increase in temperature affects the growth, immune, and ... · received: 26 june 2016 accepted: 10...
TRANSCRIPT
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e40
8
RESEARCH
Habte-Michael Habte-Tsion1,3☼, Mingchun Ren1,2, Xianping Ge1,2☼, Vikas Kumar4, Bo
Liu1,2, Jun Xie1,2, Ruli Chen2
1. Wuxi Fisheries College, Nanjing Agricultural University, Wuxi, Jiangsu 214081, PR China
2. Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences,Wuxi, Jiangsu 214081, PR China;
3. Ministry of Marine Resources the State of Eritrea, P.O.Box: 27, Massawa, Eritrea
4. Division of Aquaculture, College of Agriculture, Food Science and Sustainable Systems, Kentucky State University, Frankfort, KY,
USA)
☼Correspondence: Wuxi Fisheries College, Nanjing Agriculture University, Wuxi, Jiangsu 214081, PR China. E-mail: [email protected] (X.P.
Ge, PhD); and [email protected] (H.-M. Habte-Tsion, PhD)
Publication History
Received: 26 June 2016
Accepted: 10 July 2016
Online First: 15 July 2016
Published: 1 October 2016
Citation
Habte-Michael Habte-Tsion, Mingchun Ren, Xianping Ge, Vikas Kumar, Bo Liu, Jun Xie, Ruli Chen. Increase in temperature affects the
growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock proteins of
blunt snout bream, Megalobrama amblycephala fry. Science & Technology, 2016, 2(8), 408-426
Publication License
This work is licensed under a Creative Commons Attribution 4.0 International License.
General Note
Article is recommended to print in recycled paper.
Science & Technology, Vol. 2, No. 8, October 1, 2016 RESEARCH
Science & Technology
Increase in temperature affects the growth, immune, and antioxidant
status and hepatopancreatic gene expressions of antioxidant enzymes
and heat-shock proteins of blunt snout bream,
Megalobrama amblycephala fry
ISSN 2394–3750
EISSN 2394–3769
An International Journal
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e40
9
RESEARCH
ABSTRACT
This study performed a 10-week experiment to assess the effects of normal, acute and chronic temperatures on the growth, stress,
immune and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock proteins (HSPs) of
blunt snout bream fry, and cumulative mortality under Aeromonas hydrophila infection. For this purpose, similar size of fish fry (initial
weight, 16.08±0.03g) was randomly selected and assigned into 6 tanks (300 liter/tank), fed with an optimum semi-purified diet, and
reared at 25°C (normal temperature group) and 32°C (chronic temperature group) in triplicates. After 10 weeks, sub-sample of the
normal temperature group was challenged with acute high temperature (32°C, acute temperature group) for 7 days. At the end of
the challenge experiment, sub-samples of normal, acute and chronic temperature groups were submitted to A. hydrophila infection
and mortality was recorded at different time intervals. The results showed that poor growth performances (final body weight,
specific growth rate and feed conversion rate) were observed in the chronic temperature group compared to the normal
temperature group (P<0.05). Increase in temperature significantly (P<0.05) affected the stress responses (cortisol, glucose and
aspartate aminotransferase), immune responses (complements C3 and C4) and antioxidant enzymes activity (superoxide dismutase
(SOD), catalase (CAT) and glutathione peroxidase (GPx)). Temperature differences induced the gene expression levels of antioxidant
enzymes (Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and glutathione S-transferase mu (GST)) and HSPs (HSP60, 70 and 90). After A.
hydrophila infection, high cumulative mortality was recorded in the chronic temperature group. Indeed, these results could provide a
new molecular tool for further studies and shed light on the regulatory mechanisms that rearing temperature affects the antioxidant
and immune capacities and disease resistance of fish.
Key words: Blunt snout bream (Megalobrama amblycephala); Temperature; Growth; Stress response; Immune response; Antioxidant
status; Gene expression
Abbreviation: WGR-Weight gain rate, SGR-Specific growth rate, FCR-Feed conversion ratio, AST-aspartate aminotransferase, SOD-
superoxide dismutase, CAT-catalase, GPx-glutathione peroxidase, GST-glutathione S-transferase mu, C3 -complement component 3,
C4-complement component 4, HSPs - heat-shock proteins
1. INTRODUCTION
Among the environmental factors that affect fish growth, temperature is the most important, as it is a controlling factor that
governs the growth of ectothermic animals (Bureau et al. 2002). Freshwater fish have an optimum growing temperature in the range
of 25-30oC (Anonymous 1983). However, when the temperature becomes below or above the optimum, it has a negative impact
instead of a stimulatory influence (Jobling 1993). Temperature is also an important factor affecting physiological functions, including
adaptive and innate immunity, increase susceptibility to infection and even cause death (Ndong et al. 2007, Kling et al. 2007). When
the temperature reaches the upper extreme of the tolerated range, it can result into stress. Based on the intensity and time, thermal
stress can be either acute or chronic stress. In nature most stress can be considered as acute stress as derived from a challenge
situation normally over a short term and with a high intensity.
Fish hepatopancreas is a tissue that contains large quantities of unsaturated lipids (polyunsaturated fatty acids, PUFAs), which
are essential for membrane function (Bayir et al. 2011). A large PUFA content implies an elevated risk of oxidative stress, since these
lipids are major targets for reactive oxygen species (ROS) (Abele and Puntarulo 2004, Martinez-Alvarez et al. 2005). Fish are
equipped with a variety of enzymatic and non-enzymatic antioxidant scavenging systems, to maintain endogenous ROS at relatively
low levels and to attenuate the damage related to the high reactivity of ROS (Wilhelm Filho et al. 2001). The key antioxidant enzymes
in this antioxidant defense system include superoxide dismutase (SOD), glutathione peroxidase (GPx) and catalase (CAT) (Martinez-
Alvarez et al. 2005). These antioxidant defenses can be influenced by intrinsic and extrinsic factors including water temperature
(Martinez-Alvarez et al. 2005, Cunha et al. 2007, Aras et al. 2009, Solé et al. 2009). The activities of antioxidant enzymes could partly
result from an induction of antioxidant enzymes gene expression (Yeh et al. 2009). However, no study has been reported about the
effect of temperatures on the hepatopancreatic antioxidant status of blunt snout bream.
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
0
RESEARCH
An organism's response to environmental and physiological stressors includes a highly ordered set of events that are often
represented by rapid changes in heat shock proteins (HSPs) gene expression followed by synthesis of the proteins involved in
adaptation (Staib et al. 2007). HSPs are a group of highly conserved cellular proteins synthesized in response to a variety of stressors
(Sanders 1993). They are classified, according to their molecular weight, into HSP90, HSP70, HSP60, and smaller HSP families which
are present in all organisms including fish (Basu et al. 2002). HSPs levels differ from species to species and among different tissues
and all of them play important role in maintaining cellular homeostasis (Sanders 1993, Song et al. 2006). Nevertheless, no study was
reported regarding the effects of temperature differences on HSPs gene expression in blunt snout bream.
