughout the

nuclei, or in the perinuclear regions. However, at 24 hours, there was a shift towards

a more intense centrally-located expression of p53 within the nuclei. Non-irradiated

HSE controls (G and H) showed weak cytoplasmic p53 presence, as well as

translocation to the nucleus or intensification of the staining at 24 hours.

Figure 3.6. UVB induces p53 expression in irradiated HSEs

Sections of HSE exposed to 2 MED UVB were sampled at 0 hours (A), 3 hours (B), 6 hours (C) and 24 hours (D)

post-irradiation and analysed for the presence of p53 via immunohistochemical analysis. The presence of a brown

staining indicates the presence of p53, which is elevated in the nuclei of UVB-exposed skin equivalents as

compared to the non-irradiated controls at 0 hour (G) and 24 hours (H). A weak, diffuse cytoplasmic staining was

also observed, intensifying from the 3 hour time-point. Figures E and F are magnified views of the epidermis

showing alterations in the patterns of p53 distribution within the nucleus at 6 and 24 hours respectively. The

black scale bars represent 50 µm and the red scale bar represents 25 µm. Images from immunohistochemical

analyses are representative of experimental triplicates conducted on three independent skin donors.

63

3.3.7 Secretion of inflammatory cytokines by irradiated HSE-KC constructs

The sunburn reaction in skin as a consequence of contact with UVR rays is in

part mediated by an array of keratinocyte-produced cytokines, including IL-6, IL-8,

IL-10 and TNF-α (Kock et al., 1990; de Vos et al., 1994; Grewe et al., 1995).

Upregulation of IL-6 synthesis in response to UVB irradiation has been documented

and is believed to be a central catalyst for the activation of the local and systemic

immune response (Urbanski et al., 1990). Another proinflammatory factor, the

chemokine IL-8, is known to be constitutively expressed in the epidermis, with this

expression being appreciably increased upon UVB exposure (Kondo et al., 1993).

The levels of secreted IL-6 and IL-8 were quantified in the cell culture

supernatants of HSE-KC cultures in response to UVB irradiation. These cytokines

were measured using a sandwich ELISA technique and normalised to the total

protein detected in the samples of SFM collected. As shown in Figure 3.7, significant

upregulation in the production of both IL-6 and IL-8 was observed in cell culture

medium obtained from these irradiated HSE-KC constructs. At the T0 time-point, no

significant differences in IL-6/8 levels were detected between culture medium

samples from irradiated and non-irradiated HSE-KC cultures. Levels of IL-6 were

about 100-fold higher in irradiated HSE-KC at the 24 hour time point (90.3 ± 16.8

pg/mL) as compared to those collected at 0 hour (1.00 ± 0.3 pg/mL). Synthesis of IL-

8 induced by UVB showed an approximately 3-fold increase compared to the control

(66.1 ± 5.7 pg/mL versus 24.0 ± 1.0 pg/mL). The basal unstimulated levels of IL-8 in

the culture medium was elevated as compared to that of IL-6, with about seven times

higher IL-8 detected in the non-irradiated controls.

64

Figure 3.7. Quantification of IL-6 and IL-8 concentrations in HSE-KC culture supernatants

Cell culture medium samples were obtained from HSE-KC cultures prior to and 24 hours after irradiation with 2 MED of UVB. Supernatants were analysed for the presence of interleukin-6 (IL-

6) and IL-8 using an ELISA. Data represents the average quantities of IL-6 and IL-8 detected at the two time points (mean ± SEM), in experimental triplicates from two independent skin donors,

expressed in pg/mL. All measurements were normalised to total protein levels in culture supernatants. Asterisks represent statistical signifance (p<0.05) in the difference from matched samples

at t=0 hr. The error bars are representative of the standard error of the mean (SEM).

IL-6 production in HSE-KC

Time post-irradiation

0 hr

24 h

r

0

50

100

150

IL-6

co

ncen

trati

on

(p

g/m

L)

IL-8 production in HSE-KC


IL-8

co

ncen

trati

on

(p

g/m

L)

0 hr

24 h

r

0

50

100

1500 MED

2 MED*


3.3.8 Removal of CPDs in HSE-KC post-irradiation

Exposure of HSE-KC composites to UVB radiation results in the formation of

CPD photolesions in keratinocyte nuclei, as described in 3.3.4. Due to the frequency

of their exposure to environmental UVR, keratinocytes posses highly sophisticated

repair mechanisms to cope with the formation of UVB-induced damage (D’Errico et

al., 2007). The efficient removal of these CPDs has been strongly associated with the

prevention of oncogenic transformation in irradiated keratinocytes (Marionnet et al.,

1998; Katiyar et al., 2000; Zhao et al., 2002). In view of this, immunohistochemistry

was performed to determine whether UVB-induced CPDs in HSE-KC keratinocyte

nuclei post-irradiation were removed over time. As shown previously, control non-

irradiated HSE-KC were negative for the presence of CPDs (Figure 3.8 A to C). At

Day 0, CPD-positive keratinocyte nuclei were shown to be present in cells of the

stratum basale and suprabasal layers (Figure 3.8D). From 24 hours post-irradiation

there was a gradual decrease in the number of keratinocytes bearing photolesions,

and the intensity of immunostaining, with very few CPD-positive cells observed after

Day 4 (Figure 3.8 E to I). Overall, immunohistochemical analysis showed that

keratinocytes in the irradiated HSE-KC were able to repair CPD photolesions in

approximately three to four days after a single dose of 2 MED UVB.


Figure 3.8. Detection of CPDs in irradiated HSE-KC over time

The presence of UVB-induced CPD in the nuclei of HSE-KC irradiated with 2 MED UVB (D to I) was detected using immunohistochemical analysis. Images A to C show non-irradiated

controls at the 0, 1 and 2 day time-points, showing no detectable CPDs. Images D to I indicate a clear reduction in the numbers of CPD-positive keratinocytes from Days 0 to Day 5 post-

irradiation. Images from immunohistochemical analyses are representative of experimental triplicates conducted on three independent skin donors.


The numbers of CPD-positive cells were quantified using image analysis of

immunohistochemically-stained sections, as described previously (see section 2.2.6).

An average number of stained cells in five fields of view from three independent

experiments were counted and are represented in Figure 3.9. This graph shows the

gradual decrease in the numbers of HSE-KC keratinocytes harbouring photolesions

over a period of five days post-irradiation. The largest decrease in the number of

observed CPD-positive cells occurred between 24 and 48 hours after UVB exposure,

with an average decrease of about 52.7 ± 7.3% during this time period. There was a

statistically-significant drop in the numbers of CPD-positive cells as compared to

Day 0 at Days 2, 3, 4 and 5.

Figure 3.9. Repair of CPDs in irradiated HSE-KC

The average numbers of CPDs present in the nuclei of irradiated HSE-KC were quantified post-irradiation. The

graph indicates a decrease in the numbers of CPD-positive cells over time. The greatest number of CPDs repaired

occurred between 24 and 48 hours post-exposure. The asterisks represent statistically-significant (p<0.05)

differences compared to the number of CPD-positive cells at Day 0. Results are representative of the average of

five fields of view in three independent experiments with three independent keratinocyte donors. The error bars

are representative of the SEM.


3.3.9 Expression of Ki-67 in irradiated HSE-KC

At the same time that UVB induces cell death and cycle arrest, the opposing

effects of survival and the stimulation of proliferation also takes place in UV-

exposed skin. Epidermal hyperplasia triggered by UVB is thought to be a

consequence of the activation of various growth factor receptors and the actions of

cytokines (Rosette and Karin, 1996; Peus et al., 2000). These include fibroblast-

produced factors, such as EGF, IGF-I and IL-1, which are thought to contribute to

orchestrating the death-survival balance in irradiated keratinocytes (Rosette and

Karin, 1996).

The proliferative capacity of irradiated keratinocytes was investigated in the

epidermis of the HSE-KC. In this study, the Ki-67 nuclear proliferation marker was

used to quantify the proportion of keratinocytes within this epidermal layer actively

undergoing cell division in sections of HSE-KC tissue. The Ki-67 antigen is strongly

associated with actively proliferating cells, and has been shown to be present within

the cell’s nucleus during all active phases of the cell cycle and mitosis (Heenen et al.,

1998; Scholzen and Gerdes, 2000; Burcombe et al., 2006).

Keratinocytes expressing Ki-67 were mainly localised to the stratum basale in

immunostained sections of the HSE-KC (Figure 3.10). Non-irradiated HSE-KCs

exhibited a high proportion of Ki-67-positive keratinocytes over Days 0 to 2 during

the five days at which samples were obtained (Figure 3.10 A to C). Under normal

culture conditions the number of actively proliferating keratinocytes was observed to

diminish after this time (Figure 3.10 D to F). The HSE-KC composites exposed to a

single dose of 2 MED UVB showed a relatively decreased number of Ki-67-

expressing basal keratinocytes in the initial two days post-irradiation (Figure 3.10 G

to I). After this time point, a greater proportion of basal keratinocytes was observed

to express Ki-67 as compared to the non-irradiated controls (Figure 3.10 J to L).

The number of Ki-67-expressing keratinocytes was then quantified using

image analysis software (Figure 3.11). From the immunohistochemically-stained

sections shown previously, the average number of proliferating cells per field was

counted over a five day period following UVB exposure.


Figure 3.10. Detection of Ki-67 in irradiated HSE-KC

The proliferation marker, Ki-67, was detected in non-irradiated controls (A to F) and 2 MED UVB irradiated HSE-KC (G to L). Images are representative of sections obtained sequentially every

24 hours from Day 0 to Day 5 after irradiation. Brown stained keratinocyte nuclei indicate the presence of the Ki-67 protein, expressed during active phases of the cell cycle. Images from

immunohistochemical analyses are representative of experimental triplicates conducted on three independent skin donors. The scale bar represents 50 µm.


Non-irradiated HSE-KC show a gradual increase in the numbers of

proliferating keratinocytes from Day 0 to Day 2, followed by a decrease to below 20

Ki-67-positive cells per field. In comparison, irradiated HSE-KC exposed to 2 MED

UVB demonstrated a decreased number of proliferating cells in the days immediately

following irradiation. At Day 2, the average number of proliferating cells in these

HSE-KC composites was significantly lower than that observed in the non-irradiated

HSE-KC controls. Subsequently, there was a gradual increase in the proportion of

cells in the active phases of the cell cycle. This returned to levels similar to those

seen in non-irradiated control HSE-KCs by Day 5. Hence, this data indicates the

irradiation of HSE-KC with UVB induces changes in the numbers of proliferating

keratinocytes. This may be linked to the onset of CPD repair during this period as

described in the previous section.

Figure 3.11. Quantification of Ki-67 expression in irradiated and non-irradiated HSE-KC

The numbers of keratinocytes with positive immunostaining for the presence of Ki-67 were counted in irradiated

and non-irradiated HSE-KC. At Day 2, there was a significant decrease in the number of Ki-67-positive

keratinocytes in HSE-KC composites exposed to a single 2 MED dose at Day 0. Data represents an average of

five fields counted in experimental triplicates from three independent experiments. Error bars represent SEM

values. Asterisks represent statistically significant differences (p<0.05) as compared to the non-irradiated controls

at the same time point.

Days post-irradiation

Av

era

ge

Ki-

67

+ c

ells

/fie

ld

0 1 2 3 4 5

0

20

40

600 MED

2 MED

*

* *

*


3.3.10 Keratinocyte differentiation

The expression of keratin 1/10/11 (a marker of differentiated keratinocytes)

was analysed using immunohistochemistry (Figure 3.12). The HSE-KC composites

were exposed to either a single 2 MED or 0 MED control UVB dose, and were

sacrificed every day for five days. Using a protocol described in 3.2.6, tissue sections

were probed for the presence of keratin 1/10/11 to monitor potential changes in the

differentiated keratinocyte layers within the epidermis. The areas of these regions

were quantified using image analysis software, with the mean immunoreactive areas

expressed in Figure 3.13.

Analysis of the differentiating keratinocyte layer in the HSE-KC epidermis

revealed that UVB significantly altered the thickness of this region following

irradiation. In the first three days during this post-irradiation period, there was a

steady decline in the average area of the spinous and granular layers of the epidermis.

From the immunohistochemical analysis (Figure 3.12 G to L), this was associated

with a thickening of the stratum corneum layer. The thickness of the stratum basale,

however, remained relatively unchanged during this period. Hence, these results

indicate that UVB radiation induced the differentiation of this keratinocyte layer into

corneocytes which constitute the stratum corneum. Physiologically, it has been

demonstrated that a single moderate dose of UVB can induce up to a three-fold

thickening of the stratum corneum (Diffey, 1991). Together with the tanning

response, the increased thickness of this outermost layer of the epidermis aids in

shielding the basal keratinocytes from the harmful effects of UVR (Elias, 2005).


Figure 3.12. Time-course analysis of keratin 1/10/11 expression in irradiated and control HSE-KC

Immunohistochemical staining of keratin 1/10/11 in non-irradiated sections of HSE-KC at Day 0 (A), and 2 MED irradiated tissue at Day 0 (B). Figures C to D and H to L show keratin 1/10/11

positive keratinocytes detected from Day 1 to Day 5 in non-irradiated and irradiated HSEs respectively. Scale bar represents 50 µm. Images from immunohistochemical analyses are

representative of experimental triplicates conducted on three independent skin donors.


Figure 3.13. Quantification of keratin 1/10/11 expression in HSE-KC over time

The area of keratin 1/10/11 expression within the epidermis from immunohistochemical analysis was quantified

using image analysis software (ImageJ). The mean area of keratin 1/10/11 positive staining was expressed in µm2

from five microscopy fields in three independent experiments. Error bars represent SEM values. Asterisks

represent statistically significant differences (p<0.05) as compared to the non-irradiated controls at the same time

point. Experiments were conducted on samples from three independent skin tissue donors.


Are

a o

f K

1/1

0/1

1 im

munore

activ

ity (m

2)

0 1 2 3 4 5

0

10000

20000

30000

40000

500000 MED

2 MED

*

*

*

*


3.4 DISCUSSION

The creation of improved in vitro photobiology models involves both aligning

physiological and biological parallels with human skin in vivo, as well as combining

the ability to induce classical photodamage markers in the model. Therefore, the first

aim of this study was to compare the HSE-KC with ex vivo skin to determine the

expression of key epidermal markers known to influence the UVB response. The

HSE-KC organotypic model has previously been characterised by our research group

in relation to the study of a diverse range of epithelial processes, primarily those

associated with wound-healing (Topping, 2006; Xie et al., 2010). Hence, the aim of

this study was to further validate the HSE-KC as a photobiology model to address

some of the current limitations of conventional cell-based UV biology models.

The generation of various types of tissue-engineered skin constructs capable of

modelling the morphology and organisation of the human epidermis, has previously

been documented (Prunieras et al., 1983; Ponec et al., 1988b; Bernerd et al., 2012).

In accordance with such previously reported work, morphological features including

the rete ridges and the epidermal organisation were found to be similar in both the

HSE-KC and native skin sections (Figure 3.1). To confirm the presence of

keratinocytes at various stages of differentiation in the HSE-KC epidermis, the

expression of keratins 1/10/11 and cytokeratin 2e was analysed using

immunohistochemistry (Figure 3.1A and B). These two keratin sub-types are known

to be upregulated in differentiating keratinocyte populations (in the high and

intermediate suprabasal layers) and in the granular layer respectively (Paladini et al.,

1996; Lane and McLean, 2004; Luo et al., 2011). In the immunohistochemical

analysis performed in this study, it was found that both these keratins showed similar

expression patterns in the HSE-KC epidermis as compared to that observed in the

sections of native skin tissue.

Next, the expression of keratin 14 in these tissues was visualised using

antibody-based labelling. This keratin is known to predominantly constitute the

cytoskeleton of basal keratinocytes (Torma, 2011). In the native skin samples, there

was a more pronounced gradient of keratin 14 expression, decreasing in intensity

from the basal to suprabasal keratinocytes (Figure 3.1C). However, in the HSE this

keratin appeared to be more uniformly expressed in the basal and transient

76 Chapter 3: Validation of the HSE-KC photobiology model

amplifying cells. Indeed, this differential pattern of keratin 14 expression has also

been observed between other organotypic skin cultures and ex vivo skin (Smola et

al., 1993; Hinterhuber et al., 2002). Promisingly, however, the expressions of keratin

14, along with the cytokeratin 2e and keratin 1/10/11 differentiation markers showed

strong parallels between both the reconstituted and ex vivo tissues, thus confirming

the formation of a multilayered epithelium with a polarised differentiation gradient in

the HSE-KC.

The stratum corneum functions to scatter and absorb penetrating UVR to limit

the amount of damaging radiation reaching the proliferating basal keratinocytes

(Anderson and Parrish, 1981). Expressed in terminally differentiated layers of the

epidermis, filaggrin is thought to directly aid in maintaining this barrier function of

skin (Kanitakis et al., 1988; Sandilands et al., 2009; Mildner et al., 2010).

Immunohistochemical analysis of filaggrin expression shows similar patterns of

distribution in the HSE-KC as compared to that of native skin (Figure 3.1D). In the

HSE-KC, however, there appeared to be a decreased intensity of filaggrin staining in

the stratum corneum. This is in line with previous experimental data showing slightly

diminished filaggrin expression in various organotypic skin models (Hinterhuber et

al., 2002; Ponec et al., 2002). Nonetheless, the expression of filaggrin as part of a

functional stratum corneum barrier is significant in the validation of the HSE-KC as

an improved model of photobiology as compared to 2D cultures that lack this

feature. Indeed, it has been shown that irradiated tissue-engineered models lacking

filaggrin have elevated levels of DNA damage and apoptosis observed in the stratum

basale (Mildner et al., 2010). Hence, in the study of UVB-induced changes to the

proliferative cells of the epidermis, a multi-layered epidermis is a critical aspect to

include in the experimental model of choice.

The culture of the HSE-DED constructs at the air-liquid interface has been

shown to promote the differentiation of keratinocytes during the formation of the

stratified epidermal layer (Ponec, 1991). All the same, aspects of the in vitro culture

conditions required for HSE-DED culture deviate from those of the epidermis in

vivo. For example, the constant sloughing of the outermost layer of the skin due to

contact friction is absent in these skin equivalents, which has been shown to result in

hyperplasia of the epidermal component in HSE-DED constructs (Ponec, 2002).

Furthermore, the temperature at the surface of the skin is generally lower than the


internal body temperature. Indeed, skin cultures maintained at 37˚C have been shown

to have altered expressions of certain epidermal markers (Gibbs et al., 1997).

Collectively, these factors may contribute to the minor differences in the expression

of certain epidermal markers between the HSE-KC and native skin samples.

Collagen IV, along with other ECM factors (including laminin and collagen

VII) make up the BM region that separates the epidermis and dermis. The expression

of collagen IV has been detected in a variety of in vitro organotypic skin cultures and

is thought to be synthesized by both epithelial and mesenchymal skin cells (Bell et

al., 1979; Asselineau et al., 1985; Thomas and Dziadek, 1993). The localisation of

collagen IV in the HSE-KC in this study was observed at the epidermal-dermal

junction, akin to expression patterns in native skin sections (Figure 3.1E). This

outcome was significant for two major reasons. Firstly, BM components have been

found to profoundly influence keratinocyte responses to external stimuli such as

UVB (Stenback and Wasenius, 1985; Amano, 2009). Secondly, this finding validates

the use of the HSE-KC model in subsequent experiments investigating paracrine

interactions across the epidermal-dermal junction, as this model preserves the native

architecture and biology of skin in this respect.

An issue associated with several previous studies on keratinocyte behaviour

post-UV exposure has been the use of non-physiological doses of UVR to induce

photodamage in skin cells (Bender et al., 1997; Leverkus et al., 1997). To address

this, we aimed to develop an irradiation protocol using biologically-relevant doses of

UVB. In this study, only the UVB wavelength was used as a radiation source as this

particular wavelength has been shown to be the main source of UVR-induced

damage in epidermal cells (Muramatsu et al., 1992; Bernerd and Asselineau, 2008).

The quantitative measurement of 1 MED, or the amount of radiation required to

produce mild erythema 24 hours post-irradiation has been found to be about 25

mJ/cm2 on average in white-skinned individuals (Diffey, 1992; Tadokoro, 2003). In

Queensland, studies have shown facial solar UVR exposure can range from 2 to 11

MED (Kimlin et al., 1998; Parisi et al., 2000).

The histology of UVB-irradiated HSE-KC composites shows increasing levels

of epidermal damage as larger doses of UVB were applied (Figure 3.2). The skin

equivalents exposed to doses in excess of 3 MED of UVB showed widespread

damage to keratinocytes, and displayed characteristics of tissue necrosis (Wyllie,


1980). This observation can be attributed to a number of factors. Firstly, the HSE-KC

does not contain melanocytes incorporated into the constructs, which are a

fundamental cell type in protecting keratinocytes from the damaging effects of UVB

(Bertaux et al., 1988; Liu, 2007; Santiago-Walker, 2009). Indeed, pigmented skin

equivalents with incorporated melanocytes have been shown to withstand UV doses

in excess of 5 MED without extensive necrotic damage to the epidermis (Todd et al.,

1993; Nakazawa et al., 1997). This can be partly attributed to the shielding effect of

melanin, which is thought to absorb 50 to 75% of penetrating UVR via the formation

of supranuclear caps in melanosomes (Brenner, 2008). In addition to this, the

regeneration of the functional epidermal barrier following photodamage is also

partially maintained by paracrine signals from mesenchymal fibroblasts

(Archambault et al., 1995; Jost et al., 2001; Mildner et al., 2007). Therefore, the

cellular toxicity displayed with higher doses of UVB in the HSE-KC may in part be

due to the absence of both melanin and the activation of dermal-derived protective

pathways.

Accordingly, the dose of UVB that was chosen for subsequent experiments was

2 MED (50 mJ/cm2), as it was within the physiological range, and was shown to

induce UVB damage while maintaining enough viable keratinocytes for subsequent

epidermal regeneration. The detection of cellular viability (via MTT staining) after

this UVB dose showed no significant changes in intensity in HSE-KC up to 5 days

post-irradiation (Figure 3.3). However, while the MTT assay has been frequently

used as a measure of skin viability, it should be used in conjunction with other

histological and immunohistochemical techniques to determine the status of

keratinocyte viability more accurately (Castagnoli et al., 2003). This has also been

demonstrated in other experimental systems showing that cell viability assays such as

the lactate dehydrogenase release assay more accurately reflect the presence of

apoptotic cells, as compared to the MTT assay (Lobner, 2000).

The classical markers of acute cutaneous photodamage have been well-

documented (Matsumura and Ananthaswamy, 2002; Matsumura and Ananthaswamy,

2004). The principal signs of UVB-induced damage include the formation of DNA

lesions, cell cycle arrest, cell death via apoptosis, inflammation and the tanning

response (Black et al., 1997). In view of this, irradiated HSE-KC constructs were

analysed for the presence of keratinocyte-specific damage markers (Section 3.3.4).


The formation of CPD lesions in the stratum basale and suprabasal keratinocytes

were detected 24 hours after exposure in HSE-KC exposed to UVB (Figure 3.4). The

CPDs were localised within the nuclei of these cells and did not appear to be present

in non-irradiated controls. Both the distribution and the localisation of CPD

formation post-irradiation were consistent with results from similar studies

conducted in vivo (Chadwick et al., 1995; Katiyar et al., 2000). Skin sections from

volunteers exposed to 2 MED of UVR were reported to show similar formations of

these thymine dimers in keratinocyte DNA, with approximately 60% of CPD-

positive cells present in the epidermis at 48 hours after exposure. The results

documented herein were also comparable to those obtained from in vitro studies

using UVB-irradiated HSE constructs, in which UVB radiation-induced CPDs were

observed in the epidermal regions of irradiated skin composites (Marionnet et al.,

2010; Bernerd et al., 2012).

The process of apoptosis is a protective mechanism in skin to prevent the

proliferation of severely DNA-damaged cells following UV-exposure (D'Errico et

al., 2003). The majority of apoptotic basal and suprabasal keratinocytes appeared 24

hours after a single dose of 2 MED UVB in the HSE-KC, as detected using the

TUNEL assay (Figure 3.5). This technique to detect UVB radiation-induced

apoptosis in keratinocytes from fixed skin tissue has been widely-used in the study of

photodamage (Wrone-Smith et al., 1997; Yamaguchi et al., 2006). Interestingly, it

was observed that more pigmented skin showed fewer TUNEL-positive cells present

in the stratum basale following irradiation, as compared to skin from less pigmented

individuals (Yamaguchi et al., 2006). This suggests that the relatively elevated levels

of apoptotic keratinocytes present in the basal layer of irradiated HSE-KCs may be in

part due to an absence of melanocytes in these skin equivalents.

The activation of both DNA damage-induced apoptosis and repair mechanisms

(via cell cycle arrest) are highly-dependent on the function of p53 (Ananthaswamy

and Kanjilal, 1996). These p53-associated repair mechanisms are central in

counteracting UVB-induced damage (Cotton and Spandau, 1997; Will, 2000; van

Laethem et al., 2009). Accordingly, the activation and upregulation of p53

expression has been observed in a variety of experimental systems within the initial

24 hours post-irradiation, with peak levels of detection apparent after 6 hours (Tron

et al., 1998a; Tron et al., 1998b; D'Errico et al., 2005). In the study reported herein,


sections of irradiated HSE-KCs were probed for the presence of p53, and also

showed the accumulation of p53 within keratinocyte nuclei within 24 hours of UVB

exposure (Figure 3.6). The majority of p53-positive keratinocytes were basal and

suprabasal cells, in line with observations from previous studies (Lu et al., 1999).

Moreover, localisation patterns of nuclear p53 in the HSE-KC appeared to shift from

being predominantly perinuclear to being more centrally-located within keratinocyte

nuclei. This phenomenon has been previously reported in experiments conducted on

irradiated keratinocyte monolayers, showing clear evidence of p53 translocation into

the nucleus following high doses of UVB (Cotton and Spandau, 1997). It is

important to note that the p53 response in irradiated keratinocytes is highly sensitive

to a variety of factors including cellular adhesion and differentiation status (Kumar et

al., 1999). Additionally, major differences in the expression patterns of p53 and its

target genes have been identified between irradiated cell monolayers and in vivo skin

cells (Enk et al., 2006). Therefore, physiologically-similar p53 expression patterns

detected in the irradiated HSE-KC suggest that this model may be a more

representative model of the acute UV response.

The secretion of an array of cytokines by keratinocytes during the acute UV-

response has been well-documented in both in vivo and various in vitro techniques

(Enk et al., 1995; Strickland et al., 1997; Brink et al., 2000b; Saade et al., 2000;

Bechetoille et al., 2007; Liebel et al., 2012). These inflammatory and anti-

inflammatory cytokines include IL-1, IL-6, IL-8, IL-10, IL-12 and tumour necrosis

factor-α (Kock et al., 1990; Grewe et al., 1995; Enk et al., 1996; Petit-Frere et al.,

1998). This response is closely-linked to the erythemal effects observed post-

exposure and is thought to be triggered by DNA damage (Petit-Frere et al., 1998).

Cell culture supernatants from irradiated HSE-KC cultures were found to have

significantly elevated levels of IL-6 at 24 hours post-exposure (Figure 3.7). It was

also found that IL-8 secreted by HSE-KC composites had increased in response to

UVB radiation. In the case of IL-8, relatively higher baseline levels may be attributed

to the fact that keratinocytes have been found to constitutively produce IL-8 (Kondo

et al., 1993). Notably also, the upregulation of IL-8 production in irradiated

keratinocytes has been demonstrated to occur as early as one hour after exposure

(Kondo et al., 1993). This may then account for the lack of a significant increase in

IL-8 levels compared to baseline observed after 24 hours. The secretion of these


keratinocyte-secreted soluble mediators of inflammation have been previously

detected in both HSE and monolayer culture supernatants as a result of UVB

exposure (Grandjean-Laquerriere et al., 2003; Bechetoille et al., 2007). This

represents another central marker of the acute UVB response that was successfully

detected in the HSE-KC in vitro model.

Due to their frequent exposure to damaging radiation, keratinocytes are

equipped with sophisticated and efficient DNA repair strategies. During the post-

irradiation repair phase in skin, UVB radiation-induced photolesions, such as CPDs,

are repaired via the nuclear excision repair system (Setlow, 1966; Nijhof et al.,

2007). These processes have been well-documented in several keratinocyte culture

systems and together with cell cycle checkpoint mechanisms, function to guard the

integrity of the cell’s genetic information (Liu et al., 1983; Zhou and Elledge, 2000;

D'Errico et al., 2003). The rate of DNA damage repair is highly dependent on the

type of photolesion, the cell type, as well as the efficiency of the repair mechanism

(Svobodova and Vostalova, 2010). Lesions such as 6-4PP have been observed to be

fully repaired within 6 hours, whereas the more abundant CPDs can take up to 24

hours for the activation of repair systems (Costa, 2003).

The next aim in the validation of the HSE-KC photobiology model was to

characterise repair and regeneration responses following UVB exposure. It was

previously shown that the UVB irradiation protocol was able to illicit the formation

of CPDs in keratinocyte nuclei in the HSE-KC. Therefore, the removal of these DNA

damage markers was monitored at time-points subsequent to irradiation as an

indication of photolesion repair. Irradiated HSE-KCs sacrificed every day for five

days after UVB treatment displayed a gradual decrease in the presence of nuclear

CPDs, as shown via immunohistochemical analysis (Figure 3.8). The majority of the

CPDs occurring in basal and suprabasal keratinocyte nuclei were observed to be

eliminated between 24 and 48 hours post-irradiation (Figure 3.9). At Day 2 after

irradiation, approximately 50% of the CPD photoproducts were observed to have

been repaired in the HSE-KC. Similar experiments using irradiated keratinocyte

monolayers revealed that an average of only 20% of the initial numbers of CPD-

positive cells remained 24 hours after UVB exposure (D'Errico et al., 2003).

Prior studies have shown significant differences in the repair rates of CPDs

between native skin and cultured keratinocyte models (Mouret et al., 2008). These


comparative studies showed higher rates of CPD removal in monolayer cultures of

keratinocytes, as compared to that observed in irradiated skin in vivo. Results from

the analysis of CPD removal in the HSE-KC, however, showed more parallels with

the observed rate of CPD repair in native skin, with experimental data demonstrating

54.3% of CPD-positive cells remain present at 48 hours post-irradiation (Mouret et

al., 2008). This observation may be attributed to differences in the capacity for CPD

repair between different keratinocyte subpopulations in the epidermis. Proliferative

cells in the stratum basale are known to have relatively higher efficiencies of DNA

repair as opposed to differentiating keratinocytes in the suprabasal layers (Liu et al.,

1983). Therefore, it is to be expected that monolayer cultures (with a larger

population of proliferative keratinocytes) would be selective for cells with enhanced

DNA repair capacities.

While immunohistochemical staining and subsequent image analysis is

commonly used for detecting the presence of photolesions over time, more sensitive

techniques allow for an increased accuracy in the quantification of CPDs. For

example, techniques such as high performance liquid chromatography methods

associated with tandem mass spectrometry (HPLC-MS/MS) have been used to more

accurately quantify photoproducts in irradiated human skin (Bykov et al., 1999; Zhao

et al., 2002). However, these more sensitive methods reveal similar rates of

photolesion repair as found in whole skin models (Bykov et al., 1999; Mouret et al.,

2006).

An important aspect of the acute UVB response is the regulation of the cell

cycle to ensure that damaged DNA is repaired before being replicated. Specifically,

G1 cell cycle arrest ensures that photolesions are successfully removed from DNA

before the cell enters the S and M phase (Morgan and Kastan, 1997). The Ki-67

proliferation marker is a nuclear antigen shown to be expressed in the active phases

of the cell cycle (Heenen et al., 1998; Scholzen and Gerdes, 2000). Previous

investigations into epidermal proliferation patterns in native skin reveal a substantial

increase in the number of Ki-67-expressing basal cells at 48 hours post-UVB

irradiation (Lee et al., 2002). The study reported herein has shown that the number of

Ki-67-positive cells in the HSE-KC show a similar proliferative burst occurring

around three to four days after UVB-irradiation which subsequently returned to

baseline values (Figure 3.11). At Day 2 after irradiation, there were significantly


fewer proliferating cells in the UVB-exposed HSE-KC compared to matched non-

irradiated controls. Taken together with observations of CPD repair in the irradiated

HSE-KC, it is likely that this decrease in the number of actively cycling

keratinocytes is associated with repair processes in these cells. Also, the presence of

paracrine signals from other skin cell populations in vivo may be responsible for the

relatively accelerated post-irradiation proliferative phase as compared to the HSE-

KC (Werner and Smola, 2001).

Apart from the regulation of cell cycle progression, the processes of apoptosis,

cellular senescence and terminal differentiation are also critical in suppressing the

proliferation of UVB-damaged cells (Gandarillas, 2000). After prolonged and

repeated UVB exposures, an increase in keratinocyte terminal differentiation not

only prevents the duplication of DNA-damaged cells, but also results in the

thickening of the stratum corneum to prevent further photodamage (Gambichler et

al., 2005). However, the mediators of such responses and the mechanisms behind the

regulation of keratinocyte terminal differentiation during the UV response have yet

to be fully defined.

Keratins 1 and 10 are early markers of terminal differentiation and are

constitutively expressed in the suprabasal keratinocyte layers (Woodcock-Mitchell et

al., 1982). Hence, an antibody against keratin 1/10/11 was used to probe tissue

sections of irradiated HSE-KC and revealed changes in the proportions of

differentiated keratinocyte populations in the epidermis in the days following UVB

exposure (Figure 3.12). A diminished expression of these keratins was observed

during the 48 hours following irradiation, which then appeared to increase in

intensity from Day 3. Also, a thickening of the stratum corneum was observed during

this period, in which this layer readily detached from the HSE-KC composites, in a

process resembling blistering.

Previous in vivo and in vitro studies show a similar progressive decrease in

keratin 10 expression around 48 to 72 hours post-irradiation, which was subsequently

strongly expressed in suprabasal keratinocytes (Rosario et al., 1979; Bernerd and

Asselineau, 2008). In experiments using irradiated HSE models, it was observed that

keratin 10 expression appeared to normalise to baseline levels at about 14 days after

UVB-exposure (Bernerd, 1997). Interestingly, in vivo testing using small animal

models also showed decreased keratin 1 expression in the epidermis subsequent to


UVB exposure (Horio et al., 1993; Kambayashi et al., 2001). Therefore, UVB is

likely to cause alterations to early markers of keratinocyte differentiation, such as

keratins 1, 10 and 11 during the acute sunburn phase. The thickening and blistering

of the stratum corneum may be associated with the upregulation of other epidermal

proteins, such as cytokeratin 6, filaggrin, loricrin and involucrin (Lee et al., 2002).

Indeed, an increase in late stage differentiation markers such as filaggrin and loricrin

has been previously observed in irradiated skin, indicating keratinocyte

differentiation may be accelerated and promoted as a photoadaptive response (Bosca

et al., 1988; Kanitakis et al., 1988; Mehrel et al., 1990). Thus, changes to other

markers of epidermal differentiation can be further investigated using the HSE-KC

model in order to more fully characterise these processes as a result of UVB

exposure.

The HSE-KC model holds potential as a versatile and powerful photobiology

tool due to the retention of several physiological cutaneous properties. Moreover, the

HSE-KC represents a basic epidermal model into which additional cell types can be

incorporated resulting in the creation of an improved biologically-relevant skin

model. In the next Chapter, the addition of fibroblasts into the DED component of

the HSE-KC is described, which allows for the investigation of paracrine interactions

between the dermal and epidermal cells during the UVB response. It is important to

bear in mind that despite the HSE-DED model being flexible in terms of the origin

and type of primary cells that may be incorporated, this may also contribute to inter-

donor variability, a phenomenon that has been reported in a variety of skin studies

(Basketter et al., 1996; Judge et al., 1996; Hiroshima et al., 2011). Indeed, studies

have shown variability to exist, particularly in keratinocyte UVB-responses between

individuals (Sesto et al., 2002). We attempted to limit these effects in our study by

acquiring donor skin from female donors and from non-sun exposed anatomical

regions. The use of an ex vivo dermal component, however, can also contribute to

variability between HSE-DED constructs due to, for example, regional differences in

the health of the tissue and the composition of the BM. In the future, the

development of increasingly elegant synthetic dermal substitutes may provide

improved dermal scaffolds which can reduce variability while preserving the

physiological properties of the dermis more faithfully (Liu et al., 2004; Valenta,

2004; Supp and Boyce, 2005; Mazlyzam, 2007).


3.5 CONCLUSION

In summary, the HSE-KC in vitro skin model has been successfully validated

as a tool for photobiology in terms of the ability to experimentally induce

characteristic UVB damage markers, as well as its capacity for post-irradiation repair

and regeneration (Figure 3.14). Additionally, comparative studies on the HSE-KC

and native skin show similar expression in terms of various epidermal markers. In

optimising the irradiation protocol, a physiologically-relevant dose of UVB radiation

was determined. Therefore, the baseline measures obtained in the analysis of

irradiated HSE-KC composites formed the basis for the next aim which was to

investigate the effect of paracrine interactions with fibroblasts on these responses.


Figure 3.14. Validation of the HSE-KC as a photobiology model

Diagrammatic representation of the results obtained from the HSE-KC validation study reported in Chapter 3.

Histological and immunohistochemical analysis of the HSE-KC revealed similarities in terms of the structure and

composition of the epidermal component in comparison to the native epidermis. These include the presence of a

stratified and organised epidermal layer, positively expressing native epidermal markers, such as keratin 1/10/11,

cytokeratin 2e, keratin 14 and filaggrin. Also, the dermal-epidermal junction showed the retention of

morphological properties like the rete ridges as well as components associated with the BM zone, such as

collagen IV. Exposure of these skin composites to UVB resulted in the formation of classical markers of UV

damage in the HSE-KC epidermis, including CPD photolesions, apoptotic keratinocytes, the expression of p53

and the secretion of IL-6 and IL-8. Additionally, markers of epidermal repair and regeneration such as changes to

keratinocyte proliferation, the removal of CPD and blistering through increased keratinocyte differentiation were

also observed.

Chapter 4: Fibroblast-keratinocyte interactions and the acute UVB response 87

Chapter 4: Fibroblast-keratinocyte

interactions and the acute UVB

response

4.1 INTRODUCTION

While the aetiology and risk factors associated with skin cancer development

have been extensively explored, knowledge gaps still exist on the understanding of

pathogenesis at the cellular and molecular levels. An important factor influencing the

progress of photocarcinogenesis research is the urgent need for more robust in vitro

experimental approaches (as reviewed in Section 1.6). To address this, we have

successfully demonstrated that a primary cell-based HSE-KC model is applicable in

photobiology research to study keratinocyte changes following UVB irradiation. This

model represents a physiologically-relevant platform to study these responses to

UVB, by preserving several anatomical and functional aspects of native skin, as is

commonly lacking in many previously-employed photobiology models. The

complexity of the human epidermis, in terms of its barrier function against harmful

environmental agents, is reflected in both its intricate structure and the inherent

network of intercellular interactions which, in combination, aid in its protection and

regeneration from UVR-damage. While the shielding effect on keratinocytes from

UVR is known to be primarily conferred by melanin-producing melanocytes, it is

less well-understood how signals from mesenchymal cell types may contribute to

preventing and repairing photodamage. Hence, the aim of the study described herein

was to characterise the novel application of 2D and 3D cell-based in vitro

technologies to study fibroblast-keratinocyte interactions during the acute UVB

response in primary human skin cells.

Fibroblasts are known to be central in the regulation of many epithelial

processes, for example, proliferation, differentiation and keratinocyte migration, as

discussed in Section 1.4 (Aaronson et al., 1990; Wenczak et al., 1992; Beer et al.,

2000; El-Ghalbzouri et al., 2002; Beyer et al., 2003). The dermis consists of a

heterogeneous population of fibroblasts, with the papillary fibroblasts (situated in the

88 Chapter 4: Fibroblast-keratinocyte interactions and the acute UVB response

more superficial layers) being primarily responsible for secreting the ECM

molecules, growth factors and cytokines associated with epidermal maintenance and

regeneration (Sorrell et al., 2007). Besides being critical during phases of wound-

healing, these fibroblast-keratinocyte interactions are also thought to play a vital role

in epidermal regeneration after UVB-induced damage (Kuhn et al., 1999; Hedley et

al., 2002; Bernerd, 2005). While the exact mediators and mechanisms involved in

these interactions have yet to be comprehensively defined, various growth factor

systems such as that of EGF, KGF and IGF have been shown to be among the

principal players (Mackenzie and Fusenig, 1983; Lewis and Spandau, 2008). These

and other fibroblast-secreted factors have been observed to promote cellular

proliferation and orchestrate anti-apoptotic and repair processes post-irradiation in

vitro (Grundmann et al., 2010; Lewis et al., 2010). However, further analysis of

these processes using more robust, biologically-relevant models are still required to

characterise the complex process of fibroblast-protection during the acute

keratinocyte response to UVB more accurately.

Previous studies aimed at uncovering the role of epidermal-mesenchymal

interactions in the cutaneous UVB response predominantly rely on the use of

conventional cell culture methods (Kuhn et al., 1999; Lewis and Spandau, 2008).

These traditional 2D cell-line and primary cell monolayers possess various

limitations associated with their use for such investigations. In particular, these

experimental models lack the capacity to adequately represent some of the more

complex interactions between the dermal and epidermal cell populations. As a result

of such drawbacks, the application of monolayer culture methods in uncovering the

intercellular processes involved in the acute keratinocyte UV-response has been

limited. Nonetheless, 2D cell cultures also possess significant advantages in terms of

their ease of use, shorter incubation periods required to attain confluent monolayer

cultures, reduced variability between sample replicates and enhanced versatility

associated with the size and number of experimental replicates.

Henceforth, in order to address both the utilities and constraints of

conventional cell cultures, we proposed the use of a Transwell® co-culture model,

constituting both primary human fibroblasts and keratinocytes grown in a two-tiered

cell culture system. Comprised of two physically separated cell populations in a

common growth medium and separated by a porous membrane, this co-culture


system has previously been successfully employed by our research group to study

cellular processes including growth factor-mediated cell migration (Hyde et al.,

2004; Simpson et al., 2010; Kashyap et al., 2011). While its application in

photobiological studies has been limited thus far, the Transwell® system is

increasingly being employed to map the relationships between distinct cell

populations in modulating the UV-response. For instance, this system has been taken

advantage of in modelling keratinocyte and adipocyte interactions subsequent to

UVR exposure (Kim et al., 2011). Importantly, this model encompasses the technical

ease-of-use, reproducibility and versatility of conventional 2D cell cultures, while

more closely mimicking in vivo interactions between epidermal and mesenchymal

cell populations. Therefore, the Transwell® model was adopted in this project as an

in vitro model to characterise the influence of primary fibroblasts on the responses of

keratinocytes to UVB radiation.

In the previous Chapter, the application of a 3D HSE-KC model of primary

keratinocytes cultured on an ex vivo DED scaffold was shown to demonstrate similar

UVB irradiation damage and regeneration effects as those commonly observed in

vivo. Accordingly, the use of this 3D tissue-engineered model was also employed in

the study reported herein as an additional platform for dissecting the mechanisms

behind epidermal-mesenchymal paracrine interactions during the photoresponse to

UVB. Fundamentally, the application of these 3D organotypic photobiology models

represents a novel experimental approach, more closely retaining various

physiological properties of native skin which are believed to be critical to the UVB

irradiation response (as discussed in Section 1.3). Indeed, several physical and

functional characteristics of skin in vivo, including the BM zone at the dermal-

epidermal junction, are also known to be instrumental in facilitating fibroblast-

keratinocyte interactions, and are also retained to some degree in the HSE-DED

(Ponec et al., 2000; Amano, 2009). Additionally, from a technical viewpoint, the

process of HSE-DED culture allows for the incorporation of various combinations of

cell types into the epidermal and dermal components. This flexibility allows for the

examination of alterations in keratinocyte responses with and without the presence of

fibroblasts in the DED component in this study.

Importantly, recent theories into a possible correlation between skin aging and

NMSC development suggest potential implications of the disruption of these dermal-


epidermal interactions during the early stages of photocarcinogenesis (Lewis et al.,

2008). Notably, the lack of keratinocyte activation by fibroblast-secreted factors in

aged and chronically sun-exposed skin has been linked to an inappropriate response

to UV-damage (Albert and Weinstock, 2003; Lewis et al., 2010). Moreover, the

activation of repair mechanisms following UVB exposure has been shown to be

heavily dependent on the activation status of the IGF-IR in keratinocytes (Kuhn et

al., 1999). Furthermore, analysis of dermal fibroblasts in elderly individuals show

signs of cellular senescence and an associated diminished functionality in these cells,

thus compromising the synthesis of growth factors important during the epidermal

UVB radiation photoresponse (Lewis et al., 2010; Bigot et al., 2012; Spandau et al.,

2012). Hence, altered fibroblast-keratinocyte interactions may be related to the

higher risk of photocarcinogenesis observed in these elderly individuals (Lewis et al.,

2008). Understanding the relationship between these epithelial-mesenchymal

networks following photodamage is therefore an essential first step in the

development of targeted strategies to prevent photocarcinogenesis in such susceptible

individuals.

A critical cellular safeguard against oncogenic transformation is the activation

of appropriate repair or cell death pathways upon DNA damage (Bernerd et al.,

2001a; Bernstein et al., 2002). Direct genetic photodamage by UVB exposure occurs

in part via the generation of pyrimidine dimers, which if left unrepaired, can result in

the accumulation of mutations in various proto-oncogenes and tumour suppressor

genes (Ananthaswamy and Kanjilal, 1996). Likewise, changes to the initiation of

apoptotic pathways that function to prevent the proliferation of DNA-damaged cells

may also be responsible for skin cancer initiation (Matsumura and Ananthaswamy,

2002). While keratinocyte survival is critical for maintaining a functional epidermal

barrier post-irradiation, the removal of severely damaged cells through programmed

cell death is also crucial to prevent the propagation of transformed cells in this highly

proliferative tissue. The factors which orchestrate this delicate balance between cell

survival and death following UVR exposure, however, have yet to be extensively

mapped. Therefore, the next aim of the study reported herein was to investigate

keratinocyte damage, repair and death pathways using the novel photobiology

models as described earlier. In particular, this study aims at defining some of the


mechanisms behind fibroblast-mediated regulation of these processes using novel in

vitro strategies.

Broadly, the aims of this Chapter are therefore to:

1. Investigate the impact of dermal fibroblast co-culture on UVB-induced

keratinocyte damage, viability and apoptosis using a Transwell® system;

2. Develop and characterise a 3D HSE-DED model incorporating human

dermal fibroblasts and keratinocytes (HSE-KCF), to be used as a novel

platform for identifying how fibroblasts can modulate keratinocyte

survival, repair and apoptosis following irradiation, and

3. Identify some key pathways and molecular mechanisms involved in

fibroblast-mediated modulation of the acute UVB response in the

epidermis.



All the methods and materials used in this Chapter are as previously described

in Chapter 2. Any variation to these procedures is outlined in the following sections.

4.2.1 Primary human cell isolation and culture

The procedures for the isolation and culture of primary human keratinocytes

and fibroblasts from ex vivo skin tissues are detailed in 2.2.2.

4.2.2 Transwell® fibroblast and keratinocyte co-cultures

The co-culture of primary keratinocytes and fibroblasts using the Transwell®

cell culture system is described in 2.2.4.

4.2.3 Analysis of cellular viability

The MTS assay was used to quantify cellular viability in irradiated

keratinocytes, as a function of metabolic activity, as described in 2.2.12. The MTS

assay was performed 24 hours after the administration of a UVB dose as detailed in

4.2.7.

4.2.4 TUNEL assay for the detection of apoptosis

The TUNEL assay was used to detect apoptotic cells in the irradiated

keratinocyte monolayers, as previously described in 2.2.11. This technique was also

used to visualise the presence of sunburn cells (apoptotic keratinocytes) in formalin-

fixed, paraffin-embedded tissue sections, as outlined in 2.2.11.


The concentrations of IL-6 and IL-8 in irradiated Transwell®, HSE-KC and

HSE-KCF cultures were quantified using an ELISA, as described in 2.2.13.

4.2.6 HSE-KC construction and culture

The HSE-KC composites were constructed and maintained in culture using the

protocol outlined in 2.2.3.

4.2.7 Irradiation of keratinocyte monolayers on Transwell® inserts

Keratinocyte monolayers were irradiated with a single UVB dose (as outlined

in 2.2.5). In the dose optimisation experiments described in 4.3.1, keratinocyte

monolayers were exposed to the UVB-emitting bulb for 0, 162, 324, 486, 648 and


810 seconds to administer a single dose of 0, 1, 2, 3, 4 and 5 MED respectively. To

investigate the protective and reparative effects of fibroblast co-cultures on

keratinocytes, three different irradiation and culture protocols were utilised, as

depicted in Figure 4.1. Keratinocytes were either cultured in Transwell® inserts

without the presence of fibroblasts (Figure 4.1A), with fibroblast co-culture prior to

irradiation (B) or transferred to co-culture conditions after UVB exposure (C). All

experiments were conducted in SFM.

Figure 4.1. Irradiation of keratinocyte monolayers cultured in different co-culture conditions

Keratinocyte cultures in SFM without fibroblasts in the lower chamber were irradiated with UVB (A and C).

Under the first condition (A), irradiated keratinocyte monolayers were returned to cultures containing SFM only.

In the second condition (B), keratinocytes grown in co-culture conditions with fibroblasts were irradiated and

transferred to wells containing SFM only. In the final culture condition (C), fibroblast-free keratinocyte cultures

were irradiated and subsequently transferred to fibroblast co-culture conditions following UVB-exposure.

4.2.8 Optimisation of HSE-KCF culture protocol

The protocol for the construction of the HSE-KCF (consisting of keratinocytes

and fibroblasts on a DED scaffold) was firstly developed to identify the optimum cell

seeding conditions required for fibroblast incorporation into the HSE-KCF. The

primary human fibroblasts were isolated and cultured as detailed in 2.2.2. These

dermal fibroblasts at P2-5 were seeded on either the reticular or papillary surface of

the DED in stainless steel rings at various time points prior to the addition of cultured

keratinocytes. The optimal culture conditions (as detailed in 2.2.3) for the

construction of the HSE-KCF were determined via histological and

immunohistochemical assessment.

4.2.9 Irradiation of the HSE-DED composites

The HSE-KC and HSE-KCF composites were irradiated with specific doses of

UVB as per the irradiation protocol described in 2.2.5.


4.2.10 Histological analysis of tissues

All histology was performed using routine haematoxylin and eosin staining

protocols, previously outlined in 2.2.6.

4.2.11 Immunofluorescent analysis

Fixed native skin and HSE-DED tissues were processed as described in 2.2.6 to

obtain 5 µm thick tissue sections. For the immunofluorescent detection of vimentin,

these tissue sections were pre-treated with HIER in sodium citrate buffer (as

previously outlined in 2.2.7). The sections were then incubated with a polyclonal

rabbit anti-vimentin antibody to Arg28 in human vimentin (Cell Signaling

Technology) overnight at 4°C. The tissue was then treated with a fluorescently-

labelled goat anti-rabbit secondary antibody (Alexa Fluor™ 594, Invitrogen) for 60

minutes at room temperature. Cell nuclei were counterstained with DAPI as

previously described in 2.2.10.

