inﬂ psgl-1,deﬁ activates macrophages to promote colorectal … · oncogenes and tumor...

Oncogenes and Tumor Suppressors

Inflammatory Molecule, PSGL-1, DeficiencyActivates Macrophages to Promote ColorectalCancer Growth through NFkB SignalingJiangchao Li1, Zeqi Zhou1, Xiaohan Zhang1, Li Zheng1, Dan He2, Yuxiang Ye1,Qian-Qian Zhang1, Cui-Ling Qi1, Xiao-Dong He1, Chen Yu4, Chun-kui Shao2,Liang Qiao3, and Lijing Wang1

Abstract

P-selectin glycoprotein ligand 1 (SELPLG/PSGL-1) is an inflam-matory molecule that is functionally related to immune celldifferentiation and leukocyte mobilization. However, the role ofPSGL-1 in tumor development remains unknown. Therefore, thisstudy investigates the mechanistic role of PSGL-1 in the develop-ment of intestinal tumors in colorectal cancer. ApcMin/þ mice arehighly susceptible to spontaneous intestinal adenoma formation,and were crossbred with PSGL1-null mice to generate compoundtransgenic mice with a ApcMin/þ;PSGL-1�/� genotype. The inci-dence and pathologic features of the intestinal tumors were com-pared between the ApcMin/þ mice and ApcMin/þ;PSGL-1�/� mice.Importantly, PSGL-1–deficientmice showed increased susceptibil-ity to develop intestinal tumors and accelerated tumor growth.Mechanistically, increased production of the mouse chemokineligand 9 (CCL9/MIP-1g) was found in the PSGL-1–deficient mice,

and the macrophages are likely the major source of macrophageinflammatory protein-1 gamma (MIP-1g). Studies in vitro dem-onstrated that macrophage-derived MIP-1g promoted colorectalcancer tumor cell growth through activating NFkB signaling.Conversely, restoration of the PSGL-1 signaling via bone marrowtransplantation reduced MIP-1g production and attenuated theability of ApcMin/þ;PSGL-1�/� mice to generate intestinal tumors.In human colorectal cancer clinical specimens, the presence ofPSGL-1–positive cells was associated with a favorable tumor–node–metastasis staging and decreased lymph node metastasis.

Implications: PSGL-1 deficiency and inflammation renderintestinal tissue more vulnerable to develop colorectal tumorsthrough a MIP-1g/NFkB signaling axis. Mol Cancer Res; 15(4);467–77. �2017 AACR.

IntroductionColorectal cancer is one of the leading causes of cancer-related

death in developed countries and some developing countries(1, 2). Genetic alterations of the tumor suppressor genes such asmutation of adenomatous polyposis coli (APC) have been shownto drive the transformation of normal epithelium to adenoma-tous polyp and finally lead to invasive colorectal cancer (3, 4).Apart from the altered genetic susceptibility, chronic inflamma-

tion in the gut has also been implicated as a critical risk factor forthe development of colorectal cancer (5).

P-selectin glycoprotein ligand 1 (PSGL-1) is a member of theselection family of adhesion molecules. It is mainly expressed inimmune and inflammatory cells, and is involved in the recruit-ment of immune and inflammatory cells to the site of inflam-mation by rolling and tethering (6). PSGL-1 is also essential forcell differentiation as deficiency of PSGL-1was found to affect thedifferentiation of myeloid cells and maturation of lymphocytes(7, 8). P-selectin–deficient mice manifested impaired leukocyteadhesion which could be restored by administration of solubleP-selectin (9). Previous studies have indicated that P-selectinis important in regulating leukocyte adhesion. PSGL-1 can forma constitutive complex with Nef-associated factor 1 (Naf1),which is then phosphorylated by Src family kinase and subse-quent recruitment of phosphoinositide-3-OH kinase p85-p110delta heterodimer, leading to activation of leukocyte integrins(9). These studies suggest that PSGL-1 is essential for inflam-matory response.

In process of the inflammatory response, macrophages play akey role: PSGL-1 and P-selectin are expressed in peritoneal macro-phages (10). Macrophages secrete many cytokines and chemo-kines which can provoke either antitumor or protumor immuneresponse. In prokaryotic organism, chemokines are small-mole-cule proteins with crucial roles in mediating inflammatoryresponses and tumor immune responses, in that they can directtrafficking of leukocytes into the tumor microenvironment and

1Vascular Biology Research Institute, School of Basic Course, GuangdongPharmaceutical University, Guangzhou, China. 2Department of Pathology, TheThird Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. 3StorrLiver Centre, The Westmead Institute for Medical Research, The University ofSydney at the Westmead, New South Wales, Australia. 4Department of Gas-troenterology, The First Affiliated Hospital of Pharmaceutical University,Guangzhou, China.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corrected online May 13, 2020.

J. Li and Z. Zhou contributed equally to this article.

Corresponding Author: Lijing Wang, Guangdong Pharmaceutical University,No. 280 Wai Huan Dong Lu, Guangzhou Higher Education Mega Center,Guangzhou 510006, China. Phone: 203-935-2126; Fax: 203-935-2621; E-mail:[email protected]

doi: 10.1158/1541-7786.MCR-16-0309

�2017 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 467

guide cell movements away from poisons in response to cellularinsults (11). In addition, chemokines are critical to early devel-opment (e.g., they can facilitate the movement of sperm towardthe egg during fertilization and subsequent phases of develop-ment; ref. 12). Recent studies have shown that chemokines caneither promote or inhibit tumor growth and metastasis (13–16).Thus, the biological functions of chemokines are rather compli-cated and are likely cellular context dependent.

In this study, we investigated whether PSGL-1 deficiencyfacilitates the growth of colorectal cancer using ApcMin/þ miceas a model.

Materials and MethodsMice and animal care

ApcMin/þ mice and P-selectin glycoprotein ligand-1 (PSGL-1)homozygous knockout mice were purchased from Jackson labo-ratory (stock no.: 002020, https://www.jax.org/strain/002020and stock no.: 004201, https://www.jax.org/strain/004201) byProf. Jianguo Geng (Institute of Biochemistry and Cell Biology,ChineseAcademyof Sciences). The two kinds ofmice areC57BL/6background (C57). ApcMin/þmicewere crossbredwith PSGL-1�/�

mice to generate ApcMin/þ;PSGL-1�/� mice (SupplementaryFig. S1). Mice were housed under specific pathogen-free condi-tions in Animal Center of Guangdong Pharmaceutical University.All animal experiments were performed in accordance with theinstitutional guidelines and were approved by the Animal EthicsCommittee of Guangdong Pharmaceutical University.

