Alshammari, G. and Khan, Raheela and Brameld, John M. and Amer, Saad A. and Lomax, Michael A. (2017) Gene expression of inflammatory markers in adipose tissue between obese women with polycystic ovary and normal obese women. European Review for Medical and Pharmacological Sciences, 21 (5). pp. 1099-1105. ISSN 2284-0729

Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/41529/1/PCOS%20gene%20expression%20%28Alshammari%20et%20al%2C%202017%29.pdf

Copyright and reuse:

The Nottingham ePrints service makes this work by researchers of the University of Nottingham available open access under the following conditions.

This article is made available under the University of Nottingham End User licence and may be reused according to the conditions of the licence. For more details see: http://eprints.nottingham.ac.uk/end_user_agreement.pdf

A note on versions:

The version presented here may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the repository url above for details on accessing the published version and note that access may require a subscription.

For more information, please contact eprints@nottingham.ac.uk

mailto:eprints@nottingham.ac.uk

Abstract. – OBJECTIVE: The pathogenesis ofpolycystic ovary syndrome (PCOS), a commonendocrine disease and metabolic disturbance, isstill unknown. The aim of the study was to inves-tigate whether patients with PCOS display in-creased expression of inflammatory markers inadipose tissue.

PATIENTS AND METHODS: Two groups ofwomen were investigated, those diagnosed withPCOS (n = 8) and age and BMI-matched normalwomen (n = 12). Their age was between 20-45years and all subjects were apparently healthyand did not take any medications. Adipose tis-sue levels of mRNA of inflammatory markerswere determined by use of real-time PCR.

RESULTS: There were no differences betweenobese patients and obese PCOS in levels ofadipocytokines.

CONCLUSIONS: There were no effects ofPCOS on the expression of any of the adipocy-tokines genes measured in subcutaneous adi-pose tissue.

Key Words:Polycystic ovary syndrome, Insulin resistance, In-

flammation.

Introduction

The pathogenesis of polycystic ovary syn-drome (PCOS), a common endocrine disease andmetabolic disturbance, is still unknown. A linkbetween disturbed adipokines secretions and type2 diabetes in PCOS has previously been shown,and several studies indicate that the incidence ofinsulin resistance in PCOS women is related tothe levels of adipokines in the blood1. There is in-creasing evidence that the expression of some

European Review for Medical and Pharmacological Sciences

Gene expression of inflammatorymarkers in adipose tissue betweenobese women with polycystic ovaryand normal obese women

G. ALSHAMMARI1, R. KHAN3, J. BRAMELD2, S. AMER3, M.A. LOMAX2

1Adipocytes Research Lab, Department of Food Science and Nutrition, College of Food andAgriculture Sciences, King Saud University, Riyadh, Saudi Arabia2School of Bioscience, Nutritional Science Division, University of Nottingham, UK3School of Medicine and Health Sciences, Royal Derby Hospital, University of Nottingham, UK

Corresponding Author: Ghedeir M Alshammari, Ph.D; e-mail: aghedeir@ksu.edu.sa 1099

genes associated with insulin resistance could beaffected by high levels of testosterone (T) inPCOS2. Many studies report that dysfunction ofadipose tissue might be involved in the patho-genesis of PCOS3,4. Patients with PCOS havelow-grade inflammation characterized by highlevels of tumor necrosis factor alpha (TNF-α)and interlukin-6 (IL-6)5,6. Recently, studies havefocused on adipose tissue morphology in PCOSpatients and tried to discover the link betweenadiponectin secreted from adipocytes and insulinresistance7. High levels of androgens are thoughtto impact on adipose tissue function and distribu-tion in women with PCOS8. Previous researcheshave suggested that the molecules released byadipocytes, such as adiponectin, resistin, leptin,TNF-α and IL-6, are crucial factors in the pathol-ogy of PCOS and can be influenced by estrogensand androgens9-12. However, some investigationshave suggested that the role of adipokines in thepathogenesis of PCOS is more complicated1. Theeffects of raised T levels in PCOS could be di-rectly on the expression of adipokines secretedby adipocytes, such as adiponectin and resistin,which affect insulin resistance. These adipokinesand cytokines are stimulated by other cytokinesreleased by macrophages such as TNF-α and IL-613,14. We suggested that excess testosterone inthe blood of women with PCOS alters the ex-pression of adipocytokines involved in insulin re-sistance in subcutaneous fat tissue. To compareexpression of adipokines that play an importantrole in insulin resistance in subcutaneous fat tis-sue from women suffering from hyperandro-genism (PCOS) and normal women at a similarage and BMI.

