interested in european research? · 2015-08-11 · interested in european research? research*eu is...

Interested in European research?

Research*eu is our monthly magazine keeping you in touch with main developments (results, programmes, events, etc.). It is available in English, French, German and Spanish. A free sample copy or free subscription can be obtained from:

European Commission Directorate-General for ResearchCommunication UnitB-1049 BrusselsFax (32-2) 29-58220E-mail: [email protected]: http://ec.europa.eu/research/research-eu

EUROPEAN COMMISSION

Directorate-General for ResearchDirectorate G - Industrial TechnologiesUnit G.4 - Nano- and converging Sciences and Technologies

Contact: Dr Christos Tokamanis, Dr Sophia Fantechi

Email:

[email protected]

[email protected]

Internet: http://cordis.europa.eu/nanotechnology

European Commission

EUR 23733 - EuroNanoForum 2009

Luxembourg: Offi ce for Offi cial Publications of the European Communities

2009 — 334 pp. — 21.0 x 29.7 cm

ISBN 978-92-79-12973-5DOI 10.2777/38933

euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-cover-04.indd 2euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-cover-04.indd 2 16.10.2009 10:30:2916.10.2009 10:30:29

1

EUROPEAN COMMISSION

EuroNanoForum 2009

Nanotechnology for Sustainable Economy

European and International Forum on Nanotechnology

Edited by: Sophia Fantechi (Directorate-General for Research, European Commission)Lenka Havlíčková, Eva Svobodová, Rudolf Fryček and Vladimír Albrecht (Technology Centre ASCR)

Version 2, July 2009

Proceedings of the Forum organized by the Technology Centre of the Academy of Sciences of theCzech Republic, with the support of the Czech Ministry of Education Youth and Sports

and the European Commission, held in Prague on 2-5 June 2009 as an offi cial eventof the Czech Presidency of the Council of the European Union

Directorate-General for Research2009 Cooperation / Nanosciences, nanotechnologies, materials, and new production technologies EUR 23733

euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-08.indd 1euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-08.indd 1 26.10.2009 14:03:5826.10.2009 14:03:58

2

EUROPE DIRECT is a service to help you fi nd answers to your questions about the European Union

Freephone number (*):

00 800 6 7 8 9 10 11(*) Certain mobile telephone operators do not allow access to 00 800 numbers

or these calls may be billed

LEGAL NOTICE

Neither the European Commission nor any person acting on behalf of the Commission is responsible for the use which might be made of the following information.

The views expressed in this publication are the sole responsibility of the authors and do not necessarily refl ect the views of the European Commission.

A great deal of additional information on the European Union is available on the Internet.It can be accessed through the Europa server (http://europa.eu).

Cataloguing data can be found at the end of this publication.

Luxembourg: Offi ce for Offi cial Publications of the European Communities, 2009

ISBN 978-92-79-12973-5DOI 10.2777/38933

© European Communities, 2009Reproduction is authorised provided the source is acknowledged.

Printed in Czech Republic


3

Acknowledgements

EuroNanoForum 2009 has been organized by the Technology Centre ASCR with the support of the European Commission and the Czech Ministry for Education Youth and Sports as the fourth conference of a set of international nanotechnology conferences organized within the framework of national Presidencies of the European Union. The 4-day event, held from 2nd to 5th of June 2009 at the Prague Congress Centre, has gathered almost 800 participants from 36 countries. Focusing on "Nanotechnology for sustainable economy", EuroNanoForum 2009 has addressed the state-of-the art of key application areas of nanotechnologies as well as the challenges for nanotechnology research and innovation to contribute to a sustainable development of the European society, such as the need for reduction in carbon emissions and fossil fuels dependence, the substantial increase in energy demand, pollution control, clean water management and sustainable quality of life of the European citizens. Moreover, the Forum has created a unique opportunity for researchers and industrial experts coming from diverse fi elds of science and technology to meet, discuss and co-operate, and to contribute to the defi nition of a European nanotechnology strategy after 2009.

A large number of colleagues of the European Commission contributed to the success of EuroNanoForum 2009, with their suggestions, ideas and exchanges of views.

In particular, special thanks go to the Members of the Interservice Group on Nanotechnology for positively supporting this event of high strategic importance for the Directorate for Industrial Technologies of Directorate-General for Research.

We would also like to express gratitude to the Members of the International Advisory Board of ENF2009, the Scientifi c Committee of ENF2009 and the Czech National Advisory Board of the event for all their positive support and inspiring ideas.

Thanks go also to the Ministry of Education, Youth and Sports of the Czech Republic and to all the high-level speakers, poster authors, participants and exhibitors, from Europe and the world, for their valuable contribution and active participation in making EuroNanoForum 2009 a unique event.

The Editors

Sophia Fantechi Petra Perutková

European Commission Lenka Havlíčková

Directorate-General for Research Eva Svobodová

Industrial Technologies Directorate Rudolf Fryček

Nano- and converging sciences and technologies Unit Vladimír Albrecht

Technology Centre ASCR, Czech Republic


4

Forewords

The title of EuroNanoForum 2009, i.e. the “Nanotechnology for sustainable economy” is a big challenge for the time being. When preparation of the EuroNanoForum 2009 started, the very frequent adjective of nanotechnology was „the technology for the 21st century“, i.e. the far reaching time horizon signifi ed the role of nanotechnology. However, in a year time the world has changed considerably and the ENF2009 takes place in a time of global fi nancial crisis and economic recession. Hence, we would like to overcome the crisis even by employing the already developed potential of the nanotechnology to radically change the technology portfolios.

This book of abstracts convincingly indicates the rich potential of nanotechnology: the organizers obtained almost four hundred contributions. They cover very broad spectrum of scientifi c problems, applications of nanotechnology for health, environment, eco-and-energy effi cient industrial production, for energy production and storage and for a number of special industrial sectors. They also tackle about social and environmental safety and deal with “horizontal issues “ like education and communication, organizing international research in this particular fi eld etc.

While the current potential of nanotechnology is mapped in this book of abstracts, some important achievements of nanotechnology are demonstrated at the ENF2009 industrial exhibition, which are however reported in a separate catalogue.

The ENF2009 is organised by the European Commission and the Technology Centre of the Academy of Sciences in the framework of the Czech Republic Presidency of the EU Council.

The organizing parties believe, that the ENF2009 scientifi c programme with its many plenary discussions and complemented by several concomitant workshops and the industrial exhibition will create a good platform for effi cient contributing to fi nd common ground for solving important problems of our time.

Miroslava Kopicová

Minister of Education, Youth and Sports


5

I am pleased to present you EuroNanoForum 2009, an offi cial event of the Czech presidency of the EU and the fourth international nanotechnology conference supported by the European Commission.

More than ever, in times of global economic and fi nancial crisis, nanotechnology can off er a boost to promising new business opportunities for industries and investors, and be a source of sustainable growth and new jobs.

The current crisis has put sustainability even more strongly on the agenda and this is why the leading theme of EuroNanoForum 2009 - “Nanotechnology for Sustainable Economy” - is particularly well chosen. The conference will focus on the contribution of nanotechnology research towards reducing carbon emissions and fossil fuel dependence; enhancing our material and manufacturing sustainability; improving pollution control, clean water management and environmental quality; as well as sustainable healthcare.

And focus on putting European R&D at the service of sustainable development is essential. Not only for our future in general, is it also essential for the future of research itself. Why? Because it is only if the value of research is understood and appreciated by citizens that policy makers will fi nd the support and legitimacy to raise the level of public research funding. Whether individuals have hopes or fears about what the future will bring, research and the knowledge and technology it generates, has a role in helping realise those hopes or lessen those fears. This is true more than ever within the development of nanotechnologies. If we want to preserve Europe’s leading position in nanotechnology and exploit its full potential, we must make sure that applications are developed safely and responsibly, taking all societal concerns and implications into consideration.

EuroNanoForum engages all those involved in the development of nanotechnologies to act responsibly through an international, open and transparent dialogue. In this endeavour, each of us has a contribution to make.

With this in mind, for the organisers and participants of EuroNanoForum 2009, and to all those engaged in research, development and industrial innovation in nanotechnology go my best wishes for a fruitful and most successful conference.

Janez Potočnik

European Commissioner for Science and Research


6


7

Table of contents

Acknowledgements 3

Forewords 4

Topic: Opening Session 8

Topic: Plenary Session 1 - Nanotechnology and sustainable growth 10

Topic: Plenary Session 2 - Eco-& Energy-effi cient industrial production 12

Topic: Plenary Session 3 - Nanotechnology for Energy and Environment 14

Topic: Plenary Session 4 - Nanotechnology applications for sustainable health care 17

Topic: Plenary Session 5 - Prospects for industrial nanotechnologies 18

Topic: Plenary Session 6 - Integrated, safe and responsible nanotechnology governance in the EU 21

Parallel Session A1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Sustainable production of Chemicals 24

Parallel Session A2 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in construction 25

Parallel Session A3 - Nanotechnology for energy - Nanotechnology for H2 production & Storage; Fuel cells 28

Parallel Session A4 - Nanotechnology for health and environment - Nanotechnology in pollution monitoring and remediation 30

Parallel Session A5 - Future industrial technologies - Bionanotechnology 33

Parallel Session A6 - Future industrial technologies - Supramolecular chemistry - Molecular electronics 37

Parallel Session B1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in transportation 42

Parallel Session B2 - Nanotechnology for energy - Photovoltaics and Thermoelectrics 46

Parallel Session B3 - Nanotechnology for health and environment - Nanotechnology applications for water treatment 49

Parallel Session B4 - Nanotechnology for Health and Environment - Bio non-bio interfaces in medical applications 52

Parallel Session B5 - Horizontal activities - Safety, environmental and health protection, LCA 55

Parallel Session B6 - Horizontal activities - Nanoengineering: from nanostructure characterisation to processing technologies 58

Parallel Session C1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in textile industry 61

Parallel Session C2 - Future industrial technologies - Nanophotonics, (O)LEDS 65

Parallel Session C3 - Nanotechnology in Eco- & Energy-effi cient industrial production - Nanotechnology in food and other consumer products 67

Parallel Session C4 - Future industrial technologies - Nanotechnology based materials 68

Parallel Session D1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Nanomanufacturing 71

Parallel Session D2 - Future industrial technologies - Nanoelectronics 73

Parallel Session D3 - Nanotechnology for Health and Environment - Nanomedicine - drug delivery 75

Parallel Session D4 - Future industrial technologies - Polymer nanocomposites & membranes 78

Parallel Session E1 - Nanotechnology for energy - Rechargeable batteries; Supercapacitors 82

Parallel Session E2 - Nanotechnology for Health and Environment - Nanomedicine - diagnostics 84

Parallel Session E3 - Horizontal activities - Standardization 87

Parallel Session E4 - Horizontal activities - ELSA 90

Parallel Session E5 - Horizontal activities - From national initiatives to integrating activities - Roadmap to paneuropean funding 92

Parallel Session E6 - Horizontal activities - Education 95

Parallel Session E7 - Horizontal activities - European Technology Platforms 98

Poster Session 1 - Nanotechnology in Eco- & Energy-effi cient industrial production 99

Poster Session 2 - Nanotechnology for energy 103

Poster Session 3 - Nanotechnology for health and environment 111

Poster Session 4 - Future industrial technologies 146

Poster Session 5 - Horizontal activities 185

Poster Session 6 - Late abstracts 201

Authors´s index 272

Conclusions 278

Organisation management 279

Annex I - Final programme 281

Annex II - Exhibitors catalogue 309

Practical information 324


8

Topic: Opening Session

Nanotechnologies: Their Promise for Sustainable Development Mr José Manuel Silva Rodríguez1

1Director-General for Research

Europe has the goal of becoming a competitive, knowledge-based economy, without neglecting the social and environmental sides. Nanotechnology is crucial for the improvement of Europe’s competitiveness and the quality of life of its citizens.

The fi nancial crisis has made the Commission put in place a recovery plan that also will be a forward looking investment acknowledging that the competitiveness of Europe depends on its potential for innovation.

Nanotechnology is a good example of this due to its potential to lead to applications that benefi t both European society and the European economy, promoting sustainability. Some of these applications are with us today; others are at an advanced research stage; and others show promise for the longer term.

Successive EU Framework Programmes for Research and national programmes have committed billions to research in nanotechnology. Results are already evident in four broad application areas: Materials and manufacturing; Information and Communication Technologies; Energy and Environment; and Health.

Nanotechnology is already improving materials and surfaces, increasing the value of existing products. Nanoelectronics is improving our lives and advances in this large fi eld are providing opportunities for growth and improving quality of life - just as microelectronics has done before it.

Most importantly will nanotechnologies make valuable contributions to sustainability, thanks to savings in energy and resources. Both manufacturing and chemistry can become cleaner through the use of new methods based on nanotechnology.

Another promising topic, also covered at this conference is Nanomedicine or the application of nanotechnology to health. Nanomedicine off ers many possibilities to improve diagnosis and therapy. It can tackle serious diseases, and it can make medical care both more eff ective and more aff ordable for society.

The benefi ts of nanotechnology to sustainability are expected to increase as converging sciences and technologies enable radical rather than incremental progress in research.

Under the 6th Framework Programme (FP6), almost 1.4 billion EUR of funding was invested in total. More than 550 projects were funded involving nanosciences and nanotechnologies. Over its lifetime, FP6 accounted for almost a third of total public expenditure in Europe in this area. FP6 has seen increasing industrial participation in nanotechnology projects. Also, the creation of several European Technology Platforms has strengthened public-private cooperation.

The 7th Framework Programme is already leading to further progress, with almost a billion EUR invested in the fi rst two years alone. And this does not include the large national investments.

Of course, nanotechnology raises the issue of safety. Human health and the environment must be protected. And ethical principles must be respected.

The Commission takes these issues seriously. It is working to ensure that the public can benefi t from the innovations that nanotechnologies may bring, while being protected from any adverse impacts. Research eff orts on human and environmental safety has seen nearly 50 MEUR already committed in this area between 2004 and 2008. It is expected that the total budget committed in Europe will increase, reaching a fi gure of at least 100 MEUR by 2013, thanks to FP7 and the corresponding investments of Member States.

To address ethical issues, the Commission made a Recommendation on a Code of Conduct for nanotechnology research. This is a voluntary Code of Conduct aiming to promote safe and responsible nanotechnology research; and pave the way for its safe and responsible application and use.

That said, we must not forget that private investment is lagging behind public investment. It is important that industrial participation and industrial funding should increase.

In reaping the rewards of nanotechnology we must make sure that excellent research is translated into tangible benefi ts. And we must make sure that applications are not brought about without a meaningful involvement of society. The Nanotechnology Action Plan (2005-2009) has served us well in supporting Europe’s integrated, safe and responsible approach and we intend to continue this line.

With this outline of the promise of nanotechnology, and how European eff orts to boost research capacity can and should work together, for the ultimate benefi t of European society and European industry, I trust that this event will be successful in presenting the achievements and further promise of nanotechnology for sustainable growth.


9

Sustainability in the 21st Century and the role of Nanoscience and NanotechnologyH. Kroto1

1Francis Eppes Professor of Chemistry, Florida State University, Tallahassee, USA

Our modern world is precariously balanced on Science, Engineering and Technology (SET); an understanding of these disciplines is vital by all in positions of signifi cant responsibility . Although wise

decision-making may not be guaranteed by knowledge, common sense suggests that wisdom is not a likely consequence of ignorance.

SET have revolutionised our lives and there is no doubt that humanitarian contributions have improved the quality of life in the developed world immeasurably. These improvements were brought about by

scientifi c/technological advances based on doubt and questioning - evidence dependent philosophies totally at variance with the belief-based concepts that underpin all mystical societal attitudes.

Society has the power to use technology so that it can be of benefi t or be detrimental. Political decisions have resulted in the existence of some 28,000 nuclear weapons worldwide; in addition it appears that our technologies may have catalysed a mindless plundering of the Planet’s resources. We may be hurtling towards disaster - we may not need an asteroid.

For a 50:50 chance of surviving into the next century, every segment of society, from industrialists, engineers and scientists to politicians, farmers and fi shermen must recognise that these issues are the most serious that the human race has ever confronted. Our only hope for survival rests on the shoulders of those who take survival and sustainability issues seriously - and do something about it.

I see a key role for “Nanoscience and Nanotechnology”, where Chemistry overlaps Condensed Matter Physics, Molecular Biology and Materials Engineering. Improved SET education is also vital.

We have manifestly failed in this endeavour but there may be one last hope: The Internet is a major new communications technology which we must exploit to educate people on a global scale in the rational attitudes to decision-making that are now vital to our very survival.


10

Plenary Sessions

Topic: Plenary Session 1 - Nanotechnology and sustainable growth

PL-01Sustainable development: a challenge for nanotechnologyP. Krüger1

1 Bayer MaterialScience AG, Leverkusen, Germany

Nanotechnology (NT) is in general considered as one of the key enabling technologies in the 21st century. Extreme high market volumes and growth rates were predicted by a multitude of market studies for NT enabled products and applications.

On the other hand side today’s society is faced with many essential challenges with respect to the protection of climate and environment for tomorrow’s generations.

Especially there is a strong need to fi nd new technology options for the conversion, storage and effi cient use of energy, to provide commercially viable solutions for a reliable power supply in the future. This is required among others for a signifi cantly reduced level of CO2-emissions, as targeted worldwide in many governmental programs and declarations, to avoid or at least mitigate a serious climate change.

The effi cient use of in general limited resources also besides of energy, such as water and raw materials as well as the prevention contaminations have to be also an essential element of next technology generations. Technologies for the remediation of air, water and soil will also become important to recover the heavily used environment.

Since NT is a versatile enabling platform with a wide impact on diff erent fi elds of materials, processes and applications, it can be utilized to gain many diff erent kind of sustainable solution options to protect or recover our environment, climate and to improve the quality of our life.

The close and intensive cooperation of academia, industry, politics as well as of other stakeholders in the society is urgently needed, to transfer excellent nano science to inventions and fi nally to nano based innovations. These innovations are basis for commercially viable sustainable products and processes along the value chain on a long time scale. Such innovation based incrementally improved or disruptive products and applications will also sustainably secure the position of European countries in the world wide economic competition in the future.

For the long term success of a sustainable NT to sustain our environment and climate as well as to improve our life the responsible safe handling and use of NT based innovations (e.g. such as nanomaterials and processes) has to be ensured This includes research on health and environment related topics, taking also care of potential exposure routs as well as considerations of the life cycle aspects.

This means that research for safety has to be an integral part of the NT based innovation strategy.

PL-02Nanotechnology Commercialization: Stealth Success, Broad ImpactM.M. Nordan1

1Lux Research Inc., New York, USA

Nanotechnology is not an industry or a sector - it’s a general-purpose toolkit that’s contributing to product innovation in virtually every fi eld of manufactured good. Emerging nanotechnology enabled nearly $250 billion in products in 2008, on track to exceed $3 trillion in 2015, but the vast majority of the applications - in fi elds ranging from automotive composites to battery electrodes - are never referred to with “nano” terminology. Nanotechnology’s impact will be broad and pervasive, but will not defi ne new clusters of economic activity - more like the assembly line than recombinant DNA. This talk will review the current status of nanotechnology commercialization and describe a ten-year future outlook based on Lux Research’s continuous technology scouting in the fi eld.

PL-25Nanotechnology and the Future of Information Technology W. Riess1

1IBM Research GmbH, Zurich Research Laboratory, Switzerland

Scaling of semiconductor technology (CMOS) has been the driving force for the success of information technology. However, as device dimensions continue to shrink into the nanometer length-scale regime, conventional semiconductor technology will be approaching fundamental physical limits. New strategies, including the use of novel materials and 1D-device concepts, innovative device architectures, and smart integration schemes need to be explored and assessed. They are crucial to extend current capabilities and maintain momentum beyond the end of the technology roadmap time frame (post-CMOS era).


11

Plenary Sessions

PL-03From research to nanotechnology business - a case study: the Nanochallenge initiativeN. Trevisan1

1Veneto Nanotech Scpa, The Italian Cluster of Nanotechnologies, Padova, Italy

Nanochallenge is an international business plan competition for business ideas in nanotechnology.

The competition aims at funding high-tech start-ups and at soliciting funds from early stage investors and venture capital fi rms.

A total amount of € 600.000 will be awarded at the 2009 Competition Final Contest. The winner of the nanotechnology Grand Prize will receive € 300.000.

The competition is organized by Veneto Nanotech - the Italian Cluster for Nanotechnology, that was founded in 2003 by the Italian Ministry for University and Research and by the Veneto Region (north-east Italy). Nanotechnology research in Veneto is very advanced. More than 600 Professors, Researchers and PhD Candidates are employed in local Universities and Research Centers. Such concentration of competences can also count on a series of links and collaborations with international Universities and Research Institutes.

In addition Veneto Nanotech activities include:

Development of facilities and technology transfer.

Education, training and dissemination.

Support of new entrepreneurship.

Innovation can be a bottom-up process. The program designed by Veneto Nanotech in 2005 to support new start-ups was Nanochallenge, a business plan competition which every year awards a seed capital investment of 300 K€ to the best business idea based on nanotechnology and since 2007, polymerchallenge off ers 300 K€ to best idea on polymer-based materials. Thanks to this initiative eight new enterprises have been founded so far. The competition attracts scientists, researchers and entrepreneurs from all over the world, that every year apply to compete.

Nanochallenge aims at:

Creating start-ups within the technological clusters.

Creating a network among research, fi nancial and entrepreneurial worlds.

Transferring innovation in existing enterprises, by presenting nanotechnology projects to be applied to their technologies or their products.

Attracting the best scientifi c talents.

Boosting private investments in research and high-tech business.

The 300 K€ is divided into 200 k€ in cash and 100 K€ in services which comprise: access to Veneto Nanotech facilities and structures, use of tools and machineries, offi ce spaces, legal support, commercial and marketing assistance, networking with venture capitalists and business angels for a second round of investments.Since 2005 Nanochallenge has become a successful brand bringing the following results:Total prize 2005-2007: 1,8 M EURO, Investments moved: 20 M EURO, Number of start-ups created: 8, Jobs created: 25, Applications received: 145, Countries of origin of the teams: 25, National and international fi nalist teams: 67, International scientists hosted for the Final Contest: 157, Venture capitalists involved in the jury: 15 of whom 5 Italians, 6 Europeans, 4 from USA

PL-27Nano-Bio-Info-Cognitive sciences - the base of a new convergent NBIC technology Mikhail Kovalchuk1 1General Director, Kurchatov Insitute, Russia

The main direction of technological evolution is synergetic integration (or converging) of four technologies: nanotechnologies, biotechnologies, including genetic engineering and protein crystallography, information technologies and neuro-cognitive technologies. This is a new trend in scientifi c development -nano-bio-info-cognitive technologies - NBIC technologies.

NBIC-technologies formation opens possibility for creation a new hybrid nanomaterials, nanosystems and nanodevices, combining advantages of living and non-living nature.

In particular we have in mind development of • biosensors, biochips and hybrid sensors on their basis;• neuro-electronic systems for interaction of human brain with computer and another technical systems;• bio- and antropomorphous roboto-technical arrangements and systems, etc

In the presentation the main points of developing the research and technological infrastructure at interdisciplinary “Kurchatov NBIC center” for nano-bio science and convergent technologies, based on dedicated synchrotron radiation source, research neutron reactor and supercomputer center are introduced.


12

Plenary Sessions

Topic: Plenary Session 2 - Eco-& Energy-effi cient industrial production

PL-04Make Money by Nano and respect Eco-and Energy effi ciency? Nano based products in construction, cleaning, health, cosmetics and other industriesA.E. Reinhardt1

1microTEC, Bad Dürkheim, Germany

In its fi rst part the presentation shows an overview how nanotechnologies support sustainable production and a new generation of high value products. The samples presented cover very diff erent fi elds, e.g. construction, cosmetics, health. By explaining realized applications of latest R&D results in their diff erent markets it is aimed to inspire the discussion how in future nano related research will be faster then ever before part of business strategies towards products off ering parallel fast return of investment, respect eco- and energy effi ciency in the whole life cycle of the product and are oriented towards the main goal: bring benefi t to the people and rescue the competitiveness of Europe. In its second part the presentation opens the way to tools for building contacts in Europe, start cooperative R&D projects and disseminate the results cost effi cient via services like cordis wire, business- and social networks like xing, twitter, eunanopaprika and others.

PL-05Nanotechnology in sustainable chemical productionM. Pridöhl1

1Evonik Degussa GmbH, Hanau, Germany

Technical processes in the chemical industry often require high energy input. On average 10% of the operating costs in chemistry are related to energy. The energy costs for producing large volume base chemicals reach up to 40%, making the chemical industry to one of the most energy consuming sectors. Therefore continious improvement of energy effi ciency is a top priority.

Promising concepts to improve the energy effi ciency are microreactors with increased heat and mass transport, innovative rection media like ionic liquids, new methods for selective and targeted enegy input and measures to increase yield, product concentration and selectivity of exisiting processes.

A key role in this context play catalysts. More than 80% of all chemicals products are produced with support of a catalyst. Catalyst lower the activation energy respectively the reaction temperatures, improve selectivity and yield and reduce waste streams. Thus new and improved catalysts are essential for further improving the energy effi ciency of chemical processes.

The interest in nanomaterials and metal nanoparticles (NPs) as catalysts is increasing dramatically, as refl ected by the large number of publications in the last years. Over 80 related articles have been published just in the last 5 months. Industrial relevant examples as the direct synthesis of hydrogen peroxide will be discussed.1

A related but brand new research topic are superparamagnetic nanoparticles acting as heterogeneous catalyst and additionally as energy source for chemical synthesis. These catalysts heat up in electromagnetic fi elds and provide the activation energy selectively at the catalyst surface improving energy effi ciency, turnover rate and process speed.2

The concept of selectively introducing energy by means of superparamagnetic particles can also be used to speed up technical processes like bonding and polymerization.3

Coatings against biofouling4 and improved thermoelectric materials are other promising developments of nanotechnology. Nano-structured coatings may help to maintain the effi ciency of heat exchangers. Nanostructuring greatly improved the performance of thermoelectric materials in the last years. This may allow to economically generate electrical power from waste heat and low temperature sources.5 [1] Jennifer K. Edwards and Graham J. Hutchings, Angew. Chem. Int. Ed. 2008, 47, 9192 - 9198[2] S. Ceylan, C. Friese, C. Lammel, K. Mazac, A. Kirschning, Angew. Chem. Int. Ed. 2008, 47, 8950 -8953[3] http://www.nanowerk.com/news/newsid=687.php[4] AMBIO, Integrated EU FP6 project[5] J. Sootsman, H. Kong, C. Uher, J. D_Angelo, Chun-I Wu, T. Hogan, T. Caillat, M. Kanatzidis, Angew. Chem. Int. Ed. 2008, 47, 8618 -8622


13

Plenary Sessions

PL-06Energy effi ciency in buildings: opportunities for sustainable innovations and the role of the E2B Association to make them happenS. Carosio1

1D’Appolonia S.p.A., Italy

The objective of the presentation is to provide an overview of the strategy that is being implemented at European level concerning energy effi ciency in new and existing buildings (including cultural heritage). In this framework the European Association for Energy Effi ciency in Buildings (E2BA) will be introduced, being an industry lead European Initiative grouping all the stakeholders in the value chain to work closely with the European Commission within an eff ective Public Private Partnership (EeB PPP). The EeB PPP is fostering the development and large scale demonstration of novel multidisciplinary solutions enabled, among the others, by nanotechnology and new materials. Some examples on how nano-technology could contribute to this paradigm shift will be shortly presented. In particular the use of nano-structured catalytic coatings in next generations of water electrolysers and hydrogen burners will be discussed, providing some insights concerning their use in combination with Renewable Energy Sources in buildings and districts of buildings.

PL-07Nanotechnologies Enabling Clean and Energy Saving mobilityV. Lambertini1

1Centro Ricerche Fiat, Micro and Nanotechnologies Department, Orbassano, Italy

The automotive industry is one of the largest demanding areas of materials and technologies to develop sustainable devices with great impact on safety, on-board well-being, environment compatibility and fuel saving. Since the mid nineties the potential applications of micro and nanotechnology in the automotive has been demonstrated practically in all systems and subsystems from the tyres to the roof and from the headlamps to the tail lamps. In 10 years, the design and manufacturing of cars will be signifi cantly aff ected by nanotechnology applied to 70% of automotive applications with expected market $6.46 billion (Frost & Sullivan). During the fi rst decade of quite intense R&D, micro-nanotechnology contributed to enhanced safety and comfort, but their main impact has been on the reduction of fuel consumption, noxious and green house gas emissions. The developments of new propulsion systems and the applications of nano catalysis for gasoline, diesel and natural gas systems can be considered the most relevant on energy saving and public health. All automotive manufacturers have spent considerable resources so that in spite that most car segments increased in size, weight and power, the overall consumes and emissions have decreased.

The evolutionary approach aiming at the use of micro nanotechnologies to enhance the current mobility based on Internal Combustion Engines will continue for several years, but we are now being confronted with the original expectation, micro-nano technologies as the enablers of the cleanest and the most eff ective energy savings form of mobility: the electrical vehicle.

With respect to the conventional road mobility based on Internal Combustion Engine cars, the major benefi ts related to the introduction of the full electrical mobility are: savings of the primary energy currently used in transportation (30-40% when the electricity is produced by the conventional thermoelectrical plants and up to 60% when the electricity is produced by renewable sources), reduction of green house emissions (40-50% if the electricity would be produced by the current European mix, and 10-15 times if the electricity would be produced by renewables) and zero local emissions of noxious emissions such as NOx, SOx and fi ne particles.

The availability of the state-of-the-art nanomaterials and micro-nano technologies is essential, but in this brief overview we emphasise that, when dealing with a complex product like an automobile, the success is determined by advanced sub-systems design and integration aiming at the optimisation fi rst of the major system blocks then at the vehicle as a whole. The major system blocks enabling high performance necessary in the forthcoming electrical mobility are shown in fi gure around PHYLLA, the Centro Ricerche Fiat mobile laboratory to support the research and industrial developments on Electrical Vehicles of the Fiat Group.


14

Plenary Sessions

Topic: Plenary Session 3 - Nanotechnology for Energy and Environment

PL-08Catalytic model systems studied by high-resolution, video-rate Scanning Tunneling MicroscopyF. Besenbacher1

1Aarhus University, Interdisciplinary Nanoscience Center, Aarhus, Denmark

Developing renewable, sustainable and green energy resources and securing the environment by reducing the emission pollutants are two of the largest challenges for the human civilization within the next 50 years. Besides the well-known energy resources that power the world today, petroleum, coal, and natural gas, active research and development is done exploring alternative energy resources such as solar, biomass, wind, and hydrogen.

To realize the vision of a clean society and our vision of plentiful, low cost sustainable energy, research and innovation within the area of the rapidly expanding fi elds of nanoscience and nanotechnology, multi-disciplinary by nature involving physics, chemistry, biology, molecular biology, is mandatory. For decades single-crystal surfaces have been studied under ultra-high vacuum (UHV) conditions as model systems for elementary surface processes. This “surface science approach” has contributed substantially to our understanding of the processes involved in especially catalysis.

In this talk I will show how Scanning Tunneling Microscopy (STM) can reveal fundamental processes in relation to catalysis, and how we can extract quantitative information on surface diff usion of adatoms and molecules [2-4]; diff usion of vacancies; interstitials and molecules, e.g. water molecules on oxide surfaces [5, 6, 7]; sintering and diff usion of nanoclusters on oxide surfaces [7]; diff usion of intermediate species [8-10]; identifi cation of active sites and determination of new nanostructures with novel, catalytic properties from time-resolved, high-resolution STM images/movies (see www.phys.au.dk/spm) [1]. The atomic-scale information obtained may even lead to the design of new and improved catalysts in certain cases [11-12].

References[1] F. Besenbacher, Reports on Progress in Physics 59, 1737 (1996) [2] T. Linderoth et al. Phys. Rev. Lett. 78, 4978 (1997) [3] S. Horch et al., Nature 398, 1344 (1999) [4] Roberto et al. Nature Materials, Nature Materials 3, 779 (2004) [5] R. Schaub et al., Science 299, 378 (2003); Science 303, 511 (2004)[6] S. Wendt et al., Physical Review Letters 96, 066107 (2006)[7] S. Wendt et al. Science 320, 1755 (2008)[8] D. Matthey, et al., Science 315, 1692 (2007) .[9] E. Kruse Vestergaard et al., Phys. Rev. Lett. 88, 259601 (2002)[10] J. V. Lauritsen et al., J. Catal. 197 1-5 (2001)[11] J. Kibsgaard et al, Journal of the American Chemical Society, 128, 13950 (2006).[12] F. Besenbacher et al., Science 279, 1913 (1998).


15

Plenary Sessions

PL-24Functionalized Nanomaterials for Solar Power Conversion and StorageM. Graetzel1

1Ecole polytechnique fédérale de Lausanne, Lausanne, Switzerland

The quality of human life depends to a large degree on the availability of energy sources. As a consequence of dwindling fossil resources and enhanced energy consumption due to the growth of the world population, a huge power supply gap of 14 terawatts, equaling today’s entire consumption is expected to open up by year 2050.

Nanotechnology is expected to make important contributions to identify environmentally friendly solutions of the energy supply problem the world is facing. The sun provides about 100’000 terawatts to the earth which amounts to six thousand times the present rate of the world’s energy consumption, Learning from the concepts used by green plants we have developed a molecular photovoltaic device whose overall effi ciency for solar energy conversion to electricity has already attained 12.2 %. The new solar cell is based on the sensitization of nanocrystalline titanium dioxide fi lms by a molecular dye [1-3]. The underlying fundamental processes of light harvesting by the sensitizer, ultrafast electron transfer from the electronically excited dye into the conduction band of the semiconductor oxide and the transport of the injected electrons through the mesoporous fi lm to the collector electrode will be analyzed in my lecture. The low cost and ease of production of the new cell should benefi t large-scale applications. Impressive stability both under long-term light soaking and high temperature stress has been reached fostering fi rst industrial applications. These systems will promote the acceptance of renewable energy technologies, not least by setting new standards of convenience and economy.

The lecture will also report on most recent progress in the use of nanotechnology for electric power storage in secondary lithium ion batteries.

References:[1] B. O’Regan and M. Grätzel “A Low Cost, High Effi ciency Solar Cell “ Nature, London 353, 1991.[2] U.Bach, D.Lupo, P.Comte, J.E.Moser, F.Weissörtel, J.Salbeck, H.Spreitzert and M.Grätzel, “Solid

State Dye Sensitized Cell Showing High Photon to Current Conversion Effi ciencies” Nature, 395, 550 (1998).

[3] M Grätzel , “Photoelectrochemical Cells” Nature 414, 338−344 (2001).

PL-09The role of atmospheric nano-particles in climate forcingJ.P. Putaud1

1European Commission, Joint Research Centre, Institute for Environment and Sustainability, Ispra, Italy

The average number concentration of particles in the lower atmosphere ranges from ca. 1000 to 100,000 cm-3 across Europe. Most of these particles have a diameter smaller than 100 nm (nano-particles). Some are from natural origin (sea spray, volcanic, desert dust, biogenic particles), most result from combustion processes (e.g. soot particles from Diesel engines, particles formed in the atmosphere from gaseous pollutants), and very few are engineered nano-particles across Europe. Most of these particles have a diameter smaller than 100 nm (nano-particles). Some are from natural origin (sea spray, volcanic, desert dust, biogenic particles), most result from combustion processes (e.g. soot particles from Diesel engines, particles formed in the atmosphere from gaseous pollutants), and very few are engineered nano-particles.

Atmospheric particles (also called aerosols) directly aff ect the Earth radiative budget by absorbing or scattering back to space a fraction of the solar radiation. Atmospheric particles also control the albedo and the lifetime of low stratiform clouds. Climate model simulations suggest that the global eff ect of aerosols is to cool the Earth. This cooling eff ect might have partly compensated the warming eff ect due to the increase of greenhouse gas concentrations over the industrial era.

However, atmospheric particles (also named as PM10, PM2.5, etc…) are thought to be harmful to human health. As a consequence, air quality directives set more and more stringent limits for particle emissions and atmospheric concentrations all over the world. It is therefore expected that the concentration of atmospheric particles will strongly decrease over the next decades.

While eff orts for improving air quality should undoubtedly be pursued, the consequences of air pollution abatement policies on climate change should however not be ignored. Determining how much is the current cooling eff ect of aerosols is actually essential for forecasting how much will be the global temperature increase during the next century. This is far more diffi cult than calculating the warming eff ect of greenhouse gases due to the great variety in size and nature of the atmospheric particles, to the complexity of the processes involved (interaction light/particles, cloud droplet formation and evaporation) and to the large spatial and temporal variations in aerosol concentrations. The uncertainties of the current aerosol climate eff ect may be reduced by measuring atmospheric particles’ optical properties and cloud droplet formation potential, together with some more fundamental characteristics (size distribution, chemical composition). Eff orts are also being made to improve the representation of the role of aerosols in global climate modelling, for a more robust prediction of future temperature and precipitation fi elds.


16

Plenary Sessions

PL-10Getting the good stuff and avoiding the bad: Government’s role in maximizing environmental benefi ts and avoiding unintended consequences of nanotechnologyK. Markey1

1United States Environmental Protection Agency, New Chemicals Program, Washington, USA

The United States Environmental Protection Agency (USEPA) regulates the manufacture and use of industrial chemicals to avoid unreasonable risks to human health and the environment, while also promoting new technologies that have the potential to address environmental challenges. Nanoscale materials are a technological platform to achieve these benefi ts, provided the implications are appropriately managed. However, identifying the implications and avoiding additional unintended consequences is challenging, because many of the risk assessment tools that have served to identify concerns in previous decades of chemicals management no longer hold for nanoscale materials. At the same time, there are tangible environmental benefi ts to be realized. Hence, maximizing the benefi ts while avoiding the down sides requires judicious choices to utilize existing tools, while, where necessary, developing new ones. Central to achieving this balanceis an approach that measures the implications and benefi ts of nanoscale materials throughout their life cycles and institutes policies to foster continuous improvements. To those ends, the Agency has multiple interacting initiatives and programs on nanotechnology to coordinate research, develop testing, collect data, and evaluate results. By considering the overall picture, the Agency is able to prioritize fi lling data gaps and developing new technologies. Specifi c case studies will examine how these diff erent programs interact, how the long-term foundations of economic and environmental sustainability of nanotechnology are being achieved, and where future opportunities may lay.


17

Plenary Sessions

Topic: Plenary Session 4 - Nanotechnology applications for sustainable health care

PL-11Nanotechnologies in regenerative medicineE. Syková1

1Institute of Experimental Medicine Academy of Sciences of the Czech Republic, Department of Neuroscience and Center for Cell Therapy and Tissue Repair Charles University, Prague, Czech Republic

Magnetic resonance imaging provides a noninvasive method to study the fate of transplanted cells in vivo. The migration and fate of rat fetal cells, mouse and human embryonic stem cells, rat and human mesenchymal stem cells, rat and human olfactory glia, beta-cells of the islets of Langerhans or chondrocytes, labeled with superparamagnetic iron-oxide nanoparticles and grafted in animal models of stroke, spinal cord injury, diabetes or cartilage damage, were studied to elucidate whether these cells are capable of survival, do not produce tumors, diff erentiate, prevent scar formation and enhance regeneration. Various nanoparticles were developed and patented in our Center for experimental and clinical use.

Various biocompatible scaff olds based on non-woven nanofi bres (products of ELMARCO or Technical University Liberec), have been developed for bridging tissue defects and for use as 3D stem cell carriers. We use nanofi bre constructs seeded with stem cells labeled with superparamagnetic iron-oxide nanoparticles to bridge a spinal cord lesion. Our studies demonstrate that nanofi bre scaff olds seeded with adult or embryonic stem cells can bridge a lesion site in the brain as well as in the spinal cord. Such constructs are also useful for cartilage repair.

We implanted blocks of nanofi ber scaff olds, either alone or seeded with MSCs, in order to bridge post-traumatic cavities in injured spinal cord. The nanofi bre scaff olds were implanted into rats with acute or chronic SCI. In both acute and chronic SCI, implants reduced scar formation and bridged the lesion, providing a scaff old to reform the tissue structure. Furthermore, nanofi ber scaff olds seeded with stem cells can bridge the lesion site and increase functional recovery. We conclude that scaff olds in combination with stem cells can improve regeneration by bridging gaps after SCI, by mechanically supporting ingrowing cells and axons and by the rescue and replacement of local neural cells.

PL-12Getting Nanomedicines to Patients - The Therapeutic Nanomedicine PrioritiesM. Eaton1

1UCB, Slough, United Kingdom

In recent years there has been an increase in research into Nanomedicines but there is industrial concern that much of this eff ort will not be translatable in to signifi cant commercial value. Communication between the stakeholders is problematic and much more needs to be done to ensure that such funding leads to new drugs for patients. The stakeholders need each other, but currently critical industrial knowledge on drug research and development is not readily available to the academic sector. This will be addressed in this talk.

The Strategic Research Agenda listed many possible approaches; with the passage of time it is now possible to prioritise these from an industrial perspective. The purpose of a round table meeting in February was to start this process and it is the purpose of this talk to outline the ensuing strategy, which was further discussed at the ETP General Assembly in Munster. It is hoped that Framework and national funding will be directed to challenging projects, which can be commercialised and off er novel therapeutics to patients.

PL-13Application of nanotechnology in medical diagnosticsP. Boisseau1

1CEA-LETI, MiNaTec, Grenoble, France

By moving from the micron to the nanoscale, nanotechnology enables the development of tools, devices and objects of approximately the same scale of the biomolecules. This opens a totally new fi eld of application exploiting the interactions between biomolecules and nanodevices or nanoinstruments.

Medical diagnostics covers two main sub-domains: in vitro diagnostics and in vivo diagnostics, including imaging. In both domains, nanotechnologies turn down current limits in terms of technical performances. For instance, in the fi eld of in vitro diagnostics, miniaturisation enables faster interaction between reagents and biomarkers, analysis of smaller samples, better chemical reactivity. In vitro diagnostics goes closer to drug development by proposing tests specifi c to a new drug.

Regarding in vivo imaging, nanoscale contrast agents improve the accuracy, the specifi city, the sensitivity and the targeting of biological sites. Hybrid imaging combining diff erent imaging modalities opens new applications in both preclinical and clinical applications. Even some totally new modalities like magnetic particles imaging are under development.

All specifi c developments in medical diagnostics are driven by clinical applications. Therefore, only multidisciplinary consortia can tackle these developments.

The new horizon open by deep miniaturisation down to the nanoscale reveals new societal, regulatory, and ethical issues to be addressed simultaneously to the technical development for a harmonious development of these methods. Healthcare policy and more specifi cally reimbursement policy will dramatically impact this business as well.


18

Plenary Sessions

Topic: Plenary Session 5 - Prospects for industrial nanotechnologies

PL-14Characterisation of nanostructures and process technologiesE. Niehuis1

1ION-TOF GmbH, Muenster, Germany

In recent years we have seen impressive progress in nanoscience to manipulate matter on the nanometer scale and to generate nanostructures with completely new properties and performances. A decisive stimulus for the fi eld was the rapid development of the scanning probe techniques after the invention of the STM by Binnig and Rohrer in 1981. Nowadays these techniques allow not only to see but also to manipulate single atoms and molecules. In parallel, the more classical analytical techniques based on electron, ion or laser probes have been improved considerably with respect to spatial resolution. Therefore, a set of tools has become available to meet the requirements of exploratory nanoscale research.

The commercialisation of nanotechnology has just started, and in the future a wide range of innovative nanomaterials, nanostructures and devices will be introduced to virtually all industrial sectors from Electronics to Medicine. Future nano-manufacturing will critically depend on the ability to accurately and reproducibly measure properties and compositions on the nanoscale. New process technology developed for the production of nanostructures needs to be tailored and monitored in order to meet the demands of effi ciency and reliability. This is extremely challenging for the existing analytical techniques. Instrumentation not only with improved spatial resolution and sensitivity is required, but also with signifi cantly higher accuracy, speed, robustness and ease-of-use. The development of the analytical instrumentation to this level will also require global eff orts to implement standards and calibration procedures.

Access to infrastructure specialised on the characterisation and failure diagnostics for nanodevices will be crucial in particular for the growth of small and medium size nanotech companies. Often a combination of diff erent high-end analytical techniques, sophisticated sample preparation techniques and a high level of expertise in data interpretation is necessary for problem solving, last but not least together with a fast turn-around time. This is a challenge not only for specialised public research centres but also for private analytical service providers. The build-up of the required analytical infrastructure and services in Europe is of major importance for the future development of industrial nanotechnology.

PL-15Processing-structure-properties in advanced polymer nanocompositesJ.M. Kenny1

1University of Perugia, European Centre on Nanostructured Polymers, Terni, Italy

The ability on modifying and modelling materials at nanoscale level is leading modern society to developments which were unthinkable just a decade ago. For this reason, researchers all over the world have been focused their studies on nanotechnology and nanomaterials: dispersion of even a low concentration of nanoparticles in a material can lead to a drastic enhancement of their performance. Loading of polymers with high-aspect-ratio fi llers can, in fact, lead to very interesting results regarding the properties of the fi nal composite material, even with a very low concentration of these particles. Their particular shape and their very high aspect ratio provide a huge specifi c surface area, which is several orders of magnitude greater than the one of conventional fi llers.

Among this kind of fi llers, layered silicates, silica, metals, carbon nanoobjects (tubes, fi bres, graphenes) have a particular importance in terms of structural behaviour (mechanical properties, thermal and dimensional stability) and also in terms of multifunctional properties (electrical, magnetic, optical, biocompatibility, etc.). As the capacity of nanoparticles of producing materials with excellent properties is strongly related to the dispersion level attainable, one of the most important challenges is to develop processing method which can ensure an optimal dispersion of the nanoparticles, and, at the same time, can be scaled up at the industrial level.

Many techniques have been employed to improve the dispersion of nanoparticles inside the matrix assuring optimum intercalation and exfoliation. Melt processing and in-situ polymerization are the favourite routes while solvent processes are limited to few specifi c optoelectronic applications. Most of these techniques, although valid, are limited by their scale up to produce larger amounts of nanocomposite material. In fact, only a technique which allows high rate and high volume production, can be really exploited for industrial applications.

Here we present the current state- of- the- art for the processing of polymer nanocomposites for advanced applications. Innovative routes are presented for the processing of multifunctional polymer nanocomposites with designed mechanical and functional properties allowing the development of production systems with high reliability. Moreover, the use of nanocomposite matrices to prepare advanced fi bre reinforced composites is illustrated. In this case advanced liquid moulding (in particular, vacuum assisted resin transfer moulding -VARTM) can be used to manufacture epoxy and polyester-based composite laminates for aerospace applications.

The development and optimization of advanced processing techniques allowing reliable production methods for well dispersed and homogeneous nanocomposites is on the main research areas whose results are fundamental for the further growth of polymer nanotechnologies.


19

Plenary Sessions

PL-16Nanoelectronics: there plenty of complexity at the bottomL. Baldi1

1 Numonyx Italy S.r.l. Agrate Brianza, Italy

The sentence “there is plenty of room at the bottom” appears in a famous talk that Richard Feynman gave on December 29th 1959 at the annual meeting of the American Physical Society, and it is generally considered as the fi rst recognition of the potential of Nanotechnology. Feynman indicated the possibility of printing the entire Encyclopedia Britannica on the head of a pin. In general the talk of Feynman is quoted as an indication of the fact that things could be made much “smaller”. What is usually neglected is that he introduced another factor “complexity”. We are not there yet, however most advanced Flash memory devices can store around 400 thousand pages of text and fi gures in less than 2 square centimeters.

Surprisingly enough, and a tribute to the foresight of the man, the main engine of the long evolution that has brought us to 30nm devices has been a sort of photoengraving, based on reverse magnifi cation, as described by Feynman himself.

But Nanoelectronics is not only small feature size. Already before entering in the sub-100nm domain, semiconductor devices were exploiting quantum eff ects, taking place only on the nanometer scale, such as the tunnel eff ect, used in Flash memories.

Unfortunately the same quantum eff ects that have made Nanoelectronics possible, and have enabled it to enter all aspects of our everyday life, are also threatening its further evolution. Several factors are concurring to cloud the future of Nanoelectronics: parasitic eff ects, which are becoming dominant, change of properties of the matter on the molecular scale, and statistical eff ects related to large complexity of devices. Even events with a low probability of occurring become almost a certainty when applied to billion of individual elements.

The slowing down of the “Moore’s Law” trend, already wrongly announced several times in the past, might be a real risk this time. The reaction of semiconductor industry to the new challenge is taking essentially three directions:

New materials and new physical mechanisms could overcome some limitations of mainstream technology. The main obstacle is the level of complexity: new technologies must deal with a device count in the order of billions..

Smarter design approaches, starting from the high level system architecture down to compensation of unwanted physical eff ects and statistical variation, could increase the effi ciency in the utilization of available technology.

The already developed technology base can be applied to a much wider fi eld than simple data processing: MEMS, sensors, actuators, opto-electronic devices, all based on the manufacturing know-how and tools of semiconductor industry are opening the way to new applications and generating new industries.

As Feynman said: “there is plenty of room at the bottom”.

PL-17Prospects in molecular electronics devices based on supramolecular chemistryD. Vuillaume1

1CNRS - Institute for Electronics Microelectronics and Nanotechnology, University of Lille - Molecular Nanostructures and Devices group, Villeneuve d’Ascq, France

Molecular electronics, i.e. the molecule-based information technology at the molecular-scale, becomes more and more investigated and envisioned as a promising candidate for the nanoelectronics of the future. From this respect, supramolecular assembly of organic molecules

on solid substrates is a powerful “bottom-up” approach for the fabrication of devices for molecular-scale electronics. More than a possible answer to ultimate miniaturization problem in nano-electronics, self-assembled molecular electronics is foreseen as a possible and reasonable way to assemble a large numbers of nanoscale objects (molecules, nanoparticules, nanotubes and nanowires) to form new device and circuit architectures. It is also an interesting approach to signifi cantly reduce the fabrication costs, as well as the energetical costs of computation, compared to usual semiconductor technologies. Moreover, molecular electronics is a fi eld with a large spectrum of investigations: from quantum objects, for testing new paradigms, to hybrid molecular-silicon CMOS devices.

In this presentation, I will briefl y describe the basic concepts related to electron transport through molecules, ensemble of molecules, organic monolayers and molecular devices mandatory to understand the realistic electron transport in these molecular devices. I will introduce some “supra-molecular technologies” useful to make these organic nano-devices and pinpoint some specifi c problems encountered when working with molecules. I will review some recent results in this fi eld, especially dedicated to the applications towards some information technology functions (e.g. molecular memories, switches, transistors, etc…), and I will discuss some perspectives and challenges.


20

Plenary Sessions

PL-18Value-added materials: prospects and barriersE. Vandeweert1, R. Tomellini1

1 European Commission, Directorate-General for Research, Industrial Technologies, Value-added materials Unit, Brussels, Belgium

Materials research has an essential role in supporting development of competitive and sustainable growth in Europe: the globalization of the markets and the increasing complex needs of society demand improved industrial processes and products with better service performance, quality, reliability, durability, specifi c functionalities and end-of-life destiny. Industry does not simply “deliver products”, it now also has to play an active role towards an economic development that wants to be responsible and really sustainable, thus facing strategic objectives including energy balance, raw materials supply, carbon fi ngerprint, cost eff ectiveness, extended/networked manufacturing, safety and environmental protection or improvement. At the same time, market trends make it even harder to meet these objectives, as customers look for better and cheaper products, which in many cases should also be small, light and even wearable or portable.

The European Commission promotes research in materials science and engineering. The EU 7th Framework Programme for Research and Technological Development is currently supporting research actions to overcome scientifi c, technological and related bottlenecks, provoking or facilitating new ideas that can give Europe a competitive advantage internationally in the forthcoming years.

PL-26Experience in the Field of Research Activities with Universities - Nanotechnologies in CarJ. Machan1, R. Stranský1, D. Kramer2 1Skoda Auto, Czech Republic2VW, Germany

Within the EU 7th Framework program (FP7 in 2009 - 2013) it was defi ned fi ve major topics on the EUCAR level with high importance for automotive industry.

The fi ve of major importance to automotive and road transport research are:• Information and Communication Technologies (ICT)• Nanosciences, Nanotechnologies, Materials and new Production Technologies (NMPT)• Energy• Transport• Security

Nanosciences, Nanotechnologies, Materials and new Production Technologies (NMPT) play role in the following four sectors of automotive reseach areas: • Fuels and Powertrain (Powertrain materials)• Integrated Safety (New materials for crash worthiness)• Virtual Engineering (Methods for design, production)• Material Processes, Manufacturing (Multifunctional materials, Methods and approach for design, process and manufacturing)

Taking advantage of using nanomaterials in automotive applications can’t be purposeless. It should follow these aims:• Reduced fuel consumption and emission• Reduced weight• Cost reduction• Energy effi ciency• Robust construction and safety applications

In automotive applications nanomaterials and nanotechnologies fi nd utilization mainly in the following areas:• Powertrains (lowered friction, increased lifecycle, etc.)• Safety (new materials for crash worthiness)• Exterier, bodywork (scratchresistant and dirtresistant surfaces, etc.)• Interior (scratchresistant surfaces, comfortable materials, noise suppresion, etc.)• Air-condition (biologically inert fi lters, etc.)• Electro (battery applications, supercapacitors, etc.)

This contribution focuses mainly on utilization of nanomaterials in the area of scratchresistant parts construction. Research and development in this area is done by Skoda Auto a.s. in close cooperation with the Brno University of Technology.


21

Plenary Sessions

Topic: Plenary Session 6 - Integrated, safe and responsible nanotechnology governance in the EU

PL-19observatoryNANO - supporting informed decisions on nanotechnology developmentsM. Morisson1

1Institute of Nanotechnology, Glasgow, UK

Nanotechnology is a complex and rapidly changing fi eld, which is often diffi cult to assess in terms of opportunities, challenges and risks. The observatoryNANO project is funded by the European Commission (EC) under the seventh Framework Programme (FP7) to address this, by providing the EC and other policy and decision makers with reliable information regarding the current and forecasted development of nanotechnology and its potential impacts on society.

It assesses all aspects of the value chain from basic research to market applications in terms of scientifi c, technological and socio-economic developments and prospects. At the same time it evaluates ethical and societal aspects; potential environment, health and safety issues; and developments in regulations and standards. For the purposes of this work the assessment is performed in ten broad sectors: aerospace, automotive, and transport; agrifood; chemistry and materials; construction; energy; environment; health, medicine, and nanobio; ICT; security; and textiles.

