induced pd-l1 expression mediates acquired resistance to ...€¦ · pd-1/pd-l1 axis is a viable...

Priority Brief

Induced PD-L1 Expression Mediates AcquiredResistance to Agonistic Anti-CD40 TreatmentAlfred Zippelius1,2, Jens Schreiner1, Petra Herzig1, and Philipp M€uller1

Abstract

CD40 stimulation on antigen-presenting cells (APC) allowsdirect activation of CD8þ cytotoxic T cells, independent ofCD4þ T-cell help. Agonistic anti-CD40 antibodies have beendemonstrated to induce beneficial antitumor T-cell responsesin mouse models of cancer and early clinical trials. We reporthere that anti-CD40 treatment induces programmed deathligand-1 (PD-L1) upregulation on tumor-infiltrating mono-cytes and macrophages, which was strictly dependent on T cellsand IFNg . PD-L1 expression could be counteracted by coad-ministration of antibodies blocking the PD-1 (programmeddeath-1)/PD-L1 axis as shown for T cells from tumor models

and human donors. The combined treatment was highlysynergistic and induced complete tumor rejection in about50% of mice bearing MC-38 colon and EMT-6 breast tumors.Mechanistically, this was reflected by a strong increase of IFNgand granzyme-B production in intratumoral CD8þ T cells.Concomitant CTLA-4 blockade further improved rejection ofestablished tumors in mice. This study uncovers a novelmechanism of acquired resistance upon agonistic CD40 stim-ulation and proposes that the concomitant blockade of thePD-1/PD-L1 axis is a viable therapeutic strategy to optimizeclinical outcomes. Cancer Immunol Res; 3(3); 236–44. �2015 AACR.

IntroductionCD40, a tumor necrosis factor (TNF) receptor superfamily

member, is primarily expressed on antigen-presenting cells(APC), such as dendritic cells (DC), monocytes, and B cells(1). Ligation with CD40L (CD154) results in direct activationwith upregulation of costimulatory molecules and other criticalimmune mediators (2). Agonistic anti-CD40 antibodies are ableto fully substitute for T-cell help in vivo during the activation ofCD8þ T cells and have therefore been explored for their potentialto promote antitumor immunity in murine tumor models (3–5).Beatty and colleagues (6) have demonstrated that tumor regres-sion upon systemic CD40 activation can also be mediated byinnate immunity in a T cell–independent fashion. However, itremains unclear whether these findings apply only to specificcancers or cancer models, such as pancreatic ductal adenocarci-noma, in which anti-CD40 therapy is insufficient for invokingproductive antitumor T-cell immunity (7). Promising early clin-ical trials have been conducted with different agonistic anti-CD40antibodies leading to objective and durable tumor responses inpatients suffering from melanoma, pancreatic carcinoma, andnon–Hodgkin lymphoma (8–10).

Expression of PD-1 and its cognate ligand PD-L1 within thetumor microenvironment is a major resistance mechanism to

escape immune surveillance (11). Inhibitors of the PD-1/PD-L1pathway exert potent antitumor activity in both murine tumormodels and clinical trials (12–15). Although PD-L1 is not detect-able in most normal tissues, high levels of expression can beinduced by proinflammatory cytokines, of which IFNg is themostpotent (16–18). Accordingly, upregulation of PD-L1 in melano-ma lesions from patients is mediated by immune-cell infiltrationand is mainly driven by CD8þ T cells (18, 19). Although infil-trating immune cells such as monocytes (20) or myeloid-derivedsuppressor cells (21) can contribute to PD-L1 expression withinthe tumor microenvironment, their relative contribution as com-pared with tumor cells, some of which can also express PD-L1, islargely unknown.

Here, we report that agonistic CD40 stimulation leads to animproved antitumor T-cell response, which is accompanied byIFNg-mediated PD-L1 upregulation on tumor-infiltrating mono-cytes and macrophages. We show that this resistance mechanismcan be successfully circumvented by coadministration of PD-1/PD-L1 blocking antibodies. Concomitant CTLA-4 blockade fur-ther improved the therapeutic efficacy of this combination. Ourstudy clearly highlights therapeutic strategies to augment anti-CD40–induced, tumor-infiltrating T cells by targeting coinhibi-tory pathways.