Analysis of intestinal tumorsAfter mice being sacrificed, the intestines were removed and

sliced longitudinally, rinsed with 0.9% NaCl, fixed with 4% para-formaldehyde (PFA) for overnight, and spread onto slides whichwere treated with 3-aminopropyl-triethoxysilane (APES). Eachsmall intestine was divided into three equal sections: proximal,middle, anddistal segments and then stainedwith 0.1%methyleneblue. The number of tumors was counted in each section, and adigital caliper was used tomeasure the tumor length (L) and width(W) under thedissectingmicroscope. Tumordiameter is equal toorless than 2 mmwere indicated as microadenomas, whereas tumordiameter more than 2 mm indicated adenomena (SupplementaryFig. S2; ref. 17). Tumor volume was calculated by the formula V¼0.5 � L �W2. To assess and compare the tumor incidence in eachgroup, all separate intestinal sections from each animal were rolledinto concentric circles to "restore" intestinal construction. The"restored" intestines were then embedded in paraffin blocks, cutinto sections of 5-mmthickness, and thenwere used inhematoxylinand eosin (H&E)or IHCprocedures to assess or detect the intestinaltumor foci under the microscope.

H&E, IHC, and immunofluorescence stainingIntestinal tumors were fixed in 4% formalin overnight, then

were rinsedwith PBS, subsequently dehydrated in 35%, 50%, and75% ethanol, and then embedded in paraffin. Five-micron sec-tionswere deparrafinized in xylene and rehydrated in 100%, 95%,70%, and 50% ethanol and then PBS. H&E staining was carriedout on sections as described previously. The score of H&E stainingwas assessed and rated by a tumor pathologist. IHC was per-formed according to the manufacturer's instructions (Cell Signal-ing Technology, Inc). Primary antibodies include Ki67 (1:100,Abcam), CD34 (1:50, Abcam), PSGL-1 antibody (1:50, catalog

no.: sc-18855, Santa Cruz Biotechnology), CCR1 antibody(1:100, catalog no.: BA2231-1, Boster), pp65 antibody [1:500,phospho-NFkB p65 (93H1), Cell Signaling Technology], TNFa(1:100, Boster). Secondary antibody detection system (LSAB 2Kits, Universal, HRP anti-Rabbit/Mouse). The slides were pre-treated with EDTA solution (pH 8.5) for antigen retrieval, andthen incubated with the primary antibody at 4�C overnight.Secondary antibody detection system was used to visualize IHCstaining results. For immunofluorescence staining, the tumorspecimens were fixed in 4% PFA and subsequently incubated inPBS containing 30% sucrose and frozen at �80�C. The frozensections were incubated with anti-TNFa or anti-pp65 antibodyand imaged using confocal microscopy (Leica).

Cell culture and transfectionColorectal carcinoma cell lines HCT-116, SW620, and SW480

were obtained from the cell bank of the Chinese Academy ofSciences (Shanghai, China) in the recent 2 years. They wereauthenticated by Guangzhou Cellcook Cell Biotechnology, Ltd.using PowerPlex 16HS System (Promega). Themurine tumor celllines CT26 (derived colorectal carcinoma) and murine macro-phage RAW264.7 purchased from the cell bank of the ChineseAcademyof Sciences were cultured less than 10weeks from frozenstock for this study. Primary culture macrophage was collectedfrom peritoneal wash obtained with 0.9% NaCl. The cells wereincubated at 37�C in a humidified chamber containing 5% CO2

and cultured with DMEM (Gibco) with 10% FBS, plus 100 U/mLpenicillin, and 100 mg/mL streptomycin. Lipofectamine 2000(Invitrogen) was used to transfect siRNAs to Raw 264.7 cells(final concentration 100 nmol/L). Human PSGL-1 siRNA andcontrol siRNA were purchased from Ribobio Inc., and transfec-tions were performed using Lipofectamine 2000 (Invitrogen).

Measurement of serum cytokinesSerum sample from each mouse was obtained by centrifuging

the whole blood at 3,000 � g for 5 minutes. Cytokines in eachsamplewere analyzedusing theRayBioMouseCytokineAntibodyArray Kit or MIP-1g Elisa Kit (Raybiotech, Inc.) according to themanufacturer's instructions.

Western blottingDetailed procedures for Western blotting have been

described in our previous publications. Briefly, whole proteinsfrom the intestinal tumors and cultured colorectal cancer cellswere extracted using the lysis buffer (Cell Signaling Technology,Inc.). Approximately 30 mg of protein from each sample wassubjected to 10% SDS-PAGE by electrophoresis under reducingconditions and transferred to polyvinylidene difluoride mem-branes (Millipore Corporation), and blocked overnight with5% skim milk for 1 hour. The membranes were then incubatedat 4�C for overnight, washed in TBST, and incubated with thesecondary antibody (anti-American hamster horseradish per-oxidase-IgG). The blots were then developed with chemilumi-nescent (ECL) reagents and imaged on an X-ray film by auto-radiography. Anti-b-actin or anti-Lamin A was used as theloading control. Quantity One software (Bio-Rad) was usedto measure the band intensity. The following antibodies wereused: TNFa body (Boster), pP65 (catalog no.: #3033, CellSignaling Technology), Lamin A (Boster), and b-actin (catalogno.: #4970, Cell Signaling Technology).

Li et al.

Mol Cancer Res; 15(4) April 2017 Molecular Cancer Research468

https://www.jax.org/strain/002020

https://www.jax.org/strain/004201

Flow cytometry analysisTumor tissues and spleen were made into single-cell suspen-

sions in PBS supplemented with 1% BSA as previously described.Blood samples were collected and the red blood cells were lyzedwith lysis buffer (Life Technologies). Gallios Flow Cytometer(Beckman Coulter) was used to determine the expression ofF4/80, which is regarded as the macrophage surface marker. Theanti-mouse F4/80-FITC antibody (clone: REA126) was purchasedfrom Miltenyi Biotec, and anti-mouse CD3e PE-Cy5 (clone: 145-2C11), anti-mouse CD8a PE (clone: 53-6.7), anti-mouse CD4FITC (clone: GK1.5), anti-mouse CD45RO APC, anti-mouseCD19 PE (clone: 1D3), anti-mouse CD11b Alexa Fluor 488(clone: M1/70), and anti-mouse CD11c (clone: 53-0114) werepurchased from eBioscience Inc. An isotope control was includedin the quadrant analysis. The percentage of cells of interest, asindicated by the mean fluorescence intensity, was analyzed usingFlowJo software (Tree Star, Inc.). At least three independentexperiments were conducted for each group.

Detecting DNA content by flow cytometryCells were seeded to 6-well plates at 30% confluence. Serum-

free medium with L-Mimosine (400 mmol/L) was added for G1

synchronization. After 24 hours, medium containing 10% FBSwas added for an additional 12 hours. Cells were fixed in 75%ethanol, stained with 100 ng/mL 40,6-diamidino-2-phenylindole(DAPI), and analyzed by flow cytometry. The results of cell cyclewere analyzed with FlowJo software (Tree Star, Inc.) according tothe manufacturer's instructions.

RNA isolation and real-time PCRTotal RNA of blood and spleen cells was isolated using TRIzol

reagent (Invitrogen) according to themanufacturer's instructions.The first cDNA chain was obtained using oligo dT primers withcDNA Reverse Transcription Kit (Takara). qPCR was performedwith PCR Master Mix (Takara) on Applied Biosystems 7500. ThePCR amplification was carried out with a 3-minute predenatura-tion at 95�Cminutes, and 35 cycles: 95�C for 35 seconds, 57�C for40 seconds, and 72�C for 50 seconds, followed by a 10-minuteextension at 72�C. GAPDH served as an internal control tonormalize the starting cDNA levels. PCR primers were listed asfollows: macrophage inflammatory protein-1 gamma (MIP-1g):forward: 50-30 CCCTCTCCTTCCTCATTCTTACA; reverse: 50-30

AGTCTTGAAAGCCCATGTGAAA,which amplify fragments locat-ed in the C-C motif chemokine 9,192-332.