2017; 21: 1099-1105

1100

G. Alshammari, R. Khan, J. Brameld, S. Amer, M.A. Lomax

tase buffer, Nucleotides, RNase inhibitor, MMLVreverse transcriptase, and RNase water wereadded. All of them were mixed and spined downthen incubated at room temperature for 10 minthen returned into PCR machine to incubate themat 42°C for 60 min. All the mRNA of treatedcells was investigated by RT-PCR. All cDNAsamples were mix with SYBR Green I master(containing HotStarTaq DNA polymerase, Quan-tiTectSYBR Green PCR Buffer, dNTP mix andSYBR Green I) and mixed with 1.25 µL of eachprimer. The sequences of all genes investigatedare listed on Table l.

Statistical AnalysisTo compare the effects of PCOS on gene ex-

pression of Inflammatory Markers in adipose tis-sue, one-way ANOVA was performed by SPSS21 (SPSS Inc., Chicago, IL, USA). Data were ex-pressed as mean ± SEM and considered signifi-cant where p < 0.05.

Results

All women with PCOS have polycysticovaries, and the majority also had clinical or bio-chemical hyperandrogenism among overweightpatients with PCOS compare to normal patients.Baseline characteristics of the study populationare shown in Table II. Both the overweight pa-tients with PCOS and normal patients were at asimilar age. In comparison with normal patients,patients with PCOS had increased serum concen-trations of free androgen index, LH, and testos-terone (p-value = 0.042, < 0.001, 0.004 respec-tively).Expression of almost of genes involved in in-

sulin resistance directly or indirectly such asadiponectin, resistin, TNF-α, IL-6, Peroxisomeproliferator-activated receptor gamma (PPARg),CCAAT-enhancer-binding proteins (C/EBP al-pha), rantes, omentin, visfatin, MCP-1 and leptinwere done by RT-PCR in the subcutaneous adi-pose tissue. There is no significant difference be-tween normal patients compare with PCOS pa-tients in all genes mentioned above. In term ofadipogenesis markers PPARg and C/EBP alpha,both are similar in two groups. There were nodifferences between obese patients with obesePCOS in levels of adipose tissue mRNA foradiponectin and as well as the Figure 1 showsthat a big variation between the groups in gene

Patients and Methods

PatientsTwo groups of women were investigated, those

diagnosed with PCOS (n=8) and age and BMI-matched normal women (n=12). Their age wasbetween 20-45 years and all subjects were appar-ently healthy and did not take any medication.None of the subjects was postmenopausal andthey all gave their consent to provide samples ofsubcutaneous adipose tissue. Height and weightwere obtained and BMI calculated. The weightof collected samples did vary and was dependenton both the patients and the surgical conditions.All samples were immediately frozen in liquidnitrogen and stored at -80°C until total RNA iso-lation.

Criteria Considered For Screening andDiagnosis of PatientsThis work was carried out with women of re-

productive age, with BMI between 16.5 and 36.6kg/m2. Twenty hirsute women presenting oli-go/amenorrheic cycles, increased levels of serumT or free androgen index (FAI), and/or polycysticovaries, without other disorders causing hir-sutism were enrolled.

Fat BiopsiesFollowing general anesthesia, 1.5 cm2 of su-

perficial subcutaneous of adipose tissue was ex-cised through a 1.5 cm incision. The fat biopsieswere placed into vials and snap frozen in liquidnitrogen and stored at -80°C until assayed.