The immunofluorescent labelling of cell monolayers cultured in Transwell

inserts was performed using the protocol detailed in 2.2.10. The presence of cleaved

caspase-3 was visualised in these keratinocyte monolayers using a polyclonal

antibody specific against the large fragment (17/19 kDa) of activated caspase-3

resulting from cleavage at Asp175 (Cell Signaling Technology). Cell monolayers

were incubated with 1:50 dilutions of the primary antibody overnight at 4°C. The cell

monolayers were also fluorescently-labelled with the DAPI nuclear marker as

described in 2.2.10. Immunofluorescently-labelled cell monolayers were visualised

using confocal microscopy (TCS SP5 confocal microscope, Leica). The formation of

CPD DNA dimers was also detected in these irradiated keratinocyte monolayers

using a mouse monoclonal antibody against CPDs (clone KTM53, Kamiya

Biomedical Company, Japan) at a 1:1000 dilution and incubated overnight at 4°C.

These keratinocyte monolayers were simultaneously labelled with DAPI and

visualised using fluorescence microscopy as outlined in 2.2.10.

4.2.12 Immunohistochemical analysis

All immunohistochemical analysis conducted on the tissue sections of the

HSE-KC and HSE-KCF were performed as described in 2.2.7.


4.2.13 Analysis of apoptotic pathways using ELISA

A sandwich ELISA apoptosis array was used to detect the presence of elements

of the apoptotic cascade in cell lysates from irradiated HSE-KC and HSE-KCF (as

described in 2.2.20). The PathScan® Apoptosis Multi-target Sandwich ELISA kit

(Cell Signaling Technology, Beverly, MA) was used as per the manufacturer’s

protocol. Briefly, cell lysates (diluted to 250 pg/µl in the manufacturer’s supplied

sample diluent) were then added to a 96-well plate pre-bound with primary

antibodies to various protein antigen targets, and incubated overnight at 4°C. The

wells were then incubated for one hour with the corresponding detection antibodies

and HRP-linked secondary antibodies. The supplied 3,3',5,5'-tetramethylbenzidine

(TMB) substrate was then added to each well and incubated for 10 minutes at 37°C,

after which the reaction was stopped using the stop solution provided. The

absorbances of the ELISA reactions were read at 450 nm using a spectrophotometer.

The magnitude of the reaction absorbance was directly proportional to the quantity of

the bound target protein.

4.2.14 qRT-PCR analysis of gene expression

The protocol for qRT-PCR performed in this study is described in 2.2.19. The

primer sequences for p53 were TAACAGTTCCTGCATGGGCGGC (5’ to 3’) and

AGGACAGGCACAAACACGCACC (3’ to 5’).

4.2.15 Western immunoblotting analysis

Western blots were performed as previously outlined in 2.2.23.


4.3 RESULTS

Aim 1: To study the impact of fibroblast co-culture on the survival, repair and

death in irradiated keratinocytes using a Transwell® cell culture system

4.3.1 Optimisation of a Transwell® co-culture system photobiology model

In order to address the first aim of this Chapter, a 2D co-culture system was

firstly characterised and optimised for its use in assessing UVB-induced keratinocyte

responses. The co-culture of primary mouse keratinocytes and fibroblasts using this

Transwell® system has been previously described in an investigation into epidermal

morphogenesis during wound healing (Kandyba et al., 2008). The use of this

Transwell® cell culture system addresses some of the limitations of conventional 2D

monolayer cultures; in particular, the potential to culture two physically-separated

cell populations which share a common cell culture medium (Ami et al., 1995). In

the study reported here, this technique was characterised for its use as a novel

photobiology co-culture model using primary human skin cells.

Notably, it has been previously demonstrated that cells grown in a 2D

monolayer format respond differently to various treatments and stimuli, including

UVR exposure, in comparison to those within an in vivo setting (Sun et al., 2006).

Therefore, while the optimal experimental UVB dose for 3D HSE-KC composites

was previously assessed (Section 3.3.2), the UVB dose required to reduce cellular

viability by 50% in the Transwell® keratinocyte monolayers was firstly determined.

This would thus provide baseline measures from which fibroblast-induced changes to

keratinocyte UV-responses can be assessed in the subsequent Transwell®

experiments described in this Chapter.

The dose-response of keratinocyte viability to increasing levels of UVB are

shown in Figure 4.1A. The MTS assay used here to assess the relative cell survival in

irradiated keratinocyte populations is widely used to attain experimental dose-

response curves to UVR exposure (Ho et al., 2010; Staples et al., 2010; Han et al.,

2011). The relative cell viabilities in these keratinocyte populations were shown to

significantly decrease compared to non-irradiated cultures, 24 hours after a single

dose of 4 and 5 MED of UVB. At these doses, the percentage of viable cells

decreased to 65.2 ± 19.8% and 29.6 ± 14.0% respectively (Figure 4.2A).


Accordingly, a 4 MED UVB dose was applied in the subsequent experiments to

analyse changes to keratinocyte photoresponses as a result of fibroblast co-culture.

Figure 4.2. Cell viability of keratinocytes in UVB-irradiated Transwells®

(A) The relative cell viabilities of irradiated keratinocytes exposed to increasing doses of UVB were measured

using the MTS assay. Cells were assayed at 24 hours post-irradiation, and the absorbances expressed as a

percentage of values obtained from the non-irradiated control. Asterisks represent statistical significance (p<0.05)

relative to the non-irradiated control. (B) The effects of culture conditions and UVB exposure on keratinocyte

viability are expressed as a percentage of results obtained from non-irradiated SFM cultures. The asterisks

represent statistical significance of p<0.05. Error bars indicate SEM values. Results are representative of

experimental triplicates using cells obtained from experiments on three separate skin donors.

4.3.2 Effects of fibroblast co-culture on cell viability in irradiated keratinocytes

In the previous experiments (Section 4.3.1) the UVB dose observed to decrease

the overall viability in keratinocyte monolayers by 50% was successfully established

as being 4 MED (Figure 4.2A). Next, the changes to keratinocyte UVB responses as

a result of fibroblast co-culture were further investigated. Specifically, whether

fibroblasts conferred a protective effect to keratinocytes prior to their exposure to

UVB, or played a role in increasing cellular survival after irradiation was studied

(Figure 4.2B).

Exposure of the keratinocyte monolayers to UVB irradiation was shown to

decrease cell viability 24 hours post-irradiation under all culture conditions.

Keratinocyte monolayers cultured without the presence of fibroblasts were observed

A B

UVB dose (MED)

Pe

rce

nta

ge

ce

ll vi

ab

ility

0 1 2 3 4 50

50

100

150

*

*

UVB dose (MED)

Per

cent

age

cell

viab

ility

0 4 0 4 0 4

0

50

100

150 *

SFM + Fib (before UV) + Fib (after UV)


to have the greatest decrease in metabolic activity following irradiation, with a mean

overall decrease of 53.7 ± 11.9%. Cells co-cultured with fibroblasts before being

exposed to UVB radiation showed the most significant resistance to cell death with a

89.3 ± 19.6% of viable cells remaining post-irradiation. When transferred to

fibroblast-containing cultures after the irradiation process, the keratinocytes showed

no significant change in cell viability as compared to those cultured in SFM only

(67.0 ± 23.1%). These results suggest that keratinocyte activation by fibroblast-

secreted factors prior to UVB-induced damage may be more vital for resisting cell

death and maintaining cell viability following insult, thus conferring a protective

effect on irradiated keratinocytes.

4.3.3 Effects of fibroblast co-culture on cell death in irradiated keratinocytes

Keratinocyte apoptosis resulting from the effects of UVB exposure is a

characteristic tissue damage marker both in vivo and in vitro (Wrone-Smith et al.,

1997; Matsumura et al., 2005; Svobodova et al., 2012). The activation of apoptotic

pathways after UVB photodamage represents a fail-safe cellular mechanism

triggered predominantly by DNA damage, to reduce the risk of malignant

transformation (van Laethem et al., 2005; Claerhout et al., 2006; van Laethem et al.,

2009). Using the Transwell® co-culture system, it was reported in the previous

section that dermal fibroblast co-culture positively enhanced keratinocyte viability

subsequent to UVB exposure (4.3.2). This augmentation of cell viability in irradiated

keratinocytes was therefore characterised to determine a possible link to the

inhibition of UVB-induced apoptosis. Using an in situ TUNEL assay to detect the

presence of DNA fragmentation as a marker of apoptosis, keratinocytes undergoing

cell death post-irradiation were thus visualised and quantified. Figure 4.3 shows

TUNEL-positive keratinocytes detected in irradiated monolayers cultured using

different fibroblast co-culture conditions, as described in Figure 4.1. Using image

analysis software, the percentage of apoptotic cells per field under different culture

conditions were then determined and are represented in Figure 4.4.

A relatively low percentage of keratinocytes undergoing apoptosis was

observed in mock-irradiated controls in all the samples (1.04 ± 0.08%). In all the cell

monolayers exposed to 4 MED of UVB, however, keratinocyte nuclei containing

DNA fragmentation were detected at 24 hours post-irradiation, which represents a

characteristic cellular feature of late stage apoptosis (Cotton and Spandau, 1997).


The greatest ratio of TUNEL-positive cells was observed in keratinocytes cultured in

the absence of fibroblasts in SFM only (27.9 ± 12%) (Figure 4.3, Figure 4.4).


Figure 4.3. UVB-induced keratinocyte apoptosis in a 2D co-culture model

Apoptotic keratinocytes were detected using a TUNEL assay in Transwell® insert monolayers 24 hours after

exposure to a single dose of 4 MED UVB (B,C and D, left to right) and an non-irradiated control (A, left to

right). Images A, B and C show representative images of keratinocyte monolayers in different culture conditions

(as shown in Figure 4.1) labelled with the nuclear fluorescent label, DAPI (first column), cells treated with the

TUNEL reaction (second column) and the corresponding merged images (third column). Row B shows TUNEL-

positive keratinocytes from irradiated cultures grown in SFM only. Row C represents identical keratinocyte

cultures co-cultured in the presence of fibroblasts before the irradiation protocol. Row D shows apoptotic

keratinocytes in monolayers co-cultured with fibroblasts in the Transwell® system after UVB irradiation.

Fluorescence detected following the TUNEL reaction shows a localisation of DNA fragmentation within the cell

nuclei, as observed in the merged images. Images are representative of experiments conducted in triplicate from

three independent skin cell donors. The scale bar represents 50 µm.


Figure 4.4. Fibroblast co-culture inhibits apoptosis in irradiated keratinocyte monolayers

Apoptotic keratinocytes from irradiated Transwell® insert membranes in different co-culture conditions (Figure

4.3) were quantified. Data represents the mean number of TUNEL-positive keratinocytes counted per microscope

field. Keratinocytes were grown in SFM only (-Fib), with fibroblasts in the lower chamber of the Transwell®

(+Fib (Before)) or transferred to fibroblast co-culture conditions after irradiation (+Fib (After)). No significant

numbers of apoptotic cells were observed in non-irradiated controls in both co-culture (data not shown) and

single monolayer cultures of keratinocytes. Results shown are representative of experimental triplicates, from

experiments performed on cells from three independent donors. Asterisks represents statistical significance at

p<0.05. Error bars indicate SEM values.

In monolayers transferred to fibroblast co-culture conditions immediately

following the irradiation protocol, similar levels of keratinocyte apoptosis were

observed as those cultured only in SFM (24.8 ± 9.6%). However, in keratinocytes

grown in co-culture conditions with fibroblasts prior to their exposure to UVB

radiation, significantly fewer apoptotic cells were detected at this time-point (12.1 ±

4.3%).

These results paralleled those obtained in the cell viability assays performed in

the previous section, showing that fibroblast co-culture before cellular insult with

UVB radiation appears to have the greatest protective effect in terms of enhancing

keratinocyte survival. This is further supported by the observation that co-culture

with fibroblasts post-irradiation did not appear to have a significant effect on

inhibiting apoptosis following UVB-exposure. The activation of keratinocytes by

fibroblast-produced factors at the time of UVB-insult may therefore be critical in

Pe

rce

nta

ge

T

UN

EL

+ K

C/fi

eld

Non-ir

radia

ted

cont

rol

SFM +

UV

+ Fib

(bef

ore

UV)

+ Fib

(afte

r UV)

0

10

20

30

40

50

**


promoting cell survival and preventing widespread epidermal damage as a result of

increased keratinocyte apoptosis.

The induction of the apoptotic program involves several biochemical pathways

which eventually lead to hallmark morphological changes including cell shrinkage

and DNA fragmentation (Young, 1987; Hengartner, 1997a). The TUNEL assay is

useful in its ability to quantify DNA fragmentation as a measure of a late stage in the

apoptotic cascade, however, this morphological characteristic of apoptosis overlaps

with other cell death programs, including necrosis (Kerr, 1971; Gold et al., 1994).

The activation of these processes is heavily dependent on the sequential activation of

a class of cysteine-aspartic acid proteases known as caspases (Peter et al., 1997;

Zhang et al., 2000). Caspase-3, activated by both intrinsic and extrinsic apoptotic

pathways, is known as an executioner caspase and is a key mediator of UVB-induced

apoptosis upon its cleavage and subsequent activation (Taylor et al., 2008). To

further investigate the cell death pathway triggered by UVB exposure in these

irradiated keratinocytes, the presence of cleaved caspase-3 was detected using

immunofluorescence. Figure 4.5 shows images obtained from confocal microscopy

analysis, showing the expression of cleaved caspase-3 in Transwell®-cultured

keratinocytes as a result of UVB radiation exposure.


Figure 4.5. Detection of cleaved caspase-3 in irradiated keratinocyte monolayers

Cleaved caspase-3, an early cellular apoptotic marker, was detected in Transwell® insert monolayers 6 hours

after the exposure to a single dose of 4 MED UVB (B,C and D, left to right) and a non-irradiated control (A, left

to right). Images A, B and C show representative images of keratinocyte monolayers in different culture

conditions (as shown in Figure 4.1) labelled with the nuclear fluorescent label, DAPI (first column), labelled with

a fluorescently-labelled antibody to cleaved caspase-3 (second column) and the corresponding merged images

(third column). Row B shows keratinocytes from irradiated cultures grown in SFM only. Row C represents

identical keratinocyte cultures co-cultured in the presence of fibroblasts prior to the irradiation protocol. Row D

shows apoptotic keratinocytes in monolayers co-cultured with fibroblasts in the Transwell® system after UVB

irradiation. Images were obtained using confocal microscopy and are representative of three experiments

conducted using samples obtained from three independent skin cell donors. The scale bar represents 50 µm.

A

B

C

DAPI Cleaved caspase-3 Merged

Non-irradiated

control

6 hr

SFM

D

6 hr

+ Fib (after)

6 hr

+ Fib (before)


Keratinocyte monolayers were fixed 6 hours after exposure to a single dose of

4 MED UVB, as the cleaved caspase-3 is known to be detected in apoptotic cells

relatively earlier in the apoptotic cascade (Jänicke et al., 1998b). The activated form

of the caspase was not readily detected in non-irradiated keratinocyte monolayers,

including serum-starved cultures. Following UVB irradiation, however, cleaved

caspase-3 was observed to be present in all UVB-exposed cells. At 6 hours after

exposure, cleaved-caspase 3 was found to be most abundant in keratinocyte

monolayers cultured in SFM only, in the absence of fibroblast co-culture. This

activated caspase was observed to be mainly localised within the cytoplasmic regions

of the keratinocytes. In Transwell® monolayers transferred to fibroblast co-culture

conditions subsequent to UVB-exposure, similar levels of cleaved caspase-3 as those

present in SFM cultures were observed. Interestingly, caspase-3 appeared to be either

diffusely distributed in a granular manner throughout the cell cytoplasm, or

concentrated around the periphery of the cell in these samples. In the keratinocyte

cultures maintained in the presence of fibroblast co-culture prior to UVB treatment,

there was an appreciable decrease in the numbers of cleaved caspase-3-expressing

cells. Due to the cytoplasmic expression of cleaved caspase-3 and the apoptotic

morphology of irradiated keratinocytes, the quantification of cells expressing

activated caspase-3 could not be accurately performed, and was hence omitted.

Overall, the immunofluorescent analysis revealed that fibroblast co-culture

prior to cellular insult by UVB radiation resulted in the diminished expression of

cleaved-caspase 3 in irradiated keratinocyte monolayers. Taken together with a

similar effect observed in DNA fragmentation, as measured using the TUNEL assay,

this indicates that fibroblast-secreted factors may protect against UVB-induced

keratinocyte damage by inhibiting apoptosis.

4.3.4 Fibroblast co-culture and the removal of UVB-induced DNA dimers in

irradiated keratinocytes

In the previous section, it was demonstrated that keratinocyte viability and the

protection from apoptosis was enhanced by fibroblast co-culture before UVB

irradiation. The balance between cell survival and the initiation of cell death

pathways is known to be heavily influenced by the formation of DNA damage via

various environmental genotoxic agents, including UVR (Christmann et al., 2003;

Roos and Kaina, 2006). In the case of sub-lethal doses of UVB in particular, the


action of repair systems such as the NER, together with pro-survival signals, allow

for DNA damage to be effectively removed prior to the progression of the cell cycle

(Ahmed and Setlow, 1993). However, in the event of severe and unrepairable

damage to the cell’s genetic material, apoptosis, as part of the cellular stress

response, serves as a safety net to prevent oncogenic transformation (Christmann et

al., 2003). Hence, the removal of UVB-induced DNA dimers (in the form of CPDs)

was analysed in keratinocyte-fibroblast co-cultures to determine whether the pro-

survival effect observed in the previous section was related to an activation of DNA

repair mechanisms.

Using immunofluorescence, the presence of UVB-induced CPDs was

visualised in irradiated keratinocyte monolayers (Figure 4.6). The ratios of CPD-

positive keratinocytes within the keratinocyte population were determined using

image analysis, as detailed in 2.2.9. These keratinocyte cultures were maintained

under the different co-culture conditions as detailed previously (Figure 4.1).

Immediately after exposure, all keratinocyte nuclei in irradiated monolayers were

found to be positive for the presence of CPDs (Figure 4.6A). Keratinocytes cultured

on Transwell® inserts were probed for the presence of CPDs again at 24 hours post-

irradiation to monitor differences in the rate of CPD repair by keratinocyte DNA

repair mechanisms (Figure 4.6 B to D). The majority of UVB-induced CPDs have

been shown to be repaired during the initial 24 hours subsequent to UVB exposure in

vitro (Riou et al., 2004). Keratinocytes grown in SFM only appeared to contain the

greatest number of CPD-positive nuclei and the highest intensity of immuno-

reactivity detected at 24 hours post-irradiation, as compared to those from fibroblast

co-cultures (Figure 4.6B, Figure 4.7). At this time point, it was observed that

63.5±26.6% of the total keratinocyte population were still positive for CPDs.

Keratinocytes grown in the presence of fibroblasts before UVB-exposure were

demonstrated to have a significantly lower number of cells harbouring CPDs, as

compared to cells co-cultured after irradiation (21.5 ± 4.9% and 49.9 ± 9.9%

respectively) (Figure 4.7). This result strongly suggests that dermal fibroblasts not

only play an important role in protecting against UVB-induced cell death in

irradiated keratinocytes in vitro, but may also contribute to stimulation of DNA

repair pathways upon genotoxic insult.


Figure 4.6. Repair of CPD in irradiated keratinocyte monolayers in different culture conditions

The presence of CPD DNA dimers in irradiated Transwell® insert monolayers exposed to a single dose of 4

MED UVB were detected using immunofluorescence. Immediately following UVB exposure, the majority of

keratinocyte nuclei were positive for CPD photolesions, as shown in the representative image (A). 24 hours after

irradiation, keratinocyte monolayers cultured in SFM only (B), in fibroblast co-culture prior to irradiation (C) and

in co-culture post-irradiation (D) were probed for the presence of unrepaired CPDs. Images are representative of

experimental triplicates from experiments conducted on three independent skin cell donors. The scale bar

represents 50 µm.

A

B

DAPI CPD Merged

0 hr

(all treatments)

24 hr

SFM

D

24 hr

+ Fib (after)

C

24 hr

+ Fib (before)


Figure 4.7. Fibroblasts enhance repair in irradiated keratinocyte monolayers

The presence of UVB-induced CPDs was detected in irradiated keratinocyte monolayers grown in different

Transwell® co-culture conditions. Keratinocyte nuclei with DNA dimers were visualised using

immunofluorescence (as shown in Figure 4.6) and quantified using image analysis software. The percentages of

unrepaired CPD-positive keratinocyte nuclei at 24 hours under different culture conditions were normalised to

those observed at 0 hours post-irradiation. The results shown are representative of experimental triplicates

conducted on three experiments, each using independent skin cell donors. Asterisks represents statistical

significance at p<0.05. Error bars indicate SEM values.

Pe

rce

nta

ge

of C

PD

+ k

era

tino

cyte

s

UV 0 h

r

SFM +

UV

+ Fib

(bef

ore U

V)

+ Fib

(afte

r UV)

0

20

40

60

80

100 *

*

24 hr


Aim 2: Development and characterisation of a 3D HSE model to study

fibroblast-keratinocyte interactions during the UVB response.

In the previous section, a Transwell® co-culture technique was used to

demonstrate the effect of dermal fibroblasts on modulating keratinocyte survival and

repair following UVB-induced damage. The next aim was to investigate this

paracrine interaction during the acute UVB response using a 3D tissue-engineered

HSE-KCF model. This organotypic model consists of primary human dermal

fibroblasts incorporated into the DED component, with a stratified keratinocyte

epidermal layer. It was hypothesized that the HSE-KCF could be utilised to further

investigate the fibroblast-induced changes to keratinocyte photoresponses

(previously reported in 4.3.2, 4.3.3 and 4.3.4) in a 3D physiologically-relevant tissue

model.

4.3.5 Development and characterisation of the HSE-KCF skin model

An array of skin equivalent models composed of different combinations of

dermal and epidermal cell populations have been described as in vitro models for

studying paracrine interactions between these two distinct skin regions (Topol et al.,

1986; Hudon et al., 2003; Ng and Ikeda, 2011). As detailed in Chapter 3, the HSE-

KC model adopted by our laboratory has been characterised for its use in

photobiology studies. Fundamentally, this reconstituted skin model retains key

physiological elements of native skin known to influence the epidermal UVB

response, and shows similar markers of UVB-induced damage and subsequent

regeneration upon irradiation. Herein, I report the adaptation of this model to include

fibroblasts within the HSE-DED, in order to create an in vitro platform for studying

epidermal-dermal interactions during the UVB response.

Firstly, the protocol for seeding primary dermal fibroblasts and epidermal

keratinocytes on the DED scaffold required for the generation of the HSE-KC was

optimised. Dermal fibroblasts are known to possess the ability to migrate into the

collagen network of the dermis, a process vital for wound healing (Lin et al., 2005).

Accordingly, in vitro skin models incorporating fibroblast-populated collagen dermal

scaffolds have been extensively used (Rhee and Grinnell, 2007; Rhee, 2009; Ahn,

2010). However, the technique of reconstituting an ex vivo DED scaffold with

primary dermal fibroblasts has been relatively less well-documented (Lee and Cho,


2005). Therefore, for this study, various fibroblast-seeding methods were initially

analysed histologically to ensure successful incorporation of these cells at the

papillary dermal-epidermal junction.

Dermal fibroblasts were seeded onto either the reticular or the papillary surface

of the DED using different protocols to optimise the fibroblast-repopulation of this

scaffold (Figure 4.8 A to D). Firstly, fibroblasts were seeded onto the reticular DED

surface three days prior to the addition of keratinocytes on the papillary side (Figure

4.8A). The histological assessment of the resulting skin constructs revealed that

fibroblasts appeared to be concentrated around the deeper reticular layers of the

dermis. In these composites, it appeared that fibroblasts did not successfully migrate

superficially towards the epidermal-dermal junction (Figure 4.8A and B). It has been

previously demonstrated that papillary fibroblasts play a more significant role in

influencing epidermal behaviour through factors secreted across the BM at the

epidermal-dermal junction (Sorrell, 2004; Sorrell et al., 2007). In view of this, the

incorporation of fibroblasts into the papillary region of the DED was further

optimised.

Figure 4.8. Optimisation of fibroblast seeding in the construction of HSE-KCF

Different protocols for seeding fibroblasts into HSE-KCF composites were analysed histologically. Fibroblasts

were seeded on either the reticular surface (A and B) or the papillary surface (C and D) of the DED during HSE

construction, and samples analysed after 9 days of culture at the air-liquid interface. When fibroblasts were

seeded onto the reticular surface three days prior to keratinocyte seeding on the papillary surface, histology of

HSE sections shows fibroblasts (indicated by arrows) remained localised to the reticular region of the DED (A).

The epidermis appeared to be well-organised, though no fibroblasts appeared to be present at the dermal-

epidermal junction (B). Fibroblasts were seeded together with keratinocytes onto the papillary surface of the DED

(C). The histology of this composite shows a poorly-organised epidermis with a few dermal fibroblasts present

around the papillary surface of the DED. Fibroblasts seeded on the papillary surface 48 hours prior to the addition

of keratinocytes onto the same surface (as described in section 2.2.3) revealed a well-organised and stratified

epidermis, with fibroblasts present in the papillary region of the DED (D). Images from histological analyses are

representative of experimental triplicates conducted on three independent skin donors. The scale bar represents 50

µm.


Next, fibroblasts were seeded onto the papillary surface of the DED in order to

promote fibroblast infiltration into the papillary regions of the dermal component

(Figure 4.8C and D). Due to keratinocytes also being seeded on this surface of the

DED for the formation of the epidermis, two fibroblast and keratinocyte cell seeding

protocols were tested. The simultaneous addition of both cell types onto the papillary

surface showed histological evidence pointing towards cellular infiltration into the

papillary region of the DED (Figure 4.8 C). However, the histology of the constructs

produced using this protocol also showed a poorly-organised epidermal layer (Figure

4.8 C). Indeed, the separation of the epidermal layer from the supporting DED

scaffold was strongly indicative of poor basal keratinocyte attachment onto the

papillary surface of the scaffold. Furthermore, a well-defined differentiating gradient

of keratinocytes was not observed in these constructs. The failure of basal

keratinocytes to adequately attach to the DED indicated a potential degradation of

the BM by fibroblasts during their migration into the dermis.

To overcome this effect, fibroblasts were then seeded onto the papillary surface

three days prior to the subsequent addition of keratinocytes (Figure 4.8D). Using this

technique, it was hypothesized that migrating fibroblasts would be able to

sufficiently remodel the BM at the dermal-epidermal junction prior to the addition of

the keratinocytes, which would facilitate their attachment, proliferation and

differentiation, as reported previously (Smola et al., 1998; Ralston et al., 1999).

Histological sections from HSE-KCF constructed using this protocol showed a well-

organised, stratified epidermis, together with evidence of cellular migration into the

papillary regions of the DED (Figure 4.8D). Further characterisation of these

migrated cells was subsequently conducted to confirm the presence of fibroblasts

within the dermal component. This method was then employed for all successive

experiments utilising the HSE-KCF skin composites.

From the histological analysis of different fibroblast seeding protocols and

their associated impact on epidermogenesis, it can be suggested that BM remodelling

by fibroblasts may be a critical process during HSE-KCF formation. Hence, we

analysed components of the BM layer in the HSE-KCF composites using

immunohistochemistry to detect the expression of collagen IV in these skin

constructs (Figure 4.9). When compared to ex vivo native skin controls,

immunohistochemical analysis revealed similar patterns of collagen IV expression,


in particular at the dermal-epidermal junction and lining other elements of the dermis

such as blood vessels (Figure 4.9). The deposition of collagen IV at the BM zone by

infiltrating fibroblasts during the maturation of the HSE-KCF indicates that this

process may be integral in influencing formation of the HSE-KCF epidermis. Indeed,

several studies have demonstrated that collagen IV facilitates keratinocyte

attachment, proliferation and stratification in the developing epidermis both in vitro

and in vivo (Aumailley and Timpl, 1986; Krejci et al., 1991; Tinois et al., 1991).

Figure 4.9. Collagen IV expression in HSE-KCF and native skin

Collagen IV, a major component of the BM, was detected in tissue sections of HSE-KCF (A) and native skin (B)

using immunohistochemistry. Images from immunohistochemical analyses are representative of experimental

triplicates conducted on three independent skin donors. The scale bar represents 50 µm.

Next, the nature of the cells that repopulated the papillary region of the DED in

the HSE-KCF was characterised. Vimentin is ubiquitously expressed by

mesenchymal cells as an intermediate filament and serves primarily to maintain

cellular integrity (Satelli and Li, 2011). Hence, vimentin has been established as a

cellular marker of dermal fibroblasts in the characterisation of in vitro skin models

(El Ghalbzouri et al., 2002). Immunofluorescently-labelled tissue sections of ex vivo

native skin, HSE-KC and HSE-KCF reveal significantly higher levels of vimentin

expression in tissues containing fibroblasts in the dermal component (Figure 4.10).

The HSE-KCF showed similar vimentin expression levels to native skin which

appeared to be absent in the HSE-KC sections comprised of an acellular dermal

scaffold. This result provides further evidence for the successful incorporation of

fibroblasts into the DED using the HSE-KCF construction protocol described here.


Figure 4.10. Expression of vimentin in native skin and HSE composites

Sections of native skin (A), HSE-KC (B) and HSE-KCF (C) were probed with an immunofluorescent antibody to

the mesenchymal marker, vimentin (red fluorescence). The sections were counterstained with the DAPI nuclear

marker (blue fluorescence). Merged images show the localisation of vimentin within the dermis of native skin

and HSE-KCF tissues, but with a significantly lower staining intensity observed in the HSE-KC. Images from

immunofluorescent analyses are representative of experimental triplicates conducted on three independent skin

donors. The scale bar represents 50 µm.

Following the seeding of fibroblasts and keratinocytes onto the DED using the

abovementioned optimised protocol, the HSE-KCF constructs were maintained in

culture conditions prior to UVB irradiation as described in 2.2.3 and 2.2.5. Hence,

the histology of the mature HSE-KCF sampled at different time-points in culture

conditions was analysed (Figure 4.11). Initially, a stratified epidermis with well-

defined stratum corneum was observed, nine days after keratinocyte seeding and

subsequent culture at the air-liquid interface (Figure 4.11 A). Over the subsequent

five day period, a gradual thickening of the stratified keratinocyte layer, together

with the stratum corneum (stained in dark pink), was observed (Figure 4.11B to F).

The presence of fibroblasts in the DED was also detected, with haematoxylin-stained

DAPI Vimentin Merged

A

B

C


cell nuclei evident in the papillary regions. However, the numbers of migrated

fibroblasts within the dermis appeared to be variable between composites. Overall,

the histology of the HSE-KCF mirrored that of the HSE-KC model described

previously (Figure 3.1), and was thus utilised as an in vitro model for studying

keratinocyte-fibroblast interactions during the UVB response.

Figure 4.11. Histology of HSE-KCF in culture

Haematoxylin and eosin stained tissue sections of the HSE-KCF depict the histology of the HSE-KCF over five

days in culture. The HSE-KCF constructs were cultured at the air-liquid interface for nine days to promote the

formation and stratification of the epidermis. At this stage, the HSE-KCFs were found to have a differentiated

epidermis with a well-defined stratum corneum (A). In subsequent experiments, UVB treatments were applied at

this time point. Over the next five days in culture conditions (B to F), the HSE-KCFs showed a gradual

thickening of the stratified keratinocyte layer and the stratum corneum. Images from the histological analyses are

representative of experimental triplicates conducted on three independent skin donors. The scale bar represents 50

µm.


4.3.6 Characterisation of the UVB response in HSE-KCF

In the previous section, the HSE-KCF, a 3D organotypic model incorporating

cell-based dermal and epidermal components, was successfully established.

Henceforth, the potential fibroblast-induced modulation of keratinocyte responses to

UVB in the HSE-KCF model, as compared to those previously detailed in the HSE-

KC, were investigated. Specifically, the formation of characteristic UVB-damage

markers including CPD photolesions, apoptotic sunburn cells and the expression of

proinflammatory cytokines, were studied in the irradiated HSE-KCF constructs.

Additionally, the effect of fibroblasts in the HSE-KCF constructs on epidermal repair

and regeneration was also investigated.

The histological analysis of sections obtained from UVB-exposed HSE-KCF

constructs over a five day period post-irradiation is shown in Figure 4.12. During this

timeframe a gradual thickening of the stratum corneum is observed in the epidermis

of the irradiated HSE-KCFs (Figure 4.12A to F). At Day 2 after UVB treatment, a

decrease in the thickness of the viable keratinocyte layer in the epidermis is also

apparent, which shows a gradual regeneration from Day 3 onwards (Figure 4.12D to

F). Sections of the HSE-KCF sacrificed at Day 5 after UVB exposure show a

thickened stratum corneum with evidence of keratinocyte nuclei also present in this

epidermal layer. This may be attributed to the accelerated differentiation of

keratinocytes as part of the previously-described epidermal regenerative process

(Liu, 1996; Del Bino et al., 2004). Due to the absence of the natural sloughing of the

superficial layers of the epidermis in the in vitro HSE-KCF model, rapidly

differentiating cells may therefore become incorporated into the stratum corneum

during the post-irradiation blistering process. Overall, the histology of the UVB-

exposed HSE-KCF appeared to be aligned with previous experiments conducted

using the HSE-KC (Figure 3.2). Hence, further analyses were conducted to

characterise UVB responses in the HSE-KCF.


Figure 4.12. Histology of irradiated HSE-KCF

Images A to F represent tissue sections of irradiated HSE-KCF exposed to a single dose of 2 MED UVB and

sacrificed over a five-day period in culture. A gradual thickening of the stratum corneum layer (in dark pink) is

observed from Day 0 (A) to Day 5 (F) post-exposure. Images from the histological analyses are representative of

experimental triplicates conducted on three independent skin donors. The scale bar represents 50 µm.

Expression of proinflammatory cytokines by irradiated HSE-KCFs

The upregulation of IL-6 and IL-8 synthesis in keratinocytes following

erythemal doses of UVB has been linked to both local and systemic inflammatory

reactions commonly observed during the sunburn response (Kondo et al., 1993;

Petit-Frere et al., 1998). This response has also been previously reported using the

HSE-KC photobiology model (Figure 3.7). As a key marker of the epidermal

sunburn response, the production of IL-6 and IL-8 was also investigated in the

irradiated HSE-KCF culture model as reported herein.

The concentrations of these proinflammatory cytokines present in the cell

culture supernatants from irradiated HSE-KCF were analysed using an ELISA

quantification method, as described in 2.2.13 (Figure 4.13). Overall, relatively higher

levels of both IL-6 and IL-8 were present in cell culture medium samples obtained

from HSE-KCFs as compared to those previously reported from HSE-KC cultures

(Figure 3.7).


Figure 4.13. Quantification of IL-6 and IL-8 concentrations in HSE-KCF culture supernatants

Serum-free culture medium samples were obtained from HSE-KCF cultures at the 0 hour and 24 hour time points after 2 MED UVB irradiation. Quantification of IL-6 and IL-8 levels was

achieved using an ELISA immunoassay. Data represents the average quantities of IL-6 and IL-8 detected at the two time points (mean±SEM), in experimental triplicates from two experiments

conducted on two different skin donors, expressed in pg/mL. All measurements were normalised to total protein levels in culture supernatants. Asterisks represent statistical signifance (p<0.05)

in the difference from matched samples at t=0 hr. Error bars indicate the SEM values.


For example, mean concentrations of 67.0 ± 12.1 pg/mL IL-6 were detected in

medium from non-irradiated HSE-KCF cultures as compared to 2.37 ± 0.32 pg/mL

in those from HSE-KC cultures. In culture medium samples from the HSE-KCF

obtained 24 hours post-irradiation, both IL-6 and IL-8 showed significant increases

in concentration as compared to matched samples at the 0 hour time-point. In these

samples, a 12.7-fold and 10.5-fold increase in IL-6 and IL-8 concentrations,

respectively, were detected. These results suggest that the presence of fibroblasts in

the HSE-KCF may enhance the concentrations of these proinflammatory cytokines in

both non-irradiated and irradiated tissues.

Repair of CPDs in the irradiated HSE-KCF

The generation of nucleic CPDs is a cardinal feature of UVB-induced cell

damage and is generally used as a marker of cutaneous UVB damage in vivo

(Snellman et al., 2003; Courdavault et al., 2005; ten Berge et al., 2011).

Furthermore, the accumulation of genetic mutations associated with the formation of

these DNA lesions is strongly associated with the onset of skin cancers (Ravanat et

al., 2001). The generation and repair of CPDs in the HSE-KC photobiology model

was previously reported in this study (3.3.4, 3.3.8). Hence, these processes were

investigated using the HSE-KCF constructs to identify the impact of paracrine

signals from fibroblasts on the removal of UVB-induced photolesions on

keratinocytes.

Using immunohistochemistry, keratinocytes harbouring CPD damage were

positively identified in irradiated HSE-KCF (Figure 4.14). Papillary fibroblasts

situated near the BM zone border were also found to harbour nucleic CPD (Figure

4.14B). Immuno-labelled sections viewed at a higher magnification show the clear

localisation of CPDs within the nuclei of basal and suprabasal keratinocytes within

the epidermis of irradiated HSE-KCF (Figure 4.14 C).


Figure 4.14. UVB-induced formation of CPDs in HSE-KCF

UVB-induced CPDs were detected in HSE-KCF at 24 hours after UVB treatment using immunohistochemistry as

previously described. Non-irradiated control HSEs (A), HSE-KCF exposed to 2 MED of UVB (B) and irradiated

HSE-KCF at a higher magnification (C) are shown above. The presence of CPDs, indicated by brown immuno-

reactivity, was observed predominantly within the nuclei of basal and suprabasal cells of the epidermis and in

papillary fibroblasts near the dermal-epidermal junction. Images from the immunohistochemical analyses are

representative of experimental triplicates conducted on three independent skin donors. Black and red scale bars

represent 50 µm.

The presence of unrepaired CPDs in the HSE-KCF constructs was quantified

using image analysis as described previously (2.2.7 and 2.2.9). The percentages of

CPD-positive cells present in the HSE-KCF epidermis after UVB-exposure were

determined and compared to those previously obtained from HSE-KC cultures

(Figure 4.15). The initial numbers of keratinocytes containing CPDs immediately

after UVB irradiation did not differ significantly between the HSE-KC and HSE-

KCF. This suggests that that the presence of fibroblasts in the skin model did not

greatly influence the capacity for UVB to form photolesions in the HSE-KCF

epidermis. At 24 hours post-exposure, however, a significant drop in the proportion

of CPD-positive keratinocytes was observed in the HSE-KCF as compared to that in

the HSE-KC. This marked decrease in DNA-damaged keratinocytes relative to that

in the keratinocyte-only skin model continued at Day 2 and Day 3 after the UVB

treatment. At Days 4 and 5, no further difference was observed in the proportion of

CPD-positive cells between the two skin models. Importantly, the results obtained in

the investigation of CPD repair in the irradiated HSE-KCF mirror the responses

observed in the irradiated 2D co-culture models described in 4.3.4. The enhancement

of CPD removal in irradiated keratinocytes with the presence of fibroblasts in both

the cell monolayer and skin equivalent culture systems suggest that paracrine


signalling from the dermis may be critical in the activation and/or efficiency of DNA

repair mechanisms in epidermal cells.

Figure 4.15. Rate of CPD repair in irradiated HSE-KC and HSE-KCF

The proportions of CPD-positive keratinocytes in the epidermis of the irradiated HSE-KC and HSE-KCF culture

models were analysed using immunohistochemical detection followed by image analysis. The percentage of

CPD-positive cells per field (normalised to the total number of epidermal cells) are expressed over a period of 5

days post-irradiation. Data represents the average results from three independent experiments (each with

experimental triplicates) using cells obtained from three separate donors. Asterisks represent statistical

significance (p<0.05). The error bars represent SEM values.

Epidermal regeneration in the HSE-KCF

A complex balance of the induction of cell death and cycle arrest and the

opposing effects of cell survival and proliferation occur in UV-exposed skin (Ziegler,

1994; Young, 2006). While the precise regulators of this balance have yet to be fully

defined, post-irradiation epidermal hyperplasia is thought to be a consequence of the

activation of a variety of growth factor receptors and the actions of cytokines

(Rosette and Karin, 1996; Kuhn et al., 1999; Peus et al., 2000). These include

fibroblast-produced factors such as EGF, IGF-I and IL-1, which are thought to play a

role in maintaining the barrier function of the epidermis following UVB damage

(Rosette and Karin, 1996).

The Ki-67 protein is a cellular proliferation marker as it has been shown to be

expressed within the dividing cell’s nucleus during all active phases of the cell cycle

and mitosis (Heenen et al., 1998; Scholzen and Gerdes, 2000; Burcombe et al.,


Perc

enta

ge o

f C

PD

+ k

era

tinocyte

s

0 1 2 3 4 5

0

50

100

150

HSE-KC

HSE-KCF

*

*


2006). In the previous Chapter, shifts in the proportion of proliferating keratinocytes

within the HSE-KC model following UVB treatment were described (3.3.9). Herein,

the levels of keratinocyte proliferation in the HSE-KCF were analysed, to determine

the impact of fibroblasts on epidermal regeneration post-irradiation.

The HSE-KCF composites were exposed to either a 2 MED UVB or a mock

irradiation treatment before being returned to culture conditions and were

subsequently sacrificed daily during a five-day post-irradiation period (Figure 4.16).

It has previously been reported that the epidermis of in vitro skin models undergoes a

process similar to re-epithelialisation in vivo, in which a combination of basal

keratinocyte proliferation and differentiation occurs in the newly-formed epidermis

(Moll et al., 1998). Accordingly, non-irradiated control HSE-KCF samples revealed

keratinocytes expressing Ki-67 throughout this five-day period, with peak levels

observed at Day 2. In the UVB-exposed HSE-KCF constructs, however, a significant

decrease in the proportion of Ki-67-positive cells was observed at Day 1 and 2 after

UVB treatment, as compared to those in non-irradiated controls. From Day 3 to 5

after UVB irradiation, a rise in proliferating Ki-67-expressing keratinocytes was

observed, suggesting the active renewal of the UV-damaged epidermis during this

time. Interestingly, when compared to the levels of post-irradiation proliferation

previously observed in the HSE-KC (Figure 3.10), the HSE-KCF constructs showed

a significant reduction in Ki-67-expressing cells at Day 1 compared to matched non-

irradiated controls. In vivo, the majority of UVB-induced photolesions in

keratinocytes have been shown to be repaired within 24 hours of irradiation, before

which cell cycle checkpoints prevent the replication of unrepaired cells (Suzuki et

al., 1978; Xu et al., 2000). This suggests that fibroblast-secreted factors in the HSE-

KCF may aid in the regulation of the cell cycle in irradiated keratinocytes, by

delaying cell proliferation prior to complete DNA repair.


Figure 4.16. Effect of UVB on keratinocyte proliferation in the HSE-KCF

The number of proliferative keratinocytes were analysed via the detection of Ki-67 using immunohistochemistry.

Results shown are expressed as the average number of Ki-67-positive cells detected in ten microscope fields per

tissue section. Data represents the average results from three independent experiments using cells obtained from

three separate donors. Asterisks represent statistical significance (p<0.05). Error bars represent SEM values.

UVB-induced apoptosis in HSE-KCF

Most DNA photolesions, such as CPDs are efficiently removed by the NER

system, which acts as the first line of defence against permanent genetic alterations at

risk of being propagated to daughter cells (Sancar, 1995). Exposure to UVB also acts

as a physiological trigger for the induction of apoptosis which mainly occurs in the

proliferative basal layer in the epidermis (Qin et al., 2002). This complex process

involves the integration of multiple signals including direct DNA damage, cell

surface death receptors and oxidative stress (Lippens et al., 2009). The balance

between cell survival and death is thought to be influenced by the dose of UVB

applied, intracellular signalling, as well as various survival and death factors in the

keratinocyte microenvironment (Akunda et al., 2007; Claerhout et al., 2007; Lewis

and Spandau, 2008).

In this Chapter, the modulation of keratinocyte proliferation and the removal of

CPDs as a result of the presence of fibroblasts in the HSE-KCF skin culture model

(4.3.6) are reported. Next, changes to UVB-induced keratinocyte apoptosis

influenced by the fibroblast-populated DED as compared to the acellular DED

scaffold were investigated. To study this, the TUNEL assay, previously employed to


Ave

rage

Ki-6

7+ c

ells

/fiel

d

0 1 2 3 4 5

0

20

40

600 MED

2 MED

**


visualise sunburn cells in irradiated HSE-KC, was utilised (3.3.4). The presence of

TUNEL-positive apoptotic cells was detected in the irradiated HSE-KCF 24 hours

after UVB-exposure, predominantly in the epidermal layer (Figure 4.17A).

The presence of apoptotic cells in the HSE-KC and HSE-KCF was then

quantified over a five-day period following UVB treatment (Figure 4.17B). In the

HSE-KC, the formation of sunburn cells was detected as early as 6 hours post-

irradiation. The numbers of TUNEL-positive cells in these skin composites

subsequently increased, reaching a peak at around 24 hours post-irradiation. In the

HSE-KCF, a similar induction in keratinocyte apoptosis was observed from 6 hours

following UVB exposure, in which the incidence of sunburn cell formation was

found to be highest around the 12 to 24 hour time points. The presence of TUNEL-

positive cells in the HSE-KCF significantly decreased from Days 1 to 5 post-

irradiation. Interestingly, at 6 and 24 hours proceeding UVB treatment, a

significantly lower ratio of apoptotic keratinocytes was observed in the HSE-KCF as

opposed to that of the HSE-KC.

Overall, the presence of fibroblasts in these skin equivalent models results in

the inhibition of apoptosis in the first 24 hours after UVB irradiation. This

enhancement of cell survival after UVB exposure as a result of fibroblast co-culture

has also been observed in 2D Transwell® models, as described in 4.3.2 and 4.3.3.

This fibroblast-mediated enhancement of epithelial cell survival has been described

in a variety of in vitro studies (Tseng et al., 1996; Houchen et al., 1999). Notably,

however, the results from this study report for the first time the use of this HSE-KCF

skin model to study the effects of fibroblast-produced factors on the responses of

irradiated human keratinocytes in a biologically-similar epidermis.


Figure 4.17. Keratinocyte apoptosis in irradiated HSE-KC and HSE-KCF following UVB irradiation.

Apoptotic keratinocytes were detected in HSE-KCF, 24 hours following a single exposure of 2 MED UVB (A).

In the first column, blue fluorescence (DAPI) indicates keratinocytes in the epidermis and fibroblasts in the

dermal component. The second column shows TUNEL positive cells, indicated by the presence of green

fluorescence. The white dotted line indicates the epidermal-dermal junction in the skin equivalents. Yellow lines

indicate the scale of 50 µm. The presence of apoptotic keratinocytes post-UVB irradiation were detected and

counted using the TUNEL assay (B). The average number of TUNEL-positive cells per field (normalised to the

total number of basal epidermal cells) are expressed over time (in hours) post-irradiation. Keratinocytes in the

HSE-KCF show a decreased incidence of UVB-induced apoptosis, with significantly fewer TUNEL-positive cells

being observed in these composites at 6 and 24 hours following a single dose of 2 MED UVB. The presence of

apoptotic keratinocytes was predominantly detected between 6 and 48 hours post-irradiation. In non-irradiated

controls of both HSE constructs, no significant numbers of TUNEL-positive cells were detected (data not shown).

Data represents the average results from three independent experiments (each with samples in triplicate) using

cells obtained from three separate donors. Asterisks represent statistical significance (p<0.05). Error bars

represent SEM values.


Aim 3: Identification of molecular mediators associated with fibroblast-

induced modulation of keratinocyte responses to UVB

4.3.7 Mechanism of fibroblast-induced keratinocyte survival post-irradiation

To further characterise the mechanism behind fibroblast-induced keratinocyte

survival, we used antibody arrays pre-bound with antibodies against central players

in the major apoptotic pathways. These included the total and phosphorylated Bcl-2-

associated death promoter (Bad), cleaved poly (ADP-ribose) polymerase (PARP) and

cleaved caspase-3. To determine the effect of fibroblasts on the expression of these

factors in keratinocytes, HSE-KC and HSE-KCF were exposed to a single dose of 2

MED UVB. At various time points in the first 24 hours post-irradiation, the

epidermis was separated from the composites and keratinocytes lysed, as described

in 2.2.20. These cell lysates were then probed for the above-mentioned apoptotic

markers using a sandwich ELISA-based assay as per the protocol outlined in 4.2.13.

Bad is an intracellular pro-apoptotic protein belonging to the Bcl-2 family

(Reed, 1998). The formation of a complex between Bad, Bcl-2 and Bcl-xL has been

shown to enhance the release of cytochrome c from the mitochondria, thus initiating

apoptosis via the action of Bax and Bak proteins (Gajewski and Thompson, 1996).

Phosphorylation of Bad at serine 112, on the other hand, inhibits binding to the Bcl-

2/Bcl-x complex, which, in the absence of Bad, produces anti-apoptotic effects,

through blocking cytochrome-c release from mitochondria (Hengartner, 1997b). A

number of cell survival factors, such as EGF, IGF-I, IL-3 and TGF-β1 induce the

phosphorylation of Bad at serine residues 112 and 136, which both have been shown

to be instrumental in signalling cell survival (Zha et al., 1996; Schurmann et al.,

2000; Zhu et al., 2002).

The relative expression of Bad in irradiated HSE-KC and HSE-KCF

composites was therefore analysed to detect potential differences in the presence of

this central apoptosis-regulator following UVB exposure. Figure 4.18 (A) shows

relative expression levels of Bad in irradiated and control HSE composites. No

significant differences in total Bad levels were observed in mock-irradiated controls,

as well as UVB-treated HSE constructs at the 3 and 6 hour post-irradiation time-

points. At 24 hours following their exposure to UVB, however, there were

significantly lower levels (p<0.01) of Bad present in the HSE-KCF, as compared to


that of the HSE-KC. This indicates that the inhibition of keratinocyte apoptosis

observed in HSE-KCF (Figure 4.17) may be attributed to decreased levels of Bad as

a result of fibroblast-secreted factors.

To further confirm this, the relative amounts of phosphorylated Bad (at serine

112) were also measured in these samples. Results from Figure 4.18 (B) show similar

relative quantities of phospho-Bad in HSE composites with and without fibroblasts in

the mock-irradiated samples, as well as those sacrificed 3 hours after UVB exposure.

However, at the later time-points, the levels of phospho-Bad in the irradiated HSE-

KC appeared to decline, while those of the HSE-KCF increased with time. This

resulted in significantly higher levels of phospho-Bad in keratinocyte cell lysates

from the HSE-KCF, as compared to those in the HSE-KC (p<0.05). Since the

phosphorylation of Bad at this particular residue is critical for maintaining cell

survival, the elevated phospho-Bad observed in the HSE-KCF indicates that this may

be a mechanism by which fibroblasts exert anti-apoptotic effects in irradiated

keratinocytes.