Materials and MethodsMice

C57BL/6 and Balb/c mice were obtained from Janvier Labora-tories and bred in the animal facility of the Department ofBiomedicine, University of Basel (Basel, Switzerland). All animalswere housed under specific pathogen-free conditions and inaccordance with Swiss federal regulations. Tumor cells (seebelow) were injected s.c. Perpendicular tumor diameters weremeasured using calipers and the tumor volume calculated accord-ing to the formula: D/2xd2, where D and d are the longest andshortest diameter of the tumor in millimeters, respectively.

1Cancer Immunology and Biology, Department of Biomedicine, Uni-versity Hospital Basel and University of Basel, Switzerland. 2Depart-ment of Medical Oncology, University Hospital Basel, Switzerland.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

Corresponding Authors: Philipp M€uller or Alfred Zippelius, Department ofBiomedicine, University Hospital and University of Basel, Hebelstrasse 20,CH-4031 Basel, Switzerland. Phone: 41-61-265-5074; Fax: 41-61-265-5316;E-mail: [email protected]; [email protected]

doi: 10.1158/2326-6066.CIR-14-0226

�2015 American Association for Cancer Research.

CancerImmunologyResearch

Cancer Immunol Res; 3(3) March 2015236

on January 31, 2021. © 2015 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst January 26, 2015; DOI: 10.1158/2326-6066.CIR-14-0226

http://cancerimmunolres.aacrjournals.org/

In vivo tumor models and therapeutic treatmentsEight- to 10-week-old mice were injected s.c. with 5 � 105

MC38 colon carcinoma cells (C57BL/6) in 100 mL DMEM

without phenol red into the right flank or 2.5 � 105 EMT6breast cancer cells (Balb/c) in 40 mL DMEM without phenol redinto the mammary gland. On days 16, 18, 21, and 24 after

Figure 1.Agonist anti-CD40 induced antitumor responses and PD-L1 upregulation. A, expression of CD40 in MC38 tumor cells from tissue culture and whole MC38 tumorsas analyzed by RT-PCR. B, gating strategy: CD45þCD11bþ cells from MC38 tumors were stained for Ly6C and Ly6G (left) as well as F4/80 (Ly6C low cells, right).C, CD40 expression on monocytes and TAMs gated according to B. An isotype control antibody and tumors from CD40-deficient mice were used ascontrol. D, treatment response of MC38 tumors upon administration of agonist anti-CD40 antibodies. Mice were sacrificed when tumors reached the sizeof 1,500 mm3. E, upregulation of PD-L1 on monocytes and TAMs following agonist anti-CD40 treatment. Representative histograms are shown. Independentexperiments were performed at least two times. Tumor survival curves are representative of three independent, pooled experiments (n ¼ 15–16/group). Allexperiments were performed using the MC38 model. TAM, tumor-associated macrophage.

PD-L1 Blockade Overcomes Resistance to Anti-CD40 Therapy

www.aacrjournals.org Cancer Immunol Res; 3(3) March 2015 237




Zippelius et al.

Cancer Immunol Res; 3(3) March 2015 Cancer Immunology Research238




tumor challenge, mice were treated with 5 mg/kg anti-CD40(1C10; mIgG1; produced at Evitria) and/or 12.5 mg/kg anti–PD-L1 (10F.9G2; rat IgG2b; BioXCell) and/or 12.5 mg/kg anti-PD-1 (RMP1-14; rat IgG2a; BioXCell) and/or 12.5 mg/kg anti–CTLA-4 (9D9; mouse IgG2b; BioXCell) as indicated in thefigures. Tumor volume was measured three times/week asdescribed above. For MC38 rechallenge, mice were injectedwith 1 � 106 MC38 tumor cells in 100 mL DMEM withoutphenol red into the left flank. Na€�ve mice were used as controls.

Cell linesThe murine tumor cell lines MC38 and EMT6 were obtained

from Mark Smyth (Peter MacCallum Cancer Centre, East Mel-bourne, VIC, Australia) and ATCC, respectively. Cells werecultured in DMEM (Sigma) supplemented with 10% heat-inactivated FBS, sodium pyruvate, penicillin/streptomycin,L-glutamine, MEM nonessential amino acids, Ciproxin (Bayer),and 0.05 mmol/L 2-mercaptoethanol. All cell lines were testedand validated to be mycoplasma free; no genomic authenticationwas performed.