RNA ExtractionTotal RNA was extracted from subcutaneous

adipose tissue (100-150 mg) using Trizol (Invit-rogen Corp., Carlsbad, CA, USA), followed bytested the quality of RNA. cDNA was synthe-sized from 500 ng of total RNA and prepare realtime poly chain reaction (RT-PCR) steps. For cD-NA synthesis, the pellets were dried for 10 minthen RNA quality was assessed with a nanodropmachine. The absorbance of 1.5 µL from eachsample was determined spectrophotometrically at260 nM and 280 nM against a water blank at 260nM. The ratio of purity of RNA was between theabsorbance at 260 and 280 nM ranged from 1.8to 2. 100 ng/µL for each sample was calculatedby adding RNase-free water. To complete cDNAsynthesis, random primer, H2O were added andincubated at 70°C for 5 min in PCR machine.The following mixture MMLV reverse transcrip-

Gene Primer sequence (5′→3′)

PPARg Re GAGGGAGTTGGAAGGCTCTTCFw GATCCAGTGGTTGCAGATTACAA

C/EBPa Re CGCACATTCACATTGCACAAFw CAAATATTTTGCTTTATCAGCCGATA

Adiponectin Re CTTAGGACCAATAAGACCTGGATCTCFw GGCCTGCACAGGTTGGAT

Resistin Re GGATCCTCTCATTGATGGCTTCTFw GCGCCTGCAGGATGAAAG

IL-6 Re CGTCAGCAGGCTGGCATTFw CTGCAGAAAAAGGCAAAGAATCTAG

TNF-α Re GGTTTGCTACAACATGGGCTACAFw CCCAGGGACCTCTCTCTAATCA

MCP-1 Re GCCTCTGCACTGAGATCTTCCTFw GCTCAGCCAGATGCAATCAA

Rantase Re TGTACTCCCGAACCCATTTCTTFwACCCAGCAGTCGTCTTTGTCA

Leptin Re TGAGGGTTTTGGTGTCATCTTGFw TGGCTTTGGCCCTATCTTTTC

Visfatin Re CCAGGACTGAACAAGAATAGTCTCAATFw TGTTCCTGAGGGCTTTGTCAT

Omentin Re GGAAAGTATCCTCCTCCACCAAFw GCAGCCAACGCCTTGTGT

Cyclophillin Re CGTAGTGCTTCAGTTTGAAGTTCTCAFw GGAGATGGCACAGGAGGAAA

Table I. Primer Sequences Used for RT-PCR.

Subject characteristics Normal atients (n = 12) PCOS patients (n = 8) p-value

Age(years) 34.6 (28-45) 35.7 (22-45) 0.699Testosterone nmol/l 1.14 (0.6-1.5) 2.1 (1.4-2.9) 0.004FSH iu/l 6.86 (4.7-10.0) 6.7 (4.5-9.6) 0.884FAI 0.8 (0.4-1.3) 1.78 (1.0-3.0) 0.042LH iu/l 2.4 (1.2-3.6) 14.122 (6.3-21.0) < 0.001

Table II. Clinical characteristics of women in a study of markers of adipose tissue inflammation in relation to PCOS.

expression of resistin. TNF-α and IL-6 expres-sion did not differ between the groups and aswell as Leptin and Visfatin, whereas MCP-1 geneexpression was decreased in PCOS patient com-pared to normal patients but not significant. Incontrast, Omentin-1 was increased 5 folds in anormal patient, but due to a big standard error itis not significant Figure 1.