Blunt snout bream is an herbivorous freshwater fish endemic to China, also introduced to North America, Europe, Africa and
other Asian countries. Aquaculture of this species in China has been rapidly expanded during the last decade and its production
level reached approximately 0.7 million tons in 2012 (Ministry of Agriculture of the People’s Republic of China 2013). In recent years,
high water temperature caused disease outbreaks showed an increasing trend in cultured blunt snout bream and resulted into high
mortality, especially during summer (He et al. 2006). However, little is known about the responses (growth, stress, immune and
antioxidant) of this species to the elevation of ambient water temperature. We hypothesized that an increase in temperature may
influence the growth, antioxidant and immunity capacity, hepatopancreatic gene expressions of antioxidant enzymes and HSPs, and
disease resistance of blunt snout bream fry. Indeed, the present study was carried out to investigate this hypothesis.
2. MATERIALS AND METHODS
2.1. Experimental procedures
The experiment was conducted in a facility of indoor re-circulating system at Freshwater Fisheries Research Center (FFRC), Chinese
Academy of Fishery Sciences, Wuxi, China. Fry of blunt snout bream was obtained from FFRC, and acclimatized to the experimental
conditions and diet for two weeks. After acclimatization, similar size of fish (mean weight, 16.08±0.03g) was selected and randomly
assigned into 6 tanks (300 L/tank) at a stocking density of 25 fish per tank. The 6 tanks were randomly assigned into normal (25oC)
and chronic temperature groups (32oC). The use of experimental fish was under scientific research protocols of Chinese Academy of
Fishery Sciences and Ministry of Agriculture of China that complied with all relevant local and national animal welfare laws,
guidelines and policies (FAO 2004).
An optimum semi-purified diet (Habte-Tsion et al. 2014) with proximate composition: crude protein, of 32.16%; energy,
15.56kJ/g; and lipid, 6.17% in dry matter, was prepared in FFRC (Table 1). Fish were hand-fed with the optimum diet to apparent
satiation three times daily for 10 weeks. During the experimental period, water temperature for the normal and chronic groups was
kept at 25±1°C and 32±1°C, respectively. The following parameters were maintained during the experimental period: pH, 7.0-7.5;
ammonia nitrogen, < 0.05mg/ L; dissolved oxygen, ≥ 6.0mg/ L; photoperiod, natural (light-dark cycle).
Table 1 Ingredients and proximate composition of the optimum semi-purified diet1
Ingredients % Proximate composition (%, DM)2
Casein3 20.80 Moisture 6.81
Gelatin4 5.50 Crude protein 32.16
Fish meal5 11.50 Crude lipid 6.17
α-starch6 25.20 Ash 8.77
Dextrin7 10.00 Carbohydrate 26.01
Microcrystalline cellulose8 6.90 Gross Energy (KJ/g)10 15.56
Carboxyl-methyl cellulos4 10.00 P/E ratio (mg/KJ)11 20.66
Soybean Oil 5.40
Vitamin & mineral additives9 1.00
Soy lecithin 1.00
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
1
RESEARCH
Calcium dihydrogen
phosphate 2.50
Chlorinated choline 0.15
Ethoxyquin 0.05
1Adopted from our previous study (Habte-Tsion et al. 2014)
2Values for the proximate composition of the test diets are means of triplicate analyses.
3Purchased from Lin Xia Huaan Biological Products Co., Ltd, P.R. China;
4Purchased from Shanghai Zhan Yun Chemical Co., Ltd, P.R. China;
5Provided by Tongwei Feed Group Co., Ltd, P.R. China (origin, Coprinca, Lima, Peru);
6Purchased from Jin Ling Tower Starch Co., Ltd, P.R. China.
7Purchased from Xi Wang Chemical Co., Ltd., P.R. China;
8Purchased from Linghu Xinwang Chemical Co., Ltd, P.R. China;
9Vitamin (IU or mg/kg of premix) and mineral premixes (g/kg of premix) were used as described in our previous study (Habte-Tsion
et al. 2014). Provided by Wuxi Hanove Animal Health Products Co. Ltd., Jiangsu, China
10Gross Energy (kJ/g) calculated by 23.64kJ/g protein, 39.54kJ/g lipid and 17.15kJ/g carbohydrate
11Protein to energy ratio in mg/ kJ;
2.2. Challenge experiments
Acute temperature challenge - After 10 weeks, only the normal temperature group was submitted to an acute high temperature
challenge and this was called “acute temperature group”. The water temperature of 25°C system was quickly raised to 32°C within 3
hour by adjusting data logger. The following parameters were maintained during the challenge period: temperature, 32±1°C; pH,
7.0-7.5; ammonia nitrogen, < 0.05mg/ L; dissolved oxygen, ≥ 6.0mg/ L; photoperiod, natural (light-dark cycle); and minimal human
interference to prevent fish from additional challenge. Samples were taken at 3 hours or 0.125 day (0.125d, once the temperature
reached 32°C), 0.5d, 1d, 2d, and 7d during acute stress.
Pathogenic infection - The infection purpose was to investigate disease resistance of the normal, acute and chronic temperatures
groups by calculating the cumulative mortality of blunt snout bream fry at different time interval. Sub-samples of fish (5 fish/ tank)
from the normal, acute and chronic temperature groups were infected with bacterial septicemia pathogen Aeromonas hydrophila
(Ah, WJ2011BJ44) at the same facility. A. hydrophila was provided by the Key Laboratory of Freshwater Fisheries and Germplasm
Resources Utilization, FFRC, Chinese Academy of Fishery Sciences,Wuxi, China. According to the method described by Xie et al.
(2008), A. hydrophila was activated twice and diluted by sterile normal saline, and the final concentration was set to 1×108 cells/mL.
Bacterial suspension (0.5mL, per 50g body weight) was injected into the abdominal cavity of the fish and mortality was checked at
0.125day (3h), 0.5d, 1d, 2d and 5d after infection.
2.3. Sample collection
At the end of the 10 weeks experiment, sampling was conducted after 24h of the last feeding. Three fish from each tank were
anaesthetized with 100 mg/L MS-222 and blood samples were obtained from the caudal vein. To prepare blood serum, blood
samples were left to clot at 4°C for 1-2h, and then centrifuged at 3,000×g and 4°C for 10min. The serum was stored at -20°C for
subsequent serum biochemical measurement. Meanwhile, the three sampled fish were dissected and samples of hepatopancreas
were quickly collected and stored at -80°C for subsequent antioxidant enzymes activity and gene expression assay. Samples were
collected from normal temperature group (once), acute temperature group (five times: at 0.125d (3h), 0.5d, 1d, 2d, and 7d during
acute stress), and chronic temperature group (once).