Figure 4.18. Relative expression of Bad and phosphorylated-Bad in irradiated HSE-KC and HSE-KCF

The relative levels of total Bad (A) and phosphorylated-Bad (B) apoptotic proteins in irradiated and non-

irradiated controls of HSE-KC and HSE-KCF were measured using a sandwich ELISA antibody assay. HSE-KC

and HSE-KCF were exposed to a single dose of 2 MED UVB or to a mock irradiation in the control samples. The

HSE composites were sacrificed at 3, 6 and 24 hours post-irradiation and epidermal cell lysates obtained. Equal

quantities of total keratinocyte lysates (based on protein concentration) were added to 96-well plates pre-bound

with antibodies against human Bad (A) or Bad phosphorylated at serine 112 (B). Measured absorbances indicate

relative levels of target antigens in cell lysates samples. Statistical significance of p<0.05 is represented by ‘*’,

while p<0.01 is denoted by ‘#’. The results represent mean values from experiments performed in triplicate, each

using samples obtained from independent skin donors. Error bars represent SEM values.


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.2

0.4

0.6

0.8

1.0

#


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.2

0.4

0.6

0.8

1.0 HSE-KC

HSE-KCF

**

A B


The nuclear enzyme PARP has been shown to strongly bind to DNA strand

breaks occurring as a result of environmental stress, thus being an important

mediator of DNA repair (Satoh and Lindahl, 1992). The cleavage of PARP into the

89 and 24 kDa fragments by caspases, such as caspase-3, has been shown to inhibit

DNA repair and facilitate cellular apoptosis (Boulares et al., 1999). Using an ELISA

targeted against the large (89 kDa) fragment of cleaved PARP, I aimed to identify

differences in the relative levels of this protein fragment between HSE-KC and HSE-

KCF as a measure of apoptotic activity. In Figure 4.19, the relative levels of cleaved

PARP detected in epidermal cell lysates from these two composite types are shown.

At the 3, 6 and 24 hour time points after irradiation, there appears to be a slight

increase in the detected cleaved PARP fragment in the irradiated HSE-KC, as

compared to the unexposed samples. Matched samples from the irradiated HSE-

KCF, however, did not show a significant deviation from the non-irradiated controls.

Also, while there was a trend towards relatively lower levels of the PARP fragment

over all these time-points in the HSE-KCF in relation to the HSE-KC samples, this

difference did not prove to be statistically significant.

As previously described, caspase-3 is cleaved downstream of caspase-8,9 and

10, thus catalysing the cleavage of several essential cellular proteins (Porter and

Janicke, 1999). This caspase belongs to the family of downstream or executioner

caspases and along with caspases 6 and 7 is widely thought to be responsible for the

actual destruction of the cell during apoptosis (Slee et al., 2001). The PARP enzyme

is a substrate for cleavage (but not exclusively) by caspase-3, along with other

proteins critical to the apoptotic cascade such as α-fodrin and the DNA fragmentation

factor (Jänicke et al., 1998a).


Figure 4.19. Relative expressions of cleaved PARP in irradiated HSE-KC and HSE-KCF

The relative levels of cleaved PARP were detected in irradiated and non-irradiated controls of HSE-KC and HSE-

KCF and quantified using a sandwich ELISA antibody assay. The HSE-KC and HSE-KCF constructs were

exposed to a single dose of 2 MED UVB (coloured bars), or a sham irradiation treatment (black bars). The HSE

composites were then sacrificed at 3, 6 and 24 hours post-irradiation and epidermal cell lysates obtained. Equal

quantities of total keratinocyte lysates (based on protein concentration) were added to 96-well plates pre-bound

with antibodies against the 89 kDa fragment of human cleaved PARP. Measured absorbances indicate relative

levels of target antigens in cell lysates samples. The results represent mean values from experiments performed in

triplicate, each using samples obtained from independent skin donors. Error bars represent the calculated SEM.

Previously, it was demonstrated that fibroblast-keratinocyte co-culture prior to

UVB irradiation diminished levels of cleaved caspase-3 in keratinocytes (Figure 4.5).

Keratinocyte cell lysates from UVB-exposed HSE-KC and HSE-KCF were also

probed for the presence of this caspase using an ELISA. Figure 4.20 shows the

relative levels of cleaved caspase-3 detected in these composites from control

samples, as well as irradiated HSEs, sampled at 3, 6 and 24 hours post-irradiation. In

the HSE-KCF samples, no appreciable differences in the levels of cleaved caspase-3

were detected in the first 24 hours, as compared to the non-irradiated controls. The

samples obtained from the HSE-KC, however, showed a steady incline from the

levels detected in the sham-irradiated samples, which peaked at 24 hours post-UVB

exposure. At this time point, the difference between the cleaved caspase-3 levels in

the HSE-KC and the HSE-KCF was found to be statistically significant (p<0.05).


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.2

0.4

0.6

0.8

1.0 HSE-KC

HSE-KCF


Figure 4.20. Relative expressions of cleaved caspase-3 in irradiated HSE-KC and HSE-KCF

The relative levels of cleaved caspase-3 were detected and quantified in irradiated and non-irradiated controls of

HSE-KC and HSE-KCF using a sandwich ELISA antibody assay. The HSE-KC and HSE-KCF constructs were

exposed to a single dose of 2 MED UVB (coloured bars), or a sham irradiation treatment (black bars). The HSE

composites were then sacrificed at 3, 6 and 24 hours post-irradiation, followed by the extraction of epidermal cell

lysates from these skin equivalents. Equal quantities of total keratinocyte lysates (based on protein concentration)

were added to 96-well plates pre-bound with antibodies against the large fragment (17/19 kDa) of activated

caspase-3, formed as a result of cleavage adjacent to the Asp175 site. Measured absorbances indicate relative

levels of target antigens in cell lysates samples. Statistical significance of p<0.05 is represented by ‘*’. The

results represent mean values from experiments performed in triplicate, each using samples obtained from

independent skin donors. Error bars represent the calculated SEM.


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.2

0.4

0.6

0.8

1.0 HSE-KC

HSE-KCF*


4.3.8 Fibroblast-induced regulation of p53 in irradiated keratinocytes

The p53 tumour suppressor protein has long been established as being an

integral component in starting and propagating cellular photoresponses via the

activation of DNA repair, growth arrest and apoptotic pathways (Benchimol et al.,

1982; Ananthaswamy and Kanjilal, 1996; Lozano and Elledge, 2000; Caulin, 2007;

Cui, 2007). In vitro, this 53 kDa phospho-nucleoprotein has been shown to be

expressed in keratinocytes in a UVB dose and time-dependent manner, with its

expression levels known to be influenced by factors such as the surrounding ECM

and the differentiation status of the cell (Cotton and Spandau, 1997; Kumar et al.,

1999). Upon UVB-induced damage, p53 proteins are stabilised and activated via a

phosphorylation-mediated disruption of the inactive MDM2-p53 complex and

subsequently translocate to the nucleus (Hall et al., 1993; Matsumura and

Ananthaswamy, 2002). Depending on the cell and environmental stressor type,

increases and reductions in p53 mRNA and protein levels have been observed

experimentally following cellular insult (Reich and Levine, 1984; Fritsche et al.,

1993).

Based on the modulation of many known p53-mediated UVB response

processes between HSE-KC and HSE-KCF, the next aim of this study was to

investigate changes to p53 expression on both gene and protein levels, as well as its

activation via phosphorylation in these irradiated skin constructs. Firstly, p53

expression analysis was performed on irradiated and control HSE composites using

qRT-PCR. The mRNA levels of p53 in the HSE-KC, expressed relative to samples

from the HSE-KCF constructs, are represented in Figure 4.21. The expression of this

gene in the non-irradiated controls and at the 3 hour post-irradiation time point

showed no significant difference between the two HSE types. Interestingly, however,

at the 6 and 24 hour time points, an average of about a 500 and 280-fold upregulation

in p53 expression, respectively, was observed in the HSE-KC relative to the HSE-

KCF. This significant alteration in p53 expression levels in the irradiated skin

composites lacking dermal fibroblasts strongly suggests a marked shift in the p53-

mediated response to UVB in these constructs.


Figure 4.21. Relative expression of p53 in HSE-KC and HSE-KCF after UVB irradiation.

The relative post-irradiation gene expression of p53 in HSE-KC constructs was determined using qRT-PCR,

normalised to matched data observed in the HSE-KCF. Data shows changes in p53 expression in the non-

irradiated control skin composites, as well as from HSE-KC and HSE-KCF harvested at 3, 6 and 24 hours after

their exposure to a single dose of 2 MED UVB. A significant upregulation in p53 expression in HSE-KC was

found to take place at the 6 and 24 hour time points, as compared to that in the HSE-KCF samples. At these time

points, an average of about a 500-fold and 280-fold upregulation of p53 was observed at the 6 and 24 hour time

points, respectively. The dotted line indicates a 1.8-fold difference to the control. The results represent mean

values from experiments performed in triplicate, each using triplicate samples obtained from independent skin

donors. Asterisks represent statistical significance (p<0.05). Error bars represent SEM values.

Following the discovery of altered p53 mRNA levels in the HSE-KC as

compared to the HSE-KCF using qRT-PCR, the next aim was to validate this result

using protein quantification methods. Firstly, the total amount of p53 was measured

in epidermal cell lysates from these two HSE types using a sandwich ELISA (with a

pre-bound polyclonal antibody against human p53) and Western blot (using a

monoclonal antibody specific for an epitope between the N-terminal amino acids 37

and 45 in p53) (Figure 4.22 A and B). From the p53 ELISA, it was observed that the

total p53 detected in HSE-KC keratinocyte lysates appeared to be raised slightly at

all the post-irradiation time-points (as compared to that in the controls). In the HSE-

KCF, however, an elevation in relative p53 levels from the non-irradiated control

Time post-irradiation (hr)

Re

lativ

e g

ene

exp

ressio

np

53

Control 3 6 240.1

1

10

100

1000

HSE-KCFHSE-KC

**


was seen at 3 hours after UVB exposure, which progressively diminished at the 6 and

24 hour marks. At the 6 and 24 hour post-irradiation time points, the HSE-KC

composites showed significantly raised p53 levels in relation to those in the HSE-

KCF (p<0.05, p<0.01, respectively). The Western blot using a monoclonal p53

antibody showed similar levels of p53 at 3 and 6 hour post-irradiation and between

the two irradiated skin constructs (Figure 4.22B). However, in contrast to the ELISA

results, the HSE-KCF showed slightly elevated p53 levels, as compared to that of

HSE-KC, at 24 hours and in non-irradiated controls.

The phosphorylation of p53 at key serine sites is thought to be a critical process

in its stabilisation and subsequent activation (Jimenez et al., 1999; Ljungman, 2000).

Therefore, the relative proportions of phospho-p53 were analysed between the HSE-

KC and HSE-KCF cell lysates using an ELISA (pre-bound with an antibody against

p53 phosphorylated at serine 15) (Figure 4.22C). The levels of phospho-p53 were

noted as being relatively similar between the irradiated HSE-KC and HSE-KCF

samples at the 3 and 6 hour points. At 24 hours, a drop in phospho-p53 was seen in

both skin equivalents, with significantly higher levels seen in the HSE-KCF.


Figure 4.22. Relative levels of p53 protein in irradiated HSE-KC and HSE-KCF composites

The relative protein expression of total p53 in irradiated HSE-KC and HSE-KCF from epidermal cell lysates was assayed using an ELISA (A) and validated using Western blot analysis (B).

Samples were sacrificed at different time points post-irradiation and epidermal cell lysates obtained. Equal quantities of total keratinocyte lysates from irradiated and control (non-irradiated)

HSE constructs (based on protein concentration) were probed with antibodies against human p53. Activated p53 was analysed using an ELISA assay for p53 phosphorylated at serine 15 (C). In

the ELISA assays, measured absorbances indicate relative levels of target antigens in cell lysates samples. Statistical significance of p<0.05 is represented by ‘*’, while p<0.01 is denoted by ‘#’.

The results represent mean values from experiments performed in triplicate, each using triplicate samples obtained from independent skin donors. Error bars represent SEM values.


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.1

0.2

0.3

0.4

0.5

*


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.1

0.2

0.3

0.4

0.5HSE-KC

HSE-KCF*

#


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.1

0.2

0.3

0.4

0.5


Ab

so

rban

ce (

450 n

m)

Contr

ol3

hr6

hr

24 h

r

0.0

0.1

0.2

0.3

0.4

0.5HSE-KC

HSE-KCF*

#

Total p53 Phospho-p53A C

B


4.4 DISCUSSION

A wide range of developmental, homeostatic and disease processes in skin that

are influenced by fibroblast-keratinocyte interactions have been identified, ranging

from wound healing to psoriasis (Schultz et al., 1987; Priestley and Lord, 1990; Wu

et al., 1996; Maas-Szabowski et al., 2000; Ghahary and Ghaffari, 2007). The full

significance of these epithelial-mesenchymal interactions in the cutaneous UV-

response, however, still requires further investigation. The study reported herein

describes for the first time the use of two in vitro systems to model these paracrine

interactions experimentally. The Transwell® co-culture technique and the 3D HSE-

KCF skin model were successfully utilised in the identification of key fibroblast-

mediated influences on keratinocyte responses to UVB in the acute phase.

Importantly, dermal fibroblasts were shown in this Chapter to influence keratinocyte

survival, apoptosis and the repair of UVB-induced DNA damage in these models, all

of which are processes playing central roles in photocarcinogenesis (Black et al.,

1997; Claerhout et al., 2006). Furthermore, the presence of fibroblasts in the

keratinocyte culture system modulated the activation of p53, a central regulator of

the normal cellular response to UVB exposure. Overall, these results strongly suggest

that fibroblast-secreted factors may play a critical role in regulating the epidermal

photoresponse and determining cellular fate following UVB irradiation.

In vitro models for studying dermal-epidermal interactions

Studies into the cellular processes surrounding the epidermal response to UVB

have employed numerous experimental models, from organotypic skin constructs to

elegant transgenic mouse models (Nakazawa, 1998; Duval et al., 2003; Noonan et

al., 2003; Duval et al., 2012). Indeed, such investigations have shed light on a

multitude of biological pathways involved in acute and chronic photodamage and the

risk of oncogenic transformation in the epidermis. Nonetheless, physiologically-

relevant in vitro models with the flexibility to incorporate various primary human

skin cell types are still limited in the study of paracrine interactions occurring during

the UV response. Conventional 2D primary keratinocyte monolayer models may not

be suitable for this application as they are commonly cultured together with a mouse

fibroblast feeder layer, thus diverging from physiological conditions in vivo, in which

these cell populations exist in different skin regions, separated by the BM

(Rheinwald, 1975; Alitalo et al., 1982).


To address this limitation of traditional keratinocyte cell culture methods, the

application of a two-tiered culture system was employed to study cellular interactions

between human keratinocytes and fibroblasts. Indeed, emerging technologies such as

this Transwell® co-culture system can provide a versatile tool for investigating

paracrine interactions between two distinct cell populations, with several advantages

over other experimental skin models. Firstly, the permeable membrane separating

these two cell monolayers allows for the easy visualisation of the cells seeded on its

surface using various imaging techniques (Kandyba et al., 2008). Thus, the need for

time-consuming histological and immunohistochemical techniques required for

whole tissue samples is negated using such models. Next, the detachable cell culture

inserts in this system can be easily moved for the purpose of UV irradiation, or to be

transferred to different culture or treatment condition. Moreover, keratinocyte

monolayers on the membrane inserts can be cultured at the air-liquid interface to

promote the formation of a stratified epidermis, which more closely mimics the in

vivo situation (Fartasch and Ponec, 1994; Parnigotto et al., 1998; Ng and Ikeda,

2011). Limitations associated with some skin equivalent models, such as the

requirement for relatively larger amounts of donor skin tissue, the longer processing

and culture times and bigger volumes of cell culture medium, are reduced using the

Transwell® culture system. Importantly, keratinocytes cultured in this system have

previously been shown to possess cellular properties that paralleled the in vivo

situation in terms of their morphology, proliferative capacity and differentiation

patterns (Kandyba et al., 2008).

Previous studies have proposed that dermal fibroblasts may be central in

influencing the activation of UV stress responses in keratinocytes (Lewis et al.,

2008; Kovacs et al., 2009; Lewis et al., 2010). However, the nature of these

interactions, in terms of whether fibroblasts exert a protective effect on keratinocytes

prior to UVB insult, or aid in triggering post-irradiation repair mechanisms, is still

unclear. The Transwell® culture system utilized in this study provided a highly-

advantageous tool for examining these effects, with the potential to easily manipulate

keratinocyte culture conditions prior to and after irradiation. Significantly, it was

observed that fibroblast co-culture with keratinocytes before UVB treatment was

most effective at protecting against apoptosis and the overall reduction in

keratinocyte viability (Figure 4.2B, Figure 4.4 Figure 4.5). This observation suggests


that the activation status of keratinocytes by fibroblast-secreted factors at the time of

UVB exposure may be critical in determining the efficacy of downstream survival

post-irradiation. Notably, a similar effect has been observed in related in vivo studies,

with growth factors produced by fibroblasts shown to protect cells of the salivary

gland epithelium from radiation-induced apoptosis (Grundmann et al., 2010). In

addition to this pro-survival effect, a significant enhancement of CPD photolesion

repair was observed in keratinocyte monolayers cultured in fibroblast conditioned

medium before being exposed to UVB (Figure 4.7). The stimulation and activation

of DNA repair processes following genotoxic insult via the action of secreted factors

has also been demonstrated experimentally in a variety of other tissue types (Wu et

al., 1998; Huang and Harari, 2000; Kanamoto et al., 2002). Besides epithelial-

mesenchymal signals that can augment repair responses, studies demonstrate that α-

MSH (acting via autocrine and paracrine mechanisms) also greatly improves the

removal of DNA damage in UV-exposed keratinocytes (Dong et al., 2010). Overall,

the data obtained in this study further supports these previously-documented studies

showing a clear link between mesenchymal and epithelial cell populations during

regeneration.

Skin equivalent models have been widely used in a diverse range of cutaneous

biology studies, as an alternative to 2D cell culture and animal models (Nakazawa et

al., 1997; Bernerd and Asselineau, 2008; Egles et al., 2010). Fundamentally, such

tissue-engineered organotypic skin models have been shown to more accurately

represent structural and physiological aspects of native skin over submerged

monolayer cultures (Prunieras et al., 1983; Rosdy and Clauss, 1990). In the previous

Chapter, the use of a HSE-KC 3D skin photobiology model was validated and was

shown to retain several important morphological and biological features of human

skin. In Chapter 4, this tissue-engineered skin construct was further developed

through the addition of primary dermal fibroblasts into the DED component of this

model. Hence, it was hypothesized that this HSE-KCF model could then be applied

to studying how dermal-epidermal interactions influence key keratinocyte UVB

responses in the epidermis.

Studies into the optimal method for HSE-KCF construction reveal fibroblasts

seeded onto the papillary surface of the DED, followed by the subsequent addition of

primary keratinocytes, achieves the best result in terms of fibroblast migration into


the DED and epidermal morphogenesis (Figure 4.8). This is further supported by the

expression of the mesenchymal tissue marker, vimentin, in the DED of HSE-KCF

constructs (Figure 4.10). Histological analysis suggests that fibroblasts may migrate

into the dermal compartment by remodelling the BM layer. This represents a process

occurring in vivo during wound-healing, in which activated fibroblasts migrate into

the wound bed while producing an abundance of ECM factors and proteases required

for remodelling the healing tissue (Abraham et al., 2007). Additionally, it was

observed that upon maturation of the HSE-KCF by culture at the air-liquid interface,

the BM zone at the epidermal-dermal junction was found to be comparable with that

of native skin immunohistochemically (Figure 4.9). Indeed, it has been shown that

certain sub-populations of fibroblasts work in conjunction with epidermal cells to

assemble the BM during skin regeneration (Marinkovich et al., 1993). However,

despite fibroblast infiltration into the DED, inconsistencies associated with the

incorporation of cells into the HSE-KCF remained an issue (Figure 4.11). This may

be due to individual variations in the ex vivo DED tissue between skin donors, or

differences in the sub-type of isolated fibroblasts, which may account for a

diminished migratory capacity. To counteract this effect, alternative approaches such

as the use of a DED scaffold in conjunction with a fibroblast-populated synthetic

collagen layer can be employed in future to increase consistency of the dermal layer

within in vitro skin equivalents (Lee et al., 2000; Lee and Cho, 2005; Rhee, 2009;

Ahn, 2010). However, dermal contraction and tissue instability has been reported

with the use of synthetic collagen scaffolds (Bell et al., 1979). Alternatively, a

centrifugal fibroblast seeding technique as described by El Ghalbzouri and

colleagues (2002) may aid in enhancing the reproducibility of fibroblast

incorporation into the DED. Moreover, further characterisation of the fibroblasts

within the DED needs to be conducted, as the dermis in vivo is known to contain a

heterogeneous population of fibroblastic cells (Sorrell, 2004; Sorrell et al., 2007).

The HSE-KCF represents a novel and versatile tool for mapping epithelial-

mesenchymal interactions during the UVB response, with the potential to be

improved via the incorporation of a range of cutaneous cell populations. Importantly,

the HSE-KCF can be utilized as an in vitro experimental model to be used as an

alternative to in vivo studies in human volunteers or animal models (Quan et al.,

2004). Potentially, for example, primary skin cells cultured from a diverse range of


donors, such as those with specific skin pathologies or an increased risk of cancer

development can be incorporated into this model to identify pathways leading to

photocarcinogenesis. Likewise, various other radiation sources, such as solar-

simulated UVR, can be used to gain a more accurate picture of how environmental

sources of radiation impact the skin. Pigment-producing melanocytes are paramount

in the protection of keratinocytes against the damaging effects of UVB radiation

(Yaar and Gilchrest, 1991; Yamaguchi et al., 2007). Thereupon, the addition of

epidermal melanocytes into the HSE-KCF model in future would produce a more

robust skin model for understanding the mechanisms involved in the keratinocyte

photoresponse. To date, numerous pigmented organotypic skin models have been

described, with mixed results in terms of their congruence to the in vivo situation

(Bertaux et al., 1988; Todd et al., 1993; Nakazawa et al., 1997; Lee et al., 2007;

Duval et al., 2012). However, the intricate biology of the epidermal melanocyte unit

and the complex regulation of melanocyte proliferation and activity still represents

an ongoing challenge to model in vitro (Halaban, 2000; Czajkowski, 2011).

Conceivably, paracrine signals from fibroblast and keratinocyte populations, as well

as the preservation of essential elements of the BM in the melanocyte

microenvironment, may be favourable in the future development of a pigmented

HSE-KCF skin model (Scott and Haake, 1991).

Enhancement of keratinocyte survival post-irradiation by fibroblasts

The analysis of irradiated HSE-KCF composites reported herein revealed

several important modes by which fibroblasts are capable of enhancing cellular

survival and the regeneration of the epidermis after UVB exposure. In parallel with

the data obtained from 2D co-culture studies, keratinocytes in the UVB-treated HSE-

KCF constructs were observed to be more resistant to apoptosis and showed

accelerated rates of CPD removal compared to those in the HSE-KC (Figure 4.17

and Figure 4.15). The inhibition of cell death pathways in the epidermis HSE-KCF

was most pronounced during the first 24 hours following irradiation, a critical period

in which the majority of many types of photolesions are repaired by DNA repair

machinery (Ruven et al., 1993; You et al., 2001; Zheng et al., 2001; Snellman et al.,

2003). In similar HSE-KC constructs lacking fibroblasts, however, both significant

increases in TUNEL-positive epidermal cells, as well as the proportion of CPD-

positive keratinocytes, were observed during this time period. This further reinforces


the importance of epidermal-dermal interactions in maintaining the functionality and

integrity of the epidermis in the acute phase following UVB exposure.

Sunburn as a result of UVR exposure is a characteristic clinical response to

erythemal doses of UVB (Young, 2006). Direct DNA damage in the epidermis is

thought to be an important activator of this UVR-induced inflammation, with the

production of cytokines being pivotal in initiating this response (Enk et al., 1995;

Krutmann and Grewe, 1995; Brink et al., 2000a; Grandjean-Laquerriere et al., 2003).

The elevated expression of these cytokines in response to UVB has also been

observed both in vivo and in various skin models in vitro (Urbanski et al., 1990;

Kondo et al., 1993; de Vos et al., 1994; Bechetoille et al., 2007; Yoshizumi et al.,

2008).

In Chapter 3, it was reported that UVB radiation initiated the upregulated

expression of the inflammatory cytokines IL-6 and IL-8 in the HSE-KC model

(Figure 3.7). Herein, it was observed from the quantification of these cytokines in the

cell culture culture medium from HSE-KCF constructs, that UVB treatment

significantly increased the levels of both IL-6 and IL-8 (Figure 4.13). Notably, the

detected levels of both these cytokines were also relatively higher than those detected

from the UVB-treated HSE-KC. This may be in line with studies that have shown

paracrine signals from the epidermis stimulate the secretion of IL-6 and IL-8 by

dermal fibroblasts (Boxman et al., 1996). Indeed, responses in keratinocytes to

external stimuli have been shown to induce the production of pro-inflammatory

cytokines in fibroblasts via the action of IL-1α, which would contribute to the

elevated levels of these factors in the HSE-KCF system (Boxman et al., 1996).

While the current HSE-KCF skin model lacks vasculature, which is also a key

factor in the sunburn response, ongoing work in our laboratory towards incorporating

microvascular endothelial cells into this skin construct would enable future

investigations into these processes. Other organotypic skin models have also been

previously described, consisting of endothelial cells and dermal fibroblasts cultured

in synthetic collagen scaffolds (Hudon et al., 2003). Moreover, elements of the

cutaneous immune system, such as Langerhans cells, have also been shown to play a

role in orchestrating the inflammatory response following UVB exposure (Simon et

al., 1991; Denfeld et al., 1998). Accordingly, immunocompetent in vitro skin

equivalent models can be employed in future to better understand the relationship


between the innate immune system and the regulation of epidermal responses to

UVB radiation (Régnier et al., 1997; Bechetoille et al., 2007; Laubach et al., 2011).

Apoptosis is a critical event underlying homeostatic maintenance as well as

acting as a safety net against oncogenic transformation (Fadeel et al., 1999).

Therefore, it is not surprising that the elimination of damaged cells via apoptosis is a

fundamental mechanism by which the skin is protected against the carcinogenic

potential of UVR (Lippens et al., 2009). Both intrinsic pathways, such as the

initiation of apoptosis by DNA damage or the generation of ROS, and extrinsic

pathways, by death receptor signalling, contribute to UVB-induced keratinocyte cell

death (Chow and Tron, 2005). What still remains relatively obscure are the

extracellular and intercellular factors that can influence the apoptotic program,

together with how these elements may contribute to the formation of premalignant

cells. Using 2D and 3D co-culture techniques, HSE-KC and HSE-KCF skin models,

an association between the presence of fibroblasts and the inhibition of keratinocyte

apoptosis in response to UVB was reported (4.3.3 and 4.3.6). In view of this, the

expressions of key members of the UVB-induced apoptotic cascade were

investigated in order to further dissect the mechanism by which fibroblasts conferred

their protective effects upon keratinocytes.

The Bcl-2 related protein, Bad, is a key promoter of cellular apoptosis by

dimerising and thus inactivating the prosurvival proteins Bcl-2 and Bcl-xL (Kelekar

et al., 1997). The phosphorylation of Bad at Serine 112 and 136 has been correlated

with its interactions with 14-3-3 proteins, thus promoting cell survival (Gajewski and

Thompson, 1996). The involvement of Bad in regulating apoptotic and cell survival

responses to UVB-irradiation was therefore studied in the HSE-KC and HSE-KCF

models (Figure 4.18). In line with the inhibition of keratinocyte apoptosis observed

previously in irradiated HSE-KCF composites (Figure 4.17), this study showed an

associated reduced expression of Bad post-irradiation in the HSE-KCF, compared to

that of the HSE-KC (Figure 4.18A). Both the upregulation of Bad expression, as well

as its phosphorylation, act as regulators of the post-irradiation apoptotic program and

have been well-documented in vitro (She et al., 2002; Yang et al., 2006). In view of

this, the levels of phosphorylated Bad were also quantified in the epidermal extracts

from the irradiated HSE constructs (Figure 4.18B). The significantly higher

proportions of phospho-Bad at the 6 and 24 hour post-irradiation time points in the


HSE-KCF indicate that this mechanism may be pivotal in enhancing the keratinocyte

survival effect brought about by fibroblast-secreted mediators. Interestingly, the

activation of the Akt, MAPK and PI3-K pathways by fibroblast-synthesized growth

factors have all been implicated in controlling the phosphorylation status of Bad

(Datta et al., 1997; Peso et al., 1997; Kulik and Weber, 1998; Shimamura et al.,

2003). Of these fibroblast growth factors, IGF-I in particular has been shown to

promote its prosurvival effects via inducing Bad phosphorylation in a variety of cell

types (Kulik, 1997; Kulik and Weber, 1998; Fang et al., 1999; Raile et al., 2003;

Fernandez et al., 2004). Therefore, the regulation of Bad activity by fibroblast-

produced factors may represent a critical step in orchestrating keratinocyte responses

to UVB radiation.

The cleavage of the nuclear enzyme PARP is known to be another key

mechanism through which DNA-damaged keratinocytes are eliminated following

UVB exposure (Aragane et al., 1998; Shimizu et al., 1999). Under physiological

conditions, PARP functions to repair damaged DNA, and in conjunction with the

action of several DNA repair mechanisms maintains the integrity of the genome

(Benjamin and Gill, 1980). In cells harbouring severe DNA damage, the cleavage of

PARP by the action of various caspases is believed to be a hallmark feature in UVB-

induced apoptosis (Tewari et al., 1995; Kim et al., 2000). Using the HSE-DED

models, we reported elevated levels of cleaved PARP as a result of UVB irradiation

in the HSE-KC composites compared to that observed in the HSE-KCF (Figure

4.19). However, no significant differences were observed between these composites

at the various sampling time points. Potentially, this could be a result of the post-

irradiation sampling time points chosen. Indeed, other in vitro studies have shown

changes to UVB-induced levels of cleaved PARP in keratinocytes to occur as early

as 1.5 hours following irradiation (Han et al., 2011). Hence, future studies should

investigate the earlier cellular events occurring in response to UVB radiation.

The activation of caspases is known to be yet another essential step in the

execution of cells damaged by UVR (Mancini et al., 1998; Denning et al., 2002;

Sitailo et al., 2002). The cleavage and subsequent activation of caspase-3 is therefore

an important marker of UVB-induced apoptosis (Cejudo-Marin et al., 2012). In the

irradiated 3D skin constructs, samples from the HSE-KC were found to have

considerably elevated levels of cleaved caspase-3 at the 24 hour time point (Figure


4.20). Furthermore, the presence of fibroblasts was also shown to cause a diminished

expression of cleaved caspase-3 in irradiated keratinocytes cultured in a cell

monolayer format (Figure 4.5). Paracrine interactions between the dermis and

epidermis have indeed been shown to be involved in the activation of such caspases

under both pathological and physiological conditions (Funayama et al., 2003; Lewis

et al., 2010). The modulation of caspase-3 activation through the action of

fibroblasts, therefore, represents yet another mechanism by which the dermis may

influence epidermal cell survival in response to UVB exposure. The roles of other

members of the caspase family in maintaining epidermal function after acute

photodamage also requires further investigation. For example, caspase-14 has been

implicated in regulating terminal differentiation in irradiated keratinocytes to inhibit

replication while maintaining the barrier function of the epidermal layer (Denecker et

al., 2008). Similarly, caspase-9 has been demonstrated to play a fundamental role

upstream in the caspase cascade in activating apoptosis in UVB-damaged cells

(Sitailo et al., 2002).

Fibroblast-keratinocyte interactions influencing p53 activity during the acute

UVB response

In the past 30 years, p53 has been one of the most widely-studied tumour

suppressor genes due to its central role in numerous cell biology and cancer

development pathways (Leppard and Crawford, 1983; Levine et al., 1991;

Blagosklonny, 2000). Importantly, p53 exerts its affects as the ‘guardian of the

genome’ by regulating aspects of DNA repair mechanism, cell-cycle progression and

various apoptotic pathways (Lane, 1992). Under homeostatic conditions, p53 levels

are downregulated via the action of inhibitor proteins such as Mdm2, which promote

the degradation of p53 through ubiquitin proteolytic pathways (Kubbutat et al., 1997;

Kubbutat et al., 1998). Consequently, p53 has a rapid turnover rate and has been

detected at low levels in epidermal cells (Bottger et al., 1997). Cellular insult by

UVB radiation results in rapid elevation in p53 levels, along with enhanced stability,

half-life and DNA-binding function of the protein via post-translational

modifications and phosphorylation (Gu and Roeder, 1997). Indeed, in vitro studies in

mouse keratinocyte cultures have demonstrated that this UVB-induced increase in

p53 protein and post-transcriptional modification levels is associated with relatively

unchanged mRNA levels (Liu et al., 1994).


The expression and activity of p53 in irradiated HSE-KC and HSE-KCF skin

constructs was investigated herein, to identify potential differences to UVB-induced

p53 activity from fibroblast-secreted factors (4.3.8). From this study, I report that

p53 mRNA levels were shown to be differentially upregulated in the HSE-KC

constructs at 6 and 24 hours after UVB treatment, as compared to matched samples

from the HSE-KCF (Figure 4.21). At these time points, the p53 protein quantified

using the polyclonal antibody-based ELISA showed significantly elevated levels, in

relation to the HSE-KCF (Figure 4.22A). On the other hand, p53 detected using a

monoclonal antibody in the Western blot analysis showed a slightly diminished HSE-

KC p53 band in contrast to that of the HSE-KCF (Figure 4.22C). Collectively, this

suggests that while UVB exposure triggers the increased expression of p53 in the

HSE-KC, this may not be associated with a matched enhancement of p53 protein

stability, thus making it susceptible to degradation and a short half-life. This would

account for the detection of fragments (a product of proteolysis) by the

abovementioned polyclonal antibody. Furthermore, at 24 hours post-irradiation, the

HSE-KCF samples had proportionately higher phosphorylated p53 as opposed to that

in the HSE-KC (Figure 4.22C). This further supports the theory that dermal

fibroblasts may play a role in enhancing p53 activation through improving its

stability and phosphorylation status. Indeed, it has been shown previously that

fibroblasts can directly affect UVB-induced p53 activation in keratinocytes in vitro

through the epidermal microenvironment (Will, 2000). Intriguingly, recent evidence

has also suggested that fibroblast-produced growth factors can aid in p53-dependent

keratinocyte senescence, which allows for the inhibition of apoptosis in irradiated

cells, while maintaining cellular metabolism (Handayaningsih et al., 2012). Taken

together, this implies that fibroblast interactions with keratinocytes may influence the

cell death and survival balance via p53-dependent actions upon UVB exposure.


Conclusions and significance

The apoptotic, cell survival and repair programs all play substantial roles in the

removal of UV-damaged cells and the maintenance of the epidermal barrier function

(Cotton and Spandau, 1997; Bernstein et al., 2002; Assefa et al., 2005; Garner and

Raj, 2008). In light of this, it is clear that dysregulation or deviations from these

protective mechanisms may have serious long-term consequences in the epidermis.

Indeed, theories implicating the reduced activity of dermal fibroblasts in the onset of

skin cancers in aging skin have been proposed (Gillman et al., 1955; Lewis et al.,

2008; Lewis et al., 2010). These studies have demonstrated that diminishing levels of

fibroblast-secreted factors directly impact on DNA repair and uncontrolled

proliferation in irradiated keratinocytes, thus contributing to NMSC development.

The need to more fully understand the complexities of these dermal-epidermal

interactions in the acute and chronic response to UV-irradiation is therefore apparent.

In order to achieve this, improved in vitro systems for testing the biological

effects of UVB in keratinocytes and the paracrine interactions regulating these

processes need to be developed and characterised. In Australia, commercially

manufactured 3D skin culture models such as EpiSkin® (L’Oreal, Paris, France) and

EpiDerm™ (MatTek, Massachusetts, USA) are not readily available due to

quarantine laws, international transport logistics and cost issues (Poumay et al.,

2004). Moreover, while rigorous standards of protective strategies to minimise

photodamage have been generated to reduce the incidences of skin cancers in the

Australian public, the availability of effective therapeutic agents with minimal side

effects to counteract skin photodamage are still lacking (Reichrath, 2003; Shih et al.,

2009). Current gold standard therapeutics for photodamaged skin include

fluorouracil, imiquimod, photodynamic therapy and microdermabrasion, which

induce epidermal damage to activate skin regeneration processes (Orringer et al.,

2008; Karimipour et al., 2009; Sachs et al., 2009; Firnhaber, 2012). Thus, the

availability of improved in vitro skin models for photobiology, such as the HSE-KCF

described herein, may assist in the generation of novel and improved therapeutics

and preventative strategies against the harmful effects of UVR exposure.

Furthermore, increasing our understanding of the complex biological processes

surrounding the acute epidermal photoresponse and the links between the

dysregulation of these events during photocarcinogenesis is an essential next step.


Results from the study described in this Chapter further substantiate the role of

dermal fibroblasts in modulating keratinocyte responses to UVB, using the novel

application of Transwell® co-culture and HSE-KCF skin models. Importantly, the

presence of fibroblasts in these culture systems was shown to significantly enhance

keratinocyte viability, augment the expression of proinflammatory cytokines, inhibit

apoptosis and improve the rate of UVB-induced DNA photolesion repair. Moreover,

the activation of key members of the apoptotic cascade, including Bad, PARP and

caspase-3, were also shown to be affected by fibroblast-secreted factors.

Significantly, the study conducted herein reports the modulation of the functional

status of p53, a tumour suppressor gene central in the protective response against

UV-damage, by the presence of fibroblast-secreted factors. Collectively, these results

provide further evidence towards the associations between epidermal and

mesenchymal cells during the UVB response, indicating a strong correlation between

paracrine signals from the dermis and their influence on keratinocyte repair

responses during epidermal regeneration (Saiag et al., 1985; Priestley and Lord,

1990; Werner and Smola, 2001).

In Chapter 5, the influence of IGF-I, a key fibroblast-secreted factor involved

in epithelial-mesenchymal crosstalk, on the processes of keratinocyte survival, repair

and proliferation was further explored. Various soluble factors synthesized by

fibroblasts have been shown to induce proliferative and reparative effects in

keratinocytes, including KGF and IL-1β (Maas-Szabowski et al., 1999; Witte and

Kao, 2005). Of these, the IGF system, with its potent ability to promote cell survival

and proliferation, has been implicated in directing epithelial growth and stress

responses (Ishihara et al., 2000). Hence, the involvement of IGF-I in modulating the

UVB response in keratinocytes was further investigated using the in vitro skin

models developed and described herein.

Chapter 5: Investigating the role of IGF-I in the keratinocyte UVB response 147

Chapter 5: Investigating the role of IGF-I in

the keratinocyte UVB response

5.1 INTRODUCTION

The maintenance of epidermal integrity and the removal of damaged cells

following UVR exposure are complex, multi-factorial processes that are governed by

a network of autocrine and paracrine mechanisms (Aaronson et al., 1990; Baba et al.,

2005; Benitah, 2007). In the previous Chapter a tissue-engineered skin equivalent

model, incorporating both primary dermal fibroblasts and keratinocytes, was used to

demonstrate the importance of dermal-epidermal crosstalk in the orchestration of

UVB responses in the epidermis. Importantly, this data indicated that mesenchymal-

secreted factors are vital in maintaining the cell death-survival balance in the

irradiated epidermis by inhibiting apoptosis and promoting the removal of UVB-

induced DNA lesions. The mechanisms of apoptosis inhibition were also explored in

this study, with key members of the UVB-induced keratinocyte apoptotic cascade,

including Bad, caspase-3 and PARP, shown to be influenced by the presence of

dermal fibroblasts in the HSE-KCF. Hence, the next aim of this project was to

further investigate the cell survival and repair aspects of this keratinocyte-fibroblast

interaction during the UVB response, using the previously characterised in vitro

models described in Chapters 3 and 4. In particular, the IGF system, a central

mediator of epithelial-mesenchymal paracrine interactions, was studied to determine

its role in promoting keratinocyte survival following UVB exposure.

The activation of UVB-induced apoptosis is a critical step in preventing the

accumulation of mutated keratinocytes with the potential of developing into NMSCs

(Brash et al., 1996). Keratinocyte survival following UVB exposure, on the other

hand, is important in maintaining the integrity of the epidermal barrier and normal

skin homeostasis (Blanpain and Fuchs, 2009; Sotiropoulou and Blanpain, 2012).

However, the precise factors which decide the fate of UV-damaged keratinocytes

have yet to be mapped in detail. Broadly, it is known that the dose of UVB applied

and the balance of anti- and pro-apoptotic factors in the epidermal microenvironment

significantly influence this death-survival balance (Claerhout et al., 2006).

148 Chapter 5: Investigating the role of IGF-I in the keratinocyte UVB response

Numerous complex pro-survival signals in keratinocytes activate anti-apoptotic

pathways following UVB irradiation, with Bcl-2, survivin, NFκB and the PI3K/Akt

pathways among the main players involved in this process (Grossman et al., 2001;

Assefa et al., 2003; Wang et al., 2003; Beak et al., 2004). The activation of these

survival pathways acts to dampen apoptotic signals by interfering with the

mitochondrial death pathway and promoting the repair of damaged DNA (Assefa et

al., 2003). In the case of Bcl-2, for example, its overexpression potently blocks the

activation and translocation of the apoptotic protein Bax to the mitochondria, thus

blocking cytochrome c release and the subsequent activation of caspases in response

to UVB exposure (Van Laethem et al., 2004). Similarly, the activation of the

PI3K/Akt pathway by growth factors is central in promoting keratinocyte survival;

this is achieved in part by blocking the activities of caspase-9 and -3 (Decraene et al.,

2004; Claerhout et al., 2007). One such growth factor implicated in promoting cell

survival following UVB exposure via the PI3K/Akt pathway is IGF-I (Kulik, 1997).

The IGF system (as reviewed in 1.5) encompasses a broad network of growth

factor, ECM and cellular interactions, which in turn influence cellular functions and

responses via numerous endocrine, paracrine and autocrine mechanisms (Annunziata

et al., 2011). The activation of IGF receptors (by the peptide ligands IGF-I, IGF-II

and insulin) is known to play a significant role in normal growth and development,

and has also been implicated in elevating the risk and progression of various cancers

(Wood, 1995; Samani, 2007). As part of these diverse biological actions, IGF-IR-

mediated effects include short-term metabolic effects, such as the stimulation of

glucose uptake, along with long-term effects, including the regulation of cell cycle

progression, differentiation, apoptosis and DNA synthesis (Humbel, 1990).

In the skin, IGF-I is produced predominantly by dermal fibroblasts and acts in

a paracrine manner by subsequently stimulating basal keratinocytes, hence forming a

fundamental pathway in the dermal-epidermal crosstalk (Flier et al., 1986; Philpott et

al., 1994; Rudman, 1997). Physiologically, this interaction has been shown by

members of our research group as being central in orchestrating tissue repair and

remodelling during wound healing, as well as in other studies for the maintenance of

epidermal homeostasis (Edmondson et al., 2003; Hyde et al., 2004; Upton et al.,

2008; Kricker et al., 2010). While the involvement of the IGF-I system in the

cutaneous UVB response has been relatively less well-studied, in vitro and in vivo


data points towards a possible role for this growth factor system in the regulation of

cell survival pathways (Kulik, 1997; Kuhn et al., 1999; Lewis et al., 2008; Lewis et

al., 2010). Following cellular stress, downstream pathways triggered by the IGF-I

peptide ligand binding to IGF-IR have been shown to promote cell survival by

inhibiting intracellular apoptotic factors and enhancing cell survival signals (Figure

1.7) (Assmann, 2009). In terms of the photoresponse in keratinocytes, this

augmentation of cell survival has also been demonstrated experimentally to coincide

with the facilitation of DNA repair and the temporary arrest of the cell cycle (Héron-

Milhavet et al., 2001; Decraene, 2002). Furthermore, the activity of p53, a key

mediator in cell survival and repair processes post-irradiation, has been shown to be

strongly influenced by the functional status of the IGF-IR (Lewis, 2008).

With the IGF system playing central roles in many homeostatic and stress

responses in skin, it is not surprising that emerging evidence points towards its

potential role in skin cancer development. Indeed, in vitro studies have shown that

blocking IGF-IR activation directly impacts on the ability of keratinocytes to

undergo cell cycle arrest and adequate DNA repair processes (Lewis et al., 2010).

Furthermore, diabetic patients undergoing insulin therapy have been shown to

demonstrate lower rates of NMSC development, which is potentially correlated with

enhanced IGF-IR activation by elevated insulin levels in these individuals (Chuang et

al., 2005). Nonetheless, further investigations need to be conducted into the complex

network of IGF-mediated pathways and their role in epidermal responses to UVB.

As outlined in Chapter 4, the data obtained indicated a clear link between

fibroblast-synthesized factors and their importance in regulating major features of the

acute responses of keratinocytes to UVB exposure. The overriding aim of the studies

described in this current Chapter was therefore to investigate the role of IGF-I as a

key player of fibroblast-keratinocyte crosstalk during the acute UVB response. In

particular, the involvement of IGF-I in influencing critical elements of the

keratinocyte photoresponse, namely cell survival, cell cycle regulation, apoptosis,

DNA repair and the DNA damage response were explored. It was hypothesized that,

as a prominent pathway in epithelial-mesenchymal communication that is known to

modulate significant aspects of epidermal growth and regeneration, the IGF system

may contribute to the orchestration of keratinocyte responses to UVB damage.


The aims of this Chapter were therefore to:

1) Detect and quantify the presence of IGF-I in the Transwell® fibroblast-

keratinocyte co-culture model;

2) Investigate how IGF-I influences cell survival, cell cycle progression,

apoptosis and DNA repair in irradiated keratinocytes; and to

3) Study the role of IGF-I in the DNA damage response in UVB-exposed

keratinocytes.



5.2.1 Isolation and culture of primary human skin cells

The procedures for the isolation and culture of primary human keratinocytes

and fibroblasts from ex vivo skin tissues are detailed in 2.2.2.

5.2.2 Transwell® co-culture of keratinocytes and fibroblasts

The co-culture of primary keratinocytes and fibroblasts using Transwell® cell

culture systems is described in 2.2.4.

5.2.3 Irradiation of keratinocyte monolayers

Keratinocyte monolayers grown on the insert membranes of Transwell® cell

culture systems were irradiated with a single dose of UVB as outlined in 2.2.5.

5.2.4 Quantification of IGF-I in cell culture supernatants

The concentration of IGF-I was quantitatively determined in cell culture

supernatants from Transwell® and HSE cultures using a pre-bound sandwich ELISA

kit (Quantikine© human IGF-I immunoassay, R&D Systems, MN, USA) as per the

manufacturer’s protocols. Briefly, serum-free cell culture supernatants were obtained

from confluent co-cultures and keratinocyte monolayers after three days under

culture conditions. Samples were pooled from cells obtained from three different

patient donors. Complete keratinocyte growth medium, FGM, was also tested as a

positive control. The volume of supernatants added to the pre-bound ELISA plates

were normalised to the cell density. IGF-I standards with known concentrations were

prepared and incubated, along with the culture medium samples, in the plates

containing a mouse monoclonal antibody against human IGF-I for two hours at 4°C.

Following a thorough wash, an IGF-I conjugate was added to all wells and these

were incubated for a further one hour at 4°C. Finally, a substrate solution was added

for 30 minutes, followed by a stop solution. The resulting absorbances of the wells

were read at 450 nm using a microplate reader.

5.2.5 Testing the effects of exogenous IGF-I on irradiated keratinocytes

In studies investigating the effects of exogenous IGF-I added into the cell

culture medium of irradiated keratinocytes, the following experimental set up was

utilised, as shown in Figure 5.1. Recombinant receptor grade human IGF-I (GroPep,

Adelaide, Australia) was used in these studies.


Figure 5.1. Experimental set up for testing the effects of IGF-I on irradiated keratinocytes

Human keratinocytes were cultured in the presence of fibroblasts as described in 5.2.2. Upon reaching

approximately 80% confluency, the keratinocytes were transferred to new culture wells (without fibroblasts) and

serum-starved in SFM. Following this, specific IGF-I concentrations in SFM or SFM only were added to the

keratinocyte monolayers 30 minutes prior to irradiation with UVB. Cell culture medium in both the upper and

lower chambers was then replaced with SFM and the keratinocytes returned to culture conditions of 37°C and 5%

CO2.

5.2.6 Testing the effects of fibroblast conditioned medium on irradiated

keratinocytes

To test the effects of fibroblast conditioned medium (CM) on keratinocyte

responses to UVB, the experimental set up detailed in Figure 5.2 was used.

Fibroblast CM collected from 5 x 105 primary dermal fibroblasts at Passage 2,

cultured for 72 hours in SFM was utilised. This fibroblast CM (from fibroblasts

cultured from the same skin tissue donor) was used in all experiments requiring the

use of CM.

Figure 5.2. Experimental set up for testing the effects of fibroblast conditioned medium on irradiated

keratinocytes

Human keratinocytes were cultured in the presence of fibroblasts as described in 5.2.2. Upon reaching

approximately 80% confluency, the keratinocytes were transferred to new culture wells (without fibroblasts) and

serum-starved in SFM. Following this, fibroblast CM or SFM only were added to the keratinocyte monolayers 30

minutes prior to irradiation with UVB. Cell culture medium in both the upper and lower chambers was then

replaced with SFM and the keratinocytes returned to culture conditions of 37°C and 5% CO2.

5.2.7 Analysis of keratinocyte viability

Cell viability was determined using the MTS assay, as detailed in 2.2.12.


5.2.8 Analysis of IGF-IR-mediated cell signalling pathways using Western

immunoblotting

Western immunoblots were performed as previously outlined in 2.2.23. For

studies on cell signalling pathways in irradiated keratinocytes, the following primary

antibodies were utilised: anti-human AKT rabbit polyclonal IgG (Cell Signaling

Technology), anti-phospho-AKT (Thr 308) rabbit monoclonal IgG (Cell Signaling

Technology), anti-p44/42 MAP kinase (ERK1/2) rabbit polyclonal IgG (Cell

Signaling Technology), anti-phospho-p44/42 MAP kinase (phospho-ERK 1/2)

(dually phosphorylated at Thr 202/Tyr 204 of ERK1, Thr 185/Tyr 187 of ERK2 and

singly phosphorylated at Tyr 204) mouse monoclonal IgG (Cell Signaling

Technology), anti-IGF-IRβ rabbit monoclonal IgG (Cell Signaling Technology),

anti-phospho-IGF-IRβ (Tyr 1135/1136) rabbit monoclonal IgG (Cell Signaling

Technology) and anti-GAPDH rabbit monoclonal antibody (Cell Signaling

Technology).