Discussion

The aim of this study was to investigate the ef-fect of high level of free testosterone in the bloodon insulin resistance caused by an imbalance be-tween adipocytokines in subcutaneous fat tissueobtained from PCOS patients and normal pa-

tients at the same BMI and age. The stimulus forthe study to compare between PCOS and normalpatients is that most of the PCOS patients haveinsulin resistance which could be as a result ofhyperandrogenemia1,2,7. This report demonstratesthat the gene expression pattern of a number ofgenes in abdominal superficial subcutaneous tis-sue relating to insulin resistance and markers ofinflammation were similar in overweight womenwith and without PCOS.In terms of Adiponectin, levels of adiponectin

mRNA in SAT from the two groups are consistentwith recent scholars2,15-17 and agrees with anotherwork18 comparing people with high sensitivity andlow sensitivity to insulin. By contrast, Carmina etal19 suggested that expression of adiponectin andleptin mRNA in subcutaneous samples obtained

1101

Inflammatory markers expression in PCOS adipose tissue

1102

G. Alshammari, R. Khan, J. Brameld, S. Amer, M.A. Lomax

Figure 1. Levels of mRNA for inflammatory substances (mean ± SD) in abdominal superficial subcutaneous adipose tissuefrom obese patients with PCOS (n = 8), and obese control subjects (n = 12). Levels of mRNA are relative to the cyclophilingene (Cyclo), which was used to normalize data.

from PCOS patients was low compared with nor-mal women. On the other hand, some studies ap-peared to suggest that omental, not subcutaneous,adipose tissue secretes adiponectin and correlatesnegatively with body fat mass20,21.Resistin levels in PCOS have been sparsely in-

vestigated, and the findings have been conflict-ing22,23. No difference in mRNA levels of resistinis not consistent with results producedpreviously24. The results also do not agree with an-other study16, possibly due to different fat tissue(omental fat) being used.Regarding TNF-α, no difference was noted be-

tween the two groups, which is consistent with 2other studies2,25, but disagrees with another26,who suggest that levels of TNF-alpha mRNA inSAT are significantly higher in women withPCOS than those in BMI-matched controls. Vari-ous inflammatory proteins have been investigatedin women with PCOS, including IL-6 and the da-ta is suggestive of the presence of a chronic low-grade inflammatory state, especially in obesity,insulin resistance and hyperandrogenism. Figure5.1 shows that levels of IL-6 gene expression aresimilar in both PCOS and normal patients. Thisdata is supported by previous results2. However,the amount of IL-6 mRNA in VAT is 10 foldmore than in SAT27 and the amount of IL-6 se-creted by VAT explants is clearly higher than thatsecreted by SAT explants.Leptin gene expression levels were the same in

both groups, but one study19 implied that expres-sion was lower in both omental and SAT ob-tained from PCOS women, whereas others28-30

suggested Leptin gene expression was higher inSAT obtained from PCOS women compared tonormal patients.MCP-1 expression was also notdifferent between the two groups and this resultis consistent with all previous works on MCP-1in PCOS women25,31. Visfatin gene expressionwas similar between the two groups, which issupported by previous papers2,32,33. There was nodifference in the expression of Visfatin betweenvisceral and SAT, and no correlation observedbetween plasma Visfatin and visceral fat mass33.Moreover, Seow et al16 investigated the expres-sion of visfatin mRNA in omental fat tissue andit was significantly higher in the women withPCOS than in the controls.The main advantage of using subcutaneous fat

is that the procedure for obtaining samples is lessinvasive than for visceral fat, but we could notdetermine the protein levels of the variousadipokines due to limited sample volume.

Conclusions

There were no effects of PCOS on the expres-sion of any of the adipocytokines genes mea-sured in SAT, despite significantly higher levelsof free testosterone in this group compared withcontrol women. This may be explained by thefact that the plasma levels of free testosterone inour PCOS population, although above the normalrange for females, was still only a tenth of the an-drogen levels in males, and thus did not reach thelevels where they might be expected to have aneffect on gene expression. Furthermore, theremay be differences in androgen levels betweenPCOS populations due to differences in BMI andlevels of insulin resistance and sex hormone-binding globulin, which may explain some of thediscrepancies between our report and previousstudies. Moreover, we believe that a limitation ofour research may relate to the number of subjectsobserved, since other studies have had highernumbers in the two groups. Since visceral adi-posity is thought to be the closest link to meta-bolic risk, it is unfortunate that we had only biop-sies from the abdominal superficial SAT depot. Ithas recently been reported that the different adi-pose tissue depots have different profiles of in-flammatory markers34-36.