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
2
RESEARCH
2.4. Blood parameters measurement
Serum glucose content and aspartate aminotransferase (AST) activity were determined by a colorimetric test kit (Mindray Bio
Medical Co., Ltd., Shenzhen, PR China) according to Trinder (1969) and Reitman and Frankel (1957), respectively. Serum Cortisol was
measured by radioimmunoassay (RIA) as described by Pickering and Pottinger (1983), using a test kit from New Industries
Biomedical Engineering Co., Ltd., Shenzhen, China. Serum complement component 3 (C3) and 4 (C4) levels were determined
according to the method described by Habte-Tsion et al. (2015b), using a reagent kit from Zhejiang Yilikang Biotech Co., Ltd., China.
2.5. Hepatopancreatic antioxidant enzyme activity assay
Hepatopancreas samples were homogenized in 10 volumes (w/v) of ice-cold physiological saline and centrifuged at 6000×g for
20min at 4°C, and the supernatant was conserved for enzyme activity analysis (Habte-Tsion et al. 2016). Hepatopancreatic protein
content was measured using the method of Bradford (1976). Superoxide dismutase (SOD) and glutathione peroxidase (GPx)
activities were assayed according the protocol described by Zhang et al. (2008). Catalase (CAT) activity was determined by the
decomposition of hydrogen peroxide (Aebi 1984).
2.6. Real-time PCR analysis
Real-time PCR analysis was conducted according our previous studies (Habte-Tsion et al. 2015a,b,c,d,2016). Briefly: total RNA was
extracted from the hepatopancreas of blunt snout bream fry using an RNAiso plus kit (Takara, Dalian, China). Agarose gel
electrophoresis at 1% and spectrophotometric analysis (A260: 280 nm ratio) were used to assess RNA quality and quantity.
Subsequently, cDNA was synthesized using a PrimeScriptTM RT reagent kit (Takara, Dalian, China), according to the manufacturer’s
instructions. Briefly, oligo dT primers (50µM) were used to reverse transcribe the respective RNA in the presence of PrimeScriptTM RT
enzyme mix I, 5× PrimeScriptTM buffer, and RNase free distilled water at 37°C for 15min followed by inactivation at 85°C for 5s.
Specific primers for the genes of antioxidant enzymes were designed according to the partial cDNA sequences of the target genes
using the M. amblycephala transcriptome analysis (Gao et al. 2012, Habte-Tsion et al. 2016), and primers for HSP60, HSP70, HSP90
and β-actin were designed using the published sequences of blunt snout bream (Accession No.: EU884290.2, FJ375325, KC521466.1,
AY170122.2, respectively). All primers were synthesized by Shanghai Biocolor, BioScience & Technology Company, China (Table 2).
Table 2 Real-time PCR primer sequences
Target genes Primer sequences Amplicon length (bp)
Cu/Zn-SOD: Forward 5'-AGTTGCCATGTGCACTTTTCT-3' 21
Reverse 5'-AGGTGCTAGTCGAGTGTTAGG-3' 21
Mn-SOD: Forward 5'-AGCTGCACCACAGCAAGCAC-3' 20
Reverse 5'-TCCTCCACCATTCGGTGACA-3' 20
CAT: Forward 5'- CAGTGCTCCTGATACCCAGC -3' 20
Reverse 5'- TTCTGACACAGACGCTCTCG -3' 20
GPx1: Forward 5'-GAACGCCCACCCTCTGTTTG-3' 20
Reverse 5'-CGATGTCATTCCGGTTCACG-5' 20
GST: Forward 5'-AACCTCTGTGGGGAAACTGAAGAAG-3' 25
Reverse 5'-TAGAGTTCCTGGCAGATTCTCATCG-3' 25
HSP60: Forward 5’- AGGAGTAATGATGGCGGTGGAAG-3’ 23
Reverse 5’- AACACCCTTGCGTCCAACTTTCT-3’ 23
HSP70: Forward 5’- TACACGTCCATCACCAGAGCGC-3’ 22
Reverse 5’- CCCTGCCGTTGAAGAAATCCT-3’ 21
HSP90: Forward 5'- CATCAAAGGCGTTGTGGACTC-3' 21
Reverse 5- AGGCGAGTTCTGTTGGAGTGAT-3 22
β-Actin: Forward 5’-TCGTCCACCGCAAATGCTTCTA-3’ 22
Reverse 5’-CCGTCACCTTCACCGTTCCAGT-3’ 22
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
3
RESEARCH
Cu/Zn-SOD, copper-zinc superoxide dismutase; Mn-SOD, manganese superoxide dismutase; CAT, catalase; GPxl, glutathione
peroxidase 1; GST, glutathione S-transferase mu; HSP60, heat-shock protein 60; HSP70, heat-shock protein 70; HSP90, heat-shock
protein 90. Note: primer sequences for Cu/Zn-SOD, Mn-SOD, CAT, GPxl, GST and β-Actin were adopted from Habte-Tsion et al.
(2016).
Real-time PCR was used to determine mRNA levels using a PrimerScriptTM reagent kit (Takara, Dalian, China). Real-time PCR for
the target genes were performed according to standard protocols. Briefly, cDNA (2.0μL) was reacted with 10.0μL SYBR® Premix Ex
Taq II (2×), 0.8μL forward primer (10μM), 0.8μL reverse primer (10μM), 0.4μL ROX reference dye or dye II (50×), and 6.0μL RNase-free
distilled water in a 20μL final reaction volume. The real-time PCR was carried out in a 7500 Real-Time PCR System (Applied
Biosystems, USA). The thermocycling conditions for the target genes were as follows: initiated with a denaturation step at 95°C for
30s followed by forty cycles at 95°C for 5s, 60°C for 34s and 95°C for 30s, 95°C for 3s, 60°C for 30s, respectively. The melting curve
analysis was performed over a range of 50-95°C to verify that a single PCR product was generated. The concentration of the target
genes was based on the threshold cycle number (CT), and CT for each sample was determined using 7500 Software version 2.0.4
(Applied Biosystems). The expression levels of the target genes were normalized to those of a housekeeping gene (β-actin) of blunt
snout bream. The expression results were analyzed using the 2-∆∆CT method after verifying that the primers were amplified with an
efficiency of approximately 100% (Livak and Schmittgen 2001). Besides, cDNA concentration in each sample was determined
according to gene-specific standard curves. Standard curves were generated for both target and endogenous control genes based
on 10-fold serial dilutions. All standard curves exhibited correlation coefficients > 0.99.
2.7. Calculations and data analysis
The following formulas were used to calculate the growth performance of blunt snout bream fry reared at normal and chronic
temperatures for 10 weeks:
Weight gain rate (WGR, %) = 100 x [(W2- W1) /W1]
Specific growth rate (SGR; %/day) = 100 x [(lnW2 – lnW1) /T]
Feed conversion ratio (FCR) = [feed intake (g) / weight gain (g)]
Where W1 and W2 are the initial and final body weight, respectively, and T is the number of days in the feeding period.
Data were analyzed using SPSS version 19 (Chicago, IL, USA). Differences between the means in Table 3 were
determined by Independent-Samples T-Test. The data in all figures were subjected to one-way ANOVA followed by LSD
multiple comparisons, and significant differences (P<0.05) among the group means were further compared using Duncan's
multiple range tests. The broken-line regression model (Robbins et al. 1979) was used to estimate the cumulative mortality
of blunt snout bream fry after A. hydrophila infection. All results are presented as means plus or minus standard error ( X ±
SE) of three replicates.
