interactions with hosts and pathogens -a history of close calls-
DESCRIPTION
Interactions with Hosts and Pathogens -a history of close calls-. Clint Magill Professor of Genetics Department of Plant Pathology & Microbiology Texas A&M University. 4N maize X 4N sorghum . ‘Rescued’ embryos. Pathogen Variability. Anthracnose of Sorghum. 18 isolates. 17 pathotypes. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/1.jpg)
Interactions with Hosts and Pathogens-a history of close calls-
Clint MagillProfessor of Genetics
Department of Plant Pathology & MicrobiologyTexas A&M University
![Page 2: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/2.jpg)
4N maize X 4N sorghum
• ‘Rescued’ embryos
![Page 3: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/3.jpg)
Pathogen Variability
Louis Prom & Ramasamy Perumal
18 isolates 17 pathotypes
Anthracnose of Sorghum
![Page 4: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/4.jpg)
Rice Blast
![Page 5: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/5.jpg)
Complementing di-auxotrophsPyricularia oryzae
Dennis Genovesi
nic-, ura-
buf, lys-
leu-, ade-
lys-, met-
![Page 6: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/6.jpg)
1N and 2N conidia
Parasexual origin of new pathotypes?
![Page 7: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/7.jpg)
Anther Culture and Rice Chloroplast DNA
Chantel Scheuring
![Page 8: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/8.jpg)
Aberrant Ct DNA in Albinos
Green
Albino
Albino
Green
Alberto Livore
![Page 9: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/9.jpg)
Texmont Rice
![Page 10: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/10.jpg)
Pathogenic Race Changes
Bai Chai Wu
![Page 11: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/11.jpg)
Stable M. grisea Strain
![Page 12: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/12.jpg)
Unstable M. grisea Strain
![Page 13: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/13.jpg)
Phymatotrichum omnivorum
Cotton root rot
grapes
fruit trees (pear)
![Page 14: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/14.jpg)
DNA methylation in P. omnivorum
Mol% C Mol% 5mC % C’s methylated
Mycelium 21.65 +/- 0.08 0.78 +/- 0.07 3.5
Sclerotia 20.39+/- 0.19 2.27+/- 0.08 10.1
P. omnivorum grew in 5AZA C; the sclerotia that formed had no 5mC and did not germinate
Jane Magill, Eldon Jupe
![Page 15: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/15.jpg)
Pathogen-induced host defense -mRNA
Oscar Joost, Al Bell, Bob Stipanovic
![Page 16: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/16.jpg)
CVVK CVVK
HMGR CoA-reductase(first step in terpenoid phytoalexin synthesis)
![Page 17: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/17.jpg)
Chan Benedict, Jingao Liu
![Page 18: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/18.jpg)
- gossypol
![Page 19: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/19.jpg)
![Page 20: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/20.jpg)
Gail Martin
![Page 21: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/21.jpg)
Sorghum Defense Responses
Cory Cui
(PAL is the first step in flavonoid phytoalexin biosynthesis)
![Page 22: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/22.jpg)
Head Smut; Sphacelotheca reiliana
![Page 23: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/23.jpg)
Stealth pathogen- no response
![Page 24: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/24.jpg)
Grain mold/Curvularia & Fusarium
Chris Little, Seriba Katilé
![Page 25: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/25.jpg)
AFP mRNA levels in sorghum glumes 48 h post inoculation with Curvularia lunata (CL), Fusarium thapsinum (FT), water (control) or
both CL+FT.
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
RTx430+CL
RTx430+CL+FTRTx430+control
RTx430+FTSC170+CL
SC170+CL+FT SC170+Control
SC170+FTSureno+CL
Sureno+CL+FT Sureno+control
Sureno+FT TX2911+CL
TX2911+CL+FTTX2911+control
TX2911+FT
RTx430 SC170 Sureno TX2911
![Page 26: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/26.jpg)
PR10 mRNA levels in glumes 48h p.i.