––––––––––––––––––––AcknowledgementsWe gratefully acknowledge the Research Center, Deanshipof Scientific Research, College of Food and Agriculture Sci-ence, King Saud University, Riyadh, Saudi Arabia for thefinancial support to carry out this project.

–––––––––––––––––-––––Conflict of InterestThe Authors declare that there are no conflicts of interest.

References

1) GLINIANOWICZ M, MADEJ P, NYLEC M, OWCZAREK A,SZANECKI W, SKAŁBA P, CHUDEK J. Circulating apelinlevel in relation to nutritional status in polycysticovary syndrome and its association with metabol-ic and hormonal disturbances. Clin Endocrinol(Oxf) 2013; 79: 238-242.

2) SVENDSEN PF, CHRISTIANSEN M, HEDLEY PL, NILAS L,PEDERSEN SB, MADSBAD S. Adipose expression ofadipocytokines in women with polycystic ovarysyndrome. Fertil Steril 2012; 98: 235-241.

3) RYDÉN M, JOCKEN J, VAN HARMELEN V, DICKER A, HOFF-STEDT J, WIRÉN M, BLOMQVIST L, MAIRAL A, LANGIN D,BLAAK E, ARNER P. Comparative studies of the role

1103

Inflammatory markers expression in PCOS adipose tissue

1104

of hormone-sensitive lipase and adipose triglyc-eride lipase in human fat cell lipolysis. Am J Phys-iol Endocrinol Metab 2007; 292: 1847-1855.

4) MORO C, PASARICA M, ELKIND-HIRSCH K, REDMAN LM.Aerobic exercise training improves atrial natriuret-ic peptide and catecholamine- mediated lipolysisin obese women with polycystic ovary syndrome.J Clin Endocrinol Metab 2009; 94: 2579-2586.

5) ESCOBAR-MORREALE HF, LUQUE-RAMÍREZ M, GONZÁLEZF. Circulating inflammatory markers in polycysticovary syndrome: a systematic review and meta-analysis. Fertil Steril 2011; 95: 1048-1058.

6) ESCOBAR-MORREALE HF, SAN MILLÁN JL. Abdominaladiposity and the polycystic ovary syndrome.Trends Endocrinol Metab 2007; 18: 266-272.

7) MANNERÅS-HOLM L, LEONHARDT H, KULLBERG J, JENNIS-CHE E, ODÉN A, HOLM G, HELLSTRÖM M, LÖNN L,OLIVECRONA G, STENER-VICTORIN E, LÖNN M. Adiposetissue has aberrant morphology and function inPCOS: enlarged adipocytes and low serumadiponectin, but not circulating sex steroids, arestrongly associated with insulin resistance. J ClinEndocrinol Metab 2011; 96: 304-311.

8) BLOUIN K, VEILLEUX A, LUU-THE V, TCHERNOF A. Andro-gen metabolism in adipose tissue: recent ad-vances. Mol Cell Endocrinol 2009; 301: 97-103.

9) ORIO F JR, PALOMBA S, CASCELLA T, MILAN G, MIONI R,PAGANO C, ZULLO F, COLAO A, LOMBARDI G, VETTOR R.Adiponectin levels in women with polycystic ovarysyndrome. J Clin Endocrinol Metab 2003; 88:2619-23.

10) KELLY CC, LYALL H, PETRIE JR, GOULD GW, CONNELLJM, SATTAR N. Low grade chronic inflammation inwomen with polycystic ovarian syndrome. J ClinEndocrinol Metab 2001; 86: 2453-2455.