Table 3 The effects of normal and chronic temperature on the growth performance of blunt snout bream fry reared for 10 weeks1
Parameters Temperature (oC)
25 32
FBW2 (g) 37.74 ± 1.52b 31.24 ± 1.11a
WGR3 (%) 135.09 ± 9.79b 93.58 ± 6.32a
SGR4 (%) 1.22 ± 0.06b 0.94 ± 0.05a
FCR5 1.88 ± 0.02a 2.87 ± 0.13b
Survival rate (%) 99.00 ± 0.58 94.67 ± 3.53
1Results are mean of triplicate estimations ± S.E and means in the same row with different superscripts are significantly (P<0.05)
different in Independent-Samples t-tests.
2FBW, final body weight
3WGR, weight gain rate
4SGR, specific growth rate
5FCR, feed conversion ratio
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
4
RESEARCH
Figure 1 The stress responses such as serum cortisol level (A), glucose content (B) and aspartate aminotransferase (AST) activity (C)
of blunt snout bream fry reared at different temperatures. Note: Results are mean of triplicate estimations plus or minus standards
error ( X ± SE). Significant differences (P<0.05) between the values obtained before stress and during acute stress and chronic stress
are marked by small letters in Duncan's multiple range tests.
3. RESULTS
3.1. Growth performance
Table 3 shows the effect of normal and chronic temperature on the growth performance of blunt snout bream fry reared for 10
weeks. Final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of the chronic temperature group were
significantly (P<0.05) lower than those normal temperature group; while the reverse was found in feed conversion ratio (FCR)
(A)
(C)
(B)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
5
RESEARCH
(P<0.05). Lower survival rate was observed in the chronic temperature group compared to the normal temperature group, but it was
not in significant manner. No pathological signs were observed during the experiment period.
3.2. Serum stress responses
The effects of normal, acute and chronic temperatures on serum cortisol level, glucose content and aspartate aminotransferase (AST)
activity in blunt snout bream fry are presented in Fig.1. Both acute and chronic temperatures significantly elevated the levels of
cortisol compared to normal temperature (P<0.05, Fig.1A). The highest cortisol level was found in the acute temperature group at
0.5d during acute stress followed by 0.125d during acute stress (P<0.05). Acute temperature increased serum glucose content (at 1-
2d during acute stress) and AST activity (at 0.125-1d during acute stress) (P<0.05, Fig.1B,C). No significant differences were observed
between the normal temperature and chronic temperature groups in glucose content and AST activity.
3.3. Serum immune responses
Fig.2 shows the effects of normal, acute and chronic temperatures on the immune responses, such as serum complement C3 and C4
concentrations in blunt snout bream fry. The serum complement C3 concentration increased, reached peak at 0.125d-0.5d during
acute stress (P<0.05) and thereafter tended to decrease up to the chronic temperature group, and back to the level similar to that
normal temperature group (Fig.2A). The serum C4 concentration elevated, reached peak at 0.125d-1d during acute stress (P<0.05)
and thereafter decreased up to the chronic temperature, and back to the level similar to that normal temperature group (Fig.2B).
Figure 2 The immune responses such as serum complement C3 (A), C4 (B) of blunt snout bream fry reared at different
temperatures. Note: Legends are the same as on Fig.1.
(A)
(B)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
6
RESEARCH
3.4. Hepatopacreatic antioxidant enzymes activity
The effects of normal, acute and chronic temperatures on the antioxidant enzymes activity, such as SOD, CAT and GPx in the
hepatopancreas of blunt snout bream fry are shown in Fig.3. High temperatures (both acute and chronic) increased SOD, CAT and
GPx activities in the hepatopancreas of blunt snout bream fry (P<0.05, Fig.3). Higher SOD activity was found at 1d during acute
stress followed by 0.5d, 0.125d, 2d, 7d, and chronic stress compared to that normal temperature group (P<0.05, Fig.3A). The
activities of CAT and GPx at 0.5d during acute stress were significantly (P<0.05) higher than the others acute stress time, chronic
temperature and normal temperature (Fig.3B,C). The lowest SOD, CAT and GPx activities were measured in the normal temperature
group (Fig.3).
(A)
(B)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
7
RESEARCH
Figure 3 Hepatopancreatic antioxidant enzymes activity such as copper-zinc superoxide dismutase (SOD, A), catalase (CAT, B) and
glutathione peroxidase (GPx, C) of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on Fig.1.
3.5. Hepatopancreatic antioxidant enzymes gene expression
Fig.4 shows the effects of normal, acute and chronic temperatures on the relative gene expressions of antioxidant enzymes such as
Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST in the hepatopacreas of blunt snout bream fry. High temperature (both acute and chronic)
significantly induced the relative expression levels of Cu/Zn-SOD, with high expression levels in the acute temperature group
(P<0.05, Fig.4A). CAT mRNA expression levels of the acute temperature group elevated significantly, reached peak at 1-2d during
acute stress (P<0.05), and thereafter tended to decrease (Fig.4C). Mn-SOD, GPx1 and GST mRNA expression levels were up-
regulated at 0.125-1d during acute stress and thereafter decreased (P<0.05, Fig.4B,D,E).
(C)
(A)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
8
RESEARCH
(B)
(C)
(D)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e41
9
RESEARCH
Figure 4 The relative gene expression levels of antioxidant enzymes such as copper-zinc superoxide dismutase (Cu/Zn-SOD, A),
manganese superoxide dismutase (Mn-SOD, B), catalase (CAT, C), glutathione peroxidase 1 (GPx1, D) and glutathione S-transferase
mu (GST, E) in the hepatopancreas of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on
Fig.1.
3.6. Hepatopacreatic heat-shock proteins (HSPs) gene expression
The relative expression levels of HSP60, HSP70 and HSP90 mRNA were induced in time-dependent manner after acute temperature
challenge (Fig.5). The highest level of HSP60 mRNA was obtained at 1d during acute stress (P<0.05, Fig.5A). The relative expression
level of HSP70 mRNA was significantly (P<0.05) up-regulated at 0.125d during acute stress followed by 0.5d compared with others
acute temperature time interval, normal temperature and chronic temperature groups (Fig.5B). HSP90 mRNA expression level at 1d
during acute stress was significantly (P<0.05) higher than the others acute temperature time intervals and normal temperature
group, but not significantly different from 2d during acute stress and chronic temperature group (Fig.5C).
(E)
(A)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
0
RESEARCH
Figure 5 The relative gene expression levels of heat-shock proteins (HSPs) such as HSP60 (A), HSP70 (B) and HSP90(C) in the
hepatopancreas of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on Fig.1.