PCR arrayTo explore which signal pathway accelerated tumor growth after

stimulatingwithMIP-1g , we analyzed themRNAexpression level ofthe signal pathway–relevant genes with RT2 Profiler PCR Arrays Kit(Qiagen Kit, catalog no.: PAMM-014). According to the experimen-talworkflow,weprepareda sampleof25ngofRNA,obtainedcDNAwith the RT2 PreAMP cDNA Synthesis Kit, and analyzed the PCRdata with the analysis software on the website of Qiagen. The RT2Profiler PCR Array incorporates laboratory-verified assays for 96pathway-focused genes, 5 housekeeping genes for normalization,and controls that check for sample quality and reaction quality.

ELISAThe serum levels of MIP-1g were analyzed using commercially

available ELISA (mouse MIP-1g ELISA; catalog no.: P51670,

Raybiotech, Inc.). The serum was centrifuged and then stored at�80�C until analysis. The measurements were conducted accord-ing to themanufacturer's instructions. All sampleswere assayed intriplicate, and mean values were calculated.

Proliferation assayCell Counting Kit-8 (Dojindo) was used to determine the

proliferation rates of a series of cancer and control cell lines. Cellswere seeded at a density of 1�103 cells/well on96-well plates andcultured for 5 days (n ¼ 4 per cell line).

Bone marrow transplantationRecipient mice were given full-body irradiation at a dose of

8.5 Gy three times, 5 minutes each. Donor mice (C57, male, 6–8weeks old) were sacrificed under anesthesia by diethyl ether.Following a 3-week recovery period, the mice were further sub-jected to the experimental conditions described elsewhere in thearticle and the animals were monitored for tumor development.

Statistical analysisSPSS 16.0 was used to analyze the results expressed as themean

� SD. ThemRNA level in cell lines and tissueswas comparedusingpaired Student t test to examine the differences between groups.The graphs were drawn and analysis was performed with Prism5software (GraphPad). A x2 test or Fisher exact test was used toanalyze the significance of PSGL-1 expression in the tumor andnontumor tissue. The clinical–pathologic factors, including age,sex, histologic and pathologic stage, and invasion, as well as theTNM stage, were considered, and a log-rank test for survival wasperformed to compare the positive and negative staining results.Kaplan–Meier curves were plotted according to the overall sur-vival. Cox proportional hazards models were adopted to analyzeall clinical factors. P < 0.05was considered statistically significant.

ResultsPSGL-1�/� mice exhibit increased susceptibility to developintestinal tumors

To investigate whether PSGL-1 deficiency would affect thesusceptibility of mice to develop intestinal tumors, we cross-bred ApcMin/þ mice with PSGL-1�/� mice to generate ApcMin/þ;PSGL-1�/� mice, as detailed in the Supplementary Fig. S1. Asshown in Fig. 1A, compared with ApcMin/þ mice, ApcMin/þ;PSGL-1�/� mice were significantly more susceptible to developintestinal tumors as macroscopically revealed by methyleneblue staining of different intestinal segments (ileumsection; Fig. 1A), and quantitatively demonstrated by themarkedly increased tumor volume (Fig. 1B) and tumor number(Fig. 1C) of the intestinal tumors (including microadenoma,�2 mm in diameter; and adenoma, >2 mm in diameter) in theApcMin/þ;PSGL-1�/� mice at 9, 18, and 24 weeks of treatment(�, P < 0.05; ��, P < 0.01; ��, P < 0.01), and these mice displayedmore significantly worse survival compared with the ApcMin/þ

mice (Fig. 1D, P < 0.01). In addition, ApcMin/þ;PSGL-1�/� micelose more body weight than the ApcMin/þ mice after 9, 18, and24 weeks of treatment (Supplementary Fig. S3). To furtherconfirm the role of PSGL-1 signaling in intestinal carcinogen-esis, we conducted a study where the PSGL-1 signaling waseliminated by total body irradiation and then restored bytransplanting the normal bone marrow cells from the wild-type C57BL/6 mice. As expected, following tumorigenic treat-ment, there was no significant difference in the tumor incidence

PSGL-1 Deficiency Promotes Intestinal Tumor Growth

www.aacrjournals.org Mol Cancer Res; 15(4) April 2017 469

between theC57:ApcMin/þ;PSGL-1�/�mice chimeras and theC57:ApcMin/þ mice (Supplementary Fig. S8, P < 0.01). Clearly, PSGL-1deficiency promotes intestinal tumorigenesis.

PSGL-1�/� mice displayed an accelerated tumor progressionTo further reveal the impact of PSGL-1 deficiency on the devel-

opment and progression of intestinal tumors, the pathologicfeatures of the intestinal tumor tissues from each group of micewere microscopically analyzed. An overview of the H&E-stainedintestines revealed more tumors in the ApcMin/þ;PSGL-1�/� micethan in the ApcMin/þ mice (Fig. 2A). Three stages of tumor devel-opment were observed, ranging from the very mild hyperplasia toadenoma and finally adenocarcinoma, as exemplified in the intes-tines of ApcMin/þ mice (Fig. 2B). Detailed breakdown analysisrevealed that 37.7% of the intestinal tumors in ApcMin/þ micewere hyperplasia, 52.5% were adenomas, and 9.8% were adeno-carcinomas. In contrast, most intestinal tumors in the ApcMin/þ;PSGL-1�/�micewere adenomas andadenocarcinomas (Fig. 2C, ��,P<0.01). By IHC, the tumors in theApcMin/þ;PSGL-1�/�miceweremore proliferative than the tumors of the ApcMin/þ mice as dem-onstrated by the significantly increased number of Ki67-positivecells in the former group (Fig. 2D and E, �, P < 0.05). Tumors in theApcMin/þ;PSGL-1�/� mice also showed increased microvasculardensity as indicated by the increased expression of CD34 (Fig.2F and G; �, P < 0.05).

MIP1-g is upregulated in PSGL-1�/� micePSGL-1 is mainly expressed in inflammatory cells including

leukocytes, and can be recruited to and accumulate in tumor oradjacent nontumoral tissues. We have revealed an increase ofneutrophils in blood of PSGL-1�/�mice (Supplementary Fig. S4),and this is consistent with the mice data provided by Yang andcolleagues (18).Neutrophils and other types of immune cellsmay

explain the tumor fast growth or tumor development in the tumorenvironment (19). In contrast, there was amarked decrease in thenumber of leukocytes in the tumors of the ApcMin/þ;PSGL-1�/�

mice as compared with ApcMin/þ mice, suggesting that PSGL-1knockout would not increase but decrease immune cell recruit-ment in ApcMin/þ and PSGL-1�/� tumor-bearing mice (Supple-mentary Fig. S5). The other potential mechanism is that PSGL-1may affect the differentiation of hematopoietic stem cells anddisturb the cells of myeloid lineage to develop into granulocytes,monocytes, megakaryocytes, and dendritic cells, thereby affectingthe homeostasis of immune system, and impairing the self-renewal and differentiation of hematopoietic stem cells (20). Toreveal themechanisms by which PSGL-1 deficiency contributes tothe tumor development, we used a Commercial Cytokine ArrayKit (the RayBioMouse Cytokine Antibody Array Kit) to determinethe cytokine levels in the serum samples of tumor-free PSGL-1–deficient mice and wild-type mice. As shown in Fig. 3A, higherserum level of MIP-1g was found in PSGL-1�/�mice than in wild-type mice (dots were semiquantitatively scanned with ImageJsoftware as shown in Fig. 3A, PSGL-1�/�: C57 ¼ 3.7, normalizedby GAPDH).