11) HICKEY MS, ISRAEL RG, GARDINER SN, CONSIDINE RV,MCCAMMON MR, TYNDALL GL, HOUMARD JA, MARKSRH, CARO JF. Gender differences in serum leptinlevels in humans. Biochem Mol Med 1996; 59:1-6.

12) MERKI-FELD GS, IMTHURN B, ROSSELLI M, SPANAUS K.Serum concentrations of high-molecular weightadiponectin and their association with sexsteroids in premenopausal women. Metabolism2011; 60: 180-185.

13) MATSUZAWA Y, FUNAHASHI T, NAKAMURA T. Molecularmechanism of metabolic syndrome X: contributionof adipocytokines adipocyte-derived bioactivesubstances. Ann N Y Acad Sci 1999; 892: 146-154.

14) GIRARD J. Is leptin the link between obesity andinsulin resistance? Diabetes Metab 1997; 23:16-24.

15) WANG L, LI S, ZHAO A, TAO T, MAO X, ZHANG P, LIUW. The expression of sex steroid synthesis andinactivation enzymes in subcutaneous adiposetissue of PCOS patients. J Steroid Biochem MolBiol 2012; 132: 120-126.

16) SEOW KM, JUAN CC, HO LT, HSU YP, LIN YH, HUANGLW, HWANG JL. Adipocyte resistin mRNA levelsare down-regulated by laparoscopic ovarian elec-

trocautery in both obese and lean women withpolycystic ovary syndrome. Hum Reprod 2007;22: 1100-1106.

17) SEOW KM, TSAI YL, JUAN CC, LIN YH, HWANG JL, HOLT. Omental fat expression of adiponectin andadiponectin receptors in non-obese women withPCOS: a preliminary study. Reprod Biomed On-line 2009; 19: 577-582.

18) HOFFSTEDT J, ARVIDSSON E, SJÖLIN E, WÅHLÉN K, ARN-ER P. Adipose tissue adiponectin production andadiponectin serum concentration in human obesi-ty and insulin resistance. J Clin Endocrinol Metab2004; 89: 1391-1396.

19) CARMINA E, CHU MC, MORAN C, TORTORIELLO D, VARD-HANA P, TENA G, PRECIADO R, LOBO R. Subcutaneousand omental fat expression of adiponectin andleptin in women with polycystic ovary syndrome.Fertil Steril 2008; 89: 642-648.

20) CNOP M, HAVEL PJ, UTZSCHNEIDER KM, CARR DB,SINHA MK, BOYKO EJ, RETZLAFF BM, KNOPP RH,BRUNZELL JD, KAHN SE . Relat ionship ofadiponectin to body fat distribution, insulin sen-sitivity and plasma lipoproteins: evidence for in-dependent roles of age and sex. Diabetologia2003; 46: 459-469.

21) MOTOSHIMA H, WU X, SINHA MK, HARDY VE, ROSATOEL, BARBOT DJ, ROSATO FE, GOLDSTEIN BJ. Differen-tial regulation of adiponectin secretion from cul-tured human omental and subcutaneousadipocytes: effects of insulin and rosiglitazone. JClin Endocrinol Metab 2002; 87: 5662-5667.

22) PANIDIS D, FARMAKIOTIS D, ROUSSO D, KATSIKIS I,DELKOS D, PIOUKA A, GEROU S, DIAMANTI-KANDARAKISE. Plasma visfatin levels in normal weight womenwith polycystic ovary syndrome. Eur J Intern Med2008; 19: 406-412.

23) STEPPAN CM1, BAILEY ST, BHAT S, BROWN EJ, BANERJEERR, WRIGHT CM, PATEL HR, AHIMA RS, LAZAR MA. Thehormone resistin links obesity to diabetes. Nature2001 409: 307-312.

24) CHU Y, CUI Q, FENG G, SONG Z, JIANG X. The ex-pression of resistin in adipose tissues of patientswith polycystic ovary syndrome and insulin resis-tance. J Huazhong Univ Sci Technolog Med Sci2009; 29: 642-645.