The project activities have three main phases (which have an annual cycle):

phase 1 is a review phase. Existing literature (peer-reviewed scientifi c publications, company reports, reports from other projects and initiatives, such as the European Technology Platforms) is collated and analysed, and interim reports produced. At the same time this work is supported by an analysis of patent trends (using the PATSTAT database and in collaboration with the European Patent Offi ce) and trends in peer-reviewed publications.

phase 2 involves engagement with the wider expert community through invitation to review the interim reports, participation in interviews and workshops, and completing a series of online questionnaires covering the diff erent technology sectors.

phase 3 is publication and dissemination. There is an annual symposium, where outcomes from the review and expert engagement processes are presented; followed by the publication of concise reports, in an online database, which clearly identify developments, opportunities, challenges and risks in each of the technology sectors.

At the end of the fi rst year of the project, the following have been published:

53 reports on diff erent scientifi c and technological developments;

34 reports on economic impacts;

report on individual and collective responsibility for nanotechnology, interviews with key opinion leaders on ethical aspects of nanotechnology developments and a toolkit to support researchers in review of the ethical aspects of their work;

review of seminal research in environment, health and safety aspects of nanotechnology developments;

review of developments in standards and regulations;

review of existing and proposed observational initiatives.

About the observatoryNANO projectThe project is led by the Institute of Nanotechnology (IoN) (UK), and includes: VDI Technologiezentrum (DE), Commissariat à l’énergie atomique (CEA) (FR), Institute of Occupational Medicine (IOM) (UK), Malsch TechnoValuation (MTV) (NL), triple innova (DE), Spinverse (FI), Bax and Willems Consulting Venturing (B&W) (ES), Dutch National Institute for Public Health and the Environment (RIVM) (NL), Technical University of Darmstadt (TUD) (DE), Associazione Italiana per la Ricerca Industriale (AIRI) (IT), Nano and Micro Technology Consulting (NMTC) (DE), Swiss Federal Laboratories for Materials Testing and Research (EMPA) (CH), University of Aarhus (DK), MERIT - Universiteit Maastricht (NL), Technology Centre AS CR (CR).

For further information please contact the project coordinator Dr Mark Morrison ([email protected])

or visit the project website: www.observatory-nano.eu

observatoryNANO is funded by the European Union under FP7. Contract number 218528.


22

Plenary Sessions

PL- 20European Technology Platforms - Responsible development of Industrial NanotechnologiesP. Matteazzi1

1MBN Nanomaterialia, Italy

In the last decades Nanotechnology has passed from science fi ction to niche research to advanced technology and fi nally to industrial production. Now Nanotechnologies are ready to adds new functionalities, intelligence, integrations, portability and networking capability in many new products with high market potential in several industrial sectors.

The many benefi ts of Nanotechnologies have to acquire strategic signifi cance and they would have to be weighed against the risks involved (safety, economical/market impact, industrial sustainability, environment, ethical and political issues). Therefore the European policy on Nanotechnology innovation has to be promoted and developed to be of the same standard as other no-research issue , i.e. regulatory and educational.

Advanced nano and microfabrication are exciting not only from the environmental aspect (fewer energy and resources will be consumed once these technologies mature) but also from economic side. Their capabilities are becoming key enablers for gaining or maintaining the lead over competitors in order to sustain a strong economy and provide an impetus towards meeting societal demands.

To respond to a even wider interdependent interests constituted not only by industrial needs, but also by ETPs visions and European policies (Environment, Cooperation, Economy etc.), it is rising the need of a superstructure that would carry the load of nanotechnology industrialization forward for the benefi t of European economy and its citizens. MINAM Nanofutures is proposing itself for this role, as a technology platform, in order to collect and organize the knowledge from the European Universities and Research Institutes, to gather the needs and ideas from European Industries and SMEs and to address the eff orts of the ETPs already active on Nanotechnology.

MINAM NANOfutures at its base will be open to a broad range of industry, SMEs, NGOs, fi nancial institution, research institution, universities and civil society with a involvement from Member State at national and regional level. MINAM is a ready environment where all these diff erent entities can interact and come out with a shared vision on nanotechnology futures. MINAM Nanofutures will be structured as nano-hub for ETPs and Industries: it would lead the European Nanotechnology with a clear commitment of industry and in the meantime collaborate with the other ETPs for nanotechnology development in Europe. A Memorandum of Understanding to plan the interaction among MINAM Nanofutures and the ETPs activities on Nanotechnology has been drawn and is currently under evaluation.

Some industrial examples are given in diff erent fi elds: automotive, manufacturing and production of advanced materials.

PL-21Support to a prosperous nanotechnology industry in EuropeM.H. Van de Voorde1

1DELFT University of Technology, Natural Applied Science Faculty, Delft, The Netherlands

The paper gives an overview of the potential nanomaterials for industry: It highlights the research needs, in the future, to achieve breakthroughs in multi nanotechnology sectors: information and communication; bio-nanosystems: medicine, pharmacy, foods, …nanomaterials for energy and transport, …The benefi ts and the risks for the society: man-made environment, global climate change, security, toxicity …are highlighted. The role of nanostandardisation and metrology to assure industrial promotion is mentioned.

To achieve these ambitions: models for a new and modern “nanomaterials” infra-structure in Europe are presented. Partnerships between Universities, research centres and industries are promoted and mechanisms for smooth transfers of discoveries to industrial innovations described. Interactions between governments, funding agencies and industries to achieve a prosperous nanomaterials industry in Europe are pinpointed.


23

Plenary Sessions

PL-22Integration of nanosciences and nanotechnologies into ERA: Are ERA-Nets real assets?P.N. Lirsac1, V. Sivan1

1CEA, DSV/DPTS, Gif-sur-Yvette cedex, France

The applications of nanosciences and nanotechnologies have a vast potential for developing public welfare and economic growth but has special needs for bringing up this potential. The development of nanotechnologies applications requires a multidisciplinary approach to reduce the time to market. The main promising fi elds of applications are nanoelectronics and nanomaterials and medical application of nanotechnologies (Nanomedicine) with specifi c regulatory constraints and a longer time to market.

A lot of eff orts on basic research have been dedicated to nanotechnologies in the recent past, for a mitigated result, a few applications being generated. However, Critical issues for bringing up the potential in Europe concern the maturity of the economic players and their capability to move eff ectively innovation from knowledge to industrial technology.

This is especially a bottleneck for the development of some emerging fi elds like Nanomedicine: Industrial players need to collaborate with scientifi c and clinician partners increasing their eff orts towards biological preclinical and clinical validations. This will shorten the delay for patients to benefi t from the innovation and increase the competitiveness of European actors

In Most of the European Member states, academic and/or private actors in nanotechnologies can be found. However these players, even when achieving a critical mass, may not have access at national level to the diversity of competency they may need. Then, promoting the European competitiveness requires effi cient mechanisms to support trans-national collaborative RTD projects between academic laboratories, companies, especially SME’s, and with clinicians/public health setting in the case of Nanomedicine applications.

This goal is targeted at national and European levels through diff erent tools:• The national programmes, • The FP7 Thematic calls for proposals,• The ERA-Nets, supporting research in specifi c fi elds and being complementary to FP thematic calls in fi lling some gaps. NanoSci-Plus II

supports the basics in nanosciences, NMT-ERA-II the development of integrated systems and the newly EuroNanoMed focus translational RTD in Nanomedicine, moving science into preclinical and clinical applications for patient and industry.

• The European technology platform in Nanomedicine,• The JTI ENIAC, supporting industrial applications in the fi eld of nanoelectronics.

Their respective focus, complementarities area of interest and constraints will be analysed and discussed.

Within the fi elds of application, the overall impact of these complementary tools seems today more networking among the actors than the development of a real European Research Area. To overcome this eff ect, a possible strategy based on the development of calls within joint programmes supported by some specifi c European infrastructures will be discussed.

PL-23Innovative Nanotechnologies for Sustainable GrowthC. Tokamanis1

1 European Commission, Directorate-General for Research, Industrial Technologies, Nano- and converging Sciences and Technologies Unit, Brussels, Belgium

Europe’s advance in Nanoscience and Nanotechnologies in the last eight years was impressive. It was guided by the promise that its technological and industrial potential would make a diff erence to grand economic and societal problems and concerns.

Integration and a balanced approach are the two features characterising its progress. Resources were directed to understand basic phenomena and interactions at the atomic scale. First attempts were directed to the design and engineering of pilot lines for production of nanomaterials, components and devices. Safety, health, and the environment received special attention attempting to quantify societal impacts of nano developments. Ethical, regulatory matters were reviewed and the legal framework was placed within an international context through partnerships and in cooperation with international organisations such as OECD, ESO, CEN, and UN. Support actions were funded to coordinate developments across Europe as well as internationally. In the mean time huge eff ort was made to set-up infrastructure supportive of the needs for knowledge-based but market relevant nanotechnologies. Nanotechnology education took off and training courses were established in most prominent European Universities.

The next fi ve years, up to 2015 are critical.

Developments would be targeting Nanosystems applications whose complexity and high level specifi cations demand strategic, mutlidisciniplary and integrative eff orts. From laboratory to concept to market, interdisciplinary teams have to work in a networked environment to overcome infrastructure and knowledge barriers. Business models have to be developed that promote investment in assisting the entrepreneurial drive Building-up value networks for the diff erent application must be based on realistic future revenue streams and value adding strategies. Enabling technological innovation is a task that requires concerted eff ort supported by a knowledge-based regulatory regime accompanied by international standards. Economic progress would not be possible without the creation of a favourable educational and skilling system that prepares a knowledgeable workforce.

The expectations of sustainable growth with high economic and social impact that an emerging nanotechnology industry would bring can only be realised through an integrated, responsible and safe strategy. Such a strategy is in place in Europe since 2005. (COM (2005) 243).


24

Parallel Sessions

Parallel Session A1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Sustainable production of Chemicals

KL-01 - Industrial applications of membrane technologies for sustainable productionG.M. Rios1

1Ecole Nationale Supérieure de Chimie de Montpellier, Department of Chemical Engineering, Montpellier, France

In today’s economy, engineers must respond to the strongly changing needs of industrial processes which aim to satisfy the always stronger constraints on raw materials, energy saving and environment impact imposed by a sustainable development. To answer correctly these requests, process intensifi cation appears as a privileged path to handle the future. Basically process intensifi cation aims at replacing large, expensive, energy-intensive processes with ones that are smaller, less costly, more effi cient and which minimize environmental impact, increase safety and insure a better product quality. To reach the goals several “ingredients” can be used such as new materials, operating modes and/or multifunctional operations.

In all developed countries, membrane science has a leading role in innovative processes and is considered one of the main strategic axes. Advanced technology programs in the USA or Japan involve them; with an annual growth rate of 10 to 20 %, and a total world market above 10 billion Euros around 2010, artifi cial membranes are likely to become more and more important in a lot of systems (separation, fi ltration, reaction…) and areas (chemical , biotechnologies, energy …) of main importance for our daily life . Undoubtedly they represent the most appropriate image of sustainable development insofar as they are in general a-thermal and do not involve phase changes nor chemical additives. In fact they are just very coarse copies of biological cell membranes which ensure all the basic functions of life. To make them increasingly eff ective and to bring their performance closer to those of their biological model, it will be necessary to control the material properties on the nanoscale if not at the molecular level, and to strongly improve our global approach of membrane engineering.

For the chemical and petrochemical industries, membranes represent particularly attractive tools. At fi rst, because of their great potential for the recovery, recycling or valorization of by-products, particularly molecular species and solvents, they lead to more environment-friendly and valuable processes. Through the new concepts of membrane reactors (which for example extend the fi eld of homogeneous operation due to the easy free catalyst recycling, or by off ering original support to fi x them), and membrane contactors(which already compete with traditional operations such as distillation and extraction), they open original ways for process intensifi cation.

The presence of a strong expertise in process engineering in these industries should facilitate their development, provided that these technologies are considered with the same attention as older and more traditional ones. Particularly new modeling and simulation tools will have to be developed to predict performance, and new fl owsheets to be proposed in accordance with these results.

KL-28 - Sustainable production, handling and use of carbon-nanomaterial based productsW. Schütz1 1FutureCarbon GmbH, Bayreuth, Germany

Carbon Nanomaterials have outstanding properties concerning electrical and thermal conductivity and mechanical stability. Up to now, the toxicological potential of these materials is not completely clear. The strategy of FutureCarbon is to produce and handle these materials in a save and sustainable way and to develop save products for the customers. In this talk we will present the production of these materials and how to process these materials for diff erent applications with regard to sustainability.

O-01 - Ionic Liquids: Novel Eco-Effi cent and Green Tenside-like Materials for the Preparation of Dispersions of NanoparticlesT.F. Beyersdorff 1, T.J.S. Schubert2, F.M. Stiemke1, A. Willm1

1IoLiTec Ionic Liquids Technologies GmbH, Denzlingen, Germany2corresponding author, Germany

In recent years ionic liquids have been used more and more in the synthesis of inorganic materials. Their great synthetic potential, particularly for the synthesis of nano metals, nano metal oxides and composite particles has been demonstrated by a number of research groups.[1] Due to their unique properties, such as a wide liquid range, intrinsic charge, polarizability, low surface tension or (electro)chemical and thermal stability, ionic liquids can, for example, eff ect the size control, agglomeration and dispersability of nano particles. Furthermore, the preorganized structure of an ionic liquid can be used as template for the formation of microporous structures[2] and their microwave activity turned out to be useful for a mild and controlled energy transmission in synthesis as well.[3] The eff ect of size and shape control (Scheme 1+2) was also demonstrated recently.[4]

In this paper the authors present results how the critical micelle concentration (CMC) of selected ionic liquids can lead to surprisingly stable dispersions of materials, which cannot be dispersed by using other methods and materials. Furthermore, a vision of eco-friendly continuous fl ow processes will be presented by one of the leading companies in the combined fi eld of ionic liquid & nano-materials research.

References[1] M. Antonietti, D. Kuang, B. Smarsly, Y. Zhou, Angew. Chem. 2004, 116, 5096.[2] Y. Zhou, Curr. Nanoscience 2005, 1, 35.[3] G. Bühler, C. Feldmann Angew. Chem. 2006, 118, 4982.[4] C. Janiak, E. Redel, T. F. Beyersdorff , M. Klingele, T. Schubert, DE 2007 045 878.0-24, Patent Pending; C. Janiak, E. Redel, T. F. Beyersdorff , M. Klingele,

T. Schubert, DE 2007 038 879.0-43, German Patent.


25

Parallel Sessions

Parallel Session A2 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in construction

KL-02 - Application of nanoscience to understand the micro and nanoscale processes governing the performance of cementitious materialsK. Scrivener1

1EPFL, Lausanne, Switzerland

Concrete is the most used material on the planet due to it versatility, durability, reliability, low cost and embodied energy and widespread availability. Despite this ubiquity the basis of use of concrete has largely been based on an incremental and trial and error approach to research over the past century. Due to the huge volumes, cement production now accounts for some 5-7% of man-made CO2 emissions and demand is forecast to more than double in the next decades. In order to address the challenge of sustainability there is an urgent for progress towards a knowledge based approach.

In the past, the complexity of cement and concrete had limited understanding. Cement contains more than 5 reactive phases, each of which has variable composition and reactivity due to the presence of minor elements from the natural raw materials. This limits the application of tools which have allowed major advances in our understanding of other materials. For example, the two component iron carbon phase diagram (the basis of steels) was already established at the beginning of the 20th century. Only now, at the beginning of the 21st century, are the computer based thermodynamic models available which can deal with the 10 or more components in cementitious systems. Understanding hydration kinetics is complicated by the many phases reacting together and by the wide range of particle sizes. Nevertheless, when the basic mechanisms and starting composition can be correctly represented in a computer based simulation this complexity can be dealt with.

Many of the phases present in concrete are poorly crystalline, so diffi cult to study with traditional analytical techniques. The recent rapid development in nanoanalytical techniques has led to dramatic advances in our understanding of their structure. The basis of calcium silicate hydrate - the so called “glue of concrete” (around 50% of hardened cement paste) is now known to be a nanocrstalline material thanks to studies with nuclear magnetic resonance and transmission electron microscopy. Atomic Force Microscopy - at the heart of the development of nanotechnology - reveals the dissolution mechanisms of the cement phases.

This nanoscience provides the basis for a new research approach to cementitious materials, which is essential if new, more sustainable, materials are not only to be developed, but used with confi dence in structures designed to lasts many decades. The multidisciplinary approach necessary demands integrated research involving physicists, chemistry, materials scientists, civil engineers, etc. in close partnership with the industry. Over the last 5 years the NANOCEM consortium has started to demonstrate the potential to link the micro and nanoscale processes in cementitious materials with their macroscopic performance.


26

Parallel Sessions

O-02 - Nanomaterials and System Concepts for the Construction Industry: A Holistic Approach reported from a European ProjectU. Weimar1

1University of Tuebingen, Institute of Physical Chemistry, Tuebingen, Germany

Nanotechnology is getting more in the focus of the construction industry. This is obvious if one has a closer look to a number of components used for the internal and external applications in buildings. The question which is arising is: What is the driver to use such components? The answer is straightforward: There is an increasing need for energy effi ciency of buildings and consequently all areas of technology enabling the latter have to be explored and used. This is exactly the topic of a recently started Integrated Project (IP) on the European level called “clear-up” (see: http//www.clear-up.eu).

clear-up presents a holistic approach towards reducing operational energy use in buildings. By development and novel use of nano-materials it aims to increase energy performance in heating, ventilation, air conditioning, lighting systems and to improve indoor air quality using catalytic purifi cation. clear-up’s solutions are designed for retro-fi tting existing buildings and of course for new constructions.

It will achieve this by addressing four key components which control the indoor environment:• Windows. clear-up will advance the practical use of shutters and electrochromic window foils which reduce the building cooling load and

along with light-guide technology, reduce the need for artifi cial lighting.• Walls. clear-up will use photocatalytic materials for air purifi cation and nano-porous vacuum insulation in combination with phase change

materials to passively control temperature.• Air Conditioning. clear-up will advance technologies for demand controlled ventilation and improved air quality.• Sensors and control provide an underpinning technology for clear-up’s approach. New sensors will be developed, their use optimized for the

operation of smart windows; demand controlled ventilation and catalytic purifi cation.

clear-up will develop, install, measure and evaluate technological solutions in the laboratory, in a large-scale testing facility and in real world applications.

In the presentation the diff erent components building on nanotechnology will be explained and their systemic relevance will be highlighted. Just as an example: One can benefi t from the use of Phase Change Materials (PCMs) as a temperature buff er only if the overall control strategy is avoiding the direct illumination. This means the close loop control and cooperation of diff erent areas in the construction industry.

O-03 - The use of nanomaterials in composite components to improve the energy storage performance of systems integrated in energy effi cient buildingsJ. Gravalos1, J.M. Mieres1, A. Gutierrez1

1Acciona Infraestructuras, R&D, Madrid, Spain

Background:This research will be carried out as part of the European Project MESSIB, co-funded by the European Commission in the seventh framework program. The objective of the project is to develop and integrate a new energy storage capacity in buildings able to reduce the energy consumption by thermal storage, and active management of the energy demand by electrical storage.

A fl ywheel is an energy storage system that typically consists of high speed inertial composite rotor to store energy with a complex electronic and control system.

In the last years, some studies have shown the potential improvement in properties and performances of fi ber reinforced polymer matrix materials in which nano-scale particles were incorporated.

Objectives: The modifi cation of epoxy resins with nanofi llers could endow the materials with some superior properties such as broadening of the glass transition temperatures, modest increases in the glassy modulus, and signifi cant increases in key mechanical properties such improving transverse strength.

High performance nanocomposite for fl ywheel construction will be produced using diff erent concentrations of highly dispersed carbon nanotubes, nano-aluminium oxide and nano-silica within epoxy matrix. Further synergies of those nanofi llers will be also evaluated.

Al2O3 and SiO2 nanoparticles into the epoxy used in rotor fabrication can improve the stiff ness of the matrix. Additional organomodifi ed nano-SiO2 will also decrease moisture permeability avoiding long term dilatation that will result in undesirable residual stresses.

The unique mechanical properties of carbon nanotubes, their high strength and stiff ness and the enormous aspect ratio make them a potential structural element for the improvement of (fracture-) mechanical properties.

Further potential advantages, which promote nanotubes as ultimate fi llers for polymers, are their electrical and thermal conductivity together with a low density.

Application to practice:The fl ywheel as it spins feels the centrifugal force. If the centrifugal force creates on any point of the fl ywheel a stress higher than the ultimate stress of fl ywheel material, the rotor breaks apart.

Low density, high strength hybrid nanocomposite rotors that operate at very high speeds will be developed in the MESSIB project with the incorporation of the mentioned nanoparticles. High transverse strength will prevent delamination failure in high speed rotor spun.


27

Parallel Sessions

O-04 - STONECORE - a European project to develop and apply nano-materials for the refurbishment of buildingsG. Ziegenbalg1, M. Drdacky2

1IBZ-Freiberg, 1, Freiberg, Germany2Akademie ved Ceske republiky, Ustav teoreticke a aplikovane mechaniky, Praha, Czech Republic

In Europe, many buildings are made of either natural or artifi cial stone. Their normal life exceeds hundred years and refurbishment is necessary several times. With the age of a building, the importance of conservation increases and questions of the protection of cultural heritage become essential. Without any doubt, conservation of historical buildings, sculptures or wall paintings is the most challenging refurbishment task. Main questions are: • Stabilisation, conservation or replacement of damaged artifi cial or natural stone. • Selection of materials compatible to those originally used. • Safe removal of mildew and algae.

In all cases refurbishment requires materials which are compatible with the components originally used during construction. This is of essential importance for the consolidation of natural stone such as limestone, marble or sandstone as well as for mortar and plaster. However, the materials and components currently available do not fulfi l these demands in all cases.

It is the main idea of STONECORE, a project funded in the 7. Framework Programme of the European Commission, to develop nano-materials for the use in refurbishment and conservation. This requires the combination of fundamental and applied research in order • to develop nano-materials compatible to natural and artifi cial stone for refurbishment of buildings, monuments, fresco, plaster and mortar, • to develop nano-materials usable for safe and environmental friendly removal of mildew and algae, • to prove the eff ectiveness of the developed materials on site by means of non-destructive assessment methods.

Six SMEs, four universities, one public research organisation and one governmental organisation from seven countries have joined together in order to fi nd a new approach for refurbishment of natural and artifi cial stone. The project, which has started in September 2008, will progress from investigations in the laboratory and small scale applications on trial areas, to the use of the materials that have been developed on selected objects in the fi eld. At that time, colloidal calcium hydroxide stable dispersed in diff erent alcohols is available. Typical concentrations are between 5 and 50 g/L. The particles have sizes ranging between 50 and 250 nm. Treatment of stones with nano-lime results in the formation of solid calcium hydroxide after evaporation of the alcohol. That converts into CaCO3 (calcite) in a way similar to traditional lime mortars by reaction with atmospheric carbon dioxide. The solvent evaporates without any residues. Compounds deteriorating stone or mortar are not formed. Apart from consolidation of stone and mortar, applications are possible for coating of diff erent materials with calcium hydroxide layers, as adhesion promoter or as agent for paper conservation. The paper will summarise the overall targets of STONECORE and the foreseen investigations in detail. Additionally, an overview about the results of testing nano-lime for consolidation of stone, mortar and wall paintings will be given.

O-05 - Multiscale simulations and experiments - tools for design of durable and new construction materialsZ. Bittnar1, V. Smilauer1

1Czech Technical University, Faculty of Civil Engineering, Prague 6, Czech Republic

Multiscale perception of the world of materials has become an attractive and accessible fi eld for deeper understanding of underlying principles. The progress of computation facilities and observation techniques paved the way to recognize the small-scale world. This statement is no less than Einstein’s quote “look deep into nature, and then you will understand everything better” and Bacon’s, “Nature, to be commanded, must be obeyed”. However, the attractive small-scale world still presents a substantial challenging task for development, the scientifi c community, industry and sustainable economy.

Knowledge transfer from academia to the sector of civil engineering represents the main objective. Fire-resistant silica-based materials, such as concrete, are the most used and indispensable construction materials in the fi eld. Even small improvements have a tremendous impact on the global environmental footprint. It became clear that a lot of conventional processes have been optimized to a nearly maximum level, e.g. Portland cement production contributes to 5-8 % CO2 production worldwide with possible little improvement. On the other hand, utilization of by-products, such as fl y ash, has brought about a new binder, suitable for application in civil engineering.

Our research has focused on the sub-micron scale of high-performance cementitious materials. Nanoindentation and microcalorimetry techniques characterize intrinsic properties on the sub-micrometer scale. An enhanced chemo-mechanical model of microstructure evolution served as a basis to accommodate experimental results. The model served further in the multiscale simulation of hydrating concrete. Simulation can realistically predict heat and elasticity evolution on three spacial scales of concrete. The virtual testing clearly demonstrated critical factors of temperature evolution, especially in massive structures. In conjunction with durability indicators, life-time and reliability is easily assessed.

The hydration multiscale model was successfully applied on the mitigation of the temperature fi eld in a newly erected highway bridge. Durability indicators proved much longer bridge performance than the original design. Enhanced durability far outweighs the price for knowledge transfer from academia to industry.

Alkali-activated fl y ash materials have been developed in our group to a sophisticated level. Fire-resistance, chemical durability and low creep generally outperform the properties of conventional concrete. Moreover, the utilization of fl y ash, as a by-product of coal power plants, brings clear environmental benefi ts. Also, the application of multiscale and interdisciplinary methods was fruitful in the optimization and development.


28

Parallel Sessions

Parallel Session A3 - Nanotechnology for energy - Nanotechnology for H2 production & Storage; Fuel cells

KL-03 - Nanomaterials for Energy Applications Challenges and prospectsM. Fichtner1

1Forschungszentrum Karlsruhe, Institute for Nanotechnology, Karlsruhe, Germany

The talk starts with an introduction to upcoming challenges in the energy sector. In the view of dwindling fossil and nuclear resources harvesting sunlight is one of the important issues when it comes to an increasing introduction of renewable energy sources into the energy market. Here, it is essential to further increase the effi ciency by new concepts and nanomaterials which allow simultaneous collection of sunlight of diff erent wavelengths.

At the same time energy storage is becoming increasingly important because both stationary and mobile applications are going to rely more and more on electrons as energy carrier. The extensive use of renewable discontinuous energy sources requires large facilities for intermediate storage of energy. Moreover, automotive applications need highly effi cient and powerful energy storage systems. Novel sustainable battery systems have to be developed with storage densities which exceed those of current Li-ion systems considerably. This can only be achieved if new principles are applied where the conversion of reactive nanocomposites is utilized.

Moreover, hydrogen storage is an important option in this fi eld because energy and power densities which can be achieved by combined H storage/fuel cell systems off er outstanding performance. H storage materials of the next generation will be introduced and actual challenges will be discussed.

O-06 - Nanostructured Materials for Solid State Hydrogen StorageK. Taube1

1GKSS-Forschungszentrum Geesthacht GmbH, Nanotechnology, Geesthacht, Germany

In this talk an overview is given over the current status of development of materials for solid state hydrogen storage. The talk will focus on complex metal hydrides like alanate, amide and borohydride based materials, as only these have the potential for developing a storage technology corresponding to industrial requirements. Their properties, advantages and defi ciencies will be discussed and comparisons drawn with the current state of the art in storage alternatives like nanoporous materials and other methods of hydrogen storage like compressed gas and liquid storage. From this conclusions will be drawn for further needs for development and latest approaches to overcome the shortcomings in solid state hydrogen storage will be described.


29

Parallel Sessions

O-08 - ZEOCELL Project: An Innovative Membrane for High Temperature PEMFCsM.P. Pina1

1INA, University of Zaragoza, Spain

The PEMFC technology represents one of the most promising opportunities in the fi eld of the alternative fuels for an environmentally friendly energy production. However, it has been identifi ed as the main bottle neck the development of improved and mass manufacturable electrolyte membrane materials capable to withstand temperatures in the range of 130-200ºC. In this “new” high temperature scenario, the most important challenges are related to the electrolyte performance and durability, and also to the fuel utility (cross-over phenomena).

ZEOCELL (http://ina.unizar.es/zeocell) puts forward an innovative concept to bridge the gap between current limitations of commercial available PEMFs and the previously quoted technical targets based on the use of multifunctional nanostructured materials. Particularly, the synergic combination of microporous zeolite type materials, protic ionic liquids (PILs) and conducting polymers (see Figure 1) is proposed to overcome the existing drawbacks.

Figure 1. Individual materials which constitute the three main pillars of ZEOCELL.

Particularly, for the synthesis of microporous materials the addition of any organic template molecules has been mostly avoided to eliminate the costly calcination or extraction fi nal step. The synthesized PILs, exhibiting decomposition temperatures above 300ºC, have revealed enormous possibilities, not only as embedded proton carriers (100 mS/cm and 800 mS/cm at 160ºC in dry and saturated conditions, respectively), but also as additional chemicals in the composite membranes fabrication route. Porous conducting polymeric membranes based on poly[2,2-(m-phenylene)-5,5-bibenzimidazole] (PBI) with mechanical, chemical and thermal stability up to 200ºC have been obtained following two diff erent preparation routes: i) by the addition of a porogen agent, and ii) by the inverse phase separation method.

As the electrolyte membrane architecture plays a signifi cant role in order to ensure the best individual properties of each component materials; the herein studied structures (see Figure 2) consist of:• a 2-D microstructured polymeric matrix with a controlled thickness (15-150 μm), and 15-75% porosity values of ordered (60-500 nm in

diameter) or random (300-800 nm) pores sizes fi lled up with protic ionic liquids,• two nanostructured zeolite membranes less than 5 μm in thickness to reduce cross-over and ensure PILs confi nement.

Figure 2. Nanostructured electrolyte memmbrane architecture proposed for PEMFCs high temperature applications.

At this stage of the project, our research eff orts are focused on the synthesis of zeolitic layers onto pre-exisiting porous PBI membranes according to the quoted strategy. However, with the aim of facilitate a mass-scale production, the fabrication of polymer-zeolite-ionic liquids composite membranes in a single step is also attempted.


30

Parallel Sessions

Parallel Session A4 - Nanotechnology for health and environment - Nanotechnology in pollution monitoring and remediation

KL-04 - Foundamentals and Applications of TiO2 PhotocatalysisA. Fujishima1

1Kanagawa Academy of Science and Technology, Chairman, Kawasaki-shi Kanagawa, Japan

The tremendous amount of research that has been carried out in the two closely related fi elds of semiconductor photoelectrochemistry and photocatalysis during the past three decades continues to provide fundamental insights and practical applications.1-4

In 1972, we succeeded in the photo electrochemical decomposition of water without applied electric power, using TiO2 as the anode and the Pt as the cathode.5 The discovery attracted worldwide attention and triggeredenormous research activity in numerous laboratories to photoelectrochemically decompose water with semiconductors. The principles and measurements obtained with photoelectrochemical studies at semiconductor electrodes have also led to the research activity on heterogeneous photocatalysis, where the strong photooxidative activity of TiO2 has been applied to environmental cleanup.1-4

In the early 1990s, we recognized that it is diffi cult to utilize TiO2 photocatalysis for either production of hydrogen fuel or de contamination of large amounts of air and water, since the energy density of solar light is not suffi cient. We thus applied TiO2 photocatalysis to treat low-concentration pollutants in air and water, and to decompose pollutants adsorbed on TiO2 surfaces. This resulted in the concept of ”light cleaning,” i.e., deodorizing, disinfection, and decontamination of air, water, and surface with TiO2 thin fi lms and light. Moreover, in 1997, we reported the novel photo-induced superhydrophilicity of TiO2 and proposed the concept of self-cleaning superhydrophilic properties of TiO2.6 Our studies have led to practical applications of TiO2 photocatalysis in the decontamination of air, water and soil, self-cleaning materials, antibacterial materials, antifogging materials, and so on.

In this lecture, I will follow the history of TiO2 photocatalysis, outline the contribution of photocatalysis to a comfortable and safe urban environment, and highlight some important points related to the future development of photocatalysis, including the problem of utilizing visible light and the standardization of photocatalytic systems. I will also introduce our photocatalysis museum, which is attached to the Kanagawa Academy of Science and Technology. In addition, I will present some of our recent studies on novel photocatalyst materials and novel applications of photocatalysis, such as nanofi brous TiO2 photocatalysts, nanotubular TiO2 photocatalysts, and low-refl ection self-cleaning coatings, etc.7,8

References [1] Fujishima, A., Zhang, X., Tryk, D.A., Surface Science Reports, 2008. 63, 515-582[2] Fujishima, A.; Rao, T. N.; Tryk, D. A. J. Photochem. Photobiol. C: Photochem. Rev. 2000, 1: 1-21.[3] Fujishima, A.; Hashimoto, K.; Watanabe, T. TiO2 Photocatalysis. Fundamentals and Applications, BKC Inc., 1999.[4] Fujishima, A.; Zhang, X. C. R. Chimie 2006, 9: 750.[5] Fujishima, A.; Honda, K. Nature 1972, 238: 38-39.[6] Wang, R.; Hashimoto, K.; Fujishima, A; and Watanabe, T. et al. Nature 1997, 388: 431.[7] Jin, M.; Zhang, X.; Fujishima, A. et al. Chem. Commun. 2006, 4483.[8] Zhang, X.; Fujishima, A. et al. J. Phys. Chem. B 2006, 110: 25142.


31

Parallel Sessions

O-09 - Visible Light Driven Oxidation of Volatile Organic Compounds with Gold Nanoparticles Supported on Oxides X. Chen1, H. Zhu1

1Queensland University of Technology, Faculty of Science, Brisbane, Australia

Gold nanoparticles supported on metal oxides have been found to be effi cient catalysts for important oxidation process including selective oxidation of hydrocarbons and oxidation of various volatile organic compounds (VOCs) such as CO, CH3OH and HCHO etc. at moderately elevated temperature. Moreover gold nanoparticles have intensive absorption of visible-light because of surface plasmon resonance (SPR) eff ect. The electromagnetic fi eld of incident light couples with the oscillations of conduction electrons in gold particles, resulting in strong fi eld enhancement of the local electromagnetic fi elds near the rough surface of gold nanoparticles. The combination of the SPR absorption and the catalytic activity of gold nanoparticles highlight an important opportunity in our study: when illuminated with visible light, gold nanoparticles on oxide supports exhibited signifi cant activity for oxidation of formaldehyde and methanol in the air at room temperature.

Here we report a new fi nding: when illuminated with visible light gold nanoparticles on oxide supports exhibited signifi cant activity for oxidation of formaldehyde and methanol in the air at room temperature (298K). It is known that visible light can greatly enhances local electromagnetic fi elds of many sites on gold nanoparticles due to the surface plasmon resonance (SPR) eff ect, and we believe that the enhanced fi elds activate organic molecules adsorbed on the nanoparticles for oxidation. The nature of the oxide support has important infl uence on the activity of the gold nanoparticles. Such oxidations under visible light have existed for centuries on the window paintings of medieval churches with unrealized benefi ts. Our fi nding also reveals the possibilities to drive many other chemical reactions with abundant sunlight on gold nanoparticles at ambient temperature, highlighting a new direction for the research on visible light photocatalysts to degrade organic contaminants.

O-10 - Nanotechnology and the environment: perspectives on potential applications and implications of nanoparticles for water treatmentA. Marcomini1, S. Zuin2, G. Pojana1, A. Critto1, I. Genne3

1University Ca’ Foscari of Venice, Environmental Science, Venezia, Italy2Venice Research Consortium, Environmental Science, Venezia, Italy3VITO NV, Membrane processes, Boeretang, Belgium

It is generally recognised that nanotechnology off ers signifi cant opportunities for sustainable development, infl uencing relevant industrial sectors, i.e. transport, energy, healthcare, information and communications technologies. Nanotechnology can also off er new solutions for improving the quality of the environment, for example, by developing new environmental monitoring systems (e.g. gas sensors based on nanocrystalline metal oxide) or nano-based materials for better fi ltration in water treatment, by using engineered nanoparticles for in situ treatment of contaminated aquifers, etc. Nanomaterials are expected to play a crucial role especially in water purifi cation. However, increasing use of nanoparticles and nanoparticles-based products is triggering a growing debate regarding their potential human health and environmental eff ects, and this includes consideration on how adequately to assess risk posed by them. Today the knowledge about the environmental fate, transport and toxicity of nanoparticles is still in its infancy.

The most relevant nanotechnology-based applications for the environment, with emphasis on water remediation, will be reviewed highlighting the effi cacy of these treatment technologies, and including both performance and cost evaluation. A special attention will be paid to engineered nanoparticles used for water treatment within the EU-funded NAMETECH project (Development of intensifi ed water treatment concepts by integrating NAno- and MEmbrane TECHnologies). The approaches and methods proposed to evaluate the potential long-term implications of utilizing nanoparticles in fi ltration membranes within the NAMETECH project, i.e. characterization activities, estimation of nanoparticles release from modifi ed membranes, Life Cycle Assessment of nanotechnology-based water treatment system, etc., will be presented. The physicochemical properties of nanoparticles relevant for this specifi c application in water treatment will be also pointed up, focusing on most suitable analytical techniques and methods needed to characterize them. Finally, most suitable approaches and integrated methodologies needed to ensure a safe and responsible development of nanotechnology for water and wastewater applications will be summarized.


32

Parallel Sessions

O-11 - Recent experiences and future perspectives of nanoscale zero-valent iron applications for groundwater remediationM. Cernik1, S. Klimkova1, L. Lacinova1, P. Kvapil2

1Technical university of Liberec, NTI, Liberec, Czech Republic2AQUATEST a.s., D51, Liberec, Czech Republic

It is known that the reductive eff ects of zero-valent iron (Fe0) and the sorptive capability of iron and its oxides can be used for both the dehalogenation of chlorinated hydrocarbons (CHC), especially chlorinated ethenes (PCE→TCE→DCE→VC→ethene, ethane), and the removal of some inorganic contaminants (e.g. heavy metals) from groundwater by turning them into a less-soluble form through changes of their oxidation state or by adsorption. Numerous laboratory experiments, especially batch and column experiments, with samples of diff erent nanoFe0 (according to Zhang, TODA and core-shell type), groundwater and soil materials from seven contaminated localities around Europe have been carried out with the aim to discover the measure of the reductive eff ect of nanoFe0 on selected contaminants. The method effi ciency, rate of reductive reaction and the optimal concentrations for real remedial action were determined. The mobility of nanoFe0 samples was tested on laboratory columns showing it is a crucial parameter for application. The nanoFe0 samples were modifi ed by addition of surfactants and other compounds to obtain better migration properties whilst retaining reactivity.

Subsequently, pilot experiments were carried out in the surveyed localities. The data acquired from the measurement of concentrations of contaminants in the groundwater before and during the application of the nanoFe0 in these localities with diff erent types of contamination and diff erent physical, chemical and geological proprieties provide outcomes for the practicability of this chemical decontamination method for a real decontamination intervention. Finally, full remedial designs were proposed and later on applied at 3 contaminated sites. The long-term observations show very good results with a signifi cant and rapid decrease in the observed contaminants and thus provide an important perspective on this remediation method.


33

Parallel Sessions

Parallel Session A5 - Future industrial technologies - Bionanotechnology

KL-05 - Nanotechnology Tools for Life SciencesH. Heinzelmann1

1Nanotechnology & Life Sciences Division, CSEM Centre Suisse d’Electronique et de Microtechnique SA, Neuchatel, Switzerland

In many modern fi elds of life science research the nanometer scale becomes of increasing importance. This is in no contradiction to the strong trend of treating complex biological entities, such as cells, as complete systems that have to be understood as a whole and in the context of complex interactions with their environment. While this system approach clearly goes beyond traditional concepts of examining individual biological processes in an isolated manner, it does nevertheless necessitate their microscopic or molecular level understanding. In this presentation some examples are discussed where nanotechnology and NEMS contribute to this fi eld of research.

Combining bottom-up self-assembly with traditional MEMS and NEMS clean room processes makes possible a new class of components that otherwise would be impossible to realize, or prohibitively expensive to produce. One such example is the use of block copolymer structures as etch masks to create nanoporous membranes from Si based materials. These membranes show an interesting potential for molecular fi ltering and purifi cation, as well as for sensing applications.

In extending the usefulness of Force Microscopy (AFM) based techniques, Nanoscale Dispensing (NADIS) has been developed to transfer ultra-small volumes of liquid from a tip to a substrate. Potential applications are in microarray preparation and in liquid delivery to biological samples, such as injection into cells. Similarly, highly parallel arrays of cantilevered probes have been developed for applications in parallel force spectroscopy. With an optical read-out scheme which is suited for operation in biological buff er solutions, this setup will allow working on cell array based formats for screening purposes.

These developments were carried out at CSEM in the framework of its basic R&D program as well as of European and Swiss national programs. CSEM is an innovation center collaborating with universities to provide solutions to industry.


34

Parallel Sessions

O-12 - Integrated Micro-Nano-Opto Fluid systems for high-content diagnosis and studies of rare cancer cells as early precursors of metastasis Z. Bilkova1, J.L. Viovy2

1University of Pardubice Faculty of Chemical Technology, Dpt. of Biological and Biochemical Sciences, Pardubice, Czech Republic2coordinator of CaMiNEMS consortium, Institute Curie UMR 168, Paris, France

About 90% of cancer mortality today is associated with metastatic relapses. Metastases often develop at in multiple sites in organs diffi cult or impossible to treat by surgery, and are often more resistant to treatment than the primary tumors. These metastases are due to a small number of circulating tumor cells (CTC) (typically a few per million white blood cells). It has been proved that the number of CTC in the blood of patients with breast cancer is strong prognostic factor and an indicator of therapeutic effi cacy [1]. The question of metastatic development is one of the most critical issues in cancer today, but so far it progressed slowly, mostly because of a technological issue. Our project aims at developing the more powerful tools to sort and study rare cancer cells, mainly circulating tumor cells (CTC). The instrument will combine 1) a nanoparticles-based multiscale microfl uidic system, able to capture rare tumour cells with a high yield, and 2) optical nanoobservation and cell culture tools allowing to apply these cells elaborate dynamic cell biology protocols and visualization at the intracellular level with nanoscale resolution. Due to its microfl uidic nature, our system is ideally suited to the current diagnostic trend use minimally invasive sampling methods with minimal risk and maximal patient comfort. New microfl uidic-based sorting technology called “Ephesia” eliminated the problem with the effi cient and specifi c isolation of relatively rare disseminated cells from blood. An Innovative and bioNEMS principle at the heart of our multiscale microfl uidic system is the use of a templated self-assembled magnetic array [2]. Superparamagnetic nanoparticles functionalized with antibodies for CTC are self-assembled in predefi ned regular array (Fig.1A) to capture the cells of interest. The technology was already validated with success on model cell lines [3]. We demonstrated excellent yield and specifi city of capturing; the problem with contamination by non-specifi c cells was eliminated. To study molecular and metabolic specifi cities of the tumor cells we combine our capture platform with in-situ high resolution imaging (Fig 1B). Finally the system allows culturing and reproducing the cells on long time duration. Such approach enables to perform molecular typing at the single cell level and identify molecules or genes associated with a metastatic end point. We are convinced that these fi ndings could help clinicians to test new anticancer drugs and estimate the optimal individual therapy for patient.

References: [1] Gilbey A.M., et al., J Clin Pathol 57(9), 2004, 903. [2] Doyle P.S., et al. Science, 295(5563), 2002, 2237. [3] Saliba A.E., et al., MRS Spring meeting, San Francisco, April 9-13, 2007.

Acknowledgements: this project is under fi nal negotiation phase under FW7, NMP programme.


35

Parallel Sessions

O-13 - Functional printing of biosensor structuresI. Wirth1, E. Groth2, J. Schumacher2, I. Grunwald3, M. Maiwald1, V. Zollmer1, M. Busse4

1Fraunhofer IFAM, Functional Structures, Bremen, Germany2Fh Flensburg, Bioengineering, Flensburg, Germany3Fraunhofer IFAM, Biomolecular Surface and Material Design, Bremen, Germany4Fraunhofer IFAM, Shaping and Functional Materials, Bremen, Germany

BackgroundIn the fi eld of medical diagnostics small detector systems are required. To miniaturise a sensor array or to produce small biochips, biological materials must be applied exactly on surfaces. Sensor fi elds with a great spot density are needed. It seems, that non-contact maskless printing technologies fulfi l the requirements.

ObjectivesPrecise surface structuring, functionalisation and miniaturisation are very important to produce biochips or biosensors. Printing technologies like ink-jet printing and aerosol printing are investigated in terms of suitability and prospects to apply small structures quickly and accurately on various surfaces.

MethodsUsing ink-jet printing small single droplets are generated with minimized shear forces in a printhead, so that even biological materials can be printed non-destructive. An aerosol beam consisting of small droplets with DNA or proteins is generated with less shear forces using aerosol printing technology.

Due to the requirements in terms of biological surface functionalisation, ink-jet and aerosol printing technologies are of great interest in respect of their potential of the application of DNA, peptide and protein suspensions.

ResultsBoth ink-jet and aerosol printing have been investigated refering to possible applications in the fi eld of biosensors. Proteins were marked with diff erent fl uorescent dyestuff s in order to evaluate the applied structures. The investigations show that proteins can be applied structured and without damage on substrate surfaces using aerosol printing. Furthermore recent work shows reproducible, that DNA in a size of 100 to 10,000 base pairs can be applied non-destructive using ink-jet and aerosol printing. Using ink-jet printing spot densities of up to 40,000 spots per square centimeter can be achieved. Conventional spotters often reach only spot densities of 1,000 spots per square centimetre.

Aerosol printing was used for functionalisation of sensor structures. Finger structures were applied with silver and gold ink on glass substrates. In a next step a horseradish enzyme was printed between the fi nger structures. The enzyme survives the printing process without denaturation. The idea of this sensor functionalisation is that small changes in the electrical conductivity can be measured in dependence of the enzymes application. Thus printed enzyme or protein areas can be used for sensitive detection.

Application to practiceTo miniaturise biochips and biosensors, surface structuring technologies must be able to apply biological materials quickly, accurately, inexpensively and fi nely structured on various surfaces. The results show so far, that ink-jet and aerosol printing technologies are suitable for the structured application of biological materials and for a rapid cost-eff ective production of biosensors and microarrays. Sensors itself can be applied directly on various surfaces, as well as the required sensor molecules.


36

Parallel Sessions

O-14 - DNA self-assembled nanostructures can serve as addressable vessels for positioning functional chemical moietiesG. Zuccheri1, R. Passeri1, B. Samori’1

1University of Bologna, Department of Biochemistry, Bologna, Italy

Complex function arises in biology from the proximity and relations amongst diff erent functional units. Often, separate containers are employed in order to segregate specialized function within a cell, or in order to control reactions by facilitated substrates and products diff usion. Self-assembled nucleic-acids nanostructures can serve as templates for the designed assembly of diff erent functional units that can be stably attached at locations defi ned with nanometer accuracy.

In this communication, a few examples are presented where the self-assembled DNA parallelogram, originally designed by Ned Seeman (Sha, Liu et al. 2000), can be used as a relatively rigid template for the assembly of diff erent functional elements, such as oligonucleotides, fl uorophores, proteins.

Depending on its structure, the functional units can be included in the assembly of the parallelogram, or added later after the assembly is completed. This yields the possibility of building nanostructures with a number of diff erent hierarchical levels of complexity, for instance allowing recycling of the functional units without need of breaking down the more complex parallelogram structure. DNA parallelograms can also be polymerized, yielding the possibility of preparing 1D or 2D multi-functionalized templates with controlled distance between multiple functional units (Brucale, Zuccheri et al. 2006).

As in the case of fl uorophores, it can be shown that the rigidity and addressability of the parallelogram tile enables a high degree of control of the relation among the functional units: the measured FRET between two organic dyes is greater than in other less fl exible structures where the dyes could in principle be located at the same distance one from the other. Alternatively, the rigid template can be employed to prevent interaction between functional units that are co-localized at distant sites on it.

As these templates can bind multiple diff erent elements, controlling their location and interaction, it is in principle possible to design functional nano-objects such as smart toxins (by assembling lytic enzymes with homing peptides or antibodies), small enzyme nanofactories (keeping multiple enzymes close in space) or smart-binders (multifunctional rigid binders that can bind and select particular conformational states of macromolecules).

O-15 - New hybrid magnetic nanoparticles for magnetic fl uid hyperthemia and magnetic resonance imagingE. Pollert1, O. Kaman1, M. Veverka1, P. Veverka1

1Institute of Physics ASCR v.v.i., magnetics and superconductors, Prague 8, Czech Republic

Hybrid magnetic nanoparticles consisting generally of magnetic core and biocompatible shell appear to be advanced materials for diagnostic and therapeutic applications. Our research is aimed above all on the following applications:

Magnetic fl uid hyperthermia (MFH) for treating of cancer by magnetically induced heating originating from magnetic nanoparticles deposited in the localized tumor.Contrast materials for magnetic resonance imaging (MRI) with a dominant spin - spin relaxation.

Today available hybrid nanomaterials consist nearly exclusively of magnetite or maghemite magnetic cores and dextran shell. It is, however, diffi cult to control their magnetic properties and modify the surface making diffi cult bonding of drugs or ligands targeted on specifi c types of cells.

Therefore complex magnetic oxides, manganese perovskites, namely La1-xSrxMnO3,

spinels Zn2+xFe3+

(1-x)[Co2+(1-x)Fe3+

(1+x)]O4 and composites (SrFe12O19 + γ-Fe2O3) were selected for a development of new magnetic cores in a range of 5 nm - 80 nm and suitably tailored magnetic properties.

The synthesized magnetic nanoparticles have to be converted into non toxic suspension, stable at physiological pH and allowing their administration either by the direct intratumoral injection or an intravenous one. The former case is represented by particles of manganese perovskite phase La0.75Sr0.25MnO3@SiO2 coated with uniform silica shell, where stabilization is achieved by electrostatic repulsion.

Stabilized suspensions exhibit outstanding properties for MFH application, namely high heating power of 150 - 300 W/gMn at the body temperature for cores in the range of mean size 20 - 40 nm and the self-controlled heating mechanism when the danger of local overheating of the health tissue can be ruled out due to a decrease of the magnetic hysteresis losses in a vicinity of the Curie temperature which can be adjusted in the range of 40 - 60 °C.

The MRI relaxometric studies of LSMO@SiO2 show substantially higher r2 giving an increase of the contrast in comparison with those reported for commercial products based on iron oxides nanoparticles. It achieves at 37 oC for suspensions of nanoparticles of sizes 20 nm as much as 250 s-1/mMMn. The viability of 90 % was evidenced by the tests on the culture of rat mesenchymal stem cells.

The facile modifi cation of the silica shell enables synthesis of superfi cial organic corona based on PEG chains (currently investigated) preventing adsorption of opsonic proteins and thus providing the „stealth“ character of particles exhibiting long circulation time in intravenous applications.

The support by projects ASCR KAN20020061 and KAN201110651 is gratefully acknowledged.


37

Parallel Sessions

Parallel Session A6 - Future industrial technologies - Supramolecular chemistry - Molecular electronics

KL-06 - Molecules in Electronic Circuits: from Molecular Design to New Integration StrategiesM. Mayor1,2

1University of Basel, Department of Chemistry, Basel, Switzerland2Forschungszentrum Karlsruhe GmbH, Institute for Nanotechnology, Karlsruhe, Germany

Molecules are the smallest objects still providing an almost infi nite structural diversity, making them to promising nanoscale building blocks which are designed and assembled by synthetic chemistry.[1] Furthermore, the experimental tools to investigate these objects even on the single molecule level have been developed by experimental physicists providing an outstanding basis for the inspiring and fruitful cooperation between scientists from these two disciplines.

Integrated in electronic circuits, the ability of single molecules to modulate the transport current is investigated. In particular the synthesis of series of compounds of well defi ned structural variations followed by their transport investigations improved the comprehension of the structure/property relationship considerably.[2] First examples of single molecule devises have been developed successfully like e.g. a single molecule rectifi er[3] or electro chemically triggered single molecule switches.[4] Current investigations are geared towards new switching concepts and memory devices. In particular electrochemically triggered switching mechanisms like potential dependent coordination of anchor groups[5] or systems with redox state dependent conformations will be presented. Furthermore, molecular systems interlinking optical and electronic signals are in the focus of interest. However, due to the very limited optical absorption properties of individual molecules, self assembled monolayers (SAMs) of molecules are currently investigated. Recently, a SAM of biphenyl based azo-rods displayed promising large area switching properties[6] allowing its integration as optically triggered functional element in an electronic circuit.[7]

Furthermore, new strategies to assemble nanoparticle/molecule superstructures based on multidentate macroscopic ligands will be discussed.[8] Of particular interest are dumbbell type structures consisting of a bridging molecule between two nanoparticles, which might already be considered as subunits of the metallic electrodes. Thus, the size of the object that has to be contacted from top-down is considerably increased in such bottom-up assembled superstructures. The investigations are geared towards a wet chemical approach to reproducible and in reasonable yields producible dumbbell structures suitable for parallel integration methods like e.g. electrostatic trapping.

References[1] N. Weibel, S. Grunder, M. Mayor, Org. Biomol. Chem., 2007, 5, 2343. [2] R. Huber, M. T. González, S. Wu, M. Langer, S. Grunder, V. Horhoiu, M. Mayor, M. R. Bryce, C. Wang, R. Jitchati, C. Schönenberger, M. Calame, J. Am.

Chem. Soc., 2008, 130, 1080. [3] M. Elbing, R. Ochs, M. Köntopp, M. Fischer, C. von Hänisch, F. Evers, H. B. Weber, M. Mayor, Proc. Nat. Acad. Sci. USA, 2005, 102, 8815. [4] Z. Li, I. Pabelov, B. Han, T. Wandlowski, A. Blaszczyk, M. Mayor, Nanotechnology, 2007,18, 044018. [5] S. Grunder, R. Huber, V. Horhoiu, M. T. González, C. Schönenberger, M. Calame, M. Mayor, J. Org. Chem., 2007, 72, 8337. [6] G. Pace, V. Ferri, C. Grave, M. Elbing, C. von Hänisch, M. Zharnikov, M. Mayor, M. A. Rampi, P. Samorì, Proc. Nat. Acad. Sci. USA, 2007, 104, 9937. [7] V. Ferri, M. Elbing, G. Pace, M. D. Dickey, M. Zharnikov, P. Samorì, M. Mayor, M. A. Rampi, Angew. Chem. Int. Ed., 2008, 47, 3407.[8] T. Peterle, A. Leifert, J. Timper, A. Sologubenko, U. Simon, M. Mayor, Chem. Commun., 2008, 3438.


38

Parallel Sessions

O-16 - “SURMOF”: Anchoring metal-organic frameworks, MOFs, to surfacesC. Wöll1

1Ruhr University Bochum, Physikalische Chemie I, Bochum, Germany

Background:Metal-organic frameworks (MOFs) off er fascinating opportunities for the design of new functional materials. MOFs can be loaded with small molecules (e.g. H2) in storage tanks, with biomolecules for drug release or metal clusters relevant for heterogeneous catalysis. In particular the loading with larger objects creates a tremendous technological potential, e.g. in connection with the development of sensor devices and molecular electronics. For such applications a stable and reproducible anchoring to (electrode) surfaces is mandatory. In the EU-funded project SURMOF, fundamental guidelines for surface controlled initiation and growth of 3D metal-organic frameworks are developed.