RT-PCRRT-PCR was performed using the Go Taq qPCR Master Mix

(Promega) on a ViiA 7 Real-Time PCR System. HPRT was used ashousekeeping gene for control. The following primers were usedto amplify and detect CD40 cDNA: gagtcagactaatgtcatctgtggtt andaccccgaaaatggtgatg.

Antibodies and reagentsThe following human mAbs were used for flow cytometry:

CD4-PE, CD8-FITC, CD25-APC, HLA-DR-eFluor450 (alleBioscience), PD-1-PE-Cy7, PD-L1-PE (both from BD), andCD14-BV605 (Biolegend). Antibodies were from BD, Biole-gend, and eBioscience. The following murine mAbs were usedfor flow cytometry: CD3-PE-Cy7, CD4-BV421, CD4-PE-Cy7,CD8-BV605, CD11b-FITC, CD11c-FITC, CD11c-APC, CD19-PE, CD40-PE, CD45-PerCP, CTLA-4-PE, Ly-6C-BV605, Ly-6G-PE-Cy7, NK1.1-BV421, PD-L1-PE (all BD), F4/80-BV421, Gran-zyme B-Alexa647 PD-L1 BV421, PD-L1-APC, TCR-g/d-APC (allBiolegend), FoxP3-Alexa647, IFNg-APC, and TCR-g/d-PE (alleBioscience). The live/dead fixable near-infrared dye (Invitro-gen) was used to exclude dead cells. Either carboxyfluoresceinsuccinimidyl ester (CFSE) or Cell Proliferation Dye eFluor670(both eBioscience) was used for the determination of T-cellproliferation. The therapeutic antibodies used in studiesreported in this article are described in the Methods sectionsof the corresponding studies.

Analysis of tumor-infiltrating lymphocytesEight- to 10-week-old C57BL/6mice were injected s.c. with 5�

105 MC38 tumor cells in 100 mL DMEM without phenol red intothe right flank. On days 16, 18, 20, and 22 after tumor challenge,

mice were treated with 5 mg/kg anti-CD40 (1C10; mIgG1; pro-duced at Evitria) and/or 12.5 mg/kg anti–PD-L1 (10F.9G2; ratIgG2b; BioXCell). On day 24, mice were euthanized, and tumorsweremechanically dissociated and digested using accutase (PAA),collagenase IV (Worthington), hyaluronidase (Sigma), andDNAse type IV (Sigma). Single-cell suspensions were preparedand stained against the indicated markers for flow cytometricanalysis. For detection of IFNg-producing cells, single-cell pre-parations were cultured overnight in the presence of anti-CD3/CD28 antibodies and monensin (Biolegend).

Polyclonal human T-cell activationCD4þ and CD8þ T cells were isolated from peripheral blood

mononuclear cells (PBMC) obtained from healthy blood donors(Blood Transfusion Center, University Hospital, Basel) by CD4 orCD8 microbeads (Miltenyi Biotech). Anti-CD3e (Clone OKT3;Biolegend) was coated onto 96-well plates by overnight incuba-tion of a 10-mg/mL solution. For polyclonal stimulation, 1� 105

CD4þ or CD8þ T cells were cultured in anti–CD3e-coated wellswith the addition of soluble anti-CD28 (2 mg/mL; Clone 28.2;eBioscience). For IFNg neutralization, anti-IFNg was added to theculture (20 mg/mL; Clone NIB42; eBioscience). After 24 hours,CD14þ monocytes isolated by CD14 microbeads (Miltenyi Bio-tech) from PBMCs were added. After a further 24 hours ofcultivation, PD-L1 expression on monocytes, identified asCD14þ cells, was determined by flow cytometry.

Mixed lymphocyte reactionMonocytes purified from PBMCs provided by healthy blood

donors were isolated by plastic adherence and cultured for 6 daysin the presence of 50 ng/mL recombinant human GM-CSF and250U/mL recombinant human IL4 (rhIL4, both fromPeprotech).Day-6 humanmonocyte-derived DCs (moDC) were plated in 96-well round-bottomed plates (1 � 104 cells/well) and stimulatedwith anti-CD40 (10 mg/mL; RO7009789; previously known asCP-870,893) for 48 hours. Anti–PD-L1 (10 mg/mL; Clone29E.2A3; Biolegend) was added as indicated. PD-1–positive andPD-1–negative CD4þ T cells were isolated by FACS sorting,labeled with the cell proliferation dye eFluor670 (eBioscience),and added to the culture (1 � 105 cells/well) as indicated. After5 days of dilution of the proliferation dye in the gated CD4þ, theT-cell population was measured by flow cytometry.