Meanwhile, significantly higher level of MIP-1g mRNA wasfound in the white cells of PSGL-1�/� and ApcMin/þ;PSGL-1�/�

mice, as compared with those of the C57mice and ApcMin/þmice,respectively (��, P < 0.01; ��, P < 0.001; Fig. 3B). Using ELISA, wefound similar patterns of the serumMIP-1g protein in these mice(Fig. 3C: a, C57 and PSGL-1�/� mice without tumors; b, C57 andPSGL-1�/�mice bearing tumors but less than 4weeks. �, P< 0.05).

To investigate the source of MIP-1g , we isolated macrophagesfrom the mouse peripheral blood and spleen tissues by flowcytometry using F4/80 as a marker. Collected cells were firststainedwith anti-CD45 (amarker for bonemarrow–derived cell),and CD45þ cells were gated (Fig. 3D, a). The cells were then

Figure 1.

Accelerated growth of intestinal tumorsin PSGL-1�/� mice. A, The representativephotos of the intestinal tumors werestained by methylene blue (ileumsegment). More intestinal tumor nodulesare visible in ApcMin/þ;PSGL-1�/� micethan in ApcMin/þ mice. B, Themicroadenomas and adenomas were oflarger size in ApcMin/þ;PSGL-1�/� micethan in ApcMin/þ mice. ��, P < 0.01;�� , P < 0.001. C, The number of tumornodules (microadenoma and adenoma)in each experimentalmousewas countedat different time points. Increased tumorincidence was clearly seen in ApcMin/þ;PSGL-1�/� mice than in ApcMin/þ mice,�, P < 0.05; �� , P < 0.01; �� , P < 0.00.D,ApcMin/þ;PSGL-1�/�mice (n¼ 32) withthe intestinal tumors showed poorersurvival than the tumor-bearingApcMin/þ mice (n ¼ 42). Survival wasanalyzed by Kaplan–Meier analysis(SPSS software, 17.0).

Li et al.


stained for F4/80. We observed a significantly increased percent-age of F4/80þ cells in blood (Fig. 3D, b) and spleen (Fig. 3D, c)of the PSGL-1�/� and ApcMin/þ;PSGL-1�/� mice, as comparedwith the C57 and ApcMin/þ mice, respectively (�, P < 0.05; ��, P <0.01). Furthermore, the macrophages derived from the ApcMin/þ;PSGL-1�/� mice showed a significantly increased expression ofMIP-1g mRNA (Fig. 3E) and protein (Fig. 3F), as opposed to theApcMin/þ mice (��, P < 0.05). In addition, we colocalized F4/80expression with PSGL-1 expression in ApcMin/þ mice and humancolorectal tissue (Supplementary Fig. S10).

To confirm these data, we knocked down PSGL-1 in Raw 264.7cells (a macrophage cell line), and measured the expression ofMIP-1g in the treated cell lysates. Knockdown of PSGL-1 by si-PSGL1 (Fig. 3G) led to a significant increase ofMIP-1g (Fig. 3H, �,P < 0.01). To reconstruct the PSGL-1 signaling, we performedbone marrow transplantation assay. ApcMin/þ mice or ApcMin/þ;

PSGL-1�/� were lethally irradiated to wipe out the bone marrow,followed by reconstitution of the bone marrow with that fromC57BL/6 mice. This way, we generated C57/PSGL-1þ/þ chimeras.As shown in Supplementary Fig. S8, following an8-week recovery,there was a significant decrease in the serum level ofMIP-1g in thebone marrow–recipient mice, and nonsignificant compared withApcMinþ mice.

MIP-1g promotes tumor cell growth in vitroThe above data indicate that MIP-1g derived from the macro-

phages may play a tumorigenic role in the intestinal tumori-genesis in PSGL-1–deficient mice. We further confirmed themRNA expression of MIP-1g in the macrophages isolated frommouse peripheral blood and Raw264.7 cells (MIP-1g primeramplify: C-C motif chemokine 9,192-332), and MIP-1g is notfound in human tumor cells such as HCT-116, SW620, and

Figure 2.

Pathologic features of intestinaltumors in ApcMin/þ and ApcMin/þ;PSGL-1�/� mice. A, An overview ofthe intestinal tumors of ApcMin/þ andApcMin/þ;PSGL-1�/� mice. Intestineswere stained with H&E. B, Therepresentative three-stagedevelopment of intestinal tumors inApcMin/þ mice: hyperplasia,adenoma, and adenocarcinoma.Tissue sections were stained withH&E. C,A quantitative analysis of thepercentage of the intestinaladenomas and adenocarcinomas inApcMin/þ;PSGL-1�/� mice, ascomparedwith ApcMin/þmice.D, IHCstaining of Ki67 in the intestinaltumor tissues of ApcMin/þ andApcMin/þ;PSGL-1�/� mice. E,Quantitative analysis of the Ki67positivity in the intestinal tumors ofApcMin/þ and ApcMin/þ;PSGL-1�/�

mice. F, IHC staining of themicrovessel density as indicated byCD34 in the intestinal tumors of theApcMin/þ and ApcMin/þ;PSGL-1�/�

mice. G, Quantitative analysis ofCD34 positivity in the intestinaltumors of ApcMin/þ and ApcMin/þ;PSGL-1�/� mice. � , P < 0.01.Magnification: 40� for A, 200� forB, and 400� for D and F.



SW480 (Fig. 4A), in which the expressions were confirmed onlyin mice before study (21). Previous studies have shown that thereceptor for MIP-1g termed CCR1 is generally present on thelymphocytes and tumor cells (22–28), and this receptor mayfacilitate tumor metastasis (29, 30). We confirmed the expres-sion of CCR1 in the intestinal tumor tissues of ApcMin/þmice byIHC analysis and murine tumor cell line CT26 by Western blotanalysis (Fig. 4B).

To further confirm the tumorigenic role of MIP-1g , colorectaltumor cells (CT26) were treated with exogenous MIP-1g , and theeffect on cell growth and cell-cycle progression was studied. Asshown in Fig. 4C, MIP-1g could significantly stimulate the tumorcell growth in a time- and dose-dependent manner, and thesechanges were associated with an increased proportion of G2–Mcells (Fig. 4D) and increased ability of cells to migrate (Fig. 4E).These effects were partially reversed by the treatment of cells withtheneutralizing antibody againstMIP-1g (datanot shown). Takentogether, these results indicate that MIP-1g may exert a tumori-genic role.

