increased men1 mrna expression in sporadic pituitary tumours

Clinical Endocrinology (1999) 50, 727–733

727q 1999 Blackwell Science Ltd

Increased MEN1 mRNA expression in sporadic pituitarytumours

C. J. McCabe, N. J. L. Gittoes, M. C. Sheppard andJ. A. FranklynDepartment of Medicine, University of Birmingham,Queen Elizabeth Hospital, Edgbaston, Birmingham, UK

(Received 11 September 1998; returned for revision12 November 1998; finally revised 27 November 1998;accepted 3 February 1999)

Summary

BACKGROUND The MEN1 gene on chromosome11q13 encodes a tumour suppressor gene, mutationsin which cause multiple endocrine neoplasia (MEN)type 1 syndrome. Loss of heterozygosity (LOH) at thislocus is a common finding amongst sporadic pituitarytumours. We have therefore screened the MEN1 genefor mutations in sporadic pituitary tumours and, asthe gene is a putative tumour suppressor, have quan-tified mRNA expression in tumorous and normalpituitaries to assess the role of MEN1 in pituitarytumorigenesis.SUBJECTS AND DESIGN Thirty-one nonfunctioningpituitary tumours, 8 GH secreting, 2 TSH-secretingtumours and 1 corticotrophinoma have been assessedfor the presence of MEN1 mutations, to examine thehypothesis that MEN1 mutations may contribute tothe pathogenesis of sporadic pituitary neoplasms. Inaddition, quantitative changes in the pretranslationalexpression of the tumour suppressor gene MEN1have been determined in 42 pituitary tumours and 6normal pituitaries using semiquantitative reversetranscriptase PCR.RESULTS No novel or previously published muta-tions were apparent in the MEN1 coding regions ofany tumours studied, although several polymorph-isms were identified. Transcriptional changes of thegene, assessed by semiquantitative RT-PCR, indi-cated that nonfunctioning and GH-secreting pituitarytumours are associated with significantly increasedpretranslational expression of the MEN1 gene. Inaddition, the single corticotrophinoma showed

increased expression compared to normal, as didone of the two TSH-omas.CONCLUSION Coding mutations of the putativetumour suppressor gene MEN1 are unlikely tocontribute to pituitary tumorigenesis in sporadic non-functioning, GH-secreting and TSH-secretingadenomas. Changes in pretranslational expressionof MEN1 were observed in pituitary tumours, suggest-ing that changes in the level of MEN1 expression,rather than coding changes, may be of functionalimportance in influencing sporadic pituitarytumorigenesis.

The majority of pituitary tumours are believed to derive from amonoclonal expansion of cells originating from a somaticgenome alteration in the parent cell (Katznelsonet al., 1993).Few somatic defects in genes influencing cell proliferation orhormone production have been reported in pituitary adenomas,although mutations in the Gs protein have been implicated inthe pathogenesis of a small number of growth hormone (GH)secreting tumours (Vallaret al., 1987).Ras sequences haveshown mutation in two aggressive prolactinomas in a series of97 pituitary adenomas (Kargaet al., 1992; Caiet al., 1994) andprotein kinase C mutations have been described in only fourinvasive human pituitary tumours (Alvaroet al., 1993).Previous studies of heterozygosity at the chromosomal region11q13 demonstrated loss of heterozygosity (LOH) in 10–18%of sporadic pituitary tumours assessed, with an LOH rate of20% for nonfunctioning tumours (Boggildet al., 1994).Recently, the tumour suppressor gene MEN1 (Larssonet al.,1988) has been cloned and sequenced (Chandrasekharappaet al., 1997) and found to be localized to chromosomal region11q13. A growing number of mutations in the MEN1 gene havebeen reported in a range of sporadic tumours, includinggastroenteropancreatic (Debelenkoet al., 1997; Toliatet al.,1997; Zhuanget al., 1997a), insulinomas (Zhuanget al.,1997a), parathyroid tumours (Heppneret al., 1997) andmultiple endocrine neoplasms (Mayret al., 1997), suggestingan association between the MEN1 gene and endocrine cancer.Given the association between MEN1 mutations and sporadicendocrine neoplasms, it is proposed that MEN1 is a tumoursuppressor gene. Despite this, the precise function of the MEN1protein is uncertain, although it has recently been localized tothe nucleus (Guruet al., 1998).