ResultsAgonistic anti-CD40 induced antitumor responses and PD-L1upregulation on tumor-infiltrating monocytes andmacrophages

Tumors were obtained by s.c. inoculation of MC38 colonadenocarcinoma cells, which do not express CD40; of note, thisexcludes direct or ADCC-mediated killing ofMC38 tumor cells byCD40-targeting antibody therapy. Expression of CD40 wasdetected in MC38 tumors but not in MC38 tumor cells from

Figure 2.T-cell and IFNg dependence of PD-L1 upregulation in mice. A, depletion of T cells by i.p. injection of anti-CD4– and anti-CD8–specific antibodies in thecontext of agonist anti-CD40 therapy. Mice were sacrificed when tumors reached the size of 1,500mm3. B, T-cell depletion as described for A completely annihilatesagonist anti-CD40–induced PD-L1 upregulation, on both monocytes and TAMs. C and D, lack of IFNg signaling in IFNgR-deficient mice (C) or upon neutralizationusing IFNg-specific, neutralizing antibodies (D) phenocopies the effects of T-cell depletion on PD-L1 upregulation as described under B. Representativehistograms are shown. Independent experiments were performed at least two times. Tumor survival curves are representative of two independent, pooledexperiments (n ¼ 12/group). All experiments were performed using the MC38 model. TAM, tumor-associated macrophage.






Zippelius et al.





tissue culture using RT-PCR normalized to two different house-keeping genes (Fig. 1A and Supplementary Fig. S1A). Importantly,CD40 was not detected on CD45� cells in MC38 tumors (Sup-plementary Fig. S1B). Indeed, as CD40 is primarily expressed onAPCs (1), expression of CD40 could be readily observed onmonocytes (defined as CD11bþLy6ChighLy6Glow) and tumor-associated macrophages (TAM; defined as CD11bþLy6ClowLy6-GlowF4/80þ) by flow cytometry (Fig. 1B and C). CD40�/� miceserved as negative control. Treatment of MC38 tumor-bearingmice with the agonistic anti-CD40 antibody 1C10 (22) statisti-cally significantly (P < 0.0001; log-rank test), though modestly,prolonged survival compared with the control group of mock-treated mice (Fig. 1D). These data suggest that tumor-infiltratingmonocytes and macrophages may play an important role duringanti-CD40 therapy. Importantly, administration of 1C10 led to astrong increase in PD-L1 expression both on tumor-infiltratingmonocytes and TAMs (Fig. 1E), but not on theCD45� cell fractioncontaining MC38 tumor cells (Supplementary Fig. S1C). Further-more, PD-1 was upregulated upon anti-CD40 treatment both onCD8þ and CD4þ T cells (Supplementary Fig. S1D and S1E). Theincrease of both PD-L1 and PD-1 expression may impair thecapacity of 1C10 to promote robust antitumor T-cell responsesand provide an explanation for the limited efficacy of 1C10monotherapy in the MC38 model.

Upregulation of PD-L1 is T cell– and IFNg-dependentDepletion of T cells in anti–CD40-treated MC38 tumor-

bearing mice completely eliminated the therapy-induced survivalbenefit (Fig. 2A), providing evidence for a T cell–dependentimmune mechanism in this tumor model. Intriguingly, the upre-gulation of PD-L1 on tumor-infiltrating monocytes and macro-phages following anti-CD40 treatment was completely abrogatedwhen T cells were depleted (Fig. 2B). Similar results were obtainedusing IFNgR�/� mice (Fig. 2C) or IFNg-neutralizing antibodies(Fig. 2D). Of note, untreated IFNgR�/� mice—and, to a lesserextent, CD40�/�mice (Supplementary Fig. S2A and S2B)—exhib-it a lower basal expression of PD-L1 on tumor-infiltrating mono-cytes and macrophages compared with wild-type mice. Thisfinding in IFNgR�/� mice indeed suggests that intratumoralIFNg-secreting T cells also contribute to PD-L1 expression duringtumor growth and development; PD-L1 did not increase duringanti-CD40 agonist treatment (Fig. 2C).