25) LINDHOLM A, BLOMQUIST C, BIXO M, DAHLBOM I, HANS-SON T, SUNDSTRÖM POROMAA I, BURÉN J. No differ-ence in markers of adipose tissue inflammationbetween overweight women with polycystic ovarysyndrome and weight-matched controls. Hum Re-prod 2011; 26: 1478-1485.

26) UNLUTURK U, HARMANCI A, KOCAEFE C, YILDIZ BO. TheGenetic Basis of the Polycystic Ovary Syndrome:A Literature Review Including Discussion ofPPAR-gamma. PPAR Res 2007; 2007:49109.

27) VATIER C, KADIRI S, MUSCAT A, CHAPRON C, CAPEAU J,ANTOINE B. Visceral and subcutaneous adipose tis-sue from lean women respond differently tolipopolysaccharide-induced alteration of inflam-mation and glyceroneogenesis. Nutr Diabetes2012; 2: e51.

G. Alshammari, R. Khan, J. Brameld, S. Amer, M.A. Lomax

28) LECKE SB, MATTEI F, MORSCH DM, SPRITZER PM. Ab-dominal subcutaneous fat gene expression andcirculating levels of leptin and adiponectin in poly-cystic ovary syndrome. Fertil Steril 2011; 95:2044-2049.

29) O'CONNOR A, PHELAN N, TUN TK, BORAN G, GIBNEY J,ROCHE HM. High-molecular-weight adiponectin isselectively reduced in women with polycysticovary syndrome independent of body mass indexand severity of insulin resistance. J Clin En-docrinol Metab 2010; 95: 1378-1385.

30) LECKE SB, MORSCH DM, SPRITZER PM. Association be-tween adipose tissue expression and serum lev-els of leptin and adiponectin in women with poly-cystic ovary syndrome. Genet Mol Res 2013;12:4292-4296.

31) WU R, FUJII S, RYAN NK, VAN DER HOEK KH, JASPERMJ, SINI I, ROBERTSON SA, ROBKER RL, NORMAN RJ.Ovarian leukocyte distribution and cytokine/chemokine mRNA expression in follicular fluidcells in women with polycystic ovary syndrome.Hum Reprod 2007; 22: 527-535.

32) TAN BK, CHEN J, DIGBY JE, KEAY SD, KENNEDY CR,RANDEVA HS. Increased visfatin messenger ribonu-cleic acid and protein levels in adipose tissue and

adipocytes in women with polycystic ovary syn-drome: parallel increase in plasma visfatin. J ClinEndocrinol Metab 2006; 91: 5022-5028.

33) BERNDT J, KLÖTING N, KRALISCH S, KOVACS P, FASSHAUER M,SCHÖN MR, STUMVOLL M, BLÜHER M. Plasma visfatinconcentrations and fat depot-specific mRNA expres-sion in humans. Diabetes 2005; 54: 2911-2916.

34) HARMAN-BOEHM I, BLÜHER M, REDEL H, SION-VARDY N,OVADIA S, AVINOACH E, SHAI I, KLÖTING N, STUMVOLLM, BASHAN N, RUDICH A. Macrophage infiltration in-to omental versus subcutaneous fat across differ-ent populations: effect of regional adiposity andthe comorbidities of obesity. J Clin EndocrinolMetab 2007; 92: 2240-2247.

35) HUBER J, KIEFER FW, ZEYDA M, LUDVIK B, SILBERHUMERGR, PRAGER G, ZLABINGER GJ, STULNIG TM. CCchemokine and CC chemokine receptor profilesin visceral and subcutaneous adipose tissue arealtered in human obesity. J Clin Endocrinol Metab2008; 93: 3215-3221.

36) POULAIN-GODEFROY O, LECOEUR C, PATTOU F, FRÜHBECKG, FROGUEL P. Inflammation is associated with adecrease of lipogenic factors in omental fat inwomen. Am J Physiol Regul Integr Comp Physiol2008; 295: 1-7.

1105

Inflammatory markers expression in PCOS adipose tissue