MIP-1g activates NFkB pathway in tumor cellsTo investigate themolecular mechanisms of MIP-1g promoting

tumorigenesis, a commercial PCR Array Kit (Supplementary TableS2) was used to evaluate the possible signaling pathway(s) that is(are) activated by MIP-1g . We use qPCR to detect mRNA of theMIP-1g treatment group and control group using CT26 cell lines.As shown in Fig. 5A, themRNA expressions of several genes relatedto the NFkB pathway were upregulated in tumor cells treated byMIP-1g . Furthermore, significantly increased expression level ofTNFa protein was found in the intestinal tumor tissues of theApcMin/þ;PSGL-1�/� mice compared with ApcMin/þ mice, as deter-mined by ELISA (Fig. 5B) and IHC (Fig. 5C). These IHC findingswere further confirmed by Western blot analysis (Fig. 5D). More-over, a significant activation of NFkB was seen, as indicated bya significantly upregulated expression level of pp65 in thenuclear compartments of the intestinal tumor tissues from Apc-Min/þ;PSGL-1�/� mice as compared with the ApcMin/þ mice (Fig. 5C,bottom). In addition, treatment of CT26 cells by MIP-1g led to amarked activation ofNFkB, as indicated by increased expressionof

C57

PSG

L-1-/

-

8

6

4

2

80

60

1501,000

2.5

2.0

1.5

1.0

0.5

0.0

800

600

400

200

0

100

80

60

40

20

ControlCon

. of M

IP-1

g (ng

/mL)

Mock si-PSGL-10

100

50

0

40

20

2040

a

b c

a

A B E

C F

G

H

D

b

30

20

10

0F4/8

0 Pe

rcen

tage

in b

lood

F4/8

0 Pe

rcen

tage

in s

plee

n

Con

. of M

IP-1

g (ng

/mL)

Con

. of M

IP-1

g (ng

/mL)

The

rela

tive

mR

NA

MIP

-1g

(GA

PDH

)

The

rela

tive

mR

NA

MIP

-1g

(GA

PDH

)

%%

15

10

5

0

0

0C57 PSGL-1-/-

C57 PSGL-1-/-

ApcMin/+;PSGL-1-/-ApcMin/+;PSGL-1-/-ApcMin/+

ApcMin/+;PSGL-1-/-ApcMin/+

Control Mock si-PSGL-10.010.050.1Ratio

PSGL-1

GAPDH

ApcMin/+

ApcMin/+;PSGL-1-/-ApcMin/+

C57 PSGL-1-/- ApcMin/+;PSGL-1-/-ApcMin/+C57F4/80

CD45

74.6%

95.1%

PSGL-1-/- ApcMin/+;PSGL-1-/-ApcMin/+

Figure 3.

Downregulation of PSGL-1 leads to an increased production of MIP-1g . A, With cytokine array analysis, significantly increased serum level of MIP-1g (CCL9)was found in tumor-bearing PSGL-1�/�mice comparedwith tumor-bearing C57BL/6mice.B,By qPCR assay, increasedmRNA expression of MIP-1g in the blood cellswas found in the ApcMin/þ;PSGL-1�/� and PSGL-1�/� mice, as compared with the ApcMin/þ (no tumors by 4 weeks) and C57 mice, respectively. �� , P < 0.01;�� , P < 0.001. C, The protein expression level of MIP-1g in the mouse blood cells was detected by ELISA. Significantly increased MIP-1g level was found in theApcMin/þ;PSGL-1�/� and PSGL-1�/� mice, as compared with the ApcMin/þ and C57 mice, respectively. � , P < 0.05. D, The percentage of F4/80þ macrophages in theentire CD45þ cell populations isolated from the mouse peripheral blood and spleen was determined by flow cytometry (a). Increased percentage of F4/80þ

macrophages was found in the ApcMin/þ;PSGL-1�/� and PSGL-1�/� mice, as compared with the ApcMin/þ and C57 mice, respectively. (b, blood; c, spleen. � , P < 0.05;�� , P < 0.01). E, Expression of MIP-1g mRNA by qPCR in the macrophages collected from the peripheral blood of ApcMin/þ and ApcMin/þ;PSGL-1�/�mice. �� , P < 0.01.F, Expression of MIP-1g protein by ELISA in the macrophages collected from the peripheral blood of ApcMin/þ and ApcMin/þ;PSGL-1�/� mice. �� , P < 0.01.G and H, Knockdown of PSGL-1 in Raw264.7 cells (G) led to an increased production of MIP-1g (H). � , P < 0.05.

Li et al.


pp65 in the nuclear compartment (Fig. 5E) and increased trans-location of pp65 (Fig. 5F). Taken together, these data stronglysuggest that MIP-1g activates NFkB pathway in tumors.

Infiltration of tumor tissues by the PSGL-1–positive cells ispositively associated with TNM stage and lymph nodemetastasis in colorectal cancer patients

Almost 100% of the PSGL-1–positive cells were found in theadjacentnontumorous intestinal tissues and tumor tissues inmice(Supplementary Fig. S9A). To investigate the correlation betweenthe infiltration of PSGL-1–positive cells in the tumor tissues andthe clinicopathologic features of the tumors, expression of PSGL-1was detected in 38 cases of human colorectal cancer tissues byIHC. The PSGL-1 was mainly expressed on the membrane ofnontumor cells, and these PSGL-1–positive cells were presentaround the cancer tissues in colorectal cancer patients (Fig. 6).

We further divided the intestinal tumor tissues into two sub-groups according to the number of PSGL-1–positive cells infil-trating the tissues: low infiltrating tissues [<50 cells per lowmagnification (10�) field; ref. 17] and high infiltrating tissues[�50 cells per field high magnification (100�) field]. Patientswith low level of PSGL-1 cell infiltration showed more advancedTNM stages (Fig. 6; Table 1, P ¼ 0.00065) and more lymph nodemetastasis (Table 1, P ¼ 0.0008), as exemplified in Supplemen-tary Fig. S9B and S9C (��, P < 0.01). No statistically significantassociationwas foundbetween the level of PSGL-1 expression andthe rest of the clinicopathologic features including gender and age(Table 1, P ¼ 0.7205 and 0.4417, respectively).

DiscussionThe role ofPSGL-1 in tumormetastasiswas not recognizeduntil

recently (31). In this study, we observed that PSGL-1may play an

oncogenic role in thedevelopment of intestinal tumors, and this islikely mediated through activation of NFkB signaling by MIP-1g .Wefirst observed thatPSGL-1–deficientmice (i.e., ApcMin/þ;PSGL-1�/�mice and PSGL-1�/� transgenicmice) showed an acceleratedgrowth of intestinal tumors and xenograft tumors, respectively.We then demonstrated an upregulation of MIP-1g in the PSGL-1–deficient mice, and the increased MIP-1g level was likely derivedfrom the macrophages which may have produced MIP-1g viaactivation of NFkB pathway, promoting the intestinal tumori-genesis, as schematically shown in Fig. 6H.