Overcoming agonistic anti-CD40–induced resistance byimmune checkpoint blockade

PD-L1 upregulation upon treatment with agonistic anti-CD40antibodies might be a major limiting factor for the efficacy of theinduced antitumor T-cell response and a potential mechanism ofacquired resistance. To this end, we concomitantly treated MC38tumor-bearing mice with the agonistic anti-CD40 antibody 1C10

and a PD-L1–blocking antibody, which resulted in completetumor rejection in >50% of the mice, whereas anti-CD40 treat-ment alone led to tumor rejection only in <5% of the mice(Fig. 3A; Supplementary Fig. S2C). Administration of anti–PD-L1 as monotherapy led to prolonged survival but did notinduce rejection of tumors (Supplementary Fig. S2C). Thesedata demonstrate that PD-L1 blockade strongly enhances anti–CD40-induced antitumor immunity by overcoming resistancemediated by PD-L1 upregulation. The combination of anti–CD40- and anti–PD-L1-induced immunologic memory forma-tion as tumor-free survivors were protected upon rechallengewithMC-38 tumor cells, while all na€�ve controlmice developed tumors(Fig. 3B). Compared with controls and mice receiving anti-CD40monotherapy, flow cytometry–based analysis of tumor-infiltrat-ing immune cells revealed a relative and predominant increase ofCD8þ T cells in mice receiving the combination therapy, whereasthe proportion of regulatory T cells (Treg, defined as CD45þ

CD11b�CD11c�Ter119�CD4þFoxP3þ) declined and thereforethe CD8:Treg ratio increased (Fig. 3C; Supplementary Fig.S2D). When analyzing the functional characteristics of CD8þ Tcells, we found a strong increase in IFNg and granzyme B pro-duction (Fig. 3D and E).

We independently confirmed the synergistic interaction ofagonistic anti-CD40 with blocking anti–PD-L1 using a secondtumor model. To this end, Balb/c mice were orthotopicallyinjected with the breast cancer cell line EMT-6 and treated asdescribed for Fig. 3A–F.

Owing to their distinct immunologic mechanisms of action,concomitant blockade of PD-1 and CTLA-4 has shown superiortherapeutic activity in patients with melanoma as compared witheither of the antibodies alone (23). Intriguingly, we have noticedan increase in the frequency of CTLA-4–expressing CD8þ T cells(Supplementary Fig. S1F and S1G) upon agonistic anti-CD40treatment. We have, therefore, in a last experimental effort,assessed rejection of MC38 tumors by applying therapeutic com-binations of agonistic anti-CD40 with CTLA-4/PD-L1 as well asCTLA-4/PD-1 blocking antibodies (Fig. 3G). When combiningboth anti–PD-L1 and anti–CTLA-4 with anti-CD40 treatment,more than 90%of tumorswere rejected (Fig. 3G). Importantly, wehave noted no toxicity in any treatment group. Replacement ofanti–PD-L1 with anti–PD-1 yielded similar results (Fig. 3G),indicating that blocking either of the components of the PD-1/PD-L1 axis, at least in this model, is an equivalent therapeuticoption when combined with anti-CD40.

CD40 stimulation and concomitant PD-L1 blockade recoversT-cell function in human T cells

To investigate whether T-cell activation and the subsequentcytokine secretion lead to PD-L1 upregulation on human mono-cytes, we performed a polyclonal stimulation of CD8þ and CD4þ

Figure 3.Overcoming agonist anti-CD40–induced resistance by immune checkpoint blockade. A, survival experiments using the indicated treatments were performed.Mice were sacrificed when tumors reached the size of 1,500 mm3. B, tumor-free survivors from A were rechallenged with 1 � 106 MC38 tumor cells injected s.c.into the contralateral flank (as compared with the initial tumor cell injection). Na€�ve mice were used as control. C, tumor stroma analysis of the indicatedtreatment groups using FACS. Pooled data from three independent experiments are shown (n ¼ 15–17). Results are given as a percentage of total CD45þ cells.D, whole tumor digests were restimulated overnight in the presence of anti-CD3/CD28 antibodies and Monensin and stained for T-cell markers as wellas IFNg . E, tumor-infiltrating T cells were stained for granzyme B. Dot blots are representative of two independent experiments. Data summaries are based onpooled data from two independent experiments (n ¼ 10–12; one-way ANOVA). F and G, survival experiments using the indicated treatments were performed.Mice were sacrificed when tumors reached the size of 1,500 mm3. Tumor survival curves are representative of at least three independent, pooled experiments(n ¼ 17 or more mice/group); A–E and G, MC38; F, EMT6.