Two previous reports have assessed pituitary tumours for

Correspondence: Professor J. A. Franklyn, Department of Medicine,University of Birmingham, Queen Elizabeth Hospital, Edgbaston,Birmingham, B15 2TH, UK. Fax:þ44 (0)121 414 7620;E-mail: [email protected]

MEN mutations. Zhuanget al. (1997b) found two missensemutations in four pituitary tumours with LOH of the MEN1gene, whilst Prezantet al. (1998) failed to detect codingchanges amongst 45 functioning and nonfunctioning adenomas.However, neither study has assessed quantitatively the level ofexpression of the MEN1 gene product in pituitary tumours. Inthe present studies therefore we have examined the MEN1 genefor the presence of mutations described previously in othertissues (Chandrasekharappaet al., 1997; Debelenkoet al.,1997; Heppneret al., 1997; Toliatet al., 1997; Zhuanget al.,1997a; Zhuanget al., 1997a; Zhuanget al., 1997b; Bassettet al., 1998; Forbeset al., 1998), as well as for novel codingchanges. Since a putative role for the MEN1 gene product inpituitary tumour pathogenesis or proliferation may reflect anabnormality of MEN1 gene transcription, we have investigatedthe expression of MEN1 mRNA in tumorous and normalpituitary tissue, to determine whether sporadic pituitarytumours display altered pretranslational expression of theMEN1 gene.

Materials and methods

Tissues

Clinically nonfunctioning pituitary macroadenomas wereexcised trans-sphenoidally from 31 patients (16 male, 15female; age at the time of presentation 576 2·2 years (mean6 SE)). Six normal human pituitary glands were obtained frompost mortem proceedings, within 24 h of the time of death. Allsamples were stored at¹808C. Eight GH-secreting tumours

were also excised trans-sphenoidally from 5 female and 3 malepatients (age at diagnosis 526 3 years (mean6 SE)), and twoTSH-secreting tumours similarly obtained from a 55-year-oldmale and 75-year-old female. A single corticotrophinoma wasexcised from a female patient of age 54. All tumours werecharacterized biochemically and immunohistochemically asreported previously (Gittoeset al., 1997, 1998). All procedureshad local ethical committee approval.

RNA and DNA extraction

Total RNA was isolated from pituitary tissue following theRNAzolTM B technique (Biotech Laboratories, Inc., Houston,TX)—a single step acid guanidinium phenol-chloroformextraction procedure (Chomczynski & Sacchi, 1987). DNAwas extracted from pituitary tissue for the analysis of exon 2,which proved resistant to RT-PCR techniques, using the DNaceClini Pure kit (Bioline, London, UK) after mincing intoapproximately 10–20 mg pieces. The manufacturer’s protocolwas followed and DNA samples subsequently maintained at48C.

Sequencing

RNA was reverse transcribed using Avian Myeloblastosis virus(AMV) reverse transcriptase (Promega, Madison, WI) in a totalreaction volume of 50ml, with 2mg of pituitary total RNA,60 pmol oligo(dT)15, 10ml of 5x AMV reverse transcriptasebuffer (Promega), 5ml of deoxynucleotide triphosphate (dNTP)mix (200mM each; Boehringer Mannheim, Germany), 50 units

728 C. J. McCabe et al.

q 1999 Blackwell Science Ltd,Clinical Endocrinology, 50, 727–733

Table 1 Oligonucleotide primer sequences used for screening MEN1 coding regions in this investigation. Primers denoted Aupperand Alower are takenfrom previously published sequences (Zhuanget al., 1997a). Primer locations are given according to the original published cDNA sequence(Chandrasekharappaet al., 1997). SQ RT-PCR— primers used in the semiquantitative assessment of RNA expression.b actin—primers used to controlfor variability in RNA degradation and RT efficiency in semiquantitative RT-PCR. Tm refers to the annealing temperatures of the given primer pairs.