5.2.9 Cell cycle analysis by flow cytometry

The proportion of keratinocytes at different phases of the cell cycle was

determined using flow cytometric analysis of the total DNA content as described in

2.2.14 (Kurki et al., 1986; Nunez, 2001). Briefly, keratinocytes cultured in

Transwell® inserts with various cell culture medium treatments were exposed to 4

MED UVB radiation (as described in 2.2.5). After 24 hours, the medium was

removed (and kept on ice) and keratinocyte monolayers were washed once with PBS

and removed from the membrane inserts using a cell scraper and transferred to low-

bind tubes and resuspended in ice cold PBS. The cell culture medium (containing

non-adherent apoptotic cells) was then added to this cell suspension and the

keratinocytes were washed twice by centrifugation at 200 x g for 5 minutes, followed

by re-suspension in cold PBS. After the final wash, the keratinocytes were

resuspended in ice cold PBS with 2% BSA and were passed through a 70 µm nylon

mesh (BD Falcon) to minimise cell clumping. The keratinocyte suspension was then

added drop-wise to an equal volume of ice cold absolute ethanol and stored at 4°C

overnight prior to staining as detailed in 2.2.14.

5.2.10 Analysis of apoptosis in irradiated keratinocytes

The TUNEL assay was used to detect and quantify apoptosis in irradiated

keratinocyte monolayers, as previously described in 2.2.11.


5.2.11 Analysis of the formation of UVB-induced CPD photolesions in

irradiated keratinocytes

The formation of CPD DNA dimers was detected in irradiated keratinocyte

monolayers using a mouse monoclonal antibody against CPDs as described

previously in 4.2.11.

5.2.12 Blocking IGF-IR function using a neutralisation antibody

For IGF-IR neutralisation studies, the mouse monoclonal IGF-IRα blocking

antibody (1H7 clone, azide-free antibody, Santa Cruz Biotechnology, Santa Cruz,

CA) was utilised. The addition of this antibody into cell culture systems blocks the

binding of IGF-I to IGF-IR, thus inhibiting ligand-dependent IGF-IR

phosphorylation and the subsequent activation of downstream signalling pathways

(Burtrum et al., 2003; Maloney et al., 2003). For IGF-IR function blocking studies,

the culture medium from keratinocyte monolayers grown in Transwell® cell culture

plates were removed and the cells were washed once with PBS. The IGF-IRα

blocking antibody (10 µg/mL in SFM) was then added to the keratinocyte cultures

and incubated for 30 minutes at 37°C with 5% CO2. Negative controls using mouse

IgG (25 µg/mL in SFM) were also run in parallel. The medium was then removed

and IGF-I (15 ng/mL in SFM) was added to the keratinocyte cultures for 30 minutes

at 37°C with 5% CO2 prior to irradiation with UVB as described in 2.2.5.

5.2.13 Analysis of differential gene expression using qRT-PCR

The protocol for qRT-PCR performed in this study is described in 2.2.19. The

primer sequences for p53 were TAACAGTTCCTGCATGGGCGGC (5’ to 3’) and

AGGACAGGCACAAACACGCACC (3’ to 5’).

5.2.14 UVB radiation-induced DNA damage response antibody array

A sandwich ELISA technique was used to detect the presence of cellular

proteins involved in the response to UVB-induced DNA damage. Primary antibodies

against human phospho-histone H2A.X (Ser 139) (Clone 20E3, Cell Signaling

Technology), phospho-cdc25C (Ser 216) (Clone 63F9, Cell Signaling Technology),

phospho-Chk1 (Ser 345) (Clone 133D3, Cell Signaling Technology), ATRIP (Cell

Signaling Technology) and phospho-ATR (Ser 428) (Cell Signaling Technology)

were used. These primary antibodies were diluted 1:1000, with 200 µL of this diluted

antibody solution added to the appropriate wells of a 96-well plate and incubated for


1 hour at 37°C. The antibody solution was removed and the plates were washed three

times with PBS with 0.05% Tween-20 (PBS-T). Samples of keratinocyte total cell

lysates were standardised by protein concentration and with serial dilutions from 10

µg added to the pre-coated wells. The plates were incubated for 60 minutes at room

temperature before being washed three times with PBS-T. Next, 1:5000 dilutions of

the secondary detection antibody (goat anti-rabbit IgG, HRP-linked antibody, Cell

Signaling Technology) was added to each well and the plate incubated for 60

minutes at room temperature. Plates were washed as described earlier and 100 µL of

3,3', 5,5"-tetramethylbenzidine (TMB) substrate solution (Cell Signaling

Technology) was added to each well and the plate incubated for 30 minutes at room

temperature. The stop solution (Cell Signaling Technology) was then added (100

µL/well) and the resulting absorbances were read at 450 nm using a

spectrophotometer.


5.3 RESULTS

5.3.1 In vitro concentration of IGF-I in 2D and 3D cultures

The secretion by IGF-I by dermal fibroblasts forms an important intermediary

of dermal-epidermal crosstalk, by stimulating a variety of processes including growth

and proliferation in keratinocytes via the activation of the IGF-IR (Nickoloff et al.,

1988; Kratz et al., 1992). In vitro, cultured human fibroblasts and melanocytes, but

not keratinocytes, have been shown to secrete IGF-I (Tavakkol et al., 1992; Tavakkol

et al., 1999). Additionally, fibroblast-secreted IGF-I has also been detected in cell

culture supernatants from 3D organotypic skin culture systems (Tavakkol et al.,

1999; Swope et al., 2001). In Chapter 4, the use of both bi-layer Transwell® 2D co-

culture and 3D HSE-KCF culture systems were employed to study epidermal-dermal

interactions during the UVB photoresponse. Henceforth, in this Chapter, the potential

role of IGF-I in mediating the keratinocyte photoresponse was investigated using the

Transwell® culture system.

Firstly, the levels of IGF-I present in cell culture supernatants obtained from

both Transwell® fibroblast-keratinocyte co-cultures and HSE-DED 3D cultures were

quantified. As shown in Figure 5.3, IGF-I was detected at significantly higher levels

(23.2 ± 4.29 ng/mL) in culture medium obtained from fibroblast-containing cultures

compared to cultures containing solely keratinocytes (0.09 ± 0.02 ng/mL). A similar

trend was observed in HSE-KCF culture medium as compared to that collected from

HSE-KC cultures, with mean concentrations of 3.12 ± 0.55 ng/mL and 0.42 ± 0.09

ng/mL IGF-I detected respectively. The concentrations of IGF-I detected in the

supernatants from the HSE-KCF cultures were lower in comparison to those from 2D

co-cultures, which may be attributed to IGF-I being bound to the ECM in the 3D

construct.


Figure 5.3. Quantification of IGF-I concentration in cell culture supernatants

The concentrations of IGF-I in Full Green’s medium (FGM) and cell culture supernatants from Transwell®

monolayer cultures consisting of keratinocytes only (KC), or keratinocyte-fibroblast co-cultures (KC+F), HSE-

KC and HSE-KCF were quantified using an ELISA protein quantification method (5.2.4). Samples in triplicate

were normalised based on the cell density, in triplicate experiments with cells cultured from three independent

tissue donors. Statistical significance of p<0.01 is represented by ‘#’, and p<0.05 by ‘*’. Error bars indicate the

SEM values.

5.3.2 Effect of IGF-I on irradiated keratinocyte viability

It was previously demonstrated that fibroblast co-culture enhanced cell

viability levels in UVB irradiated keratinocyte populations (Section 4.3.2).

Moreover, previously published studies indicate a strong correlation between the

IGF-I system and fibroblast-mediated regulation of keratinocyte survival during the

acute UVB response (Kulik, 1997; Kuhn et al., 1999). In the previous section,

fibroblast-secreted IGF-I was positively detected and quantified in the keratinocyte

culture systems utilised throughout this project. The next aims of this study were

therefore to: 1) determine the minimum concentration of exogenous IGF-I required

to significantly enhance cell survival in irradiated keratinocytes; and 2) compare

irradiated keratinocyte viabilities between this minimum effective dose of IGF-I and

fibroblast CM and 3) to determine if the IGF system is involved in fibroblast-induced

keratinocyte survival post-UVB irradiation.

Figure 5.4A shows the effect of increasing doses of exogenous IGF-I pre-

treatment on the resulting relative cell viabilities of keratinocyte populations

following UVB irradiation. Cell monolayers were pre-treated with IGF-I in SFM

Cell culture supernatant

IGF

-I c

on

c.

(ng

/mL

)

FGM K

C

KC+F

HSE-K

C

HSE-K

CF

0

10

20

30

*

#


prior to their exposure to 100 mJ/cm2 UVB radiation and returned to culture

conditions for 24 hours before viability analysis using an MTS assay. Overall,

increasing concentrations of IGF-I showed a positive effect on keratinocyte viability,

as compared to those cultured in SFM only. A dose of 15 ng/mL of IGF-I was found

to be the minimum effective dose to significantly enhance keratinocyte viability in

relation to the SFM control. Concentrations of IGF-I between 15 and 30 ng/mL also

improved keratinocyte survival post-irradiation, but did not differ greatly from

results observed using the minimum effective dose.

Figure 5.4. Effects of IGF-I treatment on the viability of irradiated keratinocyte monolayers

The effects of IGF-I on irradiated keratinocyte viability were tested using an MTS assay. Cell monolayers

cultured on Transwell® membrane inserts were pre-treated with different concentrations of IGF-I, serum-free

medium (SFM), complete keratinocyte growth medium (FGM) or fibroblast CM, 30 minutes prior to irradiation

with 100 mJ/cm2 UVB. After 24 hours, the MTS assay was performed to determine dose-response changes to

keratinocyte viability with IGF-I pre-treatment (A). The minimum concentration of IGF-I required to

significantly enhance keratinocyte viability after UVB exposure was 15 ng/mL. Pre-treatment with this IGF-I

dose was further compared with the effects of fibroblast CM on irradiated keratinocytes (B). Data is represented

as a percentage of the cell viability in non-irradiated controls (white bars). Asterisks represent statistical

significance (p<0.05) relative to results obtained with SFM. Data represents the mean values of experimental

triplicates, each with cells obtained from three individual donors. The error bars indicate the SEM values.

Next, irradiated keratinocyte survival (after 15 ng/mL IGF-I pre-treatment) was

compared to the viability of cells incubated with fibroblast CM prior to irradiation.

As shown in Figure 5.4B, both IGF-I and CM pre-treatment resulted in significantly

increased viabilities in irradiated keratinocyte monolayers, as compared to those in

Treatment

Pe

rce

nta

ge

ce

ll v

iab

ilit

y

Contr

ol

SFM

CM

15 n

g/mL IG

F-I

0

50

100

**

A B

Treatment

Pe

rce

nta

ge

ce

ll v

iab

ilit

y

Contr

ol

SFM

FGM

5 ng/m

L IGF-I

10 n

g/mL IG

F-I

15 n

g/mL IG

F-I

20 n

g/mL IG

F-I

25 n

g/mL IG

F-I

30 n

g/mL IG

F-I

0

50

100

* * **


SFM only controls. Furthermore, the percentage of cell survival induced by this dose

of IGF-I was comparable to that observed in the CM pre-treated samples containing

fibroblast-secreted factors. Together with the data obtained from IGF-I

concentrations detected in CM (5.3.1), this strongly suggests that IGF-I may be a key

growth factor involved in the fibroblast-directed enhancement of cell survival after

UVB exposure in keratinocytes

5.3.3 IGF-IR signalling in irradiated keratinocytes

In the previous section, IGF-I was detected in fibroblast-keratinocyte co-

cultures and the addition of exogenous IGF-I into fibroblast-free keratinocyte

cultures resulted in a similar enhancement of keratinocyte viability post-irradiation

(Section 5.3.1). Next, the activation of IGF-IR signalling pathways following UVB

irradiation in these keratinocytes was investigated. The intracellular signalling events

triggered by IGF-IR activation via IGF-I ligand binding are discussed in detail in

Section 1.5.1. Briefly, IGF-IR activation stimulates the intra-cellular phosphorylation

of signalling transducers in the PI3K and Raf-1/MEK/ERK pathways. Subsequently,

downstream cellular processes triggered by these signalling pathways include cell

survival, differentiation, growth and proliferation (Furstenberger and Senn, 2002).

In the study reported herein, the activation of the PI3K and ERK pathways, via

the phosphorylation of ERK and AKT was investigated using immunoblot analysis

(Figure 5.5). Phosphorylated-IGF-IR was undetectable in cell lysates obtained from

keratinocytes in SFM only (Figure 5.5A). However, the addition of 15 ng/mL IGF-I

significantly increased the detectable levels of phosphorylated-IGF-IR in these cell

lysate samples. It is known that human keratinocytes express the IGF-IR on the cell

surface, and respond to IGF-I synthesized by fibroblasts and melanocytes in a

paracrine manner (Tavakkol et al., 1992). Hence, it was demonstrated herein that the

addition of exogenous IGF-I to keratinocytes in the Transwell® culture system

resulted in the phosphorylation of the IGF-IR and the activation of its associated

signalling pathways.


Figure 5.5. Activation of IGF-IR-mediated signalling pathways in irradiated keratinocytes

Irradiated keratinocyte monolayers pre-treated with serum-free medium (SFM) only (-IGF-I) and in the presence

of 15 ng/mL IGF-I (+IGF-I) prior to irradiation were lysed at the indicated times post-irradiation. The relative

levels of phosphorylated and total proteins shown above were determined by immunoblot analysis. The cell

lysates were also probed for GAPDH to ensure equal loading in all wells. Data shown is representative of

experiments performed in triplicate using independent skin sample donors.

The activation of the ERK pathway is believed to play an important role in

initiating cell survival and proliferation responses by the actions of various growth

factors (Chang et al., 2003). As seen in Figure 5.5B, the enhanced phosphorylation

of ERK 1/2 (p44 and p42) in keratinocytes was associated with increased phospho-

IGF-IR. However, a slight increase in the relative levels of total-ERK was also

observed in IGF-I-treated cells. Elevated levels of phosphorylated AKT were

detected in these cells, which may be the predominant signalling pathway triggered

as a result of IGF-I treatment in these cells. Activation of both these pathways has

been shown to be linked to the promotion of cell survival and apoptosis inhibition

following cellular insults (Burgering and Coffer, 1995; Franke et al., 1997). Hence,

collectively, this result confirms the activation of IGF-IR-mediated intracellular

signalling pathways as a result of the addition of IGF-I to keratinocyte culture

systems following UVB irradiation in this experimental system.


5.3.4 Effect of IGF-I on UVB-induced apoptosis

It has been established that the IGF system is a cardinal factor in protecting

cells against apoptotic signals (Vincent and Feldman, 2002; Denley et al., 2005).

Mounting experimental evidence, including from research conducted in our

laboratory, has shown that IGF-I has potent effects, such as promoting cell survival

in a variety of cell types (Kashyap et al., 2011; Aburto et al., 2012; Fernández et al.,

2012). In the previous Chapter, it was demonstrated that fibroblast co-culture in both

2D and 3D tissue-engineered systems had a similar effect on UVB-irradiated

keratinocytes, with apoptosis being significantly inhibited in these cultures (4.3.3).

Hence, I aimed to investigate the effect of IGF-I on apoptosis suppression in

irradiated keratinocytes following UVB exposure, as a mechanism involved in the

dermal-epidermal crosstalk during the acute UV response.

The relative levels of UVB-induced apoptosis were measured using the

TUNEL assay in keratinocyte monolayers pre-treated with either SFM only,

fibroblast CM or IGF-I prior to irradiation (Figure 5.6). As shown previously, pre-

treating keratinocytes with fibroblast-CM significantly reduced the proportion of

apoptotic cells detected after UVB irradiation. Notably, the addition of 15 ng/mL of

IGF-I to SFM also showed a significant decrease in the ratio of TUNEL-positive

cells in the irradiated keratinocyte population. The percentage of apoptotic cells

observed in UVB-treated keratinocytes exposed to fibroblast-CM and IGF-I prior to

exposure was comparable. This result strongly suggests that IGF-I present in

fibroblast CM may be an important element in inhibiting apoptosis in UVB-exposed

keratinocytes. Hence, the IGF system may be involved in resisting extensive tissue

damage in the epidermis following physiologically-relevant doses of UVB, and

thereupon helping to maintain the important barrier function of the epidermis.


Figure 5.6. Effect of IGF-I on UVB-induced apoptosis in human keratinocytes

The relative proportions of UVB-induced apoptotic keratinocytes were measured using the TUNEL assay,

following the addition of different culture medium treatments. Non-irradiated controls using all culture medium

pre-treatments showed negligible numbers of apoptotic cells. Keratinocyte monolayers were serum-starved and

pre-treated with serum-free medium (SFM), fibroblast conditioned medium (CM) or SFM containing 15 ng/mL

IGF-I, 30 minutes prior to irradiation with 100 mJ/cm2 UVB radiation. The average numbers of TUNEL-positive

cells (from experimental triplicates) are presented as a percentage of the total number of cells counted in an

average of five microscopy fields. The experiment was repeated using cells obtained from three independent skin

tissue donors. The asterisks represent statistical significance (p<0.05). Error bars represent SEM values.

5.3.5 Effects of the blocking of IGF-IR activation on cell death in irradiated

keratinocytes

In the previous sections, it was demonstrated that IGF-I influenced key

elements of the UVB response including cell survival and apoptosis. These findings

were in parallel to those in the previous Chapter, in which fibroblast-keratinocyte co-

culture prior to UVB exposure brought about similar changes to the keratinocyte

photoresponse. To further investigate whether the IGF system represents a major

component in the fibroblast-mediated inhibition of apoptosis, an IGF-IR neutralising

antibody was utilised. This function-blocking antibody is known to stop the binding

of the IGF-I ligand to the receptor, thus preventing intracellular signalling pathway

cascades and the subsequent cellular effects evoked by IGF-IR activation (Burtrum et

al., 2003; Maloney et al., 2003).

Treatment

Pe

rce

nta

ge

T

UN

EL

+ K

C/f

ield

Contr

ol

SFM

CM

15 n

g/mL IG

F-I

0

20

40

60*

*


Keratinocyte-fibroblast co-cultures were pre-treated with an IGF-IR

neutralising antibody in different culture treatments prior to keratinocyte irradiation,

as described in 5.2.12. The relative ratios of apoptotic keratinocytes present in the

irradiated monolayers were analysed 24 hours after UVB treatment and the results

are represented in Figure 5.7. As shown in previous sections, control keratinocytes

pre-treated with SFM only resulted in the highest proportion of apoptotic

keratinocytes. The addition of IGF-1 and fibroblast CM pre-treatment to

keratinocytes significantly reduced the numbers of UVB-induced apoptotic cells

detected. The addition of the 1H7 neutralising antibody before CM pre-treatment

also resulted in a significant drop in the percentage of TUNEL-positive keratinocytes

following UVB irradiation.

Interestingly, however, blocking the functionality of IGF-IR did not

significantly augment the numbers of apoptotic keratinocytes after irradiation. This

indicates that alternate pathways to those regulated by IGF-IR may also play an

important role in fibroblast-mediated keratinocyte survival post-irradiation.


Figure 5.7. Effect of IGF-IR blocking antibody treatment on UVB-induced apoptosis in irradiated

keratinocytes

The proportions of TUNEL-positive apoptotic keratinocytes were quantified in UVB-irradiated keratinocytes

subjected to different medium treatments prior to UVB exposure. Control samples were treated to a sham

irradiation. Irradiated cells were pre-treated with either SFM only, 15 ng/mL IGF-I, IGF-I and the 1H7 IGF-IR

neutralising antibody, fibroblast CM, CM and 1H7 or CM and an IgG control prior to exposure to 100 mJ/cm2

UVB. The average numbers of TUNEL-positive cells (from experimental triplicates) are presented as a

percentage of the total number of cells counted in an average of five microscopy fields. The experiment was

repeated using cells obtained from three independent skin tissue donors. The asterisks represent statistically

significant (p<0.05) values in comparison to samples treated with SFM only. Error bars represent SEM values.

Treatment

Perc

enta

ge

TU

NE

L+

KC

/fie

ld

Contr

ol

SFM

+ IG

F-I

+ IG

F-I +

1H7

CM

CM

+ 1

H7

CM

+ Ig

G c

ontrol

0

10

20

30

40

50

60

70 *

*

**


5.3.6 Effect of IGF-I on the repair of UVB-induced DNA damage

As reported earlier in this thesis, fibroblast co-culture in the Transwell®

culture system has been reported to have a positive impact on the rate of CPD

removal in irradiated keratinocytes (4.3.4). These CPD photolesions are a primary

form of UVB-induced photodamage in the epidermis and have been strongly

implicated in the development of skin malignancies (Evans and Bohr, 1994; You et

al., 2000). Hence, identifying biological factors that can improve the efficiency of

CPD photodamage in UVB-exposed skin is an essential step in the generation of

more effective strategies against UV-damage. Moreover, identifying intercellular and

intracellular pathways that function to repair genotoxic damage in vivo can aid in

understanding how the dysregulation of these protective mechanisms can increase

the risk of photocarcinogenesis. Therefore, the effects of IGF-I at modulating the

removal of UVB-induced CPDs in irradiated Transwell® keratinocyte cultures were

investigated.

At 24 hours post-UVB irradiation, irradiated keratinocytes still harbouring

CPD damage were visualised using immunofluorescence and quantified (Figure 5.8).

In these experiments keratinocytes pre-treated with basal SFM prior to UVB

exposure showed the highest rate of unrepaired CPD in irradiated keratinocyte

nuclei. However, pre-treatment with fibroblast CM or SFM containing 15 ng/mL

IGF-I significantly reduced the ratio of CPD-positive keratinocyte nuclei in these

samples. Keratinocytes exposed to fibroblast CM had a lower proportion of cells

with unrepaired CPDs, as compared to those treated with IGF-I, which suggests other

fibroblast-secreted factors may be responsible for promoting DNA repair in

epidermal cells.


Figure 5.8. Effect of IGF-I on the repair of UVB-induced CPDs in irradiated keratinocytes

Keratinocyte nuclei containing UVB-induced DNA dimers were visualised using immunofluorescence and

quantified using image analysis software. The presence of UVB-induced CPDs was detected in keratinocyte

monolayers pre-treated with serum-free medium (SFM), fibroblast conditioned medium (CM) or SFM containing

15 ng/mL IGF-I prior to irradiation. Data is represented as a percentage of the total number of keratinocyte

nuclei. Results shown are representative of three experiments (with samples in triplicate) conducted from three

independent skin cell donors. Asterisks represents statistical significance at p<0.05. Error bars represent SEM

values.

5.3.7 Repair of UVB-induced CPDs with IGF-IR neutralisation in irradiated

keratinocytes

The enhancement of cell survival following UVB exposure, as demonstrated in

the previous section, is associated with either cellular senescence or the arrest of the

cell cycle to allow for the repair of UVB-induced DNA damage (Lewis, 2008). The

formation of CPDs in the nuclei of UVB-exposed keratinocytes represents a major

form of DNA damage, of which the recruitment of DNA repair machinery during the

acute photoresponse is critical for removing these photolesions (Regan and Setlow,

1974; Su, 2006). Previously, it has been documented herein that both fibroblast-

secreted factors, as well as keratinocyte pre-treatment with IGF-I, prior to UVB

irradiation, accelerates the rate of CPD repair in these cells (section 5.3.6). To further

investigate the role of IGF-I at enhancing the removal of UVB-induced DNA

damage, the effect of IGF-IR neutralisation on the rate of CPD repair in irradiated

keratinocytes was studied.

Treatment

Perc

enta

ge o

f C

PD

+ k

era

tinocyte

s

Unir

radia

ted c

ontrol

SFM

CM

IGF-I

0

20

40

60 *

*


Figure 5.9 shows the proportions of unrepaired CPDs present in irradiated

keratinocytes pre-treated with different medium conditions at 24 hours post-

irradiation. Pre-treatment with 15 ng/mL IGF-I, fibroblast CM and CM with an IgG

control showed a statistically significant decrease in the proportion of unrepaired

CPDs in irradiated keratinocytes in relation to those in SFM only. The addition of the

IGF-IR function-blocking antibody resulted in significantly higher levels of CPD-

positive keratinocytes as compared to cell monolayers treated with CM and the IgG

control. This result indicates that the blocking of IGF-IR-activated pathways by the

1H7 neutralising antibody may impact the recruitment and functionality of DNA

repair machinery required for the efficient removal of CPDs. Importantly, this

provides further evidence for the importance of IGF-IR-mediated activities in the

orchestration of DNA repair, a process that is vital in suppressing potentially

oncogenic events in skin.

Figure 5.9. Effect of IGF-IR blocking antibody treatment on the formation of UVB-induced DNA

dimers in irradiated keratinocytes

The proportions of CPD-positive keratinocytes containing UVB-induced DNA dimers were quantified in

irradiated keratinocyte monolayers in different medium treatments prior to UVB exposure. Irradiated cells were

pre-treated with either SFM only, 15 ng/mL IGF-I, fibroblast CM, CM and the 1H7 IGF-IR neutralising antibody

or CM and an IgG control, prior to exposure to 100 mJ/cm2 UVB. The presence of CPDs in keratinocyte nuclei

was detected using immunofluorescence. Data is represented as a percentage of the total number of keratinocyte

nuclei. Results shown are representative of three experiments (with samples in triplicate) conducted from three

independent skin cell donors. The asterisks represent statistically significant values (p<0.05). Error bars represent

SEM values.

Treatment

Perc

enta

ge o

f C

PD

+ k

era

tinocyte

s

Non-ir

radia

ted c

ontrol

SFM

+ IG

F-I

+ IG

F-I +

1H7

CM

CM

+ 1

H7

CM

+ Ig

G c

ontrol

0

10

20

30

40

50

60

70

*


5.3.8 Effect of IGF-I on p53 expression in irradiated keratinocytes

Upon the generation of UVB-induced DNA damage, cellular p53 is known to

be activated and stabilised, through the disruption of p53-MDM2 complexes, and

subsequent translocation to the nucleus (Hall et al., 1993; van Laethem et al., 2009).

During this UV stress response, p53 activation can trigger both G1 and G2/M cell

cycle arrest, thus facilitating DNA repair (Matsumura and Ananthaswamy, 2004).

The activation of IGF-IR in keratinocytes has been demonstrated to be linked to p53-

mediated cellular pathways during the UVB response, both in this thesis as well as in

previously reported studies, which include the inhibition of apoptosis and the

regulation of the cell cycle (Kuhn et al., 1999; Chaturvedi et al., 2004).

Previously, I have observed significant differences in keratinocyte p53

expression levels as well as that of total and phosphorylated intracellular p53

following UVB radiation as a result of fibroblast co-culture (4.3.8). Hence, the

relative gene and protein expression levels analysed in irradiated keratinocytes pre-

treated with fibroblast CM and IGF-I are described herein (Figure 5.10).

Keratinocyte monolayers cultured in Transwell® culture systems were exposed to

either SFM only, IGF-I or CM prior to irradiation, with RNA and protein samples

obtained at various time points after UVB exposure. In non-irradiated controls, no

significant changes in gene or protein expression levels were observed in all culture

conditions, over all the time points sampled (Figure 5.10A). At 6 and 24 hours post-

irradiation, however, a significantly decreased relative gene expression of p53 was

observed in keratinocytes pre-treated with IGF-I and CM prior to irradiation. In IGF-

I pre-treated keratinocytes, a 3.99 ± 0.97 and 8.27 ± 1.99 fold decrease in p53 mRNA

levels were detected relative to SFM-treated cells at 6 and 24 hours post-irradiation

respectively. Culture of keratinocytes in CM induced a 2.38 ± 0.97 and 6.78 ± 2.38

fold decrease in relative p53 mRNA expression at these time points.


Figure 5.10. Relative gene and protein expressions of p53 in irradiated keratinocytes

The relative gene expression of p53 in irradiated keratinocytes was analysed using qRT-PCR and normalised to

results from cells pre-treated with SFM only (A). The control results represent non-irradiated keratinocyte

samples at the 0 hour time point. Keratinocytes were pre-treated with either SFM, SFM with 15 ng/mL IGF-I or

fibroblast-CM prior to UVB irradiation, with samples obtained at 3, 6 and 24 hours post-irradiation. The dotted

line indicates a 1.8-fold difference in gene expression relative to SFM treated cells. The relative protein

expression of total p53 in cell lysates from irradiated keratinocytes was analysed using ELISA (B) to validate the

gene expression data previously described (A). The relative levels of phosphorylated p53 (Ser 15) in these

samples were also analysed (C). Statistical significance of p<0.05 is represented by ‘*’. Data are represented as

mean ± SEM (error bars) from three independent replicate experiments using samples obtained from three

independent skin donors.

Next, the relative levels of total and phosphorylated p53 protein in these

samples were analysed using an ELISA (Figure 5.10B and C). Compared to p53

levels in SFM-treated keratinocytes, cells cultured in IGF-I-containing medium prior

to irradiation showed significantly higher total p53 levels at 6 and 24 hours post-

irradiation and elevated phospho-p53 at the 3 and 6 hour time-points. Total p53 was

shown to be increased in CM-treated keratinocytes at 6 hours after UVB-exposure,

with the relative levels of the phosphorylated protein shown to be higher than SFM-

treated controls at all time-points sampled. Intracellular p53 has been shown to have


Re

lativ

e g

ene

exp

ressio

n o

f p

53

Control 3 6 24-15

-10

-5

0

5

SFMIGF-I

*

CM

*


Ab

so

rban

ce (

450 n

m)

Contr

ol 0 h

r3

hr6

hr

24 h

r

0.0

0.5

1.0

1.5SFM

+ IGF-I

*

CM

*

*


Ab

so

rban

ce (

450 n

m)

Contr

ol 0 h

r3

hr6

hr

24 h

r

0.0

0.5

1.0

1.5SFM

+ IGF-I

*CM

**

A

B CTotal p53 Phospho-p53


a rapid turnover and its short half-life is a result of ubiquitin-proteasome pathways

(Maki et al., 1996). During cellular stress, downstream p53-mediated processes are

associated with the increased stabilisation via the inhibition of its binding to MDM2

and an increase in the phosphorylation of p53 at Ser15, Thr18, Ser20, Ser33 and

Ser37 (Shieh et al., 1997; Kapoor et al., 2000). The results described herein therefore

indicate that both fibroblast-secreted factors in the CM and the activation of IGF-IR

may enhance p53 via inhibiting its degradation and enhancing its phosphorylation

status.

5.3.9 Effect of IGF-I on cell cycle phase

The inhibition of apoptosis and the enhancement of cellular survival in UVB-

irradiated keratinocytes by IGF-I have previously been described (section 5.3.2).

Moreover, prior studies pertaining to downstream cellular effects resulting from the

activation of the IGF system have shown evidence towards the regulation of cell

cycle progression via Akt/PI3K mediated pathways (Chen and Rabinovitch, 1990;

Mawson et al., 2005). Thereupon, alterations to the regulation of the cell cycle in

irradiated keratinocytes as a result of IGF-I pre-treatment were investigated.

The ratios of the total keratinocyte population in the G0/G1, S and G2/M cell

cycle phases were determined using flow cytometric analysis of fluorescently-

labelled DNA content (Kurki et al., 1986; Nunez, 2001). Keratinocytes undergoing

apoptosis were also able to be detected using this technique. Figure 5.11 shows the

proportions of irradiated keratinocytes (pre-treated with different medium conditions

prior to UVB treatment) in these cell cycle phases at 24 hours post-irradiation. The

addition of exogenous IGF-I and fibroblast CM significantly decreased the

proportions of apoptotic keratinocytes following irradiation. Interestingly, significant

shifts were also observed in the irradiated keratinocytes G0/G1 and G2/M cycle phases

as a result of these treatments. Higher proportions (65.99 ± 6.32% and 57.68 ±

8.70%) of cells at the quiescent G0/G1 phase were also observed in keratinocytes

treated with 15 ng/mL IGF-I and CM respectively. In comparison, irradiated

keratinocyte monolayers cultured in SFM and FGM were observed to have a

significantly greater proportion of cells in the G2/M phases of the cell cycle. This

data points towards the possible induction of G1/S cell cycle checkpoints by IGF-I

and CM pre-treatments, which reduce the proportion of cells able to progress to the

G2/M mitotic phases.


Figure 5.11. Effect of growth factor pre-treatment on cell cycle phases in irradiated keratinocytes

The effect of IGF-I and CM pre-treatment on the cell cycle phase in irradiated keratinocytes was analysed using

flow cytometry. Cell monolayers were pre-treated with serum-free medium (SFM), Full Green’s Medium (FGM),

15 ng/mL IGF-I or fibroblast conditioned medium (CM) for 30 minutes prior to irradiation with 100 mJ/cm2

UVB. After 24 hours, keratinocytes were harvested and analysed for total DNA content by fluorescent labelling

with PI and flow cytometric analysis. The asterisks represent statistical significance (p<0.05) compared to the

SFM controls. Data is representative of experiments performed in triplicate using cells obtained from three

independent skin tissue donors. Error bars represent SEM values.

5.3.10 DNA damage response proteins

A close relationship between IGF-IR activation and the preservation of

genomic integrity in DNA-damaged cells via the initiation of DNA repair

mechanisms has been previously described in various cell models (Trojanek et al.,

2003b; Yang et al., 2005). However, as yet, the precise link between the IGF system

and the regulation of DNA repair systems to remove UVB-induced damage,

particularly in keratinocytes, is still not fully understood. In order to address this,

alterations to the activation of various proteins associated with the DNA damage

response (as discussed in 1.3.2 and 1.3.3) as a result of IGF-IR phosphorylation were

investigated. Irradiated and non-irradiated control keratinocyte monolayers pre-

treated with and without IGF-I were lysed at 1 hour post-irradiation and analysed

using an ELISA antibody array against the DNA damage response proteins ATR,

ATRIP, chk-1, cdc25C and H2A.X (Figure 5.12).

Cell cycle phase

Perc

enta

ge o

f to

tal c

ell

popula

tion

Apopto

tic 1/G0G

S M2G

0

10

20

30

40

50

60

70

80

90

100

SFM

FGM

+ IGF-I

CM

**

*


Figure 5.12. Expression of DNA damage response proteins in IGF-I-treated irradiated keratinocytes

The relative expression levels of proteins associated with the UVB-induced DNA damage response were

investigated in IGF-I pre-treated and untreated irradiated keratinocyte monolayers using a sandwich ELISA

technique. Keratinocytes were pre-treated with either SFM only or SFM containing 15 ng/mL IGF-I prior to

irradiation with 100 mJ/cm2 UVB, or a sham irradiation. Cell lysates obtained 1 hour post-irradiation were

obtained and probed with antibodies against human phospho-ATR (Ser 428), ATRIP, phospho-chk-1 (Ser 345),

phospho-cdc25C (Ser 216) and phospho-histone H2A.X (Ser 139) to determine their relative expression levels in

these samples. The asterisks represent a statistically significant difference (p<0.05) in comparison to matched

samples without IGF-I treatment. Data shown represents the mean values from two independent experiments,

using skin tissue obtained from two independent donors. Error bars represent SEM values.

The phosphorylation of ATR by UVB-induced DNA damage is a critical

initiating step in the proper function of the DNA damage checkpoint (Stokes et al.,

2007). The activation of ATR is responsible for such diverse activities as cell cycle

arrest, regulating DNA repair activities and upregulating the transcription of other

DNA damage response genes. These responses are activated via the ATR-mediated

phosphorylation of downstream targets including chk-1 and p53 (Zhao and Piwnica-

Worms, 2001; Smith et al., 2010). In this study, UVB irradiation was shown to

increase the relative levels of phospho-ATR at serine 428 in both IGF-I treated and

untreated keratinocyte monolayer samples alike. Interestingly however, there was a

Treatment

Ab

so

rban

ce (

450 n

m)

- UVB

+ UVB

- UVB

+ UVB

0.0

0.2

0.4

0.6

0.8

1.0

- IGF-I + IGF-I

ATR

ATRIP

chk-1

cdc25C

H2A.X*

*

*


significant increase in the relative level of phospho-ATR detected in irradiated

keratinocytes pre-treated with IGF-I prior to UVB exposure as compared to those

treated with SFM controls. This suggests that the activation of IGF-IR signalling

cascades may interact with factors regulating the DNA damage response such as

ATR. Additionally, this may also indicate that downstream phospho-ATR-mediated

DNA damage response elements may also be modulated as a result of IGF-IR

activation.

One such substrate of phospho-ATR, ATRIP, has been shown to form a

complex with ATR at the sites of DNA damage and is critical for regulating ATR-

mediated DNA repair and cell cycle checkpoint activities (Cortez et al., 2001).

Importantly, key functions of ATRIP include the regulation of ATR stability,

localisation and kinase activation (Nam and Cortez, 2011). In the UVB-exposed

keratinocytes, the levels of ATRIP remained relatively unchanged as compared to

those from non-irradiated samples under both IGF-I treated and untreated conditions.

The signalling cascade resulting from the ATR-mediated phosphorylation of

chk-1 is essential for promoting cell survival and DNA repair, as the principal

effector of the DNA damage and replication checkpoints (Smith et al., 2010).

Notably, this ATR/Chk1-dependent checkpoint signalling cascade also regulates the

activity and function of p53 by enhancing its stability and ability to inhibit apoptosis

(Adimoolam and Ford, 2003). In line with the increased levels of phosphorylated

ATR detected in irradiated keratinocytes pre-treated with IGF-I, significantly

elevated levels of phospho-chk-1 were also found in these cells.

Another downstream process associated with chk-1 activation is the

phosphorylation of the protein phosphatase cdc25C, a regulator of cellular mitosis

(Peng et al., 1997). Both IGF-I treated and untreated keratinocytes showed elevated

levels of phospho-cdc25C in cell lysates in response to UVB radiation. Interestingly,

there was a significant reduction in the proportion of phospho-cdc25C in cells

exposed to IGF-I prior to irradiation. However, studies on cell lysate samples

obtained at more post-irradiation time-points need to be conducted, with previously

published data showing peak levels of phospho-cdc25C being detected between 6

and 9 hours after DNA damage (Gutierrez et al., 2010).

Histone H2A.X is activated via phosphorylation at serine 139, thus forming a

central component in several DNA repair mechanisms, such as those initiated


following double-strand breaks (Rogakou et al., 1998). UVB-irradiated cells have

been shown to have elevated levels of phosphorylated H2A.X, a downstream result

of ATM and ATR-dependent pathways, and can be used as a marker for analysing

the efficacy of DNA repair systems in irradiated skin (Albino et al., 2004; Barnes et

al., 2010). Exposure to UVB radiation significantly increased the relative levels of

phospho-H2A.X in keratinocytes. However, pre-treatment with IGF-I had no

apparent effect on the levels of this histone detected in the cell lysates of irradiated

keratinocytes.

In conclusion, irradiated keratinocytes pre-treated with IGF-I demonstrated an

enhanced DNA damage response. In these cells, significantly higher levels of

phosphorylated ATR, chk-1 and cdc25C were observed following UVB irradiation.

This enhanced DNA damage response may therefore contribute to the IGF-I-

mediated modulation of downstream effects such as accelerated DNA repair,

increased cell survival and the activation of p53 described in the previous sections.


5.4 DISCUSSION

Paracrine signalling via the ligand-induced activation of receptor tyrosine

kinases represents an important paradigm of mesenchymal-epithelial interactions

(Birchmeier and Birchmeier, 1993). For example, the KGF, HGF/SF and IGF

systems have been well-established as modulators of several important processes in

epithelial tissues including proliferation, differentiation and migration (Aaronson et

al., 1990; Gartner et al., 1992; Parrott et al., 1994; Stewart, 1996; Ohmichi et al.,

1998; Maas-Szabowski et al., 1999). Besides playing central roles in developmental

and homeostatic programs within the epidermis, fibroblast-keratinocyte signalling

has also been shown to be critical for epithelial regeneration during regenerative

processes, such as wound-healing (Werner et al., 2007). The experimental data

reported in Chapter 4 of this thesis have further highlighted the importance of

dermal-epidermal crosstalk in orchestrating keratinocyte responses to UVB-induced

damage. Indeed, the presence of fibroblasts in 2D and 3D in vitro models was

reported herein to significantly inhibit UVB-induced keratinocyte apoptosis, enhance

cell viability and the repair of CPD photolesions and regulate the activation of key

tumour suppressor proteins, such as p53. Thereupon, the next objective of this

project was to investigate the role of the IGF system as part of the fibroblast-

mediated modulation on the abovementioned keratinocyte photoresponse.

Keratinocytes are well-equipped to resist oncogenic transformation resulting

from chronic exposure to physiologically-relevant doses of environmental UVB

through the activation of cell-cycle arrest and complex DNA repair mechanisms prior

to resuming normal cell replication (Liu et al., 1983; Bykov et al., 1999). High levels

of UVB, on the other hand, result in irradiated keratinocytes undergoing programmed

cell death in response to the extensive genotoxic stress (Zhuang et al., 2000). The

degree of genomic damage sustained by the UVB-exposed cell, the generation of

ROS and the activation of death receptors by UVB have all been named as major

factors in determining cellular fate post-irradiation (Kulms et al., 2002). However,

other regulatory intercellular factors capable of influencing this balance between cell

death and survival in vivo are only partially understood to date. Hence, a clearer

understanding of the molecular mechanisms surrounding these processes is of prime

concern in developing targeted strategies against photocarcinogenesis.


IGF-I is a major cell survival factor present in most tissues in vivo, and is

known to activate the PI3K/AKT signalling pathway with downstream effects

including the promotion of cell proliferation and regulation of cell cycle progression

for both tissue homeostasis and regeneration (Baserga et al., 1997; Cohen, 2006).

Moreover, this system has also been implicated as a key element in the multistep

development of skin cancer in mouse models (Wilker et al., 2005). Accordingly, the

study described in this Chapter was aimed at uncovering the role of IGF-I in

mediating the effects of fibroblast co-culture on keratinocyte photoresponses, using

the Transwell® culture system. Overall, results obtained in this Chapter indicate

IGF-I is a main effector in the regulation of keratinocyte survival, cell cycle

regulation and the DNA damage response after UVB treatment.

Dermal fibroblasts secrete IGF-I, which activates and regulates a variety of

IGF-IR-expressing keratinocyte responses in a paracrine manner (Tavakkol et al.,

1992). Several studies have demonstrated the importance of IGF-IR activation in

maintaining the epidermal equilibrium, primarily via the stimulation of proliferation

and inhibition of differentiation in keratinocytes (DiGiovanni et al., 2000;

Sadagurski et al., 2006). Moreover, elevated levels of IGF-I have been associated

with skin hyperplasia and mutations resulting in the downregulation of IGF-IR result

in a thinner, disrupted epidermis in transgenic mouse models (Liu et al., 1993;

Kanter-Lewensohn et al., 2000a; Kanter-Lewensohn et al., 2000b). Notably, in vivo

studies into the function of IGF-IR signalling in skin have been largely limited due to

IGF-IR-null mice having low survival rates as well as epidermal cells obtained from

IGF-IR-knockout mice possessing poor cell viabilities and proliferative capacities for

in vitro culture (Baker et al., 1993; Baserga et al., 1997). Hence, alternative cell-

based approaches are required to dissect the role of the IGF-IR signalling in the

cellular responses to UVB irradiation.

Application of the Transwell® photobiology model to investigating the effect

of IGF-I photoresponses

The 2D Transwell® model adopted in our study possessed certain advantages

over more complex 3D tissue-based skin models. For example, in the Transwell®

system, keratinocyte monolayers were cultured on permeable membranes physically

separated from fibroblasts in the lower chamber. This allowed for the detachment of

fibroblast-free keratinocyte cultures for both the UVB irradiation protocol as well as


for administering IGF-I and control treatments in SFM. Primary keratinocytes have

been shown to demonstrate poor levels of cell attachment and proliferation in culture

conditions in SFM lacking essential growth factor supplementation, and in the

absence of ECM factors in the in vitro system (Gilchrest et al., 1982; Hirobe, 1994).

Coating of cell culture vessels with ECM components such as collagen I and

fibronectin has been reported to enhance keratinocyte attachment levels in SFM;

however, these factors are also able to independently influence keratinocyte

responses to UVB (Gilchrest et al., 1980; Wang et al., 2012).

Additionally, in the HSE-DED models, the formation of a stratified keratinised

epidermal layer and the 3D nature of the tissue construct may result in

inconsistencies to the penetration of exogenous IGF-I added to cell culture medium

to proliferating basal keratinocytes in these systems. Moreover, interactions between

IGF-I, IGFBPs and ECM proteins such as vitronectin in both the in vivo and in vitro

tissue context have been shown to regulate the bioavailability and functionality of

this growth factor system on keratinocytes (Upton et al., 1999; Hyde et al., 2004).

Hence, future studies pertaining to the role of IGF-I in the photoresponse can take

advantage of organotypic culture models, such as the HSE-DED, in order to examine

these processes in a biologically-relevant system.

Lastly, previously published studies investigating the effects of growth factors

including EGF, KGF, IGF-I and other paracrine factors on keratinocyte cultures

commonly make use of bovine serum albumin or FCS in the cell culture medium

required to support these cells (Bhora et al., 1995; Andreadis et al., 2001; Lee et al.,

2012). With the undefined nature of FCS possibly contributing to experimental

variability in primary keratinocyte responses to exogenous growth factors, the ability

to culture keratinocyte responses in SFM using the Transwell® model as described

herein represents a significant advance.

IGF-I-mediated effects on cell survival in irradiated primary keratinocytes

In both the Transwell® and HSE-KCF skin culture systems described in this

Chapter, IGF-I was detected in cell culture supernatants, with relatively higher levels

detected in the 2D co-culture model. This may be a result of the abovementioned

interactions between IGF-I and ECM elements which may limit the secretion of IGF-

I into the cell culture medium in the HSE-KCF cultures. The physiological

concentration range of cutaneous IGF-I in vivo has yet to be conclusively


determined. However, IGF-I concentrations in blood plasma have been reported to

range between 20 to 100 nM (153.8 to 769.2 ng/mL) (Daughaday and Rotwein,

1989). On studies investigating the minimum effective dose of exogenous IGF-I

required to significantly enhance keratinocyte viability post-irradiation as described

herein, this concentration was found to be 15 ng/mL (Figure 5.4). Collectively, these

results are in parallel with other studies showing levels of IGF-I between 5 and 50

ng/mL as having potent effects not only on keratinocyte proliferation, but also their

resistance to UVB-induced damage (Kuhn et al., 1999; Claerhout et al., 2007).

The regulation of cellular fate, in particular the processes of cell survival,

proliferation and terminal differentiation by the actions of IGF-I have been widely

reported (Stewart and Rotwein, 1996; Sandhu et al., 2002). Largely due to the

practical limitations described previously, relatively few experimental studies

utilising primary human-derived cells and tissues to investigate these IGF-I mediated

processes during the acute UVB response have been conducted. Nonetheless, the

regulation of keratinocyte survival following UV-insult by IGF-I has also been

implicated as being a key aspect of dermal-epidermal interactions during the acute

photoresponse, with the dysregulation of these pathways potentially being involved

in photocarcinogenesis (Lewis et al., 2008; Lewis et al., 2010).

The novel application of the Transwell® culture system to study the impact of

both exogenous IGF-I and human fibroblast-derived secreted factors on primary

keratinocyte photoresponses as described in this Chapter has been previously

unreported. Herein, I report both the increase in post-irradiation keratinocyte cell

viability as well as the inhibition of UVB-induced apoptosis using this in vitro

model. A significant improvement in keratinocyte viability was observed after UVB-

exposure with the pre-treatment of cells with 15 ng/mL of IGF-I, as well as with

fibroblast-CM prior to irradiation. Notably, at these concentrations of exogenous

IGF-I added to the keratinocyte monolayers, the enhancement of cell viability after

UVB exposure was also higher than those observed in cells pre-treated with FGM.

Importantly, FCS-containing cell culture medium contains various undefined factors

shown to inhibit cellular apoptosis via the activation of MAPK pathways (Jung et al.,

2000). Moreover, FGM contains insulin, which shares structural and functional

homology with IGF-I and at high concentrations can cross-react and activate the

IGF-IR (Siddle et al., 2001; Jamali et al., 2003).


In Chapter 4, it was demonstrated that fibroblast co-culture with keratinocytes

prior to UVB exposure decreases the levels of apoptotic cells observed post-

irradiation in both 2D and 3D cell culture contexts. Similarly, a significant inhibition

of keratinocyte apoptosis was reported here, in monolayers pre-treated with both CM

and IGF-I. Interestingly, the addition of an IGF-IR neutralising antibody into the

keratinocyte culture systems prior to irradiation resulted in the significant blocking of

IGF-I-mediated inhibition of apoptosis in cells treated with IGF-I, but not in those

treated with fibroblast CM. This suggests that other fibroblast-secreted factors

besides IGF-I may also provide alternative pathways for preventing keratinocyte

apoptosis after UVB exposure.

The human epidermis is equipped to withstand environmental damage through

sophisticated protective and repair mechanisms in keratinocytes, while importantly,

maintaining its barrier function (Slominski and Pawelek, 1998; Yamaguchi et al.,

2006). To achieve this, the promotion of basal proliferative keratinocyte cell survival

following UVB irradiation is a vital process in maintaining the regenerative potential

of the epidermis (Boehnke et al., 2012). This has been demonstrated in the studies

reported herein; indicating IGF-IR activation and other fibroblast-mediated pathways

promote keratinocyte survival in UVB-exposed cells. This cell survival is associated

with either the activation of cell cycle damage checkpoints and DNA repair or

terminal differentiation (Gandarillas, 1999, 2000).

The cellular signalling pathways surrounding keratinocyte differentiation

following UVB insult, however, remain poorly understood. IGF-IR signalling has

been shown to be critical in regulating keratinocyte differentiation in both normal

and psoriatic skin (Wertheimer et al., 2000; Lerman et al., 2011). Moreover, the

activation of IGF-IR and the subsequent activation of PI3K, ERK 1/2 and mTOR

have previously been shown as important inhibitors of keratinocyte differentiation

post-irradiation (Sadagurski et al., 2006). In future, the role of the IGF-I in activating

differentiation pathways in irradiated keratinocytes can be investigated, taking

advantage of the in vitro models described herein.


IGF-IR signalling and the control of cell cycle progression in UVB-treated

keratinocytes

Besides stimulating proliferation, the activation of IGF-IR and its downstream

signalling pathways have been demonstrated to regulate the progression of the cell

cycle in a variety of cell types (Chen et al., 1995; Sun et al., 1999; Stull et al., 2002).

The activation of cell cycle checkpoints in response to genotoxic stressors is

necessary for the maintenance of genomic integrity and preventing the propagation

of UV-damaged cells (Stokes et al., 2007). Cells harbouring unrepaired DNA

damage which bypass cell cycle checkpoints either undergo apoptosis, or if not

removed, can accumulate genetic changes, thus leading to cancer development

(Hartwell and Kastan, 1994). Upon exposure to UVB radiation, cells have been

shown to activate both the G1/S and G2/M cell cycle checkpoints (Petrocelli and

Slingerland, 2000).

Here, the association between IGF-IR activation and the regulation of

keratinocyte cell cycle phases using a Transwell® culture system has been described.

Importantly, both IGF-I and CM pre-treatment was shown to significantly enhance

the proportion of irradiated keratinocytes in the G0/G1 phase. The p53-dependent

initiation of cell cycle arrest at G1 has been extensively studied in cells exposed to

ionizing radiation (Wade Harper et al., 1993; Lakin and Jackson, 1999). However,

relatively less is known about this response in UV-irradiated cells, with conflicting

results into the mechanisms behind G1 arrest in these DNA-damaged cells having

been described, which may be cell type dependent. While p53-mediated pathways

are not critical for initiating G1 arrest in UVB-treated dermal fibroblasts in vitro, the

increased expression and activation of intranuclear p53 has been shown to be

essential for triggering this checkpoint in UVB-irradiated keratinocytes (Gujuluva et

al., 1994; Loignon et al., 1997).