Figure 6 The cumulative mortality of blunt snout bream fry after Aeromonas hydrophila (1x108 cells/mL) infection, reared at different
temperatures. Note: Results are mean of triplicate estimations plus or minus standard error ( X ± SE). Significant differences
(B)
(C)
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
1
RESEARCH
(P<0.05) between the temperature groups at each observation point after infection are marked by asterisks in Duncan's multiple
range tests.
3.7. Cumulative mortality after Aeromonas hydrophila infection
Sub-samples of fish from normal, acute and chronic temperature groups (5 fish/ tank) were infected with a bacterial septicemia
pathogen A. hydrophila, and cumulative mortality was calculated for 5days (0.125d, 0.5d, 1d, 2d and 5d after infection, Fig.6). The
maximum cumulative mortality was observed between 1d and 2d after infection in all groups. At 1d after infection, the cumulative
mortality of the chronic temperature group (58.33%) was significantly higher than the normal (20.00%) and acute (26.67%)
temperature groups (P<0.05).
4. DISCUSSION
If an organism cannot acclimate, adapt or maintain homeostasis, several changes may occur: at the behavioral level, growth,
resistance to disease and reproduction capacity (Iwama et al. 1999, Barton 2002). Prolonged exposure of fish to stress can eventually
alter population demographics and dynamics. Impacts can be critical when it comes to early stages because growth is of crucial
importance to their fitness at these stages. In this study, poor growth performances of blunt snout bream fry were investigated in
the chronic temperature group compared to the normal temperature group (Table 3). Generally, lower survival was observed in the
chronic temperature group than the normal group. These results are in accordance with previous study reported in the same species
(Shi et al. 1988).
Exposure of fish to stressing environmental factors gives rise to a series of biochemical and physiological changes mediated by
the neuroendocrine system and characterized by increased cortisol level (Wendelaar Bonga 1997). This stress hormone, synthesized
by the head kidney interrenal cells, regulates osmolarity and metabolism, and modulates immune responses (Vazzana et al. 2002,
Vizzini et al. 2007). In the present study, the cortisol level of the acute temperature group abruptly elevated up to 0.5d during acute
stress and thereafter decreased towards chronic temperature group, but still higher than that normal temperature group. This is
most likely due to the cortisol level during chronic stress (distress), either persists long after the stressor has ceased or reduces its
level. Similar studies had been reported in the same species (Ming et al. 2012), Atlantic cod (Pérez-Casanova et al. 2008) and
gilthead seabream (Ortuño et al. 2001).
As the level of cortisol increased, blood glucose level might also increased (Pérez-Casanova et al. 2008, Ortuño et al. 2001, Ming
et al. 2012) to meet the increasing energy demand in fish under stress (Hsieh et al. 2003). An enhanced release of glucose in the
blood during acute stress becomes apparent during chronic stress with the support of cortisol (gluconeogenesis) (Iwama et al.
2006). In this study, the serum glucose content increased up to 2d during acute stress and thereafter tended to decrease towards
chronic temperature group, and reached similar to the level of normal temperature group. It can be suggested that stress has some
instantaneous effect on blood glucose level and when the stress lasts for a while blood glucose can recover back to the original level
(Hsieh et al. 2003). This is supported by the result reported in sea bass submitted to acute temperature heat shock (Enes et al. 2006).
Aspartate aminotransferase (AST) is ubiquitous aminotransferases that is found in the mitochondria of fish which is an
important index for the diagnosis of hepatopancreas function and damage (Yamamoto 1981, Habte-Tsion et al. 2014, 2015b).
Elevated level of AST has been used extensively in studies that evaluate finfish response to stress, toxins, disease and malnutrition. In
the present study, the serum AST activity abruptly increased at 0.125d during acute stress and thereafter decreased towards chronic
temperature group. No significant differences were measured in serum AST activity among the 2d and 7d during acute stress,
chronic temperature group and normal temperature group. This is most likely to be when fish is exposed to stress for a prolonged
period, the AST activity could be reduced, and fluctuated activity of AST can be considered as stress response.
Several physiological and biochemical adjustments can be involved during stress and it is regulated by stress hormones
(adrenaline and cortisol) which activate metabolic pathways that lead to biochemical alterations (Barton and Iwama 1991), and
changes in the immune functions (Barton 2002). In the present study, elevated temperature significantly affected the immune
responses (C3 and C4 concentrations), suggesting that it resulted changes in immune functions. Meanwhile, greater immune
responses were found in the acute temperature group (during 0.125-1d for C3 and 0.125-2d for C4) compared to the normal and
chronic temperature groups in this study. It indicated that acute stress may be often associated with eustress or hormesis (stress
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
2
RESEARCH
resulting in potential advantages), thus involving short-time challenges that result in immunoactivation or immunoenhancing
processes (Mattson 2008, Calabrese and Mattson 2011).
Hepatopancreas is the target organ in fish research studies (Aras et al. 2009, Chen et al. 2012, Feng et al. 2013, Habte-Tsion et
al. 2016,2015c) including in blunt snout bream research study (Habte-Tsion et al. 2015c, 2016). Fish hepatopancreas is a tissue that
contains large quantities of unsaturated lipids (polyunsaturated fatty acids, PUFAs), which are essential for membrane function (Bayir
et al. 2011). A large PUFA content implies an elevated risk of oxidative stress, since these lipids are major targets for reactive oxygen
species (ROS) (Abele and Puntarulo 2004, Martinez-Alvarez et al. 2005). Oxidative damage is an important consequence of oxidative
stress, which is a state characterized by an imbalance between the generation of ROS and the antioxidant defense capacity of the
body (Zheng et al. 2013). In general, antioxidant defense systems in fish consist of low-molecular-weight antioxidants and
antioxidant enzymes including SOD, GPx and CAT (Martinez-Alvarez et al. 2005). SOD can catalyze dismutation of superoxide
radicals to hydrogen peroxide (Zhou et al. 2013), which can be removed by GPx (Livingstone 2003). CAT is an essential defense
against the potential toxicity of free radical like hydroxyl radical by catalyzing the degradation of hydrogen peroxide (David et al.
2008). In this study, high temperature increased the activities of SOD, GPx and CAT in the hepatopancreas of blunt snout bream fry,
suggesting that high temperature could be triggered oxidative stress in the hepatopancreas of this fish. Similarly, antioxidant
enzymes activities increased in abalones exposed to high temperatures (Park et al. 2015).
The antioxidant enzyme activities of fish are closely related to their mRNA levels (Fontagné-Dicharry et al. 2014). In present
study, high temperature significantly increased mRNA levels of Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST in the hepatopancreas of
blunt snout bream fry, which showed a similar trends with antioxidant enzymes activity, suggesting that the increments of
antioxidant enzyme activity is partly attributed to the fact that high temperature (especially acute high temperature) up-regulated
the gene transcription of antioxidant enzymes in the hepatopancreas of fish. The up-regulation of the antioxidant enzymes mRNA
expression by acute high temperature stress may be related an increased signaling molecules syntheses (target of rapamycin (TOR)
and nuclear factor erythroid 2-related factor 2 (Nrf2)), which play important roles in the regulation of antioxidant enzyme gene
transcriptions in fish. However, the specific mechanisms behind the relation between high temperature and these signaling
molecules syntheses need further study.