Name Sequence Position Tm (8C) Exon

A upper 50GGCTTCGTGGAGCATTTTCT 234–253 50 2A lower 50CTCGAGGATAGAGGGACAGG 403–424B upper 50CCTGGCGGCCTCACCTACTTT 324–344 60 2,3B lower 50ACTGTCTGGCCCCTGCGGTCCTCGTT 717–742C upper 50GGATCATGCCTGGGTAGTGTTTG 647–669 62 4,5C lower 50TGTGTTCATCCCGATAGTAGGTCTTG 1037–1062D upper 50GGCCGGCCAGACCCACTCACC 990–1010 66 6–9D lower 50ACCTTCTGCCGCACCTGTCCCTCAAAAC 1447–1474E upper 50AGGAGCCCCCGCCGCCCAAGAAG 1579–1601 68 10E lower 50CCCACAAGCGGTCCGAAGTCCCCAGTAG 1945–72SQ RT-PCRlower 50CCCCGCCGCCCAAGAAG 1585–1601 62 10SQ RT-PCRupper 50AAGCGGTCCGAAGTCCCCAGTAG 1945–67b actin upper 50GTCACCAACTGGGACGACA 267–285 60 –b actin lower 50TGGCCATCTCTTGCTCGAA 708–726

of ribonuclease inhibitor (RNasin , Promega) and 15 units ofAMV reverse trancriptase (Promega). Hot start PCR wascarried out in 50ml volumes using 1ml of the resulting RTproduct, 30 pmol of each primer, 1ml of dNTP mix (200mM

each; Boehringer Mannheim, Germany), 5ml of 10x PCRreaction buffer and 2 units of Taq DNA polymerase(Boehringer Mannheim). Amplification of exon 2 fromgenomic DNA relied partially upon previously publishedprimers (Zhuanget al., 1997a) (see Table 1), with PCRreactions supplemented with 5% DMSO and 5% glycerol toachieve amplification across this GC rich region. Oligonucleo-tide design was carried out using DNAStar software (Madison,USA). Amplified coding regions of the MEN1 gene werepurified after excision from TAE agarose gels and elution usingQIAQuick gel purification kits (Qiagen, Hilden, Germany).Fragment concentration was gauged in relation to a DNA massladder (Pharmacia, Uppsala, Sweden), and 50–100 ng used persequencing reaction, with 4ml AmpliTaq (Perkin Elmer, FosterCity, USA) and 3·2 pmol forward or reverse primer. PCRfragments encompassing over 80% of the MEN1 cDNA weresequenced in both directions on an ABI 377 sequencer andelectropherograms analysed using DNAstar software. Bothpreviously reported mutations (Chandrasekharappaet al., 1997;Debelenkoet al., 1997; Heppneret al., 1997; Toliatet al., 1997;Zhuanget al., 1997a, b; Bassettet al., 1998; Forbeset al., 1998)and novel changes were screened by this method.

Semiquantitative RT-PCR

Semiquantitative RT-PCR, which we have previouslydescribed in detail (Gittoeset al., 1997, 1998; Kilbyet al.,1998), utilized comparative kinetic analysis to determine thephase of exponential PCR product generation of MEN1products in 22 nonfunctioning, 8 GH-secreting, 2 TSH-secreting and one ACTH-secreting pituitary tumour as well as6 normal pituitaries.b-actin mRNA expression was used tostringently control for any variability in RNA degradation andRT efficiency. MEN1 andb-actin primer sequences andlocations are detailed in Table 1. MEN1 reactions were runfor 34 cycles with an annealing temperature of 628C. b-actinreactions were performed over 31 cycles at 608C. Each reactionwas repeated 3 times. Products were run on ethidium bromidestained agarose gels, the images digitized and subjected toGelbase software analysis to determine the quantity of PCRproduct.