In the study of p53 expression and activation by IGF-I and CM pre-treated

keratinocytes prior to UVB-irradiation described herein, it was demonstrated that the

abovementioned culture conditions significantly enhanced both the expression and

activation of p53, as compared to cells exposed to SFM only. This increase in the

p53 protein level was also associated with a relative downregulation in p53 gene

expression in IGF-I and CM treated keratinocytes, which points towards post-

transcriptional modification of the p53 protein or the inhibition of p53 degradation


pathways in these cells. Accordingly, the elevation of activated intracellular p53

levels in cells exposed to IGF-I and fibroblast-secreted factors may be associated

with the activation of G1 cell cycle arrest response in keratinocytes described

previously.

In both fibroblast-CM and IGF-I pre-treated irradiated keratinocytes described

in this Chapter, a significant reduction in the proportion of cells at the G2/M phases

was also observed. Complex cellular DNA damage surveillance mechanisms

function to regulate the progression of the cell cycle into this critical mitotic phase

(Morgan and Kastan, 1997). Studies on UVB-irradiated keratinocytes have revealed

an association between the functional status of p53 and the ability of cells to undergo

G2/M arrest, with p53-defective irradiated keratinocytes observed to have elevated

levels of cell cycle arrest at this checkpoint (Athar et al., 2000). Thus, the enhanced

activation of p53 by IGF-IR activation in keratinocytes described herein may

contribute to the p53-mediated inhibition of G2/M arrest in IGF-I pre-treated

keratinocytes. Moreover, the increased chk-1 phosphorylation observed in irradiated

keratinocytes reported herein has also been linked to the inhibition of G2 to M

transition via the downstream activation of Cdc25C (Sanchez et al., 1997; Xiao et

al., 2003).

IGF-IR activation and the DNA damage response in UVB-irradiated

keratinocytes

Keratinocytes respond to UVB-induced DNA damage by activating complex

DNA damage response signal-transduction pathways, which serve to prevent the

propagation of heritable mutations during cell division (Zhou and Elledge, 2000).

Various interacting pathways consisting of an array of DNA damage sensors,

transducers and effectors operate in concert to execute the downstream cellular

responses, such as cell cycle arrest, DNA repair and apoptosis (Stokes et al., 2007;

Liu et al., 2009). The molecular mediators responsible for sensing DNA damage in

mammalian cells have yet to be comprehensively defined to date. However,

transducers of these pathways have been well-characterised, of which ATM and

ATR are known to be the main players involved in propagating downstream signals

in response to DNA damage (Elledge, 1996).

The detection of CPDs in irradiated keratinocyte monolayers and skin

substitutes has been utilised commonly as a measure of photogenotoxicity and the


repair of UVB-induced DNA damage (Marrot et al., 2010; Wölfle et al., 2011).

Herein, the enhancement of CPD repair in irradiated keratinocytes pre-treated with

IGF-I and fibroblast CM was reported (Figure 5.8). Furthermore, blocking the

activation of the IGF-IR using neutralising antibodies in both IGF-I and CM-treated

keratinocyte cultures reversed this promotion of CPD repair in UVB-exposed cells

(Figure 5.9). These results illustrate the significance of fibroblast-secreted factors,

including IGF-I, on driving the repair of DNA photolesions in keratinocytes.

Importantly, the accumulation of unrepaired nuclear CPDs has been identified as the

principal cause of NMSC development (Jans et al., 2005). Moreover, p53 hot spot

mutations from human NMSC tumours strongly correlate with incomplete CPD

repair in these tissues (Drouin and Therrien, 1997). Hence the fibroblast-mediated

acceleration of CPD repair may have important implications in the nature of

photocarcinogenesis.

In UVB-exposed cells, the activation of ATR has been shown to be an

initiating step in the recruitment of downstream members of the DNA damage

response program (Smith et al., 2010). In the study reported herein, a significant

enhancement of phosphorylated ATR and chk-1 were detected in UVB-irradiated

keratinocytes pre-treated with IGF-I. The role of IGF-IR activation in the ATR-

mediated DNA repair response has been a relatively unexplored area. However,

emerging experimental evidence indicates a connection between IGF-I and the

cellular maintenance of genomic stability (Yang et al., 2005; Hinkal and Donehower,

2008). For example, it has been demonstrated that IGF-IR signalling enhances

neuronal and kidney cell survival via the stimulation of ATM (Yang and Kastan,

2000). Moreover, this activated phospho-ATM was also shown to upregulate the

transcription of IGF-IR, which may also act as a positive regulator of cell survival

and DNA repair after irradiation (Peretz et al., 2001). Additionally, the functionality

of the DNA repair protein Rad51 has been associated with the enhanced activity of

the IGF-IR signalling molecule, IRS-1 following the formation of double-strand

DNA breaks by ionizing radiation (Trojanek et al., 2003a). Downstream from ATR

activation, ATRIP has been demonstrated to regulate many aspects of ATR-mediated

DNA repair and cell cycle regulation, though the precise biological activity of ATR-

ATRIP complexes is still not completely understood (Cortez et al., 2001). In the

Transwell® keratinocyte system reported herein, the activation of IGF-IR did not


significantly alter the levels of ATRIP in keratinocytes after UVB irradiation. The

activation of downstream pathways following ATR phosphorylation, however, have

been observed to also occur in an ATRIP-independent manner (Ball et al., 2005).

Hence, the regulation of ATR activity in irradiated keratinocytes by IGF-I requires

further investigation.

Phospho-ATR propagates DNA damage response signals via the activation of

chk-1, a process which has been shown to be a principal trigger of DNA damage and

replication checkpoints after genomic damage (Liu et al., 2000; Zhao and Piwnica-

Worms, 2001). The analysis of DNA damage pathways activated in irradiated

keratinocytes described herein showed an elevation in the levels of phospho-chk-1 in

cells pre-treated with IGF-I. The activation of the ATR/chk-1 pathway has

previously been described as having a protective effect on irradiated keratinocytes by

inhibiting apoptosis and enhancing p53 stability (Adimoolam and Ford, 2003;

Blasina et al., 2008; Lu et al., 2008; Heffernan et al., 2009). The phosphorylation of

the protein phosphatase cdc25C at Serine 216, an important mitotic regulator, is

another downstream event from chk-1 activation (Peng et al., 1997). Phospho-

cdc25C creates a binding site for 14-3-3 proteins, thus forming a complex which

blocks cellular entry into mitosis at the G2/M checkpoint following DNA damage

(Furnari et al., 1999; Kumagai and Dunphy, 1999). In IGF-I treated irradiated

keratinocytes, a significant reduction in the levels of phospho-cdc25C was observed

as compared to irradiated cells in SFM only. However, studies on cell lysate samples

obtained at more post-irradiation time-points need to be conducted, with previously

published data showing peak levels of phospho-cdc25C being detected between 6

and 9 hours after the generation of DNA damage (Gutierrez et al., 2010).

Theoretically, the ATR/chk-1-mediated activation of DNA damage response

pathways and cell cycle checkpoints in the keratinocytes would enhance the repair of

UVB-induced DNA damage in these cells. However, recent studies suggest a

potential link between the inhibition of ATR/chk-1 pathways and the seemingly

contradictory effect of NMSC suppression (Heffernan et al., 2009; Kawasumi et al.,

2011). These studies have demonstrated the potential for caffeine as a therapeutic

against NMSC development by blocking ATR/chk-1-regulated cell survival and

promoting apoptosis in keratinocytes harbouring p53 mutations (Kerzendorfer and

O'Driscoll, 2009). These findings, along with the IGF-I-mediated enhancement of


ATR/chk-1 pathways reported herein illustrate the complexity of keratinocyte

photoresponses and epidermal photocarcinogenesis, for which identifying potential

therapeutic targets remains challenging.

Conclusion and significance

The body of work presented in this Chapter describes for the first time, the

effects of both fibroblast-secreted factors and recombinant IGF-I on keratinocyte

responses to UVB radiation, using a Transwell® in vitro model. The addition of IGF-

I to keratinocyte cultures and the subsequent activation of the IGF-IR resulted in

significant shifts in cell cycle progression, the inhibition of apoptosis, the stimulation

of DNA repair, as well as the modulation of p53 expression and activity.

Furthermore, blocking of IGF-IR activity in co-cultured fibroblasts significantly

reduced the fibroblast-induced inhibition of apoptosis and enhancement of CPD

repair in irradiated keratinocytes. Notably, IGF-IR activation was also shown to play

a role in the activation of members of the DNA damage response following UVB

irradiation, such as ATR, chk-1 and cdc25.

Studies on the influence of IGF-IR activation and its downstream signalling

pathways on UVB responses in primary human keratinocytes have thus far been

limited (Héron-Milhavet et al., 2001; Trojanek et al., 2003a; Thumiger et al., 2005;

Lewis et al., 2008). The requirement of a fibroblast feeder layer and complex cell

culture medium using undefined elements such as FCS for supporting the in vitro

culture of human keratinocytes has restricted investigations into the specific

pathways involved in orchestrating the protective UVB photoresponse. The

Transwell® photobiology utilised in this study describes the cultivation of primary

keratinocytes in a defined SFM, with and without the presence of human dermal

fibroblast co-culture for analysing the cellular effects associated with IGF-I pre-

treatment on cell survival, repair and apoptosis post-irradiation. Importantly, this in

vitro model represents a highly advantageous platform from which other molecular

mediators critical to the epidermal response to UVB exposure can be characterised in

future. Potentially, the testing of novel photoprotectants and therapeutics against

cellular UVB-damage can also be conducted using this technique in combination

with 3D organotypic skin models. Additionally, this technique of keratinocyte

culture can also be modified to promote the stratification of keratinocytes, thus


forming a 3D Transwell® keratinocyte culture model which more closely

recapitulates the epidermis in vivo (Kandyba et al., 2008).

Importantly, the results reported herein demonstrate the close association

between fibroblast-secreted factors, in particular IGF-I, on the regulation of normal

protective responses of keratinocytes to the damaging effects of UVB radiation.

Hence, the dysregulation of normal fibroblast function in skin may therefore impact

negatively upon the protective and regenerative potential of proliferative

keratinocytes within the epidermis. Indeed, emerging epidemiological and

experimental evidence points towards a correlation between diminishing fibroblast

functionality in photodamaged or aging skin and an increased risk of NMSC

development (Chuang et al., 2005; Lewis et al., 2010). Accordingly, with the

importance of IGF-I in facilitating DNA repair and cell cycle regulation in irradiated

keratinocytes as demonstrated in this Chapter, this pathway may have the potential to

be targeted in the development of novel therapeutics to minimise photodamage and

the risk of photocarcinogenesis. Researchers within our laboratory have characterised

a novel growth factor complex, VitroGro® ECM (Tissue Therapies, Brisbane,

Australia), consisting of ECM, IGFBP and IGF-I components, which has been

proven to accelerate re-epithelialisation and epidermal regeneration following skin

damage. With the potent photoprotective effects of IGF-I observed in UVB-treated

human keratinocytes reported herein, such therapies may conceivably be applied to

treating and protecting against skin sun damage.

Chapter 6: General discussion 187

Chapter 6: General discussion

Australia experiences some of the highest levels of solar UVR globally and as

a consequence, it is estimated that 2 in 3 Australians will be diagnosed with a form of

skin cancer by the age of 70 (Gies, 1998; Staples et al., 2006). Skin cancers represent

the biggest cancer-related financial burden on the Australian health care system,

costing an estimated $300 million annually (Australian Institute of Health and

Welfare, 2005). In particular, NMSCs represent the most commonly diagnosed skin

malignancy in Australia, with an estimated 430,000 new cases diagnosed in 2008

(Australian Institute of Health and Welfare, 2008). Moreover, recent studies have

indicated that rapidly rising incidences of NMSCs also represent a global health

problem (Lomas et al., 2012). Hence, there is an urgent need to develop more

effective preventative and therapeutic strategies to address the incidences of UVR-

induced skin cancers. Associations between unprotected sun exposure and

photocarcinogenesis have been well-established over 40 years of photobiology

research (Epstein, 1978). However, major knowledge gaps still exist in our

understanding of the skin’s intrinsic responses to UVR and in particular, how these

cellular processes are disrupted during skin cancer development and progression. In

part, the lack of a complete, accessible and biologically-relevant experimental model

to investigate the human photoresponse has impeded the progress of photobiology

research thus far.

In view of this, the overriding aim of this project was to develop and

characterise novel in vitro approaches to study human keratinocyte responses to

UVB. Importantly, some of the major limitations associated with several currently-

used photobiology models, including small animal and conventional cell culture

systems were addressed in the development of the experimental skin models

described herein. The data obtained from the studies reported in this dissertation, as

presented in Chapters 3 to 5 have described the novel application of fibroblast-

keratinocyte Transwell® co-cultures and 3D tissue-engineered skin equivalent

constructs as primary cell-based platforms for the analysis of epidermal responses to

UVB.

188 Chapter 6: General discussion

Using these experimental strategies, the most significant outcomes of this

project are:

1. Two 3D organotypic skin equivalent culture models comprised of a

stratified epidermal layer cultured on an acellular or fibroblast-

populated dermal scaffold, termed the HSE-KC and HSE-KCF

respectively, have been successfully characterised in terms of their

physiological similarity to native skin.

2. Significantly, I have reported for the first time, the validation of these

reconstituted skin composites as in vitro photobiology models, with

several archetypal markers of UVB skin damage shown to be

experimentally-induced in these skin composites. Moreover, it was

demonstrated that keratinocytes within the HSE-KC and HSE-KCF

retained the ability to repair UVB-induced damage and undergo a

process of epidermal regeneration following irradiation.

3. This thesis describes a novel strategy for investigating epidermal-

dermal interactions during the acute UVB response by utilising the 3D

HSE-KCF skin culture model and the novel Transwell® fibroblast-

keratinocyte co-culture system. Notably, the influence of paracrine

signalling from dermal fibroblasts on the inhibition of keratinocyte

apoptosis, the acceleration of DNA photolesion repair and the

enhancement of p53 activation and epidermal regeneration following

UVB irradiation in these in vitro photobiology systems were described.

4. The IGF system, in particular the IGF-I-mediated activation of IGF-IR,

was reported to be an important pathway of fibroblast-keratinocyte

communication during the UVB response. Importantly, I have

described in this thesis that the suppression of apoptosis, accelerated

repair of CPD DNA photolesions, modulation of cell cycle progression

and the expression and activation of p53, as well as the enhanced

activation of DNA damage response proteins in IGF-I-treated irradiated

keratinocytes. Notably, this represents the first study of the effects of

IGF-I on primary human keratinocyte responses to UVB using the

Transwell® serum-free medium culture system.


Novel in vitro approaches for studying keratinocyte responses to UVB

Commonly utilised biological models for studying the cutaneous responses to

UVR include cell cultures, animal models, as well as a variety of organotypic skin

substitutes (Fernandez et al., 2012b). While these experimental systems have been

advantageous in broadening our knowledge on many aspects of the keratinocyte

photoresponse, these techniques possess inherent limitations which need to be

addressed. Conventional submerged monolayer keratinocyte cultures, for example,

deviate considerably from their physiological similarity to native skin, both in terms

of their structural and biological properties (Mazzoleni et al., 2009). Similarly, small

animal models differ from humans in terms of their cutaneous biology, hence do not

accurately model the human epidermal photoresponse (Szabo et al., 1982; Menon,

2002). Consequently, increasingly robust in vitro skin substitute models

incorporating natural and synthetic tissue scaffolds have been developed to study

cutaneous photoresponses experimentally. Nevertheless, factors such as

reproducibility, accessibility, cost, ethical considerations and biological similarity to

native human skin have hampered their widespread usage in photobiology research

(Marrot et al., 2010; Fernandez et al., 2012b).

To address some of the abovementioned drawbacks of current photobiology

models, the HSE-KC and HSE-KCF skin cultures utilised in this project were chosen

for their ability to recapitulate the basic architecture of human skin, in particular the

organisation of the epidermis. As described in Chapter 3, the HSE-KC was observed

to show several parallels to ex vivo skin in relation to not only the overall structure

and organisation of the epidermis, but also the expression of key epidermal

differentiation markers, including keratins 1, 2e, 10, 11, 14 and filaggrin. Also, in

contrast to some monolayer and skin substitute culture models, the use of the skin

tissue-derived DED scaffold in the HSE-KC was reported to retain elements of the

basement membrane, such as collagen IV (Hinterhuber et al., 2002). Therefore, the

HSE-KC captures aspects of the epidermal microenvironment more faithfully, which

has been shown to impact on cell surface receptor expression, proliferative capacity,

the synthesis of ECM components and importantly, the cellular responses to external

stimuli such as UVR (Bissell et al., 1982; Lin and Bissell, 1993; Smalley et al.,

2006).


UVB is regarded as the most damaging of the UVR wavelengths, in particular

due to its detrimental effects on the stratum basale of the epidermis, especially DNA

damage through the formation of nuclear photolesions and ROS (Brash et al., 1996;

Gailani et al., 1996). Analysis of the irradiated HSE-KC and HSE-KCF constructs

revealed the generation of several key characteristic UVB-induced damage markers,

including the formation of CPD photolesions, apoptotic sunburn cells, p53

expression, as well as increased synthesis of inflammatory cytokines. Importantly,

besides mirroring these aspects of UVB-induced epidermal damage, these skin

equivalent composites were also observed to retain their capacity to repair

photodamage and activate regenerative responses post-irradiation. In the future, other

markers of UV-damage, such as the generation of reactive oxygen species can also

be analysed in these HSE-DED photobiology models, and hold potential for testing

novel antioxidant therapies to counteract this damage (Hanson and Clegg, 2002;

Wertz et al., 2004; Vostalova et al., 2010).

The successful characterisation of the UVB response in the HSE-KC and HSE-

KCF 3D skin models described herein has several significant implications in the field

of photobiology research. Firstly, it represents a novel strategy in the study of UV-

damage, repair and regeneration within a physiologically-relevant tissue

microenvironment. Critically, the formation of a well-organised and stratified

epidermis is advantageous over conventional monolayer cultures in a variety of

applications (Bernerd and Asselineau, 1998, 2008). This reconstituted skin model has

the potential to be used to test topically-applied photoprotectants and sunscreens

against UVB radiation-induced skin damage (Bernerd et al., 2000; Lejeune et al.,

2008; Marionnet et al., 2011; Bernerd et al., 2012). Next, the use of these skin

reconstructs can reduce the requirement for animal and human participant models,

many of which are associated with extensive ethical considerations and limitations.

Currently, there is a global shift towards restricting the use of experimental animal

models for testing and developing skin treatments and cosmetic products (Welss et

al., 2004). In view of this, the HSE-DED may represent a cost effective, easily

accessible and biologically compatible substitute for the use of animals in the testing

and development of novel and improved sunscreens and treatments for sun damage.

Besides analysing the UVB-induced alterations to the epidermis, the HSE-KCF

(consisting of both an epidermal and fibroblast-populated dermal component) can


also be employed to study various dermal modifications as a result of UVA

exposure. This wavelength penetrates into the dermis and damages fibroblasts, thus

causing ECM modifications associated with photoaging, including the degradation of

collagen (Kligman, 1996; Bernerd and Asselineau, 1998; Wlaschek et al., 2001;

Svobodova et al., 2006; Amano, 2009). While organotypic skin models incorporating

synthetic dermal scaffolds have recently been used as photoaging models, the

application of the HSE-KCF may be more beneficial and physiologically-relevant

due to its use of an ex vivo dermis (Sok et al., 2008).

The epidermal component of the HSE-KC consists solely of keratinocytes at

different stages of differentiation. To more closely mimic the anatomy of the native

epidermis, other epidermal cell types including melanocytes and Langerhans cells

can be incorporated into the HSE model in future. Pigmented HSE models have

previously been employed to study events in the epidermal photoresponse, such as

melanogenesis (Topol et al., 1986; Archambault et al., 1995; Liu et al., 2011).

However, the isolation and culture of human melanocytes in vitro have had mixed

results in terms of preserving the original morphological, genetic and functional

aspects of these cells (Halaban et al., 1986; Halaban, 2000; Czajkowski, 2011). Skin

equivalents for photobiology with an integrated immune component have also been

previously described, wherein Langerhans and dendritic cells obtained from blood-

derived monocytes have been seeded into the HSE epidermis (Bechetoille et al.,

2007). Hence, combining these techniques to create improved HSE-DED models

represents a possible strategy towards creating experimental skin models that more

closely mimic the in vivo situation.

The HSE-DED skin construct utilised primary human keratinocytes seeded

onto an ex vivo dermal scaffold. This model may therefore represent a highly

advantageous in vitro platform for studying various aspects of photobiology in

human cells while bypassing the limitations associated with exposing volunteers to

UVR. Using this technique, primary keratinocytes can be obtained and cultured from

a specific subset of individuals to study the epidermal responses to UVB in, for

example, psoriatic or geriatric skin. However, the responses of primary keratinocytes

to UVR are highly dependent on factors such as the phototype of the skin donor, the

anatomical location of the tissue of origin, the age and gender of the donor, as well as

pre-existing medical conditions (Thomas-Ahner et al., 2007; Lewis et al., 2010;


Weatherhead et al., 2011; Smit et al., 2012). Additionally, primary cells and tissues

have a limited lifespan and capacity to scale up to the large cell numbers that are

often required to generate multiple constructs required for statistical analyses, thus

creating significant intra- and inter-laboratory variations (Brohem et al., 2011). The

use of immortalized cell lines such as HaCaT cells in organotypic skin models can

aid in addressing the reproducibility and consistency for biological, clinical and

industrial research applications (Boelsma et al., 1999). On the other hand,

reconstructed epidermal composites comprised of HaCaT keratinocytes have been

demonstrated to possess poor tissue organisation and cellular morphology

histologically, accompanied with a marked alteration in the tissue architecture

(Schoop et al., 1999). Moreover, HaCaT cells possess p53 mutations which can

significantly alter their responses to UVB compared to normal human keratinocytes

(Lehman et al., 1993; Henseleit et al., 1997). In this thesis, I report significant

histological and immunohistochemical similarities between the HSE-DED constructs

and native skin, particularly in terms of the structure and organisation of the

epidermis. Hence, performing sufficient experimental replicates and applying

parameters to the choice of skin tissue donors may aid in limiting inter-sample

variability, thus creating a robust and representative biological skin model.

While reconstructed skin models such as the HSE-DED are beneficial for their

similarity to native skin, the complexity of these systems may limit their use for

certain experimental applications. For instance, investigating the effects of the

addition of specific treatments to the cell culture medium is limited due to the

waterproof nature of the stratum corneum and the densely packed collagen fibres of

the DED, which may limit the permeability of substances to the basal keratinocytes.

The use of keratinocyte monolayer cultures can overcome such limitations. However,

the requirement for an irradiated mouse fibroblast feeder layer and complex,

undefined cell culture medium in routine primary keratinocyte culture methods pose

a problem for: 1) studying the effects of specific growth factors, particularly at low

concentrations; and 2) investigating fibroblast-keratinocyte paracrine interactions in

primary cells (Rheinwald, 1975). Herein, the use of a Transwell® co-culture system

which possesses several novel features over conventional keratinocyte culture

methods is described. Firstly, this culture technique supports the cultivation of

fibroblast-free keratinocyte monolayers in serum-free medium conditions, thus


negating the requirement of lethally-irradiated mouse fibroblasts as a feeder layer.

Instead, primary dermal fibroblasts are used to support keratinocyte cultures, which

can then be used for investigating paracrine interactions between these two

physically-separated cell populations. Secondly, upon the establishment of these

primary keratinocyte cultures, they can then be transferred to fibroblast-free, serum-

free conditions for studying the effects of specific treatments on these cells. Members

of our research group have also previously described alternative methods for the

serum-free cultivation of primary keratinocytes and fibroblasts using recombinant

proteins or lethally-irradiated human fibroblasts, which in future, may also be used in

conjunction with the Transwell® model described herein (Mujaj et al., 2010).

Additionally, a recent study has also described the use of non-irradiated human

fibroblasts to support the growth of keratinocyte cultures for clinical purposes (Jubin

et al., 2011). Accordingly, the integration of these culture techniques, together with

the Transwell® and HSE-DED models described in this thesis, may aid in the

creation of improved experimental platforms for a variety of keratinocyte research

applications.

Investigating the role of dermal-epidermal paracrine interactions during the

UVB response

Human keratinocytes possess sophisticated protective and repair mechanisms

to resist oncogenic transformation by the damaging effects of UVB exposure

(D'Errico et al., 2007). However, factors within the cutaneous microenvironment that

influence these processes are still not completely understood. The studies undertaken

in this thesis describe for the first time, using novel in vitro approaches, the

modulation of keratinocyte responses to UVB through the action of fibroblast-

secreted factors. Indeed, the presence of dermal fibroblasts in both 2D and 3D cell

culture systems resulted in the significant inhibition of UVB-induced apoptosis, the

augmentation of DNA repair processes, as well as enhanced p53 activation in

irradiated keratinocytes.

Fibroblast-keratinocyte interactions and the effect of fibroblast-secreted factors

on epidermal regeneration have been extensively studied, predominantly in wound-

healing (Werner and Smola, 2001; Raja et al., 2007; Werner et al., 2007). Through

the secretion of various cytokines, growth factors and ECM components, fibroblasts

are able to regulate numerous keratinocyte processes, including survival,


proliferation and differentiation, all of which are also central in the epidermal UV

response (Ichihashi et al., 2003; Wong et al., 2007; Nolte et al., 2008). To date, there

has been a strong research focus in relation to the biology of melanocyte responses

and cutaneous immune responses to UV exposure and the risk of melanoma

development (Schwarz, 2008; Zaidi et al., 2012). However, relatively less is

understood about the mechanisms behind fibroblast-keratinocyte crosstalk during the

UVB response and importantly, the initiation, development and progression of

NMSC. The effect of dermal-epidermal paracrine interactions on keratinocyte

responsiveness to UVB has been observed in a variety of in vitro systems (Kuhn et

al., 1999; Will, 2000; Lewis et al., 2010). Notably, it was established via the studies

conducted in this project that fibroblasts had a protective effect on irradiated

keratinocytes, with cells in fibroblast co-culture conditions prior to UVB insult

showing enhanced cell survival during the post-irradiation period.

The inhibition of keratinocyte apoptosis and the promotion of epidermal

regeneration following UVB exposure by dermal fibroblasts, suggest that these cells

may play an important role in maintaining the barrier function of the epidermis after

UV-damage. Preventing widespread keratinocyte death via UVB-induced apoptosis,

as well as inducing proliferation and differentiation during the epidermal

regenerative phase, have been shown to be critical processes in ensuring the

epidermis retains its functionality after environmental stress (Smith and Rees, 1994;

Bernerd et al., 2001b; Del Bino et al., 2004). Also, chronic sun exposure has been

shown to negatively impact on dermal fibroblasts, with altered gene and protein

expression levels and ROS production observed in cells derived from photodamaged

skin (Gilchrest, 1980; Tyrrell and Pidoux, 1989; Ma et al., 2001). Hence, besides

UVB-induced damage to keratinocytes following exposure, the deleterious effects on

dermal fibroblasts may also contribute to shifts in epithelial-mesenchymal crosstalk

and the keratinocyte death-survival balance (van Laethem et al., 2005; van Laethem

et al., 2009).

Another notable result from this study was the influence of fibroblasts on the

expression and activation of the tumour suppressor protein, p53 in UVB-irradiated

keratinocytes. Indeed, p53 has been demonstrated to play a cardinal role in the

development of a wide range of cancer types, with p53 mutations being a key

biomarker of susceptibility in most skin cancers (Rivlin et al., 2011). Despite a


wealth of experimental evidence on the functional significance and biological

activity of p53 being accumulated using various in vivo and in vitro techniques,

much is still unknown regarding the modulation of p53 function and the regulation of

its activity in human keratinocytes (Jonason et al., 1996; Li et al., 1996; Li et al.,

1998). With its central cellular functions, including apoptosis regulation, cell cycle

control and the activation of DNA repair mechanisms, it is evident that the

dysregulation of p53-mediated processes is axial in the initiation of skin cancers.

Besides UVB-induced mutations, post-translational modifications of p53, including

phosphorylation, influence its localisation, stability, DNA binding affinity and

transcriptional activity, and consequently its overall activity (Vousden, 2000;

Vousden and Woude, 2000). In line with this, the results from our study show the

presence of fibroblasts reduced relative levels of p53 mRNA and total protein in

irradiated keratinocytes, while maintaining higher levels of phosphorylated p53 in

these cells, suggesting enhanced protein stability and half-life. With the balance of

p53 stabilisation and destabilisation being critical for DNA repair and the regulation

of the cell cycle, this indicates that the mediation of these processes by fibroblasts

may impact on critical aspects of photocarcinogenesis in keratinocytes (Maki and

Howley, 1997; Geyer et al., 2000). Henceforth, further investigations need to be

conducted to identify the precise mechanisms surrounding the regulation of p53

activity by fibroblast-secreted factors, which can be carried out by taking advantage

of novel in vitro platforms such as the HSE-KCF.

Recent theories suggest that the dysregulation of critical keratinocyte post-

irradiation repair processes may be linked to the diminished functionality of dermal

fibroblasts, such as in aged and photodamaged skin (Lewis et al., 2010). Indeed, the

majority of skin malignancies are detected in individuals over the age of 60, which

illustrates a strong correlation between skin cancer development and advancing age

(Krtolica et al., 2001). It has also been proposed that one of the first epidermal

changes occurring during NMSC development is the replication of keratinocytes

harbouring unrepaired UVB-damaged DNA, which could establish permanent

chromosomal mutations, hence creating a subpopulation of initiated carcinogenic

cells (Parrinello et al., 2005). Dermal-epidermal crosstalk as a pathway for

maintaining appropriate keratinocyte responses to UVB and suppressing UVB-

induced carcinogenesis is a relatively new and unexplored paradigm of non-


melanoma skin carcinogenesis (Lewis, 2008; Lewis et al., 2010). Indeed, the

discovery that fibroblast-secreted factors, such as IGF-I, govern appropriate

keratinocyte responses to UVB, including the balance between cell survival and

apoptosis, is consequential in terms of the development of therapeutic interventions

against NMSC development (Chuang et al., 2005; Lewis, 2008; Lewis et al., 2008).

Collectively, these results illustrate the importance of dermal-epidermal

interactions in orchestrating the repair and regeneration of the epidermis following

UVB exposure and have underlying implications towards the dysregulation of these

processes during photocarcinogenesis. Importantly, while the data obtained from the

studies described here have elucidated some of the fibroblast-mediated functional

outcomes in UVB-exposed keratinocytes, the next step in this research would

involve characterising the specific molecular mediators and pathways involved in

producing these effects.

The role of IGF-I as a fibroblast-mediated regulator of keratinocyte UVB

responses

The IGF system represents a well-studied channel through which fibroblasts

regulate many aspects of epidermal physiology (Haase et al., 2003; Van Lonkhuyzen

et al., 2007; Kricker et al., 2010). Moreover, a major research focus of our laboratory

has been the development of novel therapeutic innovations for skin regeneration by

taking advantage of the potent effects of IGF-I on epidermal repair (Van Lonkhuyzen

et al., 2007; Upton et al., 2008; Kricker et al., 2010; Upton et al., 2011; Xie et al.,

2011). Henceforth, an aim of this thesis was to investigate the role of IGF-I in

modulating keratinocyte survival and repair responses following UVB-induced

damage. Significantly, it was reported herein that physiologically-relevant

concentrations of IGF-I may play central roles in determining keratinocyte cell fate

by influencing apoptosis, cell survival, cell cycle progression, p53 activation and the

DNA damage response in these cells after irradiation. Moreover, these responses

have not previously been reported in primary human keratinocytes cultivated in

serum-free culture conditions.

Using the Transwell® culture system, the improvement of keratinocyte

viability and the inhibition of apoptosis in IGF-I and fibroblast CM-treated cells after

UVB irradiation was reported. The induction of cellular apoptosis in UVB-damaged

cells has to be tightly-regulated in the epidermal context. On one hand, this process is


critical for removing DNA-damaged cells and hence preventing the propagation of

cells possibly harbouring mutations (Zutterman et al., 2010). However, cell death

particularly among basal proliferating keratinocytes must also be limited in order to

retain the barrier function of the epidermis and to ensure the capacity for self-renewal

(Regnier et al., 1986). It has been previously demonstrated that basal keratinocytes

are more susceptible to UVB-induced apoptosis as opposed to terminally

differentiated spinous keratinocytes situated in the suprabasal compartment

(Chaturvedi et al., 1999; Qin et al., 2002; Chaturvedi et al., 2004). Interestingly,

IGF-I signalling is confined to the stratum basale of the epidermis, with both IGF-I

and IGFBP-mediated effects previously described as being capable of influencing

basal keratinocyte responses to UVB (Hollowood, 2000; Williams, 2000;

Handayaningsih et al., 2012). For instance, IGFBP-3 has been shown to affect

keratinocyte survival, differentiation and proliferation in an IGF-I-independent

manner following UVB-treatment (Edmondson et al., 2005; Thumiger et al., 2005).

The higher sensitivity of basal keratinocytes to UVB and the regulation of post-

irradiation cellular fate by IGF-I signalling may therefore be a crucial cutaneous

mechanism for resisting NMSC development.

Significantly, the studies reported in Chapter 5 of this thesis have described the

IGF-I-mediated augmentation of DNA damage response elements following UVB

irradiation, as well as the acceleration of CPD DNA photolesion removal in IGF-I-

treated keratinocytes. Together, this implies that IGF-I signalling may be a critical

element in maintaining the genomic integrity of basal keratinocytes, thus impeding

the initiation of photocarcinogenesis. The involvement of IGF-I in supporting DNA

repair following cellular exposure to radiation has previously been documented

(Héron-Milhavet et al., 2001; Trojanek et al., 2003b; Yang et al., 2005). Moreover,

the analysis of protein networks upregulated as a result of DNA damage reveals

several intersections between the DNA damage response and PI3K-AKT signalling

pathways (Matsuoka et al., 2007). Additionally, the association between IGF-IR

activation and increased p53 activity was reported both in this project, as well as in

other previously-described in vitro systems (Lewis, 2008; Handayaningsih et al.,

2012).

With increasing evidence mounting and implicating the involvement of IGF-IR

signalling pathways in mediating epidermal responses to UVB, and potentially the


initiation of NMSC, the IGF system may be targeted as a therapeutic or preventative

intervention against photodamage in skin. At present, the gold standards of clinical

strategies used to treat photodamaged skin, such as the use of retinoids, lasers and

surgery show limited effectiveness at reversing sun-damage and are associated with

severe side effects (Samuel et al., 2005). Moreover, these therapies generally target

the effects of UVA-induced damage to the dermis for cosmetic purposes (Kang et al.,

2001). Importantly, various chemopreventative strategies against the development of

NMSCs have proven to be unsuccessful thus far, with the use of sunscreens and

screening programs as a preventative measure the only clinical recommendation to

date (Choudhury et al., 2012; Wu and Stern, 2012). Thereupon, the development of

innovative therapeutics targeting the protective properties of the IGF system on UV-

exposed keratinocytes may aid in limiting or counteracting the damaging effects of

UVB. For instance, a novel growth factor complex, VitroGro®, consisting of ECM,

IGFBP and IGF-I components, developed by members of our research group has

been shown to enhance re-epithelialisation and epidermal regeneration in the wound-

healing context (Hollier et al., 2005; Dawson et al., 2006; Upton et al., 2011).

Conceivably, similar treatments may be applied to address the lack of suitable

clinical interventions against NMSC development.

Future directions

The cell-based experimental platforms described in this thesis have

successfully been employed to study factors influencing human keratinocyte

responses to UVB radiation. Following on from the studies presented herein, other

aspects of the epidermal photoresponse can be investigated using these in vitro

models. While the UVB radiation wavelength has been extensively documented as

contributing to biological and clinical aspects of skin photodamage, the role of UVA

in these responses can also be investigated using the models described herein.

Indeed, UVA is known to play major roles in skin immunosuppression, photoaging

and carcinogenesis (Lowe et al., 1995; Seite et al., 2010). Moreover, UVA accounts

for the majority of the solar UV irradiance present on the terrestrial surface. Hence,

strategies for photoprotection against the harmful effects of both UVA and UVB

radiation can be identified and tested using the in vitro platforms described in this

thesis (Moyal, 2012). For example, the HSE-DED constructs and Transwell®


keratinocyte cultures can be irradiated with solar simulated UVR, to more accurately

represent cutaneous solar UVR exposure (Kostyuk et al., 2012).

While IGF-I has been identified as an important modulator of the keratinocyte

UVB photoresponse, other fibroblast-secreted factors which may also function to

protect the epidermis from UVB radiation-induced damage can be explored. For

instance, EGF and KGF have also been shown to play a role in regulating post-

irradiation processes (Xu et al., 2006; Lotti et al., 2007; Kovacs et al., 2009). These

and other growth factors and ECM elements can be explored in future and potentially

be taken advantage of in the development of therapeutic and protective clinical

therapies against cutaneous photodamage. Moreover, modulating keratinocyte

expression of genes involved in the IGF-I pathway may be yet another approach to

investigating the mechanisms of IGF-induced photoprotection.


Conclusion

In summary, this PhD project has characterised and validated novel 2D

Transwell® and 3D HSE-DED in vitro skin cell culture photobiology models for

investigating keratinocyte responses to UVB. Notably, as an improvement to many

currently-utilised photobiology models, the HSE-KC and HSE-KCF organotypic skin

cultures described herein were found to show many biological and physiological

parallels to native human skin. Moreover, analysis of UVB-exposed HSE-DED

constructs demonstrated the generation of key markers of epidermal UVB damage

and the capacity for repair and regeneration under culture conditions. Significantly,

the HSE-KCF and Transwell® co-culture systems were employed to describe for the

first time the complex interactions between primary human keratinocytes and dermal

fibroblasts during the acute UVB response using these in vitro models. Fibroblasts

were shown to exert a protective effect on irradiated epidermal keratinocytes and

significantly modulated a range of cellular responses, including cell survival,

apoptosis, DNA repair, p53 activation and epidermal regeneration. Furthermore, the

activation of IGF-IR signalling pathways by IGF-I ligand binding was reported to be

a major pathway of the fibroblast-mediated protection of keratinocytes. Significantly,

IGF-I treatment improved keratinocyte viability, the activation of DNA damage

response pathways, repair of DNA damage and regulated cell cycle progression and

apoptosis, potentially via p53-mediated actions. Taken together, this project has

characterised the use of physiologically-relevant and novel platforms for studying

keratinocyte photoresponses experimentally, with a wide-range of potential research

applications. Additionally, the importance of dermal-epidermal interactions, in

particular via IGF-I, in protecting against UVB-damage and in orchestrating the

repair responses reported herein has identified potential targets for therapeutic and

protective strategies against epidermal photodamage.

Bibliography 203

Bibliography

Aaronson, S. A., Rubin, J. S., Finch, P. W., Wong, J., Marchese, C., et al. (1990) Growth

factor-regulated pathways in epithelial cell proliferation. The American review of respiratory

disease 142:S7-10.

Abbott, A. M., Bueno, R., Pedrini, M.T., Murray, J.M., Smith, R.J. (1992) Insulin-like

growth factor I receptor gene structure. J Biol Chem 267:10759-63.

Abraham, D. J., Eckes, B., Rajkumar, V., Krieg, T. (2007) New developments in fibroblast

and myofibroblast biology: implications for fibrosis and scleroderma. Curr Rheumatol Rep

9:136-43.

Abramoff, M. D., Magalhaes, P.J., Ram, S.J. (2004) Image Processing with ImageJ.

Biophotonics International 11:36-42.

Aburto, M. R., Magariños, M., Leon, Y., Varela-Nieto, I., Sanchez-Calderon, H. (2012)

AKT Signaling Mediates IGF-I Survival Actions on Otic Neural Progenitors. PLoS One

7:e30790.

Adimoolam, S., Ford, J. M. (2003) p53 and regulation of DNA damage recognition during

nucleotide excision repair. DNA Repair (Amst) 2:947-54.

Adler, S., Basketter, D., Creton, S., Pelkonen, O., van Benthem, J., et al. (2011) Alternative

(non-animal) methods for cosmetics testing: current status and future prospects—2010.

Archives of Toxicology 85:367-485.

Ahmed, F. E., Setlow, R. B. (1993) Ultraviolet radiation-induced DNA damage and its

photorepair in the skin of the platyfish Xiphophorus. Cancer research 53:2249-55.

Ahn, S., Yoon, H., Kim, G., Kim, Y., Lee, S., Chun, W. (2010) Designed three-dimensional

collagen scaffolds for skin tissue regeneration. Tissue Eng Part C 16:813-20.

Ainscough, S. L., Barnard, Z., Upton, Z., Harkin, D. G. (2006) Vitronectin supports

migratory responses of corneal epithelial cells to substrate bound IGF-I and HGF, and

facilitates serum-free cultivation. Exp Eye Res 83:1505-14.

Akhurst, R. J., Lehnert, S. A., Gatherer, D., Duffie, E. (1990) The role of TGF beta in mouse

development. Annals of the New York Academy of Sciences 593:259-71.

Akunda, J. K., Chun, K. S., Sessoms, A. R., Lao, H. C., Fischer, S. M., et al. (2007)

Cyclooxygenase-2 deficiency increases epidermal apoptosis and impairs recovery following

acute UVB exposure. Mol Carcinog 46:354-62.

Albert, M. R., Weinstock, M. A. (2003) Keratinocyte Carcinoma. CA: A Cancer Journal for

Clinicians 53:292-302.

204 Bibliography

Albino, A. P., Huang, X., Jorgensen, E., Yang, J., Gietl, D., et al. (2004) Induction of H2AX

phosphorylation in pulmonary cells by tobacco smoke: a new assay for carcinogens. Cell

Cycle 3:1062-8.

Alitalo, K., Kuismanen, E., Myllyla, R., Kiistala, U., Asko-Seljavaara, S., et al. (1982)

Extracellular matrix proteins of human epidermal keratinocytes and feeder 3T3 cells. The

Journal of cell biology 94:497-505.

Amano, S. (2009) Possible Involvement of Basement Membrane Damage in Skin

Photoaging. J Invest Dermatol Symp Proc 14:2-7.

Ami, S. I., Rata, S. K., Noda, T. S., Kayasu, S. T. (1995) Interaction between dermal papilla

cells and follicular epithelial cells in vitro: effect of androgen. British Journal of

Dermatology 132:527-32.

Ananthaswamy, H. N., Kanjilal, S. (1996) Oncogenes and tumor suppressor genes in

photocarcinogenesis. Photochemistry and Photobiology 63:428-32.

Anderson, R. R., Parrish, J. A. (1981) The optics of human skin. J Invest Dermatol 77:13-9.

Ando, Y., Jensen, P.J. (1993) Epidermal growth factor and insulin-like growth factor I

enhance keratinocyte migration. J Invest Dermatol 100:633-9.

Andreadis, S. T., Hamoen, K. E., Yarmush, M. L., Morgan, J. R. (2001) Keratinocyte growth

factor induces hyperproliferation and delays differentiation in a skin equivalent model

system. FASEB 15:898-906.

Annunziata, M., Granata, R., Ghigo, E. (2011) The IGF system. Acta Diabetol 48:1-9.

Arad, S., Konnikov, N., Goukassian, D.A., Gilchrest, B.A. (2007) Quantification of

inducible SOS-Like photoprotective responses in human skin. J Invest Dermatol 127:2629–

36.

Aragane, Y., Kulms, D., Metze, D., Wilkes, G., Poppelmann, B., et al. (1998) Ultraviolet

light induces apoptosis via direct activation of CD95 (Fas/APO-1) independently of its

ligand CD95L. J Cell Biol 140:171-82.

Archambault, M., Yaar, M., Gilchrest, B. A. (1995) Keratinocytes and fibroblasts in a human

skin equivalent model enhance melanocyte survival and melanin synthesis after ultraviolet

irradiation. J Invest Dermatol 104:859-67.

Armstrong, B. K., Kricker, A. (2001) The epidemiology of UV induced skin cancer. J

Photochem Photobiol B 63:8-18.

Artandi, S. E., Chang, S., Lee, S. L., Alson, S., Gottlieb, G. J., et al. (2000) Telomere

dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature

406:641-5.

Bibliography 205

Assefa, Z., Garmyn, M., Vantieghem, A., Declercq, W., Vandenabeele, P., et al. (2003)

Ultraviolet B radiation-induced apoptosis in human keratinocytes: cytosolic activation of

procaspase-8 and the role of Bcl-2. FEBS Lett 540:125-32.

Assefa, Z., Van Laethem, A., Garmyn, M., Agostinis, P. (2005) Ultraviolet radiation-induced

apoptosis in keratinocytes: on the role of cytosolic factors. Biochim Biophys Acta 1755:90-

106.

Assefa, Z., Van Laethem, A., Garmyn, M., Agostinis, P. (2005) Ultraviolet radiation-induced

apoptosis in keratinocytes: on the role of cytosolic factors. Biochim Biophys Acta 1755:90-

106.

Asselineau, D., Bernhard, B., Bailly, C., Darmon, M. (1985) Epidermal morphogenesis and

induction of the 67 kD keratin polypeptide by culture of human keratinocytes at the liquid-

air interface. Experimental Cell Research 159:536-9.

Assmann, A., Ueki, K., Winnay, J.N., Kadowaki, T., Kulkarni, R.N. (2009) Glucose effects

on beta-cell growth and survival require activation of insulin receptors and insulin receptor

substrate. Mol Cell Biol 29:3219-28.

Athar, M., Kim, A. L., Ahmad, N., Mukhtar, H., Gautier, J., et al. (2000) Mechanism of

ultraviolet B-induced cell cycle arrest in G2/M phase in immortalized skin keratinocytes

with defective p53. Biochemical and biophysical research communications 277:107-11.

Aumailley, M., Timpl, R. (1986) Attachment of cells to basement membrane collagen type

IV. The Journal of cell biology 103:1569-75.

Australian Institute of Health and Welfare, A. (2005) Health System Expenditures on Cancer

and Other Neoplasms in Australia, 2000-2001 HWE 29,

Australian Institute of Health and Welfare, A. (2007) Cancer in Australia: an overview, 2006

Registries, A. A. o. C., Cancer Series, 37,

Australian Institute of Health and Welfare, A. (2008) Non-melanoma Skin Cancer: General

Practice Consultations, Hospitalisation and Mortality Cancer Series No. 43, AIHW

Catalogue No. 39,

Baba, H., Yoshida, M., Yokota, T., Uchiwa, H., Watanabe, S. (2005) Human epidermal basal

cell responses to ultraviolet-B differ according to their location in the undulating epidermis.

J Dermatol Sci 38:41-6.

Baker, J., Liu, J. P., Robertson, E. J., Efstratiadis, A. (1993) Role of insulin-like growth

factors in embryonic and postnatal growth. Cell 75:73-82.

Balafa, C., Smith-Thomas, L., Phillips, J., Moustafa, M., George, E., et al. (2005) Dopa

oxidase activity in the hair, skin and ocular melanocytes is increased in the presence of

stressed fibroblasts. Exp Dermatol 14:363-72.

206 Bibliography

Ball, H. L., Myers, J. S., Cortez, D. (2005) ATRIP Binding to Replication Protein A-Single-

stranded DNA Promotes ATR–ATRIP Localization but Is Dispensable for Chk1

Phosphorylation. Molecular Biology of the Cell 16:2372-81.

Bao, Y. (2011) Chromatin response to DNA double-strand break damage. Epigenomics

3:307-21.

Barnes, L., Dumas, M., Juan, M., Noblesse, E., Tesniere, A., et al. (2010) GammaH2AX, an

accurate marker that analyzes UV genotoxic effects on human keratinocytes and on human

skin. Photochemistry and Photobiology 86:933-41.

Baserga, R., Hongo, A., Rubini, M., Prisco, M., Valentinis, B. (1997) The IGF-I receptor in

cell growth, transformation and apoptosis. Biochim Biophys Acta 1332:F105-F26.

Basketter, D. A., Griffiths, H. A., Wang, X. M., Wilhelm, K. P., McFadden, J. (1996)

Individual, ethnic and seasonal variability in irritant susceptibility of skin: the implications

for a predictive human patch test. Contact Dermatitis 35:208-13.

Baxter, R. C. (1994) Insulin-Like Growth Factor Binding Proteins in the Human Circulation:

A Review. Hor Res 42:140-4.

Beak, S. M., Lee, Y. S., Kim, J. A. (2004) NADPH oxidase and cyclooxygenase mediate the

ultraviolet B-induced generation of reactive oxygen species and activation of nuclear factor-

kappaB in HaCaT human keratinocytes. Biochimie 86:425-9.

Beattie, P. E., Finlan, L. E., Kernohan, N. M., Thomson, G., Hupp, T. R., et al. (2005) The

effect of ultraviolet (UV) A1, UVB and solar-simulated radiation on p53 activation and p21.

The British journal of dermatology 152:1001-8.

Bechetoille, N., Dezutter-Dambuyant, C., Damour, O., Andre, V., Orly, I., et al. (2007)

Effects of solar Ultraviolet radiation on engineered human skin equivalent containing both

Langerhans cells and dermal dendritic cells. Tissue Eng 13:2667-79.

Beer, H. D., Gassmann, M. G., Munz, B., Steiling, H., Engelhardt, F., et al. (2000)

Expression and function of keratinocyte growth factor and activin in skin morphogenesis and

cutaneous wound repair. J Investig Dermatol Symp Proc 5:34-9.

Bell, E., Ivarsson, B., Merrill, C. (1979) Production of a tissue-like structure by contraction

of collagen lattices by human fibroblasts of different proliferative potential in vitro. Proc

Natl Acad Sci U S A 76:1274-8.

Benchimol, S., Pim, D., Crawford, L. (1982) Radioimmunoassay of the cellular protein p53

in mouse and human cell lines. The EMBO journal 1:1055-62.

Bender, K., Blattner, C., Knebel, A., Iordanov, M., Herrlich, P., et al. (1997) UV-induced

signal transduction. J Photochem Photobiol B 37:1-17.

Benitah, S. A. (2007) Epidermal stem cells in skin homeostasis and cutaneous carcinomas.

Clin Transl Oncol 9:760-6.

Bibliography 207

Benjamin, R. C., Gill, D. M. (1980) Poly(ADP-ribose) synthesis in vitro programmed by

damaged DNA. A comparison of DNA molecules containing different types of strand

breaks. J Biol Chem 255:10502-8.

Berking, C., Takemoto, R., Satyamoorthy, K., Elenitsas, R., Herlyn, M. (2001) Basic

fibroblast growth factor and ultraviolet B transform melanocytes in human skin. The

American Journal of Pathology 158:943-53.

Bernerd, F. (2005) Human skin reconstructed in vitro as a model to study the keratinocyte,

the fibroblast and their interactions: photodamage and repair processes. Journal de la Societe

de biologie 199:313-20.

Bernerd, F., Asselineau, D. (1997) Successive alteration and recovery of epidermal

differentiation and morphogenesis after specific UVB-damages in skin reconstructed in vitro.

Dev Biol 183:123-38.

Bernerd, F., Asselineau, D. (1998) UVA exposure of human skin reconstructed in vitro

induces apoptosis of dermal fibroblasts: subsequent connective tissue repair and implications

in photoaging. Cell Death Differ 5:792-802.