PSGL-1 was reported to assist the rolling and migration ofmacrophages, T cells, and B cells (32), which are believed to be thekey effector cells linking the tumor microenvironment and tumordevelopment. Blockade of PSGL-1 was reported to decrease therecruitment of CD14þ monocytic cells and T cells to the intestinalmucosa andattenuate the established colitis in experimentalmurinemodels (33, 34). These data are consistent with our results in PSGL-1–deficientmice (Supplementary Fig. S5). Thesepublisheddata andour own results suggest that PSGL-1 deficiency could impair therecruitment of key immune cells such as leukocytes to the inflam-matory sites (35). PSGL-1–positive cells are associated with clinicalTNM stage, suggesting PSGL-1–positive cells play an important rolein the development of colorectal cancer. The role of PSGL-1 ingastrointestinal tumorigenesis is further supported by our findingsin a clinical study,which shows that thepresenceofPSGL-1–positivecells in the tumor tissues is positively correlated with a favorableTNM staging and lymph node metastasis, but if the lymph nodemetastasis in ApcMinþ; PSGL-1�/� mice would change compared toApcminþ mice that would need clarification in our next work.

Themechanisms by which PSGL-1 deficiency promotes tumor-igenesis are not clear. We proposed that key cytokines or chemo-kines produced in the PSGL-1–deficient mice are likely responsi-ble for increased tumor growth in these animals. We have shown

Figure 4.

MIP-1g promotes tumor cell growthin vitro. A, Expression of MIP-1g mRNAwas clearly detected by RT-PCR inmacrophages isolated from theperipheral blood of mice and RAW264.7cells (amousemacrophage cell line), butnot in the intestinal tumor cell linesHCT116, SW620, SW480, and CT26. B,Expression of the MIP-1g receptor CCR1was detected in the intestinal tumortissues from the ApcMin/þ mice by IHCanalysis, and CT26 cell line was detectedwith antibody CCR1 byWestern blotting.#1 and #2 indicated the repeat assays. C,CT26 cells were treated with variousconcentrations of MIP-1g for 24, 48, and72 hours, and the effect on cellproliferation was examined by MTTassay. MIP-1g induced a time- but notdose-dependent increase in theproliferation of CT26 cells. D, Asdemonstrated by flow cytometry,MIP-1g promotes cell-cycle progressionto G2–M phase. E, MIP-1g also promotesmigration of CT26 cells, asdemonstrated by the wound healingassay.



that PSGL-1 is mainly expressed in immune cells rather than incancer cells, and PSGL-1�/� mice exhibit increased serum level ofmacrophage-derived MIP-1g , suggesting that upregulation of MIP-1g may play a major role in accelerating the intestinal tumorigen-

esis. Thesefindingsare inaccordancewith thepublisheddata in thatmany chemokines were found to promote tumor growth throughvarious mechanisms such as stimulating angiogenesis, enhancingtumor cell proliferation, and dissemination (26, 28, 36, 37). In

Figure 5.

MIP-1g activates NFkB pathway in tumorcells. A, A commercial PCR kit specific forNFkB pathway–related gene of mRNAexpression was used to examine theeffect of MIP-1g on NFkB signaling. B, Thelevels of TNFa tumor tissues of ApcMin/þ

and ApcMin/þ;PSGL-1�/� mice weredetermined using an ELISA Kit. Data areexpressed as mean � SD. � , P < 0.05.C, The expression levels of TNFa andpP65 in the tumor tissues were alsodetermined by IHC. A significantlyincreased expression of TNFa was foundin the ApcMin/þ;PSGL-1�/� mice ascompared with ApcMin/þ mice (b and a,respectively). Similarly, there was asignificant increase in the expression ofpp65 in the nuclei of the tumor cellsderived from the ApcMin/þ;PSGL-1�/�

mice as compared with ApcMin/þ mice(d and c, respectively). Magnification:400�. D, Expression level of TNFa in theintestinal tumor tissues ofApcMin/þ;PSGL-1�/� and ApcMin/þ mice was determinedby Western blot analysis.E, CT26 cells with MIP-1g treatment(20 ng/mL) led to a significantupregulation of pP65 in cell unclear andcytoplasmic protein, as determinedby Western blotting assay. F,Immunofluorescent staining of pp65in CT26 cells treated with or withoutMIP-1g . Magnification, 400�.

Li et al.


support of these data, previous studies have demonstrated thatupregulation of many chemokines (such as CCL7, CCL20, CCL25,CXCL1, and CCL26) and chemokine receptors (such as CCR8,CCR6, and CXCR2) in tumor tissues was mechanistically linked tothe tumor growth (38). The other potential mechanism is thatPSGL-1 may affect the differentiation of hematopoietic stem cellsand disturb the cells of myeloid lineage to develop into granulo-

cytes, monocytes, megakaryocytes, and dendritic cells, therebyaffecting the homeostasis of immune system, and impairing theself-renewal and differentiation of hematopoietic stem cells (20).

The tumor-promoting effect of chemokines is believed to berelated to their role in facilitating trafficking of leukocytes intotumor microenvironment. In our study, we demonstrated thattumor cells express MIP-1g receptor (CCR1) and MIP-1g could

Figure 6.

PSGL-1–positive cells in tumor were associated with clinical characteristics. A, IHC analysis representative image shows that cell membranous immunoreactivityfor PSGL-1 were present in different clinical stages—Adenoma (A, PSGL-1-positive cells present in peritumoral of adenoma), I (B), II (C), III (D), and IV (E) stage(brown, DAB, PSGL-1; blue, hematoxylin stain, nucleus). B, Statistical diagram shows that the PSGL-1–positive cells appear in different clinical stages of 0/I,II, IV, and were negatively correlated with clinical stage (F, � , P < 0.05; �� , P < 0.01, and �� , P < 0.001) in colorectal cancer patients. C, The number of PSGL-1–positivecells is associated with lymphatic metastasis (G, �� , P < 0.001; ns, no significance). D, A schematic diagram showing the possible mechanisms of the tumor-promoting role of MIP-1g in intestinal tumors in mice (H).



directly promote tumor cell growth via a ligand–receptor inter-action. Our data are supported by the previous reports that tumorcells express chemokine receptors and they can acquire the abilityof directly responding to chemokines (39). It should be men-tionedhere thatMIP-1g expressionwasonly found in the immunecells of mice, but not humans, and the tumor cells do not expressMIP-1g . We also identified the presence of the conserved domainof MIP-1g in IL8, CCL5, and other chemokines (data not shown).On the other hand, nearly all cytokine domains can be found onMIP-1g , and some domains have been explored as the therapeutictargets for inflammatory diseases and cancers. These data suggestthat MIP-1g contains a highly conserved domain that is related tothe classical function of chemokines. This is supported by ourfinding that MIP-1g could activate NFkB, a classic transcriptionfactor involved in innate immunity, inflammation, and cancerdevelopment. Previous studies have revealed that MIP-1g couldpromote osteoclast formation and survival through activation ofcanonical NFkB signaling pathway (40). In our study,MIP-1g wasfound to potently activate the NFkB signaling. We thereforepropose that the tumorigenic effect of PSGL-1 deficiency may bemediated through enhancing the secretion of MIP-1g via NFkBsignaling. In addition, upregulation of MIP-1g may stimulate theWNT/b-catenin signaling,which is also a tumorigenic pathway forintestinal cancers (Supplementary Fig. S7). Activation of WNT/b-catenin pathway byMIP-1g may also play a role, but this awaitsfurther studies to confirm.