Results

We screened 31 NFTs, 8 GH-and 2 TSH-secreting tumours andone corticotrophinoma for the presence of coding changes. Notumour showed any evidence of mutation, although two

previously unpublished silent site changes were noted: ahomozygous C333G substitution in one TSH-oma and ahomo-or hemizygous C545T substitution in a single non-functioning tumour. However, two polymorphic changes fromwild type sequences were noted in all tumour subtypes, whichconcurred with those reported previously (Agarwalet al., 1997;Chandrasekharappaet al., 1997; Pannettet al., 1998) and werepresent at heterozygous frequencies of 12·1% (ser145ser) and53·6% (Asp418Asp) (see Fig. 1). One potentially homozygouspolymorphism was identified in a nonfunctioning tumour at site(ser145ser), which may, given the comparatively rare incidence

MEN1 mRNA expression in pituitary tumours 729


Fig. 1 Examples of coding changes apparent in MEN1 sequencing.a, A silent site (C333G, in bold) coding change in a TSH-oma.b, A heterozygous (T/C) polymorphic change at codon Asp418Asp(nucleotide 1365, denoted by N) in a nonfunctioning tumour.

(a)

(b)

Wild Type

C G A N G G C AHeterozygote

TSH-oma #1

Wild Type

G G C T C

G C C T C

C G A C

G G C A

of this coding change, previously reported at around 2%(Pannett et al., 1998), reflect a hemizygous rather thanhomozygous condition, implying LOH in this tumour. Noother evidence of LOH was apparent in any of the tumoursstudied from the polymorphic analysis. Indeed, 53·6% oftumours exhibited heterozygosity at polymorphic siteAsp418Asp, ruling out LOH in over half of the pituitarytumours studied here.

Semiquantitative RT-PCR (see Fig. 2) demonstrated thatMEN1 mRNA expression was increased in all pituitary tumoursubtypes when compared with the results in normal pituitaries(see Fig. 3), and significantly so for nonfunctioning and GH-secreting adenomas. Normal pituitary tissue exhibited a meanratio of MEN1 tob actin mRNA of 0·406 0·09 (mean6 SE).Non-functioning tumours showed a ratio of 0·696 0·04* (mean6 SE, *P¼ 0·01 by Student’s t-test); GH-secreting of

0·796 0·08** (mean6 SE, **P<0·005), the two TSH-secreting tumours of 0·80 and 0·21, respectively, and thesingle corticotrophinoma of 1·44.b-actin expression wascompared across all normal (post mortem) and tumorouspituitaries. No evidence of selective degradation ofb-actinmRNA was apparent in normal pituitaries (see Fig. 2B).

Discussion

The recently characterized MEN1 gene on chromosome 11q13encodes a putative tumour suppressor gene (Chandrasekharappaet al., 1997), mutations within which are responsible for themultiple endocrine neoplasia (MEN) type 1 syndrome (Mayret al., 1997). To date, around 75 distinct mutations have beenreported, spread across the gene’s 9 exons (Marxet al., 1998).Loss of heterozygosity in the chromosomal region 11q13 is a



Fig. 2 Examples of semi quantitative RT PCR analysis. a, Four normal pituitaries (N1 to N4), 4 nonfunctioning tumours (#1 to #4) and 4GH-secreting tumours (GH1 to GH4).b-actin amplifications were carried out at 608C over 31 cycles, and MEN1 at 628C and 34 cycles.b, b-actin levels in all 6 normal pituitaries and in 12 nonfunctioning tumours.

relatively frequent finding amongst sporadic pituitary tumours(Boggild et al., 1994), suggesting that the MEN1 gene productmay also have a role in the pathogenesis of sporadic pituitarytumours. The MEN1 protein is a nuclear protein (Guruet al.,1998) of 610 amino acids (Chandrasekharappaet al., 1997), andin common with other tumour suppressors such as p53, may actas a transcriptional regulator of other genes implicated intumour and cell cycle control.