HSPs play important roles in stress response (Iwama et al. 1999), in both innate and adaptive immune responses (Roberts et al.
2010, Sung and MacRae 2011, Xie et al. 2015). In this study, acute high temperature induced the expression patterns of HSP60,
HSP70 and HSP90 in the hepatopancreas of blunt snout bream fry. Similar results have been reported that the expression levels of
HSPs abruptly induced under heat shock in different aquatic species (Palmisano et al. 2000, Qian et al. 2012, Yang et al. 2013). In our
study, the expression of HSP70 mRNA increased significantly at 0.125d during acute stress; whereas those HSP60 and HSP90
increased at 1d during acute stress, which indicated that the high sensitivity of HSP70. Qian et al. (2012) also reported that the
expression of HSP60 is very sensitive to heat shock, but less than that of HSP70. Different HSP genes may play different roles in
mediating cell stress caused by a specific environmental stressor. As a result, HSPs mRNA levels could contribute to the different
expression patterns of HSP60, HSP70, and HSP90 (Qian et al. 2012, Szymańska et al. 2009). These results indicated that the critical
roles of HSP genes in coping with heat stress in organisms.
The present study investigated that high cumulative mortality at 1d after infection in the chronic temperature group; suggesting
that this group had less resistance to A. hydrophi1a infection than the normal temperature and acute temperature groups. The low
cumulative mortality in the acute stressed group could be due to high levels of biomarkers produced during acute stress, which are
an efficient cross-tolerance phenomenon when fish were exposed to infection (Lindquist and Craig 1988, Clegg et al. 1998). On the
other hand, during chronic stress, there is a mechanism of continuous energy availability by the immune system such as the
production of antibodies, the synthesis of proteins such as complements, antioxidants and HSPs, the production and differentiation
of different types of leukocytes, etc., subjected to lack of resources. Thus decreasing its efficiency and therefore leading to immune
depression. At the end pathogenic infection resistance can be reduced and fish can be easily susceptible to disease.
5. CONCLUSION
This study indicates that poor growth and disease resistance were observed in the chronic temperature group. High temperature
increased stress and immune responses (acute temperature) and antioxidant enzymes activities (both acute and chronic
temperatures). Temperature induced the gene expression of antioxidant enzymes (Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST) and
HSPs (HSP60, 70 and 90) in the hepatopacreas of blunt snout bream fry, which may explain further the adverse effects of high
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
3
RESEARCH
temperature in cultured fish. This study expected to contribute useful insight to the knowledge for developing blunt snout bream
sustainable aquaculture, especially in summer resulting high mortality due to diseases outbreak caused by high temperature stress.
SUMMARY OF RESEARCH
1. Chronic high temperature resulted poor growth of blunt snout bream fry.
2. High temperature influenced stress and immune responses.
3. High temperature increased antioxidant enzymes activities.
4. Increase in temperature up-regulated the gene expressions of antioxidant enzymes.
5. Acute high temperature induced the gene expression of heat-shock proteins (HSPs).
6. Increase in temperature affects immune and antioxidant status, and disease resistance of fish.
ACKNOWLEDGEMENTS
The authors acknowledge to the post graduate students of Fish Disease and Nutrition Department, Freshwater Fisheries Research
Center (FFRC) for their help throughout the research period. This work was financially supported by the Modern Agro-industry
Technology Research System, PR China (CARS-46); the Special Fund for Agro-Scientific Research in the Public Interest (201003020);
and the National Nonprofit Institute Research Grant of FFRC, CAFS (2014A08XK02). H.M.H.T., B.L., G.X.P. and J.X. designed the study;
H.M.H.T., M.C.R. and R.C. performed the feeding trial and collected sample; H.M.H.T. and M.C.R. analyzed data; H.M.H.T. wrote the
manuscript, with input from all other authors; and M.C.R., B.L. and G.X.P. provided advice and critical review of the manuscript. All
authors read and approved the final version of the manuscript. The authors declare no competing financial interests.
REFERENCES
1. Abele D, Puntarulo S. Formation of reactive species and
induction of antioxidant defense systems in polar and
temperate marine invertebrates and fish. Comp. Biochem.
Physiol., 2004, 138A, 405-415.
2. Aebi H. Catalase “in vitro”. Method Enzymol., 1984, 105, 121-
127.
3. Anonymous. Nutrient requirements of warm water fish and
shellfish. National Research Council. National Academy
Press, Washington DC, 1983, 114.
4. Aras N M, Bayır A, Sirkecioğlu A N, Bayır M, Aksakal E,
Haliloğlu H I. Seasonal changes in antioxidant defense
system of liver and gills of Salmo trutta caspius, Salmo trutta
labrax and Salmo trutta macrostigma. J. Fish. Biol., 2009, 74,
842-856.
5. Barton B A, Iwama G K. Physiological changes in fish from
stress in aquaculture with emphasis on the response and
effects of corticosteroids. Ann. Rev. Fish Dis., 1991, 1, 3-26.
6. Barton B A. Stress in Fishes: a diversity of responses with
particular reference to changes in circulating
corticosteroids. Integ. Comp. Biol., 2002, 42, 517-525.
7. Basu N, Todgham A E, Ackerman P A, Bibeau M R, Nakano
K, Schulte P M, et al. Heat shock protein genes and their
functional significance in fish. Gene, 2002, 295, 173-183.
8. Bayir A, Sirkecioglu A N, Bayir M, Haliloglu H I, Kocaman E
M, Aras N M. Metabolic responses to prolonged starvation,
food restriction, and refeeding in the brown trout, Salmo
trutta: Oxidative stress and antioxidant defenses. Comp.
Biochem. Physiol., 2011, 159B, 191-196.
9. Bradford M M. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein–dye binding. Anal. Biochem., 1976, 72,
248-254.
10. Bureau D P, Kaushik S J, Cho C Y. Bioenergetics. In: Halver J
E, Hardy R W, editors. Fish Nutrition. Academic Press,
California, 2002, 1-59.
11. Calabrese E J, Mattson M P. Hormesis provides a
generalized quantitative estimate of biological plasticity. J.
Cell Commun. Signal., 2011, 5, 25-38.
12. Chen G F, Feng L, Kuang S Y, Liu Y, Jiang J, Hu K, et al. Effect
of dietary arginine on growth, intestinal enzyme activities
and gene expression in muscle, hepatopancreas and
intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Br.
J. Nutr. 2012, 108, 195-207.
13. Clegg J S, Uhlingher K R, Jackson S A, Cherr G N, Rifkin E,
Friedman C S. Induced thermotolerance and heat shock
protein-70 family in Pacific oyster Crassostrea gigas. Mol.
Mar. Biol. Biotechnol., 1998, 7, 21-30.