Figure 4.T-cell and IFNg dependence of PD-L1upregulation in human monocytes. A,polyclonal in vitro stimulation of CD4þ andCD8þ human T cells isolated from PBMCsinduced PD-L1 upregulation on CD14þ

monocytes, which could be largelyannihilated by the addition of neutralizinganti-IFNg antibody. B, a mixed lymphocytereaction with monocyte-derived DCs andsorted PD-1þ or PD-1� CFSE–labeled CD4þ

T cellswas performed. Agonistic anti-CD40and anti–PD-L1 antibodies were added asindicated. Dilution of CFSE as a marker ofproliferation was determined by flowcytometry. One representative out of threeindependent experiments with similarresults is shown. C, supernatants fromB were analyzed for IFNg using ELISA.Statistically significant differences (one-way ANOVA with Bonferroni post-test)are indicated: � , P < 0.05; �� , P < 0.005;�� , P < 0.001. n.s., not statisticallysignificant.


Zippelius et al.




T cells isolated from PBMCs of healthy human donors andcocultured them with CD14þ monocytes. T-cell activation andthe subsequent IFNg production led to a strong upregulationof PD-L1 on human monocytes, which could be largely dimin-ished by IFNg neutralization (Fig. 4A). These data confirmthat, comparable with the mouse tumor model, PD-L1 upregula-tion following human T-cell activation also largely depends onIFNg . Subsequently, to analyze whether a blocking antibodyagainst human PD-L1 is able to overcome secondary resistanceinduced by an agonistic antibody against CD40 (8), we testedboth antibodies in a human mixed lymphocyte reaction usingmoDCs and PD-1–expressing or PD-1� CD4þ T cells sorted fromwhole PBMCs by flow cytometry. Coadministration of anti–PD-L1 significantly increased the anti–CD40-induced proliferationand IFNg secretion of PD-1þ but not of PD-1� T cells (Fig. 4Band C). Utilizing human PBMCs, these results clearly confirm apotential synergistic activity of agonistic anti-CD40 and blockinganti–PD-L1 treatment.

DiscussionAlthough initial phase I studies of agonistic anti-CD40 mono-

therapy have demonstrated objective tumor responses in solidtumors (8), possibly the greatest potential for these drugs lies inthe combination with other therapeutic agents. The combinationof anti-CD40 agonists with chemotherapy (e.g., tumor-cell killingresults in the release of tumor antigens) may lead to therapeuticsynergies, as indicated by recent phase I clinical trials (24, 25). Wepropose here that antitumor T-cell responses induced and/orstrengthened by CD40 stimulation can be greatly improved bytargeting the PD-1/PD-L1 axis.

We found that CD40 engagement with agonistic antibodiesleads to a T cell– and IFNg-dependent upregulation of PD-L1 ontumor-infiltrating monocytes and macrophages, thereby feedinginto a negative feedback loop, which hampers anti–CD40-induced T-cell responses. A high level of PD-L1 expression onmonocytes and macrophages in peritumoral stroma has beenassociated with high mortality and reduced survival in patientswith cancer, as these monocytes effectively suppressed tumor-specific T-cell immunity (20), supporting the clinical relevance ofthe MC38 tumor model. Our data are in accordance with recentdata from murine melanoma models showing an IFNg-depen-dent upregulation of PD-L1 expression following CD8þ T-cellinfiltration (18) or immune-cell infiltration in general (19). Usingantibodies targeting the PD-1/PD-L1 axis in anti–CD40-treatedmice, we were able to overcome PD-L1–mediated secondaryresistance and improve T-cell function. In our tumor model,PD-L1 expression was largely restricted to immune cells, thoughin other models and, importantly, patients with cancer, PD-L1may be induced on tumor cells. Clearly, translational studies

need to be performed in future clinical trials to assess PD-L1expression upon treatment with CD40 agonistic antibodies inpatients. Importantly, using in vitro stimulation of human Tcells, we demonstrated that a profound improvement of T-cellfunction could be achieved using concomitant CD40 activationand PD-L1 blockade. This suggests that a similar benefit may beachieved in patients with cancer. By integrating CTLA-4–block-ing antibodies into the anti-CD40/PD-L1 and anti-CD40/PD-1treatment regimen, we were able to further enhance durabletumor rejection.