Given the observation of MEN1 mutations in a number ofendocrine cancers, including those of the pituitary (Zhuanget al., 1997b) and the association between LOH at the MEN1locus and the occurrence of sporadic pituitary tumours (Boggildet al., 1994), we have examined the MEN1 gene for thepresence of mutations in a series of nonfunctioning, GH-, TSH-and ACTH-secreting tumours of the pituitary. We were unableto detect mutation in the MEN1 gene in sporadic pituitarytumours. These data were broadly in accord with those recentlypublished by Zhuanget al. (1997b), who reported the presenceof only two MEN1 mutations in a group of 39 prolactinomas,adrenocorticotrophinomas and GH-secreting tumours, and ofPrezantet al. (1998), who found no mutations in a cohort of 45sporadic anterior pituitary tumours. Taken together, theseresults suggest that it is unlikely that coding changes in theMEN1 gene contribute to sporadic pituitary tumorigenesis.

Quantitative changes in MEN1 expression have, however,been relatively neglected. In contrast to one previous report (Asaet al., 1998), which demonstrated no significant change in MEN1expression in a cohort of sporadic pituitary tumours, we foundsignificantly raised levels of MEN1 mRNA in NFTs and GH-secreting tumours, as well as higher levels of MEN1 mRNA inthe single corticotrophinoma we assessed and in one of our twoTSH-omas, when compared with normal pituitaries. These dataimplicate inappropriate expression of the MEN1 gene in pituitarytumorigenesis. The increase in MEN1 mRNA detected insporadic tumours may, however, be due to a mechanism otherthan increased transcription. Recently, trisomy of chromosome11 was reported in a small number of pituitary tumours (Tanakaet al., 1998), which would result in an increase in detectablemRNA. Also, increased MEN1 expression may reflect a lowerrate of degradation of MEN1 mRNA in pituitary adenomas.

Our finding that MEN1 mRNA expression is increased insporadic pituitary tumours is somewhat surprising, givenMEN1’s putative role as a tumour suppressor gene. However,Kuwano et al. (1997) recently demonstrated that anothertumour suppressor gene, p53, showed a marked increase inmRNA in response to DNA damage in a murine model, and thatthis change reflected an increase in transcription. Changes inthe expression of the putative tumour suppressor gene MEN1may thus have important implications in the growth anddevelopment of sporadic tumours.

Another potential explanation of our data is that increasedMEN1 mRNA expression may occur as a secondary responseassociated with an as yet unidentified underlying mechanismcontributing to tumour growth. Clearly, the precise cause ofpituitary tumorigenesis remains unclear. MEN1 mutations haveonly been implicated in a small minority of such cases, with ahost of other genes and related factors (the Gs protein, Rasoncogene, protein kinase C, basic fibroblast growth factor,Rbgene and hypophysiotrophic hormones) contributing in rareinstances to tumour development (see Zhuanget al., 1997b).Given the number of potential factors influencing pituitarytumorigenesis it is conceivable that if MEN1 fails to play aprimary role in pituitary tumorigenesis then increased expres-sion of the gene may reflect a secondary mechanism or adaptiveresponse. One such potential mechanism may be involve p53,the most widely studied suppressor gene, which has recentlybeen reported to interact with thyroid receptors (TRs) (Qiet al.,1997). TRs in turn, have been shown to be expressed at reducedlevels in nonfunctioning (Gittoeset al., 1997) and TSH-secreting (Gittoeset al., 1998) pituitary tumours, suggesting apossible link between tumorigenesis, suppressor expression andhormonal action in an endocrine cancer. It is not possible tospeculate further on the mechanism by which increased MEN1expression may contribute to pituitary tumorigenesis until afunctional role for the gene is elucidated.