Bernerd, F., Asselineau, D. (2008) An organotypic model of skin to study photodamage and

photoprotection in vitro. J Am Acad Dermatol 58:S155-9.

Bernerd, F., Asselineau, D., Vioux, C., Chevallier-Lagente, O., Bouadjar, B., et al. (2001a)

Clues to epidermal cancer proneness revealed by reconstruction of DNA repair-deficient

xeroderma pigmentosum skin in vitro. Proc Natl Acad Sci USA 98:7817-22.

Bernerd, F., Asselineau, D. (1997) Successive alteration and recovery of epidermal

differentiation and morphogenesis after specific UVB-damages in skin reconstructed in vitro.

Dev Biol 183:123-38.

Bernerd, F., Del Bino, S., Asselineau, D. (2001b) Regulation of keratin expression by

ultraviolet radiation: differential and specific effects of ultraviolet B and ultraviolet a

exposure. The Journal of investigative dermatology 117:1421-9.

Bernerd, F., Marionnet, C., Duval, C. (2012) Solar ultraviolet radiation induces biological

alterations in human skin in vitro: relevance of a well-balanced UVA/UVB protection.

Indian J Dermatol Venereol Leprol 78 Suppl 1:S15-23.

Bernerd, F., Vioux, C., Asselineau, D. (2000) Evaluation of the protective effect of

sunscreens on in vitro reconstructed human skin exposed to UVB or UVA irradiation.

Photochemistry and Photobiology 71:314-20.

Bernstein, C., Bernstein, H., Payne, C. M., Garewal, H. (2002) DNA repair/pro-apoptotic

dual-role proteins in five major DNA repair pathways: fail-safe protection against

carcinogenesis. Mutat Res 511:145-78.

208 Bibliography

Bertaux, B., Morliere, P., Moreno, G., Courtalon, A., Masse, J. M., et al. (1988) Growth of

melanocytes in a skin equivalent model in vitro. The British journal of dermatology 119:503-

12.

Bessou, S., Pain, C., Taieb, A. (1997) Use of human skin reconstructs in the study of

pigment modifiers. Archives of dermatology 133:331-6.

Bessou, S., Surleve-Bazeille, J. E., Pain, C., Donatien, P., Taieb, A. (1996) Ex vivo study of

skin phototypes. The Journal of investigative dermatology 107:684-8.

Beyer, T. A., Werner, S., Dickson, C., Grose, R. (2003) Fibroblast growth factor 22 and its

potential role during skin development and repair. Experimental Cell Research 287:228-36.

Bhora, F. Y., Dunkin, B. J., Batzri, S., Aly, H. M., Bass, B. L., et al. (1995) Effect of growth

factors on cell proliferation and epithelialization in human skin. J Surg Res 59:236-44.

Bigot, N., Beauchef, G., Hervieu, M., Oddos, T., Demoor, M., et al. (2012) NF-kappaB

Accumulation Associated with COL1A1 Transactivators Defects during Chronological

Aging Represses Type I Collagen Expression through a -112/-61-bp Region of the COL1A1

Promoter in Human Skin Fibroblasts. The Journal of investigative dermatology.

Bijl, M., Reefman, E., Limburg, P. C., Kallenberg, C. G. (2007) Inflammatory clearance of

apoptotic cells after UVB challenge. Autoimmunity 40:244-8.

Billingham, R. E., Silvers, W. K. (1967) Studies on the conservation of epidermal specificies

of skin and certain mucosas in adult mammals. J Exp Med 125:429-46.

Birchmeier, C., Birchmeier, W. (1993) Molecular aspects of mesenchymal-epithelial

interactions. Annu Rev Cell Biol 9:511-40.

Bissell, M. J., Hall, H. G., Parry, G. (1982) How does the extracellular matrix direct gene

expression? J Theor Biol 99:31-68.

Black, A. F., Bouez, C., Perrier, E., Sclotmann, K., Chapuis, F., Damour, O. (2005)

Optimization and Characterization of an Engineered Human Skin Equivalent. Tissue

Engineering 11:723-33.

Black, H. S., deGruijl, F. R., Forbes, P. D., Cleaver, J. E., Ananthaswamy, H. N., et al.

(1997) Photocarcinogenesis: an overview. J Photochem Photobiol B 40:29-47.

Blagosklonny, M. V. (2000) p53 from complexity to simplicity: mutant p53 stabilization,

gain-of-function, and dominant-negative effect. Faseb J 14:1901-7.

Blanpain, C., Fuchs, E. (2009) Epidermal homeostasis: a balancing act of stem cells in the

skin. Nat Rev Mol Cell Biol 10:207-17.

Bibliography 209

Blasina, A., Hallin, J., Chen, E., Arango, M. E., Kraynov, E., et al. (2008) Breaching the

DNA damage checkpoint via PF-00477736, a novel small-molecule inhibitor of checkpoint

kinase 1. Mol Cancer Ther 7:2394-404.

Boehnke, K., Falkowska-Hansen, B., Stark, H. J., Boukamp, P. (2012) Stem cells of the

human epidermis and their niche: composition and function in epidermal regeneration and

carcinogenesis. Carcinogenesis 33:1247-58.

Boelsma, E., Verhoeven, M. C., Ponec, M. (1999) Reconstruction of a human skin

equivalent using a spontaneously transformed keratinocyte cell line (HaCaT). The Journal of

investigative dermatology 112:489-98.

Bogh, M. K., Schmedes, A. V., Philipsen, P. A., Thieden, E., Wulf, H. C. (2010) Vitamin D

production after UVB exposure depends on baseline vitamin D and total cholesterol but not

on skin pigmentation. The Journal of investigative dermatology 130:546-53.

Bonnet-Duquennoy, M., Abaibou, H., Tailhardat, M., Lazou, K., Bosset, S., et al. (2006)

Study of housekeeping gene expression in human keratinocytes using OLISA, a long-

oligonucleotide microarray and q RT-PCR. Eur J Dermatol 16:136-40.

Borg, D. J., Dawson, R. A., Leavesley, D. I., Hutmacher, D. W., Upton, Z., et al. (2009)

Functional and phenotypic characterization of human keratinocytes expanded in microcarrier

culture. Journal of biomedical materials research Part A 88:184-94.

Bosca, A. R., Tinois, E., Faure, M., Kanitakis, J., Roche, P., et al. (1988) Epithelial

differentiation of human skin equivalents after grafting onto nude mice. The Journal of


Boscoe, F., Schymura, M. (2006) Solar ultraviolet-B exposure and cancer incidence and

mortality in the United States, 1993-2002. B M C Cancer 6:264.

Bottger, A., Bottger, V., Sparks, A., Liu, W. L., Howard, S. F., et al. (1997) Design of a

synthetic Mdm2-binding mini protein that activates the p53 response in vivo. Curr Biol

7:860-9.

Boukamp, P., Breitkreutz, D., Stark, H. J., Fusenig, N. E. (1990) Mesenchyme-mediated and

endogenous regulation of growth and differentiation of human skin keratinocytes derived

from different body sites. Differentiation 44:150-61.

Boulares, A. H., Yakovlev, A. G., Ivanova, V., Stoica, B. A., Wang, G., et al. (1999) Role of

Poly(ADP-ribose) Polymerase (PARP) Cleavage in Apoptosis. Journal of Biological

Chemistry 274:22932-40.

Boxman, I. L., Ruwhof, C., Boerman, O. C., Lowik, C. W., Ponec, M. (1996) Role of

fibroblasts in the regulation of proinflammatory interleukin IL-1, IL-6 and IL-8 levels

induced by keratinocyte-derived IL-1. Arch Dermatol Res 288:391-8.

210 Bibliography

Boyce, S., Christianson, D., Hansbrough, J.F. (1988) Structure of a collagen-GAG skin

substitute optimized for cultured human epidermal keratinocytes. J Biomed Mater Res

22:939-57.

Brash, D. E., Ziegler, A., Jonason, A. S., Simon, J. A., Kunala, S., et al. (1996) Sunlight and

sunburn in human skin cancer: p53, apoptosis, and tumor promotion. J Investig Dermatol

Symp Proc 1:136-42.

Brenner, M., Hearing, V.J. (2008) The protective role of melanin against UV damage in

human skin. Photochemistry and Photobiology 84:539-49.

Briggaman, R. A. (1982) Epidermal-dermal interactions in adult skin. The Journal of

investigative dermatology 79 Suppl 1:21s-4s.

Brink, N., Szamel, M., Young, A. R., Wittern, K. P., Bergemann, J. (2000a) Comparative

quantification of IL-1beta, IL-10, IL-10r, TNFalpha and IL-7 mRNA levels in UV-irradiated

human skin in vivo. Inflamm Res 49:290-6.

Brink, N., Szamel, M., Young, A. R., Wittern, K. P., Bergemann, J. (2000b) Comparative

quantification of IL-1ß, IL-10, IL-10r, TNFa and IL-7 mRNA levels in UV-irradiated human

skin in vivo. Inflammation Research 49:290-6.

Briske-Anderson, M. J., Finley, J. W., Newman, S. M. (1997) The influence of culture time

and passage number on the morphological and physiological development of Caco-2 cells.

Proceedings of the Society for Experimental Biology and Medicine Society for Experimental

Biology and Medicine 214:248-57.

Brockes, J. (1990) Developmental biology. Reading the retinoid signals. Nature 345:766-8.

Brohem, C. A., Cardeal, L. B., Tiago, M., Soengas, M. S., Barros, S. B., et al. (2011)

Artificial skin in perspective: concepts and applications. Pigment Cell Melanoma Res 24:35-

50.

Burcombe, R., WIlson, G. D., Dowsett, M., Khan, I., Richman, P., et al. (2006) Evaluation

of Ki-67 proliferation and apoptotic index before, during and after neoadjuvant

chemotherapy for primary breast cancer. Breast Cancer Research 8:R31-41.

Burgering, B. M., Coffer, P. J. (1995) Protein kinase B (c-Akt) in phosphatidylinositol-3-OH

kinase signal transduction. Nature 376:599-602.

Burke, J. F., Yannas, I.V., Quinby, W.C. Jr, Bondoc, C.C., Jung, W.K. (1981) Successful use

of a physiologically acceptable artificial skin in the treatment of extensive burn injury. Ann

Surg 194:413-28.

Burroughs, K., Howe, S., Okubo, Y., Fuchs-Young, R., LeRoith, D., et al. (2002)

Dysregulation of IGF-I signaling in uterine leiomyoma. Journal of Endocrinology 172:83-

93.

Bibliography 211

Burtrum, D., Zhu, Z., Lu, D., Anderson, D. M., Prewett, M., et al. (2003) A Fully Human

Monoclonal Antibody to the Insulin-Like Growth Factor I Receptor Blocks Ligand-

Dependent Signaling and Inhibits Human Tumor Growth in Vivo. Cancer Research

63:8912-21.

Butler, A. A., Blakesley, V. A., Tsokos, M., Pouliki, V., Wood, T. L., et al. (1998a)

Stimulation of Tumor Growth by Recombinant Human Insulin-like Growth Factor-I (IGF-I)

Is Dependent on the Dose and the Level of IGF-I Receptor Expression. Cancer Research

58:3021-7.

Butler, A. A., LeRoith, D. (2001) Minireview: tissue-specific versus generalized gene

targeting of the igf1 and igf1r genes and their roles in insulin-like growth factor physiology.

Endocrinology 142:1685-8.

Butler, A. A., Yakar, S., Gewolb, I. H., Karas, M., Okubo, Y., et al. (1998b) Insulin-like

growth factor-I receptor signal transduction: at the interface between physiology and cell

biology. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular

Biology 121:19-26.

Bykov, V. J., Sheehan, J. M., Hemminki, K., Young, A. R. (1999) In situ repair of

cyclobutane pyrimidine dimers and 6-4 photoproducts in human skin exposed to solar

simulating radiation. The Journal of investigative dermatology 112:326-31.

Cabrijan, L., Lipozencic, J. (2011) Adhesion molecules in keratinocytes. Clinics in

dermatology 29:427-31.

Cadet, J., Douki, T., Pouget, J.P., Ravanat, J.L. (2000) Singlet oxygen DNA damage

products: formation and measurements. Methods Enzymol 319:143-53.

Cadi, R., Dhouailly, D., Sengel, P. (1983) Use of retinoic acid for the analysis of dermal-

epidermal interactions in the tarsometatarsal skin of the chick embryo. Dev Biol 100:489-95.

Caricchio, R., McPhie, L., Cohen, P.L. (2003) Ultraviolet B radiation-induced cell death:

critical role of ultraviolet dose in inflammation and lupus autoantigen redistribution. J

Immunol 171:5778-86.

Carrier, F., Smith, M. L., Bae, I., Kilpatrick, K. E., Lansing, T. J., et al. (1994)

Characterization of human Gadd45, a p53-regulated protein. Journal of Biological Chemistry

269:32672-7.

Castagnoli, C., Alotto, D., Cambieri, I., Casimiri, R., Aluffi, M., et al. (2003) Evaluation of

donor skin viability: fresh and cryopreserved skin using tetrazolioum salt assay. Burns

29:759-67.

Caulin, C., Nguyen, T., Lang, G.A., Goepfert, T.M., Brinkley, B.R., Cai, W.W., Lozano, G.,

Roop, D.R. (2007) An inducible mouse model for skin cancer reveals distinct roles for gain-

and loss-of-function p53 mutations. J Clin Invest 117:1893-901.

212 Bibliography

Cejudo-Marin, R., Tarrega, C., Nunes-Xavier, C. E., Pulido, R. (2012) Caspase-3 cleavage

of DUSP6/MKP3 at the interdomain region generates active MKP3 fragments that regulate

ERK1/2 subcellular localization and function. J Mol Biol 420:128-38.

Chadwick, C. A., Potten, C. S., Nikaido, O., Matsunaga, T., Proby, C., et al. (1995) The

detection of cyclobutane thymine dimers, (6-4) photolesions and the Dewar photoisomers in

sections of UV-irradiated human skin using specific antibodies, and the demonstration of

depth penetration effects. J Photochem Photobiol B 28:163-70.

Chakrabarty, K. H., Dawson, R.A., Harris, P., Layton, C., Babu, M., Gould, L., Phillips, J.,

Leigh, I., Green, C., Freedlander, E., MacNeil, S. (1999) Development of autologous human

dermal-epidermal composites based on sterilized human allodermis for clinical use. Br J

Dermatol 141:811-23.

Chang-Liu, C. M., Woloschak, G. E. (1997) Effect of passage number on cellular response to

DNA-damaging agents: cell survival and gene expression. Cancer Lett 113:77-86.

Chang, F., Steelman, L. S., Shelton, J. G., Lee, J. T., Navolanic, P. M., et al. (2003)

Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK pathway

(Review). International journal of oncology 22:469-80.

Chaturvedi, V., Qin, J.-Z., Denning, M. F., Choubey, D., Diaz, M. O., et al. (1999)

Apoptosis in Proliferating, Senescent, and Immortalized Keratinocytes. J Biol Chem

274:23358-67.

Chaturvedi, V., Qin, J. Z., Stennett, L., Choubey, D., Nickoloff, B. J. (2004) Resistance to

UV-induced apoptosis in human keratinocytes during accelerated senescence is associated

with functional inactivation of p53. J Cell Physiol 198:100-9.

Chen, W. H., Pellegata, N. S., Wang, P. H. (1995) Coordinated effects of insulin-like growth

factor I on inhibitory pathways of cell cycle progression in cultured cardiac muscle cells.


Chen, Y., Rabinovitch, P. S. (1990) Altered cell cycle responses to insulin-like growth factor

I, but not platelet-derived growth factor and epidermal growth factor, in senescing human

fibroblasts. J Cell Physiol 144:18-25.

Cheng, H.-L., Feldman, E. L. (1998) Bidirectional Regulation of p38 Kinase and c-Jun N-

terminal Protein Kinase by Insulin-like Growth Factor-I. Journal of Biological Chemistry

273:14560-5.

Cheng, I. H., Lin, Y.C., Hwang, E., Huang, H.T., Chang, W.H., Liu, Y.L., Chao, C.Y. (2011)

Collagen VI protects against neuronal apoptosis elicited by ultraviolet irradiation via an

Akt/phosphatidylinositol 3-kinase signaling pathway. Neuroscience 183:178-88.

Chipuk, J. E., Green, D. R. (2006) Dissecting p53-dependent apoptosis. Cell Death Differ

13:994-1002.

Bibliography 213

Choudhury, K., Volkmer, B., Greinert, R., Christophers, E., Breitbart, E. W. (2012)

Effectiveness of skin cancer screening programmes. Br J Dermatol 167 Suppl 2:94-8.

Chow, J., Tron, V. A. (2005) Molecular aspects of ultraviolet radiation-induced apoptosis in

the skin. J Cutan Med Surg 9:289-95.

Christmann, M., Tomicic, M. T., Roos, W. P., Kaina, B. (2003) Mechanisms of human DNA

repair: an update. Toxicology 193:3-34.

Chuang, T.-Y., Lewis, D. A., Spandau, D. F. (2005) Decreased incidence of nonmelanoma

skin cancer in patients with type 2 diabetes mellitus using insulin: a pilot study. British

Journal of Dermatology 153:552-7.

Claerhout, S., Decraene, D., Van Laethem, A., Van Kelst, S., Agostinis, P., et al. (2007)

AKT delays the early-activated apoptotic pathway in UVB-irradiated keratinocytes via BAD

translocation. The Journal of investigative dermatology 127:429-38.

Claerhout, S., Van Laethem, A., Agostinis, P., Garmyn, M. (2006) Pathways involved in

sunburn cell formation: deregulation in skin cancer. Photochem Photobiol Sci 5:199-207.

Cleaver, J. (2000) Common pathways for ultraviolet skin carcinogenesis in the repair and

replication defective groups of xeroderma pigmentosum. J Dermatol Sci 23:1-11.

Clemmensen, A., Thomassen, M., Clemmensen, O., Tan, Q., Kruse, T. A., et al. (2009)

Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-

epidermal separation of 4 mm human skin biopsies. Exp Dermatol 18:979-84.

Cohen, P. (2006) Overview of the IGF-I system. Horm Res 65 Suppl 1:3-8.

Coleman, A. J., Richardson, T. J., Orchard, G., Uddin, A., Choi, M. J., et al. (2012)

Histological correlates of optical coherence tomography in non-melanoma skin cancer. Skin

Res Technol.

Collin, C., Moll, R., Kubicka, S., Ouhayoun, J. P., Franke, W. W. (1992) Characterization of

human cytokeratin 2, an epidermal cytoskeletal protein synthesized late during

differentiation. Experimental Cell Research 202:132-41.

Cortez, D., Guntuku, S., Qin, J., Elledge, S. J. (2001) ATR and ATRIP: Partners in

Checkpoint Signaling. Science 294:1713-6.

Costa, R. M., Chigancas, V., Galhardo Rda, S., Carvalho, H., Menck, C.F. (2003) The

eukaryotic nucleotide excision repair pathway. . Biochimie 85:1083-99.

Cotton, J., Spandau, D. F. (1997) Ultraviolet B-radiation dose influences the induction of

apoptosis and p53 in human keratinocytes. Radiat Res 147:148-55.

214 Bibliography

Courdavault, S., Baudouin, C., Charveron, M., Canguilhem, B., Favier, A., et al. (2005)

Repair of the three main types of bipyrimidine DNA photoproducts in human keratinocytes

exposed to UVB and UVA radiations. DNA Repair (Amst) 4:836-44.

Cox, L. S., Lane, D. P. (1995) Tumour suppressors, kinases and clamps: how p53 regulates

the cell cycle in response to DNA damage. BioEssays : news and reviews in molecular,

cellular and developmental biology 17:501-8.

Cui, R., Widlund, H.R., Feige, E., Lin, J.Y., Wilensky, D.L., Igras, V.E., D'Orazio, J., Fung,

C.Y., Schanbacher, C.F., Granter, S.R., Fisher, D.E. (2007) Central role of p53 in the suntan

response and pathologic hyperpigmentation. Cell 128:853-64.

Czajkowski, R. (2011) BRAF, HRAS, KRAS, NRAS and CDKN2A genes analysis in

cultured melanocytes used for vitiligo treatment. Int J Dermatol 50:180-3.

D'Errico, M., Lemma, T., Calcagnile, A., Proietti De Santis, L., Dogliotti, E. (2007) Cell

type and DNA damage specific response of human skin cells to environmental agents. Mutat

Res 614:37-47.

D'Errico, M., Teson, M., Calcagnile, A., Nardo, T., De Luca, N., et al. (2005) Differential

role of transcription-coupled repair in UVB-induced response of human fibroblasts and

keratinocytes. Cancer research 65:432-8.

D'Errico, M., Teson, M., Calcagnile, A., Proietti De Santis, L., Nikaido, O., et al. (2003)

Apoptosis and efficient repair of DNA damage protect human keratinocytes against UVB.

Cell Death Differ 10:754-6.

D’Errico, M., Lemma, T., Calcagnile, A., Santis, L. P. D., Dogliotti, E. (2007) Cell type and

DNA damage specific response of human skin cells to environmental agents. Mutation

Research/Fundamental and Molecular Mechanisms of Mutagenesis 614:37-47.

Danpure, H. J., Tyrrell, R.M. (1976) Oxygen-dependence of near UV (365nm) lethality and

the interaction of near UV and X-rays in two mammalian cell lines. Photochem Photobiol

23:171-7.

Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., et al. (1997) Akt phosphorylation of

BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231-41.

Daughaday, W. H., Rotwein, P. (1989) Insulin-like growth factors I and II. Peptide,

messenger ribonucleic acid and gene structures, serum, and tissue concentrations. Endocr

Rev 10:68-91.

Dawson, R. A., Goberdhan, N.J., Freedlander, E., MacNeil, S. (1996) Influence of

extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to

a dermal wound model. Burns 22:93-100.

Dawson, R. A., Upton, Z., Malda, J., Harkin, D. G. (2006) Preparation of cultured skin for

transplantation using insulin-like growth factor I in conjunction with insulin-like growth

Bibliography 215

factor binding protein 5, epidermal growth factor, and vitronectin. Transplantation 81:1668-

76.

De Fabo, E. C., Noonan, F.P. (1983) Mechanism of immune suppression by ultraviolet

irradiation in vivo. I. Evidence for the existence of a unique photoreceptor in skin and its role

in photoimmunology. J Exp Med 158:84-98.

de Gruijl, F. R. (2002) Photocarcinogenesis: UVA vs. UVB radiation. Skin Pharmacol

Physiol 15:316-20.

de Laat, W. L., Jaspers, N.G., Hoeijmakers, J.H. (1999) Molecular mechanism of nucleotide

excision repair. Genes Dev 13:768-85.

De Luca, M., D'Anna, F., Bondanza, S., Franzi, A. T., Cancedda, R. (1988) Human epithelial

cells induce human melanocyte growth in vitro but only skin keratinocytes regulate its

proper differentiation in the absence of dermis. The Journal of cell biology 107:1919-26.

de Vos, S., Brach, M., Budnik, A., Grewe, M., Herrmann, F., et al. (1994) Post-

transcriptional regulation of interleukin-6 gene expression in human keratinocytes by

ultraviolet B radiation. The Journal of investigative dermatology 103:92-6.

Decraene, D., Agostinis, P., Bouillon, R., Degreef, H., Garmyn, M. (2002) Insulin-like

growth factor-1 mediated AKT activation postpones the onset of Ultraviolet B-induced

apoptosis, providing more time for cyclobutane thymine dimer removal in primary human

keratinocytes. The Journal of Biological Chemistry 277:32587-95.

Decraene, D., Van Laethem, A., Agostinis, P., De Peuter, L., Degreef, H., et al. (2004) AKT

status controls susceptibility of malignant keratinocytes to the early-activated and UVB-

induced apoptotic pathway. The Journal of investigative dermatology 123:207-12.

Del Bino, S., Vioux, C., Rossio-Pasquier, P., Jomard, A., Demarchez, M., et al. (2004)

Ultraviolet B induces hyperproliferation and modification of epidermal differentiation in

normal human skin grafted on to nude mice. The British journal of dermatology 150:658-67.

Denecker, G., Ovaere, P., Vandenabeele, P., Declercq, W. (2008) Caspase-14 reveals its

secrets. The Journal of Cell Biology 180:451-8.

Denfeld, R. W., Tesmann, J. P., Dittmar, H., Weiss, J. M., Schopf, E., et al. (1998) Further

characterization of UVB radiation effects on Langerhans cells: altered expression of the

costimulatory molecules B7-1 and B7-2. Photochem Photobiol 67:554-60.

Denizot, F., Lang, R. (1986) Rapid colorimetric assay for cell growth and survival.

Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability.

Journal of immunological methods 89:271-7.

Denley, A., Cosgrove, L. J., Booker, G. W., Wallace, J. C., Forbes, B. E. (2005) Molecular

interactions of the IGF system. Cytokine Growth Factor Rev 16:421-39.

216 Bibliography

Denning, M. F., Wang, Y., Tibudan, S., Alkan, S., Nickoloff, B. J., et al. (2002) Caspase

activation and disruption of mitochondrial membrane potential during UV radiation-induced

apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ

9:40-52.

Diffey, B. L. (1991) Solar ultraviolet radiation effects on biological systems. Phys Med Biol

36:299-328.

Diffey, B. L. (1992) Stratospheric ozone depletion and the risk of non-melanoma skin cancer

in a British population. Physics in medicine and biology 37:2267-79.

DiGiovanni, J., Bol, D. K., Wilker, E., Beltran, L., Carbajal, S., et al. (2000) Constitutive

expression of Insulin-like growth factor-1 in epidermal basal cells of transgenic mice leads to

spontaneous tumor promotion. Cancer Res 60:1561-70.

Doepfner, K. T., Spertini, O., Arcaro, A. (2007) Autocrine insulin-like growth factor-I

signaling promotes growth and survival of human acute myeloid leukemia cells via the

phosphoinositide 3-kinase//Akt pathway. Leukemia 21:1921-30.

Dong, L., Wen, J., Pier, E., Zhang, X., Zhang, B., et al. (2010) Melanocyte-stimulating

hormone directly enhances UV-Induced DNA repair in keratinocytes by a xeroderma

pigmentosum group A-dependent mechanism. Cancer research 70:3547-56.

Donovan, E. A., Kummar, S. (2008) Role of insulin-like growth factor-1R system in

colorectal carcinogenesis. Proc Natl Acad Sci USA 66:91-8.

Drouin, R., Therrien, J. P. (1997) UVB-induced cyclobutane pyrimidine dimer frequency

correlates with skin cancer mutational hotspots in p53. Photochem Photobiol 66:719-26.

Duval, C., Chagnoleau, C., Pouradier, F., Sextius, P., Condom, E., et al. (2012) Human skin

model containing melanocytes: essential role of KGF for constitutive pigmentation -

functional response to alphaMSH and forskolin. Tissue engineering Part C, Methods.

Duval, C., Regnier, M., Schmidt, R. (2001) Distinct melanogenic response of human

melanocytes in mono-culture, in co-culture with keratinocytes and in reconstructed

epidermis, to UV exposure. Pigment Cell Research 14:348-55.

Duval, C., Schmidt, R., Regnier, M., Facy, V., Asselineau, D., et al. (2003) The use of

reconstructed human skin to evaluate UV-induced modifications and sunscreen efficacy. Exp

Dermatol 12 Suppl 2:64-70.

Dziadziuszko, R., Camidge, D.R., Hirsch, F.R. (2008) The insulin-like growth factor

pathway in lung cancer. J Thoracic Oncol 3:815-8.

Edmondson, S. R., Russo, V.C., McFarlane, A.C., Wraight, C.J., Werther, G.A. (1999)

Interactions between growth hormone, insulin-like growth factor I, and basic fibroblast

growth factor in melanocyte growth. J Clin Endocrinol Metab 84:1638-44.

Bibliography 217

Edmondson, S. R., Thumiger, S. P., Kaur, P., Loh, B., Koelmeyer, R., et al. (2005) Insulin-

like growth factor binding protein-3 (IGFBP-3) localizes to and modulates proliferative

epidermal keratinocytes in vivo. Br J Dermatol 152:225-30.

Edmondson, S. R., Thumiger, S. P., Werther, G. A., Wraight, C. J. (2003) Epidermal

homeostasis: the role of the growth hormone and insulin-like growth factor systems. Endocr

Rev 24:737-64.

Egles, C., Huet, H. A., Dogan, F., Cho, S., Dong, S., et al. (2010) Integrin-blocking

antibodies delay keratinocyte re-epithelialization in a human three-dimensional wound

healing model. PloS one 5:e10528.

Eisinger, M., Marko, O. (1982) Selective proliferation of normal human melanocytes in vitro

in the presence of phorbol ester and cholera toxin. Proc Natl Acad Sci U S A 79:2018-22.

El-Abaseri, T. B., Putta, S., Hansen, L.A. (2006) Ultraviolet irradiation induces keratinocyte

proliferation and epidermal hyperplasia through the activation of the epidermal growth factor

receptor. Carcinogenesis 27:225-31.

El-Ghalbzouri, A., Gibbs, S., Lamme, E., Van Blitterswijk, C. A., Ponec, M. (2002) Effect of

fibroblasts on epidermal regeneration. British Journal of Dermatology 147:230-43.

El Ghalbzouri, A., Commandeur, S., Rietveld, M. H., Mulder, A. A., Willemze, R. (2009)

Replacement of animal-derived collagen matrix by human fibroblast-derived dermal matrix

for human skin equivalent products. Biomaterials 30:71-8.

El Ghalbzouri, A., Lamme, E., Ponec, M. (2002) Crucial role of fibroblasts in regulating

epidermal morphogenesis. Cell Tissue Res 310:189-99.

Elias, P. M. (2005) Stratum corneum defensive functions: an integrated view. The Journal of


Elledge, S. J. (1996) Cell cycle checkpoints: preventing an identity crisis. Science 274:1664-

72.

Enk, C. D., Jacob-Hirsch, J., Gal, H., Verbovetski, I., Amariglio, N., et al. (2006) The UVB-

induced gene expression profile of human epidermis in vivo is different from that of cultured

keratinocytes. Oncogene 25:2601-14.

Enk, C. D., Mahanty, S., Blauvelt, A., Katz, S. I. (1996) UVB induces IL-12 transcription in

human keratinocytes in vivo and in vitro. Photochemistry and Photobiology 63:854-9.

Enk, C. D., Sredni, D., Blauvelt, A., Katz, S. I. (1995) Induction of IL-10 gene expression in

human keratinocytes by UVB exposure in vivo and in vitro. The Journal of Immunology

154:4851-6.

Epstein, J. H. (1978) Photocarcinogenesis: a review. National Cancer Institute

monograph:13-25.

218 Bibliography

Evans, M. K., Bohr, V. A. (1994) Gene-specific DNA repair of UV-induced cyclobutane

pyrimidine dimers in some cancer-prone and premature-aging human syndromes. Mutation

Research 314:221-31.

Everett, M. A., Yeargers, E., Sayre, R. M., Olson, R. L. (1966) Penetration of epidermis by

ultraviolet rays. Photochemistry and Photobiology 5:533-42.

Fadeel, B., Orrenius, S., Zhivotovsky, B. (1999) Apoptosis in human disease: a new skin for

the old ceremony? Biochemical and biophysical research communications 266:699-717.

Falanga, V., Isaacs, C., Paquette, D., Downing, G., Kouttab, N., et al. (2002) Wounding of

bioengineered skin: cellular and molecular aspects after injury. The Journal of investigative


Fang, X., Yu, S., Eder, A., Mao, M., Bast, R. C., Jr., et al. (1999) Regulation of BAD

phosphorylation at serine 112 by the Ras-mitogen-activated protein kinase pathway.

Oncogene 18:6635-40.

Fartasch, M., Ponec, M. (1994) Improved barrier structure formation in air-exposed human

keratinocyte culture systems. The Journal of investigative dermatology 102:366-74.

Ferber, A., Chang, C., Sell, C., Ptasznik, A., Cristofalo, V. J., et al. (1993) Failure of

senescent human fibroblasts to express the insulin-like growth factor-1 gene. The Journal of

Biological Chemistry 268:17883-8.

Fernandez, A. A., Paniker, L., Garcia, R., Mitchell, D. L. (2012a) Recent advances in

sunlight-induced carcinogenesis using the Xiphophorus melanoma model. Comparative

biochemistry and physiology Toxicology & pharmacology : CBP 155:64-70.

Fernandez, M., Sanchez-Franco, F., Palacios, N., Sanchez, I., Fernandez, C., et al. (2004)

IGF-I inhibits apoptosis through the activation of the phosphatidylinositol 3-kinase/Akt

pathway in pituitary cells. J Mol Endocrinol 33:155-63.

Fernández, M. C., Venara, M., Nowicki, S., Chemes, H. E., Barontini, M., et al. (2012) IGF-

I Regulates Pheochromocytoma Cell Proliferation and Survival In Vitro and In Vivo.


Fernandez, T. L., Dawson, R. A., Van Lonkhuyzen, D. R., Kimlin, M. G., Upton, Z. (2012b)

A tan in a test tube -in vitro models for investigating ultraviolet radiation-induced damage in

skin. Exp Dermatol 21:404-10.

Firnhaber, J. M. (2012) Diagnosis and treatment of Basal cell and squamous cell carcinoma.

Am Fam Physician 86:161-8.

Fitzpatrick, T. B., Breathnach, A. S. (1963) [the Epidermal Melanin Unit System]. Dermatol

Wochenschr 147:481-9.

Bibliography 219

Flier, J. S., Usher, P., Moses, A. C. (1986) Monoclonal antibody to the type I insulin-like

growth factor (IGF-I) receptor blocks IGF-I receptor-mediated DNA synthesis: clarification

of the mitogenic mechanisms of IGF-I and insulin in human skin fibroblasts. Proc Natl Acad

Sci U S A 83:664-8.

Franke, T. F., Kaplan, D. R., Cantley, L. C. (1997) PI3K: downstream AKTion blocks

apoptosis. Cell 88:435-7.

Franklin, W. A., Doetsch, P. W., Haseltine, W. A. (1985) Structural determination of the

ultraviolet light-induced thymine-cytosine pyrimidine-pyrimidone (6-4) photoproduct.

Nucleic Acids Res 13:5317-25.

Freedberg, I. M., Tomic-Canic, M., Komine, M., Blumenberg, M. (2001) Keratins and the

keratinocyte activation cycle. The Journal of investigative dermatology 116:633-40.

Fritsche, M., Haessler, C., Brandner, G. (1993) Induction of nuclear accumulation of the

tumor-suppressor protein p53 by DNA-damaging agents. Oncogene 8:307-18.

Fuchs, E., Tyner, A. L., Giudice, G. J., Marchuk, D., RayChaudhury, A., et al. (1987) The

human keratin genes and their differential expression. Current topics in developmental

biology 22:5-34.

Funayama, E., Chodon, T., Oyama, A., Sugihara, T. (2003) Keratinocytes Promote

Proliferation and Inhibit Apoptosis of the Underlying Fibroblasts: An Important Role in the

Pathogenesis of Keloid. 121:1326-31.

Furnari, B., Blasina, A., Boddy, M. N., McGowan, C. H., Russell, P. (1999) Cdc25 inhibited

in vivo and in vitro by checkpoint kinases Cds1 and Chk1. Mol Biol Cell 10:833-45.

Furstenberger, G., Senn, H. J. (2002) Insulin-like growth factors and cancer. Lancet Oncol

3:298-302.

Gailani, M. R., Leffell, D. J., Ziegler, A., Gross, E. G., Brash, D. E., et al. (1996)

Relationship between sunlight exposure and a key genetic alteration in basal cell carcinoma.

J Natl Cancer Inst 88:349-54.

Gajewski, T. F., Thompson, C. B. (1996) Apoptosis meets signal transduction: elimination of

a BAD influence. Cell 87:589-92.

Gallagher, R., Lee, T., Bajdik, C. (2007) Epidemiology of nonmelanocytic skin cancer.

Informa Healthcare USA: New York.

Gambichler, T., Kunzlberger, B., Paech, V., Kreuter, A., Boms, S., et al. (2005) UVA1 and

UVB irradiated skin investigated by optical coherence tomography in vivo: a preliminary

study. Clinical and experimental dermatology 30:79-82.

Gandarillas, A. (2000) Epidermal differentiation, apoptosis, and senescence: common

pathways? Experimental gerontology 35:53-62.

220 Bibliography

Gandarillas, A., Goldsmith, L.A., Gschmeissner, S., Leigh, I.M., Watt, F.M. (1999)

Evidence that apoptosis and terminal differentiation of epidermal keratinocytes are distinct

processes. Exp Dermatol 8:71-9.

Garcia, M., Llames, S., Garcia, E., Meana, A., Cuadrado, N., et al. (2010) In vivo assessment

of acute UVB responses in normal and Xeroderma Pigmentosum (XP-C) skin-humanized

mouse models. Am J Pathol 177:865-72.

Garner, E., Raj, K. (2008) Protective mechanisms of p53-p21-pRb proteins against DNA

damage-induced cell death. Cell Cycle 7:277-82.

Gartner, M. H., Benson, J. D., Caldwell, M. D. (1992) Insulin-like growth factors I and II

expression in the healing wound. J Surg Res 52:389-94.

Geiger, G. A., Fu, W., Kao, G. D. (2008) Temozolomide-mediated radiosensitization of

human glioma cells in a zebrafish embryonic system. Cancer research 68:3396-404.

Geyer, R. K., Nagasawa, H., Little, J. B., Maki, C. G. (2000) Role and regulation of p53

during an ultraviolet radiation-induced G1 cell cycle arrest. Cell Growth Differ 11:149-56.

Ghahary, A., Ghaffari, A. (2007) Role of keratinocyte-fibroblast cross-talk in development

of hypertrophic scar. Wound Repair Regen 15 Suppl 1:S46-53.

Ghosh, M. M., Boyce, S., Layton, C., Freedlander, E., Mac Neil, S. (1997) A comparison of

methodologies for the preparation of human epidermal-dermal composites. Ann Plast Surg

39:390-404.

Gibbs, S., Vicanová, J., Bouwstra, J., Valstar, D., Kempenaar, J., et al. (1997) Culture of

reconstructed epidermis in a defined medium at 33 degrees C shows a delayed epidermal

maturation, prolonged lifespan and improved stratum corneum. Arch Dermatol Res 289:585-

95.

Gies, P. H., Roy C.R., Toomey, S., McLennan, A. (1998) Protection against solar ultraviolet

radiation. Mutation Research:15-22.

Gilchrest, B. A. (1980) Prior Chronic Sun Exposure Decreases the Lifespan of Human Skin

Fibroblasts in Vitro. Journal of Gerontology 35:537-41.

Gilchrest, B. A., Calhoun, J. K., Maciag, T. (1982) Attachment and growth of human

keratinocytes in a serum-free environment. J Cell Physiol 112:197-206.

Gilchrest, B. A., Nemore, R. E., Maciag, T. (1980) Growth of human keratinocytes on

fibronectin -coated plates. Cell Biol Int Rep 4:1009-16.

Gillman, T., Penn, J., Bronks, D., Roux, M. (1955) Possible significance of abnormal dermal

collagen and of epidermal regeneration in the pathogenesis of skin cancers. British journal of

cancer 9:272-83.

Bibliography 221

Gold, R., Schmied, M., Giegerich, G., Breitschopf, H., Hartung, H., et al. (1994)

Differentiation between cellular apoptosis and necrosis by the combined use of in situ tailing

and nick translation techniques. Lab Invest 71:219.

Goldstein, A. M., Chan, M., Harland, M., Hayward, N. K., Demenais, F., et al. (2007)

Features associated with germline CDKN2A mutations: a GenoMEL study of melanoma-

prone families from three continents. Journal of Medical Genetics 44:99-106.

Gordon, P. R., Mansur, C. P., Gilchrest, B. A. (1989) Regulation of human melanocyte

growth, dendricity, and melanization by keratinocyte derived factors. The Journal of


Gotz, C., Pfeiffer, R., Tigges, J., Ruwiedel, K., Hubenthal, U., et al. (2012) Xenobiotic

metabolism capacities of human skin in comparison with a 3D-epidermis model and

keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

Exp Dermatol 21:364-9.

Grandjean-Laquerriere, A., Le Naour, R., Gangloff, S. C., Guenounou, M. (2003)

Differential regulation of TNF-alpha, IL-6 and IL-10 in UVB-irradiated human keratinocytes

via cyclic AMP/protein kinase A pathway. Cytokine 23:138-49.

Green, A., Battistutta, D. (1990) Incidence and determinants of skin cancer in a high-risk

australian population. International Journal of Cancer 46:356-61.

Greenblatt, M., Bennett, W., Hollstein, M., Harris, C. (1994) Mutations in the p53 tumor

suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer research

54:4855-78.

Grewe, M., Gyufko, K., Krutmann, J. (1995) Interleukin-10 production by cultured human

keratinocytes: regulation by ultraviolet B and ultraviolet A1 radiation. The Journal of


Gross, S., Knebel, A., Tenev, T., Neininger, A., Gaestel, M., Herrlich, P., Bohmer, F.D.

(1999) Inactivation of protein-tyrosine phosphatases as mechanism of UV-induced signal

transduction. J Biol Chem 274:26378-86.

Grossman, D., Kim, P. J., Blanc-Brude, O. P., Brash, D. E., Tognin, S., et al. (2001)

Transgenic expression of survivin in keratinocytes counteracts UVB-induced apoptosis and

cooperates with loss of p53. J Clin Invest 108:991-9.

Grundmann, O., Fillinger, J. L., Victory, K. R., Burd, R., Limesand, K. H. (2010)

Restoration of radiation therapy-induced salivary gland dysfunction in mice by post therapy

IGF-1 administration. BMC cancer 10:417.

Gu, W., Roeder, R. G. (1997) Activation of p53 sequence-specific DNA binding by

acetylation of the p53 C-terminal domain. Cell 90:595-606.

222 Bibliography

Gujuluva, C. N., Baek, J. H., Shin, K. H., Cherrick, H. M., Park, N. H. (1994) Effect of UV-

irradiation on cell cycle, viability and the expression of p53, gadd153 and gadd45 genes in

normal and HPV-immortalized human oral keratinocytes. Oncogene 9:1819-27.

Gustafson, T. A., Rutter, W.J. (1990) The cysteine-rich domains of the insulin and insulin-

like growth factor I receptors are primary determinants of hormone binding specificity.

Evidence from receptor chimeras. J Biol Chem 265:18663-7.

Gutierrez, G. J., Tsuji, T., Cross, J. V., Davis, R. J., Templeton, D. J., et al. (2010) JNK-

mediated Phosphorylation of Cdc25C Regulates Cell Cycle Entry and G2/M DNA Damage

Checkpoint. Journal of Biological Chemistry 285:14217-28.

Ha, L., Noonan, F. P., De Fabo, E. C., Merlino, G. (2005) Animal models of melanoma. J

Investig Dermatol Symp Proc 10:86-8.

Haase, I., Evans, R., Pofahl, R., Watt, F. M. (2003) Regulation of keratinocyte shape,

migration and wound epithelialization by IGF-1- and EGF-dependent signalling pathways.

Journal of Cell Science 116:3227-38.

Häcker, G. (2000) The morphology of apoptosis. Cell Tissue Res 301:5-17.

Hakem, R. (2008) DNA-damage repair; the good, the bad, and the ugly. The EMBO journal

27:589-605.

Halaban, R. (2000) The Regulation of Normal Melanocyte Proliferation. Pigment Cell

Research 13:4-14.

Halaban, R., Ghosh, S., Duray, P., Kirkwood, J. M., Lerner, A. B. (1986) Human

melanocytes cultured from nevi and melanomas. The Journal of investigative dermatology

87:95-101.

Halaban, R., Langdon, R., Birchall, N., Cuono, C., Baird, A., et al. (1988) Basic fibroblast

growth factor from human keratinocytes is a natural mitogen for melanocytes. The Journal

of cell biology 107:1611-9.

Hall, P. A., McKee, P. H., Menage, H. D., Dover, R., Lane, D. P. (1993) High levels of p53

protein in UV-irradiated normal human skin. Oncogene 8:203-7.

Halliday, G. (2005) Inflammation, gene mutation and photoimmunosuppression in response

to UVR-induced oxidative damage contributes to photocarcinogenesis. Mutation Res

571:107-20.

Han, W., Ming, M., He, Y. Y. (2011) Caffeine promotes ultraviolet B-induced apoptosis in

human keratinocytes without complete DNA repair. J Biol Chem 286:22825-32.

Handayaningsih, A. E., Takahashi, M., Fukuoka, H., Iguchi, G., Nishizawa, H., et al. (2012)

IGF-I enhances cellular senescence via the reactive oxygen species-p53 pathway. Biochem

Biophys Res Commun.

Bibliography 223

Hanson, K. M., Clegg, R. M. (2002) Observation and Quantification of Ultraviolet-induced

Reactive Oxygen Species in Ex Vivo Human Skin¶. Photochemistry and Photobiology

76:57-63.

Harrison, C. A., Gossiel, F., Bullock, A. J., Sun, T., Blumsohn, A., et al. (2006a)

Investigation of keratinocyte regulation of collagen I synthesis by dermal fibroblasts in a

simple in vitro model. The British journal of dermatology 154:401-10.

Harrison, C. A., Gossiel, F., Layton, C. M., Bullock, A. J., Johnson, T., et al. (2006b) Use of

an in vitro model of tissue-engineered skin to investigate the mechanism of skin graft

contraction. Tissue Eng 12:3119-33.

Hartwell, L. H., Kastan, M. B. (1994) Cell cycle control and cancer. Science 266:1821-8.

Hedley, S. J., Layton, C., Heaton, M., Chakrabarty, K. H., Dawson, R. A., et al. (2002)

Fibroblasts play a regulatory role in the control of pigmentation in reconstructed human skin

from skin types I and II. Pigment Cell Res 15:49-56.

Heenen, M., Thiriar, S., Noël, J. C., Galand, P. (1998) Ki-67 immunostaining of normal

human epidermis: comparison with 3H-thymidine labelling and PCNA immunostaining.

Dermatol 197:123-6.

Heffernan, T. P., Kawasumi, M., Blasina, A., Anderes, K., Conney, A. H., et al. (2009)

ATR-Chk1 pathway inhibition promotes apoptosis after UV treatment in primary human

keratinocytes: potential basis for the UV protective effects of caffeine. J Invest Dermatol

129:1805-15.

Hengartner, M. O. (1997a) Apoptosis and the shape of death. Developmental genetics

21:245-8.

Hengartner, M. O. (1997b) Apoptosis. CED-4 is a stranger no more. Nature 388:714-5.

Henseleit, U., Zhang, J., Wanner, R., Haase, I., Kolde, G., et al. (1997) Role of p53 in UVB-

induced apoptosis in human HaCaT keratinocytes. J Invest Dermatol 109:722-7.

Herlyn, M., Mancianti, M. L., Jambrosic, J., Bolen, J. B., Koprowski, H. (1988) Regulatory

factors that determine growth and phenotype of normal human melanocytes. Experimental

Cell Research 179:322-31.

Hermanto, U., Zong, C. S., Wang, L. H. (2000) Inhibition of mitogen-activated protein

kinase kinase selectively inhibits cell proliferation in human breast cancer cells displaying

enhanced insulin-like growth factor I-mediated mitogen-activated protein kinase activation.

Cell Growth Differ 11:655-64.

Heron-Milhavet, L., Karas, M., Goldsmith, C. M., Baum, B. J., LeRoith, D. (2001) Insulin-

like growth factor-I (IGF-I) receptor activation rescues UV-damaged cells through a p38

signaling pathway. Potential role of the IGF-I receptor in DNA repair. The Journal of


224 Bibliography

Héron-Milhavet, L., Karas, M., Goldsmith, C. M., Baum, B. J., LeRoith, D. (2001) Insulin-

like Growth Factor-I (IGF-I) Receptor Activation Rescues UV-damaged Cells through a p38

Signaling Pathway. Journal of Biological Chemistry 276:18185-92.

Hinkal, G., Donehower, L. A. (2008) How does suppression of IGF-1 signaling by DNA

damage affect aging and longevity? Mech Ageing Dev 129:243-53.

Hinterhuber, G., Marquardt, Y., Diem, E., Rappersberger, K., Wolff, K., et al. (2002)

Organotypic keratinocyte coculture using normal human serum: an immunomorphological

study at light and electron microscopic levels. Exp Dermatol 11:413-20.

Hirai, Y., Nose, A., Kobayashi, S., Takeichi, M. (1989) Expression and role of E- and P-

cadherin adhesion molecules in embryonic histogenesis. II. Skin morphogenesis.

Development 105:271-7.

Hirobe, T. (1994) Keratinocytes are involved in regulating the developmental changes in the

proliferative activity of mouse epidermal melanoblasts in serum-free culture. Dev Biol

161:59-69.

Hiroshima, Y., Bando, M., Kataoka, M., Inagaki, Y., Herzberg, M. C., et al. (2011)

Regulation of antimicrobial peptide expression in human gingival keratinocytes by

interleukin-1α. Archives of Oral Biology 56:761-7.

Ho, J. H., Su, Y., Chen, K. H., Lee, O. K. (2010) Protection of thymosin beta-4 on corneal

endothelial cells from UVB-induced apoptosis. Chin J Physiol 53:190-5.

Hollier, B., Harkin, D. G., Leavesley, D., Upton, Z. (2005) Responses of keratinocytes to

substrate-bound vitronectin: growth factor complexes. Experimental Cell Research 305:221-

32.

Hollier, B. G., Kricker, J. A., Van Lonkhuyzen, D. R., Leavesley, D. I., Upton, Z. (2008)

Substrate-bound insulin-like growth factor (IGF)-I-IGF binding protein-vitronectin-

stimulated breast cell migration is enhanced by coactivation of the phosphatidylinositide 3-

Kinase/AKT pathway by alphav-integrins and the IGF-I receptor. Endocrinology 149:1075-

90.

Hollowood, A. D., Lai, T., Perks, C.M., Newcomb, P.V., Alderson, D., Holly, J.M.P. (2000)

IGFBP-3 prolongs the p53 response and enhances apoptosis following UV irradiation. Int J

Cancer 88:336-41.

Holmes, C., Foley, P., Freeman, M., Chong, A. H. (2007) Solar keratosis: epidemiology,

pathogenesis, presentation and treatment. Australas J Dermatol 48:67-74.

Holzle, E., Honigsmann, H. (2005) UV-radiation - Sources, wavelength, environment. J

Dtsch Dermatol Ges 9:S3-S10.

Bibliography 225

Horio, T., Miyauchi, H., Sindhvananda, J., Soh, H., Kurokawa, I., et al. (1993) The effect of

ultraviolet (UVB and PUVA) radiation on the expression of epidermal keratins. The British

journal of dermatology 128:10-5.

Houchen, C. W., George, R. J., Sturmoski, M. A., Cohn, S. M. (1999) FGF-2 enhances

intestinal stem cell survival and its expression is induced after radiation injury. American

Journal of Physiology - Gastrointestinal and Liver Physiology 276:G249-G58.

Hoxtell, E. O., Mandel, J. S., Murray, S. S., Schuman, L. M., Goltz, R. W. (1977) Incidence

of skin carcinoma after renal transplantation. Archives of dermatology 113:436-8.