Objectives:The goal is a uniform and homogenous coating of surfaces with MOFs. Since the grafting of preformed MOF-particles yields [1] only rather inhomogeneous fi lms (Fig. 1) we have developed a novel step-by-step procedure [2], which yields very homogenous fi lms [3].In detail, the goals of the SURMOF project are:• Preparation and characterization of self-assembled monolayers (SAMs) to be used for nucleation and growth of MOFs.• Fundamental studies on MOF structure-property relationships and their loading with metal-organic precursors.• Development and improvement of theoretical methods to describe anchoring of SURMOFs to surfaces.• Modifi cation of existing MOF concepts to optimize the anchoring to surfaces.• Strategies to deposit MOFs on predefi ned areas of the surface.• Development of concepts to electrically contact MOF particles deposited on nonconducting substrates.• Fabrication of a functioning gas sensor based on SURMOFs.• chemical vapor deposition (CVD) or infi ltration

Results:The most important progress achieved is the development of the new layer-by-layer method to deposit MOFs on solid surfaces. Employing this method, diff erent classes of MOFs have been successfully anchored on suitable organic surfaces. A particular advantage of this method is that it allows to laterally structure the deposited MOF fi lms, see Fig. 2. Very recently is has been demonstrated that the potential of the step-by-step approach goes far beyond coating substrates with MOFs but also allows to create new types of metal-organic frameworks which cannot be fabricated using conventional synthesis methods [4].

Figures:


39

Parallel Sessions

References:[1] K. Szelagowska-Kunstman, P. Cyganik, M. Goryl, D. Zacher, Z. Puterova, R. Fischer, M. Szymonski, JACS 130 (44), 14446 (2008)[2] O. Shekhah, H.Wang, S. Kowarik, F. Schreiber, M. Paulus, M. Tolan, Ch. Sternemann, F. Evers, D. Zacher, R. A. Fischer, Ch. Wöll, JACS 129 (49), 15118

(2007)[3] C. Munuera, O. Shekhah, H. Wang, Ch. Wöll, C. Ocal, PCCP 10, 7257 (2008)[4] O. Shekhah, H.Wang, M. Paradinas, C. Ocal, B. Schüpbach, A. Terfort, D. Zacher, R. A. Fischer, Ch. Wöll, Nature Materials, 2009, in print.


40

Parallel Sessions

O-17 - High-resolution scanning tunneling microscopy studies of terephthalic acid molecules on rutile TiO2(110)-(1x1) surfacesP. Cyganik1, J. Prauzner-Bechcicki1, S. Godlewski1, A. Tekiel1, J. Budzioch1, M. Szymonski1

1Jagiellonian University, Physics, Krakow, Poland

The surface of titanium dioxide is the most often studied metal oxide surface. The adsorption of organic molecules is certainly one of the most appealing directions in the surface science of TiO2, however, the chemical functionalization of these surfaces by organic molecules is still in its preliminary stage. In this contribution we focus on scanning tunneling microscopy (STM) measurements of terephthalic acid (TPA) monolayers adsorbed on the rutile TiO2(110)-(1x1) surface. Our interest in studying adsorption of TPA is driven by the fact that TPA molecules are used in some of metal-organic frameworks (MOFs). MOFs form a relatively new class of porous materials which consist of metal ions linked by specifi c organic molecules like the TPA. It was demonstrated recently that thin fi lms of this material can be very selectively grown on surfaces functionalized by monolayers of organic molecules which mimic the functionality of organic linkers used for MOFs synthesis. Along this line of research, formation of well-defi ned and stable TPA monolayers on the TiO2 surface would enable later research on MOFs formation on this substrate, and thus, possibility of merging these two important classes of materials. STM measurements of TPA deposited on the rutile TiO2(110)-(1x1) revealed formation of well ordered complete monolayer at room temperature. The detailed analysis of diff erent STM contrasts, which most probably correspond to imaging diff erent parts of the fi lm electronic structure i.e. adsorption sites, molecular backbone and surface functional groups, allowed us to propose a model of the TPA adsorption on that surface. In this model adsorption of the TPA molecules takes place in an upright orientation in the (2x1) structure with rather regular network of dimer rows along the [001] substrate direction. Our results show that non-destructive STM imaging, enabling proper analysis of the fi lm structure, requires rather high impedance, i.e. low current set point at relatively high bias voltage. This limitation is particularly important for imaging TPA fi lm at the submonolayer coverage and correct identifi cation of the non-tip-induced defects within the fi lm in the form of missing molecules, domain boundaries and impurities, documented in our studies. The noninvasive STM imaging also allows for direct observation of defects diff usion within the TPA monolayer as exemplifi ed by the detection of the single molecule vacancy migration. Nevertheless, our STM measurements show that these inherent defects do not disturb signifi cantly the order and stability of the TPA monolayer, as it is also demonstrated by its resistance against exposure to the air environment. The later property is particularly important since it enables ex situ analysis of this system, and its further treatment in the non-UHV environment.

O-18 - Solution Based Supramolecular Self-Assembly on Surfaces: Towards a Toolbox for the NanoscaleM. Buck1, I. Cebula1, M. Raisanen1, C. Shen1, C. Silien1

1University of St Andrews, School of Chemistry, St Andrews, United Kingdom

Contrasting established top-down approaches to access the nanometre range, supramolecular chemistry as bottom-up strategy is considered a most promising alternative due to the precisely defi ned dimensions and the virtually unlimited fl exibility in the design of molecules. So far, work in this area has been dominated by synthesis and characterisation of bulk materials, whereas supramolecular chemistry on surfaces is much less developed. However, for technological developments surface based assembly can be expected to be crucial as this allows controlled arrangement of functional entities not only in the two dimensions of the surface plane but also into the third dimension. With respect to the latter it is crucial to realize that surface controlled assembly goes beyond the possibilities of bulk processes [1].

The extent to which surface based supramolecular chemistry can be harnessed for technological developments will depend on, fi rstly, how robust such structures are with respect to further processing and, secondly, whether fl exible and routinely applicable procedures are available. With respect to the latter a solution based preparation is crucial since it is simple and, in contrast to vacuum based methods, does not impose limitations on the choice of molecules.

Recently, we made signifi cant progress towards the exploitation of supramolecular systems at surfaces by, fi rstly, showing that hydrogen bonded networks can be prepared from solution which are suffi ciently robust to allow further processing. Secondly, we have merged supramolecular chemistry with a complementary concept of self-assembly which is based on self-assembled monolayers (SAMs) [2,3].

The supramolecular networks allow control of dimensions on the sub-5 nm scale as demonstrated by experiments where networks containing perylene tetracarboxylic di-imide (PTCDI) and naphtalene tetracarboxylic di-imide (NTCDI) are compared. Using the networks as templates, SAMs are formed which are patterned on the nanoscale. Since SAMs enable precise tailoring of surface properties, the combination of both assembly concepts is a promising way to control chemistry on the nanoscale, ultimately down to the level of single molecules.

References[1] O. Shekhah et al, Step-by-Step Route for the Synthesis of Metal-Organic Frameworks, J. Am. Chem. Soc. 129, 15118 (2007).[2] R. Madueno et al., Functionalizing hydrogen-bonded surface networks with self-assembled monolayers, Nature 454, 618 (2008).[3] C. Silien et al., A Supramolecular Hydrogen-Bonded Network as a Diff usion Barrier for Metal Adatoms, Angew. Chem. Int. Ed. 48, Published Online:

Apr 3 2009.


41

Parallel Sessions

O-19 - Synthesis of novel organic ligands for gold nanoparticles decoration and architectures based on them A. Majouga1, R. Antipin1, L. Agron1, E. Beloglazkina1, R. Romashkina1, P. Rudakovskaia1, N. Zyk1

1Lomonosov Moscow State University, Chemistry, Moscow, Russia

At present time the research on gold nanoparticles is one of the most important topic in chemistry, in life and materials science. This is mostly due to the versatility of these systems: the properties of gold nanoparticles can be used in a high range of applications thanks to the combination of their particular and unusual optical and electronic properties. The multi-scale organization of metal nanoparticles is a key step in their application as macroscopic nanodevices. Well organized nanostructures often display valuable chemical, optical, catalytic, electronic and magnetic properties, that are distinctly diff erent from those of their component parts or those of larger mass.Nowadays our research work is deals with synthesis of new organic sulfur-containing ligands with additional donor atoms and investigation of their adsorption properties on gold surface and gold nanoparticles. At present time numerous sulfur-containing compounds (such as thiols, disulfi des, diaryldisulfi des, dithiocarbamates, sulfi des and thiourea derivatives) are widely applied for gold nanoparticles modifi cation, but, unfortunately the adsorption of organic ligands involving terminal donor groups hasn’t been developed yet, in spite of the fact that interaction of such nanoparticles with transition metal ions would result in obtaining new nano-hybrid materials on the basis of gold nanoparticles. In addition, compared with pure organic compounds, the metal-ligand complexes provide rich redox, optical and electronic properties, which enable them to be good building blocks for constructing functional hybrids.Synthesis of gold nanoparticles, their properties, principle possibility of 2D and 3D aggregates formation will be concerned in presentation. We thank RFBR (grant № 07-03-00584), RSC and Nanochemtech Ltd. for fi nancial support of this work.


42

Parallel Sessions

Parallel Session B1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in transportation

O-20 - Nano applications in ContinentalH. Kornemann1 1CONTINENTAL, Germany

With targeted annual sales of €25 billion for 2008, the Continental Corporation is one of the top automotive suppliers worldwide. As a supplier of brake systems, systems and components for the powertrain and chassis, instrumentation, infotainment solutions, vehicle electronics, tires and technical elastomers, the corporation contributes towards enhanced driving safety and protection of the global climate. Continental is also a competent partner in networked automobile communication. Today, the corporation employs approximately 146,500 at nearly 200 locations in 36 countries. Research in Naonotechnology, both regarding nanoscale materials and nano strucures, is conducted in various areas of the corporation. Applications include tyres, elastomers, and automotive electronics - presentation will provide an overview of sample projects.

O-21 - Atmospheric pressure plasma jet treatment for eco- & energy-effi cient industrial production in the transportation sector U. Lommatzsch1, D. Kolacyak1, C. Regula1, R. Wilken1, J. Ihde1

1Fraunhofer IFAM, Surface Technology, Bremen, Germany

Cleaning, pretreatment, and coating of metals and polymers are signifi cant process steps in many industrial production lines. Typical examples for such processes are the corrosion protection of metals by applying an organic coating, or the use of adhesion-promoting layers (primers) to achieve durable adhesive bonds for the assembly of multi-material structures. Applications range from high-demanding applications in the aeronautic sector to mass consumer products. Surface treatment by atmospheric pressure plasma is an interesting alternative to conventional (wet-chemistry based) coating processes, because of its effi cient use of resources. Plasma treatment needs only small amounts of chemicals because the typical thickness of coatings is in the range of 1-500 nm. Atmospheric plasma provides also high process speeds and allows the localized treatment on the required surface area only. As an overview, three examples for the use of atmospheric pressure plasma jets for such applications will be given.

(a) Corrosion protection: A 500 nm thin plasma polymer coating based on a siliconorganic material is deposited at atmospheric pressure on aluminum. The protective properties of the coating are evaluated by a salt spray test. Depending on the type of aluminum alloy the surface is protected for up to 500 hours. This indicates the high potential for a plasma based coating process at atmospheric pressure as a replacement for organic coatings (containing e.g. chromium). An industrial example for the use of such a chromate-free coating in the automotive sector will be presented.

(b) Adhesion promotion: Typical adhesion promoters in the adhesive bonding of aluminum are often based on organic solvents or contain metallo-organic compounds. To reduce the emission of volatile organic solvents and to avoid the use of hazardous materials a very thin (< 15 nm) coating is applied by an atmospheric plasma. It will be shown that this coating improves eff ectively the durability of aluminum/epoxy joints under corrosive and wet/humid environmental conditions.

(c) Functionalization of carbon nano tubes (CNT): The use of CNTs in the transportation sector includes applications for fuel cells or the design of new materials with improved properties, such as strength, weight, or electrical/thermal conductivity. The effi cient use of CNTs in metallic or polymeric matrices requires a good dispersability. Therefore CNTs need to be functionalized before getting dispersed in the matrix. Today typically functionalization of CNTs is achieved by wet chemical treatment, e.g. nitric acid treatment. It will be shown that the functionalization of CNTs can be also achieved by an atmospheric pressure plasma process.

Those examples shall demonstrate how nanotechnology products (coating + particles) can be processed by a resource-effi cient plasma process at atmospheric pressure.

O-22 - The Real WorldI. Konecny1

1Elmarco s.r.o., Liberec, Czech Republic

Position of Elmarco’s Nanospider™ technology in the real world of emerging opportunities for new applications of nanofi ber materials will be described.

Elmarco’s business model is based on partnership. Benefi ts and challenges of this approach will be discussed in the presentation. Deliberations about the ways how to create new markets for the exciting nanofi ber products will be presented.

Elmarco as an example case study will be used to demonstrate possible approach to high technology transfer to the real life.

The principle, main features, and technical capabilities of the technology will be presented in the paper. Materials for fi nal products used in transportation applications (sound absorption, fi ltration, catalysts, batteries, fuel cells, composite materials) and their recent test results will be described and discussed.


43

Parallel Sessions

0-23 - The LAYSA project: Multifunctional layers for safer aircraft composite structuresJ.L. Viviente1, C. Elizetxea1, N. Markaide1, M. Txapartegi1

1INASMET-Tecnalia, San Sebastian, Spain

The use of composite materials in aeronautics industry has increased constantly over the last 35 years, due mainly to their high specifi c strength and stiff ness combined with the possibility of designing complex geometry components that are more aerodynamically effi cient than metals. But due to organic nature of polymeric matrix component, composite materials are electrically and thermally bad conductors and they tend to burn easily, emitting toxic gases and smoke. For that, they require aff ordable, eff ective and certifi able protection systems against atmospheric hazards such as icing, as well as fi re and burning in case of accidents. Moreover, improved in fi eld inspection techniques are required with the increased use of composite materials.

Current technologies address those issues separately; ice protection is usually performed by mean of a metal mesh or foil incorporated into the outer ply of fabric on the skin of the structure, fi re protection is performed with thermal barrier coatings on the structures and life monitoring is performed with embedded sensors. All of them add high weight penalty and complexity during the component manufacturing and posterior maintenance even may go against the structural integrity of the component in some cases.

With the participation of twelve European members, the LAYSA FP7 project (Multifunctional Layers for Safer Aircraft Composite Structures, contract nº: ACP7-GA-20008-213267) will develop a new multilayer material that approaches the problems of icing protection, fi re resistance and health monitoring of a composite component simultaneously. The outer layer of the multilayer material will be reinforced with either carbon nanofi bers or carbon nanotubes. The conductive capacity of the carbon will mean that an electrical fi eld will heat the composite component and avoid ice from building up on its surface. An inner layer will contain inorganic nanoreinforcements that may be combined with fl ame retardants to enhance the fi re resistance of the component without signifi cantly increasing its weight, a key factor in aeronautical applications. In addition, the sensory capacity of the materials will also be used to identify the status of the part at all times (self-inspection).

The direct benefi ts of the proposed application include: a) Improve aircraft safety and security, b) Structural weight reduction and simplifi cation of manufacturing processes and maintenance operations due to elimination of current metals mesh or foils, by replacement with multifunctional layer integrated in composite structure.


44

Parallel Sessions

O-24 - Aerospace Nanotube Hybrid Composite Structures with Sensing and Actuating Capabilities - the NOESIS projectG. Maistros1

1INASCO Hellas, Greece

BackgroundNOESIS is the fi rst EC funded research project in the Aeronautics sector that exploits the potential offered by Carbon Nanotube (CNT) reinforcements and focuses on developing novel nano-composite components with enhanced sensing and actuating capabilities. 15 partners across Europe involving large industrial organisations, universities and SMEs aim at material property enhancement and unique value-added properties not normally possible with common fi llers and only with small loading (0.1-1%) of nanoparticles. Added benefi ts include reduced component weight and embedded sensing capacity.

ObjectivesThe effort is concentrated around the forming of CNT structured assemblies (such as CNT fi bres) embedded into resin systems for sensing and actuating purposes and also mechanical performance improvement. The underlying modelling activity focuses on defi ning and implementing of a multi-scales approach for designing nano-composites (see Figure 1). The main innovation lies on the development of a coupled platform for mechanical sensing-actuating performance predictions. For the assessment of the impact of CNT addition an experimental campaign was organised for the design and fabrication of CNT-doped matrices and CNT modifi ed composite structures to measure damage tolerance, fracture toughness, fatigue performance and damping properties.

Fig. 1. Multi-scale design approach showing the hierarchy of models

ResultsDuring the project novel composites were manufactured and although they did not exhibit greatly improved mechanical properties and superior damage tolerance properties, they managed to prove their sensing and actuating capacities due to the inclusions of CNTs and CNT fi bres. Developed models were divided into 3 major categories based on the scale of approach: CNT-, micro- and macro-level. In all levels pioneering work achieved to simulate several aspects of the CNT behaviour towards sensing capability. In some modelling cases there was interconnection at adjacent scaling levels. A roadmap has been created revealing the remaining steps for the completion of a fully-integrated multi-scale modelling platform predicting required properties (mechanical, electrical) for CNT reinforced composite structures.

Applications to practiceTo demonstrate the modelling utility in designing sensors for nanocomposites, several real-life applications were designed and realised. They include strain and damage sensing in structural aerospace components incorporating adhesive joints or stiff ened panels, enhanced acoustic characteristics of hollow spheres and CNT doped resin systems for effi cient microwave curing of thermosets.

ConclusionCNT structured arrays off er the potential for integration, modelling and validation of real time sensing / actuating systems in structural composite materials. It has been shown that is feasible to achieve the scale up of sensing and actuating performance of CNTs into macro structures and realise life monitoring capability.


45

Parallel Sessions

O-25 - Does surface nanostructuring infl uence ship-fouling organisms?J. Callow1

1University of Birmingham, Biosciences, Birmingham, United Kingdom

Biofouling is the unwanted growth of marine organisms on structures in aquatic environments, and constitutes a signifi cant economic problem with associated environmental impacts. Fouling of a surface is essentially the outcome of the molecular interfacial processes involving the polymeric adhesives produced by the aquatic organisms, and the substrates to which they attach. This adhesion is infl uenced by the physico-chemical properties of a surface such as surface energy, charge, conductivity, porosity, roughness, wettability, friction, physical and chemical reactivity. All of these surface properties may be manipulated at the nanoscale. The EC-funded, Framework 6 Integrated Project, AMBIO (‘Advanced Nanostructured Surfaces for the Control of Biofouling’) was set up to explore the potential of surface nanostructuring for creating conceptually novel coatings for the control of aquatic fouling, without the use of biocides. This presentation will discuss some of the results of the project that illustrate how nanosurface engineering infl uences fouling organisms.


46

Parallel Sessions

Parallel Session B2 - Nanotechnology for energy - Photovoltaics and Thermoelectrics

KL-07 - Organic Photovoltaics - a scalable nanotechnology for energy harvestingJ.A. Hauch1

1Konarka Technologies GmbH, Nürnberg, Germany

As the demand for energy is increasing and non-renewable energy resources are dwindling new solutions for cost eff ective conversion of sunlight into electric power are required. Flexible solar cells based on Organic Photovoltaics (OPV) are widely expected to be the fi rst truly low cost solar technology. OPV utilizes nano-junctions made from Fullerenes and semi-conducting polymers that result in ultra-thin solar cells. For production these semiconductor materials are dissolved in solvents to produce inks that are printed onto plastic substrates. The results are thin and fl exible solar modules, which are produced in a low-cost and highly scalable process. While the technology is still in its early stages, fi rst products with 3% effi ciency and 3 years of lifetime are being realized. The presentation will introduce the technology, performance and expected future developments of organic photovoltaics.

O-26 - Nanotechnologies for PV application new trendsB. Fillon1

1CEA, LITEN, Grenoble, France

CEA/LITEN is strongly involved in research, industrial development and innovation for energy applications. The goal is to develop promising technologies for the wide deployment of solar energy, fuel cell, batteries, etc. in France and throughout the world.

Photovoltaic (PV) research area covers a large panel of activities, from solar grade silicon material production to solar cells encapsulation in innovative module architectures. Several teams address respectively various generation and technology of PV cells:

1. silicon wafer-based, from standard multicristalline cells to high effi ciency heterojunction architectures 2. thin fi lms solar cells, including silicon and CIGS 3. various nanostructures and nanotechnologies adapted on solar cells.

Nanotechnologies and nanomaterials have been introduced in PV roadmaps towards higher conversion effi ciency. Specifi c physical properties at nanoscale let researchers think that strong effi ciency enhancement could be obtained. This new class of PV material can be manufactured with nanotechnology tools and could be easily implemented in PV silicon processing or on various cheap substrates as glass, steel and polymers. Various confi gurations and applications are possible and have been depicted by diff erent laboratories. For solar energy based on nanomatechnologies, LITEN is especially focused on nanostructured active PV material as semiconductor quantum dots and nanowires and nanophotonic structures as photonic crystals and surface plasmons generators.

Quantum dots are studied to create a nanomaterial showing the capability to tune optical energy band gap, so as to allow ideally the design of multijunction silicon solar cells. Main issue is to design a material architecture with higher band gap and with enough conductivity for effi cient photogenerated carrier collection.

Nanowires are an interesting alternative with conductivity demonstrated along wires and possibility to have an effi cient doping of the array of nanowires. Nanowires can be used in two types of PV devices. A fi rst approach consists in synthesizing nanowires with very small diameters (less than 5 nm), for tuning the band gap and realizing multijunction solar cells. A second approach consists in forming nanowires with a pn junction in the radial direction. Such radial junction solar cells may allow an almost ideal collection of photogenerated carriers, since the nanowire diameters can be adjusted to the carrier diff usion length.

Optical nanostructures are promising solutions to enhance optical absorption inside active PV material, as thin fi lms and silicon wafers are supposed to go thinner and thinner. Photonic crystals and nanostructures generating surface plasmons are able to modify light propagation to allow a stronger absorption in PV structures.

Nanotechnologies can then be applied on diff erent generation of solar cells.


47

Parallel Sessions

O-27 - Enabling nanotechnologies in photovoltaics and thermoelectrics for effi cient and clean transportation M. Brignone1, A. Ziggiotti1, L. Belforte1

1Centro Ricerche FIAT, Micro & Nanotechnologies, Turin, Italy

The transport sector is responsible for almost 60% of oil consumption in OECD countries, it is the chief sector driving future growth in world oil demand and a major source of pollution and greenhouse gas emissions. Air pollution is a serious problem in many regions of Europe. Pollutants include nitrogen oxides, sulphur dioxide, carbon monoxide, volatile organic compounds, lead, and particulate matter, which are health hazards, damage the environment, and limit visibility. Besides, it must be taken into account that only 30% of the chemical energy of the fuel is converted into mechanical power while the remaining 70% is lost as waste heat through the engine cooling system and exhausted gases. The demand for electrical energy on board is now around 3-4 kW and is expected to grow more and more in the next years, but on present ICE vehicles chemical-to-electrical energy effi ciency is only 19%.

Hence two main challenges have to be faced to move towards effi cient and clean mobility: the energy generation from green sources and the recovery of waste energy. Photovoltaics and thermoelectrics perfectly match these requests and micro and nanotechnologies can represent the added value for the defi nitive, wide and effi cient application of PV and TE systems on board vehicle.

Thin fi lms photovoltaic are projected at a cost below 100$/m2 and their integration in the automotive body is a relatively easy process, they maintain a good response under diff used light and can satisfy the design requirements. Amorphous Si, CdTe, CIGS and dye-sensitized cells can be deposited on either coated glass or fl exible substrate and are amenable to large area deposition and hence high volume manufacturing. Then third generation solar cells promise to bring further advantages characterised by effi ciencies beyond Shockley-Queisser limit and costs and versatility comparable with thin fi lm solar cells.

Thermoelectric generators and coolers are compact, quiet, stable and very reliable, but they have found few applications because of their low effi ciency and low COP and relatively high cost. To be able to recover even only 10% of the waste heat of a vehicle would have a striking impact on fuel saving, CO2 emission reduction, alternator size reduction and money saving.

Also the TE refrigeration on board can bring many advantages: no need for pipelines, absence of cooling fl uids, easiness of integration, localized cooling and the possibility to optimize the thermal management with energy saving. In particular the application of TE device on vehicles becomes crucial in a possible future scenario of totally electrical cars.

A signifi cant break through for a wide application of TE in the automotive sector is given by the introduction of nanotechnologies which permit to overcome present limitations of thermoelectric systems using nanomaterials characterized by high effi ciency, low costs and scalability.

O-28 - Self-Organized Titanium Oxide Nanotube-Layers: Application in Dye Sensitized Solar CellsP. Schmuki1

1LKO Uni-Erlangen, Materials Science, Erlangen, Germany

The presentation demonstrates approaches to achieve electrochemical fabrication of self-organized high aspect ratio titanium oxide nanotube layers. Key to obtain highly defi ned tubes is an optimized and controlled anodization of titanium in fl uoride containing solutions. In general, the morphology of the tubular layers is aff ected strongly by the electrochemical parameters such as solution pH and anodization voltage. By optimizing the local electrochemical conditions within the tubes, layers consisting of highly ordered TiO2 nanotubes with a length of several 100 micrometers can be grown on Ti surfaces. The diameters that can be obtained range from 20 nm to 200 nm with typical wall thicknesses in the range of 10-20 nm. Titanium oxide is a highly functional material that has, for example, interesting semiconductive or surface catalytic properties and therefore a high potential for technological exploitation. The talk will address applications of the TiO2 nanotube layers in solar energy conversion.


48

Parallel Sessions

O-29 - Integer charge transfer model - application to donor-acceptor heterojunctionsS. Braun1, L. Lindell1, X. Liu1, P. Sehati1, M. Fahlman1

1Linkoping University, Department of Physics, Linkoping, Sweden

Organic electronic devices as solar cells, light-emitting diodes and fi eld-eff ect transistors are basically interface devices where their ultimate performance is dominated by the relative position of energy levels across the stack of thin organic layers. For this reason the energy level alignment at interfaces comprising organic materials is of high importance in device engineering and optimization. In spite of a great progress that has been made on this topic a detailed and unifi ed understanding of the electronic processes occurring at these interfaces is currently missing, though signifi cant progress have recently been made on this topic [1-3].

Experimental results obtained on various organic-organic semiconductor hetero-junctions and the pinning values (EICT+, EICT-) of their constituents show that the behavior of specifi c organic hetero-junctions can be predicted by the ICT model using values of the integer charge transfer states and substrate work functions as measured by ultraviolet photoelectron spectroscopy (UPS). Accordingly, the relative position between the molecular (polymer) pinning levels (EICT+, EICT-) and the substrate Fermi level can play a detrimental role for the energetic alignment at the organic-organic interfaces in a multi-layered structure. Hence, not only the relative position between charge transfer states of the given materials forming the interface is important, but also their energetic position with respect to the substrate/electrode Fermi level [4]. In the context of photovoltaic devices of particular interest is the energy level alignment at organic-organic interfaces comprised of donors and acceptors. As will be shown on various examples, the relative position of ICT states, not HOMO and LUMO levels, is the relevant parameter to characterize and predict the interfacial interaction at donor and acceptor interfaces.

References[1] C. Tengstedt, W. Osikowicz, W.R. Salaneck, I.D. Parker, C-H. Hsu and M. Fahlman, Appl. Phys. Lett. 88 (2006) 053502. [2] M. Fahlman, A. Crispin, X. Crispin, S.K.M. Henze, M.P. de Jong, W. Osikowicz, C. Tengstedt and W.R. Salaneck, J. Phys.: Condens. Matter 19 (2007)

183202. [3] S. Braun, W. R. Salaneck and M. Fahlman, Adv. Mater., (2009) DOI: 10.1002/adma.200802893. [4] S. Braun, M.P. de Jong, W. Osikowicz, W.R. Salaneck, Appl. Phys. Lett. 91 (2007) 202108.


49

Parallel Sessions

Parallel Session B3 - Nanotechnology for health and environment - Nanotechnology applications for water treatment

KL-08 - Photocatalysis for Water and Wastewater TreatmentJ.A. Byrne1

1University of Ulster, Nanotechnology and Integrated BioEngineering Centre, Newtownabbey, N. Ireland / U. K.

Photoexcited metal oxide semiconductors e.g. TiO2 and ZnO, have been reported to be eff ective for the photocatalytic degradation of a wide range of organic pollutants in water and the inactivation of pathogenic microorganisms. TiO2 is particularly suitable for water and wastewater treatment because it is: photoactive, insoluble under normal pH conditions, chemically and photochemically stable, non-toxic, inexpensive and readily available. This paper will present some work investigating the degradation of problematic pollutants and the inactivation of pathogenic microorganisms. In particular the paper will focus on two areas: 1. enhancing the solar disinfection of water for application in developing countries (pilot scale studies) and 2. fabrication of titania nanotubes (self-organised and dispersed) and their use for water treatment.

1. Enhancing solar disinfection of water: Diarrhoeal disease kills approximately 1.8 million people each year and accounts for nearly one fi fth of the deaths of children under 5 years old in developing countries and contaminated drinking water is a major source of disease. Solar Disinfection (SODIS) is a simple technique where transparent bottles are fi lled with contaminated water and placed in direct sunlight for 6 hours. SODIS can be eff ective against the pathogens responsible for cholera, dysentery, typhoid, salmonella, gastroenteritis, cryptosporidiosis, giardiasis and polio. However, some pathogenic microorganisms will exhibit a higher resistance to SODIS treatment. The use of nanoparticle TiO2 may be used to enhance the solar disinfection. As part of the SODISWATER FP6 project we have been testing photocatalytically enhanced solar disinfection on a pilot scale under real sun conditions.

2. Titania nanotubes: Nano-engineered materials may off er greater effi ciency for photocatalysis and other applications due to increased surface area and size quantisation eff ects. Very high surface area TiO2 nanotubes have been grown using a hydrothermal method. While these materials have specifi c surface areas up to ten times that of very active titania nanopaticles, they do not perform as eff ectively for photocatalytic water treatment. Reasons for this will be discussed. Furthermore, self-organised aligned titania nanotubes may be grown by the electrochemical oxidation of titanium in a fl uoride electrolyte. The tube morphology and crystallinity may be controlled by the anodising parameters and post-growth anneal. These materials show great promise for photocatalytic and electrochemically assisted photocatalytic water treatment.


50

Parallel Sessions

O-30 - EWAT®: electrocoagulation and advanced oxidation wastewater treatment process involving nanostructure materialsI. Aglietto1

1SA Envitech s.r.l., Italy

The EWAT® process is a new approach to industrial wastewater treatment and purifi cation. The process, involving nanostructure materials, is characterized by a heightened capacity to remove a wide range of contaminants, and features a simple design confi guration and modular set up which can be integrated depending on the volume of wastewater to treat and on the concentrations to be reached before discharge. In this kind of process there is no sludge production.

The process is carried out through two main stages:• the electrocoagulation process;• photocatalytic process of advanced oxidation with titanium dioxide and multi-walled carbon nanotubes.

The main innovation in the electrocoagulation process is the fact that both cathode and anode electrodes are made of carbon nanostructures. This material, having undergone mechanical compression, creates electrodes with the following properties:• heightened conductivity thanks to carbon nanotubes;• catalyzing behavior: no electrode-corrosion takes place at the anode;• no sediment or sludge are formed in the process cell;• they allow the creation of highly-oxidizing products.

The main and innovative feature of the photocatalytic process is the use of titanium dioxide in anatase form combined with multi-walled carbon nanotubes. The nanotubes have a very interesting structure and excellent electronic properties, actually making them semiconductors in their own right.

The nanotubes are made of nano-cylindrical molecules which at room temperature can convey electricity with almost zero resistance. This phenomenon is known as the ballistic eff ect, in which electrons move freely throughout the structure. Therefore, the electrons that are freed as a result of the activation of titanium dioxide are easily transported to nanotubes that are linked with TiO2.

It follows that the possibility of recombination of the e-CB/h+

VB (CB = conductivity band, VB = valence band) couples, that represents the main critical state in photocatalytic processes, is greatly reduced by increasing the production level of the process. When an electron is transferred from the titanium dioxide to the nanotube, these reactions take place:

TiO2(e-CB) + CNTs = TiO2 + CNTs(e-) (1.1)

CNTs(e-) + O2 = CNTs + O2•- (1.2)

CNTs(e-) + H+ + O2•- = HO2

•- (1.3)HO2

•- + H+ = H2O2 (1.4)O2

•- + H2O = HO2- + OH• (1.5)

contaminant + OH• = contaminant degradation (1.6)

In addition, the chemisorption of water on the surfaces of TiO2/CNTs particles increases the amount of hydroxyl groups present, thus increasing the effi ciency of the process.

The EWAT process can be used for all wastewater with high organic contaminant loads, as a treatment in itself or as a process integrated into existing plants.

Its effi ciency in organic-material and MTBE (Methyl-Tertiary-Butyl-Ether) removal is due to a unique system in the water-treatment fi eld, providing improved results both in terms of quality levels at point of discharge and in treatment costs.

O-31 - Nanotechnology for clean water: Water detoxifi cation using innovative visible nanophotocatalystsP. Falaras1, V. Likodimos1, P. Aloupogiannis2

1NCSR “Demokritos”, Institute of Physical Chemistry, Athens, Greece2NCSR “Demokritos”, Institute of Material Sciences, Athens, Greece

This presentation highlights the main issues of the “Clean Water - 227017” project that will be implemented under FP7-ENV-NMP-2008-2. The concept of the project is based on the development of innovative nanostructured UV-Visible photocatalysts for water treatment and detoxifi cation by using doped TiO2 nanomaterials with visible light response. The project aims at an effi cient and viable water detoxifi cation technology exploiting solar energy and recent advances in nano-engineered titania photocatalysts and nanofi ltration membranes for the destruction of extremely hazardous compounds in water. To this aim, the UV-VIS responding titania nanostructured photocatalysts will be stabilized on nanotubular membranes of controlled pore size and retention effi ciency as well as on carbon nanotubes exploiting their high surface area and unique electron transport properties to achieve photocatalytically active nanofi ltration membranes. This will be the crucial component for the fabrication of innovative continuous fl ow photocatalytic-disinfection-membrane reactors for the implementation of a sustainable and cost eff ective water treatment technology based on nanoengineered materials. Comparative evaluation of the UV-visible and solar light effi ciency of the modifi ed titania photocatalysts for water detoxifi cation will be performed on specifi c target pollutants focused mainly on cyanobacterial toxin MC-LR and endocrine disrupting compounds (EDC) in water supplies as well as classical water pollutants such us phenols, pesticides and azo-dyes. Particular eff orts will be devoted on the analysis and quantifi cation of degradation products. The fi nal goal is the scale up of the photocatalytic reactor technology and its application in lakes, tanks and continuous fl ow systems for public water distribution.


51

Parallel Sessions

O-32 - Removal of arsenate from water by magnetic nanoparticlesT. Tuutijarvi1, R. Vahala1, M. Sillanpaa2, G. Chen3

1Helsinki University of Technology, Department of Civil and Environmental Engineering, Espoo, Finland2Kuopio University, Department of Environmental Sciences Laboratory of Applied Environmental Chemistry, Mikkeli, Finland3The Hong Kong University of Science and Technology, Department of Chemical and Biomolecular Engineering, Hong Kong, Hong Kong

Arsenic is a poisonous and carcinogenic heavy metal which exists naturally on the earth’s crust, but can also be transferred to nature by anthropogenic source. At certain conditions it is easily leached to the groundwater, which is common water source worldwide. Arsenic pollution has been documented globally; however, the most alarming exposures are reported in Bangladesh and West-Bengal in India. Because of the toxicological eff ects of arsenic, the guideline value in drinking water is set as low as 10 μg/L. The common arsenic removal techniques are adsorption, precipitation, ion exchange and reverse osmosis. The major disadvantages of conventional adsorbents are diffi cult separation (centrifugation or fi ltering), waste formation and in many cases poor adsorption capacity. Here is introduced a novel adsorbent, magnetic nanoadsorbent, which has a good adsorption capacity with a small adsorbent quantity and easy separation by a magnet.

Objectives of the study were to investigate suitability of a magnetic nanoadsorbent, maghemite, for arsenate removal. Methods used were synthesis of maghemite nanoparticles by sol-gel method, characterization of maghemite, single- and multi-component batch adsorption experiments and magnetic separation. The eff ect of interfering ions on arsenate removal was studied with multi-component system. Adsorption studies were conducted with commercially purchased and sol-gel synthesized maghemites.

The specifi c surface area of sol-gel method synthesized particles was 90.4 m2/g and an average particle size was 12.1 nm. Commercial maghemite possessed a slightly larger particle size, 18.4 nm, and the specifi c surface area of 51.0 m2/g. It was observed that maghemites adsorb arsenate successfully. Adsorption equilibrium was reached at the same time frame 30-50 hours for both maghemites and the kinetics followed typical behaviour of heavy metal adsorption onto oxide surface; adsorption reaction is rapid initially and then the rate diminishes gradually. During the rapid stage, in 30 minutes, approximately 80-90% of arsenate was adsorbed onto the maghemites. Experimental data of maghemites fi t well with Langmuir isotherm and adsorption was pH and surface area dependent. The best adsorption effi ciencies were achieved at pH 3 for maghemites, 25.0 mg/g and 16.7 mg/g for sol-gel and commercial maghemite, respectively.

O-33 - Development of advanced nano-engineered membranes for water purifi cationI. Gehrke1, V. Keuter1

1Fraunhofer UMSICHT, Process Technology, Oberhausen, Germany

Background In 2030, 47% of world population will be living in areas of high water stress (UN World Water Development Report 3, 2009).From the global water shortage an emerging need for novel, more effi cient and cost saving water purifi cation methods is resulting. In both developing and industrialised countries a growing number of contaminants like micropollutants (e. g. endocrine substances) are entering water supplies. Conventional water decontamination processes basing on oxidising chemicals like ozone or chlorine consume a high amount of chemical agents and, furthermore, can produce toxic by-products [1]. A more promising water cleaning method represents the membrane technology with very poor use of chemical substances and secures retention of contaminants. However, membrane processes are characterised by a high tendency to fouling resulting in drastically fl ux decrease.

Objectives The adaption of highly advanced nanotechnology to traditional process engineering off ers new opportunities for the intensifi cation of water processes. In our approach we focus on the application of nanocoating procedures to membrane processes in order to reduce the fouling potential of membranes and increase the fi ltration capacity.

Methods Nanocoating methods based on biocide and photocatalytic substances like titandioxide and silver are applied in order to functionalise membranes. For producing suitable membranes novel moulding processes were utilised. Specifi c experimental set-ups at laboratory scale for measuring permeate fl ux, pressure loss and photocatalytic as well as biocide eff ects were mounted.

Results Novel metallic microsieves at CD-scale, including a homogeneous pore size distribution and higher robustness, have been developed and tested [2]. They feature an enormous permeate fl ux. In order to maintain the high permeate capacity, currently, fouling repellent nanocoatings consisting of photocatalytic titandioxide are applied to the membrane surface. The coatings are characterised by a high adhesion to the metallic membrane material. The coating process can be exactly controlled, so the very precise pore geometry is preserved and the holes are kept unblocked from coating material.

Conclusion/Applications The novel fouling repellent metallic microsieves are to be implemented in compact and fl exibly adjustable membrane modules particularly for producing potable water but also for the post-treatment of waste water. Due to their high robustness and easily handling among others decentralised plants, e.g. for confl ict areas and developing countries are addressed.

References[1] M. A. Shannon et al., Nature, 452, 301-310 (2008) [2] I. Gehrke, V. Keuter, 3rd International Conference on Surfaces, Coatings and Nanostructured Materials (NanoSMat) 21-24 October, 2008


52

Parallel Sessions

Parallel Session B4 - Nanotechnology for Health and Environment - Bio non-bio interfaces in medical applications

KL-09 - Applications of carbon nanotube neural interfacesE.W. Keefer1

1University of Texas Southwestern (UTSW) Medical Center, Department of Plastic Surgery, Dallas TX, USA

The quality of neuronal recording is heavily dependent upon the type electrode used; an electrode designed to record single-unit fi ring is generally less than optimal for passing electrical stimulation. Similarly, an effi cient stimulating electrode usually does not have the selectivity to record spiking neurons. Neural prosthetics are currently used in treating a variety of pathologies such as Parkinson disease, hearing loss, macular degeneration, depression, chronic pain, and limb amputation. These techniques will ultimately be widely adopted only if bi-directional neuron-electrode interfaces can be established and maintained for long periods of time. Sharpened metal microwires have been the primary tool of the electrophysiologist for at least 50 years. Nearly all modifi cations aim to lower the electrode impedance, either to enhance electrode sensitivity, or to increase the amount of electrical charge a given electrode can safely pass when used for stimulation. CNTs are extremely conductive electrically and have intrinsically large surface areas, implying that a CNT-coated electrode will have low impedance and large capacitance. We devised techniques for coating metal electrodes with CNTs under ambient conditions and tested the function of the CNT-coated electrodes for both recording and stimulating. We show from acute in vivo recordings using CNT coated electrodes decreased noise, increased neural signal amplitudes, and higher neural content compared to non-coated controls. Electrodes coated with CNTs were broad-band neuronal sensors, able to simultaneously record fi eld potentials, multi-unit activity and single units without the use of noise fi lters.

We have also constructed neural electrodes from carbon nanoyarns, and used them to record and stimulate from the brain and sciatic nerve of rats. The biocompatibility of these nanoyarns was examined by implanting in rat sciatic nerve for periods of up to 90 days. From immunohistochemical and TEM examination of the nanoyarn/nerve interface, we conclude that the carbon nanoyarn is well-tolerated and provokes no infl ammatory responses. Nanoyarn electrodes also show extremely low noise, with signal-to noise ratios as high as 50:1. These fi ndings have direct application in the neural prosthetic fi eld, where the ability to both record and stimulate neurons may be essential.

Financial disclosures:Patent: PCT/US2008/072662-Coating neural electrodes with carbon nanotubes and variations

O-34 - The interactions between carbon nanotubes and neuronal networks: fi rst steps in NanoneurosciencesM. Giugliano1, M. Prato2, L. Ballerini3

1University of Antwerp, Department of Biomedical Sciences, Wilrijk, Belgium2University of Trieste, Department of Pharmaceutical Sciences, Trieste, Italy3University of Trieste, Physiology and Pathology Department, Trieste, Italy

One of the more attractive materials employed to develop nano-bio hybrid systems is represented by carbon nanotubes (CNT). We have recently shown that the growth of functional hippocampal networks cultured on a conductive CNT substrate is always accompanied by a signifi cant enhancement in the effi cacy of neural signal transmission, suggesting that the electrical conductivity of the CNT nano-substrate might be underlying these physiological eff ects (Lovat et al., 2005; Mazzatenta et al., 2007).

Here, we address the impact of CNT to the network-level and single-neuron electrical properties by whole cell current clamp recordings in single neurons (grown on control glass or CNT). In order to probe regenerative excitable properties in proximal and distal areas of a single neuron, we adopted a special stimulation protocol (Cellot et al., 2008). By brief current pulse injections into the soma, we forced the cell to fi re a regular train of precisely timed action potentials (APs) at increasing frequency, ranging from 20 Hz to 100 Hz. We then addressed CNT eff ects on neuronal integrative properties by examining the presence of additional somatic depolarization after the last AP in the spike-train. Such an after-depolarization (ADP) was demonstrated in brain tissue slices to be associated with dendritic Ca2+ electrogenesis, ignited by the distal summation of backpropagating APs (Larkum et al., 1999).

To this aim we analyzed the area below the membrane potential trajectory, starting 50 ms after the last AP of the train, measured with respect to the rest potential. We classifi ed after-potential responses in three categories, based on area values: after hyperpolarization (AHP, area<0 ms*mV), neutral response (NR, 0>area<100 ms*mV) and after depolarization (ADP, area>100 ms*mV). The majority (69 %) of control neurons laying on control substrates, when forced to fi re APs trains displayed either an AHP (44 %) or NR (25 %). Only in a subset of cells (31 %) an ADP was observed (n=52).

To our surprise, 52% of neurons grown on CNT displayed an ADP response (n=72), with AHP in 27% of recorded cells and NR in 21% of neurons.

We fi nally propose a biophysical interpretation of such an eff ect, on the basis of electronic equivalent circuits and through computer model network simulations, performed to further explore the impact of ADP and AHP on emerging spontaneous activity.

References:Cellot et al., 2008, Nature Nanotech., Epub 21 December 2008Mazzatenta et al., 2007, J Neurosci, 27, 6931:6936Lovat et al. 2005, Nanoletters, 5:1107-1110Larkum et al., 1999, PNAS, 96, 14600-14604

Acknowledgments: Financial support from NEURONANO-NMP4-CT-2006-031847.


53

Parallel Sessions

O-35 - Principles of tactile sensingM. Adams1

1Centre for Formulation Engineering, University of Birmingham, Chemical Engineering, Birmingham, United Kingdom

Principles of Tactile SensingBackground: During a tactile experience many thousands of action potentials are discharged from nanoscale units of the mechanoreceptors in the skin. Gaining an understanding of the processes involved during a tactile experience provides the potential for designing an artifi cial fi nger (based on an array of NEMS force transducers) with biomimetic tactile perception.

Objective:The objective is to develop a biomimetic artifi cial fi nger by using an array of NEMS force transducers mounted within a biomimetic skin material that is integrated into a robotic fi nger. A cross-disciplinary approach was employed in order to investigate the basis of the tactile stimuli, characterise the peripheral and brain responses to these tactile stimuli and develop a fi nite element model of the tactile stimulation.

MethodsTactile stimuli (sandpapers) with various roughness were used for psychophysical texture studies in healthy adults and in patients with peripheral nerve injury. The sandpapers were characterised using tribology and load cells prior to clinical experimentation. Psychophysical testing was performed using the sandpapers to evaluate the eff ects of age and gender on roughness discrimination, stimulus length on texture discrimination, contact duration, contact force and movement. The aff erent activity was also examined in parallel microneurography experiments. The data collected from the psychophysical and microneurography were used to develop a virtual model of taction for an artifi cial fi ngerpad using surface characterisation of selected artifi cial materials. This involved a number of techniques such as tribological measurements, laser profi lometry and computational modelling of the fi ngerpad responses to various surfaces.

ResultsPsychophysical results on groups of subjects across the lifespan (10-70 years) showed no signifi cant eff ects of age or gender on the threshold of diff erentiation between sandpapers. Contact force did not have any eff ects apart from the static touch of coarse texture and a reduction in the discrimination threshold higher contact force. Contact duration did not aff ect the discrimination threshold. Results from patients with peripheral nerve injuries showed that roughness discrimination was well preserved, in spite of a considerable degradation of tactile sense. Characterisation of four candidate polymers for use as the skin-like matrix using ball indentation showed that mechanically and tribologically, the most appropriate skin analogue was Dragonskin, a silicone rubber.

ConclusionThe results from the psychophysical and microneuography experiments have enabled the design of a virtual model for taction in the human fi nger. This has informed the design strategy of the artifi cial fi nger: specifying the geometrical placement of the NEMs sensors within both polymeric and tissue engineered matrices to best replicate the process of human tactile sensation.

This work was funded by the EU 6th Framework Programme

O-36 - Diamond to retina artifi cial micro-interface structuresP. Bergonzo1, A. Off enhaeusser2, R.B. Jackman3, R. Schoepfer3, J.A. Garrido4, S. Picaud5

1CEA LIST, Diamond Sensor Laboratory, 91191 CEA/Saclay Gif-sur-Yvette, France2Forschungszentrum Julich GmbH, 52425 Institut fur Bio- und Nanosysteme (IBN), Julich, Germany3University College London, London Centre for Nanotechnology, WC1H 0AH London, United Kingdom4Walter Schottky Institut, Technische Universitat Munchen, D-85748 Garching, Germany5U-592 INSERM, Laboratoire de Physiopathologie Cellulaire et Moleculaire de la retine, 7101 Paris, France

Electrical stimulation of neurons is a recognised therapeutic approach for treatment of several neurodegenerative pathologies (e.g. Parkinson disease, audio prosthesis, etc). The presented work is a part of the FP6 project DREAMS, proposing to study and fabricate novel types of nanotransducers, which are based on artifi cial nanocrystalline diamond (NCD) and leading to construction of novel devices for retina interfacing and for stimulation of a blind retina.In this work we describe progress on development of such novel neural interfacial devices, specifi cally MEAs and SGFETs, that take the advantage of both the biocompatible and the semiconducting properties of diamond in order to explore the feasibility of an all-carbon bioelectronics structure for retina stimulations. Specifi cally, we will present data demonstrating the biocompatibility of the developed diamond nanostructures for the neuronal growth and coupling, particularly for adult retinal neurons. These features are investigated with retinal neurons because they can survive in vitro and regrow neurites at the adult age. We present data showing the fabrication of novel retinal MEAs devices as well as demonstration of functioning diamond FET, coupled to neural cells. Finally we discuss the advantages of the concept proposed and its possible impact on novel therapeutical treatments based on understanding the bio-non bio interfacial science.


54

Parallel Sessions

O-37 - Covalent coupling of nucleic acids and antibodies to semiconductors: enabling techniques for label-free real-time biosensorsW. Wenmackers1, V. Vermeeren2, L. Grieten1, S. Janssens1, L. Michiels2, K. Haenen1, S.D. Pop3, K. Hinrichs3, N. Esser3, P. Wagner4

1Hasselt University, IMO-IMOMEC, Diepenbeek, Belgium2Hasselt University, Biomed, Diepenbeek, Belgium3Institute for Analytical Sciences, Berlin, Berlin, Germany4University Hasselt, IMO-IMOMEC, Diepenebeek, Belgium

Chemical-vapor deposited diamond coatings on silicon or quartz substrates are an excellent platform material for biosensors due to their extraordinary chemical and physical stability. Moreover, diamond is biocompatible and allows for the covalent grafting of receptor molecules by carbon-based chemistry. We will give an overview on various, recently developed coupling techniques for nucleic acid fragments, enzymes, and immunoglobulins to diamond and address related strategies for the biological functionalization of silicon and nitride-based semiconductors. Special attention will be given to the study of the density and orientation of covalently bound DNA brushes by scanning-probe microscopy and spectroscopic ellipsometry. DNA absorbs e.g. UV radiation via two orthogonal transition dipole moments, one along the backbone and one along the bases. Based on this, the absorption of polarized vacuum-UV light (in cooperation the BESSY II synchrotron facility) is shown to be a powerful, non-destructive tool to analyze the typical tilt angle of DNA molecular brushes with respect to their immobilization platform. Moreover, diamond fi lms covered with single-stranded DNA as working electrodes in impedimetric biosensors proved to be effi cient in monitoring DNA hybridization as well as denaturation in real time under biochemically relevant buff er- and temperature conditions. The sensitivity allowed even to distinguish between complementary strands and ssDNA with built-in SNP mutations. With a similar approach, the cardiovascular marker protein CRP was selectively detected with diamond electrodes coated with anti-CRP immunoglobulins while tests with a competitor protein were negative. Finally, we will address the issue of biological functionalization of diamondoids and other semiconcductor nanoparticles for diagnostic purposes at the cellular level. Acknowledgements: This work was supported by the European Community - (FP6) through the Integrated Infrastructure Initiative “Integrating Activity on Synchroton and Free Electron Laser Science - Contract RII 3-CT-2004-506008”, the Federal Belgian Belspo IUA program “Quantum eff ects in clusters and nanowires”, and the National Funds for Scientifi c Research FWO-Flanders through the project “Synthetic diamond fi lms as platform material for novel DNA-sensors with electronic detection principles”.


55

Parallel Sessions

Parallel Session B5 - Horizontal activities - Safety, environmental and health protection, LCA

KL-10 - Research into the health and safety and environmental risks of nanomaterials; current perspectives and landscapeR.J. Aitken1

1Institute of Occupational Medicine, Edinburgh, United Kingdom

In 2004, the Royal Society and the Royal Academy of Engineering published a major review of the opportunities and uncertainties of nanotechnologies. Whilst indicating that for many nanotechnologies, there were no foreseeable risks to heath or to the environment at that time, the report concluded that for “nanoparticles and nanotubes” there were potential risks which may arise to both health and the environment, and not enough was known about them. This was based on knowledge gained from exposure to other particles and fi bres in an occupational setting and from environmental exposure to particles. A strong message from RS/RENG report was the need to assess risk in a multidisciplinary way, addressing toxicology, exposure and risk management. Similar conclusions have been drawn in more than 100 major reviews since.

There is substantial activity underway to address these issues. In Europe, the NMP (FP7) programme has funded around 15 projects to date. While the majority of projects focus on toxicology (examples include NANOMUNE, NANOTEST and ENPRA) there is at least some attention being paid to wider risk management through projects such as ENRHES which is reviewing toxicology, exposure and risk assessment and NANODEVICE which is focussing on exposure measurement methods. National programmes of research are underway in many countries including the US, UK, France and Germany.

In addition, the OECD has initiated a sponsorship programme which is investigating the effi cacy of existing toxicological tests for 14 priority nanomaterials. OECD have also launched a database of relevant research in this area. ISO TC229 ‘Nanotechnology’ has established a workgroup on EHS which is focussing on developing improved guidance on the safe use of these materials.

Countries have been slow to regulate on these issues although this is beginning to change; the world’s fi rst national mandatory nanoscale materials reporting program for companies is now pending in Canada, and similar legislation has been proposed within France through its national initiative, the Grenelle Project.

Support is becoming available to help those with a duty to understand and manage the risks of these materials. This support includes codes of conduct, management guidance and systems and observatories which track recent developments and emerging trends. For example, the EC has recently published a code of conduct for researchers working in the nanotechnology fi eld. In the UK, the BSI had published a “Guide to safe handling and disposal of nanomaterials, PD6699-2” which may be downloaded from the BSI website. SAFENANO is a UK initiative which aims to collect and disseminate the emerging scientifi c evidence on nanotechnology risks.

Whilst there is a signifi cant amount of work underway, solutions to the many questions posed are slow to emerge. Until they do, those who are responsible for the management of these risks must remain vigilant and proactive to fi nd appropriate and proportionate solutions.