Rat

io o

f M

EN

I:

Act

in R

NA

β

1.6

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0

Tumour subtype

Normal NFT GH TSH ACTH

*

**

Fig. 3 Semi quantitative RT PCR ratios of MEN1 mRNA tob actinRNA in 6 normal, 22 nonfunctioning (NFT), 8 growth hormone(GH), 2 thyrotrophin (TSH 1 and 2) and one ACTH secretingtumours. Bars represent mean6 SE; *P¼ 0·01; **P<0·005compared with control, determined by Student’st-test.

Selective degradation of theb-actin internal control intumour samples is another potential, if unlikely, explanation ofour data. We have stringently assessed this possibility byanalysingb-actin mRNA levels across all tumorous and normalpituitaries, and have demonstrated similar levels of expressionregardless of the origin of the tissue, suggesting that increasedexpression of the MEN1 gene in sporadic pituitary tumours didnot reflect selective degradation ofb-actin mRNA.

In summary, our data reinforce the potential importance ofthe MEN1 gene in pituitary tumour pathogenesis and growth,and demonstrate the need to examine transcriptional expressionas well as MEN1 mRNA sequence in endocrine tumours.Protein studies are now needed to further elucidate the role ofmenin in pituitary disease.

Acknowledgements

This work was supported by the award of a Project Grant fromthe Medical Research Council UK. We are grateful to Mrs RMitchell, Mr R Walsh and Mr A Johnson for providing us withtumour samples at the time of surgery.

References

Agarwal, S., Kester, M.B., Debelenko, L.V., Heppner, C., Emmert-Buck, M.R., Skarulis, M.C., Doppman, J.L., Kim, Y.S., Lubensky,I.A., Zhuang, Z., Green, J.S., Guru, S.C., Manickam, P., Olufemi,S.E., Liotta, L.A., Chandrasekharappa, S.C., Collins, F.S., Spiegel,A.M., Burns, A.L. & Marx, S.J. (1997) Germline mutations of theMEN1 gene in familial MEN1 and related states.Human MolecularGenetics, 6, 1169–1175.

Alvaro, V., Levy, L., Dubray, C., Roche, A., Peillon, F., Querat, B. &Joubert, D. (1993) Invasive human pituitary tumours express a point-mutated alpha-protein kinase-C.Journal of Clinical Endocrinologyand Metabolism, 77, 1125–1129.

Asa, S.L., Somers, K. & Ezzat, S. (1998) The MEN1 gene is rarelydown-regulated in pituitary ademomas.Journal of Clinical Endo-crinology and Metabolism, 83, 3210–3212.

Bassett, J.H.D., Forbes, S.A., Pannett, A.A.J., Lloyd, S.E., Christie,P.T., Wooding, C., Harding, B. & Thakker, R.V. (1998) Mutations inthe multiple endocrine neoplasia type 1 (MEN1) gene in glaucomas.(Abstract)Journal of Endocrinology, 156 (Suppl.), 115.

Boggild, M.D., Jenkinson, S., Pistorello, M., Boscaro, M., Scanarini,M., McTernan, P., Perrett, C.W., Thakker, R.V. & Clayton, R.N.(1994) Molecular genetic studies of sporadic pituitary tumours.Journal of Clinical Endocrinology and Metabolism, 78, 387–392.

Cai, W.Y., Alexander, J.M., Hedley-Whyte, E.T., Scheithauer, B.W.,Jameson, J.L., Zervas, N.T. & Klibanski, A. (1994) ras mutations inhuman prolactinomas and pituitary carcinomas.Journal of ClinicalEndocrinology and Metabolism., 78, 89–93.

Chandrasekharappa, S.C., Guru, S.C., Manickam, P., Olufemi, S.E.,Collins, F.S., Emmert-Buck, M.R., Debelenko, L.V., Zhuang, Z.,Lubensky, I.A., Liotta, L.A., Crabtree, J.S., Wang, Y., Roe, B.A.,Weisemann, J., Boguski, M.S., Agarwal, S.K., Kester, M.B., Kim,Y.S., Heppner, C., Dong, Q., Spiegel, A.M., Burns, A.L. & Marx, S.J.