Although a clinical trial evaluating the agonistic anti-CD40antibody RO7009789 in combination with the CTLA-4–blockingantibody tremelimumab is currently under way at the Universityof Pennsylvania, to our knowledge, a combinationwithPD-1/PD-L1–blocking antibodies has not yet been attempted in patientswith cancer. Our data clearly provide a strong rationale for thecombination of these antibodies, which could be rapidly tested ina clinical setting.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: A. Zippelius, P. M€ullerDevelopment of methodology: A. Zippelius, J. Schreiner, P. M€ullerAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A. Zippelius, J. Schreiner, P. Herzig, P. M€ullerAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A. Zippelius, J. Schreiner, P. M€ullerWriting, review, and/or revision of the manuscript: A. Zippelius, J. Schreiner,P. M€ullerAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): A. Zippelius, P. HerzigStudy supervision: A. Zippelius, P. M€ullerOther (acquisition of funding): P. M€uller

AcknowledgmentsThe authors thank Melanie Buchi and Yvonne Fink for excellent technical

assistance with the mouse experiments and RT-PCR, respectively; Acuna Gon-zalo, Christian Klein, and Martin Stern (Roche Glycart) for providing theagonistic anti-human-CD40 antibody (RO7009789); Mark Smyth for provid-ing the MC38 tumor cell line; and Jeffrey Ravetch for providing the anti-mouse-CD40 (1C10) expression construct.

Grant SupportThis work was supported by grants from the Swiss National Science Foun-

dation, the Sassella Foundation, the Wilhelm-Sander Foundation, the CancerLeague Basel, and the FAG Basel.

Received December 3, 2014; revised January 9, 2015; accepted January 12,2015; published OnlineFirst January 26, 2015.

References1. Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Ann

Rev Immunol 1998;16:111–35.2. Vonderheide RH, Glennie MJ. Agonistic CD40 antibodies and cancer

therapy. Clin Cancer Res 2013;19:1035–43.3. French RR, Chan HT, Tutt AL, Glennie MJ. CD40 antibody evokes a

cytotoxic T-cell response that eradicates lymphoma and bypasses T-cellhelp. Nat Med 1999;5:548–53.

4. Todryk SM, Tutt AL, Green MH, Smallwood JA, Halanek N, Dalgleish AG,et al. CD40 ligation for immunotherapy of solid tumours. J ImmunolMethods 2001;248:139–47.

5. Elgueta R, Benson MJ, de Vries VC, Wasiuk A, Guo Y, Noelle RJ. Molecularmechanism and function of CD40/CD40L engagement in the immunesystem. Immunol Rev 2009;229:152–72.

6. Beatty GL, Chiorean EG, Fishman MP, Saboury B, Teitelbaum UR,Sun W, et al. CD40 agonists alter tumor stroma and show efficacyagainst pancreatic carcinoma in mice and humans. Science 2011;331:1612–6.

7. Vonderheide RH, Bajor DL, Winograd R, Evans RA, Bayne LJ, Beatty GL.CD40 immunotherapy for pancreatic cancer. Cancer Immunol Immun-other 2013;62:949–54.






8. Vonderheide RH, Flaherty KT, Khalil M, Stumacher MS, Bajor DL, HutnickNA, et al. Clinical activity and immune modulation in cancer patientstreated with CP-870,893, a novel CD40 agonist monoclonal antibody. JClin Oncol 2007;25:876–83.

9. de Vos S, Forero-Torres A, Ansell SM, Kahl B, ChesonBD, Bartlett NL, et al. Aphase II study of dacetuzumab (SGN-40) in patients with relapsed diffuselarge B-cell lymphoma (DLBCL) and correlative analyses of patient-specificfactors. J Hematol Oncol 2014;7:44.

10. Khubchandani S, Czuczman MS, Hernandez-Ilizaliturri FJ. Dacetuzumab,a humanized mAb against CD40 for the treatment of hematologicalmalignancies. Curr Opin Invest Drugs 2009;10:579–87.

11. Zou W, Chen L. Inhibitory B7-family molecules in the tumour microen-vironment. Nat Rev Immunol 2008;8:467–77.

12. Sakuishi K, Apetoh L, Sullivan JM, Blazar BR, Kuchroo VK, Anderson AC.Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restoreanti-tumor immunity. J Exp Med 2010;207:2187–94.