O-38 - NANODEVICE - Technology Promoting Safety of Engineered Nanomaterials in WorkplacesK. Savolainen1

1Finnish Institute of Occupational Health, New Technologies and Risks, Helsinki, Finland

Due to their unique properties engineered nanomaterials (ENM) are now being used for a great number of novel industrial applications of great economic and technological importance. Such applications include mobile technologies in telecommunication industry, modern paper making, textile and food industry, construction and car industry, cosmetics industry, energy production, drug industry and many others. However, some of the properties that make ENM so unique, especially their surface reactivity, chemistry and area, chemical composition, and crystallinity, have raised health concerns which have prompted scientists, regulators and industry to seek consensus protocols for the safe production and use of diff erent forms of ENM. There is currently a shortage of fi eld-worthy, cost-eff ective ways - especially in real-time - for reliable assessment of exposure levels to ENM in the air of occupational environments. In addition to the size-distribution of, a major uncertainty in the safety assessment of airborne ENM arises from the lack of knowledge of their physical and chemical properties, and the levels of exposure. A special challenge of ENM monitoring is to separate ubiquitous background nano-sized particles from diff erent sources of the ENM. Here the main NANODEVICE project goal is to develop innovative concepts and reliable methods for characterizing ENM in workplace air with novel, portable and easy-to-use devices suitable for workplaces. Additional research objectives are (1) identifi cation of relevant physico-chemical properties and metrics of airborne ENM; (2) establishment of reference materials for diff erent types of ENM; (3) exploring the association between physico-chemical and toxicological properties of ENM; (4) analyzing industrial processes as a source of ENM in workplace air; (5) developing methods for calibration and testing of the novel devices in real and simulated exposure situations; and (6) dissemination of the research results to promote the safe use of ENM and nanotechnologies through guidance, standards and education, implementation of safety objectives in ENM production and handling, and promotion of safety-related collaborations through an international annual platform for nanosafety. Supported by the European Union Framework Programme 7 Grant CP-IP 211464-2.


56

Parallel Sessions

O-39 - Safe Use and Application of Nanomaterials by Integrated Production Processes and Toxicological TestingR. Landsiedel1, B. Sachweh2

1BASF SE, Product Safety - Regulations - Toxicology and Ecology, Ludwigshafen, Germany2BASF SE, Process Engineering, Ludwigshafen, Germany

Nanotechnology off ers great opportunities in developing innovative solutions by selective modifi cations of material properties. However, new material properties may also alter the eff ect of these materials on humans. Therefore, nanomaterials need a thorough risk assessment before use and marketing. BASF has defi ned a Code of Conduct Nanotechnology encompassing objectives for product safety. This obligates BASF to identify sources of risk in production and use of nanomaterials and to eliminate these using the appropriate measures. For the production process the risk minimisation can be achieved by using production processes with no or minimal exposure or by selecting nanomaterials with low hazard potency. Both practice require an understanding and controlling aerosol processes and of potential health risk from nanomaterials. We will discuss the production with no or minimal exposure by integrated aerosol processes and toxicity testing of nanomaterials to facilitate risk assessment and management and to guide the design of new nanomaterials with favourable toxicological profi les.

O-40 - A fast measuring method for airborne nanoparticlesJ. Spielvogel1, R. Hagler1, L. Keck1, M. Pesch1, H. Grimm1

1GRIMM Aerosol Technik, Nano Particles, Ainring, Germany

Handling of engineered nanostructured material imposes the risk that nanoparticles are released in airborne state, and such nanoparticles might be harmful to health when inhaled by the employees. Thus monitoring of nanoparticle concentrations is recommendable to exclude any risk for the workers, moreover such monitoring can amend the acceptance of nanotechnology. A well established tool for measuring nanoparticles is the Scanning Mobility Particle Sizer (SMPS), and these instruments provide a complete size distribution even for very low number concentrations. SMPS systems feature however only a limited time resolution, moreover they are rather expensive, large and elaborate to operate. Hence, SMPS systems are hardly suitable for the routinely real-time monitoring of nanoparticles.

The aim of this project was the development of a simple portable instrument intended for fast and easy assessment of nanoparticle exposure risks. An additional requirement was that the instrument should be usable along the way with a well established system for the measurement of mass concentrations, for workplace monitoring these mass concentrations must be recorded in terms of inhalable, thoracic and alveolic mass fraction.

The instrument consists of three elements, a corona charger, a condenser, and a Faraday Cup Electrometer. Measurements are done in two steps, which are completed within 10 s. In the fi rst step, the condenser is operated just as an ion trap, and in the second step the condenser is operated at 80 V. The total current of the charged particles is measured for both steps, and total number concentration and mean size of nanoparticles can be calculated from the two currents.

The detection limit of the system is a function of the mean particle size and amounts to 500 particles/ccm for typical size distributions. The instrument was tested with monodisperse NaCl particles of diff erent sizes, these experiments showed that nanoparticles in the size range of 25 - 400 nm can be detected and sized. The new instrument was compared with a conventional SMPS system as a reverence and an excellent agreement both for total number concentration and mean particle size was observed. Practical tests were performed with the instrument being operated downstream of an optical aerosol spectrometer. The instrument worked reliably both for indoor measurements with a separate upstream diff usion dryer, and also for outdoor nanoparticle monitoring where the dryer was already integrated in the sampling system.

Total number concentration and mean size of airborne nanoparticles can be measured with a portable instrument, which features a time resolution of only 10 s and a detection limit well below the typical ambient concentration.


57

Parallel Sessions

O-41 - Nanoparticles monitoring in workplaces devoted to nanotechnologiesI. Olivato1

1Veneto Nanotech, Padova, Italy

In recent years nanotechnologies have indeed expanded and produced a variety of NPs. Engineered materials have unique properties because of their small size and large surface area, and found several industrial applications. However, these characteristics are thought to confer to NPs new potential impacts not yet quantifi ed. Therefore the question about possible NPs eff ects and their mechanisms remains open and a large debate has started about the risks that are linked with the development of Nanotechnology spread into research and industry. The scientifi c community, Industry and Governance demonstrate particular attention to the impacts of new technologies on human health and on the environment and it is recognised the importance of assuring a sustainable development of nanotechnologies. The concept of sustainable development relies on a development system that responds to the needs of the present, but will not compromise the capacity of future generations to satisfy their needs. Further, it suggests the development and implementation of a safe and responsible strategy to reinforce RTD position in this area by using new and appropriate test methods to assess the toxicological profi le of manufactured NPs in particular for regulatory purposes. This kind of development aims to improve the life quality of people conjugating this aspect with a short-, middle- and long-term environmental safeguard. This approach is transversal from the economic, social and environment issues and it takes into account the collaboration of diff erent expertise. The monitoring on occupational environment of the present of engineered or natural NPs in the nanotech labs or areas seems to be the fi rst step for the evaluation of the impact of nanotechnologies on humans and an important step into the risk assessment evaluation: the defi nition of exposure thresholds of NPs is necessary for the sustainable management of risk, even if now there are not any specifi c regulation and the safe of workers are let to the industry’ actions.

This approach is complex when dealing with nanotechnology, because it is necessary to study new and modern techniques to detect, discriminate and characterize engineered NPs from the natural ones to avoid background eff ects; further new preventive rules has to be evaluated and adopted for people involved in the nanotech fi eld.

Ecsin is the laboratory devoted to the integration of diff erent competences form the human health, environment, social, and law fi eld to support the study of the impact of nanotechnology and many studies are being performing in this context.


58

Parallel Sessions

Parallel Session B6 - Horizontal activities - Nanoengineering: from nanostructure characterisation to processing technologies

KL-11 - Atomic Force Microscope: eyes and hands for NanoworldP. Jelinek1

1Institute of Physics of the ASCR, Department of Thin Films, Prague 6, Czech Republic

Since the invention of Atomic Force Microscopy (AFM) in 1986 by G. Binning and co-workers, AFM has rapidly developed into a powerful a invaluable surface analysis technique on nanoscales and even on atomic and molecular scale. One of the most promising variant of AFM techniques is so called Non-Contact AFM (NC AFM) with a fast growing application in surface science and nanotechnology.

In this talk, brief introduction and roadmap of NC AFM technique will be provided. Recent development and outstanding achievements of the technique will be presented, such as chemical identifi cation [1] of individual atoms, atomic manipulation [2] and complex atomic pattering [3] on semiconductor surfaces.

References[1] Y. Sugimoto et al. Nature 466, 64 (2007).[2] Y. Sugimoto et al. Phys. Rev. Lett. 98, 106104 (2007).[3] Y. Sugimoto et al. Science 322, 413(2008)

KL-12 - A Novel Route Towards Electrical Connection and Probing of Molecular Nano-scaled DevicesM. Oertel1, J. Koeble1, D. Jie2, M. Maier1, N. Chandrasekhar2, C. Joachim3

1Omicron NanoTechnology GmbH, Taunusstein, Germany2Institute of Materials Research and Engineering, Singapore3CEMES-CNRS, Nanoscience group, France

A major challenge in Nanotechnology is the incorporation of single nano-devices into larger integrated circuits. Although work on individual (and non-integrated) nano-structures such as molecules is intense [Ref. 1], the question of their electrical connection with more than two probes (such as conventional SPM experiments) remains an open question. Established nano-lithography techniques such as EBL and FIB don’t seem to satisfy requirements for ultra clean and defi ned contact structures at the atomic scale [Ref. 2]. Traditional instrumentation for analysis is fundamentally limited: How to bridge the dimensional range of an integrated circuit (mm range) down to the atomic scale of a single molecular device and at the same time to have an adequate integrated navigation system? To meet these requirements, we have established and continually advance a new approach integrating SPM technology with high resolution electron microscopy: (1) Bridging dimensions by combined SEM (down to below 3nm resolution) and STM operation at the atomic scale; (2) Rapid SEM navigation of four local STM probes; (3) Individual probe fi ne positioning by high resolution STM imaging; (4) STM based approach for “soft-landing” of sharp and fragile probes and controlled electrical contact for transport measurements. To open a route for fundamental evaluation of the potential of single molecule devices, this instrumental technology is employed to establish electrical connection for local transport measurements. As a model system, we have chosen Au nano-islands on MoS2 [Ref. 2]. These islands represent contact pads, each electrically connected by an individual STM probe. As good band gap (approx. 1.3eV transverse gap) semiconductor, MoS2 has the potential to suffi ciently decouple those nano-structures electrically at low voltage. Those Au triangular nano-islands have a lateral size of typically 10-30nm and form an “atomically” ultra clean and defi ned metal-semiconductor interface. We present measurements that prove (1) SEM based navigation and STM based electrical contacting with a tip radius in the 10nm range: (2) reproducible Schottky like IV properties for the individual STM tip/Au nano-island/substrate contact; (3) surface conductance measurements with variable inter-island distances down to 17nm; (4) comparison with surface conductance measurements of the bare MoS2 substrate. We also show that the individual STM probe can be employed under SEM to manipulate those Au nano-islands [Ref. 3] with high precision in order to generate arbitrary multi probe planar contact confi gurations.[1] Electronics using Hybrid- Molecular and Mono- Molecular Devices,

C. Joachim, J.K. Gimzewski and A. Aviram, Nature, 408, 541 (2000)[2] A reliable scheme for fabricating sub-5 nm co-planar junction for molecular electronics

MSM Saifullah, T. Ondarcuhu, D.F. Koltsov, C. Joachim and M. Welland, Nanotechnology, 13, 659 (2002).[3] UHV-STM Manipulation of Single Au nano-island on MoS2 for the construction of planarnano-interconnects

J.S. Yang, D. Jie, N. Chandrasekar and C. Joachim J. Vac. Sci. Tech. B, 25, 1694 (2007)


59

Parallel Sessions

O-42 - FIBLYS - a unique ‘multi-nano’-toolS. Christiansen1, J. Michler2, M. Troyon3, A. Sill4, M. Gonin5, A. Kortschack6, J. Klima7

1IPHT, Jena, Germany2EMPA, Thun, Switzerland3University Reims, France4Universität Oldenburg5TOFWERK, Switzerland6Smaract, Germany7TESCAN, Brno, Czech Republic

FIBLYS is a European project funded in FP7, in which leading researchers and SMEs collaborate to create a new instrument for nanotechnology based on the integration of basic techniques such as Scanning Electron Microscopy (SEM) with additional Focused Ion Beam (FIB) capabilities for materials deposition and removal, Scanning Probe Microscopy (SPM) and nano-manipulation and additional analytical capabilities such as Energy Dispersive X-ray Spectroscopy (EDX), 3D Electron Backscatter Diff raction (EBSD), Time-of-Flight Mass Spectrometry (TOFMS), Electron Beam Induced Current (EBIC) and Cathodoluminescence (CL).

The aim of the project is to design and build an ‘all-in-one-tool’ formost advanced nano-vision, nano-structuring, nano-manipulation and nano-analytics and thus provide to the nano-science and nano-technology community a unique ‘multi-nano tool’. Three sources of sample inspection do exist, SEM, FIB and SPM, and can be used to visualize the sample surface in various imaging modes. The FIB (a column with standard Ga-ions or ExB mass-fi ltered column with Au-ions) allows nano-structuring and sample surface modifi cation via materials removal by milling or deposition in a ‘direct-write’ procedure of nano-structures of various materials including gold. In particular the 3D gold nano-patterns that can be written are of great use in various applications in photonics, plasmonics, and life-sciences. Nano-manipulation add-ons with custom made end-eff ectors such as tips, grippers, contact fi elds, etc. allow manipulation of nano-objects as well as contacting of nano-objects. The investigation of nano-objects is complemented by the wealth of the aforementioned analytical facilities to gain analytical information of the volume material of the nano-structures.

The goal of FIBLYS and thus of the ‘multi-nano-tool’ is to provide a unique and comprehensive tool to create/shape and analyze/characterize all sorts of sophisticated nano-structures/objects. A prerequisite for that is the novel design of a sophisticated chamber that hosts all the aforementioned tools and detectors with dedicated specimen stage. The fl exible design will allow to equip the ‘multi-nano-tool’ in a modular way with just the add-ons needed so that a tailor-made equipment can be assembled according to the customers’s individual needs. The project started on the September 1st, 2008 and fi rst milestones have already been reached and will be reported.

O-43 - Consolidation of Nanoimprinting for ProductionJ. Ahopelto1

1VTT Technical Research Centre of Finland, VTT Micro and Nanoelectronics, Espoo, Finland

Nanoimprinting lithography is usually claimed to be a low cost and high throughput manufacturing method for various kinds of nanostructures and devices. However, there are not many reports available on production processes exploiting nanoimprinting methods. The “Nanopatterning, Production and Applications based on Nanoimprinting Lithography (NaPANIL)” project addresses the aspects arising from manufacturing related points of view.1 The NaPANIL consortium consists of 18 partners from eight countries with almost half of the partners coming from industry. The total volume of this four year project is 16 M€.

The aim in the project is to realise three industrial demonstrators as manufacturing technology drivers of 3D nanopatterning production technologies, including the design, simulation and metrology aspects. More specifi cally, the aim is to develop up-scalable manufacturing processes for master stamps and up-scaled replication processes for working stamps. The lack of masters and corresponding working stamps form the main bottle-neck to exploit in production the novel nanopatterning methods based on nanoimprinting. The qualifi cation of the processes is performed by producing large amount, thousands, of the selected demonstrators to collect the required statistics. The processes are primarily based on various nanoimprinting technologies developed in the Integrated Project “Emerging Nanopatterning Methods (NaPa)”.2 Napa was running from 2004 to 2008 and was among the largest nanotechnology projects in Europe with 36 groups from 14 countries.

The applications chosen are based on controlling light at surfaces using nanoscale 3-dimensional structures. The structures consist of arbitrary 3-dimensional surfaces with features with dimensions from a few micrometers to well below 100 nm. At the moment there is no effi cient production method available for this kind of surfaces and the aim is to develop and qualify processes that can produce such surfaces in small scale production environments. The focus is on applications with surface areas in the range from a few mm to tens of cm. These include mobile applications, automotive applications, housing and spot lighting. [1] www.napanil.org [2] www.napaip.org


60

Parallel Sessions

O-44 - Challenges and opportunities for Focused Ion Beam processing at the nanoscaleJ. Gierak1, B. Schiedt1, D. Lucot1, A. Madouri1, E. Bourhis1, G. Patriarche1, C. Ulysse1, X. Lafosse1, L. Bruchhaus2, R. Jede3

1CNRS, LPN, Marcoussis, France2Université d’Évry Val d’Essone, MPI, Évry Cedex, France3RAITH GmbH, Dortmund, Germany

There is a solid consensus that new methods of structure fabrication, placement and organization within the sub 10 nm resolution gap, are urgently required to meet existing challenges in condensed matter, semiconductors and mesoscopic physics. Standard top-down methods such as resist-based lithographies even used at the shortest available wavelengths have clearly identifi ed limitations, while on the other hand bottom-up approaches like scanning probe manipulation techniques, remain challenging when trying to generate reproducible, functional and addressable nanostructures. Therefore at the laboratory level new routes must be explored.

The patterning of samples using the FIB (FIB for Focused Ion Beam) technique is a very popular technique in the fi eld of inspection of Integrated Circuits and electronic devices. This is the case mainly for prototyping devices. The FIB technique allows 3D patterning of target materials using a fi nely focused pencil of ions having speeds of several hundreds of km/seconds at impact. In what the ion nature is concerned, apart that most of existing metals can be used in FIB technology as pure elements or in the form of alloys, gallium (Ga+ ions) is preferred in most cases. Practically, FIB patterning can be achieved either by local surface defect generation, by ion implantation or by local sputtering. These adjustments are obtained very easily by varying the locally deposited ion fl uence with reference to the sensitivity of the target and to the selected FIB processing method.

In this presentation we will detail the advanced methodology and FIB technology we have carefully optimised for such deep sub-10 nm nano-device fabrication [Contract number G5RD-CT2000-00344]. Using examples we will describe and illustrate the challenges and the opportunities we are foreseeing for Focused Ion Beam processing at the nanoscale.

In particular we will show the possibility to successfully to apply our FIB technology for the direct fabrication of devices while reaching very interesting throughput capabilities. Indeed identical devices requiring individual FIB processing times around 100 ms can be fabricated within quantities compatible with some device research and commercialisation requirements. This is a major paradigm shift for FIB processing since before this achievement nanofabrication with scanned focused ion beams, as a sequential process, was not be expected to provide a mass production capability of devices. Here the success of our FIB approach in this application due to the very high performances of our instrument, its capability to work “inline” with standard lithography techniques and to the high added value of the fi nal device.

Owing these there is now a promising future for Focused Ion Beam processing at the nanoscale.


61

Parallel Sessions

Parallel Session C1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Applications in textile industry

KL-13 - Functionalisation of Textiles with NanotechnologyE. Schollmeyer1, T. Textor1

1Deutsches Textilforschungszentrum Nord-West e.V., Krefeld, Germany

Twenty years ago if a textile with a certain property was needed the producer would have gone to an organic chemist and ask him to prepare a new polymer. Nowadays textile industry has to deal with a certain number of fi ber polymers and the establishment of a new polymer is improbably, so surface modifi cation became one of the most important topics to create new textiles. Beside other techniques, the functionalisation of fi ber material by making use of the nanotechnology is part of our work since several years. Coatings based on nanosols and inorganic-organic hybrid polymers, derived by the sol-gel process have an immense potential for creative modifi cations of surface properties with a comparatively low technical eff ort and at moderate temperatures. The coatings often combine properties of organic polymers with those of ceramic materials. Therefore those hybrid polymers are of an enormous interest for textile coatings especially for technical textiles. These basic materials off er the opportunity to produce very hard but fl exible coatings, especially by fi lling or modifying the networks with nano-particles. Approaches to modify such coatings by various inorganic or organic substances achieve a huge number of additional functionalities, asked in textile industries. Coatings of a thickness of less then one micron can act as eff ective barriers against chemical attacks, super-repellent surfaces can be created, or the wear-resistance of textile materials can be improved. Certain coatings protect sensitive polymers against decomposition due to ultraviolet radiation using nanoparticles as employed in sun creams. Ballistic body wear based on fabrics protect against guns but it does not properly protect against knives, thin coatings based on inorganic-organic hybrid polymer fi lled with alumina nanoparticles achieved good stab-resistance for such products. Further approaches deal e.g. with reversible photochromic coatings - coatings that change its colour if irradiated with sun light - (superpara-)magnetic hybrid polymers or medical systems based on porous sol-gel-coatings with immobilized drugs that are released in contact with skin. Recently fi rst commercial products for textile fi nishing that are based on sol-gel technique are available proving that the basic approach is not only an idea for the laboratory but also for industrial application.

O-45 - Ecological considerations in designing nanoparticle-loaded textilesS. Tofail1

1University of Limerick, Materials and Surface Science Institute, Limerick, Ireland

Nanoparticle-loaded textiles are now used in products that range from biomedical applications such as in wound dressings to consumer applications such as in odour-free socks. Widely known nanoparticles used in textiles include silver (Ag), zinc oxide (ZnO) and titania (TiO2). These nanoparticles are incorporated in the textile materials in a variety of ways, all of which are associated with a weak nanoparticle/textile interfacial bonding. Such a weak ‘fi xation’ of nanoparticles poses the risk of dislodgement of nanoparticles from the textile yarn or fabric, thus causing environmental concern.

Nanoparticles can penetrate skin and can get into the blood stream, pass the blood brain barrier and also collect in the lungs. These particles can be incorporated in synapses and cause cognitive disorders. These risks are usually associated with free and airborne nanoparticles and not with coatings which strongly adheres to substrates. For example, the National Institute of Occupational Safety and Health (NIOSH), USA recommends exposure limits for airborne particles of 1.5 mg/m3 for fi ne TiO2 and 0.1 mg/m3 for hyperfi ne TiO2, as time-weighted average concentrations for up to 10 hr/day during a 40-hour work week. These recommendations represent levels that should reduce risks of lung cancer to below 1 in 1000 over a working lifetime. The eco-toxic eff ects of titania nano particles in water is believed to be lower due to the tendency of the nanoparticles to cluster together. For nano-titania the critical concentration for eco-toxicity in water is in the range of 100-1000 ppm. The question of safe disposal of these nanoparticles and nanoparticles loaded textiles is becoming a huge concern for its potential environmental impact.

In this work we discuss these ecological considerations pertinent to the design of nano-particle-loaded textiles and propose a simple approach in optimising the amount of nanoparticles in textile for a given functional application.

O-46 -Refi ning textiles by using nanotechnologyH. Haufe1, B. Mahltig1, H. Böttcher1

1GMBU e.V., Functional Coatings, Dresden, Germany

Nanotechnology can be advantageously used for the refi nement of fi bres and textile fabrics

(i) by coating with modifi ed inorganic nanosols (functionalisation of surfaces) and

(ii) by incorporation of nanoparticles into fi bres during the spinning process.

By these procedures it is possible to change the biological, electrical, optical and physico-mechanical properties of textiles in a wide range [1]. Among these new opportunities some actual results of textile functionalisation by modifi ed inorganic nanosols will be presented:(1) Antimicrobially equipped textiles by application of new, simply prepared Ag@SiO2 and Ag@TiO2 nanosols(2) Textiles coated with photoactive TiO2 for the photocatalytic degradation of waste water(3) Textiles with health care and wellness eff ects by sol-gel immobilized natural oils and natural active agents.References:[1] B. Mahltig, H. Haufe, H. Böttcher, “Functionalization of textiles by inorganic sol-gel coatings“ J. Mater. Chem. 2005, 15, 4385 - 4398No confl ict of interest


62

Parallel Sessions

O-47 - Nanotechnology in textile applications: research @ CentexbelI. De Schrijver1, K. Eufi nger1, M. Vanneste1, L. Ruys1, J. Laperre1

1Centexbel, Gent, Belgium

Nanotechnology is considered one of the most promising technologies for the 21st century. On the one hand there is the economical impact from new and optimised products. On the other hand one expects a strong contribution of nanotechnology in decreasing the ecological impact and consumption of natural resources. Nanotechnology has the potential to improve the eff ectiveness of a number of existing consumer and industrial products and is expected to have a substantial impact on the development of new applications.

The “nano” prefi x denotes that at least one of the dimensions of these materials is in the order of 1-100 nanometer. A nanometer (nm) is a billionth of a meter, which is about 1/80000 of the diameter of a human hair, or 10 times the diameter of a hydrogen atom. At nanoscale, the physical, chemical, and biological properties of materials diff er in fundamental and valuable ways from the properties of individual atoms and molecules as well as bulk matter.

The wave of nanotechnology has shown a huge potential in the textile and clothing industry which is normally very traditional. The future success of nanotechnology in textile applications lies in areas where new functionalities are combined into durable, multifunctional textile systems without compromising the inherent favourable textile properties, including processability, pexibility , washability and softness.

The textile market is changing thanks to nanotechnology. Better healthcare systems, protective clothing and integrated electronics are just some of the applications. The use of nanotechnology is allowing textiles to become multifunctional and produce fabrics with special functions: e.g. antibacterial, UV-protection, easy-clean, anti-odour,…

An important issue is to control the dispersion of the nanoparticles in the polymer matrix of the coating. For one, these particles often have the tendency to agglomerate, so that their actual size lies in the range of several μm or even higher. Such particles no longer behave like nanomaterials. On the other hand, the dispersion of the particles (agglomerated or not) may not be homogeneous throughout the polymer matrix. The fi nal properties of the textile will be dependent on the homogeneity of the dispersion as well as the actual particle size of the additive.

In this paper some important research studies performed at Centexbel involving nanotechnology will be discussed and demonstrated for selected nanoparticle systems.


63

Parallel Sessions

O-48 - Needleless electrospinning using linear and circular cleftsD. Lukas1, A. Garg1, J. Bhasin1, K. Sachar1, P. Mikes1, K. Vodsedalkova1, J. Chvojka1

1Faculty of Textiles, Department of Nonwoven Textiles, Technical University of Liberec, Czech Republic

Needleless Electrospinning has been the basic technology due to its inherent nature of producing nanofi bers at a much higher rate thanks multiple jetting from crests of waves formed on polymer solution surface. Experiments with various experimental conditions (linear and circular clefts) were carried out and the relationship between jet spacing (wavelength on polymer surface) and the voltage diff erence applied was found. Needleless variant of Electrospinning is perceived here as an outcome of instability of liquid waves under the infl uence of external electric fi eld. The present experimentation encompasses linear (fl at planar) and curvilinear (co-axial cylindrical) clefts.

Needleless variant of Electrospinning is perceived here as an outcome of instability of liquid waves under the infl uence of external electric fi eld. The present experimentation encompasses linear (fl at planar) and curvilinear (co-axial cylindrical) clefts.The following formulas hold true [1] for the critical fi eld strength EC for unstable electrohydrodynamic waves and for distance λ between neighbouring jets.

where γ is surface tension, ρ denotes liquid mass density, ¨g is gravity accleration and ε is the air electroc permitivity.

The experiments were carried out with a solution of 8% Polyvinyl Alcohol (PVA) + 2% Bu-Alcohol (surfactant) using linear cleft of outer length 70.46 mm at a distance of 80 mm from the collector plate, PVA surface tension γ =32° 10-3 N/m, solution density ρ= 879.5 kg/m3, gravity acceleration g= 9.8 m/s2 and electric permittivity ε= 0,885 *10-12 m-3kg-1s4A4, supply rate of polymeric solution: 12-30 ml/hr using linear pump, temperature: 23.5 degrees, RH: 65% and voltage range: 33-42 kV

Fig. 1: Wavelength vs. Field strength for a linear cleft.

The experiments were carried out also with the same solution using circular cleft of outer diameter 2cm and inner diameter 1.1cm at a distance of 80 mm from the collector plate, temperature20 degrees, RH 72%, voltage range: 33kV - 45kV.

Fig. 2: Wavelength vs. Field strength for a circular cleft.

As can be seen from the graph shown on the left, there is step decrease in the wavelength as expected but this does not correspond to the graph that has been plotted using the relation between wavelength and fi eld strength.


64

Parallel Sessions

The value of constant as obtained from experimental data was found to be 95089.43 for linear cleft and 60086.1765 for circular cleftAs predicted by the theory, a continuous decrease in wavelength was observed with increase in voltage in experiments with linear cleft while a step decrease in wavelength was observed with circular cleftCircular cleft is preferred over linear cleft for uniform electrospinning due to good conductivity and lower viscosity solutions.

References: David LUKAS and Arindam SARKAR, Faculty of Textiles, Department of Nonwoven Textiles, Technical University of Liberec, Halkova 6, Liberec 1, 461 17, Czech Republic.


65

Parallel Sessions

Parallel Session C2 - Future industrial technologies - Nanophotonics, (O)LEDS

KL-17 - Nanophotonics contributes to future industrial technologiesC.M. Sotomayor Torres1

1Catalan Institute of Nanotechnology, Centre for Nanoscience and Nanotechnology, Bellaterra-Barcelona, Spain

Research in nanophotonics over the last decade or so has resulted in many novel concepts, tools and materials, which have found their way into demonstrators of photonic components. Nanophotonic concepts lend themselves very appropriately to bridge the micrometer to the nm-scale worlds by making use of, for example, coupled electronic and optical excitations. It also off ers the possibility of using light-biological matter interaction to induce ordering in the nm-scale in simultaneously biologically- and optically-inspired self-assembly, as well as means to harvest novel optical materials and their functions on silicon platforms. Moreover, confi nement and resonant phenomena go hand in hand to enhance, suppress, guide and modulate electromagnetic information, with an enormous promise in areas such as heterogeneous integration. A representative sample of these demonstrators will be covered in the fi rst part of this talk

The other side is the uptake by industry to realise the potential in the form of a product. In fact, the increasingly diverse presence of photonics in everyday life brings with it a series of challenges to these demonstrators in their uptake in industry. It is exactly at this stage in the value chain that the road blocks to transferring the advances from nanophotonics research to end users appear and two examples of these, one successful and another from which we can draw lessons, will be the subject of the second part of this presentation.

A brief view of how other economies are dealing with this issue in the realm of nanophotonics will be outlined to complete this presentation.

O-54 - Effi cient organic lighting: options and future from a European perspectiveP. Visser1

1Philips Lighting, OLED development, Aachen, Germany

Organic light emitting diodes (OLEDs) are the fi rst real fl at light sources, which can be made in any form and color. And OLEDs could be made very energy effi cient and very long lasting. That’s why researchers around the globe are working in high speed to increase OLED performances parameters such as effi cacy and lifetime of materials and processes to make larger tile sizes.

Europe is currently leading this race via coordinated research and industry cooperation’s. The is illustrated by the successfully closed project like OLLA and OPAL. With several newly started research projects, Europe wants to keep this momentum. But for what reason?

OLED is not just another lighting technology. It’s something fundamentally diff erent in the lighting scene. For lighting designers, OLEDs present amazing new opportunities, such as fully transparent lights and freedom of to design the form of light elements themselves. OLEDs and LEDs together will transform the way we use light in our daily life.

In this talk I will update you on OLED technology in general and on the current status of OLEDs for Lighting Applications, as well on the ecosystems in which this technology is developing. Secondly, I will show diff erent application area’s options as well as an outlook how the technology could develop in future.

O-55 - Plasmonic nanophotonicsA.V. Zayats1

1Centre for Nanostructured Media, IRCEP, The Queen’s University of Belfast, Belfast, United Kingdom

Recent advances in nanofabrication and subwavelength optical characterisation have led to the development of a new area of nanophotonics concerned with routing and manipulation of optical signals in scalable and integratable devices. In this context, plasmonics which is dealing with surface electromagnetic excitations in metallic structures, may provide a great deal of fl exibility in photonic integration in all-optical circuits since with surface plasmons the problem of light manipulation can be reduced from three to two dimensions. Surface plasmon polaritons, the electromagnetic excitations coupled to collective motion of conduction electrons near a metal surface, are emerging as a new optical information carrier that enables signal manipulation and processing on the subwavelength scale. Various elements of two-dimensional optics based on surface plasmon polariton waves, such as mirrors, lenses, resonators, waveguides, etc. have been demonstrated. In this talk the applications of plasmonic nanostructures to light guiding and manipulation in subwavelength photonic elements will be discussed. Numerous possible applications of plasmonic elements can be envisaged in nanophotonic devices, classical and quantum optical information processing and optical communications as well as optical and magneto-optical data storage.


66

Parallel Sessions

O-56 - Electromagnetic modelling of the plasmonic enhanced solar cellK. Zvezdin1, V. Belotelov2, G. Carotenuto3, D. Korolev1

1Instituto P.M. srl, Torino, Italy2A.M.Prokhorov General Physics Institute of RAS, Moscow, Russia3National Research Council, Institute of Composite and Biomedical Materials, Napoli, Italy

Nowadays, the problem of the solar elements effi ciency enhancement is of prime importance. One of the ways of dealing with that is to concentrate light energy in the region of the active medium. The antirefl ection multilayer coatings or/and dielectric gratings allows for lager fraction of the incident light to be applied to the semiconductor. In addition to that optical lenses concentrate incident radiation in the relatively small region given further improvement. However to effi ciently absorb light energy one need to assure that most part of light energy is not only transmitted through the semiconductor but also bounded in the volume of the semiconductor. Light energy can be localized in the close proximity to the interface by excitation of the surface plasmon polaritons. That is why the application of the plasmonic gratings to the semiconductor solar elements is very promising.

To fi nd the optimal plasmonic structure and its geometrical parameters giving most prominent light energy concentration one need to calculate electromagnetic fi eld distribution inside the semiconductor. For that rigorous coupled waves analysis (RCWA) is well applicable here. The essence of the RCWA method is to solve Maxwell equations by transferring from them to a system of linear algebraic equations. Working in truncated space is essential, so some issues concerning slow convergence arise. Nevertheless, some special approached including factorization rules improve the convergence greatly.

Preliminary numerical analysis of the problem demonstrated that the effi ciency of the solar cell element measured by the ratio of the photocurrent to the incident light energy can be increased by several tens percents by making additional cover layers on the basis of the plasmonic metal gratings. The period of the metal grating should be about several hundreds of nanometers while the thickness of the layer is about 60-100 nm.

O-57 - HB-LED devices - from laboratory to high volume productionB. Heidari1 1Obducat AB, Malmö, Sweden

The benefi ts of photonic crystal technology in improving the power consumption and performance of HB-LEDs have been proven over and over again from both a theoretical point of view and on laboratory scale. During the recent years the technology has been brought out of the laboratories, into the production environment, much with the help of nano imprint lithography. This presentation will discuss the advantages of the photonic crystal technology for increasing the performance of HB-LEDs and the suitability of Nano Imprint Lithography for producing Photonic crystal-based HB LEDs.


67

Parallel Sessions

Parallel Session C3 - Nanotechnology in Eco- & Energy-effi cient industrial production - Nanotechnology in food and other consumer products

KL-14 - Nanotechnology in food? Safe to eat?S. Weigel1

1RIKILT Institute for Food Safety, Wageningen UR, Wageningen, The Netherlands

A number of recent reports and reviews have identifi ed the current and short-term projected applications of nanoparticles for food and beverages. These include nano-sized or nanoencapsulated ingredients and additives for food, beverages, and health-food applications as well as the use of engineered nanoparticles for the improvement of food contact materials with view to mechanical properties, gas permeability or antimicrobial activity. Although potential benefi cial eff ects of nanotechnologies are generally well described, their potential (eco)toxicological eff ects and impacts have so far received little attention. The high speed of introduction of nanoparticle-based consumer products urges the need to generate a better understanding about the potential negative impacts that nanoparticles may have to biological systems. Otherwise, the high expectations of nanotechnologies for the agro-food sector may become threatened by an important factor: the declining public acceptance. Priority research topics include:• The development of analytical tools for the detection and characterisation of nanoparticles in complex biological matrices like food• Investigation of deviant behaviour (kinetics) and novel eff ects (toxicity) of nanoparticles and evaluation of the validity of currently used test

systems for oral exposure and risk assessment approaches • Establishment of relevant dose metrics for nanoparticles used both for interpretation of scientifi c studies as well as for regulatory frameworks

The presentation will highlight some current applications of nanoparticles in food and food contact materials and will review analytical and toxicological approaches which address the food safety related research issues of nanotechnology.

KL-15 - Nanotechnology in coatingsP. Venturini1, J. Godnjavec1, T. Razborsek1, B. Znoj1, B. Music1

1Helios Domzale d.d., Research and Development, Domzale, Slovenia

The coatings market is facing many challenges driven by customer expectations, new scientifi c discoveries and changing environmental legislation. These very challenges also present the industry with the opportunity to use innovation to change the market place.

In coatings, nanotechnology has been introduced via nanoparticle additives already long time ago. Demands for higher value and performance have in the recent years encouraged nanotechnology based ideas fi nding its way into ever more practical coating applications. Several approaches within this technology are used today to achieve organic-inorganic nanocomposite or nanostructured coatings. These approaches include incorporation of preformed nanoparticles in organic resin systems, in-situ generation of nanoparticles or nanophases, and other nanostructuring mechanisms. They are mainly aiming at an improved scratch resistance, stable UV protection, or the generation of specifi c nanostructures in the coating binders, often leading to very novel functionalities.

With increased demands for coatings that can sense their environment, perform multifunctionaltasks and at the same time be produced cheaply and safely a new class of coatings has emerged. Several smart coating systems have been examined and are currently under investigation by several laboratories and industries throughout the world. These smart coatings include stimuli responsive, conductive, antimicrobial, antifouling, self-healing, sensor, photocatalytic, super hydrophobic, thermochromic, color shifting and nanoengineered coatings. These structured coatings have been developed to provide additional benefi ts by giving an appropriate response to outside conditions.

Several novel additives, nano-sized resins, and coating formulations incorporating these technologies are now commercially available. New approaches off er many benefi ts for customers, provide environmentally friendlier and sustainable products. It is not surprising that numerous large, well established companies as well as small, entrepreneurial fi rms have focused on developing products for the coatings marketplace based on nanotechnology.

O-49 - Nanoparticles and nanocomposites for industrial applicationsJ. Zelenka1, T. Vlcek1, K. Zetkova1

1SYNPO joint-stock company, Czech centre of nanostructured polymers and polymers based on renewable resources, Pardubice, Czech Republic

Synpo has been doing R&D in solvent based and waterborne coatings for more than 50 years. We developed many new products based on epoxies, acrylics, polyurethanes, alkyds, and hybrids of these polymers. During the past several years, we started several R&D programs focused on systems containing nanoparticles. Initially, we looked at commercially available nanoparticles but we were disappointed with the results obtained. Often, physical properties of nanocomposites containing such particles were worse than those of unfi lled systems. We concluded that it was due to a poor compatibility of nanoparticles with the chosen binders. We noticed that as a result of this poor compatibility, nanoparticles aggregated fairly quickly during processing and, thus, lost their eff ectiveness.

Synpo decided to develop new types of nanoparticles, specifi cally designed to optimize their interaction with various binders. We now have a lot of experience in synthesis of unique “dispersants/stabilizers” for modifi cation of surfaces of nanoparticles for their specifi c end use. This expertise allows us to prepare unique nanofi lled system containing the polymeric binders listed above. Our unique nanoparticles are based on clays, metal oxides, carbon nanotubes, silicas, metals and even hybrid organic/inorganic nanoparticles and hyperbranched fully organic polymers. Examples of various industrial applications for such nanocomposites will be shown in this presentation.


68

Parallel Sessions

Parallel Session C4 - Future industrial technologies - Nanotechnology based materials

KL-16 - Material developments with chemical nanotechnologies: Examples from the Fraunhofer-Alliance NanotechnologyK.H. Haas1

1Fraunhofer-Institut für Silicatforschung ISC, Fraunhofer Nanotechnology Alliance, Würzburg, Germany

Chemical nanotechnologies - based mainly on reactions in solutions - have found widespread applications in various industries. This encompasses inorganic materials (glasses and ceramics), metallic nanoparticles, organic composites and hybrid materials. The main advantage of this approach is that it relies mainly on established chemical processing technologies without the need for large investments. The bottom-up approach for generating nanostructures is based on the formation of (self-assembled) nanostructures either held together by weak or strong chemical bonds.

The focus of this contribution is on material development aspects for diff erent applications and will give examples of relevant industrial applications.

The examples presented are:• nanoparticles (oxides, clays, metals, carbon nanotubes) for reinforcement and functionalization of polymers (e.g. for antimicrobial functions)

or as nanoscaled inks• Multifunctional coatings (transparent hard coats, nanoporous antirefl ective coatings, easy-to-clean, photocatalysis, corrosion protection,

barrier layers)• molecular imprinted particles for removal of toxic compounds• organic block-copolymers for the use in cosmetics or medicine• hybrid polymers for new optical and photonic devices

Also some critical bottlenecks for the further use of chemical processing techniques for the development of nanotechnology will be discussed f.e. • avoiding the use of solvents (green chemistry)• controlling nanostructure formation using weak intermolecular forces, • creating sustainable value chains for small and medium size companies dealing with the development of nanomaterials • aspects of workplace safety and environmental concerns

The main task of the Fraunhofer-Gesellschaft is to contribute to industrial implementation of new technologies and processes also in the fi eld on nanotechnology (www.nano.fraunhofer.de). The research areas encompass materials, electronics/optics, life science, production technologies and analytics.

O-50 - Challenges in modelling properties of nanomaterials D. Leszczynska1, B. Rasulev2, A. Toropov2, J. Leszczynski3

1Jackson State University, Civil and Environmental Engineering, Jackson, USA2Jackson State University, Interdisciplinary NanoToxicity Center, Jackson, USA3Jackson State University, Chemistry, Jackson, USA

Industrial applications of various nanomaterials have been increasing appreciably in the last decade. This progress is paralleled by the investigation of fundamental properties of nanostructures by chemists, biochemists and medicinal chemists. Usually such experimental investigations can be augmented by the results of advanced computational studies. Among various computational approaches the quantitative structure - property/activity relationships (QSPR/QSAR)-based methods by combination of experimental data with theoretical descriptors provide useful tools to supply necessary information assisting development of novel nanomaterials.

This talk highlights the most signifi cant achievements and challenges related to our recent studies on nanomaterials. Among studied species are, fullerenes, carbon nanotubes, metal and metal oxide clusters. Application of computational techniques allows obtaining detailed information on various properties of these nanostructures. Among studied properties are molecular structures, solubility, and Young modules. Also novel developments of Quantitative Structure - Activity Relationships (QSAR) approach in prediction properties of nanospecies and in the risk assessment of nano-size materials will be reviewed.


69

Parallel Sessions

O-51 - Nano patterned materials for future productsB. Löchel1, A. Schleunitz1, N. Nüsse1, O. Mertsch1

1Helmholtz-Zentrum Berlin für Materialien und Energie GmbH, Berlin, Germany

Nano patterning of materials is often changing the character of these materials drastically. Modern materials used in micro electronic fabrication and patterning methods known and established in micro electronics are favored for such investigations.

Two examples will here be discussed. The fi rst treats of the characteristics of some 100 nm thick layers of SiNx. It was structured with periodically arranged holes of about 100 nm diameter with distance to each other in the same order. Such patterned SiNx layers behave as Photonic Crystals. This new material class gains much attention because they facilitate designing optical properties of thin layers and aff ords further miniaturizing of optical elements and circuits. Only few research teams are capable of fabricating Photonic Crystals in the visible spectral range. Our investigations include eff ective single photon sources for quantum cryptography and quantum computers, brilliant and energy-saving lasers, as well as novel sensors.

A second example deals with the change of surface characteristics caused by patterned thin polymer layers. Such micro and nano textured layers highly infl uence the wetting characteristics of surfaces. In nature they are known from several plants and represent water and dust repelling characteristics. This attribute is also known as „Lotus eff ect“. Those properties can also be applied to fl uidic microsystems, where they are employed to reduce sample volumes and enable self-cleaning eff ects. The Lotus eff ect here is realized by means of micro- and nano structuring using lithography, PVD, CVD and chemical etching processes. We can generate both fl at membranes and structures with high aspect ratios that are extremely water repellent and have contact angles of 165 degrees and more.

In both cases surface patterns with nanometer dimensions has to be realized. Favored technologies for structuring in this dimension are lithographical methods (electron beam writing, UV lithography) as well as Nano Imprint Technologies. They were preferred for cost-eff ective and reliable fabrication of such patterns. In contrast to conventional lithography, micro- and nano scaled structures are generated with Nano Imprint Technique by a simple imprint stamp. Under applied heat and force, the pattern is transferred into a polymer layer only by local material displacement. Thus, technical limitations in resolution related to conventional lithography methods are exceeded and technical eff orts are drastically reduced.

O-52 - Eff ect of grain size on curie temperature, magnetic and electrical properties of NiFe2O4 nanoparticle synthesized by chemical co-precipitation techniqueH. Sheikh Manjura1, A.K.M.A. Hakim1, I. Saha2, P. Nordblad3, R.C. Sinha2

1Atomic Energy Centre Bangladesh Atomic Energy Commission, Materials Science Division, Dhaka, Other2Jahangirnagar University, Department of Physics, Dhaka, Other3Uppsala University, Solid State Physics Dept. of Eng. Physics, Uppsala, Sweden

Nanocrystalline nickel ferrite has been prepared by chemical co-precipitation technique. X-ray diff raction patterns of as dried and samples calcined at various temperatures have been studied. It has been observed that the sample in the as dried condition is fully single phase and no extra peak could be observed in XRD patterns. The grain size has been obtained from Scherrer’s formula and found as 7 nm. When the samples were calcined at higher temperatures subsequent grain growth has taken place. Samples calcined at 600°C led to the grain size as 16 nm. Further calcinations at 1200°C led to the grain size above 50 nm. Frequency dependence of real and imaginary part of initial permeability has been presented for the samples calcined at diff erent temperatures. Real part of initial permeability, increases with the increase of grain growth as expected i.e. when the grain size is smaller the permeability is lower. The presence of small grain size interferes with wall motion, which decreases permeability and increases the stability region of real part of initial permeability. The loss component represented by imaginary part of initial permeability decreases with frequency up to the measured frequency of this study of 13 MHz. At higher frequencies, losses are found to be lower if domain wall motion is inhibited and the magnetization is forced to change by rotation. At lower fi ring temperatures i.e. when the grain sizes are smaller, the Neél temperature is lower. The decrease in Neél temperature with grain size can be explained on the basis of the fi nite size scaling theory. The fi nite size eff ect is predominant when the grain sizes are very small which results in a decrease in Neél temperature with grain size reduction. The small particles have a signifi cant fraction of atoms on the surface and their exchange interaction should be weaker because of the lower coordination. They will have a reduced average Neél temperature compared to that of the interior atoms, which accounts for the decrease in Neél temperature at lower sintering temperature. Field dependence of magnetization has been recorded for the samples sintered at diff erent temperatures. The coercivity of the samples in the as-prepared condition is almost zero, which is suggestive of superparamagnetic behavior at room temperature. Sample sintered at 400°C shows a small but non-zero coercivity. The much reduced Ms in the nano-particle sample implies that outside a core of ordered moments, those in the surface layer are in a state of frozen disorder. Temperature and frequency dependence of resistivity and dielectric constant have been measured for the samples sintered at 1000-1350°C. The real part ε’ of the dielectric constant and the dielectric loss tanδ for samples sintered at higher temperature are about two orders of magnitude smaller than those of the NiFe2O4 prepared from chemicals of analytical grade.


70

Parallel Sessions

O-53 - Development of nanostructured diamond-like carbon coatings with biofouling-resistant propertyQ. Zhao1, X. Su1, S. Wang1, D. Xu1, X. Zhang2, P. Navabpour2, D. Teer2

1University of Dundee, Mechanical Engineering, Dundee, United Kingdom2TEER Coatings Ltd, West Stone House, Worcestershire, United Kingdom

The rapid development of the global off shore industry and of amphibious chemical, steel and power plants leads to more intensive use of water as a cooling medium. However heat exchangers using water as coolant suff er from biological fouling. As biofi lm is highly hydrated, it therefore acts as an insulator, increasing heat transfer resistance and pressure drop in heat exchangers and calling for higher pumping requirements. The cost of cleaning and lost output can be extremely high. Since microbial adhesion on the surfaces of pipelines and heat exchangers is a prerequisite for biofouling formation, prevention of microbial adhesion on the equipment surfaces will have a major impact in preventing biofouling.

Diamond-like carbon (DLC) coatings have excellent properties such as excellent thermal conductivity similar to metals, low friction, extremely smooth surface, hardness, wear resistance and corrosion resistance, which are very suitable for heat exchanger applications. Recently we found that DLC coatings reduced hard mineral scale formation on heat transfer surfaces signifi cantly due to their special nanostructures. In this paper Si and N-doped DLC coatings were deposited using magnetron sputter ion-plating and plasma-enhanced chemical vapour deposition (PECVD) for biofouling control. The DLC coatings were evaluated with Pseudomonas fl uorescens, which is one of the most common bacteria forming biofouling on the surfaces of heat exchangers in cooling water systems. The experimental results showed that the nanostructures and surface energy of the DLC coatings have signifi cant infl uence on bacterial adhesion. The incorporation of 2%N into the Si-doped DLC coatings further signifi cantly reduced bacterial settlement and signifi cantly increased bacterial removal. The Si-N-doped DLC coatings reduced bacterial settlement by 58% and increased bacterial removal by 41%, compared with T2 silastic. Bacterial adhesion strength on the DLC coatings was explained with thermodynamic work of adhesion. This investigation demonstrated that the modifi ed DLC coatings have a potential to reduce biofouling in heat exchangers.


71

Parallel Sessions

Parallel Session D1 - Nanotechnology in Eco-& Energy-effi cient industrial production - Nanomanufacturing

O-58 - Charged particle nanopatterning of masters for substrate conformal imprint lithography F. van Delft1, R. van de Laar1, M. Verschuuren2, E. Platzgummer3, H. Loeschner3

1Philips Research, Mi Plaza, Eindhoven, The Netherlands2Philips Research, Photonic Materials and Devices, Eindhoven, The Netherlands3IMS Nanofabrication AG, Vienna, Austria

Charged Particle Nanopatterning (CHARPAN) techniques based on electron and ion multi-beam projection techniques are fi nding increased industrial interest for the fabrication of leading-edge complex masks, nanoimprint templates and for nanosystem devices. Recently, the fi rst generation programmable Aperture Plate System with integrated CMOS electronics (CMOS-APS) featuring 43 thousand switchable beams was inserted into a CHARPAN tool. Using this confi guration, the fi rst exposure results in Hydrogen Silsesquioxane (HSQ) resist employing 10 keV Hydrogen parallel ion beams of 12.5 nm spot size show that (at least) a 20 nm resolution is feasible in this system (Fig. 1). These patterns have been tested as masters for PDMS stamp casting. The PDMS stamps have been successfully implemented in Substrate Conformal Imprint Lithography (SCILTM). The latter technique has been licensed to Süss MicroTec and is already being applied in the mass production of optical components. An example of the fl exibility of SCIL is shown in Fig. 2. The CHARPAN tool can also be operated with heavier ions (Argon, Xenon) enabling maskless and resistless 2D and 3D nanopatterning. Such micrometer deep 3D structures can also be applied in SCIL e.g. for manufacturing micro lenses. The combination of CHARPAN and SCIL opens up new possibilities for fast and fl exible manufacturing of nano-devices.

O-59 - Micro and nano manufacturing: challenges and opportunitiesS. Dimov1

1Cardiff University, Manufacturing Engineering Centre, Cardiff , UK

In recent years, manufacturing industry has witnessed a rapid increase in demand for micro products and micro components in many industrial sectors including electronics, optics, medicine, biotechnology and automotive. Examples of applications include medical implants, drag delivery systems, diagnostic devices, connectors, switches, micro reactors, micro engines, micro pumps, and printing heads. These microsystems-based products represent key value-adding elements for many sectors of industry and thus, an important contributor to a sustainable economy. As a result of this current trend for product miniaturisation, there is a demand for constant advances in micro and nano structuring technologies and their integration in new manufacturing platforms. These platforms must enable both function and length scale integration (meso, micro and nano) in existing and new emerging products, and at the same time their cost eff ective manufacture in a wide range of materials.

Lithography-based technologies are able to produce micro- and nanometer size features. However, these techniques are mainly for producing planner 2D and 2.5D structures, and have limitations concerning the range of materials that can be processed. Thus, they cannot meet the demand for miniaturised products and components that require 3D and high aspect ratio features, resistance to aggressive environments and enhanced-forced micro actuation. For this reason, new complementary micro and nano manufacturing (MNM) technologies are necessary to produce components with micro and nano structures in a multiplicity of materials and also enable function and length scale integration in products.

In this context, a Pan-European Research Infrastructure (RI) for micro- and nano-structuring and characterisation of new, novel and emerging functional materials (EUMINAfab) has been established. Within the scope of this FP7 RI programme, the Manufacturing Engineering Centre (MEC) at Cardiff University in collaboration with other EUMINAfab partners off er access to a unique portfolio of state-of-the-art installations, and simultaneously through a joint R&D aim to advance the state of the art in MNM technologies. This talk will discuss the challenges and opportunities associated with the development of new MNM platforms for multi-function multi-material products, and the need for technology convergence in order to benefi t from a range of available or emerging technologies for low cost volume manufacture. Also, in the talk feasibility studies and pilot applications from the MEC MNM programme will be used to illustrate the latest advances in micro and nano structuring and replication technologies.


72

Parallel Sessions

O-60 - Bottom up surface functionalization by dip-pen nanolithography at the Karlsruhe NanoMicro Facility (KNMF)S. Lenhert1

1Forschungszentrum Karlsruhe, Institute of Nanotechnology, Eggenstein Leopoldshafen, Germany

While top-down microfabrication strives to fabricate smaller structures from a single material, the bottom-up approach seeks to assemble and integrate small components into larger and more complex devices. Dip-Pen Nanolithography (DPN) is a bottom-up nano- and micro-fabrication technique that uses the tip of an atomic force microscope as an ultra-sharp dip-pen.1 The constructive (bottom-up) nature of DPN gives it several unique capabilities.2 First, it can be readily carried out using parallel tip arrays enabling both high throughput and high resolution.3 Second, since no etching or post-processing is typically required, prepatterned surfaces composed of a variety of materials can be used. Finally, (DPN) is capable of simultaneously integrating of multiple materials (or inks).4 In particular, the use of lipid-based inks developed at the Forschungzentrum Karlsruhe and now part of the KNMF takes advantage of these aspects of DPN.4, 5 For example, a variety of surfaces can be functionalized with multiple biological molecules, with applications including biosensors, nanoarrays and cell culture.

References[1] Piner, R. D., Zhu, J., Xu, F., Hong, S. H. & Mirkin, C. A. “Dip-pen” nanolithography. Science 283, 661-663 (1999).[2] Lenhert, S., Fuchs, H. & Mirkin, C. A. in Nanoprobes (ed. Fuchs, H.) (Wiley-VCH, Weinheim, 2009).[3] Salaita, K. et al. Massively parallel dip-pen nanolithography with 55000-pen two-dimensional arrays. Angew Chem Int Edit 45, 7220-7223 (2006).[4] Sekula, S. et al. Multiplexed Lipid Dip-Pen Nanolithography on Subcellular Scales for the Templating of Functional Proteins and Cell Culture. Small

4, 1785-1793 (2008).[5] Lenhert, S., Sun, P., Wang, Y. H., Fuchs, H. & Mirkin, C. A. Massively parallel dip-pen nanolithography of heterogeneous supported phospholipid

multilayer patterns. Small 3, 71-75 (2007).