(1997) Positional cloning of the gene for multiple endocrineneoplasia-type 1.Science, 276,404–407.

Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroform extrac-tion. Analytical Biochemistry, 162,156–159.

Debelenko, L.P., Zhuang, Z.P., EmmertBuck, M.R., Chandrasekhar-appa, S.C., Manickam, P., Guru, S.C., Marx, S.J., Skarulis, M.C.,Spiegel, A.M., Collins, F.S., Jensen, R.T., Liotta, L.A. & Lubensky,I.A. (1997) Allelic deletions on chromosome 11q13 in multipleendocrine neoplasia type 1-associated and sporadic gastrinomas andpancreatic endocrine tumours.Cancer Research, 57, 2238–2243.

Forbes, S.A., Pannett, A.A.J., Bassett, J.H.D., Christie, P.T., Lloyd,S.E., Wooding, C., Harding, B. & Thakker, R.V. (1998) Approachesto the detection of mutations in multiple endocrine neoplasia type 1(Abstract).Journal of Endocrinology,156 (Suppl.), 116.

Gittoes, N.J.L., McCabe, C.J., Verhaeg, J., Sheppard, M.C. & Franklyn,J.A. (1997) Thyroid hormone and estrogen receptor expression innormal pituitary and ‘non-functioning’ tumours of the anterior pituitary.Journal of Clinical Endocrinology & Metabolism,82, 1960–1967.

Gittoes, N.J.L., McCabe, C.J., Verhaeg, J., Sheppard, M.C. & Franklyn,J.A. (1998) An abnormality of thyroid hormone receptor expressionmay explain abnormal thyrotropin production in thyrotropin-secreting pituitary tumours.Thyroid, 8, 9–14.

Guru, S.C., Goldsmith, P.K., Burns, A.L., Marx, S.J., Spiegel, A.M.,Collins, F.S. & Chandrasekharappa, S.C. (1998) Menin, the product ofthe MEN1 gene, is a nuclear protein.Proceedings of The NationalAcademy of Sciences of The United States of America,95,1630–1634.

Heppner, C., Kester, M.B., Agarwal, S.K., Debelenko, L.V., Emmert-Buck, M.R., Guru, S.C., Manickam, P., Olufemi, S.E., Skarulis,M.C., Doppman, J.L., Alexander, R.H., Kim, Y.S., Saggar, S.K.,Lubensky, I.A., Zhuang, Z.P., Liotta, L.A., Chandrasekharappa, S.C.,Collins, F.S., Spiegel, A.M., Burns, A.L. & Marx, S.J. (1997)Somatic mutation of the MEN1 gene in parathyroid tumours.NatureGenetics, 16, 375–378.

Karga, H.J., Alexander, J.M., Hedley-Whyte, E.T., Klibanski, A. &Jameson, J.L. (1992) Ras mutations in human pituitary tumours.Journal of Clinical Endocrinology and Metabolism, 74, 914–919.

Katznelson, L., Alexander, J.M. & Klibanski, A. (1993) Clinical review45: Clinically non-functioning pituitary adenomas. [Review].Journal of Clinical Endocrinology and Metabolism, 76,1089–1094.

Kilby, M.R., Verhaeg, J., Gittoes, N.J.L., Somerset, D., Clark, P.M.S. &Franklyn, J.A. (1998) Circulating thyroid hormone concentrationsand placental thyroid hormone receptor expression in normal humanpregnancy and pregnancy complicated by intrauterine growthrestriction.Journal of Clinical Endocrinology and Metabolism, 83,2964–2971.

Kuwano, K., Hagimoto, N., Nomoto, Y., Kawasaki, M., Kunitake, R.,Fujita, M., Miyazaki, H. & Hara, N. (1997) P53 and p21 (Waf1/Cip1)mRNA expression associated with DNA damage and repair in acuteimmune complex alveolitis in mice.Laboratory Investigation., 76,161–169.