14. Cunha Bastos V L F, Salles J B, Valente R H, León I R, Perales
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
4
RESEARCH
J, Dantas R F, et al. Cytosolic glutathione peroxidase from
liver of pacu (Piaractus mesopotamicus), a hypoxia-tolerant
fish of the Pantanal. Biochimie., 2007, 89, 1332-1342.
15. David M, Munaswamy V, Halappa R, Marigoudar S R.
Impact of sodium cyanide on catalase activity in the
freshwater exotic carp, Cyprinus carpio (Linnaeus). Pestic.
Biochem. Phys., 2008, 92, 15-18.
16. Enes P, Panserat S, Kaushik S, Oliva-Teles A. Rapid
metabolic adaptation in European sea bass (Dicentrarchus
labrax) juveniles fed different carbohydrate sources after
heat shock stress. Comp. Biochem. Physiol., 2006, 145A, 73-
81.
17. FAO. In: Spreij M, editor. National aquaculture legislation
overview-China. National aquaculture legislation OVERVIEW
(NALO) fact sheets. Rome: FAO Fisheries and Aquaculture
Department, 2004. http://www.fao.org/fishery/legalfram
ework/nalo_china/en#tcNB0041.
18. Feng L, Peng Y, Wu P, Hu K, Jiang W D, Liu Y, et al.
Threonine Affects Intestinal Function, Protein Synthesis and
Gene Expression of TOR in Jian Carp (Cyprinus carpio var.
Jian). PLoS ONE, 2013, 8(7), e69974.
doi:10.1371/journal.pone.0069974
19. Fontagné-Dicharry S, Lataillade E, Surget A, Larroquet L,
Cluzeaud M, Kaushik S. Antioxidant defense system is
altered by dietary oxidized lipid in first-feeding rainbow
trout (Oncorhynchus mykiss). Aquaculture, 2014, 424-425:
220-227.
20. Gao Z X, Luo W, Liu H, Zeng C, Liu X L, Yi S K, et al.
Transcriptome analysis and SSR/SNP markers information
of the blunt snout bream (Megalobrama amblycephala).
PLoS One, 2012, 7 (8), e42637.
doi:10.1371/journal.pone.0042637.
21. Habte-Tsion H M, Ge X P, Liu B, Xie J, Ren M C, Zhou Q L, et
al. A deficiency or an excess of dietary threonine level
affects weight gain, enzyme activity, immune response and
immune-related gene expression in juvenile blunt snout
bream (Megalobrama amblycephala). Fish Shellfish
Immunol., 2015b, 42, 439-446.
22. Habte-Tsion H M, Liu B, Ge X P, Xie J, Xu P, Ren M C, et al.
Effects of dietary protein levels on the growth performance,
muscle composition, blood composition and digestive
enzymes activities of Wuchang bream, Megalobrama
amblycephala fry. Israeli J. Aquac., 2014, 65, 1-9. Bamidgeh
2013 IJA_65. 925.
23. Habte-Tsion H M, Liu B, Ren M C, Ge X P, Xie J, Zhou Q L, et
al. Dietary threonine requirement of juvenile blunt snout
bream (Megalobrama amblycephala). Aquaculture, 2015a,
437, 304-311.
24. Habte-Tsion H M, Ren M C, Liu B, Ge X P, Xie J, Chen R, et
al. Threonine influences the absorption capacity and brush-
border enzyme gene expression in the intestine of juvenile
blunt snout bream (Megalobrama amblycephala).
Aquaculture, 2015d, 448, 436-444.
25. Habte-Tsion H M, Ren M C, Liu B, Ge X P, Xie J, Chen R.
Threonine modulates immune response, antioxidant status
and gene expressions of antioxidant enzymes and
antioxidant-immune-cytokine-related signaling molecules
in juvenile blunt snout bream (Megalobrama amblycephala).
Fish Shellfish Immunol., 2016, 51, 189-199.
26. Habte-Tsion H M, Ren M C, Liu B, Xie J, Ge X P, Chen R, et
al. Threonine affects digestion capacity and
hepatopancreatic gene expression of juvenile blunt snout
bream (Megalobrama amblycephala). Br. J. Nutr., 2015c,
114, 533-543.
27. He L J, Liao Yuan J F, Tang H Y, Wu Q, Zhang G W.
Pathological observation of bacterial septicemia in
Megalobrama amblycephala. J. Southwest Univer., 2006, 3,
483-490 (in China).
28. Hsieh S L, Chen Y N, Kuo C M. Physiological responses,
desaturase activity and fatty acid composition in milkfish
(Chanos chanos) under cold acclimation. Aquaculture, 2003,
220, 903-918.
29. Iwama G K, Afonso L O B, Vijayan M M. Stress in fishes. In:
Evans D H, Claiborne J B, editors. The Physiology of Fishes,
3rd edition. CRC Press, New York, 2006, 319-342.
30. Iwama G K, Vijayan M M, Forsyth R B, Ackenrian P A. Heat
shock proteins and physiological stress in fish. Am. Zool.,
1999, 39, 901-909.
31. Jobling M. Bioenergetics: feed intake and energy
partitioning. In: Rankin J C, Jensen F B (eds) Fish Eco-
physiology. Chapman & Hall, London, 1993, 1-44.
32. Kling L J, Muscato H J, Jordaan A. Growth, survival and feed
efficiency for post-metamorphosed Atlantic cod (Gadus
morhua) reared at different temperatures. Aquaculture,
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
5
RESEARCH
2007, 262, 281-288.
33. Lindquist S, Craig E A. The heat-shock proteins. Annu. Rev.
Genet., 1988, 22, 631-677.
34. Livak K J, Schmittgen T D. Analysis of relative gene
expression data using real-time quantitative PCR and the 2-
∆∆CT method. Methods, 2001, 25, 402-408.
35. Livingstone D R. Oxidative stress in aquatic organisms in
relation to pollution and aquaculture. Rev. Med. Vet., 2003,
154, 427-430.
36. Martinez-Alvarez R M, Morales A E, Sanz A. Antioxidant
defenses in fish: biotic and abiotic factors. Rev. Fish Biol.
Fish, 2005, 15, 75-88.
37. Mattson M P. Hormesis defined. J. Ageing Res. Rev., 2008, 7,
1-7.
38. Ming J H, Xie J, Xu P, Ge X P, Liu W B, Ye J Y. Effects of
emodin and vitamin C on growth performance, biochemical
parameters and two HSP70s mRNA expression of Wuchang
bream (Megalobrama amblycephala Yih) under high
temperature stress. Fish Shellfish Immunol., 2012, 32, 651-
661.
39. Ministry of Agriculture of the People’s Republic of China.
Chinese fishery statistical yearbook. Chinese Agricultural
Press, Beijing, China, 2013 (in Chinese).
40. Ndong D, Chen Y Y, Lin Y H, Vaseeharan B, Chen J C. The
immune response of tilapia Oreochromis mossambicus and
its susceptibility to Streptococcus iniae under stress in low
and high temperatures. Fish Shellfish Immunol., 2007, 22,
686-694.