O-61 - Eff ect of surface nanotexturing on friction and wear during lubricated sliding.C. Chouquet1

1CEA, LITEN, Grenoble, France

Despite very low friction coeffi cients and wear rates of DLC coatings under dry conditions, lubrication is in most cases a necessary solution for maintaining effi ciency, reliability and durability of DLC coated machine components.

In this study, surface nano-texturing was investigated, in order to improve the tribological properties of a DLC/steel lubricated sliding contact. A direct coating nano-texturing process based on a laser lithography technique was developed and used for patterning hydrogenated amorphous carbon (a-C:H) layers. Circular nano-cavities with various diameters and depths were thus realised.

Tribological characterisation of those nano-textured layers was performed by means of a ball-on-disk tribometer and diff erent eff ects on friction and wear behaviours were highlighted depending on the cavity dimensions.

Creation of small and shallow cavities on a DLC layer allowed a signifi cant reduction of friction coeffi cient of a DLC/steel contact comparing to a system with a non-textured DLC fi lm. This improvement is attributed to several physical mechanisms such as wear debris entrapment, local increase of lubricant supply by fl uid reservoirs creation and also increase of load carrying capacity by a hydrodynamic eff ect. Interesting applications of this work appear particularly in automotive domain, where friction losses determine the fuel economy and performance of the vehicle.


73

Parallel Sessions

Parallel Session D2 - Future industrial technologies - Nanoelectronics

KL-21 - Physics and applications of spintronicsT. Jungwirth1

1Institute of Physics v.v.i. Academy of Sciences of the Czech Republic, University of Nottingham, Prague, Czech Republic

In this lecture we will introduce the fi eld of spintronics which has revolutionized magnetic storage technologies, is making its way into semiconductor microchips, and represents one of the most rapidly developing scientifi c fi elds in nano-electronics. We will start by introducing basic concepts of spintronics which recognize that, apart from the electrical charge, each electron carries a microscopic magnetic moment called spin. Its utility led to discoveries of many new physical eff ect in magneto-electronics, some of which are now widely used in applications and others still challenging our basic understanding of relativistic quantum-mechanics phenomena. Current spintronics research topics pursued both in the Academy of Sciences of the Czech Republic and worldwide will be the main topic of the lecture. We will also discuss the prospect of spintronics in terms of its future applications in information technologies.

O-68 - CARBonCHIP: Carbon nanotubes technology on silicon integrated circuits; some key resultsP. Rapposelli1, B. Capraro1, J. Dijon2, D. Cott3, G. Groeseneken4, J. Pinson5, X. Joyeux5, J. Amadou6, J. Van Noyen7, S. Bert7

1Intel Ireland Ltd., Mailstop IR6-2-2, Leixlip Co. Kildare, Ireland2CEA LITEN, Hybrid Components Laboratory LITEN/DTNM/LCH, Grenoble, France3IMEC, NANO-Group, Leuven, Belgium4IMEC, CMOS-DRE, Leuven, Belgium5Alchimer S.A., R&D, Massy, France6Nanocyl S.A., R&D, Sambreville, Belgium7Katholieke Universiteit Leuven, Centre for Surface Chemistry and Catalysis, Leuven, Belgium

CARBonCHIP (“Carbon Nanotubes Technology on Silicon Integrated Circuits”) has been a three year EU FP6 STReP collaborative project coordinated by IMEC and participated by CEA Liten, Katholieke Universiteit Leuven, Alchimer, Nanocyl and Intel Ireland. The International Technology Roadmap for Semiconductors (ITRS) reported that by 2014 wiring materials will need current densities to exceed that of Cu (107 A cm-2); in addition, the Cu resistivity is exponentially increasing with the scaling and miniaturization of Cu wiring. [1]. Based on these motivations, and on the fact that in microelectronic research huge expectations have been created for carbon nanotube (CNT) based nanotechnologies [2], the CARBonCHIP project aimed to determine whether carbon nanotubes are a viable material to be used in the manufacture of interconnected transistors for future electronic devices beyond the 22 nm node.

The research activities performed within the CARBonCHIP consortium primarily focused on the back end of line (BEOL, vias and interconnects) leading to the ability to now selectively grow dense bundles of vertical CNTs (1012 CNTs cm-2) inside BEOL small diameter vias (140 nm) with repeatable yield. Furthermore, it was demonstrated the proof of concept to use nano-scale template materials (zeolites) to enable similar CNT growth in the horizontal direction for BEOL interconnects. The fi nal project deliverable has been the generation of a materials based roadmap indicating further development of CNTs as a viable building block in nanoelectronics IC devices to extend Moore’s Law beyond the year 2020.

In this presentation, an overview of the CARBonCHIP key results will be illustrated. First the target specifi cations for BEOL applications will be introduced. Then the results on catalyst location control, CVD growth of dense packed stacks of CNTs into vias and integration issues will be shown; a perspective on the use of zeolites as possible route for the integration of CNTs in horizontal interconnects will also be given. Finally, a summary of the project and next steps will conclude the CARBonCHIP overview.

References[1] International Technology Roadmap for Semiconductors (ITRS) 2005, http://public.itrs.net [2] M. J. O’Connell, Carbon Nanotubes: Properties and Applications, CRC Press, May 2006


74

Parallel Sessions

O-69 - Atomic vapor deposition of new materials for nano-electronic device technologiesP.K. Baumann1, U. Weber1, P. Lehnen1, S. Pasko1, Y. Senzaki2, J. Lindner2, M. Heuken1

1AIXTRON AG, Kackertstr. 15-17, 52072 Aachen, Germany2AIXTRON Inc., 1139 Karlstad Drive, Sunnyvale, CA 94089, USA

As outlined in the International Technology Roadmap for Semiconductors (ITRS), alternative high-k dielectrics and electrode materials have to be introduced to replace silicon dioxide and polysilicon, to allow continued scaling of nano-electronic device technologies. This includes memory, capacitive and logic applications. Other new materials of interest include phase change materials for non volatile memory devices. The fabrication of such material systems with high uniformity, high purity, precisely controlled impurities as well as well defi ned interfaces sets high standards for possible enabling deposition technologies.

We have deposited high-k, electrode and phase change materials by AVD® (atomic vapor deposition). AVD is a pulsed MOCVD (metal organic vapor deposition) method that combines basic operation of conventional MOCVD and ALD (atomic layer deposition) processes. AVD uses a vaporizer with several independent injectors for pulsed direct liquid injection of various metal-organic precursors. Conventional MOCVD typically uses heated bubblers for the precursors. This causes precursor deterioration and a drift in deposition quality over time. In comparison for AVD the precursors are stored at room temperature right until injection into the vaporizer. Precise pulse dosing and fl ash evaporation allow high precursor gas phase saturation. This enables deposition of multi-component materials with high throughput and precise composition control even for metal-organic precursors with low volatility, low thermal stability and instability in air. In this study deposition was performed on 300 mm and 200 mm wafers by AVD. The fi lm thickness, interfacial structure, chemical composition, microstructure and electrical characteristics of the deposited fi lms have been determined. Results from deposition process development and physical and electrical measurements will be presented.


75

Parallel Sessions

Parallel Session D3 - Nanotechnology for Health and Environment - Nanomedicine - drug delivery

KL-18 - Polymer carriers for specifi c delivery of biologically active moleculesK. Ulbrich1

1Institute of Macromolecular Chemistry ASCR v.v.i., Department of Biomedicinal Polymers, Prague 6, Czech Republic

Conjugation of water-soluble synthetic polymers with conventional drugs or other biologically active molecules is one of the most effi cient methods of improvement therapeutic index of drugs employed in human therapy. We have developed various structures of the polymer-drug conjugates based on copolymers of N-(2-hydroxypropyl)methacrylamide (HPMA) or biodegeradable poly(ethylene glycol)-based polymers. Water-soluble polymer-drug conjugates exhibit improved drug solubility, prolongation of blood clearance, decrease in renal excretion and decrease in the drug non-specifi c toxicity. Biodegradable high-molecular-weight conjugates of linear, grafted, hyperbranched or micellar structure with anti-cancer drugs were designed to achieve in vivo passive accumulation in solid tumours due to EPR eff ect. In these systems tumour-specifi c drug (doxorubicin, DOX) release and activation is followed by degradation and elimination of the polymer from body by glomerular fi ltration.

HPMA copolymer-DOX conjugates actively targeted with monoclonal antibodies and bearing DOX bound to the polymer via enzymatically degradable oligopeptide spacers or spacers susceptible to pH-controlled hydrolysis show a remarkable tumour cell line-specifi c anti-tumour activity in mice bearing model tumours with often complete cure of animals. Anti-tumour activity of the conjugates strongly depends on the conjugate architecture and method of conjugation with the antibody. A similar eff ect, i.e. complete cure of animals can be achieved by using only passively targeted HPMA copolymer carriers. Both cytostatic and anti-tumour immunoprotecting eff ects in tumour-bearing mice are responsible for high activity of the drugs.

Reactive HPMA copolymers with a structure similar to that used in a synthesis of anti-tumour therapeutics were used for coating of surfaces of gene delivery vectors (viruses, polyplexes) and their targeting using murine growth factors (EGF, bFGF) as targeting moieties. In the copolymers reactive thiazolidine-2-thione (TT) groups were linked to a polymer chain via spacers susceptible to degradation in reducing environment of cytoplasm with the aim to release the protecting polymer shield of the adenovirus after entering the target cells. Coating of viruses using aminolytic reaction of polymer TT groups with primary amino groups of the virus capsid resulted in ablation of natural tropism of adenovirus and enabled its specifi c targeting by incorporation of targeting ligands. Specifi c anti-tumour activity of polymer-coated viral systems shows that transductional targeting strategies can be used to improve versatility of adenovirus gene delivery vectors.

Support by grant KAN200200651 and Praemium Academiae is gratefully acknowledged.

KL-19 - Nanotechnology challenges in targeted delivery of biopharmaceuticsC. Kiparissides1

1Aristotle University of Thessaloniki, Centre for Research and Technology Hellas, Thessaloniki, Greece

New Peptidic/Proteinic (P/P) drugs are being discovered every day and their increased availability off ers new ways to treat and prevent diseases. However, the structure, physicochemical properties, stability, pharmacodynamics and pharmacokinetics of these new biopharmaceutics place stringent demands on the way they are delivered into the body. Additionally, P/P drugs do not easily cross mucosal surfaces and biological membranes, are easily denatured or degraded, prone to rapid clearance in the liver and other body tissues, and require precise dosing.

Major goals of nanomedicine in terms of controlled delivery of biopharmaceutics, are the maximization of their bioavailability and effi cacy, the control of pharmacokinetics, pharmacodynamics, non-specifi c toxicity, immunogenicity and biorecognition as well as the overcoming of obstacles arising from low solubility, degradation, fast clearance rates, relatively short-lasting biological activity and inability to cross biological barriers. The above goals are expected to be achieved, through the development of targeted delivery systems that can be selectively delivered to specifi c areas in the human body. However, since P/P drug characteristics diff er substantially with respect to chemical composition, molecular size, hydrophilicity, bioavailability, optimum concentration range, etc., the essential characteristics that identify the effi ciency of the delivery systems are highly complex. Thus, their development has to be pursued as a multi disciplinary eff ort, fi rmly built on extensive experience in polymer science, pharmacochemistry, pharmacology, molecular biology, bioconjugate chemistry and toxicology.

Recent advances in the delivery of biopharmaceutics deal with the development of synthetic nanometer sized targeted delivery systems in the form of nanocarriers (e.g., polymeric or hybrid nanoparticles, nanogels, lipid based vesicles, dendrimers) and molecular carriers (e.g., polyelectrolyte complexes, polymer-P/P drug complexes). Targeted delivery systems can have multiple functions, a key one being their ability to recognize specifi c molecules which can be located either in the membrane of target cells, or in specifi c compartments within the cell. The carrier-based drug delivery systems can improve the bioavailability and diminish the toxicity of P/P drugs, control their release profi le and make alternative administration routes possible. A challenging objective of targeted delivery is the development of novel nanocarriers and molecular carriers for the targeted delivery of biopharmaceutics via oral, nasal and Blood Brain Barrier (BBB) crossing administration routes.


76

Parallel Sessions

O-62 - Nanotechnology based drug delivery system in the inner ear: cochlear implant as example for delivery system - the nanoear projectI. Pyykkö1, J. Zou1, D. Poe1, P. Dalton1

1University of Tampere, Otolaryngology, Tampere, Finland

Objectives. The goal of the NANOEAR project is to improve the function of cochlear implant (CI) by stimulating peripheral processes of the auditory nerve to grow closer to electrodes and also to stimulate the supporting cells to regenerate the outer hair cells. To this end, novel multifunctional nanoparticles (MFNPs) are being developed, which are targetable to selected cell populations, biodegradable, traceable in-vivo, and equipped with controlled drug/gene release.

Methods. Novel MFNPs of diff erent types - lipolexes, dendrimers, micelles, mesoporous NPs, polymer-protein complexes, nanocapsules and nano-layers have been constructed.. To target spiral ganglion cells with the MFNPs, we have cloned Trk B receptors, synthetized BDNF and bio-panned selected tissues from the inner ear from which we are designing ligands against suitable epitopes of hair cells and supporting cells. The MFNPs will be coated by polyethylene glycol (mPEG), housed with BDNF or a combination of Math-1 gene and siRNA, and decorated with markers and targeting ligands. Signalling molecules (gadolinium) will be assessed for benchmarking purposes in vivo. This novel implant will include a MFNP drug reservoir providing continuous drug delivery through the electrode tip for nerve outgrowth.

Results. Cell entry and intracellular traffi cking are limiting factors in the drug/gene incorporation process. At present the nano-carriers are capable of using diff erent specifi c pathways to pass the round window membrane and to enter the cell. Cell entry can be facilitated by using viral TAT-peptide and nuclear pore complex entry by nuclear targeting peptides. The critical size for cellular traffi cking seems to be 80 nm of particle size.

A cochlear implant with a drug reservoir and delivery system through the electrode tip has now been designed. Hundreds of NPs have been produced and tested. Several diff erent coating techniques have been investigated. The coating is important to reduce protein absorption and to provide the base for attachment of diff erent ligands, signalling molecules and markers. The MFNPs are equipped with markers allowing identifi cation with histological methods. Of particular interest is GFP gene that is used to demonstrate the effi cacy of the transfection rate of the MFNPs in cell inoculation upon entering the nucleus of the cells. Furthermore we have worked on Math-1 gene and siRNA plasmids to demonstrate their effi cacy for entering the specifi c cells (PC12 cells) in vitro. For cellular targeting and in inoculation processes, the transfection rate is still relatively low, and more eff orts will be made to improve the intracellular traffi cking and to promote migration of DNA through nuclear pore complexes.

Conclusions. The application of the nano-carriers into the cochlea indicates that, depending on the type of nanoparticle, diff erent migration pathways are employed and optimal carriers can be designed for various cargos. The use of nanoparticles as drug/gene carriers is especially attractive as an intraoperative adjunct to cochlear implantation or as a drug/gene reservoir incorporated into the implant for prolonged delivery.


77

Parallel Sessions

O-63 - Drug design and nanosensing for cardiovascular diseasesC. Ruggiero1, P. Arrigo2, N. Maggi1, L. Pastorino1, F. Caneva Soumetz1

1University of Genoa, Dist, Genova, Italy2CNR, Ismac, Genova, Italy

BackgroundPersonalized medicine is beginning to be recognized and is expected to become the standard of medical practice within the next decade. The discovery of biomarkers, molecular diagnostics [1], drug discovery and drug delivery are pivotal elements of personalized medicine - a time consuming processes. The aim of the EU project ‘Drug Design for Cardiovascular Diseases: Integration of in Silico and in Vitro Analysis’ (Cardioworkbench) is the discovery of new targets involved in cardiovascular diseases, mainly atherosclerosis, and systems to select and test new molecules that can be pharmacologically active for this class of multifactorial disease. The project also focuses on the development and optimization of a new integrated pipeline for target discovery and lead compound design.The project integrates pharmacology, clinical expertise, biology and computer science in a European multidisciplinary network. The approach is based both on ‘in silico’ analysis and on ‘wet’ lab activity. The personalization of therapy is crucial for gene therapy application and for regenerative medicine [2].

MethodsA new piezoelectric biosensor, based on layer-by-layer (LbL) technique, has been designed and developed. This new diagnostic tools has been designed to detect a protein, the MMP-1, that seems to be critical in cardiovascular disease emergence and progression. The integration of high-throughput proteomic (antibody array) with LbL or functionalized polymers or supramolecular structure will allow to develop a new generation of multiple biosensors. The ‘wet’ lab activity has been planned on the basis of an intensive integrative chemo-bioinformatic analysis. The ‘in silico’ screening has allowed to select potential epitopes for mAbs and for NAdevices design. The integrative chemo-bioinformatics analysis has also supported the investigation of genetic variability on nanodevices effi ciency.

Results and perspectivesThe results of Cardioworkbench, in addition to the design and synthesis of new drugs, also support the foreseeable development of DNA or RNA based nanodevices [3]. DNA based nanodevices can be used as biosensors to detect the presence of proteins or nucleic acids potentially related with diseases. One of the great advantages for nucleic acid devices is their ‘in vivo’ applicability and one of their main applications is DNA or RNA delivery for gene therapy purposes. DNA can be used to build nanocontainers for drugs or switchable hydrogels, which can trap and release compounds. It is planned to continue the activity of Cardioworkbench along these lines.

References[1] Jain, K.K., Clin Chem, 2007, 53, (11), pp. 2002-2009[2] Solanki, A., Kim, J.D., and Lee, K.B, Nanomed, 2008, 3, (4), pp. 567-578[3] Simmel, F.C., Nanomed, 2007, 2, (6), pp. 817-830


78

Parallel Sessions

Parallel Session D4 - Future industrial technologies - Polymer nanocomposites & membranes

KL-20 - Nano- and micro structured smart polymercompositesM. Zrínyi1

1Semmelweis University, Faculty of Pharmacy, Department of Pharmaceutics, Budapest, Hungary

Composite materials consisting of rather rigid polymeric matrices fi lled with magnetic particles are long time known and called magnetic elastomers or magnetoelasts. These materials are successfully used as permanent magnets, magnetic cores, connecting and fi xing elements in many areas. These traditional magnetic elastomers have low fl exibility and practically do not change their size, shape and elastic properties in the presence of external magnetic fi eld.

The new generation of magnetic gels and elastomers represent a new type of composites, consisting of small (mainly nano-sized) magnetic particles dispersed in a high elastic polymeric matrix. The particles couple the shape of the elastomer to the external magnetic fi elds. Since the particles cannot leave the polymer matrix, so that all of the forces acting on the particles are transmitted directly to the polymer chains resulting in either locomotion or deformation. Shape distortion occurs instantaneously and disappears abruptly when external fi elds are applied or removed, respectively.

Combination of magnetic and elastic properties leads to a number of striking phenomena that are exhibited in response to impressed magnetic fi elds. Giant deformational eff ect, tunable elastic modulus, non-homogeneous deformation and quick response to magnetic fi eld open new opportunities for using such materials for various applications.

Elastic materials with tailor-made anisotropy can also be prepared under external fi eld. The anisotropy manifests itself in both direction dependent elastic modulus as well as direction dependent swelling.

Synthesis of elastomers in uniform magnetic fi eld can be used to prepare anisotropic samples. In uniform fi eld there are no attractive or repulsive fi eld-particle interactions therefore particle-particle interactions become dominant. In monomer solution the imposed fi eld orients the magnetic dipoles. If the particles are spaced closely enough, so that their fi eld can reach their neighbours, mutual particle interactions present. The particles attract each other when aligned end to end, and repel each other when placed side by side. Due to the attractive forces pearl chain structure develops. If the chemical reaction proceeds not too fast, then there is enough time to induce the pearl chain structuring of the fi ller particles by applying uniform external fi eld before the reaction is completed. The anisotropy manifests itself in both direction dependent elastic modulus as well as direction dependent swelling.

The magnetic elastomers have shown a change in compressive modulus under uniform magnetic fi eld. The interactions of magnetic particles result in an increase of the elastic modulus. This induced temporary reinforcement depending on the magnetic fi eld intensity may exceed one order of magnitude.

Novel composite-gel membranes capable of regulating permeability in response to external temperature change are being explored. These membranes containing ordered nanochannels can act as “on-off ” switches or “permeability valves”. The channels are designed to contain an ordered array of core-shell type magnetic polystyrene latex particles that can change their size in response to external stimuli. Expansion and contraction of the thin shell of magnetic latex particles aff ect the permeation pattern from the membrane “on”state to “off ” state. This is shown in Fig.3.


79

Parallel Sessions

Magnetic and electric fi eld induced deformation, locomotion and rotation, as well as on/off switching control of magnetic polymeric membranes will be the subject of the oral presentation.

ACKNOWLEDGEMENTSThis research was supported by Hungarian National Research Fund (OTKA, Grant No. 68750).

References[1] M. Zrínyi , D. Szabó, G. Filipcsei and J. Fehér: Polymer Gels and Networks, Marcel Dekker, Inc., New York (2001)Chapter 11, p. 309-355[2] Filipcsei G, Csetneki I, Szilágyi A and Zrínyi M: Magnetic Field-responsive Smart Polymer Composites (rewiev), In: Advances in Polymer Science,

Springer-Verlag Berlin Heidelberg, 2007, pp. 137-189


80

Parallel Sessions

O-64 - UV protective zinc oxide/poly(methyl methacrylate) nanocomposites with enhanced thermal propertiesM. Zigon1, A. Anzlovar1, Z. Crnjak Orel2, Y.M. Strzhemechny3

1National Institute of Chemistry, Polymer Chemistry and Technology, Ljubljana, Slovenia2National Institute of Chemistry, Laboratory for The Spectroscopy of Materials, Ljubljana, Slovenia3Texas Christian University, Department of Physics and Astronomy, Fort Worth, USA

The organic-inorganic nanocomposites are two-phase systems consisting of polymers loaded with high-surface-area fi llers. They are known to posses diff erent or enhanced properties as compared to pure polymers, which is the consequence of the large specifi c surface area of nanoparticles leading to enhanced interfacial reactions between them and the polymer matrix. In addition, nanocomposites are compatible with conventional polymer processing.

Poly(methyl methacrylate), PMMA, is an amorphous thermoplastic polymer with excellent optical properties and favourable mechanical properties. On the other hand, zinc oxide, ZnO, is one of the most attractive and technologically important semiconductors due to unique combination of electric and optical properties. The nanocomposites of ZnO and PMMA, ZnO/PMMA, have high potential for applications as UV protecting fi lms and plates, antirefl ection coatings, transparent barrier/protective layers and as PMMA materials with enhanced thermal stability. For the preparation of homogeneous ZnO/PMMA nanocomposites it is crucial to achieve good dispersion stability, usually by using surface-functionalized ZnO nanoparticles.

In this contribution we report on ZnO/PMMA nanocomposites with potential application as UV protective and thermally stabilized PMMA materials. ZnO nanoparticles with an organophillic surface layer were synthesized in various glycols and were incorporated in the PMMA matrix by the chain polymerization of MMA in bulk. By this method homogeneous ZnO/PMMA nanocomposites were prepared without additional surface functionalization of ZnO or addition of any other additives.

PMMA with very low concentration of nano-ZnO (0.1 wt. %) absorbs above 98% of UV light. Nano-ZnO also enhances the thermal stability of ZnO/PMMA for over 20 °C at concentrations of 1 wt. % ZnO and above, which was ascribed to the changes in termination mechanism of MMA polymerization as shown by NMR and TGA. The increase in molecular weight with increasing concentration of nano-ZnO complements the NMR and TGA results. Nano-ZnO also increases the MMA reaction rate and reduces the activation energy. The average particle size is an important parameter for optimizing the UV absorption and thermal stabilization of ZnO/PMMA nanocomposites.

Room temperature photoluminescence spectra of the as-grown and PMMA-embedded ZnO nanoparticles exhibit a bandgap emission at 3.3 eV, a shallow defect emission at ~ 3.1 eV and a broad defect band at ~ 2.4 eV. Relative intensity of the defect vs. bandgap luminescence depends on the solvent used for ZnO preparation as well as the average particle size. PMMA-embedded particles produce a much stronger bandgap emission, whereas the ratio of the 3.1 eV to 2.4 eV remains approximately constant, which is an indication of surface-mediated phenomena in the nanoparticles surrounded by a polymer matrix.

O-65 - Materials & Technologies for manufacturing of fl exible electronic devicesS. Logothetidis1

1Lab for Thin Films - Nanosystems & Nanometrology (LTFN), Physics Department, Aristotle University of Thessaloniki, Thessaloniki, Greece

Nanotechnology is rapidly exploding worldwide and it will revolutionize all aspects of our everyday life, since it will lead to fundamental breakthroughs in the way materials, devices and systems are understood, designed and manufactured. Although during the past four decades, inorganic Si and GaAs semiconductors, SiO2 insulators, and metals as Cu and Al were the backbone of the semiconductor industry, nowadays, the replacement of rigid Si substrates by fl exible polymeric substrates has opened new horizons for the production of novel display, lighting and energy generation systems.

The innovations associated with the development of Flexible Organic Electronics (FEDs) are the use of novel materials, (conductive polymers, polymer nanocomposites, printable metals, organic semiconductors, etc.), the replacement of rigid substrates (as glass), with fl exible polymeric substrates, and the integration of these into large-scale vacuum vapour deposition and roll-to-roll (r2r) production processes. These materials off er several advantages, by being more lightweight, fl exible and more versatile than traditional solar materials, while r2r process enables their large-scale production through a cost-eff ective and environmentally-friendly procedure. Signifi cant eff orts have been recorded in materials and their synthesis methods, targeting to the improvement of their effi ciency, performance, stability and lifetime in order to be implemented in large-scale production processes of FED products, such as fl exible Organic Photovoltaics (OPVs), Organic Light Emitting Diodes (OLEDs) and Organic Thin Film Transistors (OTFTs).

In this work, the latest advances and prospects in the fi elds of materials (organic semiconductors, conductors, electrodes, barrier layers) and technologies (solution- and vacuum- based deposition processes) for the low-cost and large-scale manufacturing of FEDs will be discussed in detail.


81

Parallel Sessions

O-66 - Nanostructured organic semiconductors for opto-electronic applicationsJ. Ulanski1 1Technical University, Lodz, Molecular Physics, Lodz, Poland

Growing interest in organic opto-electronics is stimulated by the premises that organic materials off er low cost, ease processing and unusual properties, like fl exibility, large area and low weight. While these premises are usually fulfi lled in a case of the so called “plastic electronics” based entirely on polymers, the situation is more complex when semiconducting molecular crystals should be used as components of the opto-electronic devices. Fragile and tiny single crystals cannot be used for large scale fabrication of the devices, therefore there is a need for elaboration of eff ective methods of production of thin layers or polymer composites with molecular crystals; one has take into account also that diff erent applications impose diff erent desired morphology of such materials. In this talk unconventional methods of producing nanostructured organic semiconductor layers and nanocomposites with diff erent morphology will be presented. By applying specifi c conditions of in situ crystallization of semiconducting molecular crystals it is possible to produce large area layers with controlled morphology, e.g. showing high anisotropy or high connectivity of interpenetrating networks. Several examples of applications of such materials in electronic devices, like fi eld-eff ect-transistors, will be presented.

O-67 - Interactive coloured interference fi lms made from microfi brillated cellulose applied onto paperH. Granberg1, L. Wagberg1, S. Forsberg1, J. Holmqvist1, U. Niring1

1STFI-Packforsk AB, FMM, Stockholm, Sweden

The newfound capability of creating interactive coloured interference fi lms made of transparent microfi brillated cellulose and mundane polymers such as gelatine and carrageenan was shown previously using a silicon wafer substrate. The possibility to incorporate the interference fi lms on paper surfaces would enable new applications within authentication, sensing, and customer attraction for the paper and packaging industries.

We have created interference fi lms on Tefl on™ and trichloro silane treated silicon substrates. We found that the fi lms comprising diff erent combinations of microfi brillated cellulose, gelatine, carrageenan, polyethyleneimine, and polystyrenesulphonate gave rise to predicted colour changes when they were exposed to moisture. The fi lms can be released from the substrate as free-standing interference fi lms or can be applied directly onto paper substrates. We found that the microfi brillated cellulose stabilises the fi lm along the surface plane enabling colour changes even on such a porous substrate as paper.

In the presentation we will show how the interference fi lms are created by treating a silicon surface with diff erently charged polymers in solutions using the layer-by-layer method, how these interference fi lms are transferred to a paper surface, and how the colour of the fi lms can be predicted by our optical model.


82

Parallel Sessions

Parallel Session E1 - Nanotechnology for energy - Rechargeable batteries; Supercapacitors

KL-22 - Nanocarbons and their composites for supercapacitorsE. Frackowiak1

1Poznan University of Technology, Institute of Chemistry and Technical Electrochemistry, Poznan, Poland

Supercapacitors are high power energy sources which are very attractive devices because of fast energy delivery and long durability. As they are able to release energy within few seconds, supercapacitors are proposed for applications where a peak power is required (hybrid vehicles, lasers, tramways, cranes…).

Carbon materials are most often used as supercapacitor electrodes. New trends in carbon development will be presented to show the possibility of enhancement the supercapacitor performance. Taking into account the formulae of the energy density, E = ½ CU2, and power density, P = U2/4RS, the main eff orts are devoted to increase capacitance C and voltage U, while reducing the equivalent series resistance RS.

In the typical electrical double layer (EDL) capacitors, the charges are stored in the electrode/electrolyte interface. Activated carbons, due to their good electrical conductivity and high specifi c surface area, are extensively used as electrode materials. In aqueous as well as organic medium, narrow micropores less than 1 nm which fi t with the dimensions of ions are highly recommended for an eff ective formation of the EDL. Distortion and/or lack of solvation shell of ions has been suggested. Beside of EDL charging, in some carbon materials, electrons can be involved in pseudo-capacitive phenomena, i.e. in quick faradic reactions during which the charge transferred is proportional to voltage. Pseudocapacitive properties are observed especially for carbons rich with oxygenated or nitrogenated surface groups. Carbons of high volumetric capacity prepared by one-step carbonization without further activation are of great interest. Nitrogen enriched C/C composites have been obtained by one-step pyrolysis of polyacrylonitrile/carbon nanotubes or melamine/carbon nanotubes blends. In this case nitrogen or oxygen presence plays a crucial role for capacitor performance (redox reactions, electronic properties, wettability). Interestingly, an additional pseudo-capacitance is also observed when water is reduced within a nanoporous carbon electrode. Hydrogen is weakly chemisorbed in the nanopores, being oxidized during the anodic sweep. Such nanoporous carbon reversibly sorbed hydrogen is convenient as a material for negative electrode. Combination of two pseudo-capacitive materials in an asymmetric confi guration, e.g., a nanoporous carbon at the negative electrode and suitable material (e.g. oxidized carbon, a-MnO2/carbon composite, conducting polymer/carbon composite) at the positive electrode allow to reach high voltage values in aqueous medium, in turn, high energy and power density of supercapacitor.

O-70 - Potential benefi ts of nanomaterials for Li ion batteriesH. Burlet1

1CEA, Litem, Grenoble, France

Nanomaterials exhibit specifi c properties that could be of great interest in the case of batteries. However the use of nanomaterials is subjected to cost and safety constraints. An overview of the potential benefi t of nanomaterials for advanced Li-ion batteries electrodes (high charge/discharge rates, short path lengths for both electronic and ion transport) as well as their drawbacks (risk of instabilities at the interfaces) will be reviewed, and then results obtained at CEA/Liten on various type of nanostructuration of both positive and negative electrodes will be given.

For high energy batteries, nanocomposites are foreseen for the anode. Indeed silicon is a good candidate to replace the graphite due to its high specifi c capacity. However the insertion/extraction mechanism is accompanied by a high volume change and thus to a risk of cracks and delamination after a few cycles. In order to avoid these issues a nanostructuration based on the use of silicon nanowires may be the solution. However we expect problem on electronic conductivity in case of pure Si electrode. That is why nanocomposites Si-C are preferred to pure nanoSi materials. Nanocomposites Si-C are expected to combine the good resistance to cycles of the graphite with the high specifi c capacity of the silicon. Diff erent techniques may be used ot manufacture these nanocomposites : mechanical alloying on a mixture of powders, deposit of Si layer on graphite nanoparticles or on Carbon nanotubes by Chemcal Vapor Deposition process, spray dryers. For the shell-core C-Si structures, it has been proved that the Si layer must be thin enough to avoid instabilities issues. However, the best results have been obtained with the mechanical alloying process.

For high power batteries, the choice of LiFePO4 for the positive electrode seems promising due to its low cost and good stability ensuring safety. Nanoparticles LiFePO4 have been manufactured using mechanical alloying techniques. During the process a thin layer of carbon is deposited on the LiFePO4 nanoparticles giving rise to a nanocomposite. It is expected that the carbon layer which is a good electronic conductor will facilitate the transport of the electrons. Moreover, the nanosize shortens all the path lengths and thus increases the charge/discharge rate and thus the power.


83

Parallel Sessions

O-71 - Synthesis of carbon nanotube forests on metallic substrates for supercapacitor electrodesH. Althues1, S. Doerfl er1, A. Meyer2, I. Dani1, S. Kaskel1

1Fraunhofer IWS, CVD thin fi lm technology, Dresden, Germany2TU Dresden, Inorganic Chemistry, Dresden, Germany

Vertical aligned carbon nanotube (CNT) fi lms on conducting substrates represent an ideal structure for super capacitor electrodes. The CNT fi lms provide a matrix with a high surface area, a low internal resistance and a directed pore system for fast ion diff usion, all being crucial for high power supercap applications. For the industrialization of such energy storage devices scalable deposition methods for CNT growth on conductive substrates are required.

A wet-chemical deposition process for the catalyst (Fe2O3) and buff er (Al2O3) coating was developed. Homogeneous fi lms of only a few nanometer thicknesses were obtained on metal foils, while the deposition technique is fast and scalable. The actual growth of CNTs was performed by a thermal CVD process at atmospheric pressure and 750 °C in a tube reactor. A small amount of water vapour enhances the catalyst activity during the process. After reaction times between 10-20 min homogenous black coatings were grown.

The carbon nanotube morphology was characterized by scanning electron microscopy and Raman spectroscopy. On stainless steel foil CNTs with vertical orientation and a maximum height of about 20 μm were obtained. Carbon nanotube forests up to 110 μm were synthesized on nickel foil. Nickel is known to be a catalyst for the CNT growth explaining the enhanced growth rate as compared to steel. Raman spectra of CNTs grown on stainless steel and nickel foil show radial breathing modes (120-250 cm-1) indicating the presence of single and double walled nanotubes in addition to multi walled CNTs.

The deposition of vertical aligned CNTs on conducting substrates is the fi rst step in the direction of CNT based nanoporous electrodes for next generation supercapacitors.

O-73 - Aligned carbon nanotubes array in conductive polymer composite, a design for new energy and energy storageE. Vanhaecke1, F. Huang1, D. Chen1

1Norvegian University of Technology and Science, Chemical Engineering Department, Trondheim, Norway

Nanostructured materials are becoming increasingly important for electrochemical energy storage and conversion (lithium-based batteries, supercapacitors and fuel cells). Recently a range of novel nanostructured catalytic materials were developped, which are now beginning to be investigated for applications in the area of energy conversion and storage such as hierarchically organized carbon nanotubes and nanofi bers were prepared by CVD methods but also thin CNT fi lms coated with conductive polymers are synthesized as supercapacitors and polymer solar cells.

Our work deals with the optimization of the catalytic CVD methods to synthesize aligned CNT as well as CNT/CNF layers on diff erent conductive substrates such as Titanium, Stainless Steel or Graphite foils. The substrate is selected based on diff erent applications. Fe catalyst is introduced by in-situ CVD with organic metal compounds and deposited on the foil. Operation conditions including temperature, carbon sources, carbon to hydrogen ratio and growth time, are studied to tune the CNT layer properties on each substrate. On the second hand the work focuses on the examination of the in-situ polymerization of diff erent conducting polymers on carbon nanostructures and the determination of the properties, such as electrochemical behaviour or thermal stability. Series of composites have been chemically made in-situ, including polyaniline synthesized on both CNTs powder (non-aligned) and CNTs supported on foils (aligned). The experiment conditions such as temperature, reaction time, monomer concentration were tested. Their infl uence on the composition of the composite and fi nally on the performance of the composite is one major concern of this project. A large improvement of the capacitance of the composite compared with CNT on foil, typically called carbon electrode, is seen from cyclic voltammetry.


84

Parallel Sessions

Parallel Session E2 - Nanotechnology for Health and Environment - Nanomedicine - diagnostics

KL-23 - Nanomedicine: breakthroughs in healthcare, enabled by nanotechnologyJ.W. Hofstraat1

1Philips Research, Healthcare Strategic Partnerships, Eindhoven, The Netherlands

Recent developments in genomics and proteomics have led to a revolutionary increase in the knowledge of the molecular origins of health and disease. These developments provide the basis for personalized, molecular, medicine, a novel approach to healthcare, enabling the tailoring of therapeutic approaches to a particular patient. In future also an individual’s predisposition to particular diseases or medical problems may be determined, so that people at risk can be monitored more closely, and diagnosis can be invoked at a much earlier stage and hence treated more eff ectively. Nanomedicine therefore has the potential to improve the quality and eff ectiveness of healthcare signifi cantly.

To implement this new approach to cure, care and prevention, availability of technologies, which provide access to the relevant molecular information, is key. Since diseases typically originate at the molecular and cellular level, at the length scale of 1-100 nm, nanotechnology precisely addresses the ‘holy grail’ of molecular medicine. At the nanoscale, manmade structures match typical sizes of natural functional units in living organisms, facilitating their interaction with the biology of these organisms, enabling novel opportunities for (targeted) therapy and diagnosis. Furthermore, nanometer-sized materials and devices often show novel properties, e.g. as a result of quantum size eff ects, which may lead to unexpected applications. Finally, nanotechnology enables the miniaturization of many current devices, resulting in increased sensitivity, faster operation, the integration of several functions, and the potential for high-throughput approaches, enabling operation at decentralized locations. The integration of devices and structures built with nanosized building blocks in microsystems facilitates the interaction with the macroscopic world. The resulting products, which take advantage from both nanotechnology and microsystems technology, hold the promise to provide breakthroughs in healthcare, leading to paradigm shifts in clinical approaches within the areas of preventive medicine, diagnosis, therapy and follow-up - this is the area covered by Nanomedicine, breakthroughs in healthcare, enabled by nanotechnology.

An integrated approach that mobilizes a large number of disciplines is required to turn the vision of Nanomedicine into reality. Crucial is the active engagement of clinical researchers and healthcare professionals to ensure that meaningful solutions for relevant unmet needs are generated, and demonstrated up to the proof-of-concept level. Open innovation, public-private partnerships and collaborations between companies with complementary business scope provide the means to make the vision come true.

References• J.W. Hofstraat, Molecular Medicine: A Revolution in Healthcare, in G. Spekowius and T. Wendler (Eds.), Advances in Healthcare Technology, Springer

Verlag, 2006, Chapter 15, pp. 235-246.• Nanomedicine - Nanotechnology for Health, Strategic Research Agenda for Nanomedicine, ETP Nanomedicine,2006

(available at http://cordis.europa.eu/nanotechnology/nanomedicine.htm).

O-74 - Surface plasmon resonance biosensors - a tool for medical research and diagnosticsJ. Homola1

1Institute of Photonics and Electronics, Department of Optical Sensors, Prague, Czech Republic

Diff usion of inorganic and biological worlds represents an important paradigm of modern science and technology [1]. Biophotonics stands out as emerging fi eld of research at the crossroad of physical, chemical and life sciences and is widely regarded as the key science upon which the next generation of clinical tools and biomedical research instruments will be based. The last two decades have witnessed an increasing eff ort devoted to research and development of photonic biosensors. These devices hold vast potential for applications in areas such as genomics, proteomics, medical diagnostics, environmental monitoring, food analysis, agriculture, and security. Photonic affi nity biosensors are devices that incorporate a biological recognition element which specifi cally recognizes a particular analyte and an optical transduction system which allows observation and quantifi cation of the interaction between the analyte and the biomolecular recognition element. In the last decade we have witnessed development of numerous optical transduction methods, including both label-based methods such as fl uorescence spectroscopy and label-free methods such as optical interferometry, spectroscopy of guided modes of optical waveguides, and surface plasmon resonance.

Label-free optical biosensors are a unique technology that enables real-time direct observation of molecular interaction and the rapid and sensitive detection of a wide variety of chemical and biological species. Optical biosensors based on surface plasmon resonance (SPR) represent the most advanced and mature optical label-free biosensor technology. This paper reviews the present state of the art and recent advances in the development of SPR sensors [1-2] and presents selected results of SPR sensor research at the Institute of Photonics and Electronics, Prague. Instrumental developments discussed in detail include high-performance SPR sensors for detection of low levels of molecular analytes, miniature fi ber optic SPR sensors for potential in vivo applications, and multi-channel SPR sensors for high-throughput screening applications. Methods for immobilization of biorecognition elements (e.g. antibodies, oligonucleotides) on the SPR sensor are reviewed. Examples of applications of SPR biosensors for analytes related to medical diagnostics are also given. They include SPR biosensors for detection of oligonucleotides, hormones (human chorionic gonadotropin), antibodies (antibody against Epstein-Barr virus) and biomarkers.

References[1] J. Homola, Surface Plasmon Resonance Based Sensors, Springer, 2006.[2] J. Homola, Chemical Reviews 2008, 108, 462-493.


85

Parallel Sessions

O-75 - Advanced lab-on-a-chip nanobiosensors tools for early diagnostics in nanomedicineL.M. Lechuga1

1Research Center on Nanoscience and Nanotechnology, Nanobiosensors and Molecular Nanobiophysics Group, Barcelona, Spain

Clinical analyses are tending to leave laboratories to approach the patient in point-of-care (POC) settings because nowadays most of the tests for diseases detection are based on time-consuming, expensive and sophisticated techniques which can only be utilised by specialised technicians in laboratory environments. Usually those tests require sampling and labelling with fl uorescent or radioactive labels. There is an urgent necessity to develop devices based on nanotechnology concepts which can allow the identifi cation of any disease at the earliest stage possible (ideally at the level of a single molecule) in a fast, simple and cost-eff ective way.

Nanobiosensors are ideal tools for these applications due to its portability, cost eff ectiveness and simple operation. Integration of the biosensors in lab-on-a-chip platforms can off er early diagnostic tools of better sensitivity, specifi city and reliability which could improve the eff ectiveness of in vivo and in-vitro diagnostics. This kind of POC devices has a promising application fi eld in the detection of biomarkers as proteins or DNA sequences for screening, diagnostic and monitoring turning into a valuable support in early disease diagnostic and treatment. The requirements match with a nanobiosensor POC device easy to use, fast, which will take measurements in real-time with very low volumes (nl) of samples and reagents and which will allow the identifi cation and quantifi cation of biomarkers (at femtomolar level) without using labels. In the future, they could even be working inside the human body to detect, at the very early stages, the presence of cancer cells or infectious agents.

Nanobiosensor devices based on MEMS technologies could provide a technological solution for achieving label-free devices which could be operated stand-alone outside a laboratory environment and which could fulfi l the requirements for a truly POC device. The (BIO)MEMS fabrication approach allows the fl exible development of miniaturized compact sensing devices, microfl uidics delivery systems and the possibility of fabricating multiple sensors on one chip, opening the way for high-throughput screening. Additional advantages are the robustness, reliability, potential for mass production with consequent reduction of production costs, low energy consumption and simplicity in the alignment of the individual elements. For that reason, our work is focus in photonic and nanomechanical biosensor devices fabricated with MEMS technology. Examples of fabrication, characterization and real applications of the devices will be discussed as well as the way toward their integration in ‘‘lab-on-a-chip’’ microsystems for nanodiagnotics (even in-vivo) applications.

O-76 - Sensing Biosystems and their Dynamics in Fluids with Organic TransistorsE. Bystrenova1, P. Stoliar1, F. Valle1, B. Chelli1, P. Greco1, A. Lazar1, F. Biscarini1

1CNR-Istituto per lo Studio dei Materiali Nanostrutturati, Via P. Gobetti 101, I-40129 Bologna, Italy

The detection of biological and chemical species is central to many areas of health care and the life sciences, ranging from uncovering and diagnosing disease, to the discovery and screening of new drug molecules. Neuroscience, especially diagnostics and therapies of neurological diseases, demands for development of new devices with a highly sensitive mechanism of transduction of the biological and chemical signals.

Devices based on organic semiconductors emerge as a powerful and versatile class of ultra-sensitive electrical transducers for direct and dynamic detection of biological species. In fact, they can be fabricated and easily integrated with micro- and nanofl uidics devices by the use of sustainable nanofabrication techniques, downscaled and endowed with specifi c recognition functionality by design and tailoring of the materials.

Our vision is a hybrid bio-organic technology for transduction of dynamical phenomena of biosystems in-vitro. The developed device is based on organic ultra thin fi lm transistors integrated with microfl uidics. It responds subtle changes of the electrostatic charge at the interface between the biosystem in the solution and the organic semiconductor. These changes are due, for instance, to the fl ow of ions, the adsorption and diff usion of charged or polarisable molecules, the motion of large biomolecules, and the activity of cells grown on the organic semiconductor.

Preliminary results of the transduction of the dynamical behavior of peptides involved in neurological functions and neurons and glia cells will be shown. The signal is correlated with dynamical data from fl uorescence and scanning probe microscopy and structural techniques at the micro- and nano-scales. The incorporation of neural cells into this technology aimed to achieve breakthroughs with respect to the state-of-the-art. This approach integrates nanoscience, nanofabrication, organic electronics, biotechnology and neuroscience and addresses the implications on social and cognitive sciences in the long term towards converging technologies.

Acknowledgements:

This work is supported by Project EU-NMP-STRP 032652 BIODOT.


86

Parallel Sessions

O-77 - Development of an integrated EWOD based POC system for genetic analysis D. Brennan1, D. Jary2, M. Macek3, L. Clarke4, P.J. Freitas5, A. Kurg6, M.G. Dobson7, D.E. Barton7, P. Galvin1

1Tyndall National Institute, LSI, Cork, Ireland2CEA-Leti, DTBS/SBSC/LFCM, Grenoble, France3UCPRA, 2SM.CFC, Prague, Czech Republic4FFCUL, Centre for human molecular genetics, Lisboa, Portugal5INESC, MN, Lisboa, Portugal6ASPER, Biotech, Tartu, Estonia7UCD, National Centre for Genetics, Dublin, Ireland

Cystic Fibrosis (CF) which is a disease associated with mutations in the CFTR gene, is symptomatic in one in every 3000 newborn Caucasians. While more than 1000 CFTR mutations have been identifi ed to date, only a small subset of these are known to result in CF symptoms (and only where an individual has mutations on both copies of the CFTR gene, resulting in defective CFTR proteins). Genetic screening can be used for early diagnosis of the disease where symptoms have not yet appeared, or for carriers screening. Currently, CFTR testing is carried out at dedicated clinical laboratories with specialist personnel, a costly and time consuming process. However with emerging technologies rapid, portable, low cost systems suitable for non-specialist medical facilities are exploiting nanotechnologies for sample handling, molecular biology protocols and detection. The SNIP2Chip project brought together various technologies advancing development towards a fully integrated “sample to answer” CF mutation diagnosis system.

The objective of the project was to develop a system implementing protocols for cell lysis, PCR amplifi cation, purifi cation and detection on a number of CFTR mutations. We use Electro-Wetting on Dielectric (EWOD) technology to implement sample manipulation, dispensing, moving and mixing nanolitre droplets to implement protocols for multiplex hybridisation detection using magnetic spin-valve sensor arrays or fl uorescence microarrays.

The key milestones have were to adapt protocols to nanolitre systems compatible with a component integration strategy, maintaining chemistry and device performance and functionality. We extracted viable genomic DNA from whole blood (0.25μl) by cell lysis in the EWOD device using magnetic beads as platforms to capture, hold and release DNA during wash and elution steps. The EWOD also implemented a two temperature 30-cycle PCR amplifi cation process, and delivered the PCR product to the detection module via a microfl uidic interconnect.

Key results have demonstrated successful DNA extraction and PCR amplifi cation of genomic DNA characterised by real time PCR. An APEX protocol has been successfully implemented on our EWOD chip, with subsequent fl uorescence SNP detection demonstrated on an integrated waveguide /microfl uidic module using a modifi ed commercial microarray scanner. The magnetic sensor array has achieved sensitivities comparable with other electrical or optical hybridisation detection techniques.

Physical component integration was achieved by inserting components (EWOD, magnetic sensor array, waveguide) into an injection moulded carrier substrate with a microfl uidic “lid” (injection molded) to seal the system. Our modular approach facilitates the integration of devices fabricated from diff erent materials and processes, is a technique gaining popularity in “sample to answer” based Lab-on-Chip systems.

In conclusion, the outputs of the SNIP2Chip project provide the basis for a fully integrated system for genetic testing for multiple mutations in parallel, by exploiting nanotechnologies for sample preparation, manipulation and detection.


87

Parallel Sessions

Parallel Session E3 - Horizontal activities - Standardization

KL-24 - Adding value to nanotechnology Framework Projects through standardizationP. Hatto1

1IonBond Ltd, Chairman ISO/TC 229 and CEN/TC 352 nanotechnologies standardization committees, United Kingdom

International, European and national documentary standards provide agreed ways of naming, describing and specifying things, measuring and testing things, and managing and reporting things. In industry, commerce and other areas of human activity, standards support interoperability and compatibility, quality, optimization, and test and measurement methods for quantifying and evaluating product attributes such as materials, processes and functions. Together these elements help to ensure the effi cient and reliable delivery of customer focused products and services.

Standards are not part of the regulatory framework although they can and do support regulation. They derive their legitimacy from the voluntary, consensus based approach used for their development and application. Standards are used because they provide a validated and reliable basis for best practice, not because their use is mandatory. Industry and commerce as we know them could not possibly operate without standards, and whilst standards are by no means essential for life, they are absolutely essential for modern living.

Standards are one of the most important tools used to take research outputs to the market place. They help transfer research fi ndings into guidance documents and provide the bridge that connects research to industry. This connectivity is critical to successful commercialisation. Whilst it might appear that standardization will inhibit innovation, the existence of relevant standards frees innovators to concentrate on the essential essence of their innovation, rather than being diverted by issues that are not core to their new product or service. Thus the development of anticipatory standards in new and emerging areas of technology provides a foundation for innovation, not a barrier to it. For new areas of technology, early participation in the standards-making process allows countries and organisations to help create and shape markets, providing an early mover advantage for those involved.

Following an overview of standards and standardization, the presentation will review how standardization can add value to nanotechnology RTD projects, both generically, by the provision of a standards infrastructure covering: terminology and defi nitions; measurement and characterization methods and procedures; environmental, health and safety practices and protocols; and materials specifi cations; and specifi cally by disseminating research results to industry in a readily accessible format, leading to enhanced implementation of the outputs of European funded research projects.

O-78 - Measurement and standardization priorities for nanotechnologiesM. Solar1, J.M. Aublant2, I. Weir3, K. Hossain4, N. Siegel5

1Czech Technical University in Prague, Faculty of Mechanical Engineering, Prague 6, Czech Republic2LNE Paris, Scientifi c and Research Division, Paris, France3Optimat Ltd., Scottish Enterprise Technology Park, East Kilbride, United Kingdom4National Physics Laboratory, Science and Innovation, London, United Kingdom5DIN Deutsches Institut für Normung e.V., Referat Entwicklungsbegleitende Normung, Berlin, Germany

Backgroud Nanostrand, the European nanometrology and standards foresighting project, aimed to identify the new measurement tools, technologies and standards required to support nanotechnology development and exploitation. Nanostrand was supported by the European Commission 6th Framework Programme - Contract: NMP4-CT2006-033167.

Objectives • Leading international metrology and standards organisations, LNE, NPL and DIN together with Optimat and the Czech Technical University in

Prague have jointly carried out this project to identify • Barriers to the development and exploitation of nanotechnology • Needs for new measurement tools, technologies and standards that will support nanotechnology development and exploitation • Priorities for nanometrology developments • Priorities for pre-normative / standards research

Results Nanostrand’s main deliverables were two roadmaps - one defi ning nanometrology research priorities and one focusing on nanotechnology standardisation priorities. These roadmaps make a major contribution in defi ning the way forward for nanometrology and standards development in Europe.


88

Parallel Sessions

O-79 - Frictions at the interface between research and standardisation in nanotechnologyS. Gauch1, K. Blind1

1Berlin University of Technology, Faculty Economics and Management, Berlin, Germany

Nanoscience and nanotechnology are science fi elds which are growing extremely dynamically. Market success of nanotechnology applications depends very much on the development of corresponding standards, which clarify not only terminology, measurement and testing methods, but also regulate safety and health aspects and specify interfaces. Other countries, respectively European and international standardisation organisations have launched fi rst initiatives.

Germany was not able to translate its excellent starting position in nanotechnology research into a leading position in standardisation initiatives. Based on the statistical analysis of a quantitative survey among stakeholders of German nanotechnology research, we are able to defi ne the major problems at the interface between research and standardisation, but also possible options for their solution. In order to structure the need for standardisation in nanotechnology systematically, we follow a typology which characterises the standards according to their economic functions (Tassey 2000) using the following categories: measurement and testing standards (incl. terminology), quality and safety standards and compatibility and interface standards. The science indicator of scientifi c publications and the innovation indicator of patent applications prove that the not inconsiderable state funds which are being invested in researching nanoscale phenomena in Europe, especially Germany, have helped Germany to achieve a top-class position within nanotechnology research worldwide. The analysis of the future need for standards in nanotechnology using the typology demonstrates certain priorities time-wise. First, there is the necessity to standardise the new terms emerging in nanotechnology. This would result in effi ciency gains in communication and cooperation in the research fi eld and in commercial applications of nanotechnology. Agreements on measurement and testing methods in the nanoscale world are a further precondition for scientifi c further developments in the nanosciences, but also for the commercial application of nanotechnology. As social acceptance for products based on nanomaterials is a prerequisite for commercial success risks for health and the environment have to be identifi ed and corresponding precautions to protect them taken. State regulations will be unavoidable in this matter which can be complemented by the development of quality and safety standards. In the sense of self-regulation, standards can also relieve the burden of the state in the regulation of fi elds which are aff ected by nanotechnology. For the fast diff usion of whole systems which are composed of single components made of nanomaterials, compatibility and interface standards will be required in a later phase of the technology cycle. The overview of current standardisation activities in nanotechnology shows that not only in the United States, but also at the European level fi rst initiatives have been launched.