Larsson, C., Skogseid, B., Oberg, K., Nakamura, Y. & Nordenskjold,M. (1988) Multiple endocrine neoplasia type 1 gene maps tochromosome 11 and is lost in insulinoma.Nature, 332,85–87.

Marx, S., Spiegel, A.M., Skarulis, M.C., Doppman, J.L., Collins, F.S. &Liotta, L.A. (1998) Multiple Endocrine Neoplasia Type 1. Clinicaland Genetic Topics.Annals of Internal Medicine, 129,485–494.

Mayr, B., Apenberg, S., Rothamel, T., vonzurMuhlen, A. & Brabant, G.(1997) Menin mutations in patients with multiple endocrineneoplasia type 1.European Journal of Endocrinology, 137,684–687.



Pannett, A.A.J., Wooding, C., Forbes, S.A., Bassett, J.H.D., Ellison, D.,Lees, P.D., Myles, L. & Thakker, R.V. (1998) Mutational analysis of themultiple endocrine neoplasia type 1 (MEN1) gene in sporaic pituitarytumours (Abstract).Journal of Endocrinology,156 (Suppl.), 114.

Prezant, T.R., Levine, R. & Melmed, S. (1998) Molecular charac-terization of the Men1 tumor suppressor gene in sporadic pituitarytumors. Journal of Clinical Endocrinology and Metabolism, 83,1388–1391.

Qi, J.S., Desai-Yajnik, V., Yuan, Y. & Samuels, H.H. (1997)Constitutive activation of gene expression by thyroid hormonereceptor results from reversal of p53-mediated repression.Molecularand Cellular Biology., 17, 7195–7207.

Tanaka, C., Kimura, T., Yang, P., Moritani, M., Yamaoka, T., Yamada,S., Sano, T., Yoshimoto, K. & Itakura, M. (1998) Analysis of loss ofheterozygosity on chromosome 11 and infrequent inactivation of theMEN1 gene in sporadic pituitary adenomas.Journal of ClinicalEndocrinology and Metabolism, 83, 2631–2634.

Toliat, M.-R., Berger, W., Ropers, H.H., Neuhaus, P. & Weidenmann,B. (1997) Mutations in the MEN 1 gene in sporadic neuroendocrinetumours of the gastroenteropancreatic system.Lancet, 350,1223.

Vallar, L., Spada, A. & Giannattasio, G. (1987) Altered Gs andadenylate cyclase activity in human GH-secreting pituitary adeno-mas.Nature, 330,566–568.

Zhuang, Z.P., Vortmeyer, A.O., Pack, S., Huang, S., Pham, T.A., Wang,C.Y., Park, W.S., Agarwal, S.K., Debelenko, L.V., Kester, M., Guru,S.C., Manickam, P., Olufemi, S.E., Yu, F., Heppner, C., Crabtree,J.S., Skarulis, M.C., Venzon, D.J., EmmertBuck, M.R., Spiegel,A.M., Chandrasekharappa, S.C., Collins, F.S., Burns, A.L.,Marx, S.J., Jensen, R.T., Liotta, L.A. & Lubensky, I.A. (1997a)Somatic mutations of the MEN1 tumour suppressor gene insporadic gastrinomas and insulinomas.Cancer Research, 57,4682–4686.

Zhuang, Z.P., Ezzat, S.P., Vortmeyer, A.O., Weil, R., Oldfield, E.H.,Park, W.S., Pack, S., Huang, S., Agarwal, S.K., Guru, S.C.,Manickam, P., Debelenko, L.V., Kester, M.B., Olufemi, S.E.,Heppner, C., Crabtree, J.S., Burns, A.L., Spiegel, A.M., Marx, S.J.,Chandrasekharappa, S.C., Collins, F.S., EmmertBuck, M.R., Liotta,L.A., Asa, S.L. & Lubensky, I.A. (1997b) Mutations of the MEN1tumour suppressor gene in pituitary tumours.Cancer Research, 57,5446–5451.



increased men1 mrna expression in sporadic pituitary tumours

Documents