RTx430 SC170 Sureno TX2911
![Page 27: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/27.jpg)
P. sorghi• conidia-asexual spores
• antheridum and oogonium forming in leaf tissue
![Page 28: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/28.jpg)
Downy mildews of Andropogonea
• Peronosclerospora sorghi• P. maydis• P. sacchari• P. philippinensis (select agent)• P. zeae• Sclerophthora rayssiae (select agent)• Sclerospora graminicola
![Page 29: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/29.jpg)
P. sorghi
Infected seed, with glume
Healthy seed, with glume
Infected seed, no glume
Healthy seed, no glume
Dot-Blot Hybridizations; probe pMLY12
Colletotrichm graminicola
Acremonium strictum
Fusarium moniliforme
Infected seed, glumes 40d
Infected seed, no glumes 40d
Chenglin Yao
![Page 30: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/30.jpg)
ITS 1 ITS 2 & 5.8sP. sorghi pt1
P. sorghi Thai1P. sorghi Thai2
P. maydis
P. sacchari
P. sorghi pt1P. sorghi Thai1P. sorghi Thai2
P. maydis
P. sacchariM M
PCR using conserved ITS primers
![Page 31: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/31.jpg)
Nebulize genomic DNA withHaeIII, RsaI, and DraI+ 50 ng of RNaseA
2. Ligate adaptersAP11 (5´CTCTTGCTTAGATCTGGACTA3´) &AP12 (5´pTAGTCCAGATCTAAGCAAGAGCACA3´, where p = 5´ phosphate)
3. Amplifyby PCR using AP11 primer
4. Hybridize with di & tribiotinylated oligos(TG/AC, CA/GT, GA/CT,CAA, AGG and GTT)
5. Select with streptavidin-coatedparamagnetic beads
6. Elution Of captured DNA
7. Remove residual oligos
8. Amplifyby PCR using AP11 primer
9. Cloning, Squencing,Identifying SSRs,
Primer Designing &Pathotypes genotyping
Microsatellite Capture
SSR’s for DM
![Page 32: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/32.jpg)
Ramasamy Perumal
Cluster analysis of DM species based on 54 Simple Sequence Repeats
![Page 33: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/33.jpg)
R gene taggingSorghum anthracnose example
Midrib infection Stem infection Seed infection
![Page 34: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/34.jpg)
Co-segregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands.
Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1 allele was 152 bp (BTx623) or 155 bp (SC748-5)
Ramasamy Perumal
![Page 35: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/35.jpg)
Jae Min Cho and Andy Paterson
![Page 36: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/36.jpg)
Sorghum RGA Map
![Page 37: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/37.jpg)
Claviceps africana: Ergot
![Page 38: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/38.jpg)
![Page 39: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/39.jpg)
![Page 40: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/40.jpg)
![Page 41: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/41.jpg)
RNAi against cotton nematodes
Root-Knot
reniform
![Page 42: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/42.jpg)
• Two species causing large losses in Texas – Root knot = Meloidogyne incognita– Reniform = Rotylenchulus reniformis
• Plan– ID ‘matching’ sequences in genes of both species that are lethal if
knocked out in C. elegans– Prepare hairpin construct to express in cotton
• a) roots• b) constitutively (CaMV 35S promoter)
• So far– No common sequences, but individual constructs made– Transient expression in root cultures worked well– Transgenic plants look very promising
Keerti Rathore and Jim Starr
![Page 43: Interactions with Hosts and Pathogens -a history of close calls-](https://reader035.vdocument.in/reader035/viewer/2022062814/56816739550346895ddbecdb/html5/thumbnails/43.jpg)
THANKS
To you for listening and to
TRRFSeveral USDA Collaborative AgreementsINTSORMILTARPThe Sorghum Checkoff ProgramGlobal Crop Diversity TrustTexas A&M Agrilife Research (formerly TAES)
For Research $$