O-92 - Towards an increased contribution from standardisation to innovation in EuropeG. Katalagarianakis1

1European Commission, Directorate-General for Research, Industrial Technologies, Nano- and converging Sciences and Technologies, Brussels, Belgium

Nanoscience and Nanotechnology are research domains which show extreme dynamism worldwide. Europe occupies a strong position due to the support that this domain receives form research funds of the European Union and of the Member States. Transfer and implementation of this new knowledge from the laboratory to a wide spectrum of industrial sectors is expected to be equally dynamic. European and International organisations have launched initiatives for development of standards necessary for market success. Due to the fast moving research situation the interface between research and standardisation has to be strengthened. Integration of eff orts between EU and national projects, integration of research infrastructure, building of knowledge networks for communication and synergy will allow addressing the problems at the interfaces between research, standardisation and innovation. Success on this level will yield signifi cant benefi ts both for the research process and the technology life-cycle.


89

Parallel Sessions

O-80 - Photocatalytic applications, standardization and testing methods F. Peterka1, J. Jirkovsky1, P. Stahel1, Z. Navratil1 1Research Centre for Nanosurfaces Engineering - NANOPIN, Praha, Czech Republic

Experience with several applications projects in Europe utilizing photocatalytic nanosurfaces are leading to conclusion that successful industrial commercialization of photocatalytic systems is strongly dependent on the development of testing methods accepted as ISO or CEN standards to ensure the advertised function and thus worldwide acceptance. This is also one of the main objective of the European COST 540 project “Photocatalytic technologies and novel nanosurfaces materials critical issues”, which is understand as European platform to group the existing European teams focusing on the development of photocatalytic nanomaterials and standard photoactivity testing methods. In the present talk a brief overview of state of art of applications and testing methods in the fi eld of photocatalysis performed in the frame of COST540 and worlwide will be given.

1. IntroductionThe development of nanocrystalline photocatalytic materials is still rapidly growing fi eld of science and technology. The commercial potential for such materials are massive as e.g. building and architectural application (environmental as light-easy cleaning exterior facade paints, mortars, glass window, even indoor treatment). Among the various nanocrystalline photocatalytic materials that have been studied over the past 30 years research has mainly focussed on titanium dioxide because of its stability, commercial availability and ecological safety. Numerous papers have been published on the fundamentals of pure titania systems, and the mechanisms of oxidation and superhydrophilicity have been investigated in detail. Safety of nanotitania form become fashionable, but very important topic nowadays, which can not be underestimated since its wrong interpretation may strongly infl uence commercial applications.

2. Photocatalytic application dreams or reality Despite of enormous application possibilities of photoactive nanostructured materials, most of technical and applied-research aspects are still waiting for being approached and clarifi ed. Among others, standard testing methods for the characterization of photocatalytic and hydrophilic properties of nanostructured materials were completely missing, when application fi eld started. Without proper evaluation many of applications are rather doubtful. As a result working group for test methods for photocatalytic materials within ISO technical committee 206 was established (ISO/TC206). The methods proposed by the ISO TC206 are evaluating properties of photocatalytic materials for diff erent application such as:• test method for air purifi cation performance as NOx (other VOC gases will follow) • test method for antibacterial activity • test method for self-cleaning performance• test method for water purifi cation performance • light sources

These methods do not completely cover fi eld of testing of photocatalytic technologies, but these activities are considered as extremely important for commercial application fi eld.

3. European photocatalytic project cost 540 European project COST540 “Photocatalytic technologies and novel nanosurfaces materials - critical issues“ may be understood as joint activity of all European countries (incl. Czech Republic) to overcome of some of the most critical issues of photocatalysis. Proving the function of photocatalytic products and technologies by standard testing is one of the most crucial issues. COST 540 signifi cantly contributed to establishing of European CEN standard TC 386 for photocatalysis in December 2008. In the frame of the Action international conference is organized in the Conference centre in Chateau Liblice, Czech Republic on 25-26 May, 2009, which will focus on the state of art of applications and testing methods in the fi eld of photocatalysis. Exhibitions and demonstrations of existing ISO and CEN methods and devices will be provided during the meeting. The CEN TC386 meeting in Prague organized by COST540 will follow on 27-28 May 2009 in the building of the Czech Offi ce for Standards, Metrology and Testing (UNMZ).

4. Example of proposed iso standard for self cleaningFor evaluation of construction materials for building sector ISO test methods for self cleaning seem to be the most important. Czech Republic and namely Czech National Centre for Nanosurfaces Engineering (NANOPIN, www.nanopin.cz) is considered as one of European groups pioneering application fi eld in Europe. Czech Normalization Institute joined ISO/TC206 and CEN/TC386. NANOPIN in cooperation with Masaryk University Brno, developed according to the ISO standard ISO TC 206/SC simple device for evaluation of self-cleaning performance of photocatalytic materials (SEE System, www.advex-instruments.cz) as well proposed some modifi cation for nonporous and porous photocatalytic surfaces. The method for self cleaning performance of non porous surface is based on combination of both eff ect of photocatalytic surface, which is redox reaction and hydrophylicity. When oleic acid, as organic material deposited on tested photocatalytic material is decomposed, surface is becoming hydrophilic. Based on the above-mentioned principle, the low-cost measuring instrument has been adapted and is commercial available. The device enables to measure the contact angle of liquid drops on solid surfaces and to calculate surface energy of the solids based on commonly used models.


90

Parallel Sessions

Parallel Session E4 - Horizontal activities - ELSA

KL-25 - Nano-ethics beyond risk-assessmentG. Hermerén1

1Lund University, Sweden/EGE, Brussels

Integration of ethics and science is essential, and I will describe an approach to ethical problems in this area what facilitates such an integration, using the following headings: (1) Description of the present situation (2) Identifi cation of problems and concerns(3) Analysis of positive and negative goals(4) Identifi cation of key factors: obstacles and opportunities(5) Comparison between diff erent strategies of dealing with the obstacles and opportunitiesExamples are provided which illustrate the ethical issues raised on these diff erent levels.

Safety issues and safety studies are obviously important to consumers and patients - and hence to regulatory authorities: but it is essential to avoid a black and white picture here. The approach chosen will also underline that an ethical analysis of any emerging technology needs to go beyond risk assessment. In fact, excessive focus on risk assessment can be a way of preventing other ethical issues from getting the attention they deserve. These issues range from anthropological issues to global justice:

Anthropological issuesWhat is the potential impact of applications of nanoscale research and nanomedicine on our understanding of ourselves and the man-machine distinction? Which changes of this understanding are ethically justifi able?

Dual usesThere are several possibilities of dual use of these technologies: for off ensive and defensive military purposes, for medical purposes and for surveillance, as well as for bio-terrorism. How should such dual uses of nanotechnologies be handled?

Public participation and democracyIn what way should people participate in the debate on priority setting and funding of research promoting new emerging technologies? What are the ethically acceptable conditions for public participation in the debate on the uses of emerging new technologies? What, if anything, can we learn from the GMO debate and consumer resistance?

Social changes and global justiceHow will social structures be aff ected by diff erent applications of nanoscale research? Will there be a nano-divide in the sense that the new technology is likely to increase the gap between the developed and the developing countries? Whose values and whose future we are prepared to take into account, and why?

In dealing with these issues, the underlying values have to be made explicit and their ranking order clarifi ed. Tensions between diff erent values have to be made explicit. All values could be perfectly legitimate, but some could be more important than others. In the end, a holistic picture is necessary where sets of diff erent values and ranking orders are balanced with an eye to the future. We have to ask: “what kind of society do we want for our children and grandchildren, and for their children and grandchildren?” In doing this, we have to distinguish as clearly as possible between the present situation, near future scenarios, and more distant ones, since the ethical problems are not likely to be the same.


91

Parallel Sessions

KL-26 - Ethical, legal, social and economic aspects of nanomedicineK.M. Weltring1

1Gesellschaft für Bioanalytik Münster e.V., Münster, Germany

Although very promising, nanomedicine may add new dimensions to many ethical, legal, social and economic issues. For the promises to be realised to achieve the maximum benefi t of nanomedical innovations for everyone the way has to be paved for a safe, integrated and responsible approach to nanomedicine. This will also be a necessary condition for the sustainable competitiveness of nanomedical research and development in Europe, and for its healthcare industry. It is therefore of primary importance to understand its possible impacts and consequences in advance and to provide for all stakeholders a clear vision of the development of nanomedicine in all its facets to ensure a sustainable development and exploitation of this important scientifi c and economic area.

The presentation will summarise results of several EC projects including the ELSA Board of Nano2Life, the Nanomed Round Table and the NanoBio RAISE projects.

O-81 - The Evolving Global Framework for Nanotechnology: 10 Key Legal, Policy and Regulatory DriversR. Johnson1

1Arnold & Porter LLP, N/A, Washington DC, USA

Nanotechnology, as a set of general purpose technologies with broad applications across multiple fi elds and sectors, represents a key platform that increasingly is global in scope and capacity. More than 35 countries now have national nanotechnology strategies and initiatives. International organizations such as the OECD have become global hubs for nanotechnology policy and ELSA-related issues. Scientifi c and technological capacity and major ELSA activities exist not only in Europe but also in the United States and Canada, in a number of Asian countries and in a growing number of transition economies such as India, Brazil, Israel and South Africa.

The achievement of Europe’s goals for realizing the promise of nanotechnology to enable a sustainable economy, therefore, requires a deep and broad understanding about emerging global framework trends and developments for nanotechnology outside the European Union. The global ELSA context directly aff ects the future directions of European nanotechnology. These trends also off er a range of challenges and opportunities for Europe to shape the global legal and policy framework for nanotechnology R&D, commercialization and multi-stakeholder public engagement.

This horizontal presentation briefl y will review the development of key ELSA issues beyond the European Union. In particular, it will highlight 10 key legal, policy and regulatory drivers shaping the global framework for nanotechnology. They include: (1) risk governance and regulatory compatibility; (2) the science-innovation interface; (3) intellectual property rights; (4) liability and stewardship; (5) public outreach and engagement strategies; (6) standards; (7) capital formation and investments; (8) S&T policy for nanotechnology; (9) national security; and (10) human capital.

O-82 - Nanotechnology governance and ELSA studies in MexicoG.C. Delgado1

1CEIICH, UNAM., Torre II de Humanidades 4to piso, Ciudad Universitaria, Mexico

There is an increasing excitement for the development of nanoscience and nanotechnology in Mexico. Several actions have been taken lately and some further steps are being planned for the coming years. In this context, it is of interest to present the nanoscience and nanotechnology state of the art and the current nanotechnology governance in Mexico. This is achieved by identifying the main stakeholders, their characteristics, role, limitations and potentialities.Thus, a comprehensive review of research centres; governmental programs and projects; enterprises interested in commercializing nanotechnology in Mexico; public and offi cial perceptions and misconceptions of nanotechnology?s potentialities and risks; among other aspects, are to be presented. Such a panoramic assessment of Mexico’s nanotechnology governance concludes with a prospective of the country’s current and normative ”best“ scenario(s) regarding economical, ethical, societal and environmental nanotechnology regulation.


92

Parallel Sessions

Parallel Session E5 - Horizontal activities - From national initiatives to integrating activities - Roadmap to paneuropean funding

O-83 - MNT-ERA.NET: Micro and Nano Technologies for a highly competitive European industryR. Brandenburg1

1FFG, Austrian Research Promotion Agency, Vienna, Austria

BackgroundMNT-ERA.NET is a large network of 22 funding organisations from 21 European countries and regions which cares for the growing international dimension of industrial research.

It reduces the fragmentation of European funding for micro- and nanotechnologies (MNT), makes regional and national funding programmes accessible to transnational consortia and opens transnational calls for applied R&D projects.

ObjectivesMNT-ERA.NET will establish a framework for a long-term coordination between a large number of national and regional funding programmes. It will improve the cooperation between national and regional funding programmes, research organisations and industry partners to secure a durable network of European key actors in micro and nano technologies.

MNT-ERA.NET will support the convergence of funding programmes, the streamlining of procedures, the elimination of wasteful cross-European programme duplication and the most effi cient use of programme resources.

MNT-ERA.NET will aim at the best possible integration of regional and national MNT strategies with European needs and visions, ensuring complementarities with other funding instruments. The value of funding programmes for end-users will increase as a result of a close interaction with industry networks, exploiting strategy papers and roadmaps published by European Technology Platforms.

MNT-ERA.NET will launch annual joint calls for collaborative projects, refl ecting the needs and challenges identifi ed by the European R&D community, thus opening an attractive instrument for transnational R&D that is complementing the portfolio of European funding initiatives.

45 transnational projects have already been funded in pilot calls since 2006, indicating that call features are especially attracting newcomers and SMEs because of the transparent procedures and low administrative eff orts required.

Funded projects are expected to be less complex than projects funded under FP7 and will be comparatively close to the market. Thus, they will close a gap between purely national or regional projects and comparatively larger European projects.

Finally, the broad range of MNT-ERA.NET activities will strengthen European research and development in micro and nano technologies. MNT-ERA.NET will support the broad implementation of excellence and decisive knowledge for high added-value products, processes and applications and provide strategic and practical contributions to enhancing the competitiveness of the European industry.

ContactMNT-ERA.NET Coordinator: Dr. Roland BrandenburgFFG - Austrian Research Promotion Agency [email protected]


93

Parallel Sessions

O-84 - The Netherlands and nanotechnology: NanoNed & the Netherlands Nano InitiativeL. Gielgens1

1NanoNed, Program Offi ce, Utrecht, The Netherlands

In the Netherlands actors of industry, knowledge institutes, academia, and also research organisations, non-governmental organisations and government are involved in nanotechnology. The lecture will focus on activities and results of the research program NanoNed and the future plans of the Netherlands Nano Initiative, both activities where all mentioned actors play a role.

NanoNed is the nanotechnology research program of the Netherlands. It clusters the nanotechnology strengths of the Dutch industrial and scientifi c nanotechnology knowledge infrastructure in a national network and enables a knowledge leap through strong research projects, an infrastructure investment program and economically relevant dissemination of the knowledge and expertise, resulting in high added value economic growth.

The objective of NanoNed is to generate a strategic impulse for the Dutch scientifi c and industrial knowledge position in nanotechnology. This impulse is given through a broad, national nanotechnology program formulated by researchers and industry with economically, socially and scientifi cally relevant research and infrastructure projects, selected in co-operation with industrial partners. NanoNed will ensure the realization of the future potential of nanotechnology as a source of economic growth in a highly productive, sustainable, knowledge driven economy. Furthermore, NanoNed aims to strengthen the Dutch nanotechnology position in an international environment of major initiatives and investments in nanotechnology. The education of a highly skilled nanotechnology researchers with knowledge of and feeling for business for the high-tech industry and the stimulation of entrepreneurship is a very important goal of NanoNed.

The total budget of the NanoNed, started in 2004 and ending in 2010, is 235 million Euro. The program is organised in eleven research fl agship programs, a shared nanotechnology research NanoLab NL facility with state-of-the-art highly-specialised equipment and a Technology Assessment program. In the latter, social scientists will study the future development of nanotechnology and society, the possible impact of nanotechnology on society and how nanotechnologists can take this into account.

To maintain the strong position of nanotechnology in the Netherlands after NanoNed ends in 2010, the Dutch government asked NanoNed - together with its partners Technology Foundation STW and Foundation FOM - to prepare the Strategic Research Agenda Nanotechnology of the Netherlands Nano Initiative (SRA-NNI). The agenda was presented to the Dutch minister of Economical Aff airs in September 2008.

The agenda focuses on the following subjects important for the Dutch economy and society for the coming decade: four generic theme’s (beyond Moore, Nanomaterials, bio-nano and Nanofabrication); four application area’s (Nanomedicine, Energy, Food and Clean water); and an overall program on Risk & Impact.

O-85 - Facilitating nanotechnology activities in the UKJ. Johnstone1, M. Kemp1, A. Reader1, K. Robson1, M. Fisher2

1Centre for Process Innovation, Nanotechnology KTN, Newcastle Upon Tyne, United Kingdom2BioNanoConsulting Ltd., Nanotechnology KTN, London, United Kingdom

The UK Nanotechnology Knowledge Transfer Network is a UK Government funded network which is helping to facilite and coordinate aspects of nanotechnology development and commercialisation in the UK. It represents a cluster of over 1,000 interested parties including companies, academia, networks and in the UK who are looking to develop, commercialise and adopt nanotechnology into new products and processes. Just over 200 of these are SME’s who are directly involved with developing and supplying specifi c nanotechnologies to the mainstream industrial base. The main specifi c roles of the Nanotechnology KTN are;• To support to the 23 UK MNT Open access Capital Facilities • Brokerage of national and international collaborative research projects • Support to UK Government in policy making • Provision and facilitation of sectorial and technical focus groups • Studies on innovation capability and supply chain activation • Support to standardisation and regulatory discussions • News and updates to the UK community • International brokerage through internal and external missions

The aim of the Nanotechnology is to catalyse introductions, connect supply chains and broker interactions within the UK and also the wider global stage. At this stage of the development cycle, commercialisation of nanotechnology is a crucial goal and the Nanotechnology KTN sees that the main barriers to commercialisation are;• Demonstrating a signifi cant cost/benefi t margin for ingredient suppliers to existing products that are now nano enabled • Ascertaining and obtaining the widespread consumer acceptance for new products • Creation of the consumer need for entirely new marketable products in radically new fi elds.

The main vehicle for brokerage between academic and business interactions are through focus groups and events, these cover areas such as, food, energy, metrology, gas sensing, entrepreneurship, diagnostics and micro systems.

The presentation will outline and summarise the current industrial, academic and policy landscape in the UK and explain how innovation is catalysed. Data on regional strengths will be presented alongside how the markets are being infl uenced by regulation and standards initiatives which the UK leads in some instances.


94

Parallel Sessions

O-86 - Foresight and roadmaps for nanotechnology and nanoindustry in RussiaA. Afanasiev1, Y. Khakhanov1, A. Sokolov2

1Russian Corporation of Nanotechnologies (RUSNANO), Foresight Department, Moscow, Russia2State University Higher School of Economics (HSE), The Institute for Statistical Studies and Economics of Knowledge (ISSEK), Moscow, Russia

RUSNANO is a state corporation established by Russian government in 2007 with the main aim to promote development of nanotechnology applications in Russia via selection and co-fi nancing projects that have high potential for commercial or social benefi t. Average annual investments of RUSNANO in selected projects are expected to be approximately 300 mln. euro as from 2009.

In addition, RUSNANO develops diff erent supporting instruments, incl. foresight and roadmaps aimed at assessment of future trends in nanoindustry and identifi cation of priority areas for future investments.

The foresight study and a system of roadmaps based on its results will contribute to:• planning RUSNANO activities, incl. formulating priorities of projects’ selection and fi nancing;• informing Russian S&T and business society about perspective future trends in nanoindustry;• private investors’ involvement in projects, selected and fi nanced by RUSNANO;• off ering foreign companies to participate and co-invest in RUSNANO projects;• improvement of legal and regulative base.

The foresight program is aimed at identifying promising nano-enabled product. To form these groups of nanotechnology products a Delphi survey will be carried out for over 800 products.

There were developed 6 pilot roadmaps for the promising areas of nanotechnology applications in 2008 (nuclear energy, aircraft industry, space industry, water cleaning and purifi cation, medicine, light emitting diodes).

Three more technology roadmaps are in progress for the following areas: energy effi ciency; catalysts for petrochemical industry; carbon nanotubes.

After fi nishing the foresight program it is planned to create 15 more roadmaps, which would cover the whole range of nanoindustry products.

O-87 - Spanish initiatives to promote translational research on nanomedicineJ. Samitier1

1Spanish Technology Platform on Nanomedicine, CIBER of Bioengineering, biomaterials and nanomedicine Institute for Bioengineering of Catalonia - University of Barcelona, Barcelona, Spain

Spain presents a lag with the European Union in terms of R & D in both total investments relative to GDP and company involvement in the fi nancing of such investment. Spanish companies’ research shortfall suggests that they fail to develop know-how of their own and, moreover, they are failing to take advantage of the technology generated by public research centres. This makes it essential to increase the critical mass and research excellence of our Science and Technology System. To meet these challenges, the Spanish government started in 2005, the INGENIO 2010 program, to maintain and improve existing R & D and Innovation programs and to focus signifi cant resources on new strategic initiatives as:• The CENIT Program (National Strategic Technological Research Consortiums) to stimulate R & D and Innovation collaboration among

companies, universities, public research bodies and centres, scientifi c and technological parks and technological centres. The CENIT program co-fi nance major public-private research activities. These projects will last a minimum of 4 years with a minimum annual budgets of 5 million euros, where i) a minimum of 50% will be funded by the private sector, and ii) at least 50% of the public fi nancing will go to public research centres or technological centres.

• The CONSOLIDER Program to reach critical mass and research excellence. CONSOLIDER Projects off ers long-term (5-6 years), large scale (1-2 million euros) fi nancing for excellent research groups and networks. Research groups may present themselves in all areas of know-how of the National R & D and Innovation Program.

• The CIBER Projects promote high quality research in Biomedicine and Health Sciences in the National Health Care System and the National R & D System, with the development and enhancement of Network Research Structures.

In this framework, the Spanish Technology Platform on NanoMedicine (STPNM) is a joint initiative between Spanish industries and research centres working on nanotechnologies for medical applications. The main objectives are:• Improve the collaboration within the nanomedicine community in Spain avoiding fragmentation and lack of coordination• Promote the participation of Spanish stakeholders in international initiatives, from transnational co-operations to European projects,

especially regarding the European Technology Platform• Establish recommendations concerning strategic research lines in the nanomedicine fi eld • Dissemination of Nanomedicine results to the scientifi c community and society-at-large.


95

Parallel Sessions

Parallel Session E6 - Horizontal activities - Education

KL-27 - Teaching Across Scientifi c and Geographical Boarders: A European Master Programme on Nanoscience and NanotechnologyP. Rudquist1

1Chalmers University of Technology, Department of Microtechnology and Nanoscience (MC2), Göteborg, Sweden

Nanoscale science opens up for a variety of new fascinating future applications in a wide range of fi elds and markets. But the important next step, leading to new and useful nanotechnology products is often still far away. In order to meet the challenge of the coming decades to bringing today´s nanoscience into tomorrow’s nanotechnology, many countries and universities have started undergraduate educational programmes on nanoscience and nanotechnology. But how should these programmes be designed and for whom? What do industry and society need today, and what will we need in fi ve, ten, or twenty years? Moreover, nanoscience challenges the division of natural science into the classical disciplines physics, chemistry, biology, materials science, electronics, and medicine.

The cross-disciplinary nature of the fi eld might therefore also question the traditional structure and curricula of educational programmes when it comes to teaching and education in nanoscience.

Within the frame of Erasmus Mundus[1] four European university partners in four diff erent countries have created a two-year international master programme “Nanoscience and Nanotechnology” (EMM-nano) [2,3], which is now in its fourth year. We would like to discuss some of our experiences from the EMM-nano programme and our visions for future development of nanoscience education, especially regarding the cross-disciplinary nature of the fi eld, and some issues related to the integration of teaching across the borders within Europe.

References:[1] http://ec.europa.eu/education/external-relation-programmes/doc72_en.htm[2] http://www.emm-nano.org[3] A Chesneau, G Groeseneken, P Heremans, D Rep. P Rudquist, P Schwille, B Sluijter, and G Wendin, Journal of Physics: Conference Series 100 (2008)

032002

O-88 - Interdisciplinary nanotechnology education at MESA+ / University of TwenteM.L. Bennink1

1MESA+ Institute for Nanotechnology, University of Twente, Zuidhorst, The Netherlands

MESA+ Institute for Nanotechnology has brought together research and expertise of diff erent research groups in the fi eld of applied physics, electrical engineering and chemical technology, in order to enable excellent ground-breaking research in diff erent areas of nanotechnology such as bionanotechnology, nanofabrication, nanoelectronics, and nanomaterials. TO maintain this high level and to move forward, education in these new areas is key. This has led to a number of initiatives in the fi eld of education, of which the most important one is the 2-year MSc program in Nanotechnology.

The modules in the master program have been set-up according to the existing areas as they were present in the research institutes, forming an excellent preparation but also taking full advantage of the expertise present. Next to these core modulus, the student is off ered lab courses including cleanroom work, a course on developing writing and presentation skills, and non-technical courses on societal implications and technology venturing. The second year consists of an internship and the Master research project.

Next to providing information on our master program I will furthermore discuss other educational activities at MESA+ for both MSc students as well as PhD students and young postdocs, and the lessons we learned in setting up all this.


96

Parallel Sessions

O-89 - European PhD School on “Nanoanalysis using focussed ion and electron beams”M. Gradimir1, S. Siebentritt2, A. Benninghoven3, P. Bertrand4, J. Mayer5, H.N. Migeon6

1Gimmune GmbH, RTD, Zug, Switzerland2Université du Luxembourg, Photovoltaics (LPV), Luxembourg, Luxembourg3ION-TOF GmbH, ION-TOF, Muenster, Germany4Université Catholique de Louvain, Physical Chemistry and Physics of Materials, Louvain-la-Neuve, Belgium5RWTH-Aachen University, Gemeinschaftslabor für Elektronenmikroskopie (GFE), Aachen, Germany6Centre de Recherche Public Gabriel Lippmann, SAM, Luxembourg, Luxembourg

BackgroundEuropean PhD School was created in 2005 and initially sponsored by EU FP6 Nanobeams Network of Excellence. Now, it is fi nancially supported by the University of Luxembourg and CRP-GL.

ObjectivesEuropean PhD School on “Nanoanalysis using fi nely focused ion and electron beams” focuses on three complementary techniques: i) Secondary Ion Mass Spectrometry (SIMS), ii) Transmission Electron Microscopy (TEM) and iii) Auger Electron Spectrometry (AES), with the purpose of forming specialists in the interdisciplinary fi eld of nanoanalysis.

MethodsThe school consists of four teaching weeks and one analysis week each composing one two-year cycle. The fi rst teaching week proposes an overview on SIMS, TEM and AES analytical techniques with an introduction to: i) Ion and electron to matter interactions, ii) Instrumentation and iii) Applications. The three following teaching weeks provide an in-depth understanding to these techniques with the purpose to form specialists in the fi eld. The last analysis week permits attendees to analyze their own samples of interest. Lectures as well as practical sessions are given by leading professors and key researchers in the fi eld. The practical sessions consist of tutorials on state-of the-art instrumentation in small groups. The core group of the European PhD School consists of six members: Prof. H.-N. Migeon, Centre de Recherche Public - Gabriel Lippmann, G.-D. Luxembourg; Prof. S. Siebentritt, Université du Luxembourg, G.-D. Luxembourg; Prof. A. Benninghoven, Westfälische Wilhelms-Universität Münster, Germany; Prof. P. Bertrand, Université Catholique de Louvain, Belgium; Prof. J. Mayer, RWTH-Aachen University, Germany; Prof. G. N. Misevic, Université de Rouen, France and Gimmune GmbH, Switzerland. The core group have prepares the teaching program and is the responsible for the organization and lecturing.

ResultsBetween 2005 and 2008, in the framework of the European PhD School, the teaching cycles 1 and 2 (fi ve weeks each) have been successfully completed and cycle 3 and 4, which will be completed in 2009, have been started. Certifi cates for the successful completion of the courses were provided. The core group has also prepared the teaching program for cycles 5-7 until 2012. The list of proposed lecture courses can be downloaded from https://www.nanobeams.org/phd-school.html.

During the period between 2005 and 2008, over 80 PhD students attended the fi rst two cycles. 120 hours of lectures were given (2 x 60 h), 128 hours practicum and two weeks of analyses.

Conclusion/Application to practice - European PhD School successfully implemented and sustained interdisciplinary education for physicists, chemists and biologists with results of forming specialists in the fi eld of nanoanalysis. Thus, it is continuing to contribute to education in rapidly developing fi eld of nanosciences and to transfer of nanotechnology to industrial applications.


97

Parallel Sessions

O-90 - Facilitating the Russian Universities Nanonetwork entry into the European Research Area in Nanoscience and NanotechnologyA. Ivanov1, V. Luchinin1, M. Morrison2

1St Petersburg Electrotechnical University “LETI”, Nanotech REC, Saint Petersburg, Russia2Institute of Nanotechnology, CEO, Glasgow, United Kingdom

In 2007 the Russian Government adopted the Federal Targeted Program “Nanoindustry Infrastructure Development in the Russian Federation for the period 2008 - 2010”. In 2008 this led to the foundation of Nanotechnology Research-Educational Centers (Nanotech REC) at forty leading universities across Russia. Their aim is to carry out advanced research in nanoscience and nanotechnology (N&N), to create new MSc and PhD programmes in N&N, and to increase international cooperation with European partners within the European Research Area (ERA). Nanotech RECs are part of the Russian Universities NanoNetwork (RUNN), which coordinates national and international activities and maintains information exchange between members.

Last year St. Petersburg Electrotechnical University “LETI” (ETU) was nominated as the international information node for RUNN as a result of its recognition, by the Federal Agency for Education, as a leader among Russian universities involved in European research co-operation. The Labs and International Projects offi ce at ETU is an experienced participant of several FP6 and FP7 Projects in the NMP Priority/N&N Theme. ICPCNanoNet [1] is one such project in which ETU represents the Russian N&N research community.

ICPCNanoNet provides an electronic archive of nanoscience and nanotechnology research publications and supports the networking of researchers in the ERA and Russia (as one of the EU’s International Cooperation Partner Countries, ICPC). The electronic archive (nanoarchive.org) is based on open-source software (EPrints) that is widely used by scientifi c institutions across the globe, and allows the incorporation of full-text open access publications (submitted by authors themselves) and the incorporation of entries from other publicly available sources (including other open-access repositories, electronic tables of contents and abstracts).

This facilitates researcher access to new data and the identifi cation of groups that are performing complementary research for potential collaboration. ICPCNanoNet also has established a database of researchers and organizations in RU, other ICPCs and the ERA (through nanoforum.org) which include contact details, research interests and expertise. This database is available to all registered users of the website (icpc-nanonet.org), allowing researchers to search for individuals that have specifi c expertise and organizations that have desired instrumentation and capacity.

ETU as a partner in ICPCNanoNet provides a link between the nano-segment of the ERA and RUNN and facilitates member entry into European Research Area in nanoscience and nanotechnology.

References[1] http://cordis.europa.eu/fetch?CALLER=FP7_PROJ_EN&ACTION=D&DOC=3&CAT=PROJ&QUERY=011f8d353f2b:3755:01f00b51&RCN=87962


98

Parallel Sessions

Parallel Session E7 - Horizontal activities - European Technology Platforms

O-91 - Nanoscience and technology implementation in industry: planning the new nano-ETPP. Matteazzi1

1MBN Nanomaterialia, Italy

MINAM Nanofutures is a rising European multi-sectorial, cross-ETP, integrating platform that will be able to congregate and support all elements required for establishing within the next 10 years (2010-2020) a new, competitive nano-based industry, encompassing RTD, legislative, HSE, innovation and commercialisation aspects.

This new platform will be instrumental in the industrialisation of nanotechnology by bridging the gap between research, technological innovation and company /market innovation aspects. When fully operational MINAM Nanofutures would act as a superstructure that would carry nanotechnology industrialization forward to the benefi t of European economy and its citizens. An important objective will be to connect and establish cooperation and representation of all relevant Technology Platforms that require nanotechnologies in their industrial sector and products. MINAM Nanofutures will be an unique environment where it will be possible to select key priorities and to identify common point of interest (key nodes) emerging from the overlapping of Industrial needs, Nanotechnology solutions, ETPs visions and European policies.

MINAM NANOfutures will serve as a nano-hub for all relevant sectors:• creating synergies and identifying common elements between the ETPs, and where appropriate, with National and/or Regional Programmes

and Platforms, ERA-NETS, and Networks of Excellence;• developing joint programme of activities with the objective of meeting major challenges; e.g. clean and sustainable manufacturing,

competitive and socially responsible commercialisation of nanotechnology, materials and “horizontal” technologies that will enable competitive and sustainable developments in a range of industrial sectors (ETPs).


99

Posters

Poster Session 1 - Nanotechnology in Eco- & Energy-effi cient industrial production

P - 001EUMINAfab: a new European Infrastructure for Micro-Nano FabricationS. Anson1, M. Kautt1

1Forschungszentrum Karlsruhe, Programme Nano and Microsystems, Eggenstein Leopoldshafen, Germany

EUMINAfab is a European research infrastructure for micro-nano fabrication of functional structures and devices out of a knowledge-based multimaterials’ repertoire. With this FP7 integrating activity, the European Commission supports the establishment of a unique technology platform that is open to external users from industry and academia. EC funding covers the costs of access and transport and accommodation costs for EUMINAfab’s users, regardless whether from both academia or industry, upon condition that the results can be publically available. The Consortium of 10 partners off ers access to 36 installations with the necessary technical support personnel in the areas of micro and nano patterning, thin fi lm deposition, replication and characterisation.

Access is possible by written proposal submission through the EUMINAfab Entry Point which will be shortly available on the project web page www.euminafab.eu. Proposals for access to a particular installation will be assessed by an independent peer review board according scientifi c and technical merit. Calls will be published at sixth monthly intervals. There is also the possibility of a fast track procedure in which proposals will be fi rst assessed according to technological feasibility and then for scientifi c and technological merit by the project executive board.

The research infrastructure is supported and enhanced by Joint Research Activities designed e.g. to develop a knowledge based approach, defi ne technology readiness levels and technology integration of the currently isolated processes in selected cases. Networking activities cover the operation of the “Entry Point” in addition to roadmapping activities, dissemination and researcher exchange.

Partners off ering access are Cardiff University (United Kingdom), CEA-Liten (France), FIAT Research Centre (Italy), IMS-Nanofabrication (Austria), Forschungszentrum Karlsruhe (Germany), National Physical Laboratory (United Kingdom), Philips Research Miplaza (The Netherlands) and TEKNIKER (Spain) and are complemented by KTH (Sweden) and Fraunhofer IPA (Germany).

EUMINAfab has strong links with the 4M association, MINAM, Nanofuture and EPoSS.

The poster provides an overview of the technologies available at the 36 installations and information on the fi rst calls which will be opened in September at the Commercialization of Micro and Nano Systems Conference, COMS 2009, Copenhagen.

P - 002Nanostructured materials integration in microcomponents by direct ultraprecision manufacturingA. Bianchin1, P. Matteazzi2, A. Colella1, R. Rolli1

1CSGI-Interuniversity consortium, Nanomaterials, Vascon di Carbonera (TV), Italy2MBN nanomaterialia, Research, Vascon di Carbonera (TV), Italy

Development of rapid nanomanufacturing technology represents a key factor for future competitiveness of EU manufacturing industry. In this fi eld the fi rst level objective of MANUDIRECT project is to provide industry with an entirely new platform of ultraprecision nanomanufacturing by the way of high productivity-high resolution direct (one step) laser sintering using nanostructured powders as metals, ceramic materials or their combination. Virtual engineering concepts and design are translated into nano-inside products without the need of prototyping steps opening the way to direct nanomanufacturing at microscale components. Impact of platform and its success will be horizontal to many sectors and vertical in engineering methodologies. The operating Direct Manufacturing Platform integrates: capacity of production (tons per year) of tailored nanostructured materials grades by high energy ball milling developed for this technology;innovative methodologies for materials design and manufacturing of components;the machine equipped with highly localized powder fl ux and laser beam capable of high productivity rate combined with spatial resolutions in the scale of 50 μm (microscale integration, well beyond the state of the art); innovative monitoring on board tools and control software.Tailored nanophased powders can be synthesized according to specifi c industrial case study requirements. Direct laser sintering technology allows to built micro-components while retaining the unique properties of nanostructured powders, achieving in such a way advanced nano-inside products. This technology can answer the needs of several applications in many engineering sectors by using single or double melting phases alloys or ceramic reinforced metal alloys. The following materials have been developed: martensitic stainless steel and Ti based nanomaterials for biomedical products, Ni based nanomaterials for aeronautics and power generation, Al2O3 ceramic reinforced metal nanoalloys for mechanical components and tools. An industrial prototype machine is fully working producing geometries (cylinders, squares and dome) and parts with diff erent nanostructured materials.


100

Posters

P - 003Nanostructured composite membrane catalysts prepared by atomic layer deposition methodN. Orekhova1, M. Ermilova1, G. Tereshchenko1, A. Malygin2, A. Malkov2, S. Mikhailovski2

1A.V.Topchiev Institute of Petrochemical Synthesis, Laboratory of Membrane Catalysis, Moscow, Russia2St. Petersburg’s State Technological University, Department of Nanotechnology, St. Petersburg, Russia

The membrane catalysts with a selective permeability allow to aff ect the rate and selectivity of several catalytic processes. The combination of properties of a membrane and catalyst opens wide prospects for a realization of catalytic reactions in energy effi cient and safe mode. The clue question in such composite membranes synthesis is a proper method of chemical modifi cation of membrane pores and surface to prepare an active and selective membrane catalyst. One of the most promising methods of an inert membrane modifi cation on the atomic scale is the method of atomic layer deposition (ALD), based on the irreversible interaction between of low-molecular reagents and functional groups of a solid substrate surface under the conditions of continuous reagent input and removing the formed gaseous products. A lot of publications on obtaining of nanostructured catalytic and membrane systems by ALD method were appeared last decade.

The purpose of the given research was the obtaining of vanadium- and chromium-phosphorus oxides’ structures on a surface of an inert asymmetric membrane of alumina and studies of structure and catalytic properties of these nanostructured composite membranes in a relation of methanol oxidative transformations. To improve the selectivity of gas permeability of inert membranes their pore structure was preliminary modifi ed by ALD deposition of titania at the variation of number of ALD cycles. Methanol conversion and formaldehyde formation selectivity of the formed membrane catalyst was shown to depend on the nature and the composition of metal-phosphorus-oxide structures deposited on the surface of inert asymmetric ceramic membrane. The yield of formaldehyde depends also on the modes of reagents feeding to the surface of catalyst: by diff usion of air through the membrane to the catalyst layer or by diff usion of methanol through the membrane to the catalyst layer.

The work is carried out with support of Russian Academy of Sciences Programme.

P - 004Enhanced Surface Plasmon Resonance (SPR) Immunosensor for Antibiotic Residue Analysis using Nanogold ProbesF. Fernandez Santos1, F. Sanchez Baeza1, M.P. Marco Colas1

1Institute for Advanced Chemistry of Catalonia (IQAC-CSIC), Chemical and Biomolecular Nanotechnology (AMR group / CIBER-BBN), Barcelona, Spain

Background:Immunosensors based on Surface Plasmon Resonance (SPR) are an alternative to conventional analytical methods for monitoring drugs in the framework of food security. Fluoroquinonlone (FQ) antibiotics are between the veterinary drug residues that should be monitoring according to the European Regulations (1). An attractive signal-amplifi cation in SPR can be achieved by the use of gold nanoparticles. The observed eff ect may be due to an increase of the refractive index or to the electromagnetic coupling between the gold nanoparticles and the gold surface (2-4).

Objectives:Establishment of an SPR immunosensor method for fl uoroquinolones antibiotic residue detection using gold nanoparticles probes for signal and detectability enhancement.

Methods:The format consists in the immobilization of the antigen, a FQ haptenized protein, by covalent attachment by means of a mixed SAM over a gold surface. Solutions containing the analyte, enrofl oxacin, and the antibody, As171, were pumped to the fl ow-cell. For signal enhancement a secondary gold-labelled antibody (anti rabbit IgG) was passed through the cell. The obtained calibration curves were used to evaluate the eff ect of nanogold. The employed immunoreagents were developed in a previous work (5).

Results:The developed immunosensor is able to reach suffi cient detectability to analyze residues of the antibiotic in milk samples according to the EC regulations. A great enhancement in the signal is observed using gold nanoparticles labelled secondary antibody, allowing using lower concentrations of As171. As consequence, the IC50 value of the calibration curves shifted from 10,1 ug L-1 to 0,8 ug L-1 .

Conclusion/Application to practice:The extraordinary signal enhancement produced by the gold nanoparticles in SPR allows to reduce the concentration of specifi c immunoreagents used and improves signifi cantly the detectability of the FQ immunosensor. This has an extraordinary value for the analysis of real samples, since allows eliminating non specifi c interferences just by sample dilution.

References[1] Council Regulation ECC/2377/90. Off .Journal of Europ. Comm. 1990. L224 1-8.[2] Mitchell, J. S.; Wu, Y.; Cook, C. J.; Main, L. Anal. Biochem. 2005, 343, 125-135.[3] Yuan, J.; Oliver R.; Aguilar, M. I.; Wu, Y. Q. Anal. Chem. 2008, 80(21), 8329-8333[4] Gobi, K. V.; Matsumoto, K.; Toko, K.; Miura, N. Sens. & Instrumen. Food Qual. 2008, DOI 10.1007/s11694-008-9033-5.[5] Pinacho, D. G.; Sánchez-Baeza, F; Marco, M-Pilar. Agric. Food Chem. 2009. Submitted.


101

Posters

P - 005The investigation of nanosized supramolecular aggregates of biologically relevance molecules by using physical methods.T. Leshina1, A. Kruppa1, N. Polyakov1, M. Taraban1, S. Petrova1, V. Kornievskaya1, A. Schlottgayer1

1Institute of Chemical Kinetics and Combustion, Laboratory of Magnetic Phenomena, Novosibirsk, Russia

In recent years nanosized organic host-guest complex and micelles has become an intensively pursued fi eld of organic and medicinal chemistry. Highly interesting are molecular complex formation involving macrocyclic, biologically active compounds isolated from biological raw materials. Such agents can protect parent substances from metabolic decay and provide for their prolonged action. But the infl uence of complexation is not restricted to only the protection role. Changes of some physicochemical characteristics of biologically active molecules due to complexation can result in changes of their therapeutic activity.

One of the main questions in the investigation of chemical processes in the organized media (nanosized supramolecular complexes, micelles, liquid crystals, e.a.) is the elucidation of mechanisms of these aggregates infl uence on the reactivity of the “guest” molecules. To answer this question we present a new approach based on combination of NMR and spin chemistry methods. We have found the correlation between NMR characteristics of complexes and micelle in solution at diff erent concentrations of “host” molecules and the effi ciency of separate stages of radical reactions of biologically relevant compounds in complexes and micelles. The control of complexes and micelles formation was made by independent method (NMR relaxation measurement). Radical reactions effi ciency was measured by CIDNP techniques, EPR and UV spectroscopy.

This approach is illustrated by examples of the demonstration of the infl uence of nanosized complexes and micelles of natural amphiphilic compound, glycyrrhizic acid (GA), complexes of beta-cyclodextrin and arabinogalactan on carotenoids antioxidant properties. It was also shown the variance of the reactivity of aminoacids and several cardiovascular drugs in model redox proccesses in complexes with GA and cyclodextrin. It is suggested the abovementioned alternations result in the infl uence of supramolecular environment on molecular dynamics of radical pairs. For example, the ratio of contributions of CIDNP from radical - ion pairs and free radical pairs in complexes diff er from that one in solution.

This work was supported by the grant 08-03-00372 of Russian Foundation of Basic Research.

P - 006On-axis and off -axes single target magnetron co-sputtering and dual magnetron sputtering study of fe doped SnO2 coatings M. Kormunda1, J. Pavlik1

1J.E. Purkyne University, Department of Physics, Usti nad Labem, Czech Republic

The SnO2 material combines electrical conductivity with optical transparency. SnO2 is used as a heterogeneous oxidation catalyst and a solid-state gas sensor. The doped SnO2 gas sensors are produced by many diff erent techniques with a wide range of dopands improving their selectivity and sensitivity. It has been demonstrated that a small amount of transition metals (less than 1 at.%) modifi es the properties of tin oxide thin fi lms signifi cantly.

The magnetron deposition is known to introduce energy particles to the growing fi lms especially in a planparallel on-axis confi guration and therefore a wide range of coating structures is possible. But the surface damages are also introduced to the fi lm by the ion bombardment. Therefore materials as low temperature superconductors and other structured materials are deposited often in off -axes confi guration.

The Fe doped SnO2 thin fi lms were fi rst deposited by RF magnetron co-sputtering of SnO2 and Fe dopand using a single sputter target (48 mm diameter) with a variable SnO2/Fe ratio in the argon gas in on-axes arrangement face to face.

The second set of fi lms was deposited from the same magnetron target in off -axes confi guration. The face of substrates was perpendicular to the face of target. The substrate center was in distance about 40 mm from target axis and 70 mm from target face.

Third set of samples was prepared by dual magnetron sputtering of SnO2 and Fe target.

The infl uence of annealing up to 600o C on the structure and composition of the coatings was investigated.

The basic composition of the coatings was investigated by XPS technique. The main expected elements O 1s, Sn 3d and C 1s peak were identifi ed in the spectra. The probable dominant source of the carbon contamination was in the ex-situ environment because the samples were moved from the deposition chamber to XPS chamber for analyses. The peak of Fe 2p was clearly identifi ed but the deconvolution was necessary to estimate the Fe concentration in the fi lms.

The Fe doped SnO2 fi lms can be successfully deposited by co-sputtering from the single Fe:SnO2 target with variable Fe ratio in both confi gurations.


102

Posters

P - 007Development of nano- and micro-structured surfaces by polymer phase-separation for antifouling (AMBIO)H.Y. Erbil1

1Gebze Institute of Technology, Chemical Engineering, Kocaeli, Turkey

Antifouling and foul-release properties of marine and freshwater ships depend on surface roughness, surface free energy and elastic modulus properties of the paints. When the contact area of the paint surface with the microorganism is decreased, then the settlement is generally reduced and foul-release is usually increased depending on the chemical nature of the coating. A surface roughness of below 5 micron in size is needed to prevent the initial Ulva spore settlement. The coatings, which have a defi nite degree of geometric patterning can be manufactured mostly from expensive materials with time consuming processes and cannot be used in the marine paint industry. However, micro-patterning with polymer protrusions having 2-4 micron diameter could be achieved by polymer phase-separation method and large-area micro-patterned surfaces having nano-protrusions on the micron sized patterns were prepared by dip and spray coating methods using mixed polyolefi n solutions in the European Commission-AMBIO project (Advanced Nanostructured Surfaces for the Control of Biofouling). Polypropylene, high-density polyethylene, cyclic olefi n copolymer and ethylene vinyl acetate copolymers were used to prepare these polymeric blend coatings. The change in the surface morphology of these thin coatings with the change in the composition and concentration of polymer solutions, and also application conditions were investigated in terms of wettability, contact angle hysteresis, surface free energy and foul-release properties.

P - 008Technology and equipment for mass industrial production of nanofi ber materialsS. Petrik1

1Elmarco s.r.o., Nano Division, Liberec 10, Czech Republic

Electrospinning method for obtaining nanofi bers from polymer solutions has been known since decades, but just 4 years ago, the revolutionary Nanospider™ technology open full possibility to produce nanofi ber layers in mass industrial scale.

The principle, main features, and technical capabilities of the technology will be presented in the paper. Nanospider™ position among other nanofi ber technologies will be discussed.

Materials for fi nal products used in biomedical applications (wound care, surgery), sound absorption, fi ltration, and their recent test results will be described and discussed. Newest achievements of Nanospider™ technology will be presented: nanofi bers from various polymers and inorganic materials (Al2O3, ZnO, TiO2, ZrO2, Cu, Co, Mn, etc.). Wide range of applications of these unique new materials, e.g. devices for energy generation and storage (batteries, supercapacitors, fuel cells, and solar cells), catalysts, and composite materials will be discussed.

P - 009Synthesis of new nanostructured framework phosphates as high selective catalysts of alternative fuel preparationM. Ermilova1, N. Orekhova1, G. Tereshchenko1, M. Sukhanov2, V. Petkov2

1A.V.Topchiev Institute of Petrochemical Synthesis, Laboratory of Membrane Catalysis, Moscow, Russia2Nizhni Novgorod University, Department of chemistry, Nizhni Novgorod, Russia

Dimethyl ether (DME) has received attention in last decade as a clean alternative transportation fuel for diesel engines due to its thermal effi ciency and near-zero smoke. Commercially DME is prepared by methanol catalytic dehydration on Al2O3. This very active catalyst is hydrophilic and loses activity gradually in presence of water which is reaction product.

The framework phosphates with NaZr2(PO4)3 NASICON (Na SuperIonic CONductors, NZP) type structure with nanochannels have attracted great interest from both fundamental and applied view since owing to their structural particulars can have high ionic conductivity, high catalytic activity et al. The crystal structure of NaZr2(PO4)3 is based on a three-dimensional framework of corner-sharing PO4-tetrahedra and ZrO6-octahedra and includes two kinds of cavities of 0.3 and 0.6 nm in diameter. Cavities can be populated by cations or vacant and due to their closed location form a 3D-framework of channels with width up to 1.1 nm. Wide set of isomorphic ion substitutions at all crystallographic positions of NZP structure allows the control of chemical composition and topology of framework cavities of these new compounds with adjustable catalytic and physicochemical properties.

Novel nanostructured catalysts were developed for methanol dehydration to DME on the base of framework phosphates of NZP type of general formula AZr2(PO4)3 (A - K, Rb, Cs), B0.5Zr2(PO4)3 (B - Mg, Ca, Sr, Ba), Zr2(PO4)3 .Phosphates were characterized using XRD, IR-spectroscopy, DTA and microprobe analysis. It was shown that the catalytic activity, selectivity, yields of products and methanol conversion on the studied phosphates depend on the temperature, surface area of the samples, their chemical composition and temperature treating, and feed rate of alcohol. The catalyst doesn’t absorb water at reaction conditions and save their activity over a long period. Phosphates NaZr2(PO4)3, B0.5Zr2(PO4)3 (B - Mg, Ca) and Zr2(PO4)3 showed the best catalytic activity (6 - 6.5 mmol/h∙g of methanol at the 580-620 K) ,and competitive with commercial catalysts for obtaining of DME, DME selectivity being about 100 % and conversion of methanol being closed to equilibrium.


103

Posters

Poster Session 2 - Nanotechnology for energy

P - 010TiO2 Nanotubes for Dye-Sensitized Solar CellsD. Kim1, A. Ghicov1, S. Albu P.1, R. Hahn1, T. Stergiopoulos2, J. Kunze1, P. Falaras2, P. Schmuki1

1LKO in Uni-erlangen, Material.Sci WWIV-LKO, Erlangen, Germany2Physical Chemistry, NCSR Demokritos, Athens, Greece

In the presentation, we demonstrate that self-organized TiO2 nanotubular layers are a highly effi cient material for dye-sensitized solar cells. We replaced the nanocrystalline TiO2 particles in the DSSCs system with anodic TiO2 nanotubes made by electrochemical anodization in fl uoride containing electrolytes. Furthermore, we optimised the system with diff erent tube morphologies, crystallization and dye-sensitisation processes. Exploiting TiO2 nanotubes signifi cantly eliminates the grain boundary and random wall eff ects and hence can signifi cantly enhance the light conversion effi ciency.

P - 011Cathodoluminescence study of lattice mismatch Ga0.5In0.5P/GaxIn1-xAs solar cells grown on GaAs substratesP.T.H. Nguyen1, K.H. Kim1, J. Lee1

1Ajou University, Electrical and Computer Engineering, Suwon, South-Korea

Metamorphic or lattice mismatched (LMM) III-V multi-junction solar cells can absorb solar energy eff ectively obtaining ability to archive higher conversion effi ciency compare to lattice matched solar cells. In this paper, we report on the study of lattice mismatch problem in metamorphic Ga0.5In0.5P/GaxIn1-xAs tandem solar cells by cathodoluminescence investigation. Three solar cell samples with diff erent Indium composition in the bottom cells including Ga0.5In0.5P/GaAs, Ga0.5In0.5P/Ga0.99In0.01As and Ga0.5In0.5P/Ga0.975In0.025As were grown by Metal-Organic Chemical Vapor Deposition (MOCVP) for inspection. Cathodoluminescence data indicated that the total photon intensity of Ga0.5In0.5P/GaxIn1-xAs tandem solar cells decrease as increasing the Indium composition in the bottom cell caused by increasing in lattice mismatch between bottom cells and the substrates.

P - 012Fully Automated Multi Sensor Metrology for use in PV, MEMS and SemiconductorT. Fries1 1FRT GmbH, Bergisch Gladbach, Germany

A surface metrology system was developed to fulfi l the needs of semiconductor and MEMS industry from lab to production taking into account the above said. The system investigates wafers, PCB or any other device surfaces and estimates TTV, bow or warp all automatically. Also high resolution topography, roughness or profi les for the whole surface can be performed. Additionally fi lm thickness is measured. An outstanding innovation is the modular multi sensor technology. The various optical sensors are fast and accurate. Furthermore the system can optionally be equipped with AFM. The system does automated evaluation of the following metrological data: total thickness variation TTV, bow, warp, roughness, fi lm thickness, step height, pitch, profi le, contour, edge structures, trenches, topography, geometry, coplanarity, critical dimensions und angles.

The metrology system uses atomic force microscopy (AFM) or optical sensors or even a combination of several of them. The metrology tools may be used as integrated into the production line or set up as stand alone instruments in the metrology lab.

To get the ability to fully automate surface inspection in production environments and support alignment tasks, a complete vision setup is integrated into the systems. By utilizing a high resolution, telecentric, illuminated CCD-camera and pattern recognition software, the metrology system automatically detects diff erent reference marks or dies and measurements sites and thus saves you valuable time for routine, repetitive measurements.

To fulfi l Frontend needs, the metrology system is integrated to a fully equipped EFEM with wafer handling robot, prealignement, OCR, own fan units and FOUP or SMIF ports. Completed are these systems by a professional SECS/GEM integration. To ensure the comprehensive functionality and guarantee uptime of such a metrology system a completely new software environment has been developed and mechanical and electronical components have been optimized for repeatability and modularity in function.


104

Posters

P - 013Possible applications of polymeric nanocomposites like dielectrics in power engineeringJ. Bocek1

1University of West Bohemia Faculty of Electrical Engineering, Department of Technologies and Measurement, Pilsen, Czech Republic

This paper contains basic information on the potential use of these materials in power engineering. It is also the fi rst move towards practical sample testing, which is planned for the near future.

There has been a signifi cant increase in the interest in materials and technologies containing nanometre sized function elements. In nanometre sizes, material properties are dramatically changing. Macroscopic materials as such cease to play the main role and phase interferences are becoming determinant. We are only at the beginning of this new material research. However, nano-materials have already found a number of applications and it is expected that this number will rapidly grow in the future.

Polymeric composite dielectrics fi lled with micro-particles are well tried materials in power engineering. Evaluation of nano-fi ller properties and their application in new insulating systems is a logical next step.

Polymeric composite dielectrics fi lled with a very small amount of nano-fi llers (units of weight percentage) are very interesting applications of these materials. The most often researched systems are based on polymer and inorganic nano-fi llers. Functional characteristics are also signifi cantly infl uenced by the process of manufacturing and inclusion of dirt and other foreign materials.