Previous studies have shown that PSGL-1 deficiency may affectthe immune cell differentiation and neutrophil function, andtherefore contribute to tumor growth (41). Our data have con-firmed that macrophages are themajor source ofMIP-1g in PSGL-

1–deficient mice, and it is not clear whether MIP-1g drives thetransition of M1 macrophages to M2 macrophages, which havebeen shown to exert tumor-promoting effect (42–44). Detailedmechanisms for MIP-1g upregulation in the setting of PSGL-1deficiency and the mechanisms by which MIP-1g promotestumorigenesis require further studies.

In summary, our data convincingly show that PSGL-1 deficien-cy promotes tumor growth by secreting MIP-1g , and the presenceof PSGL-1–positive cells in tumor tissues is associated with afavorable patient survival in colorectal cancer patients. Furtherstudies to clarify the molecular mechanisms involved in theoncogenic effect of MIP-1g and whether MIP-1g holds any poten-tial as a therapeutic target for intestinal cancers are warranted.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: J. Li, Z. Zhou, L. Zheng, Q.-Q. Zhang, X.-D. He, C. Yu,L. WangDevelopment of methodology: J. Li, Z. Zhou, C.-L. Qi, X.-D. HeAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J. Li, Z. Zhou, D. He, Y. Ye, X.-D. He, C.-K. ShaoAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. Li, Z. Zhou, X. Zhang, Q.-Q. Zhang, X.-D. He, C. Yu,L. Qiao, L. WangWriting, review, and/or revision of the manuscript: J. Li, Z. Zhou, X.-D. He,L. Qiao, L. WangAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): J. Li, Z. Zhou, Y. Ye, X.-D. He, C. YuStudy supervision: J. Li, Z. Zhou, C.-L. Qi, X.-D. He, L. Qiao, L. WangManagement and feeding mice: Z. Zhou, X.-D. He

AcknowledgmentsAll flow cytometry work was supported by and performed in the School of

Life Science, Sun Yat-sen University, and Guangdong Provincial Key Laboratoryof Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen MemorialHospital, Sun Yat-Sen University. We thankQiaobing Yuan for her assistance inanimal raising and histologic staining. The clinical samples were collected fromthe Department of Pathology, the Third Affiliated Hospital of Sun Yat-senUniversity.

Grant SupportThis work was supported by the National Natural Science Foundation of

China (grant nos. 81472336 and 31471290), the research and capacity buildingfor public welfare of Guangdong Province (grant nos. 2015A030302086 and2014A020212313), Pearl River S&T Nova Program of Guangzhou (grant no.201610010045), and Technology Planning Project of Guangdong Province(grant no. 2014B020212012).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 18, 2016; revisedDecember 4, 2016; acceptedDecember6, 2016; published OnlineFirst January 20, 2017.

References1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer

statistics. CA Cancer J Clin 2011;61:69–90.2. Chen W, Zheng R, Zeng H, Zhang S. The incidence and mortality of major

cancers in China, 2012. Chinese J Cancer 2016;35:73.3. Su LK, Kinzler KW, Vogelstein B, Preisinger AC, Moser AR, Luongo C, et al.

Multiple intestinal neoplasia caused by amutation in themurine homologof the APC gene. Science 1992;256:668–70.

4. Dove WF, Clipson L, Gould KA, Luongo C, Marshall DJ, Moser AR, et al.Intestinal neoplasia in the ApcMin mouse: independence from themicrobial and natural killer (beige locus) status. Cancer Res 1997;57:812–4.

5. Slattery ML, Wolff RK, Herrick J, Caan BJ, Samowitz W. Tumor markersand rectal cancer: support for an inflammation-related pathway. Int JCancer 2009;125:1698–704.

Table 1. Clinicopathologic data and correlation with PSGL-1 expression in 38patients with primary colorectal cancers

Number of PSGL-1 cellsClinical feature Number High Low P

Gender 0.7205Male 28 8 (28.57%) 20 (71.42%)Female 10 4 (40%) 6 (60%)

Age 0.4417>60 33 10 (56%) 24 (47%)�60 5 2 (49%) 3 (51%)

Lymph node metastasisa,b 0.0008N0 18 9 (50%) 9 (50%)N1 7 0 (0%) 5 (71.42%)N2 7 1 (14.28%) 6 (85.71%)

TNM stagea,b 0.00065I–II 21 16 (76.19%) 5 (23.8%)III–IV 17 1 (5.8%) 16 (94.12%)

NOTE: The low of number of PSGL-1 cells indicate less 20 cells in each 400�fieldunder microscope.aPartial data are not available, and the all statistics were based on the infor-mative data.bLymph node metastasis was defined by results in the final pathologic analysis.

Li et al.


6. Laszik Z, Jansen PJ, Cummings RD, Tedder TF, McEver RP, Moore KL.P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid,lymphoid, and dendritic lineage and in some nonhematopoietic cells.Blood 1996;88:3010–21.

7. Sultana DA, Zhang SL, Todd SP, Bhandoola A. Expression of functionalP-selectin glycoprotein ligand 1 on hematopoietic progenitors is develop-mentally regulated. J Immunol 2012;188:4385–93.

8. Zarbock A, Muller H, Kuwano Y, Ley K. PSGL-1-dependent myeloidleukocyte activation. J Leukoc Biol 2009;86:1119–24.

9. WangHB,Wang JT, Zhang L, Geng ZH, XuWL, Xu T, et al. P-selectin primesleukocyte integrin activation during inflammation. Nat Immunol 2007;8:882–92.

10. Tchernychev B, Furie B, Furie BC. Peritoneal macrophages express both P-selectin and PSGL-1. J Cell Biol 2003;163:1145–55.

11. Baggiolini M. Chemokines and leukocyte traffic. Nature 1998;392:565–8.12. Tamba S, Yodoi R, Segi-Nishida E, Ichikawa A, Narumiya S, Sugimoto Y.

Timely interaction between prostaglandin and chemokine signaling is aprerequisite for successful fertilization. Proc Natl Acad Sci U S A 2008;105:14539–44.

13. Raman D, Baugher PJ, Thu YM, Richmond A. Role of chemokines in tumorgrowth. Cancer Lett 2007;256:137–65.

14. Payne AS, Cornelius LA. The role of chemokines in melanoma tumorgrowth and metastasis. J Invest Dermatol 2002;118:915–22.

15. Wang JM, Deng X, Gong W, Su S. Chemokines and their role in tumorgrowth and metastasis. J Immunol Methods 1998;220:1–17.

16. Sun Y, Peng D, Lecanda J, Schmitz V, Barajas M, Qian C, et al. In vivo genetransfer of CD40 ligand into colon cancer cells induces local production ofcytokines and chemokines, tumor eradication and protective antitumorimmunity. Gene Ther 2000;7:1467–76.