Huang, Q., Dawson, R., Pegg, D., Kearney, J., Macneil, S. (2004) Use of peracetic acid to

sterilize human donor skin for production of acellular dermal matrices for clinical use.

Wound Repair Regen 12.

Huang, S.-M., Harari, P. M. (2000) Modulation of Radiation Response after Epidermal

Growth Factor Receptor Blockade in Squamous Cell Carcinomas: Inhibition of Damage

Repair, Cell Cycle Kinetics, and Tumor Angiogenesis. Clinical Cancer Research 6:2166-74.

Hudon, V., Berthod, F., Black, A. F., Damour, O., Germain, L., et al. (2003) A tissue-

engineered endothelialized dermis to study the modulation of angiogenic and angiostatic

molecules on capillary-like tube formation in vitro. Br J Dermatol 148:1094-104.

Humbel, R. E. (1990) Insulin-like growth factors I and II. Eur J Biochem 190:445-62.

Hyde, C., Hollier, B., Anderson, A., Harkin, D., Upton, Z. (2004) Insulin-like growth factors

(IGF) and IGF-binding proteins bound to vitronectin enhance keratinocyte protein synthesis

and migration. The Journal of investigative dermatology 122:1198-206.

Ichihashi, M., Ueda, M., Budiyanto, A., Bito, T., Oka, M., et al. (2003) UV-induced skin

damage. Toxicology 189:21-39.

Imokawa, G., Yada, Y., Morisaki, N., Kimura, M. (1998) Biological characterization of

human fibroblast-derived mitogenic factors for human melanocytes. Biochem J 330 ( Pt

3):1235-9.

Ishihara, H., Yoshimoto, H., Fujioka, M., Murakami, R., Hirano, A., et al. (2000) Keloid

Fibroblasts Resist Ceramide-Induced Apoptosis by Overexpression of Insulin-Like Growth

Factor I Receptor. 115:1065-71.

Ito, N., Ito, T., Kromminga, A., Bettermann, A., Takigawa, M., et al. (2005) Human hair

follicles display a functional equivalent of the hypothalamic-pituitary-adrenal axis and

synthesize cortisol. The FASEB journal : official publication of the Federation of American

Societies for Experimental Biology 19:1332-4.

Jamali, R., Bao, M., Arnqvist, H. J. (2003) IGF-I but not insulin inhibits apoptosis at a low

concentration in vascular smooth muscle cells. J Endocrinol 179:267-74.

226 Bibliography

Jänicke, R. U., Ng, P., Sprengart, M. L., Porter, A. G. (1998a) Caspase-3 Is Required for α-

Fodrin Cleavage but Dispensable for Cleavage of Other Death Substrates in Apoptosis.

Journal of Biological Chemistry 273:15540-5.

Jänicke, R. U., Sprengart, M. L., Wati, M. R., Porter, A. G. (1998b) Caspase-3 Is Required

for DNA Fragmentation and Morphological Changes Associated with Apoptosis. Journal of


Jans, J., Schul, W., Sert, Y. G., Rijksen, Y., Rebel, H., et al. (2005) Powerful skin cancer

protection by a CPD-photolyase transgene. Curr Biol 15:105-15.

Jeggo, P. A., Löbrich, M. (2006) Contribution of DNA repair and cell cycle checkpoint

arrest to the maintenance of genomic stability. DNA Repair (Amst) 5:1192-8.

Jeong, Y. M., Sung, Y. K., Kim, W. K., Kim, J. H., Kwack, M. H., et al. (2012) Ultraviolet

B Preconditioning Enhances the Hair Growth-Promoting Effects of Adipose-Derived Stem

Cells Via Generation of Reactive Oxygen Species. Stem Cells Dev 13:13.

Jimenez, G. S., Khan, S. H., Stommel, J. M., Wahl, G. M. (1999) p53 regulation by post-

translational modification and nuclear retention in response to diverse stresses. Oncogene

18:7656-65.

Jonason, A. S., Kunala, S., Price, G. J., Restifo, R. J., Spinelli, H. M., et al. (1996) Frequent

clones of p53-mutated keratinocytes in normal human skin. Proc Natl Acad Sci U S A

93:14025-9.

Jones, P. H., Harper, S., Watt, F.M. (1995) Stem cell patterning and fate in human epidermis.

Cell 80:83-93.

Jost, M., Gasparro, F. P., Jensen, P. J., Rodeck, U. (2001) Keratinocyte Apoptosis Induced

by Ultraviolet B Radiation and CD95 Ligation - Differential Protection through Epidermal

Growth Factor Receptor Activation and Bcl-xL Expression. 116:860-6.

Jubin, K., Martin, Y., Lawrence-Watt, D. J., Sharpe, J. R. (2011) A fully autologous co-

culture system utilising non-irradiated autologous fibroblasts to support the expansion of

human keratinocytes for clinical use. Cytotechnology 63:655-62.

Judge, M. R., Griffiths, H. A., Basketter, D. A., White, I. R., Rycroft, R. J., et al. (1996)

Variation in response of human skin to irritant challenge. Contact Dermatitis 34:115-7.

Jung, F., Haendeler, J., Goebel, C., Zeiher, A. M., Dimmeler, S. (2000) Growth factor-

induced phosphoinositide 3-OH kinase/Akt phosphorylation in smooth muscle cells:

induction of cell proliferation and inhibition of cell death. Cardiovascular Research 48:148-

57.

Kairuz, E., Upton, Z., Dawson, R. A., Malda, J. (2007) Hyperbaric oxygen stimulates

epidermal reconstruction in human skin equivalents. Wound Repair Regen 15:266-74.

Bibliography 227

Kambayashi, H., Yamashita, M., Odake, Y., Takada, K., Funasaka, Y., et al. (2001)

Epidermal changes caused by chronic low-dose UV irradiation induce wrinkle formation in

hairless mouse. J Dermatol Sci 27 Suppl 1:S19-25.

Kanamoto, T., Hellman, U., Heldin, C.-H., Souchelnytskyi, S. (2002) Functional proteomics

of transforming growth factor-[beta]1-stimulated Mv1Lu epithelial cells: Rad51 as a target

of TGF[beta]1-dependent regulation of DNA repair. EMBO J 21:1219-30.

Kandyba, E. E., Hodgins, M. B., Martin, P. E. (2008) A murine living skin equivalent

amenable to live-cell imaging: analysis of the roles of connexins in the epidermis. The

Journal of investigative dermatology 128:1039-49.

Kang, S., Fisher, G. J., Voorhees, J. J. (2001) Photoaging: pathogenesis, prevention, and

treatment. Clin Geriatr Med 17:643-59, v-vi.

Kanitakis, J., Ramirez-Bosca, A., Reano, A., Viac, J., Roche, P., et al. (1988) Filaggrin

expression in normal and pathological skin. A marker of keratinocyte differentiation.

Virchows Arch A Pathol Anat Histopathol 412:375-82.

Kanter-Lewensohn, L., Dricu, A., Girnita, L., Wejde, J., Larsson, O. (2000a) Expression of

insulin-like growth factor-1 receptor (IGF-1R) and p27Kip1 in melanocytic tumors: a

potential regulatory role of IGF-1 pathway in distribution of p27Kip1 between different

cyclins. Growth Factors 17:193-202.

Kanter-Lewensohn, L., Girnita, L., Girnita, A., Dricu, A., Olsson, G., et al. (2000b)

Tamoxifen-induced cell death in malignant melanoma cells: possible involvement of the

insulin-like growth factor-1 (IGF-1) pathway. Mol Cell Endocrinol 165:131-7.

Kapoor, M., Hamm, R., Yan, W., Taya, Y., Lozano, G. (2000) Cooperative phosphorylation

at multiple sites is required to activate p53 in response to UV radiation. Oncogene 19:358-

64.

Karimipour, D. J., Rittie, L., Hammerberg, C., Min, V. K., Voorhees, J. J., et al. (2009)

Molecular analysis of aggressive microdermabrasion in photoaged skin. Arch Dermatol

145:1114-22.

Kasai, H., Nishimura, S. (1984) Hydroxylation of deoxyguanosine at the C-8 position by

ascorbic acid and other reducing agents. Nucleic Acids Res 12:2137-45.

Kashyap, A. S., Hollier, B. G., Manton, K. J., Satyamoorthy, K., Leavesley, D. I., et al.

(2011) Insulin-like growth factor-I:vitronectin complex-induced changes in gene expression

effect breast cell survival and migration. Endocrinology 152:1388-401.

Katiyar, S. K., Matsui, M. S., Mukhtar, H. (2000) Kinetics of UV light-induced cyclobutane

pyrimidine dimers in human skin in vivo: an immunohistochemical analysis of both

epidermis and dermis. Photochemistry and Photobiology 72:788-93.

228 Bibliography

Kaulfuss, S., Burfeind, P., Gaedcke, J., Scharf, J.G. (2009) Dual silencing of insulin-like

growth factor-I receptor and epidermal growth factor receptor in colorectal cancer cells is

associated with decreased proliferation and enhanced apoptosis. Mol Cancer Ther 8:821-33.

Kawasumi, M., Lemos, B., Bradner, J. E., Thibodeau, R., Kim, Y. S., et al. (2011) Protection

from UV-induced skin carcinogenesis by genetic inhibition of the ataxia telangiectasia and

Rad3-related (ATR) kinase. Proc Natl Acad Sci U S A 108:13716-21.

Kelekar, A., Chang, B. S., Harlan, J. E., Fesik, S. W., Thompson, C. B. (1997) Bad is a BH3

domain-containing protein that forms an inactivating dimer with Bcl-XL. Mol Cell Biol

17:7040-6.

Kemp, C. J. (2005) Multistep skin cancer in mice as a model to study the evolution of cancer

cells. Semin Cancer Biol 15:460-73.

Kerr, J. F. R. (1971) Shrinkage necrosis: a distinct mode of cellular death. J Pathol 105:13-

20.

Kerzendorfer, C., O'Driscoll, M. (2009) UVB and caffeine: inhibiting the DNA damage

response to protect against the adverse effects of UVB. The Journal of investigative


Khavari, P. A. (2006) Modelling cancer in human skin tissue. Nature reviews Cancer 6:270-

80.

Kim, E. J., Kim, Y. K., Kim, J. E., Kim, S., Kim, M. K., et al. (2011) UV modulation of

subcutaneous fat metabolism. The Journal of investigative dermatology 131:1720-6.

Kim, J. W., Kim, K., Kang, K., Joe, C. O. (2000) Inhibition of Homodimerization of

Poly(ADP-ribose) Polymerase by Its C-terminal Cleavage Products Produced during

Apoptosis. Journal of Biological Chemistry 275:8121-5.

Kimlin, M., Parisi, A. (2001) Usage of real-time ultraviolet radiation data to modify the daily

erythemal exposure of primary schoolchildren. Photodermatol Photoimmunol Photomed

17:130-5.

Kimlin, M. G., Parisi, A. V., Wong, J. C. (1998) The facial distribution of erythemal

ultraviolet exposure in south-east Queensland. Physics in medicine and biology 43:231-40.

Kligman, L. H. (1996) The hairless mouse model for photoaging. Clinics in dermatology

14:183-95.

Kligman, L. H., Akin, F. J., Kligman, A. M. (1985) The contributions of UVA and UVB to

connective tissue damage in hairless mice. Journal of Investigative Dermatology 84:272-6.

Knebel, A., Rahmsdorf, H.J., Ullrich, A., Herrlich, P. (1996) Dephosphorylation of receptor

tyrosine kinases as target of regulation by radiation, oxidants or alkylating agents. EMBO J

15:5314-25.

Bibliography 229

Kock, A., Schwarz, T., Kirnbauer, R., Urbanski, A., Perry, P., et al. (1990) Human

keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release

upon stimulation with endotoxin or ultraviolet light. J Exp Med 172:1609-14.

Kondo, S., Kono, T., Sauder, D. N., McKenzie, R. C. (1993) IL-8 gene expression and

production in human keratinocytes and their modulation by UVB. The Journal of


Kong, W., Li, S., Liu, C., Bari, A. S., Longaker, M. T., et al. (2006) Epithelial-mesenchymal

transition occurs after epidermal development in mouse skin. Experimental Cell Research

312:3959-68.

Konomi, H., Hayashi, T., Nakayasu, K., Arima, M. (1984) Localization of type V collagen

and type IV collagen in human cornea, lung, and skin. Immunohistochemical evidence by

anti-collagen antibodies characterized by immunoelectroblotting. The American Journal of

Pathology 116:417-26.

Kostyuk, V., Potapovich, A., Stancato, A., De Luca, C., Lulli, D., et al. (2012) Photo-

Oxidation Products of Skin Surface Squalene Mediate Metabolic and Inflammatory

Responses to Solar UV in Human Keratinocytes. PLoS One 7:e44472.

Kosztka, L., Rusznák, Z., Nagy, D., Nagy, Z., Fodor, J., Szűcs, G., Telek, A., Gönczi, M.,

Ruzsnavszky, O., Szentandrássy, N., Csernoch, L. (2011) Inhibition of TASK-3 (KCNK9)

channel biosynthesis changes cell morphology and decreases both DNA content and

mitochondrial function of melanoma cells maintained in cell culture. Melanoma Res.

Kovacs, D., Raffa, S., Flori, E., Aspite, N., Briganti, S., et al. (2009) Keratinocyte growth

factor down-regulates intracellular ROS production induced by UVB. J Dermatol Sci

54:106-13.

Kraemer, K. H., Lee, M. M., Andrews, A. D., Lambert, W. C. (1994) The role of sunlight

and DNA repair in melanoma and nonmelanoma skin cancer: the xeroderma pigmentosum

paradigm. Archives of dermatology 130:1018.

Kraemer, K. H., Seetharam, S., Seidman, M. M., Bredberg, A., Brash, D., et al. (1990)

Defective DNA repair in humans: clinical and molecular studies of xeroderma pigmentosum.

Basic life sciences 53:95-104.

Kratz, G., Lake, M., Ljungstrom, K., Forsberg, G., Haegerstrand, A., et al. (1992) Effect of

recombinant IGF binding protein-1 on primary cultures of human keratinocytes and

fibroblasts: selective enhancement of IGF-1 but not IGF-2-induced cell proliferation. Exp

Cell Res 202:381-5.

Krejci, N. C., Cuono, C. B., Langdon, R. C., McGuire, J. (1991) In Vitro Reconstitution of

Skin: Fibroblasts Facilitate Keratinocyte Growth and Differentiation on Acellular Reticular

Dermis. J Investig Dermatol 97:843-8.

230 Bibliography

Kricker, J. A., Hyde, C. E., Van Lonkhuyzen, D. R., Hollier, B. G., Shooter, G. K., et al.

(2010) Mechanistic investigations into interactions between IGF-I and IGFBPs and their

impact on facilitating cell migration on vitronectin. Growth Factors 28:359-69.

Kricker, J. A., Towne, C. L., Firth, S. M., Herington, A. C., Upton, Z. (2003) Structural and

functional evidence for the interaction of insulin-like growth factors (IGFs) and IGF binding

proteins with vitronectin. Endocrinology 144:2807-15.

Krtolica, A., Parrinello, S., Lockett, S., Desprez, P. Y., Campisi, J. (2001) Senescent

fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and

aging. Proc Natl Acad Sci U S A 98:12072-7.

Krutmann, J., Grewe, M. (1995) Involvement of cytokines, DNA damage, and reactive

oxygen intermediates in ultraviolet radiation-induced modulation of intercellular adhesion

molecule-1 expression. The Journal of investigative dermatology 105:67S-70S.

Kubbutat, M. H., Jones, S. N., Vousden, K. H. (1997) Regulation of p53 stability by Mdm2.

Nature 387:299-303.

Kubbutat, M. H., Ludwig, R. L., Ashcroft, M., Vousden, K. H. (1998) Regulation of Mdm2-

directed degradation by the C terminus of p53. Mol Cell Biol 18:5690-8.

Kuhn, C., Hurwitz, S. A., Kumar, M. G., Cotton, J., Spandau, D. F. (1999) Activation of the

insulin-like growth factor-a receptor promotes the survival of human keratinocytes following

ultraviolet B irradiation. Int J Cancer 80:431-8.

Kulik, G., Klippel, A., Weber, M.J. (1997) Antiapoptotic signalling by the insulin-like

growth factor I receptor, phosphatidylinositol 3-kinase, and Akt. Mol Cell Biol 17:1595-606.

Kulik, G., Weber, M. J. (1998) Akt-Dependent and -Independent Survival Signaling

Pathways Utilized by Insulin-Like Growth Factor I. Mol Cell Biol 18:6711-8.

Kulms, D., Zeise, E., Poppelmann, B., Schwarz, T. (2002) DNA damage, death receptor

activation and reactive oxygen species contribute to ultraviolet radiation-induced apoptosis

in an essential and independent way. Oncogene 21:5844-51.

Kumagai, A., Dunphy, W. G. (1999) Binding of 14-3-3 proteins and nuclear export control

the intracellular localization of the mitotic inducer Cdc25. Genes Dev 13:1067-72.

Kumar, M. G., Hurwitz, S. A., Cotton, J., Spandau, D. F. (1999) Subphysiological

concentrations of extracellular calcium sensitize normal human keratinocytes to UVB-

induced apoptosis. Archives of dermatological research 291:37-46.

Kurki, P., Vanderlaan, M., Dolbeare, F., Gray, J., Tan, E. M. (1986) Expression of

proliferating cell nuclear antigen (PCNA)/cyclin during the cell cycle. Experimental Cell

Research 166:209-19.

Lakin, N. D., Jackson, S. P. (1999) Regulation of p53 in response to DNA damage.


Bibliography 231

Lane, D. P. (1992) Cancer. p53, guardian of the genome. Nature 358:15-6.

Lane, E. B., McLean, W. H. (2004) Keratins and skin disorders. J Pathol 204:355-66.

Lanier, L. L., Warner, N. L. (1981) Paraformaldehyde fixation of hematopoietic cells for

quantitative flow cytometry (FACS) analysis. Journal of immunological methods 47:25-30.

Lann, D., LeRoith, D. (2008) The role of endocrine insulin-like growth factor-1 and insulin

in breast cancer. J Mammary Gland Biol Neoplasia 13:371-9.

Larue, L., Dougherty, N., Porter, S., Mintz, B. (1992) Spontaneous malignant transformation

of melanocytes explanted from Wf/Wf mice with a Kit kinase-domain mutation. Proc Natl

Acad Sci U S A 89:7816-20.

Laubach, V., Zoller, N., Rossberg, M., Gorg, K., Kippenberger, S., et al. (2011) Integration

of Langerhans-like cells into a human skin equivalent. Arch Dermatol Res 303:135-9.

Lee, D. Y., Ahn, H. T., Cho, K. H. (2000) A new skin equivalent model: dermal substrate

that combines de-epidermized dermis with fibroblast-populated collagen matrix. J Dermatol

Sci 23:132-7.

Lee, D. Y., Cho, K. H. (2005) The effects of epidermal keratinocytes and dermal fibroblasts

on the formation of cutaneous basement membrane in three-dimensional culture systems.

Archives of dermatological research 296:296-302.

Lee, J. H., An, H. T., Chung, J. H., Kim, K. H., Eun, H. C., et al. (2002) Acute effects of

UVB radiation on the proliferation and differentiation of keratinocytes. Photodermatol

Photoimmunol Photomed 18:253-61.

Lee, J. H., Kim, J. E., Kim, B. J., Cho, K. H. (2007) In vitro phototoxicity test using artificial

skin with melanocytes. Photodermatol Photoimmunol Photomed 23:73-80.

Lee, S. H., Jin, S. Y., Song, J. S., Seo, K. K., Cho, K. H. (2012) Paracrine Effects of

Adipose-Derived Stem Cells on Keratinocytes and Dermal Fibroblasts. Ann Dermatol

24:136-43.

Lehman, T. A., Modali, R., Boukamp, P., Stanek, J., Bennett, W. P., et al. (1993) p53

mutations in human immortalized epithelial cell lines. Carcinogenesis 14:833-9.

Lehmann, A. R. (2003) DNA repair-deficient diseases, xeroderma pigmentosum, Cockayne

syndrome and trichothiodystrophy. Biochimie 85:1101-11.

Lehmann, B. (1997) HaCaT cell line as a model system for vitamin D3 metabolism in human

skin. The Journal of investigative dermatology 108:78-82.

Lejeune, F., Christiaens, F., Bernerd, F. (2008) Evaluation of sunscreen products using a

reconstructed skin model exposed to simulated daily ultraviolet radiation: relevance of

232 Bibliography

filtration profile and SPF value for daily photoprotection. Photodermatol Photoimmunol

Photomed 24:249-55.

Leppard, K., Crawford, L. (1983) Monoclonal antibodies displaying a novel species

specificity for the primate transformation-related protein, p53. The EMBO journal 2:1457-

64.

Lerman, G., Avivi, C., Mardoukh, C., Barzilai, A., Tessone, A., et al. (2011) MiRNA

Expression in Psoriatic Skin: Reciprocal Regulation of hsa-miR-99a and IGF-1R. PLoS One

6:e20916.

LeRoith, D., Werner, H., Beitner-Johnson, D., Roberts, C. T., Jr. (1995) Molecular and

cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 16:143-63.

Leverkus, M., Yaar, M., Gilchrest, B. A. (1997) Fas/Fas ligand interaction contributes to

UV-induced apoptosis in human keratinocytes. Experimental Cell Research 232:255-62.

Levine, A. J., Momand, J., Finlay, C. A. (1991) The p53 tumour suppressor gene. Nature

351:453.

Lewis, D. A., Spandau, D. F. (2008) UVB-induced activation of NF-kappaB is regulated by

the IGF-1R and dependent on p38 MAPK. The Journal of investigative dermatology

128:1022-9.

Lewis, D. A., Travers, J. B., Somani, A.-K., Spandau, D. F. (2010) The IGF-1/IGF-1R

signaling axis in the skin: a new role for the dermis in aging-associated skin cancer.


Lewis, D. A., Travers, J. B., Spandau, D. F. (2008) A new paradigm for the role of aging in

the development of skin cancer. J Invest Dermatol 129:787-91.

Lewis, D. A., Yi, Q., Travers, J.B., Spandau, D.F. (2008) UVB-induced senescence in

human keratinocytes requires a functional insulin-like growth factor-1 receptor and p53. Mol

Biol Cell 19:1346-53.

Ley, R. D., Fourtanier, A. (1997) Sunscreen protection against ultraviolet radiation-induced

pyrimidine dimers in mouse epidermal DNA. Photochemistry and Photobiology 65:1007-11.

Li, D., Turi, T. G., Schuck, A., Freedberg, I. M., Khitrov, G., et al. (2001) Rays and arrays:

the transcriptional program in the response of human epidermal keratinocytes to UVB

illumination. The FASEB journal : official publication of the Federation of American

Societies for Experimental Biology 15:2533-5.

Li, G., Mitchell, D. L., Ho, V. C., Reed, J. C., Tron, V. A. (1996) Decreased DNA repair but

normal apoptosis in ultraviolet-irradiated skin of p53-transgenic mice. The American journal

of pathology 148:1113-23.

Li, G., Tron, V., Ho, V. (1998) Induction of squamous cell carcinoma in p53-deficient mice

after ultraviolet irradiation. The Journal of investigative dermatology 110:72-5.

Bibliography 233

Li, L., Fukunaga-Kalabis, M., Herlyn, M. (2012) Isolation and cultivation of dermal stem

cells that differentiate into functional epidermal melanocytes. Methods in molecular biology

806:15-29.

Li, Z., Wu, H., Khardori, R., Song, Y.H, Lu, Y.W., Geng, Y.J. (2009) Insulin-like growth

factor-1 receptor activation prevents high glucose-induced mitochondrial dysfunction,

cytochrome-c release and apoptosis. Biochem Biophys Res Commun 384:259-64.

Liebel, F., Kaur, S., Ruvolo, E., Kollias, N., Southall, M. D. (2012) Irradiation of skin with

visible light induces reactive oxygen species and matrix-degrading enzymes. The Journal of


Lin, C. Q., Bissell, M. J. (1993) Multi-faceted regulation of cell differentiation by

extracellular matrix. Faseb J 7:737-43.

Lin, F., Ren, X. D., Doris, G., Clark, R. A. (2005) Three-dimensional migration of human

adult dermal fibroblasts from collagen lattices into fibrin/fibronectin gels requires syndecan-

4 proteoglycan. The Journal of investigative dermatology 124:906-13.

Lin, J. Y., Fisher, D. E. (2007) Melanocyte biology and skin pigmentation. Nature 445:843-

50.

Lippens, S., Hoste, E., Vandenabeele, P., Agostinis, P., Declercq, W. (2009) Cell death in

the skin. Apoptosis 14:549-69.

Liu, F., Luo, X. S., Shen, H. Y., Dong, J. S., Yang, J. (2011) Using human hair follicle-

derived keratinocytes and melanocytes for constructing pigmented tissue-engineered skin.

Skin Res Technol.

Liu, H., Mao, J., Yao, K., Yang, G., Cui, L., et al. (2004) A study on a chitosan-gelatin-

hyaluronic acid scaffold as artificial skin in vitro and its tissue engineering applications. J

Biomater Sci Polym Educ 15:25-40.

Liu, J. J., Fisher, D. E. (2010) Lighting a path to pigmentation: mechanisms of MITF

induction by UV. Pigment Cell Melanoma Res 23:741-5.

Liu, J. P., Baker, J., Perkins, A. S., Robertson, E. J., Efstratiadis, A. (1993) Mice carrying

null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF

receptor (Igf1r). Cell 75:59-72.

Liu, K. (1996) Changes in keratinocyte differentiation during accelerated repopulation of the

irradiated mouse epidermis. Int J Radiat Biol 69:763-9.

Liu, L., Lee, S., Zhang, J., Peters, S. B., Hannah, J., et al. (2009) CUL4A abrogation

augments DNA damage response and protection against skin carcinogenesis. Molecular cell

34:451-60.

234 Bibliography

Liu, M., Dhanwada, K. R., Birt, D. F., Hecht, S., Pelling, J. C. (1994) Increase in p53 protein

half-life in mouse keratinocytes following UV-B irradiation. Carcinogenesis 15:1089-92.

Liu, Q., Guntuku, S., Cui, X. S., Matsuoka, S., Cortez, D., et al. (2000) Chk1 is an essential

kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes

Dev 14:1448-59.

Liu, S. C., Parsons, S., Hanawalt, P. C. (1983) DNA repair in cultured keratinocytes. J Invest

Dermatol 81:179s-83s.

Liu, Y., Suwa, F., Wang, X., Takemura, A., Fang, Y.R., Li, Y., Zhao, Y., Jin, Y. (2007)

Reconstruction of a tissue-engineered skin containing melanocytes. Cell Biol Int 31:985-90.

Livingstone, L. R., White, A., Sprouse, J., Livanos, E., Jacks, T., et al. (1992) Altered cell

cycle arrest and gene amplification potential accompany loss of wild-type p53. Cell 70:923.

Ljungman, M. (2000) Dial 9-1-1 for p53: mechanisms of p53 activation by cellular stress.

Neoplasia 2:208-25.

Lobner, D. (2000) Comparison of the LDH and MTT assays for quantifying cell death:

validity for neuronal apoptosis? Journal of neuroscience methods 96:147-52.

Lodygin, D., Yazdi, A. S., Sander, C. A., Herzinger, T., Hermeking, H. (2003) Analysis of

14-3-3sigma expression in hyperproliferative skin diseases reveals selective loss associated

with CpG-methylation in basal cell carcinoma. Oncogene 22:5519-24.

Loignon, M., Fetni, R., Gordon, A. J. E., Drobetsky, E. A. (1997) A p53-independent

Pathway for Induction of p21waf1cip1 and Concomitant G1 Arrest in UV-irradiated Human

Skin Fibroblasts. Cancer Research 57:3390-4.

Lomas, A., Leonardi-Bee, J., Bath-Hextall, F. (2012) A systematic review of worldwide

incidence of nonmelanoma skin cancer. Br J Dermatol 166:1069-80.

Lopez, T., Hanahan, D. (2002) Elevated levels of the IGF-1 receptor convey invasive and

metastatic capability in a mouse model of pancreatic islet tumourigenesis. Cancer Cell

1:339-53.

Lotti, L. V., Rotolo, S., Francescangeli, F., Frati, L., Torrisi, M. R., et al. (2007) AKT and

MAPK signaling in KGF-treated and UVB-exposed human epidermal cells. J Cell Physiol

212:633-42.

Lowe, N. J., Meyers, D. P., Wieder, J. M., Luftman, D., Borget, T., et al. (1995) Low doses

of repetitive ultraviolet A induce morphologic changes in human skin. The Journal of


Lozano, G., Elledge, S. J. (2000) p53 sends nucleotides to repair DNA. Nature 404:24-5.

Bibliography 235

Lu, Y. P., Lou, Y. R., Peng, Q. Y., Xie, J. G., Nghiem, P., et al. (2008) Effect of caffeine on

the ATR/Chk1 pathway in the epidermis of UVB-irradiated mice. Cancer Res 68:2523-9.

Lu, Y. P., Lou, Y. R., Yen, P., Mitchell, D., Huang, M. T., et al. (1999) Time course for

early adaptive responses to ultraviolet B light in the epidermis of SKH-1 mice. Cancer

research 59:4591-602.

Luo, S., Yufit, T., Carson, P., Fiore, D., Falanga, J., et al. (2011) Differential keratin

expression during epiboly in a wound model of bioengineered skin and in human chronic

wounds. The international journal of lower extremity wounds 10:122-9.

Ma, W., Wlaschek, M., Tantcheva-Poor, I., Schneider, L. A., Naderi, L., et al. (2001)

Chronological ageing and photoageing of the fibroblasts and the dermal connective tissue.

Clin Exp Dermatol 26:592-9.

Maas-Szabowski, N., Shimotoyodome, A., Fusenig, N. E. (1999) Keratinocyte growth

regulation in fibroblast cocultures via a double paracrine mechanism. Journal of Cell Science

112:1843-53.

Maas-Szabowski, N., Stark, H. J., Fusenig, N. E. (2000) Keratinocyte growth regulation in

defined organotypic cultures through IL-1-induced keratinocyte growth factor expression in

resting fibroblasts. The Journal of investigative dermatology 114:1075-84.

Mackenzie, I. C., Fusenig, N. E. (1983) Regeneration of organized epithelial structure. The

Journal of investigative dermatology 81:189s-94s.

MacNeil, S. (2007) Progress and opportunities for tissue-engineered skin. Nature 445:874-

80.

Maki, C. G., Howley, P. M. (1997) Ubiquitination of p53 and p21 is differentially affected

by ionizing and UV radiation. Mol Cell Biol 17:355-63.

Maki, C. G., Huibregtse, J. M., Howley, P. M. (1996) In vivo ubiquitination and proteasome-

mediated degradation of p53(1). Cancer Research 56:2649-54.

Maloney, E. K., McLaughlin, J. L., Dagdigian, N. E., Garrett, L. M., Connors, K. M., et al.

(2003) An Anti-Insulin-like Growth Factor I Receptor Antibody That Is a Potent Inhibitor of

Cancer Cell Proliferation. Cancer Research 63:5073-83.

Maltzman, W., Czyzyk, L. (1984) UV irradiation stimulates levels of p53 cellular tumor

antigen in nontransformed mouse cells. Mol Cell Biol 4:1689-94.

Mancini, M., Nicholson, D. W., Roy, S., Thornberry, N. A., Peterson, E. P., et al. (1998) The

Caspase-3 Precursor Has a Cytosolic and Mitochondrial Distribution: Implications for

Apoptotic Signaling. The Journal of Cell Biology 140:1485-95.

Mancuso, M., Pazzaglia, S., Tanori, M., Hahn, H., Merola, P., et al. (2004) Basal cell

carcinoma and its development: insights from radiation-induced tumors in Ptch1-deficient

mice. Cancer research 64:934-41.

236 Bibliography

Marinkovich, M. P., Keene, D. R., Rimberg, C. S., Burgeson, R. E. (1993) Cellular origin of

the dermal-epidermal basement membrane. Dev Dyn 197:255-67.

Marionnet, C., Armier, J., Sarasin, A., Stary, A. (1998) Cyclobutane pyrimidine dimers are

the main mutagenic DNA photoproducts in DNA repair-deficient trichothiodystrophy cells.

Cancer research 58:102-8.

Marionnet, C., Grether-Beck, S., Seite, S., Marini, A., Jaenicke, T., et al. (2011) A broad-

spectrum sunscreen prevents UVA radiation-induced gene expression in reconstructed skin

in vitro and in human skin in vivo. Exp Dermatol 20:477-82.

Marionnet, C., Pierrard, C., Lejeune, F., Sok, J., Thomas, M., et al. (2010) Different

oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to

non extreme daily-ultraviolet radiation. PLoS One 5:e12059.

Marko, O., Houghton, A. N., Eisinger, M. (1982) Purification of human melanocytes by

monoclonal antibody combined with Percoll gradients. Experimental Cell Research 142:309-

15.

Marrot, L., Planel, E., Ginestet, A. C., Belaidi, J. P., Jones, C., et al. (2010) In vitro tools for

photobiological testing: molecular responses to simulated solar UV of keratinocytes growing

as monolayers or as part of reconstructed skin. Photochem Photobiol Sci 9:448-58.

Martin, J. L., Baxter, R.C. (1990) Production of an insulin-like growth factor (IGF)-inducible

IGF-binding protein by human skin fibroblasts. Endocrinology 127:781-8.

Matichard, E., Verpillat, P., Meziani, R., Gérard, B., Descamps, V., et al. (2004)

Melanocortin 1 receptor (MC1R) gene variants may increase the risk of melanoma in France

independently of clinical risk factors and UV exposure. Journal of Medical Genetics 41:e13.

Matsumura, Y., Ananthaswamy, H. (2004) Toxic effects of ultraviolet radiation on the skin.

Toxicology and Applied Pharmacology 1995:298-308.

Matsumura, Y., Ananthaswamy, H. N. (2002) Molecular mechanisms of

photocarcinogenesis. Front Biosci 7:d765-d83.

Matsumura, Y., Moodycliffe, A. M., Nghiem, D. X., Ullrich, S. E., Ananthaswamy, H. N.

(2005) Inverse relationship between increased apoptosis and decreased skin cancer in UV-

irradiated CD1d-/- mice. Photochemistry and Photobiology 81:46-51.

Matsuoka, S., Ballif, B. A., Smogorzewska, A., McDonald, E. R., III, Hurov, K. E., et al.

(2007) ATM and ATR Substrate Analysis Reveals Extensive Protein Networks Responsive

to DNA Damage. Science 316:1160-6.

Mawson, A., Lai, A., Carroll, J. S., Sergio, C. M., Mitchell, C. J., et al. (2005) Estrogen and

insulin/IGF-1 cooperatively stimulate cell cycle progression in MCF-7 breast cancer cells

through differential regulation of c-Myc and cyclin D1. Mol Cell Endocrinol 229:161-73.

Bibliography 237

Mazlyzam, A. L., Aminuddin, B.S., Fuzina, N.H., Norhayati, M.M., Fauziah, O., Isa, M.R.,

Saim, L., Ruszymah, B.H.I. (2007) Reconstruction of living bilayer human skin equivalent

utilizing human fibrin as a scaffold. Burns 33:355-63.

Mazzoleni, G., Di Lorenzo, D., Steimberg, N. (2009) Modelling tissues in 3D: the next

future of pharmaco-toxicology and food research? Genes Nutr 4:13-22.

Medalie, D. A., Tompkins, R. G., Morgan, J. R. (1996) Evaluation of acellular human dermis

as a dermal analog in a composite skin graft. Asaio J 42:M455-62.

Medrano, E. E., Nordlund, J. J. (1990) Successful culture of adult human melanocytes

obtained from normal and vitiligo donors. The Journal of investigative dermatology 95:441-

5.

Mehrel, T., Hohl, D., Rothnagel, J. A., Longley, M. A., Bundman, D., et al. (1990)

Identification of a major keratinocyte cell envelope protein, loricrin. Cell 61:1103-12.

Meier, F., Nesbit, M., Hsu, M. Y., Martin, B., Van Belle, P., et al. (2000) Human melanoma

progression in skin reconstructs : biological significance of bFGF. The American Journal of


Menon, G. K. (2002) New insights into skin structure: scratching the surface. Adv Drug

Deliv Rev 54 Suppl 1:S3-17.

Meylan, E., Tschopp, J., Karin, M. (2006) Intracellular pattern recognition receptors in the

host response. Nature 442:39-44.

Mildner, M., Jin, J., Eckhart, L., Kezic, S., Gruber, F., et al. (2010) Knockdown of filaggrin

impairs diffusion barrier function and increases UV sensitivity in a human skin model. J

Invest Dermatol.

Mildner, M., Mlitz, V., Gruber, F., Wojta, J., Tschachler, E. (2007) Hepatocyte Growth

Factor Establishes Autocrine and Paracrine Feedback Loops for the Protection of Skin Cells

after UV Irradiation. J Invest Dermatol 127:2637-44.

Mitchell, D. L., Fernandez, A.A., Nairn, R.S., Garcia, R., Paniker, L., Trono, D., Thames,

H.D., Gimenez-Conti, I. (2010) Ultraviolet A does not induce melanomas in a Xiphophorus

hybrid fish model. Proc Natl Acad Sci U S A 107:9329-34.

Miyauchi-Hashimoto, H., Tanaka, K., Horio, T. (1996) Enhanced inflammation and

immunosuppression by ultraviolet radiation in xeroderma pigmentosum group A (XPA)

model mice. The Journal of investigative dermatology 107:343-8.

Moll, I., Houdek, P., Schmidt, H., Moll, R. (1998) Characterization of epidermal wound

healing in a human skin organ culture model: acceleration by transplanted keratinocytes. The

Journal of investigative dermatology 111:251-8.

238 Bibliography

Monteiro-Riviere, N. A., Inman, A. O., Snider, T. H., Blank, J. A., Hobson, D. W. (1997)

Comparison of an in vitro skin model to normal human skin for dermatological research.

Microscopy research and technique 37:172-9.

Morgan, S. E., Kastan, M. B. (1997) p53 and ATM: cell cycle, cell death, and cancer.

Advances in cancer research 71:1-25.

Morita, S., Ikada, Y., (ed) (2002) Lactide copolymers for scaffolds in tissue engineering.,

Marcel Dekker: New York.

Mouret, S., Baudouin, C., Charveron, M., Favier, A., Cadet, J., et al. (2006) Cyclobutane

pyrimidine dimers are predominant DNA lesions in whole human skin exposed to UVA

radiation. Proc Natl Acad Sci U S A 103:13765-70.

Mouret, S., Charveron, M., Favier, A., Cadet, J., Douki, T. (2008) Differential repair of

UVB-induced cyclobutane pyrimidine dimers in cultured human skin cells and whole human

skin. DNA Repair (Amst) 7:704-12.

Moyal, D. (2012) Need for a well-balanced sunscreen to protect human skin from both

Ultraviolet A and Ultraviolet B damage. Indian J Dermatol Venereol Leprol 78 Suppl 1:S24-

30.

Mujaj, S., Manton, K., Upton, Z., Richards, S. (2010) Serum-free primary human fibroblast

and keratinocyte coculture. Tissue engineering Part A 16:1407-20.

Muramatsu, T., Kobayashi, N., Tada, H., Yamaji, M., Shirai, T., et al. (1992) Induction and

repair of UVB-induced cyclobutane pyrimidine dimers and (6-4) photoproducts in organ-

cultured normal human skin. Archives of dermatological research 284:232-7.

Na, G. Y., Paek, S. H., Park, B. C., Kim, D. W., Lee, W. J., et al. (2006) Isolation and

characterization of outer root sheath melanocytes of human hair follicles. The British journal

of dermatology 155:902-9.

Nakagawa, A., Kobayashi, N., Muramatsu, T., Yamashina, Y., Shirai, T., Hashimoto, M.W.,

Ikenaga, M., Mori, T. (1998) Three-dimensional visualization of ultraviolet-induced DNA

damage and its repair in human cell nuclei. J Invest Dermatol 110:143-8.

Nakazawa, K., Kalassy, M., Sahuc, F., Collombel, C., Damour, O. (1998) Pigmented human

skin equivalent--as a model of the mechanisms of control of cell-cell and cell-matrix

interactions. Med Biol Eng Comput 36:813-20.

Nakazawa, K., Nakazawa, H., Sahuc, F., Lepavec, A., Collombel, C., et al. (1997)

Pigmented human skin equivalent: new method of reconstitution by grafting an epithelial

sheet onto a non-contractile dermal equivalent. Pigment Cell Res 10:382-90.

Nam, E. A., Cortez, D. (2011) ATR signalling: more than meeting at the fork. Biochem J

436:527-36.

Bibliography 239

Naruse, K., Hori, H., Shimizu, N., Kohara, Y., Takeda, H. (2004) Medaka genomics: a

bridge between mutant phenotype and gene function. Mechanisms of development 121:619-

28.

Nelson, M. A., Einspahr, J. G., Alberts, D. S., Balfour, C. A., Wymer, J. A., et al. (1994)

Analysis of p53 gene in human precancerous actinic keratosis lesions and squamous cell

cancers. Cancer Lett 85:23-9.

Ng, W., Ikeda, S. (2011) Standardized, defined serum-free culture of a human skin

equivalent on fibroblast-populated collagen scaffold. Acta Derm Venereol 91:387-91.

Nickoloff, B. J., Misra, P., Morhenn, V. B., Hintz, R. L., Rosenfeld, R. G. (1988) Further

characterization of the keratinocyte somatomedin-C/insulin-like growth factor I (SM-C/IGF-

I) receptor and the biological responsiveness of cultured keratinocytes to SM-C/IGF-I.

Dermatologica 177:265-73.

Nijhof, J. G., van Pelt, C., Mulder, A. A., Mitchell, D. L., Mullenders, L. H., et al. (2007)

Epidermal stem and progenitor cells in murine epidermis accumulate UV damage despite

NER proficiency. Carcinogenesis 28:792-800.

Nishigori, C., Yarosh, D. B., Ullrich, S. E., Vink, A. A., Bucana, C. D., et al. (1996)

Evidence that DNA damage triggers interleukin 10 cytokine production in UV-irradiated

murine keratinocytes. Proc Natl Acad Sci U S A 93:10354-9.

Noble, A., Towne, C., Chopin, L., Leavesley, D., Upton, Z. (2003) Insulin-like growth

factor-II bound to vitronectin enhances MCF-7 breast cancer cell migration. Endocrinology

144:2417-24.

Nolte, S. V., Xu, W., Rennekampff, H. O., Rodemann, H. P. (2008) Diversity of fibroblasts--

a review on implications for skin tissue engineering. Cells Tissues Organs 187:165-76.

Noonan, F. P., Dudek, J., Merlino, G., De Fabo, E. C. (2003) Animal models of melanoma:

an HGF/SF transgenic mouse model may facilitate experimental access to UV initiating

events. Pigment Cell Res 16:16-25.

Nunez, R. (2001) DNA measurement and cell cycle analysis by flow cytometry. Current

issues in molecular biology 3:67-70.

O'Driscoll, M., Jeggo, P. A. (2006) The role of double-strand break repair - insights from

human genetics. Nat Rev Genet 7:45-54.

O'Grady, A., Kay, E. W., McKenna, D. B., Bennett, M. A., Murphy, G. M., et al. (1998)

Altered expression of the p53-regulated proteins, p21Waf1/Cip1, MDM2, and Bax in

ultraviolet-irradiated human skin. Human pathology 29:559-64.

O'Toole, E. A., Marinkovich, M. P., Hoeffler, W. K., Furthmayr, H., Woodley, D. T. (1997)

Laminin-5 inhibits human keratinocyte migration. Experimental Cell Research 233:330-9.

240 Bibliography

Oba-Shinjo, S. M., Correa, M., Ricca, T. I., Molognoni, F., Pinhal, M. A., et al. (2006)

Melanocyte transformation associated with substrate adhesion impediment. Neoplasia 8:231-

41.

Ogi, T., Limsirichaikul, S., Overmeer, R. M., Volker, M., Takenaka, K., et al. (2010) Three

DNA polymerases, recruited by different mechanisms, carry out NER repair synthesis in

human cells. Molecular cell 37:714-27.

Ohmichi, H., Koshimizu, U., Matsumoto, K., Nakamura, T. (1998) Hepatocyte growth factor

(HGF) acts as a mesenchyme-derived morphogenic factor during fetal lung development.

Development 125:1315-24.

Onuma, H., Mastui, C., Morohashi, M. (2001) Quantitative analysis of the proliferation of

epidermal cells using a skin organ culture system and the effect of DbcAMP using markers

of proliferation (BrdU, Ki-67, PCNA). Arch Dermatol Res 293:133-8.

Orringer, J. S., Hammerberg, C., Hamilton, T., Johnson, T. M., Kang, S., et al. (2008)

Molecular effects of photodynamic therapy for photoaging. Arch Dermatol 144:1296-302.

Paladini, R. D., Takahashi, K., Bravo, N. S., Coulombe, P. A. (1996) Onset of re-

epithelialization after skin injury correlates with a reorganization of keratin filaments in

wound edge keratinocytes: defining a potential role for keratin 16. The Journal of cell

biology 132:381-97.

Papini, S., Cecchetti, D., Campani, D., Fitzgerald, W., Grivel, J. C., et al. (2003) Isolation

and clonal analysis of human epidermal keratinocyte stem cells in long-term culture. Stem

Cells 21:481-94.

Parisi, A. V., Kimlin, M. G., Wong, J. C., Wilson, M. (2000) Personal exposure distribution

of solar erythemal ultraviolet radiation in tree shade over summer. Physics in medicine and

biology 45:349-56.

Park, K., Elias, P. M., Oda, Y., Mackenzie, D., Mauro, T., et al. (2011) Regulation of

cathelicidin antimicrobial peptide expression by an endoplasmic reticulum (ER) stress

signaling, vitamin D receptor-independent pathway. The Journal of Biological Chemistry

286:34121-30.

Parnigotto, P. P., Bernuzzo, S., Bruno, P., Conconi, M. T., Montesi, F. (1998)

Characterization and applications of human epidermis reconstructed in vitro on de-

epidermized derma. Farmaco 53:125-31.

Parrinello, S., Coppe, J. P., Krtolica, A., Campisi, J. (2005) Stromal-epithelial interactions in

aging and cancer: senescent fibroblasts alter epithelial cell differentiation. Journal of Cell

Science 118:485-96.

Parrott, J. A., Vigne, J. L., Chu, B. Z., Skinner, M. K. (1994) Mesenchymal-epithelial

interactions in the ovarian follicle involve keratinocyte and hepatocyte growth factor

production by thecal cells and their action on granulosa cells. Endocrinology 135:569-75.

Bibliography 241

Peng, C. Y., Graves, P. R., Thoma, R. S., Wu, Z., Shaw, A. S., et al. (1997) Mitotic and G2

checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on

serine-216. Science 277:1501-5.

Perdiz, D., Grof, P., Mezzina, M., Nikaido, O., Moustacchi, E., et al. (2000) Distribution and

repair of bipyrimidine photoproducts in solar UV-irradiated mammalian cells. Possible role

of Dewar photoproducts in solar mutagenesis. J Biol Chem 275:26732-42.

Peretz, S., Jensen, R., Baserga, R., Glazer, P. M. (2001) ATM-dependent expression of the

insulin-like growth factor-I receptor in a pathway regulating radiation response. Proc Natl

Acad Sci U S A 98:1676-81.

Perks, C. M., Holly, J.M. (2008) IGF binding proteins (IGFBPs) and regulation of breast

cancer biology. J Mammary Gland Biol Neoplasia 13:455-69.

Perona, r. (2006) Cell signalling: growth factors and tyrosine kinase receptors. Clin Transl

Oncol 8:77-82.

Peso, L. d., González-Garc a, M., Page, C., Herrera, R., Nu ez, G. (1997) Interleukin-3-

Induced Phosphorylation of BAD Through the Protein Kinase Akt. Science 278:687-9.

Peter, M. E., Heufelder, A. E., Hengartner, M. O. (1997) Advances in apoptosis research.

Proc Natl Acad Sci U S A 94:12736-7.

Petit-Frere, C., Clingen, P. H., Grewe, M., Krutmann, J., Roza, L., et al. (1998) Induction of

interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes

and in a human keratinocyte cell line is mediated by DNA damage. The Journal of


Petrocelli, T., Slingerland, J. (2000) UVB induced cell cycle checkpoints in an early stage

human melanoma line, WM35. Oncogene 19:4480-90.

Peus, D., Vasa, R. A., Meves, A., Beyerle, A., Pittelkow, M. R. (2000) UVB-induced

epidermal growth factor receptor phosphorylation is critical for downstream signaling and

keratinocyte survival. Photochemistry and Photobiology 72:135-40.

Phillipson, R. P., Tobi, S.E., Morris, J.A., McMillan, T.J. (2002) UVA induces persistent

genomic instability in human keratinocytes through and oxidative stress mechanism. Free

Radic Biol Med 32:474-80.

Philpott, M. P., Sanders, D. A., Kealey, T. (1994) Effects of Insulin and Insulin-Like Growth

Factors on Cultured Human Hair Follicles: IGF-I at Physiologic Concentrations Is an

Important Regulator of Hair Follicle Growth In Vitro. J Investig Dermatol 102:857-61.

Pianigiani, E., Andreassi, A., Taddeucci, P., Alessandrini, C., Fimiani, M., et al. (1999) A

new model for studying differentiation and growth of epidermal cultures on hyaluronan-

based carrier. Biomaterials 20:1689-94.

242 Bibliography

Pollack, L. A., Li, J., Berkowitz, Z., Weir, H. K., Wu, X. C., et al. (2011) Melanoma survival

in the United States, 1992 to 2005. J Am Acad Dermatol 65:S78-86.

Ponec, M. (1991) Reconstruction of human epidermis on de-epidermized dermis: Expression

of differentiation-specific protein markers and lipid composition. Toxicol In Vitro 5:597-606.

Ponec, M. (2002) Skin constructs for replacement of skin tissues for in vitro testing. Adv

Drug Deliv Rev 54:S19-30.

Ponec, M., Boelsma, E., Gibbs, S., Mommaas, M. (2002) Characterization of reconstructed

skin models. Skin pharmacology and applied skin physiology 15 Suppl 1:4-17.

Ponec, M., Boelsma, E., Weerheim, A., Mulder, A., Bouwstra, J., et al. (2000) Lipid and

ultrastructural characterization of reconstructed skin models. International journal of

pharmaceutics 203:211-25.

Ponec, M., Weerheim, A., Kempenaar, J., Boonstra, J. (1988a) Proliferation and

differentiation of human squamous carcinoma cell lines and normal keratinocytes: effects of

epidermal growth factor, retinoids, and hydrocortisone. In vitro cellular & developmental

biology : journal of the Tissue Culture Association 24:764-70.

Ponec, M., Weerheim, A., Kempenaar, J., Mommaas, A. M., Nugteren, D. H. (1988b) Lipid

composition of cultured human keratinocytes in relation to their differentiation. J Lipid Res

29:949-61.

Poon, R. Y., Jiang, W., Toyoshima, H., Hunter, T. (1996) Cyclin-dependent kinases are

inactivated by a combination of p21 and Thr-14/Tyr-15 phosphorylation after UV-induced

DNA damage. The Journal of Biological Chemistry 271:13283-91.