P - 014Nanoparticles embedded in alloy thermoelectric B. Fillon1

1CEA /LITEN, Grenoble, France

Research in thermoelectric materials has experienced an impressive revival during the last decade, due to the development of nanofabrication and nano-characterization techniques. Scaling down the size of present miniaturized autonomous wireless sensor networks is impeded, to a great extent, by the inability to power them with small and durable enough batteries. Energy storage must be supplemented by ambient energy harvesting that can recharge sub mm3 batteries and provide energy on demand. Thin fi lm thermoelectric power generation is also thought to be the most promising way to achieve microscopic energy harvesting for self-powered autonomous sensor networks and devices.

Additionally, active hotspot cooling by chip integrated thermoelectric devices is in many cases necessary in order to lengthen the lifetime of the chip.

The biggest challenge in thermoelectric energy conversion is to increase the thermoelectric fi gure of merit (ZT) of current materials. Nanotechnology revolution has clearly shown a payoff : numerous examples of improved ZT have been recently achieved via nano-structured materials.

CEA /Liten have developed a promising nano-structuring strategy, called “nanoparticles embedded in alloy” thermoelectrics.

The “nanoparticles embedded in alloy” concept for thermoelectrics was fi rst developed at UCSC by the group of Ali Shakouri, in the form of ErAs nanodots embedded in a matrix of InGaAs alloy. With this revolutionary strategy, improvements of 100% in the material’s thermoelectric fi gure of merit were demonstrated at room temperature, and even higher increases were shown to take place at high temperature. The basic idea is to embed nanoparticles made of a compatible material into a matrix of an alloy semiconductor that intrinsically possess good thermoelectric properties. If coherent nanodots can be grown lattice- matched or nearly lattice-matched with a matrix, without generating dislocations, it is possible to considerably reduce the thermal conductivity of the material, L below that of the matrix alloy, while still maintaining a high value of the electronic conductivity σ and thermopower S. The dimensionless thermoelectric fi gure of merit is defi ned as ZT = σS2T/ λso this approach allows for a considerably increase in ZT.

CEA/Liten has proposed materials based on SiGe matrix with silicide and germanide nano-inclusions, which are nano-structured for higher effi ciency, while being also compatible with IC fabrication techniques, monolithically integrable with silicon. This is a considerable technological advantage because we can then take advantage of all the well developed CMOS technology. This silicon based approach provides a key opportunity for a real integration of thermoelectric in IC devices with a high level of performance for cooling or energy harvesting capability.


105

Posters

P - 015Nanostructured metal-carbon composite materials as an eff ective catalysts in pure hydrogen productionG. Karpacheva1, L. Zemtsov1, M. Efi mov1, M. Ermilova1, N. Orekhova1

1A.V.Topchiev Institute of Petrochemical Synthesis, Chemistry of polyconjugated systems, Moscow, Russia

The carbon materials, prepared by carbonization of polymers, are of great interest among new forms of the carbon carriers, capable to provide high metal specifi c area and steady dispersion of particles. As a fact, the implantation of particles of catalytically active metals into a carbon matrix could be carried out already at the carbonization step, simultaneously modifying the activity and stability of metal.

Novel heterogeneous catalysts for hydrocarbon dehydrogenation with bimetallic nanoparticles fi nely dispersed in carbon matrix were developed. Carbon-carbon composites based on IR-pyrolyzed polyacrylonitrile (IR-PAN) and extra carbon component such as multiwalled carbon nanotubes (MCNT), purifi ed fi nely dispersed coal SKT-6A, ultra dispersed nanodiamonds (UDA) were used as carbon carriers. The nanosized bimetalic particles were introduced into the structure of carbon matrix directly in the course of IR-pyrolysis of composite-precursor on the basis of PAN, mentioned above extra carbon component, PtCl4 and RuCl3. Effi cient reduction of metals takes place in the course of IR-pyrolysis of composite-precursor with participation of hydrogen, which is released in dehydrogenation of main PAN chain.

According to X-ray diff raction data, bimetallic Pt-RU nanosized particles are alloys with simple cubic lattice (a=3.888 Å). The decrease of the lattice parameter in compare to a=3.923 Å for Pt attests to formation of solid solutions of substitution. It is shown by transmission electron microscopy method that bimetallic nanoparticles of diameter from 2 to 12 nm are fi nely dispersed in carbon matrix, the ~90% Pt-Ru nanoparticles being 4-8 nm in size.

Nanocomposites containing 0,7-2,8 % mas. Pt-Ru nanoparticles were choosen for testing their catalytic activity in relation to dehydrogenation of cyclohexane. Nanoparticles of Pt-Ru alloys fi nely dispersed in structure of carbon carriers were fi rstly obtained directly during the catalyst formation process. Pt-Ru catalysts deposited on carbon-carbon composites on the basis of IR-PAN (10 % mas.) and coal SKT-6A (90 % mas.) or UDA (90 % mas.) were shown to off er the high catalytic activity and selectivity in dehydrogenation of cyclohexane. 100% cyclohexane conversion was reached. Only benzene and hydrogen were obtained in all reaction temperature interval.

So, developed by us nanostructured heterogeneous Pt-Ru/carbon catalysts allow to obtain pure hydrogen with high effi ciency.

P - 016Platinum-iridium oxide nanoparticles for oxygen electrode of unitized regenerative fuel cellsM.V. Martínez-Huerta1, F.J. Pérez-Alonso1, N. Tsiouvaras1, P. Terreros1, J.L.G. Fierro1, M.A. Peña1

1Instituto de Catalisis y Petroleoquimica CSIC, Estructura y actividad, Madrid, Spain

A unitized regenerative fuel cell (URFC) is an electrochemical cell working both as the fuel cell and water electrolyzer in a close loop, and could serve as the basis of a hydrogen economy operating on renewable energy [1]. These systems have got an acid polymer electrolyte membrane (PEM) that works as an electrolyte. However, the key technology in the development of the PEM URFC is the fabrication of bifunctional electrode for reduction and evolution of oxygen with high effi ciency, and resistant to anodic corrosion during the water electrolysis reaction. It is well known that the best electrocatalyst for oxygen reduction reaction (ORR) is platinum, and IrO2 is the best candidate for oxygen evolution reaction (OER). Thus, a mixture of Pt and IrO2 is considered suitable bifunctional electrocatalyst for oxygen electrode. Over the last decade the electrocatalytic properties of noble metal and metal alloys nanoparticles have improved considerably the development of PEMFC. Therefore, nanoparticles of Pt-IrO2 for URFC applications may be interesting to increase the effi ciency and reduce the cost, since a high ratio surface/volume is expected with these expensive noble metals.

The main objective of this research is the development of nanoparticles of Pt-IrO2, which could make URFC system technically and economically more competitive. For this propose, we have employed sol-gel derived method [2] to form nanoparticulate binary mixtures containing Pt and Ir powders, in controlled atomic ratios, Pt:Ir. These catalysts were compared to Pt black (Alfa Aesar) and PtIrblack (1:1) prepared by mixing Pt black and Ir black (Alfa Aesar) physically. Electrocatalysts have been studied using diff erent physicochemical techniques as XRD, TEM, TXRF and TGA, and conventional electrochemical techniques such as cyclic voltammetry and rotating disk electrode will be used for the study of the ORR and OER processes.

Combining Pt and Ir sol-gel together produces electrocatalyst mixed on the nanometer scale, with TEM analysis showing an average particles size of 5 nm. Nanoparticles of PtIrsolgel (1:1) present lower ORR electrocatalytic activity than commercial Pt black catalyst, but higher than the mixed PtIrblack (1:1) catalyst. Iridium oxide obtained by sol gel method presents the best activity toward oxygen evolution, followed by PtIrsolgel (1:1) catalyst. These results show how nanoparticles are further indispensable as electrocatalysts for URFC applications.

References[1] J. Petterson, B. Ramsey and D. Harrison, Journal of Power Sources 157 (2006) 28[2] H. Tsaprailis and V.I. Birss, Electrochemical and Solid-State Letters 7 (2004) A348-A352


106

Posters

P - 017Plasma-chemical etching for in-line processing of crystalline silicon solar cells at atmospheric pressureI. Dani1, D. Linaschke1, E. Lopez1, V. Hopfe1, S. Kaskel1, E. Beyer1, A. Poruba2, R. Barinka2

1Fraunhofer IWS, CVD Thin Film Technology, Dresden, Germany2SOLARTEC s.r.o., SOLARTEC s.r.o., Roznov pod Radhostem, Czech Republic

Plasma processing at atmospheric pressure provides a unique combination of economic and technological advantages: the in-line processing capability reduces substantially the substrate handling costs, high deposition rates allow an increased throughput. The saving of capital cost is a further factor compared to low pressure operation.

The industrial production of crystalline Si solar cells is mostly based on wet chemical processing. Atmospheric pressure etching and coating are promising alternative routes to establish cost-effi cient technologies for manufacturing of crystalline silicon solar cells. The atmospheric pressure plasma etching is expected to lead to reduced running costs because of reduced wafer breakage rate, reduced chemical waste and reduced handling operation due to in-line processing.

Based on a linearly extended DC arc with a working with of 250 mm for plasma activation the plasma-enhanced chemical etching of silicon solar wafers has been successfully carried out at atmospheric pressure. The technology operates in an afterglow (downstream) mode, avoiding plasma source damage due to chemical attack. In this confi guration ion bombardment on the wafer is prevented. Continuous etching of silicon in atmospheric pressure air-to-air plasma reactors requires carefully designed purge gas curtains, based on fl uiddynamic modelling, to obtain a controlled atmosphere inside the reactor.

The technology comprises the potential to be inserted in diff erent silicon wafer processing steps such as reduction of refl ection losses by surface texturing, saw damage removal, edge isolation, phosphor silicate-glass removal, etc.

Fluorine radicals generated by an argon/nitrogen plasma from NF3 and SF6 have been successfully utilized to etch (100)-mono-Si wafers. Dynamic etch rates of 3.6 μm•m/min have been obtained with the most favourable etch gas, NF3. SF6 dynamic etching rates are also rather high with peak values of 0.95 μm•m/min. Etch gas utilisation has been measured by means of Fourier Transformed Infrared (FTIR) gas spectroscopy and results in maximum values of 71 % for NF3. The etch gas utilisation in the case of SF6 is signifi cant lower with peak values of 28 %.

Additionally, the chemical composition of the waste gas was analysed. SiF4 was identifi ed as main reaction product of the plasma chemical etching. The fraction of NF3 decomposed in the plasma reached values up to 99 %.

The feasibility of several etching steps at atmospheric pressure for photovoltaic production has been evaluated. Several independent industrial tests for rear surface etching, for edge isolation, and rear surface polishing have been carried out. Comparable results to established wet chemical etch processes were achieved.

This work is supported by the European Commission, under FP7 project N2P.


107

Posters

P - 018Hybridized continuous depositing of carbon nanotubesZ. Kolacinski1, G. Raniszewski1, M. Druri2, L. Szymanski3

1Technical University of Lodz, Electrical Electronic Computer and Control Engineering, Lodz, Poland2Technical University of Lodz, Biotechnology and Food Sciences, Lodz, Poland3Academy of Humanities and Economics in Lodz, Informatics, Lodz, Poland

ObjectivesCarbon nanotubes (CNTs) depositing on various substrates are urgently required for many technological applications such as electron emitters, supercapacitors, rechargeable batteries, photovoltaic cells, etc. This process is identifi ed as one of the best candidates for scale-up and industrialization. One of the main challenges to obtain the optimal product properties is a continuous and uniform dispersion of product on a moving substrate.

The Chemical Vapor Deposition (CVD) of liquid aerosols hydrocarbon/metallocene is one of the most effi cient and fl exible methods provided that metal catalyst is gasifi ed and heated up to the reaction temperature. However the most effi cient results we obtained using plasma assisted synthesis methods (PACVD) with diff erent levels of hybridization.

MethodsIn this paper the experimental set-up consisted of PACVD furnace and microwave plasma generator is presented. This has been equipped with independent catalyst precursor and carbon containing gas feed systems. The microwave plasma unit has been used for precursor and carbon activation and to produce the appropriate temperature of the infl owing gases. To enable continuous working mode of the hybrid system the vortex mix of carrier gases screening the quartz tube has been applied. The 1m long furnace has been used to control the CNTs synthesis process. The internal tube of 50mm in diameter was divided into three sections of separately controlled temperature. This allowed to keep the reactor quartz tube in the bests temperature ranged from 8000C to 12000C minimizing the cooling eff ect of both ends of the furnace. PACVD process allows the synthesis of clean CNTs with low content of sub-products such as an amorphous carbon. We have found good results of amorphous carbon segregation as permanent magnet were used in the CNTs dry collector. Dry collector followed by a wet collector for zero contamination of the exhaust gas with carbon particles have been applied at the line end.

ResultsThe growth of CNTs is sensitive to the temperature distribution in the PACVD line. As it comes from our experiment the continuous CNTs synthesis process requires carbon radicals and metal catalyst uniform mixture to be treated in some time by the adequate temperature around 10000C.

We have found that the velocity of CNTs growth can reach the values such as 50 m/min and the nanotubes length can be varied from some tenths of microns to few micrometers according to synthesis parameters. However the CNTs are contaminated with metallic particles. This is a positive phenomenon for our applications as it allows magnetic separation if ferrocene or iron pentacarbonyl catalysts are used.


108

Posters

P - 019Mid-infrared light-emitting diodes based on heterostructure with deep AlSb/InAsSb/AlSb quantum well using a switching positive-to-negative luminescenceM. Mikhailova1, K. Moiseev1, E. Ivanov1, Y. Yakovlev1, E. Hulicius2, A. Hospodkova2, J. Pangrac2, T. Simecek2, K. Melichar2

1Ioff e Physicotechnical Institute, Physics of Nanoheterostructures, Saint-Petersburg, Russia2Institute of Physics AS CR, Movpe, Prague, Czech Republic

We report the study of positive and negative luminescense in light-emitting diodes (LEDs) based on type II asymmetric p-InAs/AlSb/InAsSb/AlSb/p-GaSb heterostructures with a deep quantum well (QW) at the heterointerface. Negative electroluminescence (EL) has been recently studied in narrow-gap InAs, InSb, CdHgTe, InAsSb bulk, p-n junctions and superlattices [1, 2]. We investigated positive and negative EL in p-InAs/AlSb/InAsSb/AlSb/p-GaSb heterostructures for the fi rst time. The structures were grown on p-InAs: Mn (100) substrate by metal-organic vapor phase epitaxy and consist of 20 nm-AlSb/5 nm-InAs0.84Sb0.16/20nm-AlSb QW and 0.5 μm p-GaSb capping layer. Mesa-diodes 500 mm in diameter were prepared by standard photolithography. Negative diff erential resistance (N-type peculiarity) was observed on the current-voltage characteristics at T=77 K under high voltage +/-(1-2) V. It indicates the presence of resonant tunneling transfer of the carriers through AlSb/InAsSb/AlSb barriers. EL spectra were measured both under forward and reverse bias at 77 K and at higher temperatures 300-380 K. Low-temperature spectra under forward bias (“+” is at the p-InAs substrate) consist of two positive EL bands with photon energy hνmax = 0.407 eV and 0.376 eV (lmax = 3.05 μm and 3.3 μm, respectively), which can be ascribed to band-to-band radiative recombination transitions in InAs and from Mn acceptor level (Ea = 31 meV). Full width at a half maximum (FWHM) was about 21 meV for both bands. High-intense negative EL was found in the temperature range 300-380 K under reverse bias. Negative EL spectra were situated in the range 0.3-0.4 eV (3-4 μm) and their shape was similar to the positive EL. Dependence of negative EL intensity on the drive current in the range 25-200 mA, and photon energy at diff erent temperatures was studied. Negative EL intensity was almost constant for the drive current 100-200 mA, while the positive EL intensity increases linearly with the drive current. It is the evidence that complete carrier extraction took place even at elevated temperature. It was established that at high temperature (> 75 °C) and drive current up to 100-150 mA the negative EL intensity exceeds the positive EL intensity by 60 %. High effi ciency of the negative EL was due to the suppression of Auger recombination at elevated temperatures. These heterostructures can operate as LEDs or as photodiodes with switching positive-to-negative luminescense in the spectral range 3-4 μm. Their applications include gas sensing, ecological monitoring, testing of thermal imagers etc.

Work was supported in part by RBRF grant # 09-02-0063, by Program of the RAS Presidium, by GAAV of the Czech Republic Grant no. A100100719 and project of Inst. of Phys. - AV0Z 10100521.

References[1] V.I.Ivanov-Omskii, B.A.Matveev. Semiconductors, 41 (3), 247-258 (2007).[2] T.Ashley, G.R.Nash. In: Mid-Infrared Semiconductor Optoelectrnics (Springer Series in Optical Science) ed. by A.Krier

(London, Springer-Verlag, 2006) part III, p. 453.

P - 020NANO-OXIDE MATERIALS AS A HYDROGEN STORAGEA. Martyla1, R. Przekop1, B. Olejnik1

1Institute of Non-ferrous Metals, Department in Poznan Central Laboratory of Batteries and Cells, Poznan, Poland

In the search for alternative fuels, hydrogen is the ideal candidate as a clean energy carrier for transportation and stationary applications. Currently there are no optimal systems for hydrogen storage. Hydrogen can be stored in gaseous, liquid or more recently in solid forms. The major challenges in the development of new hydrogen storage materials are improved energy storage density, cycle life. Hydrogen may be stored in solids by chemisorption or physisorption. For physisorption new nanoscale materials with high specifi c surface area are needed. Gas adsorption characterization of ordered organic-inorganic nanocomposities, i.e. mesoporous materials was reviewed recently. The supramolecular templating techniques and processing have revolutionized the synthesis and application opportunities of nanoporous materials. There are many templating pathways in making mesostructured materials. New synthesis strategies are constantly being revealed and trailed for improving the pore size range, chemical composition, thermal and hydrothermal stabilities.

In order to have materials with suffi cient hydrogen storage, several attempts are being made to explore new materials using physisorption requires which have higher desorption temperatures than those possible using conventional adsorbents such as carbon [1]. This compound is solid boron oxide which can be modifi ed by the inclusion of various metals. We have studied binary oxide systems Al2O3-B2O3 obtained by the sol-gel method and by the sol-gel method with templating agent. These researches are the part of the project on the new materials for storage hydrogen, sorbents based on oxide samples Al2O3-B2O3. The design, synthesis and modifi cation of oxide materials are challenging and have to be well controlled. The sol-gel technique seems to be a perfect method. We have prepared and characterized a series of new hydrogen sorbents.

References[1] S.H. Jhi et all, Solid State Communications 129 (2004) 769-773.


109

Posters

P - 021Synthesis of Benzothiadiazole/Thiophene-based Copolymers for Photovoltaic CellsA. Keawprajak1, P. Piyakulawat1, J. Wlosnewski1, P. Iamraksa1, C. Saekung2, U. Asawapirom1

1National Nanotechnology Center, Research and Development, Pathumthani, Thailand2Institute of Solar Energy Technology Development, Research and Development, Pathumthani, Thailand

Organic solar cells based on conjugated polymers and small molecules have been paid more attention, due to their easy processing, mechanical fl exibility and potential low cost. The most successful system until now is a blend of poly(3-hexylthiophene) (P3HT) and [6,6]-phenyl-C61 butyric acid methyl ester (PCBM), in which a well-acknowledged state-of-the-art organic solar cells give PCE up to 3-5% [1,2,3] and more than 6% on tandem cell confi guration.[4] Further improvement of polymer-based single cells requires new p-type polymers, which absorb more broadly to match the terrestrial solar radiation; furthermore the HOMO/LUMO levels and carrier mobility of the p-type materials should also be optimized to achieve high effi ciency, as proposed by Scharber et al.[5] It has become well-known that coupling electron donors with electron acceptors leads to eff ective broadening of the absorption range.[6]

In this work, we study benzothiadiazole/thiophene-based copolymers, PFTBzTT and PFTBzDP, as a new donor for organic solar cells; their absorption and photoluminescence spectra of materials dissolved in chloroform are observed from 300 to 620 nm and 600 to 850 nm, respectively. The new materials are mixed with PCBM to form bulk-heterojunction and fabricated on PEDOT:PSS layer by spin coating. The open circuit voltages of device are 0.66 and 0.80V, while the short circuit currents are 0.51 and 1.44 mA/cm2 for PFTBzDP and PFTBzTT device respectively. The PFTBzTT device indicates promising power conversion effi ciency up to 0.78% under AM 1.5 illumination

References: [1] P. Schilinsky, U. Asawapirom, U. Scherf, M. Biele, C. J. Brabec, Chem. Mater. 2005, 17, 2175. [2] M. Reyes-Reyes, K. Kim, D. L. Carrolla, Appl. Phys. Lett. 2005, 87, 83506. [3] G. Li, V. Shrotriya, J. Huang, Y. Yao, T. Moriarty, K. Emery, Y. Yang, Nat. Mater. 2005, 4, 864. [4] J. Y. Kim, K. Lee, N. E. Coates, D. Moses, T. Q. Nguyen, M. Dante, A. J. Heeger, Science 2007, 317, 222. [5] M.C. Scharber, D. Muhlbacher, M. Koppe, P. Denk, C. Waldauf, A.J. Heeger, C.J. Brabec, Adv. Mater. 2006, 18, 789. [6] J. C. Li a, H. Y. Leea, S. H. Leea, K. Zongb, S. H. Jin c, Y. S. Leea, Synthetic Metals 2009, 159, 201.

P - 022Probing Charge Transport in Hydrogenated Micro-crystalline Silicon Thin Films with Nanometer ResolutionA. Vetushka1, A. Fejfar1, M. Ledinsky1, B. Rezek1, J. Stuchlík1, J. Kocka1

1Institute of Physics, Academy of Sciences of the Czech Republic, v.v.i, Prague, Czech Republic

Solar cells made from crystalline silicon (c-Si) still dominate the photovoltaic industry but that may change as silicon thin fi lms can be produced relatively cheaply at low temperatures on large areas of wide range of substrates, including plastics. These fi lms range from classical amorphous hydrogenated silicon (a-Si:H) to microcrystalline silicon (μc-Si:H) or nanocrystalline silicon (nc-Si:H), which may combine the advantages of both amorphous and crystalline structures. The common feature of these materials is the presence of grain boundaries and a complex nanostructure which strongly depends on the growth conditions. The nanostructure of the fi lms defi nes electrical properties which in turn determine the effi ciency of the solar cells. Unfortunately, the relation between the microstructure and electronic transport is so complex that till now there is no widely accepted model of charge transport in μc-Si:H thin fi lms [1].

In this contribution we present our long-term eff ort to characterize both the structure and local electronic properties of μc-Si:H thin fi lms by the nanometer resolved measurements of local conductivity using a tip of atomic force microscope (AFM) [2-5]. Conductive AFM can measure simultaneously and independently topography and local conductivity of the sample with resolution down to few nanometers and so it can be used to address the existing controversy about what is the dominant route of electronic transport in these fi lms. However, the C-AFM technique itself is infl uenced by surface oxide, either native or created in the process of measurement by local anodic oxidation (LAO). Our experiments allowed us to understand the eff ect of oxide on the observed maps of conductivity. We describe the origin of the oxide-related artifacts and also a procedure how to avoid them. Based on these experiments we off er the model of charge transport, which is also supported by results from many other experimental techniques.

Our results of the conductive AFM of μc-Si:H may also serve as an example of the more general approach to correlating nanostructure and local electronic properties using the scanning probe methods [6].

References[1] Jan Kocka et al., Sol. Energy Mat. Sol. Cells 78, 493-512 (2003).[2] B. Rezek et al., Appl. Phys. Lett. 74, pp. 1475-1477 (1999).[3] B. Rezek et al., J. Appl. Phys. 92, pp. 587-593 (2002).[4] T. Mates et al., J. Non-Crystalline Solids 352, pp. 1011-1015 (2006).[5] A. Vetushka et al., submitted to Phys. Rev. B[6] J. Cermák et al., physica status solidi - rapid research letters 1, pp. 193-195 (2007)

This research was supported by AV0Z 10100521, LC510, LC06040, IAA1010413, KJB100100512 and KAN400100701 projects.


110

Posters

P - 023Impact of Ligands on CO2 Adsorption in Metal-Organic Frameworks: DFT Study of the Interaction of CO2 with Functionalised Benzenes. T. Antonio1, B. Rob G.1, M. Caroline1

1University College London, Chemistry, London, United Kingdom

Intermolecular interactions between the CO2 molecule and a range of functionalised aromatic molecules have been investigated using Density Functional Theory(DFT). The work is directed towards the design of linker molecules, which could form part of new metal-organic framework materials with enhanced affi nity for CO2 adsorption at low pressure. Three classes of substituted benzene molecules were considered: (i) with halogen substituents (tetrafl uro-, chloro-, bromo- and dibromobenzene), (ii) with methyl substituents (mono-, di-, and tetramethlybenzene) and (iii) with polar subsituents. In the benzene-CO2 complex, the main interaction is between the delocalised π aromatic system and the molecular quadrupole on CO2. Halogen substituents have an electron-withdrawing eff ect on the ring, which destabilises the π-quadrupole interaction. Weak “halogen-bond” and hydrogen bond-like interactions partially compensate for this, but not to the extent that any signifi cant enhancement of the intermolecular binding energy is observed. Methyl groups, on the other hand, have a positive inductive eff ect, which strengthens the CO2-aromatic interaction by up to 3 kJmol-1 in the case of tetramethylbenzene. Weak hydrogen bond-like interactions with methyl H also contribute to the stability of the complexes. The strongest interactions are with polar substituent groups, such as amino, nitro and sulphonate, where lone pair interactions and polarisation of CO2 dominate. With groups such as COOH and OH, cooperative hydrogen-bonding further enhances the binding energy. We also studied the eff ect of the most promising substituent groups in the interaction with CO2 within the crystalline environment of a MOF. DFT studies of the modifi ed benzene-di-carboxylate ligand of MIL-53(Al3+) with amino, carboxylic, di-methyl and di-hydroxyl groups show an increasing in the binding energy with CO2 in all the modifi ed MIL-53(Al3+) structures, due to the presence of synergic interactions, which are possible because of the crystalline environment and structural characteristics of the MOF.

P - 024Nanostructured bulk magnesium compounds for hydrogen storageP. Matteazzi1, A. Bianchin2, A. Colella2, C. Milanese3, A. Marini3

1MBN Nanomaterialia SpA, Hydrogen storage, Vascon di Carbonera (TV), Italy2CSGI, Nanomaterials, Firenze, Italy3Universita di Pavia, Chimica Fisica, Pavia, Italy

Safe systems for hydrogen storage should work at low pressure using environmental friendly materials. Effi cient systems should require the smallest energy amount to store hydrogen, as it occurs for gasoline, and they should be reversible.

Magnesium is a system able to meet all these characteristics, because it is cheap, light, ecofriendly, reversible and abundant element on earth.

In order to achieve the best performance in terms of effi ciency and reliability of desorption/absorption cycles, magnesium based systems have been produced using the High Energy Ball Milling (HEBM).

The HEBM process patented by MBN nanomaterialia® can provide nanostructured materials at industrial scale.

More than 500 diff erent compounds were produced and tested. From these materials a Mg-Ni alloy was selected doped with graphite and a metal oxide.

This material can adsorb and release about 6,5wt% of hydrogen in few minutes at the temperature of 280/310 °C.

Using bulk materials, instead of powders, the storage tank have the advantage of a more effi cient heating capabilities and an easier storage tank design and engineering. The nanostructured bulk materials have been obtained using several consolidation technologies.

A test station was developed to verify the eff ective performances of the nanostructured bulk materials in large quantities (besides the lab scale). The station performs hydrogen measurements using mass fl ow meters and it is controlled by PLC able to perform automated repeated charging (at 8-10bar and 280°C) and discharging (at 1-2 bar and 310-320°C) cycles.

It is shown that the kinetic performance of the Mg-Ni doped nanostructured bulk alloy is able to sustain a fuel cell: after the proper activation of the material, a single tank module can desorb 80% of the stored hydrogen (about 80g) in 25min at the pressure of 1,5 bar.

Perspectives of hydrogen storage using such nanostructured systems are further discussed.


111

Posters

Poster Session 3 - Nanotechnology for health and environment

P - 026High performance metal based hydrotalcite catalytic support for nanotubes growingA. Khinsky1, K. Klemkaite1, A. Sabino2, E. Garcia-Bordeje2, A. Monzon3

1Norta Ltd, Amiagus Research Department, Kaunas, Lithuania2CSIC, Instituto de Carboquimica, Zaragoza, Spain3Institute de Nanoscience of Aragon, Department of Chemical and Environmental Engineering University of Zaragoza, Zaragoza, Spain

The uniform distribution and reliable adhesion of carbon nanotubes (CNT) to support is very important topic in catalytic applications. Amiagus has developed very eff ective and reliable technology for compositional metal/hydrotalcite production, especially for nanotubes growing. Hydrotalcite coating (thickness 5-10 microns) is thermally sprayed on both sides of steel strip (thickness 30-40 microns).

Hydrotalcite coating of received semi product (total thickness 40-60 microns) has high adhesion to metal substrate and this permits to make any mechanical treatment, such as cutting, corrugation, perforation and etc. without depletion or peeling of sprayed hydrotalcite coating. Desirable catalytic unit (e.g. metal based honeycomb structure) can be produced in its fi nal shape.

Hydrotalcite coating after thermal spraying has microcrystalline structure of randomly distributed oxides of metals, which were introduced in hydrotalcite structure during its synthesis (e.g. Ni, Co, Fe etc.) and appear ideal support for CNT growing. Initial structure of sprayed hydrotalcite can be partly changed (size of oxides, transition to spinels, porous structure) by annealing at diff erent temperatures and adopted for optimal conditions of CNT growing.

The research of CNTs’ growth has been carried out by chemical vapor deposition (CVD), under diff erent conditions of temperature between 550 C and 650 C, using ethane as carbon source. This gas id fed into the reactor in changeable ratio of 25% and 100% of C2H6: H2, over hydrotalcite type coating. After reaction, obtained sheets were characterized with SEM and TEM. In addition, it was determined the weight of the CNT obtained, which considerably increased with raising C2H6:H2 ratio and temperature of reaction.

The SEM images showed the formation of forest of CNTs with variable size. It was also observed the diff erent sizes of encapsulated nickel particles within the carbonaceous material. The results of adherence calculated as weight lost did not show considerable changes with the changes of temperature of synthesis.

The works were performed as preliminary for MONACAT project devoted to water treatment.


112

Posters

P - 028The eff ect of silver nanoparticle in water disinfectionP. Ghanbarizadeh1, N. Talebbeydokhti2

1Islamic azad university of bandar abbas, Water and Wastewater Engineering, Bandar Abbas, Iran2Shiraz University, Civil and Environmental Engineering, Shiraz, Iran

1. Introduction The antibacterial and antiviral actions of silver, silver ion, and silver compounds have been thoroughly investigated. Silver nanoparticles are known to have antimicrobial properties against bacteria and viruses and because of their high reactivity due to the large surface to volume ratio, are expected to play a crucial role in water purifi cation. The low solubility of this metal in water served as a natural controlled-release mechanism which added trace amounts of these ions to the water. Polyurethane (PU) is one of the most attractive synthetic elastomers and is extensively used in biomedical applications. This support was chosen because the _N(H)COO_ (carbamate) group is expected to bind with the surface of the nanoparticles.

2. Methods The synthesis of Ag@citrate was done according to the procedure of (Kamat et al., 1998) with silver nitrate & sodium citrate. Structural characteristic and morphology of silver nanoparticles were examined with UV-vis spectrophotometer and TEM. Polyurethane (PU) foams were soaked in silver nanoparticle solution. The coated PU foams were characterized with SEM and EDX. E. coli ATCC 25922 was selected, using McFarland standard to achieve 1×105 cfu/ml in distilled water. For microbial test, pieces of the foam were put into the test tubes with 5 mL E. coli suspension. After diff erent contact times, the foam were squeezed to get the treated water.

Plating was done with this treated water with Endo-c agar. Plating was also done with uncoated PU-treated water. Three diff erent pH was prepared with citric acid and NaOH, six turbidities were prepared with formazine. Then plating was done as explained. Measuring of silver was done with polargraph Metrohm model 757 in treated water.

3. Results A peak at 419 nm, clearly indicates the presence of silver nanoparticles in solution . TEM images show nano sized silver in solution. EDX analysis of pure PU and PU coated with nanosilver prove the presence of silver in PU after coating and washing it . At concentration of 1×105 cfu/ml, after 10 min contact time, there was no growth on nutrient agar nor Endo-c agar. pH and turbidity changes, have little eff ect on removal effi ciency. There is not any silver in treated water.

4. Conclusion Some antimicrobial agents are toxic so there is much interest in fi nding new safe types. The performance of the material as an antibacterial water fi lter after coating with silver nanoparticle was proved. In developing countries, usage of fi lters, zeolites and activated carbon coating with silver, can be useful in home water purifi cation.

P - 029Antibacterial eff ect of nanosilver, microsilver and silver nitrateE. Skrivanova1, M. Marounek1

1Institute of Animal Science, Physiology of Nutrition, Prague, Czech Republic

Background: The antibacterial activity of silver ions and silver-based compounds has been known for a long time. Silver nitrate and silver sulfadiazine have been traditionally used in past few decades. However, in consequence of increased usage of Ag+ containing products, it is unsuprising that high numbers of Ag-resistant bacteria have been isolated. Following the constant drive to develop antibacterial compound to which resistance is unlikely to evolve, silver nanoparticles have been studied for their antibacterial eff ect. The aim of this study was to evaluate and compare antibacterial activity of silver nanoparticles, microparticles and AgNO3 against representative enteropathogenic bacteria and food borne pathogens.

Methods: Silver nanoparticles with particle size ranging from 10 to 60 nm, silver microparticles less than 45 μm and silver nitrate were used in this study. Enteropathogenic Escherichia coli, Salmonella enteritidis, S. infantis, Campylobacter jejuni, Arcobacter butzleri, A. cryaerophilus, A. skirrowii, Staphylococcus aureus, Pseudomonas aeruginosa and Clostriduim perfringens were incubated in medium containing 10, 50 or 100 μg/ml of the three forms of silver in orbital shaker. Every hour, 1 ml of medium was removed and immediately freezed at -20°C for further analyses. As Campylobacteraceae possess weak biochemical activity and cause a very small turbidity of medium, numbers of all bacteria (Log10 CFU/ml) were analyzed using the Q PCR technique of lysed cells using specifi c primers. Strains used in this study incubated in the same media without the silver were used as the control. Results were used for bacterial growth curves construction, where generation time and specifi c growth rate were counted and duration of lag phase was determined.

Results and conclusion: The highest antibacterial activity showed AgNO3, followed with the nanosilver. The lowest antibacterial activity was observed in the case of microsilver. Nanoparticles of silver did not change the generation time of bacteria and the specifi c growth rate, but it markedly extended the lag phase. Arcobacter spp. was found to be the most susceptible to all forms of silver. AgNO3 caused no growth of majority of bacteria used in this study. It can be concluded that nanoparticles of silver did not show the same antibacterial activity as AgNO3 in liquid environment. However, nanosilver extended lag phase and showed bacteriostatic eff ect, that was more pronounced in Gram negative bacteria.

The study was supported by the Ministry of Agriculture of the Czech Republic (project MZe 0002701404).


113

Posters

P - 030Adsorption Behavior of Molybdenum(VI) on modifi ed mesoporous zirconium silicatesH. Sepehrian1, S.W. Husain2, J. Fasihi1, M. Khayatzadeh Mahani1

1Nuclear Science and Technology Research Institute, Chemistry research Group, Tehran, Iran2Islamic Azad University, Department of Chemistry, Tehran, Iran

In this study, molybdenum(VI) ion adsorption on modifi ed mesoporous zirconium silicates, Zr-MCM-41, synthesized from sodium silicate, zirconium oxychloride and cethyltrimethylammonium bromide (CTAB) is considered. Zr-MCM-41 has potential as an adsorbent material, with a regular hexagonal pore structure, large specifi c surface area, and large pore volume. The adsorbent is characterized using powder X-ray diff raction and nitrogen adsorption and desorption isotherm data. Adsorption behavior of molybdenum on the Zr-MCM-41 adsorbent was studied. Experimental adsorption isotherm was successfully described by Freundlich model. The pH eff ect and adsorption kinetic were studied by batch method. The adsorption capacity of molybdenum varied signifi cantly with the pH of the solution. It was found that adsorption capacity is very high in the pH range of 2-3 and adsorption deceases with increasing of the pH value.

P - 031Characterization of biocide free antifouling coatingsW. Schrepp1

1BASF SE, Polymer Physics, Ludwigshafen, Germany

The poster presents results from the AMBIO (Advanced Nanostructured Surfaces for the Control of Biofouling) EU-project aiming at antifouling coatings without the use of biocides. In addition to the extensive bio-fouling tests the physico-chemical characterization of the coatings will be highlighted.

Besides the trivial property of mechanical stability under (artifi cial) seawater conditions a variety of other key properties are of importance i.e. wetting behavior (polarity, surface energy, wetting under immersed conditions), elasticity, hardness (both determined by nanoindentation), roughness as well as surface composition.

An important parameter -especially referring to the AMBIO goals- is surface morphology determined by scanning electron microscopy and chemical composition determined by energy dispersive x-ray spectroscopy.

In particular AFM investigations of coatings of coatings under real conditions i.e. under seawater will be presented [1]. Surface nanostructures and changes thereof under seawater can be revealed.

References[1] E. Martinelli, S. Agostini, G. Galli, E. Chiellini, A. Glisenti, M.E. Pettitt, M.E. Callow, J.A. Callow, K. Graf, F.W. Bartels, Nanostructured Films of

Amphiphilic Fluorinated Block Copolymers for Fouling Release Applications, Langmuir 24 (2008) 13138 - 13147

P - 032Preparation and characterization of nanostructured anodic titania fi lms for gas sensor applicationsG. Gorokh1, A. Mozalev1, V. Khatko1, D. Solovei1

1Belarusian State University of Informatics and Radioelectronics, Micro- and Nanoelectronics, Minsk, Belarus

In this work we present a novel electrochemical approach to the formation of easy-controlled nanostructured titania fi lms and show the preliminary experimental results of investigation of their physical, chemical and gas-sensing properties.

Nanostructured titanium oxide thin fi lms were formed in the several steps. Thin Al(1 μm)/Ti(0.3 μm) bilayers deposited by rf magnetron sputtering onto n-type Si substrates were fi rstly anodized in 0.2 M H2C2O4 solutions at a constant current of 10 A /cm 2 and a steady-state voltage ranging 30 to 53 V. During this stage a porous alumina fi lm was formed from the aluminium layer and the underlying titanium was partly and locally oxidised through the alumina pores. Then the specimens were reanodised to a higher voltage ranging 90-150 V. Finally, after selective dissolution of the alumina ‘host’, the nanostructured titania fi lms were annealed in a vacuum at 200-12000C. The specimens were examined by SEM, XPS and XRD. Gas sensing properties of the fi lms were assessed by measuring the in-plane electrical resistivity in the presence of either pure air or NO2 gases of various concentrations in a temperature range of 100 - 300oC.

The SEM and XRD results have shown that, after the electrochemical processing of the Al/Ti bilayer, the titanium fi lm was eff ectively oxidized through the alumina pores. As a result, the titania fi lled the bottom parts of the alumina pores thus getting a self-organised nano-hillock structure. The mean diameter of the hillocks and their height were up to 50 nm and 150 nm respectively. Successive annealing of the samples in vacuum promoted the order of phase transformations in titania hillocks. A stable amorphous phase of titania is formed at temperatures up to 400°C. Above 400°C this amorphous phase is transformed to anatase. Further, the new phase - rutile appears together with anatase. Upon reaching a defi nite temperature of annealing, the titania only consists of rutile which remains after cooling the samples down to room temperature. The responses of the annealed nanostructured titania fi lms to the temperature change and to introducing NO2 gas were investigated. Test sensors showed clear responses to NO2 already at 1500C and the nanostructured titania fi lms behaved as a low-resistance n-type semiconductor, suitable for gas-sensor applications.


114

Posters

P - 033Minimizing the antibiotics environmental pollution using nanotechnologiesM. Badea1, N. Mihailescu1, V. Daescu1

1The National Institute for Research and Development in Environmental Protection, IM, Bucharest, Romania

Background Modern day pharmaceutical companies developed powerful, an apparent high-tech solution to get microbes such as harmful bacteria under control. Bacteria and other microorganisms that cause infections are becoming remarkably resilient and can develop ways to survive drugs meant to kill or weaken them. This antibiotic resistance is due largely to the increasing use of antibiotics.

Just consider the fact that by some estimates 70% of U.S. antibiotics (25 million pounds) are given to farm animals - not to treat disease, but to promote slightly faster growth and to compensate for crowded and unsanitary living conditions. These antibiotics fi nd their way, through our food, into our bodies. Antibiotics have even been found in breast milk.

Objectives The present paper aims to highlight the antibiotics fate and pathways among diff erent environmental compartments, including human health and how nanotechnologies can act in order to reduce the antibiotic pollution and, subsequently the generation of antibiotic resistance, as well as the need of developing risk assessment methodologies for nanotechnologies.

Results and conclusion Mainly, the antibiotics are used like therapeutic agents, prophylactic agents or Growth promoters (feed additives). For each of these application there are available appropriate nanotechnologies, such as nano-enriched feed, nanotubes, silver nanoparticles, etc.

Nanotech has great potential to really restrict the spread of foodborne disease, reduce the amount of pesticide on crops and antibiotics in livestock and help with supply-chain planning. The emerging fi eld of green nanoscience faces considerable research challenges to achieve the maximum performance and benefi t from nanotechnology while minimizing the impact on human health and the environment.

Life cycle studies of emerging nanotechnologies are susceptible to huge uncertainties due to issues of data quality and the rapidly evolving nature of the production processes.The Japanese Ministry of the Environment released guidelines on March 10, 2009, with the intent of reducing the risk of environmental harm from nanomaterials. The guidelines point out potential risks in nanomaterial manufacturing and urge companies to adopt policies that limit releases.

In order to enjoy the benefi ts of nanotechnology it is necessary to manage nanomaterials so as not to adversely aff ect humans and animals, especially those that would be manufactured for industrial applications to which humans and animals are likely to be exposed the most.”

P - 034Laser synthesis of the metal nanoparticles and its application in laser surgery A. Lalayan1

1Yerevan State University, Yerevan, Armenia

Nanoparticles have a great potential for various applications in the modern spectroscopy, medicine, biology, near fi eld microscopy, integrated optics, lasers, etc.[1] In biomedicine main interest arises nanoparticles with sizes that are small enough to remain in the circulation after injection and to pass through the capillary systems of organs and tissues avoiding vessel embolism. Recently, the laser synthesis of nanoparticles with the smallest sizes of nanoparticles up to 2-3nm [2,3] by the laser ablation in liquid media has been demonstrated. In the present work YAG:Nd laser with 1064nm wavelength, pulse duration of timp=33ps, was used for syntheses of colloidal Ag, Ni, Ti nanoparticles in the distillated water. Laser welding and ablation of biotissue stained with the metal nanoparticles has been studied on samples of chicken skin. The continuous wave YAG:Nd laser with an output beam diameter of 2mm and power up to 4W was used for the biotissue welding and ablation. Two areas of sample: unstained and stained with metal nanoparticles were ablated at the same dose of the laser irradiation. The size of ablated area that was colored with nanoparticles is 2.5-3 times larger than for non colored area. This result demonstrates that by using metal nanoparticles in laser surgical procedures we can signifi cantly reduce the dose of the irradiation. Application of nanoparticles in laser surgery allows also eff ectively to use IR laser light that penetrates deeply and is absorbed poorly by native tissue, but is absorbed strongly by the nanoparticles. This advantage can be used for development of the new scheme of laser welding in biotissue depth. The scheme of point welding was performed for two samples of chicken skin with thickness of 2mm each. The contact surfaces of samples were colored with the silver nanopatricles. The laser radiation penetrates through the fi rst sample without production of the visible damage of tissue and riches the interface of samples that contain nanoparticles. Due to strong absorption of light by nanoparticles and subsequently selective heating of the surrounding tissue the local spot welding of samples can be performed by optimization of the laser irradiation dose. Furthermore, great interest arises application of Ag nanoparticles in laser surgery because they exhibit microbicidal eff ect and therefore can signifi cantly improve a postoperative healing of patients. It is also important because tissue photoheating could cause infl ammatory process due to local antimicrobial resistance reduction, thus this negative eff ect could be also minimized.

References [1] Alivisatos, A.P. J. Phys. Chem. 1996,100, 13226 -13239. [2] Lalayan, A. et al. Laser Phys. Lett. 2005, 2,12-15. [3] Svrcek V. et al. JLMN-Journal of Laser Micro /Nanoengineering 2007,2,15-20.


115

Posters

P - 035Effi cient immunoaffi nity carriers for in-chip isolation and pre-concentration of Alzheimer disease biomarkersM. Slovakova1, L. Korecka1, B. Jankovicova1, Z. Zverinova1, R. Mohamadi2, L. Hernychova3, J.L. Viovy4, Z. Bilkova1

1University of Pardubice Faculty of Chemical Technology, Dept. Biological and Biochemical Sciences, Pardubice, Czech Republic2Institute Curie, Laboratory of Physical Chemistry, Paris, France3University of Defence, Institute of Molecular Pathology, Hradec Kralove, Czech Republic4Institute Curie, Laboratory of Physical Chemistry, Paris, France

Medical practice is about to enter a new era focused on the nanomedicine based on the application of nanoscale technologies to the practice of medicine, namely, for diagnosis, prevention, and treatment of disease. The creation of nanodevices is one long-term goal. This study is concerned with development a prototype of a miniaturized system for diagnostics in the early stage of Alzheimer disease (AD), which is the most prevalent cause for dementia in the elderly population today. The system is based on construction of an effi cient immunoaffi nity carriers for isolation and/or pre-concentration of AD biomarkers present in blood and CSF, such as Aβ peptides and Tau protein. Innovative affi nity carriers with suffi cient binding capacity will be an integral part of microfl uidic device fabricated from polydimethylsiloxane [1].

Immunoaffi nity carriers were prepared by oriented immobilization through carbohydrates of specifi c anti-Aβ or anti-Tau antibodies on superparamagnetic microparticles with hydrazide function groups [2].Consequently the carriers were self-organized under the magnetic fi eld in the channel of the microfl uidic device in order to create a compact microcolumn with auto-calibrated micron-sized pores. Binding effi ciency and specifi city of developed immunosorbents were validated by immunoprecipitation from human serum and CSF spiked with synthetic Aβ peptides or Tau protein and also from real biological samples of patients suff ering from AD. The immunocapture of the biomarkers was performed by circulating sample through the immunoaffi nity microcolumns. Releasing of captured proteins was realized by the change of pH and released biomarkers were detected by Tris-Tricin-SDS-PAGE-urea [3] and MALDI-TOF-MS.

Due to the extremely low levels of AD biomarkers in biological samples, ranging from tens of ng/ml to hundreds of pg/ml, it is necessary to achieve a maximal specifi c and eff ective system for detection and a pre-concentration step will be anyway required. The miniaturization and integration are intended to extend the sensitivity of biomarker detection, and thus improve the precocity of diagnosis. Newly developed magnetic immunoaffi nity carriers in combination with microfl uidic device have plenty of advantages and provide proper tool for rapid and sensitive detection of AD biomarkers.

Acknowledgements: This work was supported by the E.C. project NeuroTAS No. 037953 and the Ministry of Education of Czech Republic (MSMT 0021627502).

References:[1] M. Slovakova et al., Lab. Chip 5 (2005) 935. [2] B. Jankovicova et al., 7th International Conference: Scientifi c and Clinical Applications of Magnetic Carriers (2008).[3] H.-W. Klafki et al., Anal. Biochem. 237 (1996) 24.

P - 036Highly effi cient photocatalysts for clean and healthy environmentV. Kalousek1, J. Rathousky1

1J. Heyrovsky Institute of Physical Chemistry of the ASCR v. v. i., Department of Structure and Dynamics in Catalysis, Prague, Czech Republic

Air pollution and the soiling of the external surfaces of buildings are among the major present-day issues. Photocatalytic oxidation is a promising technology for the purifi cation of air and removal of solid and liquid deposits. Its main advantage over other oxidation treatments is the ability to degrade pollutants at ambient pressure and temperature from the direct absorption of light. Providing the surfaces with a fi nish which is photocatalytically active and exhibits stable illumination-induced superhydrophilicity is a promising route how to render them self-cleaning.

We have developed a low-cost and feasible procedure for the preparation of mesoporous fi lms of TiO2, which is based on a template-assisted EISA mechanism and spray-coating technique with controlled thickness deposited on surfaces of any shape and size. The self-cleaning performance of mesoporous TiO2 fi lms was tested by following the decomposition of a layer of oleic acid as modelling the soiling of the surface. The photocatalytic decomposition of oleic acid being followed by measuring the decrease in the contact angle for water, which is expected proportional to the degree of its degradation. The photocatalytic test in the gaseous phase was carried out by photocatalytic oxidation of NO. The surface of the photocatalyst was fi rst equilibrated with gaseous NO/water vapour/air mixture. After switching on the light there was very fast increase of the conversion of NO. This fast increase is followed by a decrease in conversion effi ciency.

In summary, mesoporous fi lms of TiO2 prepared by the low-cost spraying procedure are highly promising photocatalysts for the decomposition of pollutants present at very low concentrations in the gas-phase and for the self-cleaning fi nish of the surfaces. The authors are thankful to the Grant Agency of the Czech Republic for the fi nancial support (grant. No. 104/08/0435-1).


116

Posters

P - 037Chemical nanosensorsG. Di Francia1, V. La Ferrara1, E. Massera1, D. Della Sala2, B. Alfano2

1ENEA, FIM Matnano, Naples, Italy2ENEA, FIM Matnano, Rome, Italy

The presentation will report on the current status and the future perspectives of the research activities in the fi eld of chemical nanosensors.

This is one of the most immediate and promising application of nanotechnologies since most materials in the nanostate exhibit enhanced chemical reactivities, even at room temperature. This peculiar physico-chemical property originates from a cooperation among several specifi c characteristics: quantum confi nement, surface-to-volume ratio and specifi c surface termination, nanoparticle doping and morphology, aggregation and agglomeration states.

Like other nanoelectronic or nanophotonic devices, nanosensors construction critically relies on the ability to fabricate functional heterostructures and interfaces with the designed characteristics. Several approaches have been proposed in this view, but many issues remain to be addressed, the most challenging being probably the defi nition of a fabrication process suitable for interfacing the nanodevice to the macroworld.

In this respect, “growth in place” approaches have recently shown to be eff ective in overcoming, at least in part, such diffi culties because they allow the fabrication of the nanomaterial exactly where the nanodevice architecture requires it, strongly simplifying the process and avoiding nanomaterial deterioration through manipulation.

In Fig.1, as an example of the growth-in place approach we report on a hydrogen sensor based on a single Pd nanowire fabricated on nanoelectrodes patterned by the combined used of Focused Ion Beam (FIB) and Dielectrophoresis (DEP).

In Fig. 2 the H2 nanosensor response to various hydrogen cycles is shown. The device is sensitive and reversible in the range 0.5% to 4% in dry air, even at room temperature.

Finally, the possible applications of nanosensor devices in diff erent fi elds such as environment monitoring, food, transport etc. will be also discussed.

Fig. 1: H2 nanosensor fabricated by the growth in place of a single Pd nanowire between two Pt nanoelectrodes.

Fig. 2 The H2 nanosensor response to various hydrogen cycles.


117

Posters

P - 038A novel fused protein-based vector for targeted cancer gene deliveryM. Ramezani1, Z. Karjoo1, A. Hatefi 2

1School of Pharmacy, Biotechnology, Mashhad, Iran2Washington State University, Pharmaceutical Sciences, Washington, USA

A receptor-mediated non-viral gene delivery system which can transfer gene to a specifi c tissue with less toxicity and high transfection effi ciency is the main goal of gene delivery studies. Such vector should provide suffi cient uptake and expression of a transgene to a specifi c cell type without triggering immune response or undesirable eff ect. Synthetic polycations seem not to fully fulfi l these criteria. A nature-inspired and multi-segment peptide is supposed to be capable of providing more homogenous and less toxic vectors for targeted delivery of foreign nucleic acid to special cell lines. The multi-segment programmable peptide designed in this study uses the natural ability of 4 repeats of a part of histone H1 sequence in DNA condensation and protection. Also, a short 13-mer motif leads to a very specifi c interaction between the vector and over-expressed receptors on breast cancer cell surfaces. Therefore, the sequence of above mentioned peptide vector was reverse translated to DNA sequence and then chemically synthesized. It is subsequently cloned to an expression vector [namely pEt28(b)] and the cloning was verifi ed by restriction enzyme analysis, PCR and sequencing analysis. The recombinant plasmid was transferred to E. coli BL 21(DE3)plysS. The Recombinant protein was purifi ed by the use of His tag sequence added to SK1by its N-terminal during translation. Recombinant protein identity was confi rmed by SDS-PAGE, western blotting and MALDI-TOF. The resulted peptide-based vector is now under assessment for its ability in successfully targeting only breast cancerous cells and delivering its DNA cargo (reporter gene) toward nucleus.

P - 039Signal amplifi cation by light induced polymerization for DNA microarraysC. Del Rio1, P. Winklehner1, C. Mittermayr1

1Lambda GmbH, R&D, Freistadt, Austria

Photopolymerization of an organic monomers has been proposed as a non-enzymatic signal amplifi cation method. Instead of a fl uorophor a photoinitiator (Eosin) is used as label. After the labelled target is captured the monomer solution (polyethylenglycol diacrylate and 1-vinyl-2-pyrrolidinone and triethanolamine) is added and the microarray is irradiated by light that is absorbed by the photoinitiator.

The irradiation creates a radical that starts the polymerization reaction. After the excess reagents have been washed away the colorless polymer has to be visualized.

Various visualization strategies have been proposed and tested, like simple staining of the polymer with a dye, or incorporation of signal generating entities into the polymer, like fl ourescent nanoparticles or dye molecules.

We present here results of using incorporation of fl ourescent nanoparticles and an enzyme (HRP) that can generate various kinds of signals: colorimetric, chemiluminiscent or fl ourescent.

The experiments with fl ourescent nanoparticles showed that those visualization methods are promising, but that the nanoparticles with a carboxylate surface produced high unspecifi c background signals on amino modifi ed polymer slides. Blocking reduced the background but not suffi cient for high sensitive detection. Experiments with incorporating HRP into the polymer showed that the reaction conditions did not destroy the enzyme activity so this seems to be quite a promising approach.