17. XiaoH, YinW, KhanMA, GulenMF, ZhouH, ShamHP, et al. Loss of singleimmunoglobulin interlukin-1 receptor-related molecule leads toenhanced colonic polyposis in Apc(min) mice. Gastroenterology 2010;139:574–85.

18. Yang J, Hirata T, Croce K, Merrill-Skoloff G, Tchernychev B, WilliamsE, et al. Targeted gene disruption demonstrates that P-selectin glyco-protein ligand 1 (PSGL-1) is required for P-selectin-mediated but notE-selectin-mediated neutrophil rolling and migration. J Exp Med 1999;190:1769–82.

19. Noh H, Eomm M, Han A. Usefulness of pretreatment neutrophil tolymphocyte ratio in predicting disease-specific survival in breast cancerpatients. J Breast Cancer 2013;16:55–9.

20. Carlow DA, Gossens K, Naus S, Veerman KM, Seo W, Ziltener HJ. PSGL-1function in immunity and steady state homeostasis. Immunol Rev 2009;230:75–96.

21. Poltorak AN, Bazzoni F, Smirnova II, Alejos E, Thompson P, Luheshi G,et al. MIP-1 gamma: molecular cloning, expression, and biological activ-ities of a novel CC chemokine that is constitutively secreted in vivo.J Inflamm 1995;45:207–19.

22. Razmkhah M, Arabpour F, Taghipour M, Mehrafshan A, Chenari N,Ghaderi A. Expression of chemokines and chemokine receptors inbrain tumor tissue derived cells. Asian Pac J Cancer Prev 2014;15:7201–5.

23. Fusi A, Liu Z, Kummerlen V, Nonnemacher A, Jeske J, Keilholz U. Expres-sion of chemokine receptors on circulating tumor cells in patients withsolid tumors. J Transl Med 2012;10:52.

24. Masai K, Iwashita Y, Tominaga M, Hirano S, Shibata K, Matsumoto T, et al.mRNA expression of chemokine receptors in hepatic and pancreatic tumorcell lines. Gan To Kagaku Ryoho 2004;31:1261–3.

25. ClemetsonKJ, Clemetson JM, ProudfootAE, PowerCA, BaggioliniM,WellsTN. Functional expression of CCR1, CCR3, CCR4, and CXCR4 chemokinereceptors on human platelets. Blood 2000;96:4046–54.

26. Dairaghi DJ, Oyajobi BO, Gupta A, McCluskey B, Miao S, Powers JP, et al.CCR1 blockade reduces tumor burden and osteolysis in vivo in a mousemodel of myeloma bone disease. Blood 2012;120:1449–57.

27. BignonA, Gaudin F, Hemon P, TharingerH,Mayol K,Walzer T, et al. CCR1inhibition ameliorates the progression of lupus nephritis in NZB/W mice.J Immunol 2014;192:886–96.

28. Lee MM, Chui RK, Tam IY, Lau AH, Wong YH. CCR1-mediated STAT3tyrosine phosphorylation and CXCL8 expression in THP-1 macrophage-like cells involve pertussis toxin-insensitive Galpha(14/16) signaling andIL-6 release. J Immunol 2012;189:5266–76.

29. Kitamura T, Fujishita T, Loetscher P, Revesz L, Hashida H, Kizaka-KondohS, et al. Inactivation of chemokine (C-C motif) receptor 1 (CCR1) sup-presses colon cancer liver metastasis by blocking accumulation of imma-ture myeloid cells in a mouse model. Proc Natl Acad Sci U S A 2010;107:13063–8.

30. Rodero MP, Auvynet C, Poupel L, Combadiere B, Combadiere C. Controlof both myeloid cell infiltration and angiogenesis by CCR1 promotes livercancer metastasis development in mice. Neoplasia 2013;15:641–8.

31. Hoos A, Protsyuk D, Borsig L. Metastatic growth progression caused byPSGL-1-mediated recruitment ofmonocytes tometastatic sites. Cancer Res2014;74:695–704.

32. Moore KL, Patel KD, Bruehl RE, Li F, Johnson DA, Lichenstein HS, et al.P-selectin glycoprotein ligand-1mediates rolling of human neutrophils onP-selectin. J Cell Biol 1995;128:661–71.

33. Rijcken EM, Laukoetter MG, Anthoni C, Meier S, Mennigen R, Spiegel HU,et al. Immunoblockade of PSGL-1 attenuates established experimentalmurine colitis by reduction of leukocyte rolling. Am J Physiol GastrointestLiver Physiol 2004;287:G115–24.

34. Inoue T, Tsuzuki Y, Matsuzaki K, Matsunaga H, Miyazaki J, Hokari R, et al.Blockade of PSGL-1 attenuates CD14þ monocytic cell recruitment inintestinal mucosa and ameliorates ileitis in SAMP1/Yit mice. J Leukoc Biol2005;77:287–95.

35. Sreeramkumar V, Adrover JM, Ballesteros I, CuarteroMI, Rossaint J, BilbaoI, et al. Neutrophils scan for activated platelets to initiate inflammation.Science 2014;346:1234–8.

36. Swamydas M, Ricci K, Rego SL, Dreau D. Mesenchymal stem cell-derivedCCL-9 and CCL-5 promote mammary tumor cell invasion and the acti-vation of matrix metalloproteinases. Cell Adh Migr 2013;7:315–24.

37. Long H, Xie R, Xiang T, Zhao Z, Lin S, Liang Z, et al. Autocrine CCL5signaling promotes invasion and migration of CD133þ ovarian cancerstem-like cells via NF-kappaB-mediated MMP-9 upregulation. Stem Cells2012;30:2309–19.

38. Acharyya S, Oskarsson T, Vanharanta S, Malladi S, Kim J, Morris PG, et al.A CXCL1 paracrine network links cancer chemoresistance and metastasis.Cell 2012;150:165–78.

39. Schimanski CC, Schwald S, Simiantonaki N, Jayasinghe C, Gonner U,Wilsberg V, et al. Effect of chemokine receptors CXCR4 and CCR7 on themetastatic behavior of human colorectal cancer. Clin Cancer Res 2005;11:1743–50.

40. Okamatsu Y, Kim D, Battaglino R, Sasaki H, Spate U, Stashenko P. MIP-1gamma promotes receptor-activator-of-NF-kappa-B-ligand-induced oste-oclast formation and survival. J Immunol 2004;173:2084–90.

41. Coffelt SB, Kersten K, Doornebal CW, Weiden J, Vrijland K, Hau CS, et al.IL-17-producing gammadelta T cells and neutrophils conspire to promotebreast cancer metastasis. Nature 2015;522:345–88.

42. Wynn TA, Chawla A, Pollard JW. Macrophage biology in development,homeostasis and disease. Nature 2013;496:445–55.

43. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progressionand metastasis. Cell 2010;141:39–51.

44. Pollard JW. Tumour-educated macrophages promote tumour progressionand metastasis. Nat Rev Cancer 2004;4:71–8.



inﬂ psgl-1,deﬁ activates macrophages to promote colorectal … · oncogenes and tumor...

Documents