Poon, T., Kuchel, J., Badrddin, A., Halliday, G., Barnetson, R., et al. (2003) Objective

measurement of minimal erythema and melanogenic doses using natural and solar-simulated

light. Photochem Photobiol 78:331-6.

Porter, A. G., Janicke, R. U. (1999) Emerging roles of caspase-3 in apoptosis. Cell Death

Differ 6:99-104.

Potten, C. S. (1974) The epidermal proliferative unit: the possible role of the central basal

cell. Cell Tissue Kinet 7:77-88.

Poumay, Y., Dupont, F., Marcoux, S., Leclercq-Smekens, M., Herin, M., et al. (2004) A

simple reconstructed human epidermis: preparation of the culture model and utilization in in

vitro studies. Arch Dermatol Res 296:203-11.

Poumay, Y., Dupont, F., Marcoux, S., Leclercq-Smekens, M., Herin, M., Coquette, A.

(2004) A simple reconstructed human epidermis: preparation of the culture model and

utilization in in vitro studies. Arch Dermatol Res 296:203-11.

Bibliography 243

Priestley, G. C., Lord, R. (1990) Fibroblast-keratinocyte interactions in psoriasis: failure of

psoriatic fibroblasts to stimulate keratinocyte proliferation in vitro. British Journal of


Protic-Sabljic, M., Tuteja, N., Munson, P. J., Hauser, J., Kraemer, K. H., et al. (1986) UV

light-induced cyclobutane pyrimidine dimers are mutagenic in mammalian cells. Mol Cell

Biol 6:3349-56.

Prunieras, M., Regnier, M., Woodley, D. (1983) Methods for cultivation of keratinocytes

with an air-liquid interface. The Journal of investigative dermatology 81:28s-33s.

Qin, J. Z., Chaturvedi, V., Denning, M. F., Bacon, P., Panella, J., et al. (2002) Regulation of

apoptosis by p53 in UV-irradiated human epidermis, psoriatic plaques and senescent

keratinocytes. Oncogene 21:2991-3002.

Quan, T., He, T., Kang, S., Voorhees, J. J., Fisher, G. J. (2004) Solar ultraviolet irradiation

reduces collagen in photoaged human skin by blocking transforming growth factor-beta type

II receptor/Smad signaling. Am J Pathol 165:741-51.

Raile, K., Hille, R., Laue, S., Schulz, A., Pfeifer, G., et al. (2003) Insulin-like growth factor I

(IGF-I) stimulates proliferation but also increases caspase-3 activity, Annexin-V binding,

and DNA-fragmentation in human MG63 osteosarcoma cells: co-activation of pro- and anti-

apoptotic pathways by IGF-I. Horm Metab Res 35:786-93.

Raja, Sivamani, K., Garcia, M. S., Isseroff, R. R. (2007) Wound re-epithelialization:

modulating keratinocyte migration in wound healing. Front Biosci 12:2849-68.

Ralston, D. R., Layton, C., Dalley, A. J., Boyce, S. G., E., F., et al. (1999) The requirement

for basement membrane antigens in the production of human epidermal/dermal composites

in vitro. British Journal of Dermatology 140:605-15.

Ramsay, H. M., Harden, P. N., Reece, S., Smith, A. G., Jones, P. W., et al. (2001)

Polymorphisms in glutathione S-transferases are associated with altered risk of

nonmelanoma skin cancer in renal transplant recipients: a preliminary analysis. The Journal

of investigative dermatology 117:251-5.

Rass, K., Reichrath, J. (2008) UV damage and DNA repair in malignant melanoma and

nonmelanoma skin cancer. Adv Exp Med Biol 624:162-78.

Ravanat, J. L., Douki, T., Cadet, J. (2001) Direct and indirect effects of UV radiation on

DNA and its components. Journal of Photochemistry and Photobiology B: Biology 63:88-

102.

Rayment, E. A., Dargaville, T. R., Shooter, G. K., George, G. A., Upton, Z. (2008)

Attenuation of protease activity in chronic wound fluid with bisphosphonate-functionalised

hydrogels. Biomaterials 29:1785-95.

Reed, J. C. (1998) Bcl-2 family proteins. Oncogene 17:3225-36.

244 Bibliography

Regan, J. D., Setlow, R. (1974) Two forms of repair in the DNA of human cells damaged by

chemical carcinogens and mutagens. Cancer research 34:3318.

Régnier, M., Staquet, M. J., Schmitt, D., Schmidt, R. (1997) Integration of Langerhans cells

into a pigmented reconstructed human epidermis. J Invest Dermatol 109:510-12.

Regnier, M., Vaigot, P., Darmon, M., Prunieras, M. (1986) Onset of epidermal

differentiation in rapidly proliferating basal keratinocytes. The Journal of investigative


Reich, N. C., Levine, A. J. (1984) Growth regulation of a cellular tumour antigen, p53, in

nontransformed cells. Nature 308:199-201.

Reichrath, J. (2003) Protecting against adverse effects of sun protection. J Am Acad

Dermatol 49:1204-6.

Reus, A. A., van Meeuwen, R.N.C., de Vogel, N., Maas, W.J.M., Krul, C.A.M. (2011)

Development and characterisation of an in vitro photomicronucleus test using ex vivo human

skin tissue. Mutagen

26:261-8.

Rhee, S. (2009) Fibroblasts in three dimensional matrices: cell migration and matrix

remodeling. Experimental & molecular medicine 41:858-65.

Rhee, S., Grinnell, F. (2007) Fibroblast mechanics in 3D collagen matrices. Adv Drug Deliv

Rev 59:1299-305.

Rheinwald, J. G., Green, H. (1975) Serial cultivation of strains of human epidermal

keratinocytes: the formation of keratinizing colonies from single cells. Cell 6:331-43.

Riou, L., Eveno, E., van Hoffen, A., van Zeeland, A. A., Sarasin, A., et al. (2004)

Differential Repair of the Two Major UV-Induced Photolesions in Trichothiodystrophy

Fibroblasts. Cancer research 64:889-94.

Rivlin, N., Brosh, R., Oren, M., Rotter, V. (2011) Mutations in the p53 Tumor Suppressor

Gene. Genes & Cancer 2:466-74.

Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., Bonner, W. M. (1998) DNA double-

stranded breaks induce histone H2AX phosphorylation on serine 139. The Journal of

biological chemistry 273:5858-68.

Roos, W. P., Kaina, B. (2006) DNA damage-induced cell death by apoptosis. Trends in

molecular medicine 12:440-50.

Rosario, R., Mark, G. J., Parrish, J. A., Mihm, M. C., Jr. (1979) Histological changes

produced in skin by equally erythemogenic doses of UV-A, UV-B, UV-C and UV-A with

psoralens. The British journal of dermatology 101:299-308.

Bibliography 245

Rosdy, M., Clauss, L. C. (1990) Terminal epidermal differentiation of human keratinocytes

grown in chemically defined medium on inert filter substrates at the air-liquid interface. J

Invest Dermatol 95:409-14.

Rosette, C., Karin, M. (1996) Ultraviolet light and osmotic stress: activation of the JNK

cascade through multiple growth factor and cytokine receptors. Science 274:1194-7.

Rotwein, P. (1999) Human growth disorders: molecular genetics of the growth hormone-

insulin-like growth factor I axis. Acta Paediatr Suppl 88:148-51.

Rudman, S. M., Philpott, M.P., Thomas, G.A., Kealey, T. (1997) The role of IGF-I in human

skin and its appendages: morphogen as well as mitogen? Society for Investigative


Ruven, H. J., Berg, R. J., Seelen, C. M., Dekkers, J. A., Lohman, P. H., et al. (1993)

Ultraviolet-induced cyclobutane pyrimidine dimers are selectively removed from

transcriptionally active genes in the epidermis of the hairless mouse. Cancer research

53:1642-5.

Saade, N. E., Nasr, I. W., Massaad, C. A., Safieh-Garabedian, B., Jabbur, S. J., et al. (2000)

Modulation of ultraviolet-induced hyperalgesia and cytokine upregulation by interleukins 10

and 13. British journal of pharmacology 131:1317-24.

Sablina, A. A., Budanov, A.V., Ilyinskaya, G.V., Agapova, L.S., Kravchenko, J.E.,

Chumakov, P.M. (2005) The antioxidant function of the p53 tumor suppressor. Nat Med

11:1306-13.

Sachs, D. L., Kang, S., Hammerberg, C., Helfrich, Y., Karimipour, D., et al. (2009) Topical

fluorouracil for actinic keratoses and photoaging: a clinical and molecular analysis. Arch

Dermatol 145:659-66.

Sadagurski, M., Yakar, S., Weingarten, G., Holzenberger, M., Rhodes, C. J., et al. (2006)

Insulin-like growth factor 1 receptor signaling regulates skin development and inhibits skin

keratinocyte differentiation. Mol Cell Biol 26:2675-87.

Saiag, P., Coulomb, B., Lebreton, C., Bell, E., Dubertret, L. (1985) Psoriatic fibroblasts

induce hyperproliferation of normal keratinocytes in a skin equivalent model in vitro.

Science 230:669-72.

Samani, A. A., Yakar, S., LeRoith, D., Brodt, P. (2007) The role of the IGF system in cancer

growth and metastasis: overview and recent insights. Endocr Rev 28:20-47.

Samuel, M., Brooke, R. C., Hollis, S., Griffiths, C. E. (2005) Interventions for

photodamaged skin. Cochrane Database Syst Rev:CD001782.

Sancar, A. (1995) DNA repair in humans. Annual review of genetics 29:69-105.

246 Bibliography

Sancar, A., Lindsey-Boltz, L. A., Ünsal-Kaçmaz, K., Linn, S. (2004) Molecular mechanisms

of mammalian DNA repair and the DNA damage checkpoints. Annual review of

biochemistry 73:39-85.

Sanchez, Y., Wong, C., Thoma, R. S., Richman, R., Wu, Z., et al. (1997) Conservation of the

Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through

Cdc25. Science 277:1497-501.

Sandhu, M. S., Dunger, D. B., Giovannucci, E. L. (2002) Insulin, insulin-like growth factor-I

(IGF-I), IGF binding proteins, their biologic interactions, and colorectal cancer. J Natl

Cancer Inst 94:972-80.

Sandilands, A., Sutherland, C., Irvine, A. D., McLean, W. H. (2009) Filaggrin in the

frontline: role in skin barrier function and disease. Journal of cell science 122:1285-94.

Santiago-Walker, A., Li, L., Haass, N.K., Herlyn, M. (2009) Melanocytes: from morphology

to application. Skin Pharmacol Physiol 22:114-21.

Satelli, A., Li, S. (2011) Vimentin in cancer and its potential as a molecular target for cancer

therapy. Cellular and Molecular Life Sciences 68:3033-46.

Satoh, M. S., Lindahl, T. (1992) Role of poly(ADP-ribose) formation in DNA repair. Nature

356:356-8.

Sauter, E. R., Klein-Szanto, A.J., Atillasoy, E., Montone, K.T., Goodrow, T., Binder, R.L.,

Seykora, J.T., Herlyn, M. (1998) Ultraviolet B-induced squamous epithelial and melanocytic

cell changes in a xenograft model of cancer development in human skin. Mol Carcinog

23:168-74.

Schafer, I. A., Shapiro, A., Kovach, M., Lang, C., Fratianne, R. B. (1989) The interaction of

human papillary and reticular fibroblasts and human keratinocytes in the contraction of

three-dimensional floating collagen lattices. Exp Cell Res 183:112-25.

Scharffetter-Kochanek, K., Wlaschek, M., Brenneisen, P., Schauen, M., Blaudschun, R., et

al. (1997) UV-induced reactive oxygen species in photocarcinogenesis and photoaging.

Biological chemistry 378:1247.

Scholzen, T., Gerdes, J. (2000) The Ki-67 protein: from the known and the unknown. J Cell

Physiol 182:311-22.

Schoop, V. M., Mirancea, N., Fusenig, N. E. (1999) Epidermal organization and

differentiation of HaCaT keratinocytes in organotypic coculture with human dermal

fibroblasts. The Journal of investigative dermatology 112:343-53.

Schultz, G. S., White, M., Mitchell, R., Brown, G., Lynch, J., et al. (1987) Epithelial wound

healing enhanced by transforming growth factor-alpha and vaccinia growth factor. Science

235:350-2.

Bibliography 247

Schurmann, A., Mooney, A. F., Sanders, L. C., Sells, M. A., Wang, H. G., et al. (2000) p21-

activated kinase 1 phosphorylates the death agonist bad and protects cells from apoptosis.

Mol Cell Biol 20:453-61.

Schwartz, R. A. (1996) Premalignant keratinocytic neoplasms. J Am Acad Dermatol 35:223-

42.

Schwarz, T. (2008) 25 years of UV-induced immunosuppression mediated by T cells-from

disregarded T suppressor cells to highly respected regulatory T cells. Photochem Photobiol

84:10-8.

Scott, G., Cassidy, L., Busacco, A. (1997) Fibronectin suppresses apoptosis in normal human

melanocytes through an integrin-dependent mechanism. The Journal of investigative


Scott, G. A., Haake, A. R. (1991) Keratinocytes regulate melanocyte number in human fetal

and neonatal skin equivalents. The Journal of investigative dermatology 97:776-81.

Segal, N., Andriani, F., Pfeiffer, L., Kamath, P., Lin, N., Satyamurthy, K., Egles, C., Garlick,

J.A. (2008) The basement membrane microenvironment directs the normalization and

survival of bioengineered human skin equivalents. Matrix Biol 27:163-70.

Seite, S., Fourtanier, A., Moyal, D., Young, A. R. (2010) Photodamage to human skin by

suberythemal exposure to solar ultraviolet radiation can be attenuated by sunscreens: a

review. The British journal of dermatology 163:903-14.

Sesto, A., Navarro, M., Burslem, F., Jorcano, J. L. (2002) Analysis of the ultraviolet B

response in primary human keratinocytes using oligonucleotide microarrays. Proc Natl Acad

Sci U S A 99:2965-70.

Setlow, R. B. (1966) Cyclobutane-type pyrimidine dimers in polynucleotides. Science

153:379-86.

Setlow, R. B., Carrier, W. L. (1966) Pyrimidine dimers in ultraviolet-irradiated DNA's. J

Mol Biol 17:237-54.

She, Q.-B., Ma, W.-Y., Zhong, S., Dong, Z. (2002) Activation of JNK1, RSK2, and MSK1

Is Involved in Serine 112 Phosphorylation of Bad by Ultraviolet B Radiation. Journal of


Shieh, S. Y., Ikeda, M., Taya, Y., Prives, C. (1997) DNA damage-induced phosphorylation

of p53 alleviates inhibition by MDM2. Cell 91:325-34.

Shih, S. T. F., Carter, R., Sinclair, C., Mihalopoulos, C., Vos, T. (2009) Economic evaluation

of skin cancer prevention in Australia. Preventive Medicine 49:449-53.

Shimamura, H., Terada, Y., Okado, T., Tanaka, H., Inoshita, S., et al. (2003) The PI3-

kinase-Akt pathway promotes mesangial cell survival and inhibits apoptosis in vitro via NF-

kappa B and Bad. J Am Soc Nephrol 14:1427-34.

248 Bibliography

Shimizu, H., Banno, Y., Sumi, N., Naganawa, T., Kitajima, Y., et al. (1999) Activation of

p38 Mitogen-Activated Protein Kinase and Caspases in UVB-Induced Apoptosis of Human

Keratinocyte HaCaT Cells. 112:769-74.

Shin, J. H., Ji, C., Casinghino, S., McCarthy, T.L., Centrella, M. (1997) Parathyroid

hormone-related protein enhances insulin-like growth factor-I expression by fetal rat dermal

fibroblasts. J Biol Chem 272:23498-502.

Shin, Y.-H., Seo, Y.-K., Yoon, H.-H., Song, K.-Y., Park, J.-K. (2012) Effect of keratinocytes

on regulation of melanogenesis in culture of melanocytes. Biotechnology and Bioprocess

Engineering 17:203-10.

Siddle, K., Urso, B., Niesler, C. A., Cope, D. L., Molina, L., et al. (2001) Specificity in

ligand binding and intracellular signalling by insulin and insulin-like growth factor receptors.

Biochem Soc Trans 29:513-25.

Simon, J. C., Tigelaar, R. E., Bergstresser, P. R., Edelbaum, D., Cruz, P. D. (1991)

Ultraviolet B radiation converts Langerhans cells from immunogenic to tolerogenic antigen-

presenting cells. Induction of specific clonal anergy in CD4+ T helper 1 cells. The Journal of

Immunology 146:485-91.

Simpson, M. J., Towne, C., McElwain, D. L., Upton, Z. (2010) Migration of breast cancer

cells: understanding the roles of volume exclusion and cell-to-cell adhesion. Physical review

E, Statistical, nonlinear, and soft matter physics 82:041901.

Sitailo, L. A., Tibudan, S. S., Denning, M. F. (2002) Activation of Caspase-9 Is Required for

UV-induced Apoptosis of Human Keratinocytes. Journal of Biological Chemistry

277:19346-52.

Sjögren, K., Jansson, J.O., Isaksson, O.G., Ohlsson, C. (2002) A transgenic model to

determine the physiological role of liver-derived insulin-like growth factor I. Minerva

Endocrinol 27:299-311.

Sjögren, K., Liu, J. L., Blad, K., Skrtic, S., Vidal, O., et al. (1999) Liver-derived insulin-like

growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for

postnatal body growth in mice. Proceedings of the National Academy of Sciences 96:7088.

Slee, E. A., Adrain, C., Martin, S. J. (2001) Executioner Caspase-3, -6, and -7 Perform

Distinct, Non-redundant Roles during the Demolition Phase of Apoptosis. Journal of


Slominski, A., Pawelek, J. (1998) Animals under the sun: effects of ultraviolet radiation on

mammalian skin. Clinics in dermatology 16:503-15.

Slominski, A., Pisarchik, A., Semak, I., Sweatman, T., Wortsman, J., et al. (2002)

Serotoninergic and melatoninergic systems are fully expressed in human skin. The FASEB

journal : official publication of the Federation of American Societies for Experimental

Biology 16:896-8.

Bibliography 249

Smalley, K. S., Lioni, M., Herlyn, M. (2006) Life isn't flat: taking cancer biology to the next

dimension. In Vitro Cell Dev Biol Anim 42:242-7.

Smit, P., Plomp, E., Neumann, H. A. M., Thio, H. B. (2012) The influence of the location of

the lesion on the absolute risk of the development of skin cancer in a patient with actinic

keratosis. Journal of the European Academy of Dermatology and Venereology:no-no.

Smith-Thomas, L., Moustafa, M., Spada, C. S., Shi, L., Dawson, R. A., et al. (2004)

Latanoprost-induced pigmentation in human iridial melanocytes is fibroblast dependent. Exp

Eye Res 78:973-85.

Smith, J., Tho, L. M., Xu, N., Gillespie, D. A. (2010) The ATM-Chk2 and ATR-Chk1

pathways in DNA damage signaling and cancer. Adv Cancer Res 108:73-112.

Smith, L. T., Underwood, R. A., McLean, W. H. (1999) Ontogeny and regional variability of

keratin 2e (K2e) in developing human fetal skin: a unique spatial and temporal pattern of

keratin expression in development. The British journal of dermatology 140:582-91.

Smith, M. D., Rees, J. L. (1994) Wavelength-specific upregulation of keratin mRNA

expression in response to ultraviolet radiation. The Journal of investigative dermatology

102:433-9.

Smola, H., Stark, H. J., Thiekotter, G., Mirancea, N., Krieg, T., et al. (1998) Dynamics of

basement membrane formation by keratinocyte-fibroblast interactions in organotypic skin

culture. Experimental Cell Research 239:399-410.

Smola, H., Thiekotter, G., Fusenig, N. E. (1993) Mutual induction of growth factor gene

expression by epidermal-dermal cell interaction. The Journal of cell biology 122:417-29.

Snellman, E., Strozyk, M., Segerback, D., Klimenko, T., Hemminki, K. (2003) Effect of the

spectral range of a UV lamp on the production of cyclobutane pyrimidine dimers in human

skin in situ. Photodermatol Photoimmunol Photomed 19:281-6.

Sok, J., Pineau, N., Dalko-Csiba, M., Breton, L., Bernerd, F. (2008) Improvement of the

dermal epidermal junction in human reconstructed skin by a new c-xylopyranoside

derivative. Eur J Dermatol 18:297-302.

Sorrell, J. M., Baber, M. A., Caplan, A. I. (2007) Clonal characterization of fibroblasts in the

superficial layer of the adult human dermis. Cell Tissue Res 327:499-510.

Sorrell, J. M., Caplan, A.I. (2004) Fibroblast heterogeneity: more than skin deep. J Cell Sci

117:667-75.

Sotiropoulou, P. A., Blanpain, C. (2012) Development and homeostasis of the skin

epidermis. Cold Spring Harb Perspect Biol 4:a008383.

250 Bibliography

Spandau, D. F., Lewis, D. A., Somani, A. K., Travers, J. B. (2012) Fractionated laser

resurfacing corrects the inappropriate UVB response in geriatric skin. J Invest Dermatol

132:1591-6.

Stanton, M. F. (1965) Diethylnitrosamine-Induced Hepatic Degeneration and Neoplasia in

the Aquarium Fish, Brachydanio Rerio. J Natl Cancer Inst 34:117-30.

Staples, C. J., Owens, D. M., Maier, J. V., Cato, A. C., Keyse, S. M. (2010) Cross-talk

between the p38alpha and JNK MAPK pathways mediated by MAP kinase phosphatase-1

determines cellular sensitivity to UV radiation. J Biol Chem 285:25928-40.

Staples, M. P., Elwood, M., Burton, R. C., Williams, J. L., Marks, R., et al. (2006) Non-

melanoma skin cancer in Australia: the 2002 national survey and trends since 1985. Med J

Aust 184:6-10.

Stenback, F., Wasenius, V. M. (1985) Basement membranes in ultraviolet light-induced skin

lesions and tumors. Photo-dermatology 2:347-58.

Stewart, C. E., Rotwein, P. (1996) Growth, differentiation, and survival: multiple

physiological functions for insulin-like growth factors. Physiol Rev 76:1005-26.

Stewart, F. (1996) Roles of mesenchymal-epithelial interactions and hepatocyte growth

factor-scatter factor (HGF-SF) in placental development. Reviews of reproduction 1:144-8.

Stokes, M. P., Rush, J., Macneill, J., Ren, J. M., Sprott, K., et al. (2007) Profiling of UV-

induced ATM/ATR signaling pathways. Proc Natl Acad Sci U S A 104:19855-60.

Strickland, I., Rhodes, L. E., Flanagan, B. F., Friedmann, P. S. (1997) TNF-[agr] and IL-8

Are Upregulated in the epidermis of Normal Human Skin after UVB Exposure: Correlation

with Neutrophil Accumulation and E-Selectin Expression. J Investig Dermatol 108:763-8.

Stull, M. A., Richert, M. M., Loladze, A. V., Wood, T. L. (2002) Requirement for IGF-I in

epidermal growth factor-mediated cell cycle progression of mammary epithelial cells.


Su, T. T. (2006) Cellular responses to DNA damage: one signal, multiple choices. Annu Rev

Genet 40:187-208.

Sun, H., Lesche, R., Li, D. M., Liliental, J., Zhang, H., et al. (1999) PTEN modulates cell

cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate

and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A 96:6199-204.

Sun, T., Jackson, S., Haycock, J. W., MacNeil, S. (2006) Culture of skin cells in 3D rather

than 2D improves their ability to survive exposure to cytotoxic agents. Journal of

Biotechnology 122:372-81.

Supp, D. M., Boyce, S. T. (2005) Engineered skin substitutes: practices and potentials.

Clinics in Dermatology 23:403-12.

Bibliography 251

Surmacz, E. (2000) Function of the IGF-I Receptor in Breast Cancer. J Mammary Gland

Biol Neoplasia 5:95-105.

Suzuki, H., Fukuyama, K., Epstein, J. H., Epstein, W. L. (1978) Ultrastructural study of the

nuclei in premitotic and repair DNA synthesis following UVB injury. The Journal of


Svobodova, A., Vostalova, J. (2010) Solar radiation induced skin damage: review of

protective and preventive options. Int J Radiat Biol 86:999-1030.

Svobodova, A., Walterova, D., Vostalova, J. (2006) Ultraviolet light induced alteration to the

skin. Biomedical papers of the Medical Faculty of the University Palacky, Olomouc,

Czechoslovakia 150:25-38.

Svobodova, A. R., Galandakova, A., Sianska, J., Dolezal, D., Lichnovska, R., et al. (2012)

DNA damage after acute exposure of mice skin to physiological doses of UVB and UVA

light. Archives of dermatological research.

Swope, V. B., Supp, A. P., Greenhalgh, D. G., Warden, G. D., Boyce, S. T. (2001)

Expression of Insulin-Like Growth Factor I by Cultured Skin Substitutes Does Not Replace

the Physiologic Requirement for Insulin In Vitro. J Investig Dermatol 116:650-7.

Szabo, G., Blog, F. B., Kornhauser, A. (1982) Toxic effect of ultraviolet light on

melanocytes: use of animal models in pigment research. J Natl Cancer Inst 69:245-50.

Tadokoro, T., Kobayashi, N., Zmudzka, B.Z., Ito, S., Wakamatsu, K., Yamaguchi, Y.,

Korossy, K.S., Miller, S.A., Beer, J.Z., Hearing, V.J. (2003) UV-induced DNA damage and

melanin content in human skin differing in racial/ethnic origin. FASEB J 17:1177-9.

Takayama, H., La Rochelle, W. J., Anver, M., Bockman, D. E., Merlino, G. (1996) Scatter

factor/hepatocyte growth factor as a regulator of skeletal muscle and neural crest

development. Proc Natl Acad Sci U S A 93:5866-71.

Tang, J. Y., Hwang, B. J., Ford, J. M., Hanawalt, P. C., Chu, G. (2000) Xeroderma

pigmentosum p48 gene enhances global genomic repair and suppresses UV-induced

mutagenesis. Molecular cell 5:737-44.

Tao, Y., Pinzi, V., Bourhis, J., Deutsch, E. (2007) Mechanisms of Disease: signaling of the

insulin-like growth factor 1 receptor pathway[mdash]therapeutic perspectives in cancer. Nat

Clin Prac Oncol 4:591-602.

Tavakkol, A., Elder, J. T., Griffiths, C. E., Cooper, K. D., Talwar, H., et al. (1992)

Expression of growth hormone receptor, insulin-like growth factor 1 (IGF-1) and IGF-1

receptor mRNA and proteins in human skin. The Journal of investigative dermatology

99:343-9.

252 Bibliography

Tavakkol, A., Varani, J., Elder, J. T., Zouboulis, C. C. (1999) Maintenance of human skin in

organ culture: role for insulin-like growth factor-1 receptor and epidermal growth factor

receptor. Arch Dermatol Res 291:643-51.

Taylor, R. C., Cullen, S. P., Martin, S. J. (2008) Apoptosis: controlled demolition at the

cellular level. Nat Rev Mol Cell Biol 9:231-41.

ten Berge, O., van Velsen, S. G., Giovannone, B., Bruijnzeel-Koomen, C. A., Knol, E. F., et

al. (2011) Assessment of cyclobutane pyrimidine dimers by digital photography in human

skin. Journal of immunological methods 373:240-6.

Tewari, M., Quan, L. T., O'Rourke, K., Desnoyers, S., Zeng, Z., et al. (1995) Yama/CPP32

beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death

substrate poly(ADP-ribose) polymerase. Cell 81:801-9.

Therrien, J.-P., Rouabhia, M., Drobetsky, E. A., Drouin, R. (1999) The Multilayered

Organization of Engineered Human Skin Does Not Influence the Formation of Sunlight-

induced Cyclobutane Pyrimidine Dimers in Cellular DNA. Cancer research 59:285-9.

Thomas-Ahner, J. M., Wulff, B. C., Tober, K. L., Kusewitt, D. F., Riggenbach, J. A., et al.

(2007) Gender Differences in UVB-Induced Skin Carcinogenesis, Inflammation, and DNA

Damage. Cancer Research 67:3468-74.

Thomas, T., Dziadek, M. (1993) Genes coding for basement membrane glycoproteins

laminin, nidogen, and collagen IV are differentially expressed in the nervous system and by

epithelial, endothelial, and mesenchymal cells of the mouse embryo. Experimental Cell

Research 208:54-67.

Thumiger, S. P., Adams, T. E., Werther, G. A., Wraight, C. J., Edmondson, S. R. (2005) UV

induced responses of the human epidermal IGF system: impaired anti-apoptotic effects of

IGF-I in HaCaT keratinocytes. Growth Factors 23:151-9.

Tinois, E., Tiollier, J., Gaucherand, M., Dumas, H., Tardy, M., et al. (1991) In vitro and

post-transplantation differentiation of human keratinocytes grown on the human type IV

collagen film of a bilayered dermal substitute. Experimental Cell Research 193:310-9.

Todd, C., Hewitt, S. D., Kempenaar, J., Noz, K., Thody, A. J., et al. (1993) Co-culture of

human melanocytes and keratinocytes in a skin equivalent model: effect of ultraviolet

radiation. Arch Dermatol Res 285:455-9.

Topol, B. M., Haimes, H. B., Dubertret, L., Bell, E. (1986) Transfer of melanosomes in a

skin equivalent model in vitro. The Journal of investigative dermatology 87:642-7.

Topping, G., Malda, J., Dawson, R., Upton, Z. (2006) Development and characterisation of

human skin equivalents and their potential application as a burn wound model. Primary

Intention 14:14-21.

Torma, H. (2011) Regulation of keratin expression by retinoids. Dermato-endocrinology

3:136-40.

Bibliography 253

Trojanek, J., Ho, T., Del Valle, L., Nowicki, M., Wang, J. Y., et al. (2003a) Role of the

insulin-like growth factor I/insulin receptor substrate 1 axis in Rad51 trafficking and DNA

repair by homologous recombination. Mol Cell Biol 23:7510-24.

Trojanek, J., Ho, T., Del Valle, L., Nowicki, M., Wang, J. Y., et al. (2003b) Role of the

Insulin-Like Growth Factor I/Insulin Receptor Substrate 1 Axis in Rad51 Trafficking and

DNA Repair by Homologous Recombination. Mol Cell Biol 23:7510-24.

Tron, V. A., Trotter, M. J., Ishikawa, T., Ho, V. C., Li, G. (1998a) p53-dependent regulation

of nucleotide excision repair in murine epidermis in vivo. J Cutan Med Surg 3:16-20.

Tron, V. A., Trotter, M. J., Tang, L., Krajewska, M., Reed, J. C., et al. (1998b) p53-regulated

apoptosis is differentiation dependent in ultraviolet B-irradiated mouse keratinocytes. The

American Journal of Pathology 153:579-85.

Tsao, H., Atkins, M. B., Sober, A. J. (2004) Management of cutaneous melanoma. N Engl J

Med 351:998-1012.

Tseng, S. C. G., Kruse, F. E., Merritt, J., Li, D.-Q. (1996) Comparison between serum-free

and fibroblast-cocultured single-cell clonal culture systems: Evidence showing that epithelial

anti-apoptotic activity is present in 3T3 fibroblast-conditioned media. Current Eye Research

15:973-84.

Tyrrell, R. M., Keyse, S. M. (1990) New trends in photobiology. The interaction of UVA

radiation with cultured cells. J Photochem Photobiol B 4:349-61.

Tyrrell, R. M., Pidoux, M. (1989) Singlet oxygen involvement in the inactivation of cultured

human fibroblasts by UVA (334 nm, 365 nm) and near-visible (405 nm) radiations.

Photochemistry and Photobiology 49:407-12.

Unger, T., Sionov, R. V., Moallem, E., Yee, C. L., Howley, P. M., et al. (1999) Mutations in

serines 15 and 20 of human p53 impair its apoptotic activity. Oncogene 18:3205.

Upton, Z., Cuttle, L., Noble, A., Kempf, M., Topping, G., et al. (2008) Vitronectin: growth

factor complexes hold potential as a wound therapy approach. The Journal of investigative


Upton, Z., Wallace, H. J., Shooter, G. K., van Lonkhuyzen, D. R., Yeoh-Ellerton, S., et al.

(2011) Human pilot studies reveal the potential of a vitronectin: growth factor complex as a

treatment for chronic wounds. International wound journal 8:522-32.

Upton, Z., Webb, H., Hale, K., Yandell, C. A., McMurtry, J. P., et al. (1999) Identification

of vitronectin as a novel insulin-like growth factor-II binding protein. Endocrinology

140:2928-31.

Urbanski, A., Schwarz, T., Neuner, P., Krutmann, J., Kirnbauer, R., et al. (1990) Ultraviolet

light induces increased circulating interleukin-6 in humans. The Journal of investigative


254 Bibliography

Vaira, V., Lee, C. W., Goel, H. L., Bosari, S., Languino, L. R., et al. (2006) Regulation of

survivin expression by IGF-1//mTOR signaling. Oncogene 26:2678-84.

Valenta, C., Auner, B.G. (2004) The use of polymers for dermal and transdermal delivery.

Biopharmaceutics 58:279-89.

van Laethem, A., Claerhout, S., Garmyn, M., Agostinis, P. (2005) The sunburn cell:

regulation of death and survival of the keratinocyte. Int J Biochem Cell Biol 37:1547-53.

van Laethem, A., Garmyn, M., Agostinis, P. (2009) Starting and propagating apoptotic

signals in UVB irradiated keratinocytes. Photochem Photobiol Sci 8:299-308.

Van Laethem, A., Van Kelst, S., Lippens, S., Declercq, W., Vandenabeele, P., et al. (2004)

Activation of p38 MAPK is required for Bax translocation to mitochondria, cytochrome c

release and apoptosis induced by UVB irradiation in human keratinocytes. Faseb J 18:1946-

8.

Van Lonkhuyzen, D. R., Hollier, B. G., Shooter, G. K., Leavesley, D. I., Upton, Z. (2007)

Chimeric vitronectin:insulin-like growth factor proteins enhance cell growth and migration

through co-activation of receptors. Growth Factors 25:295-308.

Van Steeg, H., Kraemer, K. H. (1999) Xeroderma pigmentosum and the role of UV-induced

DNA damage in skin cancer. Mol Med Today 5:86-94.

Verkler, T. L., Delongchamp, R. R., Couch, L. H., Miller, B. J., Warbritton, A., et al. (2008)

Populations of p53 codon 270 CGT to TGT mutant cells in SKH-1 mouse skin tumors

induced by simulated solar light. Mol Carcinog 47:822-34.

Vincent, A. M., Feldman, E. L. (2002) Control of cell survival by IGF signaling pathways.

Growth Hormone & IGF Research 12:193-7.

Vostalova, J., Zdarilova, A., Svobodova, A. (2010) Prunella vulgaris extract and rosmarinic

acid prevent UVB-induced DNA damage and oxidative stress in HaCaT keratinocytes.

Archives of dermatological research 302:171-81.

Vousden, K. H. (2000) p53: death star. Cell 103:691-4.

Vousden, K. H., Woude, G. F. (2000) The ins and outs of p53. Nat Cell Biol 2:E178-80.

Vreeswijk, M. P., van Hoffen, A., Westland, B. E., Vrieling, H., van Zeeland, A. A., et al.

(1994) Analysis of repair of cyclobutane pyrimidine dimers and pyrimidine 6-4 pyrimidone

photoproducts in transcriptionally active and inactive genes in Chinese hamster cells. The


Wade Harper, J., Adami, G. R., Wei, N., Keyomarsi, K., Elledge, S. J. (1993) The p21 Cdk-

interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-16.

Bibliography 255

Walsh, S. B., Xu, J., Xu, H., Kurundkar, A.R., Maheshwari, A., Grizzle, W.E., Timares, L.,

Huang, C.C., Kopelovich, L., Elmets, C.A., Athar, M. (2011) Cyclosporine a mediates

pathogenesis of aggressive cutaneous squamous cell carcinoma by augmenting epithelial-

mesenchymal transition: Role of TGFβ signaling pathway. Mol Carcinog.

Wang, G. Y., Wang, J., Mancianti, M. L., Epstein, E. H., Jr. (2011) Basal cell carcinomas

arise from hair follicle stem cells in Ptch1(+/-) mice. Cancer Cell 19:114-24.

Wang, H. Q., Quan, T., He, T., Franke, T. F., Voorhees, J. J., et al. (2003) Epidermal growth

factor receptor-dependent, NF-kappaB-independent activation of the phosphatidylinositol 3-

kinase/Akt pathway inhibits ultraviolet irradiation-induced caspases-3, -8, and -9 in human

keratinocytes. The Journal of biological chemistry 278:45737-45.

Wang, R. J. (1976) Effect of room fluorescent light on the deterioration of tissue culture

medium. In Vitro 12:19-22.

Wang, Z., Wang, Y., Farhangfar, F., Zimmer, M., Zhang, Y. (2012) Enhanced Keratinocyte

Proliferation and Migration in Co-culture with Fibroblasts. PLoS One 7:e40951.

Weatherhead, S. C., Farr, P. M., Jamieson, D., Hallinan, J. S., Lloyd, J. J., et al. (2011)

Keratinocyte apoptosis in epidermal remodeling and clearance of psoriasis induced by UV

radiation. J Invest Dermatol 131:1916-26.

Wei, L., Debets, R., Hegmans, J. J., Benner, R., Prens, E. P. (1999) IL-1 beta and IFN-

gamma induce the regenerative epidermal phenotype of psoriasis in the transwell skin organ

culture system. IFN-gamma up-regulates the expression of keratin 17 and keratinocyte

transglutaminase via endogenous IL-1 production. J Pathol 187:358-64.

Welfare, A. I. o. H. a. (2005) Health system expenditures on cancer and other neoplasms in

Australia, 2000-01. Welfare, A. I. o. H. a., Health and Welfare Expenditure, 22,

Welss, T., Basketter, D. A., Schroder, K. R. (2004) In vitro skin irritation: facts and future.

State of the art review of mechanisms and models. Toxicol In Vitro 18:231-43.

Wenczak, B. A., Lynch, J. B., Nanney, L. B. (1992) Epidermal growth factor receptor

distribution in burn wounds. Implications for growth factor-mediated repair. J Clin Invest

90:2392-401.

Werner, H., Weinstein, D., Bentov, I. (2008) Similarities and differences between insulin

and IGF-I: structures, receptors, and signalling pathways. Arch Physiol Biochem 114:17-22.

Werner, S., Krieg, T., Smola, H. (2007) Keratinocyte-Fibroblast Interactions in Wound

Healing. J Invest Dermatol 127:998-1008.

Werner, S., Smola, H. (2001) Paracrine regulation of keratinocyte proliferation and

differentiation. Trends in cell biology 11:143-6.

Wertheimer, E., Trebicz, M., Eldar, T., Gartsbein, M., Nofeh-Moses, S., et al. (2000)

Differential roles of insulin receptor and insulin-like growth factor-1 receptor in

256 Bibliography

differentiation of murine skin keratinocytes. The Journal of investigative dermatology

115:24-9.

Wertz, K., Seifert, N., Hunziker, P. B., Riss, G., Wyss, A., et al. (2004) Beta-carotene

inhibits UVA-induced matrix metalloprotease 1 and 10 expression in keratinocytes by a

singlet oxygen-dependent mechanism. Free radical biology & medicine 37:654-70.

Wheatcroft, S. B., Kearney, M.T. (2009) IGF-dependent and IGF-independent actions of

IGF-binding protein-1 and -2: implications for metabolic homeostasis. Trends Endocrinol

Metab 20:153-62.

Wilker, E., Lu, J., Rho, O., Carbajal, S., Beltran, L., et al. (2005) Role of PI3K/Akt signaling

in insulin-like growth factor-1 (IGF-1) skin tumor promotion. Mol Carcinog 44:137-45.

Will, K., Neben, M., Schmidt-Rose, T., Deppert, W., Wittern, K-P., Bergemann, J. (2000)

p53-dependent UVB responsiveness of human keratinocytes can be altered by cultivation on

cell cycle-arrested dermal fibroblasts. Photochem Photobiol 71:321-26.

Williams, A. C., Collard, T.J., Perks, C.M., Newcomb, P., Moorghen, M., Holly, J.M.,

Paraskeva, C. (2000) Increased p53-dependent apoptosis by the insulin-like growth factor

binding protein IGFBP-3 in human colonic adenoma-derived cells. Cancer Res 60:22-7.

Witte, R. P., Kao, W. J. (2005) Keratinocyte-fibroblast paracrine interaction: the effects of

substrate and culture condition. Biomaterials 26:3673-82.

Wlaschek, M., Tantcheva-Poór, I., Naderi, L., Ma, W., Schneider, L. A., et al. (2001) Solar

UV irradiation and dermal photoaging. Journal of Photochemistry and Photobiology B:

Biology 63:41-51.

Wölfle, U., Esser, P. R., Simon-Haarhaus, B., Martin, S. F., Lademann, J., et al. (2011)

UVB-induced DNA damage, generation of reactive oxygen species, and inflammation are

effectively attenuated by the flavonoid luteolin in vitro and in vivo. Free Radical Biology

and Medicine 50:1081-93.

Wong, T., McGrath, J. A., Navsaria, H. (2007) The role of fibroblasts in tissue engineering

and regeneration. The British journal of dermatology 156:1149-55.

Wood, J., Pring, M., Eveson, J.W., Price, N., Proby, C.M., Hague, A. (2011) Co-

overexpression of Bag-1 and heat shock protein 70 in human epidermal squamous cell

carcinoma: Bag-1-mediated resistance to 5-fluorouracil-induced apoptosis. Br J Cancer

104:1459-71.

Wood, T. L. (1995) Gene-targeting and transgenic approaches to IGF and IGF binding

protein function. Am J Physiol 269:E613-22.

Woodcock-Mitchell, J., Eichner, R., Nelson, W. G., Sun, T. T. (1982) Immunolocalization of

keratin polypeptides in human epidermis using monoclonal antibodies. The Journal of cell

biology 95:580-8.

Bibliography 257

Wrone-Smith, T., Mitra, R. S., Thompson, C. B., Jasty, R., Castle, V. P., et al. (1997)

Keratinocytes derived from psoriatic plaques are resistant to apoptosis compared with

normal skin. The American Journal of Pathology 151:1321-9.

Wu, K. I., Pollack, N., Panos, R. J., Sporn, P. H. S., Kamp, D. W. (1998) Keratinocyte

growth factor promotes alveolar epithelial cell DNA repair after H2O2exposure. American

Journal of Physiology - Lung Cellular and Molecular Physiology 275:L780-L7.

Wu, L., Pierce, G. F., Galiano, R. D., Mustoe, T. A. (1996) Keratinocyte growth factor

induces granulation tissue in ischemic dermal wounds. Importance of epithelial-

mesenchymal cell interactions. Arch Surg 131:660-6.

Wu, P. A., Stern, R. S. (2012) Topical tretinoin, another failure in the pursuit of practical

chemoprevention for non-melanoma skin cancer. J Invest Dermatol 132:1532-5.

Wyllie, A. H., Kerr, J.F.R., Currie, A.R. (1980) Cell death: the significance of apoptosis. .

IntRev Cytol 68:251-306.

Xiao, Z., Chen, Z., Gunasekera, A. H., Sowin, T. J., Rosenberg, S. H., et al. (2003) Chk1

mediates S and G2 arrests through Cdc25A degradation in response to DNA-damaging

agents. The Journal of biological chemistry 278:21767-73.

Xie, Y., Rizzi, S. C., Dawson, R., Lynam, E., Richards, S., et al. (2010) Development of a

three-dimensional human skin equivalent wound model for investigating novel wound

healing therapies. Tissue Eng Part C 16:1111-23.

Xie, Y., Upton, Z., Richards, S., Rizzi, S. C., Leavesley, D. I. (2011) Hyaluronic acid:

evaluation as a potential delivery vehicle for vitronectin:growth factor complexes in wound

healing applications. Journal of controlled release : official journal of the Controlled

Release Society 153:225-32.

Xu, G., Snellman, E., Jansen, C. T., Hemminki, K. (2000) Levels and repair of cyclobutane

pyrimidine dimers and 6-4 photoproducts in skin of sporadic basal cell carcinoma patients. J

Invest Dermatol 115:95-9.

Xu, Y., Voorhees, J. J., Fisher, G. J. (2006) Epidermal growth factor receptor is a critical

mediator of ultraviolet B irradiation-induced signal transduction in immortalized human

keratinocyte HaCaT cells. The American journal of pathology 169:823-30.

Yaar, M., Gilchrest, B. A. (1991) Human melanocyte growth and differentiation: a decade of

new data. The Journal of investigative dermatology 97:611-7.

Yamaguchi, Y., Brenner, M., Hearing, V. J. (2007) The regulation of skin pigmentation. The


Yamaguchi, Y., Hearing, V. J., Itami, S., Yoshikawa, K., Katayama, I. (2005) Mesenchymal-

epithelial interactions in the skin: aiming for site-specific tissue regeneration. J Dermatol Sci

40:1-9.

258 Bibliography

Yamaguchi, Y., Takahashi, K., Zmudzka, B. Z., Kornhauser, A., Miller, S. A., et al. (2006)

Human skin responses to UV radiation: pigment in the upper epidermis protects against

DNA damage in the lower epidermis and facilitates apoptosis. Faseb J 20:1486-8.

Yang, D. Q., Kastan, M. B. (2000) Participation of ATM in insulin signalling through

phosphorylation of eIF-4E-binding protein 1. Nat Cell Biol 2:893-8.

Yang, G., Zhang, G., Pittelkow, M. R., Ramoni, M., Tsao, H. (2006) Expression Profiling of

UVB Response in Melanocytes Identifies a Set of p53-Target Genes. J Invest Dermatol

126:2490-506.

Yang, S., Chintapalli, J., Sodagum, L., Baskin, S., Malhotra, A., et al. (2005) Activated IGF-

1R inhibits hyperglycemia-induced DNA damage and promotes DNA repair by homologous

recombination. Am J Physiol Renal Physiol 289:F1144-52.

Yang, W., Wu, Y.H., Yin, D., Koeffler, H.P., Sawcer, D.E., Vernier, P.T., Gundersen, M.A.

(2011) Differential sensitivities of malignant and normal skin cells to nanosecond pulsed

electric fields. Technol Cancer Res Treat 10:281-6.

Yoshihisa, Y., Honda, A., Zhao, Q.L., Makino, T., Abe, R., Matsui, K., Shimizu, H.,

Miyamoto, Y., Kondo, T., Shimizu, T. (2010) Protective effects of platinum nanoparticles

against UV-light-induced epidermal inflammation. Exp Dermatol 19:1000-6.

Yoshizumi, M., Nakamura, T., Kato, M., Ishioka, T., Kozawa, K., et al. (2008) Release of

cytokines/chemokines and cell death in UVB-irradiated human keratinocytes, HaCaT. Cell

biology international 32:1405-11.

You, Y. H., Lee, D. H., Yoon, J. H., Nakajima, S., Yasui, A., et al. (2001) Cyclobutane

pyrimidine dimers are responsible for the vast majority of mutations induced by UVB

irradiation in mammalian cells. The Journal of Biological Chemistry 276:44688-94.

You, Y. H., Szabo, P. E., Pfeifer, G. P. (2000) Cyclobutane pyrimidine dimers form

preferentially at the major p53 mutational hotspot in UVB-induced mouse skin tumors.

Carcinogenesis 21:2113-7.

Young, A. R. (1987) The sunburn cell. Photodermatol 4:127-34.

Young, A. R. (2006) Acute effects of UVR on human eyes and skin. Prog Biophys Mol Biol

92:80-5.

Zaidi, M. R., De Fabo, E. C., Noonan, F. P., Merlino, G. (2012) Shedding light on

melanocyte pathobiology in vivo. Cancer Res 72:1591-5.

Zanetti, R., Franceschi, S., Rosso, S., Colonna, S., Bidoli, E. (1992) Cutaneous melanoma

and sunburns in childhood in a southern European population. Eur J Cancer 28:1172-6.

Zattra, E., Coleman, C., Arad, S., Helms, E., Levine, D., et al. (2009) Polypodium

leucotomos extract decreases UV-induced Cox-2 expression and inflammation, enhances

Bibliography 259

DNA repair, and decreases mutagenesis in hairless mice. The American Journal of


Zenisek, A., Kral, J.A., Hais, I.M. (1955) Sun-screening effect of urocanic acid. Biochim

Biophys Acta 18:589-91.

Zha, J., Harada, H., Yang, E., Jockel, J., Korsmeyer, S. J. (1996) Serine phosphorylation of

death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L).

Cell 87:619-28.

Zhang, H., Xu, Q., Krajewski, S., Krajewska, M., Xie, Z., et al. (2000) BAR: An apoptosis

regulator at the intersection of caspases and Bcl-2 family proteins. Proc Natl Acad Sci U S A

97:2597-602.

Zhao, C., Snellman, E., Jansen, C. T., Hemminki, K. (2002) In situ repair of cyclobutane

pyrimidine dimers in skin and melanocytic nevi of cutaneous melanoma patients. Int J

Cancer 98:331-4.

Zhao, H., Piwnica-Worms, H. (2001) ATR-mediated checkpoint pathways regulate

phosphorylation and activation of human Chk1. Mol Cell Biol 21:4129-39.

Zhao, Z., Jin, C., Ding, K., Ge, X., Dai, L. (2012) Dedifferentiation of human epidermal

melanocytes into melanoblasts in vitro. Exp Dermatol.

Zheng, Y., Pao, A., Adair, G. M., Tang, M. (2001) Cyclobutane pyrimidine dimers and

bulky chemical DNA adducts are efficiently repaired in both strands of either a

transcriptionally active or promoter-deleted APRT gene. The Journal of Biological

Chemistry 276:16786-96.

Zhou, B. B., Elledge, S. J. (2000) The DNA damage response: putting checkpoints in

perspective. Nature 408:433-9.

Zhu, Y., Yang, G. Y., Ahlemeyer, B., Pang, L., Che, X. M., et al. (2002) Transforming

growth factor-beta 1 increases bad phosphorylation and protects neurons against damage. J

Neurosci 22:3898-909.

Zhuang, L., Wang, B., Sauder, D. N. (2000) Molecular mechanism of ultraviolet-induced

keratinocyte apoptosis. J Interferon Cytokine Res 20:445-54.

Ziegler, A., Jonason, A.S., Leffell, D.J., Simon, J.A., Sharma, H.W., Kimmelman, J.,

Remington, L., Jacks, T., Brash, D.E. (1994) Sunburn and p53 in the onset of skin cancer.

Nature 372.

Zigler, J. S., Jr., Lepe-Zuniga, J. L., Vistica, B., Gery, I. (1985) Analysis of the cytotoxic

effects of light-exposed HEPES-containing culture medium. In Vitro Cell Dev Biol 21:282-7.

Zou, L., Elledge, S.J. (2003) Sensing DNA damage through ATRIP recognition of RPA-

ssDNA complexes. Science 300:1542-8.

260 Bibliography

Zutterman, N., Maes, H., Claerhout, S., Agostinis, P., Garmyn, M. (2010) Deregulation of

cell-death pathways as the cornerstone of skin diseases. Clinical and experimental


in vitro models for investigating keratinocyte responses...

Documents