41. Ortuño J, Esteban M A, Meseguer J. Effects of short-term
crowding stress on the gilthead seabream (Sparus aurata L.)
innate immune response. Fish Shellfish Immunol., 2001, 11,
187-197.
42. Palmisano A N, Winton J R, Dickhoff W W. Tissue-specific
induction of Hsp90 mRNA and plasma cortisol response in
Chinook salmon following heat shock, seawater challenge,
and handling challenge. Mar. Biotechnol., 2000, 2, 329-338.
43. Park K, Lee J S, Kang J C, Kim J W, Kwak I S. Cascading
effects from survival to physiological activities, and gene
expression of heat shock protein 90 on the abalone Haliotis
discus hannai responding to continuous thermal stress. Fish
Shellfish Immunol., 2015, 42, 233-240.
44. Pérez-Casanova J C, Rise M L, Dixon B, Afonso L B O, Hall J
R, Johnson S C, Gamperl A K. The immune and stress
responses of Atlantic cod to long-term increases in water
temperature. Fish Shellfish Immunol., 2008, 24, 600-609.
45. Pickering A D, Pottinger P. Seasonal and diet changes in
plasma cortisol levels of the brown trout, Salmo trutta L.
Gener. Comp. Endocrinol., 1983, 49, 232-239.
46. Qian Z Y, Liu X L, Wang L J, Wang X Z, Li Y, Xiang J H, et al.
Gene expression profiles of four heat shock proteins in
response to different acute stresses in shrimp, Litopenaeus
vannamei. Comp. Biochem. Physiol., 2012, 156C, 211-220.
47. Reitman S, Frankel S. Colorimetric determination of
glutamic oxaloacetic and glutamic pyruvic transaminases.
Am. J. Clin. Pathol., 1957, 28, 53-56.
48. Robbins C T, Cohen Y, Davitt B B. Energy expenditure by elk
calves. J. Wildl. Manage., 1979, 43, 445-453.
49. Roberts R J, Agius C, Saliba C, Bossier P, Sung Y Y. Heat
shock proteins (chaperones) in fish and shellfish and their
potential role in relation to fish health: a review. J. Fish Dis.,
2010, 33, 789-801.
50. Sanders BM. Stress proteins in aquatic organisms: an
environmental perspective. Crit. Rev. Toxicol., 1993, 23, 49-
75.
51. Shi W L, Shan J, Liu M Z, Yan H, Huang F Q, Zhou X W, et al.
A study of the optimum demand of protein by blunt snout
bream (Megalobrama amblycephala). FAO library, 1988,
Accession no. 289611.
52. Solé M, Rodríguez V, Papiol F, Maynou F, Cartes ĵ E.
Xenobiotic metabolism in marine fish with different trophic
strategies and their relationship to ecological variables.
Comp. Biochem. Physiol. 2009, 149C, 83-89.
53. Song L, Wu L, Ni D, Chang Y, Xu W, Xing K. The cDNA
cloning and mRNA expression of heat shock protein 70
gene in the haemocytes of bay scallop (Argopecten
irradians, Lamarck 1819) responding to bacterial challenge
and naphthalin stress. Fish Shellfish Immunol., 2006, 21,
335-345.
54. Staib J L, Quindry J C, French J P, Criswell D S, Powers S K.
Increased temperature, not cardiac load, activates heat
shock transcription factor 1 and heat shock protein 72
expression in the heart. Am. J. Physiol. Regul. Integr. Comp.
Physiol., 2007, 292, R432-439.
55. Sung Y Y, MacRae T H. Heat shock proteins and disease
Habte-Michael Habte-Tsion et al.
Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock
proteins of blunt snout bream, Megalobrama amblycephala fry,
Science & Technology, 2016, 2(8), 408-426,
www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved
ARTICLE
Pag
e42
6
RESEARCH
control in aquatic organisms. J. Aquac. Res. Dev., S2 2011,
006.
56. Szymańska Z, Zylicz M. Mathematical modeling of heat
shock protein synthesis in response to temperature change.
J Theor Biol 2009; 259: 562-9.
57. Trinder P. Determination of glucose concentration in the
blood. Annals of Clinical Biochemistry, 1969, 6, 24-27.
58. Vazzana M, Cammarata M, Cooper E L, Parrinello N.
Confinement stress in sea bass (Dicentrarchus labrax)
depresses peritoneal leukocyte cytotoxicity. Aquaculture,
2002, 210, 231-243.
59. Vizzini A, Vazzana M, Cammarata M, Parrinello N. Peritoneal
cavity phagocytes from the teleost sea bass express a
glucocorticoid receptor (cloned and sequenced) involved in
genomic modulation of the in vitro chemiluminescence
response to zymosan. Gen. Comp. Endocrinol., 2007, 150,
114-123.
60. Wendelaar Bonga S E. The stress response in fish. Physiol.
Rev., 1997, 77, 591-562.
61. Wilhelm Filho D, Tribess T, Gáspari C, Claudio F D, Torres M
A, Magalhães A R M. Seasonal changes in antioxidant
defenses of the digestive gland of the brown mussel (Perna
perna). Aquaculture, 2001, 203, 149-158.
62. Xie J, Liu B, Zhou Q L, Su Y T, He Y J, Pan L K, et al. Effects of
anthraquinones extract from rhubarb R. officinale Bail on
the crowding stress response and growth of common carp
(Cyprinus carpio var. Jian). Aquaculture, 2008, 281, 5-11.
63. Xie Y J, Song L, Weng Z H, Liu S, Liu Z J. Hsp90, Hsp60 and
sHsp families of heat shock protein genes in channel catfish
and their expression after bacterial infections. Fish Shellfish
Immunol., 2015, 44, 642-651.
64. Yamamoto Y. Determination of toxicity by biochemical
method. In: Egami N, editor. Fishes as Laboratory. Soft
Science, Tokyo, 1981, 568-574 (Chapter 4).
65. Yang Y N, Ye H H, Huang H Y, Li S J, Liu X L, Zeng X L, et al.
Expression of Hsp70 in the mud crab, Scylla paramamosain
in response to bacterial, osmotic, and thermal stress. Cell
Stress and Chaperone, 2013, 18, 475-482.
66. Yeh C T, Ching L C, Yen G C. Inducing gene expression of
cardiac antioxidant enzymes by dietary phenolic acids in
rats. J. Nutr. Biochem., 2009, 20, 163-171.
67. Zhang X D, Zhu Y F, Cai L S, Wu T X. Effects of fasting on the
meat quality and antioxidant defenses of market-size
farmed large yellow croaker (Pseudosciaena crocea).
Aquaculture, 2008, 280, 136-139.
68. Zheng P, Yu B, He J, Tian G, Luo Y H, Mao X B, et al.
Protective effects of dietary arginine supplementation
against oxidative stress in weaned piglets. Br. J. Nutr., 2013,
109, 2253-2260.
69. Zhou Q C, Wang Y L, Wang H L, Tan B P. Dietary threonine
requirements of juvenile Pacific white shrimp, Litopenaeus
vannamei. Aquaculture, 2013, 392-395, 142-147.