13. Ansell SM, Lesokhin AM, Borrello I, Halwani A, Scott EC, GutierrezM, et al.PD-1 blockade with nivolumab in relapsed or refractory Hodgkin's Lym-phoma. N Engl J Med 2015;372:311–9.

14. Robert C, Long GV, Brady B, Dutriaux C, Maio M, Mortier L, et al.Nivolumab in previously untreated melanoma without BRAF mutation.N Engl J Med 2015;372:320–30.

15. Powles T, Eder JP, Fine GD, Braiteh FS, Loriot Y, Cruz C, et al. MPDL3280A(anti-PD-L1) treatment leads to clinical activity in metastatic bladdercancer. Nature 2014;515:558–62.

16. Liang SC, Latchman YE, Buhlmann JE, TomczakMF, Horwitz BH, FreemanGJ, et al. Regulation of PD-1, PD-L1, and PD-L2 expression during normaland autoimmune responses. Eur J Immunol 2003;33:2706–16.

17. Dong H, Strome SE, Salomao DR, Tamura H, Hirano F, Flies DB, et al.Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mecha-nism of immune evasion. Nat Med 2002;8:793–800.

18. Spranger S, Spaapen RM, Zha Y, Williams J, Meng Y, Ha TT, et al. Up-regulation of PD-L1, IDO, and T(regs) in the melanoma tumor micro-environment is driven by CD8(þ) T cells. Sci Transl Med 2013;5:200ra116.

19. Taube JM, Anders RA, Young GD, Xu H, Sharma R, McMiller TL,et al. Colocalization of inflammatory response with B7-h1expression in human melanocytic lesions supports an adaptiveresistance mechanism of immune escape. Sci Transl Med 2012;4:127ra37.

20. Kuang DM, Zhao Q, Peng C, Xu J, Zhang JP, Wu C, et al. Activatedmonocytes in peritumoral stroma of hepatocellular carcinoma fosterimmune privilege and disease progression through PD-L1. J Exp Med2009;206:1327–37.

21. Deng L, Liang H, Burnette B, Beckett M, Darga T, Weichselbaum RR, et al.Irradiation and anti-PD-L1 treatment synergistically promote antitumorimmunity in mice. J Clin Invest 2014;124:687–95.

22. Li F, Ravetch JV. Inhibitory Fcgamma receptor engagement drives adjuvantand anti-tumor activities of agonistic CD40 antibodies. Science 2011;333:1030–4.

23. Wolchok JD, Kluger H, CallahanMK, PostowMA, Rizvi NA, Lesokhin AM,et al. Nivolumab plus ipilimumab in advanced melanoma. N Engl J Med2013;369:122–33.

24. Vonderheide RH, Burg JM, Mick R, Trosko JA, Li D, Shaik MN, et al. Phase Istudy of the CD40 agonist antibody CP-870,893 combined with carbo-platin and paclitaxel in patients with advanced solid tumors. Oncoimmu-nology 2013;2:e23033.

25. Beatty GL, Torigian DA, Chiorean EG, Saboury B, Brothers A, Alavi A,et al. A phase I study of an agonist CD40 monoclonal antibody(CP-870,893) in combination with gemcitabine in patients withadvanced pancreatic ductal adenocarcinoma. Clin Cancer Res 2013;19:6286–95.


Zippelius et al.




2015;3:236-244. Published OnlineFirst January 26, 2015.Cancer Immunol Res Alfred Zippelius, Jens Schreiner, Petra Herzig, et al. Agonistic Anti-CD40 TreatmentInduced PD-L1 Expression Mediates Acquired Resistance to

Updated version

10.1158/2326-6066.CIR-14-0226doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2015/01/23/2326-6066.CIR-14-0226.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/3/3/236.full#ref-list-1

This article cites 25 articles, 9 of which you can access for free at:

Citing articles

http://cancerimmunolres.aacrjournals.org/content/3/3/236.full#related-urls

This article has been cited by 20 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/3/3/236To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-14-0226

http://cancerimmunolres.aacrjournals.org/content/suppl/2015/01/23/2326-6066.CIR-14-0226.DC1

http://cancerimmunolres.aacrjournals.org/content/3/3/236.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/content/3/3/236.full#related-urls

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/3/3/236


induced pd-l1 expression mediates acquired resistance to ...€¦ · pd-1/pd-l1 axis is a viable...

Documents