118

Posters

P - 040Detection of organic molecules encapsulated inside single-walled carbon nanotubes by means of transmission electron microscopyG. Tobias1, B. Ballesteros2, L. Shao3, M.L.H. Green3

1Institut de Ciencia de Materials de Barcelona (ICMAB-CSIC), Campus UAB, 08193 Bellaterra (Barcelona), Spain2Centre d’Investigació en Nanociencia i Nanotecnologia (CSIC-ICN), Campus UAB, 08193 Bellaterra (Barcelona), Spain3University of Oxford, Inorganic Chemistry Laboratory, OX1 3QR Oxford, United Kingdom

One of the emerging goals of nanotechnology is the development of new and eff ective drug delivery systems. Nano-tubular structures are highly attractive as carrier systems since their needle-like shape grants them an enhanced capacity to penetrate cellular membranes and have the potential to carry multiple moieties at high density. Furthermore, whilst the external walls can be covalently or non-covalently modifi ed, their inner voids may be loaded with a chosen therapeutic cargo. Transmission electron microscopy (TEM) is one of the most powerful techniques for direct imaging and analysis of nanostructures and provides structural information down to the atomic scale. Whilst widely used for the characterisation of inorganic materials, their use for organic compounds is limited by lack of structural periodicity and the presence of low-scattering elements (H, C, N, O). Moreover, when working with single-walled carbon nanotubes (SWNTs), organic molecules may be easily confused with amorphous carbon present in the sample, which often covers the SWNT walls. In the present study, we overcome the limitation of TEM techniques to detect organic molecules encapsulated inside SWNTs by either labeling them with a high scattering heavy element, or by choosing organic molecules bearing heavy elements that serve as tags. For the detection of these heavy element tagged molecules, scanning transmission electron microscopy (STEM) is preferred over high resolution electron microscopy (HRTEM). The high-angle annular dark fi eld (HAADF) images in STEM (also called Z-contrast images) scale approximately with the square of the atomic number, resulting in heavy elements appearing brighter than light elements. Here we present our results on imaging erythrosine B and the caesium salt of acetylsalicylic acid encapsulated into SWNTs. Their detection has been possible due to the presence of iodine and caesium respectively, where a large contrast is observed between I or Cs (Z = 53, 55 respectively) and C (Z = 6). We believe that that this direct detection technique could play a valuable role in the verifi cation of the fi lling of organic therapeutic cargos into carbon nanotubes.

P - 041Case study: Zero-valent nanoiron application for groundwater remediation in Horice v PodkrkonosíL. Lacinová1, J. Hrabal2, M. Cerník1

1Technical University of Liberec, Faculty of Mechatronics Informatics and Interdisciplinary Studies NTI, Liberec, Czech Republic2MEGA a.s,, Stráž pod Ralskem, Czech Republic

There are many sites contaminated with diff erent type of pollutants - chlorinated hydrocarbons (CHC), PCBs, heavy metals etc. in the Czech Republic. In-situ zero-valent nanoiron (NZVI) application is an innovative and progressive method and besides application of permanganate the most used chemical decontamination method. Since 2004 seven pilot application of NZVI at diff erent geological and hydrogeological conditions and diff erent types of contaminants has been carried out in Czech Republic.

Object of this paper is a case study of NZVI application in Horice v Podkrkonosí with a detail description of whole process from laboratory experiments to pilot test and full-scale application and a results presentation.

The aquifer is composed of sedimentary rocks of loess origin. The main contaminant in the groundwater is PCE (about 30 mg/l), concentration of TCE and 1,2-cis-DCE is about 2000 ug/l. Design of laboratory tests was the batch experiments with soil and groundwater. In these tests were determinated eff ective NZVI dose and then reaction rate of contaminant removing. In the pilot tests was used both pressure injection to wells and “direct push” technique for NZVI application. There was carried out monitoring of CHC, pH and ORP for several months.

In the pilot application was verifi ed, that NZVI is successful agent for locality remediation and because of poor permeability of aquifer “direct push” technique is recommended for this site.

Acknowledgements

The authors want to acknowledge for support Academy of Science of the Czech Republic for grant no. KAN 108040651 and Ministry of Education, Youth and Sports for research project no. 1M0554.


119

Posters

P - 042Evaluation of Anticancer Eff ects of Epigallocatechin Incorporated in Carbohydrate NanoparticlesS. Rocha1, P. Juzenas2, M.d.C. Pereira1, M. Coelho1

1Faculty of Engineering University of Porto, Department of Chemical Engineering LEPAE-Laboratory, Porto, Portugal2Institute for Cancer Research Norwegian Radium Hospital Rikshospitalet University Hospital, Department of Radiation Biology, Oslo, Norway

Background: Polyphenol extracts from tea are potential candidates for growth inhibition and induction of apoptosis of cancer cells. Combined eff ect of X-radiation with antioxidant epigallocatechin from green tea extract to enhance apoptosis of cancer cells has been reported [1].

Objectives: Carbohydrate nanoparticles with entrapped Epigallocatechin gallate (EGCg) have been produced and their eff ect on the growth of prostate cancer cells has been analyzed.

Methods: The encapsulation process consisted of preparing an aqueous solution of arabic gum and maltodextrins, incorporating the antioxidant with stirring and spray-drying the solution [2]. The particles are spherical with diameters ranging from 8 to 400 nm and have a zeta potential of -33.1± 1.9 mV. The eff ect of nanoparticles loaded with EGCg on prostate cancer cell line DU145 has been studied using MTT and caspase-3 activation tests and clonogenic assays.

Results: Both MTT and caspase 3 activation assays proved that nanoparticles loaded with EGCg induce apoptosis of prostate cancer cells when incubated for 24 or 48 hours. Clonogenic assays showed that encapsulated extracts were more effi cient in inhibiting colony formation when compared to free antioxidants.

Conclusion: The results presented here show that EGCg has potential anticarcinogenic eff ects and that carbohydrate nanoparticles are promising EGCg delivery systems as they lower the concentration at which the antioxidant is active by protecting it from degradation.

References:[1] S. Baatout, P. Jacquet, H. Derradji, D. Ooms, A. Michaux, M. Mergeay, Study of the combined eff ect of X-irradiation and epigallocatechin-gallate

(a tea component) on the growth inhibition and induction of apoptosis in human cancer cell lines, Oncol. Rep. 12 (2004), pp. 159-167. [2] I. Ferreira, S. Rocha and M. Coelho, Encapsulation of antioxidants by spray-drying, Trans. 11 (2007), pp. 713-717.

P - 044Nanocarrier Porphyrin-Cyclodextrin Conjugates as Versatile Supramolecular Approach for Multimodal Cancer TherapyV. Kral1, T. Briza1, J. Kralova2, Z. Kejik1, P. Pouckova3, P. Martasek3 1Institute of Chemical Technology, Analytical Chemistry, Prague 6, Czech Republic2Institute of Molecular Genetics, Academy of Sciences in Prague, Prague 4, Czech Republic3Charles University in Prague, First Medical Faculty, Prague 2, Czech Republic

Nanocarries made by self-assembly supramolecular approach represents important approach how to achieve desired function: controlled and targeted drug delivery. While many such systems rely on covalent attachment of drug to polymeric carrier, our approach is based on self-assemble of selected tectones to create functional supramolecular systems with designed recognition and binding properties for drugs in question. Our versatile lego systems allow versatility in terms of building blocks and drug selectivity. Thus this way we created from metalloporphyrins and cyclodextrins self assembled drug nanocarriers. As porphyrin building block represent also fl uorescence label with photosensitizing properties, this method can be used as single therapy or in combination with other therapeutic modes. Characterisation of self-assembled nanocarries - cyclodextrin-porphyrin will be presented, together with selectivity for drugs based on inclusion complex formation. The complexation of nanocarries to biopolymers, such as human imunoglobuline was tested for selective and eff ective multifunctional drug delivery and combined therapy.

Acknowledgements

This work was supported by grants from the Ministry of Education of the Czech Republic - MŠMT 1M 6837805002, LC 512, MSM0021620857, AV0Z50520514, project LC06077 and MSM6036137307 and projects AV0Z50520514 and grant KAN200200651 awarded by the Grant Agency of the Academy of Sciences of the Czech Republic and Grant Agency of the CZ No. 203/09/1311


120

Posters

P - 045High Effi ciency Enantioseparation in Capillary Electrochromatography (CEC)Using Submicron Porous Silica Particles T.T.Y. Tan1, S.C. Ng1, L. Li1

1Nanyang Technological University, School of Chemical and Biomedical Engineering, Singapore, Singapore

Capillary electrochromatography (CEC) has become a versatile, capillary separation technique which combines attractive features of micro-high performance liquid chromatography (HPLC) and capillary electrophoresis (CE). In CEC, the electro-osmotic fl ow (EOF) transports the mobile phase and the solutes through the column. This type of fl ow has favourable properties compared to the viscous fl ow used in a HPLC separation system. Flow velocity diff erences in the axial direction leading to band broadening by Eddy diff usion are much smaller in electrical driven solvent transport than in HPLC. Furthermore, the EOF is generated by the charge of the silica particles, as well as by the charges at the capillary wall, in contrast to pressure-driven solvent transport. This allows the usage of much smaller particles or longer separation columns than in HPLC.

To the best of our knowledge, no chiral-functionalized silica porous submicron particles have been applied in CEC. In current work, we report, for the fi rst time, the development and application of such particles in enantiosepration in CEC. A facile approach to fabricate submicron chiral porous silica packed capillaries for CEC application is presented. The submicron silica particles formed were highly uniform at 660 and 810 nm, with specifi c surface and pore size of about 227 m2/g and 7 nm, and 215 m2/g and 8 nm, respectively. Chiral (R/S)1-(4-iodo-phenyl) ethanol was chosen as the analyte to evaluate enantioseparation in CEC for the 660 and 810 nm chiral silica packed capillaries and compared with 3m chiral silica column. High enantioseparation effi ciencies were obtained when the 660 and 810 nm chiral silica capillary packed capillaries were used. A separation effi ciency as high as 475000 plates/m. Baseline separation was not possible using the 3 m chiral silica capillary. The capillaries are highly stable and reproducible, giving similar retention times after fi ve repeats. The current work has shown high effi ciency enantioseparation using submicron chiral silica as the packing material in CEC.

P - 046The encapsulation of monoacylglycerol into polymeric nanoparticles by several processesP. Chiewpattanakul1, E. Marie2, B. Thanomsub1, A. Durand3

1Srinakharinwirot University, Microbiology, Bangkok, Thailand2Nancy-Université, Laboratoire de Chimie Physique Macromoléculaire, Nancy, France3Nancy-Université, Laboratoire des Sciences du Génie Chimique, Nancy, France

Background Monoacylglycerols have been shown to exhibit good emulsifying properties due to their amphiphilic structure. They are widely used in food and pharmaceuticals industries as well as in health services. Moreover, they are reported in inhibitory eff ect against some types of microorganisms [1]. These biosurfactants can be extracted from crude extracts obtained from cultivation of microorganisms.

Objectives Encapsulation of monoacylglycerols into polymeric nanoparticles was particularly considered in this work. The best conditions and process for encapsulating the monomyristin; one kind of monoacylglycerol, into polymeric nanoparticles were investigated. The nature of the core material as well as the encapsulation process was varied.

Results In order to avoid the structural complexity of biosurfactant mixtures, it was decided to use a well-defi ned biosurfactant obtained by direct synthesis. Monomyristin was thus synthesized following a known procedure and the purity of the product was checked by NMR spectroscopy. Two diff erent processes were investigated: emulsion/solvent evaporation and nanoprecipitation [2]. Several hydrophobic matrixes were tested for the nanoparticles: poly(lactic acid) (PLA) and a hydrophobically modifi ed polysaccharide obtained after chemical modifi cation of dextran (neutral bacterial and biocompatible polysaccharide) [3]. The surface of the nanoparticles was covered by a hydrophilic layer ensuring colloidal stability and preventing the non-specifi c adsorption of proteins. This superfi cial layer was obtained by controlling the adsorption of hydrophobically modifi ed dextran molecules with a low degree of modifi cation [4].

The main characteristics of the obtained nanoparticles (average size, colloidal stability, composition) were related to their conditions of elaboration. The nature of the core material was shown to have a strong infl uence on the encapsulation effi ciency and on the size of the obtained nanoparticles. Blends of PLA and hydrophobically modifi ed dextran appeared to improve the characteristics of the fi nal particles.

References[1] J. Růžička, K. Velclová, R. Janiš, J. Krejčí. Eur Food Res Technol 217 (2003) 329 [2] M. Léonard, E. Marie, M. Wu, E. Dellacherie, T. A. Camesano, A. Durand, ACS Symposium Series 996 (2008) 322 [3] A. Aumelas, A. Serrero, A. Durand, E. Dellacherie, M. Léonard, Colloids Surf. B : Biointerfaces 59 (2007) 74 [4] C. Rouzès, A. Durand, M. Léonard, E. Dellacherie, J. Colloid Interface Sci. 253 (2002) 217


121

Posters

P - 047Monitoring of nano Particles PM10 and PM2.5 in the Mitrovica Urban Atmosphere - KosovoA. Syla1, A. Veliu1, S. Makolli1

1Institute of Environmet, Air quality, Mitrovica - Kosovo, Albania

Abstract: The city of Mitrovica, approximately 40 km north of Prishtina, was the site of one the largest lead smelters in Europe. The present environmental situation in Mitrovica, puts us in front of the responsibility to act more rationally towards nature and to be more responsible towards the protection of the environment for future generations. The lack of environment protection during the last ten years, as well as the confl ict in Kosovo is the origin of huge problems regarding present environmental situation in Mitrovica (Kosovo). Mitrovica has its air divided in two kinds, speaking in quality terms: Air above rural and mountainous zones, which is clean. Air above the city centre urban and nearby diff erent plants, which is more polluted. Urban air contains dust particles and gases as results of normal activity of the city and industries in them. Mitrovica can be cited as one of the capitals of Europe with worst air pollution. Exposure to airborne particulates PM10 and PM2.5 containing low concentrations of heavy metals, such as Pb, Cd and Zn, may have serious health eff ects. However, little is known about the specifi cation and particle size of these airborne metals. Fine and PM10 particles size with heavy metals in aerosol samples from the Mitrovica urban area were examined in detail to investigate metal concentrations and specifi cation. The crystal structures of the particles containing Pb, Cd and Zn were determined from their electron diff raction patterns by XRF methods. Sampling of suspended particulate matter, PM10 and PM2.5 started in July April 2003 and are still in progress at three sites in the very urban area of Mitrovica: roof of the FXM building MIP, roof of the elementary school “Bedri Gjina” at about 4m height; 40m far from heavy-traffi c streets; on the platforms above entrance stairs to the faculty of Mining at the height above 3m from the ground. Suspended particles were collected on Pure Tefl on fi lters, Whatman (37 mm diameter, 2 μm pore size) and Pure Quartz, Whatman (37 mm diameter) fi lter paper, using the low volume air sampler Mini-Vol Airmetrics Co, Inc. (5 l min-1 fl ow rate). The duration of each sampling period was 24 hours.

P - 048Removing of salts from solution with the help of nanostructured hydrogel compositesT. Jumadilov1, I. Suleimenov2, L. Zaitova2

1Institute of Chemical Science, Department of physical chemistry, Almaty, Kazakhstan2Institute of Power Engineering and Telecommunications, Department of Telecommunications, Almaty, Kazakhstan

Nowadays water purifi cation is one of the most important ecological problems, particularly Central Asia will face with pronounceable defi ciency of fresh water in the nearest future. This problem cannot be solved with the help of ion exchange at all. Electrodialysis methods require suffi cient energy outlays and their using shows low eff ectiveness in practice.

New method of water purifi cation, which allows total removing of salts from solution, is proposed in the present report. This method is based on recently observed eff ect of long-distance interactions between two diff erent hydrogel specimens. Polymer hydrogels are cross-linked macromolecular networks, which are intensively studied during last few decades. Such gels are able to accumulate large amounts of water and demonstrate pronounceable reaction on wide range of external infl uences (temperature variations, electric current, etc.).

One of the interacting specimens is donor of hydrogen ions, and the other is acceptor. Cross-linked polycarbon acid may be used as donor of hydrogen ions, and any nitrogen-containing network, which is able to form chemical bonds with protons, may be used as acceptor. Hydrogen ions transportation from one network to another leads to appearance of non-compensated electric charge of both specimens (negative and positive, respectively). Such electric charge results in additional swelling of hydrogels, i.e. such samples actually can infl uence on each other at quite far distances (up to few centimetres).

Such hydrogel pair may remove any salt from water solution. Negative ions of dissolved salt attract to positively charged specimen and positive - to negatively charged one, as it is shown in present report both in theoretical and experimental way. A set of chemical reactions resulting in ions removing from water may be considered as anomalous ion exchange eff ect.

One of the most important parameter of any process of water purifi cation is its velocity. Using of macroscopic hydrogel pairs actually allows salt removing, but this process is quite slow, while its velocity is rectricted by diff usion of hydrogen ions from one specimen to another. Velocity of anomalous ion exchanging may be suffi ciently increased by using of hydrogel dispersions.

Such dispersions forms quite defi nite composite, while formation of salt chemical bonds take place at surface of the specimens at direct contact. Nevertheless, contact zone is very thin, i.e. main part of functional groups of hydrogel may take part in anomalous ion exchange reactions. Moreover, thickness of such zone (< 10 nm) allows using of nanocomposites with < 100 nm size particles, as it is shown in present report. It is also shown, that the highest velocity of anomalous ion exchange may be realized namely with the help of such composites. One should underline, that regeneration of such composites may be carried out by electric current as it is shown in present report too.

Thus, nanostructured composites based on anomalous ions exchange using is advantage method of water purifi cation and preparation of fresh water.


122

Posters

P - 049Gene transfer mediated by carbon nanotubesV. Raff a1, O. Vittorio1, M. Costa2, A. Ziaei3, K.T. Al-Jamald4, P. Tommaso5, B. Giuseppe5, G. Lisa5, K. Kostas6, N. Antonio6, N. Stephanos7, K. Theodoros7, B. Marko8, S. Padmanabhan8, A. Nadja8, R. Cristina9, C. Alfred9

1Scuola Superiore Sant’Anna, Crim, Pisa, Italy2CNR, Istituto Neuroscienze, Pisa, Italy3Thales, Thales Research & Technology France, Palaiseau cedex, France4University of London, The School of Pharmacy, London, United Kingdom5CNR, Istituto Neuroscienze, Pisa, Italy6University of London, The School of Pharmacy, London, United Kingdom7Nanothinx S.A.,Rio-Patras, Greece8Max-Planck-Institut fuer Festkoerperforschung, , Stuttgart, Germany9Scuola Superiore Sant’Anna, Crim, Pisa, Italy

Background Carbon nanotubes (CNTs) are widely used for biomedical applications as intracellular transporters of (bio)molecules, due to their high propensity to cross cell membranes, allowing their use for the delivery of therapeutically active molecules [1]. There are numerous reports on the use of carbon nanotubes in biomedicine and moderate biological eff ects have been reported in these studies [2,3]. Several studies have confi rmed that CNTs off er specifi c advantages for pharmacological applications. There have also been initial studies exploiting the unique electrical, optical and thermal properties of CNTs in a biological context.

Objectives and Methods The present contribution describes how the chemical and physical properties of CNTs can be utilized for the design of a new nanodevice for gene transfer. The vector is a functionalised nanotube (f-CNT) which consists of a polymer coating which “wraps” the surface of the nanotube and allows the binding of the desired biomolecules (DNA, cell ligands, fl uorescent molecules). For this study, ad hoc CNTs (highest possible purity and uniformity of dimensions and properties) were produced and characterized in terms of diameter, length, number of layers, carbon purity, metal particles content, amorphous carbon content and morphology. Evaluation of the cytotoxicity was performed using cell cultures, primary cells and animals.

Results f-CNTs conjugated with DNA were tested for their ability for gene transfer. Finally, physical means to enhance the gene transfer via the f-CNTs have been used.

Acknowledgements

This work has been performed in the framework of the NINIVE project funded by the EC (contract n° 033378).

References [1] L. Lacerda, V. Raff a, M. Prato, A. Bianco, K. Kostarelos, Nano Today, 2, 38-43 (2007). [2] G. Bardi, P. Tognini, G. Ciofani, V. Raff a, M. Costa, T. Pizzorusso, Nanomedicine: Nanotechnology, medicine and Biology, 5, 96-104 (2009). [3] O. Vittorio, V. Raff a, A. Cuschieri, Nanomedicine: Nanotechnology, Biology and Medicine DOI: 10.1016/j.nano.2009.02.006


123

Posters

P - 050Optimization of the properties of novel TiO2 fi lms for the photocatalytic degradation of organic pollutants in waterO. Monzon1, L. Scifo1, P. Benguria1, I. Villaluenga2, Y. de Miguel2, A. Porro2, O. Santa-Coloma1

1LABEIN-Tecnalia, Urban & Industrial Environment Unit, Derio, Spain2LABEIN-Tecnalia, NANOC Associated Unit LABEIN/CSIC, Derio, Spain

Background TiO2 photocatalysis has proved to be one of the most eff ective solutions to remove organic compounds from polluted waters. Indeed, under UV illumination, electron-hole pairs are generated in the semiconductor, entailing, either directly or via the formation of hydroxyl radicals, the oxidative degradation of contaminants. In most cases, complete mineralization to water and CO2 can be reached, making this process extremely attractive for water decontamination.

Photocatalysis has been extensively studied in the past 20 years [1], the catalyst being mainly used in two forms: suspended in the aqueous solution or immobilized on a support. Due to the higher exposed superfi cial area, best degradation effi ciencies are achieved in suspended confi gurations [2]. However, catalyst retrieval after treatment implies a separation step that may severely reduce the cost-effi ciency of the process at the industrial scale. To remedy to this problem, eff orts have been made to fi x the catalyst on a support [3]. Although reliable immobilization could be achieved through diff erent methods, it always induced an important loss of photocatalytic activity, and so far no ideal system was found.

Objectives Recently, novel TiO2 fi lms have been synthesized in our laboratory that displayed enhanced degradation effi ciencies under preliminary testing. Our purpose in this work is to investigate further the photocatalytic capacity of these fi lms and determine how it could be infl uenced by structural and physico-chemical parameters. An optimization of fi lm properties for the photocatalytic degradation of organic pollutants in water will be searched.

Methods Titanium dioxide fi lms were prepared from readily available TiO2 nanoparticles and deposited on a stainless steel substrate by dip-coating. Diff erent titania nanoparticles were compared, Degussa P25 serving as a referent for our home-made particles.

The photocatalytic activity of the fi lms was measured in a batch reactor inspired from the Japanese standard JIS R 1703-2: 2007. Irradiation was provided by a UV lamp of 365nm and methylene blue was used as a model contaminant. UV-vis spectroscopy was used to determine the evolution of the concentration of methylene blue during the experiment.

Acknowledgments

This work was funded by the Basque Government in the framework of the “Plan Vasco de Ciencia Tecnología e Inovación” (SAIOTEK programme). The authors are grateful to Txomin Laburu for its assistance in the development of the experimental platform.

References [1] Thiruvenkatachari R., Vigneswaran S., Moon I. S. (2008): A review on UV/TiO2 photocatalytic oxidation process. Korean J. Chem. Eng. 25:64-72. [2] Djikstra M. F. J., Michorius A., Buwalda H., Panneman H. J., Winkelman J. G. M., Beenackers A. A. C. M. (2001) : Comparison of the effi ciency of

immobilized and suspended systems in photocatalytic degradation. Catal. Today 66: 487-494. [3] El Madani M., Guillard C., Pérol N., Chovelon J. M., El Azzouzi M., Zrineh A., Herrmann J. M. (2006): Photocatalytic degradation of diuron in aqueous

solution in presence of two industrial titania catalysts, Esther as suspended powders or deposited on fl exible industrial photoresistant papers. Appl. Catal. B: Environ. 65:70-76.


124

Posters

P - 051Fluorescent Rare-earth Oxides Nanorods for Potential Biomedical ImagingT.T.Y. Tan1, G.K. Das1, Y. Zhang1

1Nanyang Technological University, School of Chemical and Biomedical Engineering, Singapore, Singapore

In recent years controlled synthesis of functional nanomaterials with desired phase, composition, morphology, and tailoring surface properties has become one of the widespread research interests.1 Fluorescent nanomaterials including carbon nanotubes, semiconductor quantum dots, and diff erent metal oxides have been extensively studied for biomedical applications.2 With the increasing interests of fabrication of advanced nanomaterials, the investigation of various mechanisms to control shape, size, and morphology of nanostructures is necessary. Synthesis and shape control of nanomaterials have been investigated by a number of researchers for a range of materials.3-7 For example, a wide range of shapes including rods, arrows, tetradrops, tetrapods have been reported using CdSe nanocrystals by Alivasators group.3 Due to the ladder-like arrangement of energy levels of rare-earth ions (RE3+), capability of having multicolor emission, long emission lifetime, better photostability, and less toxicity lanthanide ions based luminescent nanomaterials have great potential as indicators and photon sources for a range of applications including biolabels, light-emitting devices, sensor technology and low-threshold lasers.8,9 A great advantage of these RE-doped materials is they can emit both down and up-conversion fl uorescence simply by choosing diff erent RE ions or combinations of RE ions.

In our previous work, we reported shape evolution of diff erent RE-doped and codoped yttrium oxide (Y2O3:RE) from nanocrystals to nanorods.10,11 Here, we extent our investigation and report a general method of synthesizing fl uorescent nanocrystals and nanorods with controllable shapes for other RE-oxides including gadolinium oxide (Gd2O3) and dysprosium oxide (Dy2O3). Gadolinium and dysprosium ions were investigated as they are paramagnetic in nature. These as-synthesized nanocrystals and nanorods are highly dispersible in organic solvents like hexane. Typical TEM images show the formation of Y2O3, Gd2O3, and Dy2O3 nanocrystals and nanorods of size around 15-30 nm. Based on the TEM observation we propose a mechanism for nanorods formation. Evidence from TEM images show diff erent phases of nanorod evolution. It is proposed that self-assembly of the nanocrystals takes place by end-to-end fusion due to dipole-dipole interactions and evolved with nanorods. Down- and up- conversion fl uorescence was characterized by exciting the nanomaterials under xenon lamp and 980 nm external laser excitation sources which confi rms their fl uorescence. Surface-functionalization with biomolecules and in vitro cytotoxicity studies were also undertaken. These materials, having bifunctional paramagnetic and fl uorescent properties, and ease of functionalization and non-observable cytotoxicity, are envisioned to have potential application as bioimaging probes in multimodal imaging.

P - 052Local pore sizes and transport properties in porous catalyst for exhaust gas conversionV. Novak1, P. Koci1, F. Stepanek2, M. Marek1, M. Kubicek1

1Institute of Chemical Technology Prague, Department of Chemical Engineering, Prague 6, Czech Republic2Institute of Chemical Technology Prague, Chemical Robotics Laboratory, Prague 6, Czech Republic

The microstructure of porous supports used in heterogeneous catalysis determines key transport properties of the catalyst such as the eff ective diff usivity and thermal conductivity, thus strongly infl uences both steady-state and transient behaviour of the catalyst under real process conditions. The porous microstructure of the support can be infl uenced by the conditions of its preparation (primary particle granulometry, binder, temperature, etc.). In order to optimise the catalyst support microstructure and ultimately the whole catalyst, it is necessary to relate quantitatively the morphological features of the porous structure both to its preparation conditions and to the fi nal transport properties and catalyst performance. In this paper, transport properties of porous medium are investigated by the means of 3D porous medium reconstruction and computer simulations on micro and nano scale. New method for evaluation of local pore radii - maximum sphere inscription method - is proposed and output pore size distribution is compared with the results obtained by virtual capillary condensation method and experimentally measured pore size distribution. Relationship between mass transport and local pore radii is discussed and evaluated transport properties are confronted with the results of molecular dynamics simulations.


125

Posters

P - 053Fluorescent magnetic nanoparticles for bimodal cellular labellingM. Kacenka1, O. Kaman1, J. Kotek2, I. Rehor2, L. Falteisek3, J. Cerny3, J. Kupcik4, P. Jendelova5, I. Lukes2, E. Pollert1

1Institute of Physics of the AS CR, Department of Magnetics and Superconductors, Prague, Czech Republic2Faculty of Science of Charles University in Prague, Department of Inorganic Chemistry, Prague, Czech Republic3Faculty of Science of Charles University in Prague, Department of Cell Biology, Prague, Czech Republic4Institute of Inorganic Chemistry of the AS CR, Department of Solid State Chemistry, Prague, Czech Republic5Institute of Experimental Medicine of the AS CR, Department of Neuroscience, Prague, Czech Republic

Silica coated magnetic nanoparticles of perovskite phase La1-xSrxMnO3 (LSMO@SiO2) are promising material for magnetically induced hyperthermia due to the high heating effi ciency, adjustability of the Curie temperature and the stable shell that separates oxide core from the biological system. Besides, the relaxometric studies of LSMO@SiO2 suspension revealed high values of relaxivity r2, related to the fi nal contrast in MRI, exceeding those of iron oxide nanoparticles. The new two-step procedure of encapsulation was developed. It involves the use of complex triethoxysilane synthetized from 3-aminopropyltriethoxysilane and fl uoresceinisothiocyanate in a mixture with tetraethoxysilane in the fi rst step giving rise to the fl uorescent shell of the LSMO particles. The resulting particles, however, exhibit low colloidal stability in water at neutral pH due to the fl uorescein and particularly due to the presence of uncoupled amino-groups. Therefore the particles were subsequently coated in the second step by a thin secondary silica layer employing only tetraethoxysilane. The resulting product exhibits high colloidal stability in water, its zeta potential dependence and the isoelectric point (app. 2) are similar to those of the silica nanoparticles.

IR and Raman spectroscopy proved the presence of fl uorescein and thiourea moiety. TEM evidenced the presence of app. 15 nm thick shell. No fl uorescein leaching was observed even after long storage. The fl uorescent properties are the same as for the fi rst product before the secondary coating. The morphology was investigated by means of DLS and TEM, that evidenced the increase of the shell thickness after the second step.

Cellular labelling experiments were carried out with HeLa cells and fi broblasts. Signifi cant uptake of the nanoparticles occurred in both cases and the viability of the cells was not aff ected even after few days of incubation. According to the fl uorescence microscopy numerous endosomes containing nanoparticles were formed. Currently the viability tests with rat mesenchymal stem cells are carried out.

The advanced nanoparticles are suitable for biological experiments where fl uorescein covalently attached to the inner silica shell enables direct observation of the internalization of magnetic particles in the cells and their subsequent fate. Furthermore such complex magnetic nanoparticles could pose as bimodal labelling agents in solution of challenging biomedical problems.

The support by projects ASCR KAN20020061, KAN201110651 and KAN201110651 is gratefully acknowledged.


126

Posters

P - 054Controlled functionalization of single walled carbon nanotubes for preparation of nanostructured TiO2 based compositesR. R.N. Marques1, B. F. Machado1, J. L. Faria1, A. M.T. Silva1

1Faculdade de Engenharia Universidade do Porto, Laboratório de Catálise e Materiais (LCM) Laboratório Associado LSRE/LCM Departamento de Engenharia Química, Porto, Portugal

Several acid treatments, mostly using boiling acids under refl ux, have been proposed for purifi cation or functionalization of carbon nanotubes (CNT) [1]. However, these methods are unable to modify the surface of CNTs in a controlled and accurate mode, i.e. no correlation can be found between the groups attached to the surface and the concentration of the used acids. On the other hand, due to their electric conductivity and extremely high mechanical and thermal resistance, CNT have been widely explored in heterogeneous catalysis [2]. In particular, CNT/TiO2 are photocatalytic active upon irradiation in the visible range [3], in opposition to bare TiO2, therefore potentiating the use of natural sunlight as radiating source.

Given the importance of controlling the CNT surface chemistry, in order to obtain eff ective photoactive composite materials, the motivation of this work is to develop a novel method for the proper functionalization of Single Walled Carbon Nanotubes (SWCNT), and to prepare SWCNT/TiO2 composites which can be applied in heterogeneous photocatalysis for waste water treatment and detoxifi cation.

Modifi cation of the surface chemistry of SWCNT was carried out by hydrothermal functionalization with diff erent nitric acid concentrations at two diff erent temperatures (393 and 473 K). Boiling acid methods were used as comparison standards. The total amount of developed oxygenated groups (e.g., carboxylic acids, anhydrides, carbonyls or quinones, lactones and phenols) was determined by Temperature Programmed Desorption (TPD). Afterwards, SWCNTs/TiO2 composites were prepared by the sol-gel method and tested in the photocatalytic degradation of p-methoxyphenol.

A quantitative correlation was found between the amount of groups introduced on the surface of SWCNTs and the concentration of nitric acid. The degree of functionalization was improved as function of the nitric acid concentration, following the obtained exponential dependency. The new hydrothermal treatment uses a concentration more than ten times lower to produce two times the concentration of surface groups, when compared to the usual boiling methods. In addition, the photocatalytic tests reveal an improvement on the activity when the so functionalized SWCNT are used to prepare SWCNT/TiO2 composites.

The desired amount of oxygenated groups was successfully introduced in a controlled way on the surface of SWCNT after the HNO3-hydrothermal functionalization methodology developed in this work. This approach undoubtedly leads to SWCNT/TiO2 composites with the higher photocatalytic response in the visible range.

[1] V. Datsyuk, M. Kalyva, K. Papagelis, J. Parthenius, D. Tasis, A. Sioku, I. Kallitsis, C. Galiotis, Carbon 46 (2008) 833[2] P. Serp, M. Corrias, P. Kalck, Appl. Catal. A 253 (2003) 337[3] W. Wang, P. Serp, P. Kalck, C.G. Silva, J.L. Faria, Mater. Res. Bull. 43 (2008) 958


127

Posters

P - 055Silica coated La1-xSrxMnO3 nanoparticles for magnetically induced hyperthermia and MRIO. Kaman1, E. Pollert1, P. Veverka1, M. Marysko1, M. Veverka1, V. Herynek2, P. Jendelova3, P. Kaspar4, V. Grunwaldova5, M. Klementova6

1Institute of Physics of the AS CR, Department of Magnetics and Superconductors, Prague, Czech Republic2Institute of Clinical and Experimental Medicine, Department of Magnetic Resonance, Prague, Czech Republic3Institute of Experimental Medicine of the AS CR, Department of Neuroscience, Prague, Czech Republic4Faculty of Electrical Engineering CTU, Department of Measurement, Prague, Czech Republic5Zentiva a. s., Prague, Czech Republic6Institute of Inorganic Chemistry of the ASCR, Department of Solid State Chemistry, Prague, Czech Republic

Magnetic nanoparticles of the perovskite phase La1-xSrxMnO3 represent a unique core material with tunable Curie temperature Tc and high specifi c power losses. The adjustment of Tc rules out the risk of local overheating during the magnetically induced hyperthermia while high heating effi ciency causes damage of cancer cells at low concentration of the particles. Moreover these magnetic nanoparticles are promising for MRI as the T2 agent. The crucial step in the development of material suitable for medical application is preparation of the colloidally stable suspension of nanoparticles which shell prevents the toxic eff ects of the core. Silica shell seems to fulfi l these requirements and further it enables preparation of multifunctional particles due to its facile modifi cation.

Nanoparticles of La0.75Sr0.25MnO3 (LSMO) were synthetized via sol-gel procedure, followed by thermal and mechanical treatment (dXRD =20 nm, Tc = 335 K). The silica coated particles (LSMO@SiO2) were prepared in the procedure based on tetraethoxysilane (TEOS) hydrolysis and fi nally certain size fraction was separated via centrifugation. TEM and HRTEM evidenced high morphological quality with uniform 20 nm silica shell around magnetic cores. The colloidal stability was investigated by DLS including the hydrodynamic size measurement (135 nm) and dependence of zeta-potential on pH. Other characterizations like IR spectroscopy and magnetic measurements were carried out as well. In order to enable further functionalization the amine-derivatized particles with complex shell were prepared. The procedure involved poly(vinylpyrrolidone) stabilization and encapsulation using a mixture of TEOS and 3-aminopropyltriethoxysilane.

The heating of LSMO@SiO2 was studied under AC fi eld in the water suspension and revealed higher heating effi ciency in comparison with uncoated LSMO. This result given by the diff erent size distributions of magnetic cores was further evidenced by AC hysteresis loops. The relaxometric studies of LSMO@SiO2 show substantially higher r2 in comparison with those reported for iron oxides nanoparticles. In addition its temperature dependence is suppressed by the use of larger magnetic cores. Cell labelling and viability were studied on rat mesenchymal stem cells (rMSCs) with incubation period of 48 hours in the presence of coated LSMO at concentration around 0.1 mmol(Mn)/l. The viability was found repeatedly higher than 90 % in comparison to 94 % for Feridex®. The amount of manganese inside the cells, evaluated from the relaxivity measurements, is lower compared to the content of Fe in the case of Feridex® loaded ones although the contrast is higher.

The support by projects ASCR KAN20020061 and KAN201110651 is gratefully acknowledged.


128

Posters

P - 056Advances on the preparation of luminescent silicon nanoparticles for bio-imaging M. Falconieri1, R. D’Amato2, E. Borsella2, N. Herlin3, G. Miserocchi4, H. Xu5, I. Rivolta4, G. Sancini4, E. Trave6, D. Wang5

1ENEA, Advanced Physics Technologies and New Materials Dep, Roma, Italy2ENEA, Advanced Physics Technologies and New Materials Dep, Frascati, Italy3CEA, Service des Photons Atoms and Molecules, Saclay, France4Univ. of Milano-Bicocca, Dept. of Experimental Environmental Medicine and Biotechnology, Milano, Italy5Max Planck Institute of Colloids and Interfaces, Potsdam, Germany6Univ. of Padova, Physics Dept., Padova, Italy

Until now, cellular components and processes have been mostly visualized through organic dye based fl uorophores, having drawbacks such as rapid photo-oxidation, short lifetime and need of diff erent excitation wavelengths. Recently, semiconductor nanocrystals (quantum dots-QD) were introduced for bio-labelling as they exhibit intense, size-tuneable emission in the visible and near-IR range, photostability, increased sensitivity through longer life time, and excitability by a single wavelength. However, widely used II-VI QDs are highly cytotoxic. The EC-funded BONSAI Project aims at replacing II-VI QDs with light emitting Si and Si-based nanoparticles (NPs) having broader excitation band, and size dependent optical emission. Sizeable quantities of Si NPs with size ≤ 5 nm are produced by laser pyrolysis of silane, but the as-prepared material shows weak photoluminescence (PL). The PL emission intensity increases as a result of (non-controllable) exposure to air or by controlled chemical processes, like passivation in liquids of NPs with size ≤ 5 nm, or (soft) wet-oxidation of NPs with size ≤ 7-8 nm. The PL emission of Si NPs falls in the range 600-1000 nm with emission lifetimes in the range 0.05-0.3 ms. Using two-photon excitation Si NPs can be excited in the IR where the human skin transmittivity is high, showing potential for in-vivo diagnostics.

Bio-medical applications require that NPs are dispersed and stable in physiological media. Disaggregation of dried powders to well-dispersed Si NPs in water by both acid and alkali etching processes resulted problematic, but successful results were achieved by a combined alkali-etching procedure terminated by addition of H2O2. The use of HF/HNO3 mixture as etching agent makes the Si NPs photoluminescent with various emission colors depending on the etching time.

For in vitro and in vivo applications, NPs should be coated with a biocompatible polymer to prevent the formation of large aggregates. Thus, the second step was the fabrication of colloidally stable and biocompatible Si NPs by grafting hydrophilic polymer chains, such as poly(ethylene glycol) (PEG), on the Si NPs. PEGylation of disaggregated Si NPs was achieved by intermediate coating with functional silanes terminated with amine or epoxy groups. It was found that the PEGylated Si NPs remained stable in water for weeks. Optimization of the degree of PEGylation is in progress to achieve a better colloidal stability against salts.

Negligible cytotoxicity of PEGylated Si-NPs was observed by vitality tests on epithelial cell lines. Preliminary in-vitro and in-vivo experiments have shown that the main factors still limiting exploitation of Si NPs in bio-imaging are: poor emission tunability and broad emission band, long emission decay time and low quantum yield. These preliminary results will be shown and critically discussed. Moreover, the strategies to overcome these limiting factors will be outlined and the fi rst achievements will be reported.


129

Posters

P - 057Metallic and Magnetic Nanoparticles for Environmental and Biomedical Application A. Fojtik1, K. Piksova1, P. Kovacik2, T. Skeren3

1Czech Technical University in Prague, Faculty of Nuclear Sciences and Physical Engineering, Prague 1, Czech Republic2University of Oxford Oxford United Kingdom, Department of Materials, Oxford, United Kingdom3Intrauniversitary Microelectronics Center (IMEC) Leuven Belgium, Microelectronics Center, Leuven, Belgium

Nanotechnology is getting still more attention and is becoming emerging topic of recent days. Its biological and medical approaches and applications are opening novel, unpredicted and effi cient ways of solving health issues, that is why the extraordinary fi eld of bionanotechnology is shaping into one of the leading sciences of the 21st century. Goal is to functionalize Fe3O4 magnetic nanoparticles, which according to chemical groups attached at the surface, are able to bond to special pathogens (bacteria or virus) and being easily manipulated by magnetic fi eld, they can be removed from the system taking the pathogens with them as well.

Among them a very specifi c position belongs to the carriers (nanoparticles properly functionalized to attach and carry a specifi c load). Material of the nanoparticles should be biologically compatible, i.e. the nanoparticles can be introduced into the organism (bloodstream) without any damage or side eff ects. Size of nanoparticles in combination with surface modifi cation favor this condition - it allows for interaction between nanoparticle and molecules of cells and cells surfaces, however, this interaction does not infl uence the behavior of cells nor their physiological functions.

Nanoparticles are produced by ‘wet’ chemical way under special conditions. Final product is 10s of nanometers in diameter and possesses special superparamagnetic properties, which give it ability to be manipulated while working in complex biological systems such as human body. Surface of the particles is stabilized and treated, so that they maintain their unique properties and remain stable and separated. Certain chemical groups, proteins or residues are attached onto the surface to functionalize it. Particles are then ready to play a key role in recognition of the pathogens bonding to the surface of nanoparticles and following applied magnetic fi eld to get out of the system.

Transmission Electron Microscopy (TEM) and Atomic Force Microscopy (AFM) allow one to calculate particle size and shape. Mössbauer Absorption Spectroscopy is perfectly suitable for measuring the phase composition of iron nanoparticles, also providing their magnetic properties, while Superconducting Quantum Interference Device (SQUID) is used to measure extremely small magnetic fi elds and hysteresis characteristics of weak ferromagnets. Presently, synthesized nanoparticles are being evaluated using AFM and magnetic properties measured by Mössbauer Spectroscopy and SQUID techniques. Data and graphs will be provided during the presentation.

Acknowledgements:

This work has been supported by the Czech Ministry of Education, Youth and Sports in the framework of the Research Plan 60840770022 and by the Grant Agency of the Academy of Science of the Czech Republic, project KAN401220801 and grant GACR No. 202/07/0818 and 102/09/1037


130

Posters

P - 058Fluorescence Lifetime Imaging NanoscopyK. Kemnitz1, I. Cox2, A. Cherniy3, M. Oheim4, D. Bald5, W. Zuschratter6, D. Dryden7, J. Vacek8, O. Jagutzki9, E. Turbin10

1EuroPhoton GmbH, Berlin, Germany2Photek Ltd., St. Leonards on Sea, United Kingdom3PNPI, St.-Petersburg, Russia4INSERM, Paris, France5VU Amsterdam, Amsterdam, The Netherlands6IfN-Magdeburg, Magdeburg, Germany7UofE, Edinburgh, United Kingdom8UOCHB, Praha, Czech Republic9Roentdek GmbH, Frankfurt, Germany1RRC KI, Moscow, Russia

Background: Fluorescence Lifetime Imaging Nanoscopy (FLIN), as recently introduced in SingleMotorFLIN (NMP4-CT-2005-013880), provides groundbreaking tools for the study of single molecules (SM) and single molecular motors (SMM), as well as a broad array of phenomena in NanoWorld. Classical limitations in SM/SMM studies, such as resolution, short observation times, and photo-dynamic reactions are overcome by minimal-invasive picosecond FLIN. FLIN is the extension of the extremely successful fl uorescence lifetime imaging microscopy (FLIM) into the nano-domain, with down to 10 nm space-resolution. FLIN results from the combination of nanoscopy (such as multi-colour, wide-fi eld, point-spread- function (PSF) modelling microscopy) with novel ultrasensitive, widefi eld (non-scanning) imaging detectors, based on time- and space-correlated single photon counting (TSCSPC) that allows ultra-low excitation levels, resulting, e.g., in long-period (>1 hour), minimal-invasive observation of living cells and SM/SMM, without any cell damage or irreversible bleaching. Minimal-invasive FLIN with global PSF-modelling allows observation of point-source movement at 1-nm accuracy and distance determination at the 10-nm level, while simultaneously acquiring multi-exponential pico/nanosecond fl uorescence dynamics. FLIN opens a wide avenue of novel applications, such as SMM-tracking, FRET-verifi cation, dual-polarisation tracking, and super-background-free 2-photon TIRF-FLIN. Enhanced basic understanding of biological and artifi cial machines/motors will lead to advanced models and proceed one day to artifi cial systems, revolutionising the interface of biological and non-biological worlds. Since biological SMM are involved in many human disorders, the novel FLIN method will help to show how these motors operate and how they break down in disease.

Objectives: (a) set-up of a FLIN prototype at the coordinating SME in Berlin-Adlershof, (b) improvements of several parameters of the current generation of TSCSPC detectors, such as time-resolution, space-resolution, and through-put, (c) improved TIRF microscope and SM/SMM observation, (d) application of PSF-modelling for tracking of SM/SMM and use dual-colour FLIN PSF-modelling method to approach 5 nm accuracy and 10 nm resolution, (e) employing the novel Picosecond FLIN/FLIM method and several of its unique applications to study artifi cial and biological motors.

Results: Construction of a FLIN prototype and its introduction to cell-biological research and the Nanoworld, by studying the behaviour of single molecules and single molecular motors in living cells and artifi cial systems.

Conclusion: FLIN will improve our understanding of biological and artifi cial motors, provide a ground-breaking tool for minimal-invasive study of delicate living systems and will see wide application in biological and medical research as well as nanotechnology, also in hybrid-nanosystems such as FLIN-AFM.


131

Posters

P - 059Nanocrystalline diamond thin fi lms - a step ahead in life scienceA. Kromka1, B. Rezek1, O. Babchenko1, M. Vanecek1, M. Kalbacova2, A. Broz2, L. Grausova3, L. Bacakova3

1Institute of Physics of the ASCR v. v. i., Optical crystals, Prague 6, Czech Republic2Charles University in Prague, Institute of Inherited Metabolic Disorders, Prague, Czech Republic3Institute of Physiology ASCR v.v.i., Dept. of Growth and Diff erentiation of Cell Populations, Prague 4-Krc, Czech Republic

Growth and applications of nanocrystalline diamond (NCD) fi lms have been widely studied because of inexpensive alternative to single crystalline diamond. These fi lms exhibit an excellent combination of intrinsic properties including optical transparency, mechanical, chemical and radiation stability, bio-compatibility, etc. This contribution of properties is very attractive for science and applications at the interface of organic and inorganic world.

In this contribution we study the infl uence of diamond nucleation on the growth of NCD fi lms on various substrates. Ultrasonication in a colloidal dispersion and spin-coating of polymer composites are applied as the nucleation techniques. We show that these techniques can be used for nucleation of sensitive substrates. After the nucleation, the NCD fi lms are grown by microwave plasma CVD process. We achieved NCD fi lms of specifi c and controlled morphology (hierarchically structured micro- or nano-roughness), atomic surface termination (plasma treatment in oxygen/hydrogen), and vertically aligned nano-rods or cones (dry plasma post-growth structuring).

Further on, such NCD fi lms and structures are used for cell cultivation of human osteoblast-like cells (SAOS-2 or MG-63) and mesenchymal stromal cells. We found that the hierarchically-composed roughness and the atomic surface termination of diamond exhibited signifi cant eff ects on the cell adhesion, proliferation, diff erentiation, etc. Moreover, we showed that the cell growth of SAOS-2 on nano-structured surface is controlled via the total contact areas of “nano-features” which aff ect the morphology of the cells.

The results indicate that NCD fi lms are well biocompatible and their applications in the cell cultivation can be easily enhanced by adjusting nano-scale morphology. This makes NCD fi lms promising for industrial applications in prosthesis, tissue engineering, regenerative medicine and more.

This work was supported by the grants IAA700280901, KAN400100652, KAN400480701, KAN400100701 and 1M06002, by the Institutional Research Plan No. AV0Z10200521 and by the Ministry of Education of the Czech Republic, project MSM0021620806.

P - 060Surface-bound DNA self-assembly or enzymatic reactions toward the amplifi cation of biosensor signalsG. Zuccheri1, A. Vinelli1, M. Onofri1, B. Samorì1

1Biochemistry, Biochemistry, Bologna, Italy

Single-molecule sensitivity can be nowadays achieved when trying to characterize minute amounts of macromolecules on an environmental or diagnostic specimen in a research laboratory setting. The sensitivity is signifi cantly worse when working in the fi eld and trying to assess the presence of a pollutant or a pathogen as quickly as possible. Point-of-care testing is the realm of biosensors and the trend of research is towards simplicity of use, low cost, reliability and, last but not least, sensitivity.

In the detection of nucleic acids, the hybridization of an oligonucleotide probe with its poly-nucleotidic target is monitored by changes in physico-chemical properties of an interface, commonly induced by the use of a specifi c label. The probe, often bound to an oligonucleotide itself, can be a fl uorescent dye, an enzyme, an electroactive moiety or other functional element. Such probes impart specifi city and sensitivity to the assay, but make it drift far from simplicity of use (and low cost).

Recently, label-free techniques are developing in which the presence of the analyte macromolecule itself can induce detectable physico-chemical changes. The struggle is to make such techniques suffi ciently sensitive and specifi c. In our work, we are trying to implement DNA-based surface-bound amplifi cation strategies that can serve to amplify the read-out signal of DNA hybridization in a label-free biosensor, such as those measuring the electrochemical properties of an electrode interface.

The ‘hybridization chain reaction’ is an isothermal enzyme-free strategy to trigger polymerization of oligonucleotides into a long double-stranded DNA. We have demonstrated that the ‘hybridization chain reaction’ can be also implemented in a surface-bound confi guration, leading to the self-assembly of many copies of oligonucleotides on a target DNA bound on an oligonucleotide self-assembled monolayer.

In another attempt, we have shown that terminal transferase (a template-free DNA polymerase) can be used to build a long polynucleotide out of the target DNA that is bound to its immobilized oligonucleotide probe.

Both such strategies will lead to the accumulation of nucleic acids at the solid-liquid interface when triggered by the probe-target recognition. This produces an amplifi cation of the signal of a label-free biosensor. Even though the amplifi cation factors of these implementations are still as low as 10, their further development is still possible, with the hope of avoiding or reducing the need of polymerase chain reaction in the detection of low concentrations of nucleic acids.


132

Posters

P - 061Microfl uidic chip-based immuno-electrophoretic system for the early stage diagnosis of Alzheimer’s diseaseZ. Bilkova1, J.L. Viovy2, M.R. Mohamadi2, M. Taverna3, R. Verpillot3, B. Jankovicova4, F. Reymond5, J. Kutter6

1University of Pardubice Faculty of Chemical Technology, Dpt. of Biological and Biochemical Sciences, Pardubice, Czech Republic2Institute Curie/CNRS/Université Pierre et Marie Curie, UMR 168, Paris, France3Universite Paris sud JE 2495, Faculte de pharmacie, Chatenay Malabry, France4University of Pardubice, Dpt. of Biological and Biochemical Sciences, Pardubice, Czech Republic5Diagnoswiss S.A., Rte de l’Ile-au-Bois 2, Monthey, Switzerland6Technical University of Denmark, Dpt. of Micro and Nanotechnology, Copenhagen, Denmark

The increased demand for sensitivity, specifi city and cost-eff ectiveness in diagnostics motivate researchers to develop universal microanalyzers. Current fi ndings in microfl uidic technology and nanodiagnostics enable to integrate a number of consequential diagnostic procedures into simple devices as μTAS, MEMS, nanochips, etc. The aim of the present project is to apply these progresses in biotechnology, nanoparticles and nano-instrumentation (in which several partners played a major role) and develop fully integrated lab-on-a-chip instrument, able to elaborate and perform routinely multimodal biomarkers analysis, at the ultrasensitive level required and in a minimally invasive way, i.e. in easy-to-access body fl uids such as blood, urine or saliva.

Within the frame of teamwork of physics, physicochemists and biochemists have designed and developed microfl uidic multiplexed devices for rapid detection of Alzmeimer´s disease markers. Device providing not only basic analytical parameters but also merits as increased sensitivity and specifi city, possibility to automatize, minimal sample consumption lowering the stress for patients and reduced analysis time. The goal was to detect pathological form of Aβ peptides and/or hyperphosphorylated Tau protein in CSF or in blood at an early stage of disease, ideally before irreversible symptoms.

Our prototype is composed of biocompatible poly(PDMS) and glass and fabricated by rapid prototyping and PDMS technology. This device comprises 3 functional elements. The PDMS device integrates 2 strong magnets to create a magnetic fi eld with a gradient along the channel, providing a potential minimum for bead trapping. Fixed magnetic particles functionalized by anti-Aβ amyloid or anti-Tau monoclonal antibodies are intended for capturing of target peptides or proteins. The captured peptides are electrokinetically eluted and preconcentrated on a second module, hydrogel membrane prepared by in-situ photopolymerization of (PEG)acrylate. The eluted and preconcentrated peptides are then separated by electrophoresis on chip, using 3rd optimized CZE separation module, where peptides are detected by LIF after their covalent labelling.

As an alternative to the module described above, a second strategy was to develop microchip sensor adapted to the dosage of neurodegenerative disease markers by immunoassays with electrochemical (EC) detection. Such platform enables the rapid diagnosis of low analyte concentrations (sub-pM detection limit).

For parametrization and end-user pre-clinical validation 2 medical groups (Institute of University Duisburg-Essen, University of Ulm) are involved in this project. Because of pathogenic role of Abeta amyloid deposits and neurofi brillary tangles with hyperphosporylated Tau proteins, the capabilities of identifying, characterizing and even quantifying of biomarkers may gain high importance in a relatively short time. Validated method for detection of the presence of each isoform can help in screening diagnostics, testing new medicines and monitoring the progression of Alzheimer´s disease.

Acknowledgement: this work was supported by the E.C. project “Neurotas” 037953.


133

Posters

P - 062Nanoparticles of zinc-substituted cobalt ferrite for the magnetic hyperthermiaM. Veverka1, E. Pollert1, K. Zaveta1, Z. Jirak1, O. Kaman1, K. Knizek1, M. Marysko1, P. Veverka1, P. Kaspar2, S. Vasseur3 1Institute of Physics ASCR v.v.i., Magnetics and superconductors, Prague 8, Czech Republic2Czech Technical University, Dep. of measurements, Prague 6, Czech Republic3Institut de Chimie de la Matire Condensée de Bordeaux, CNRS/Université Bordeaux 1, Matériaux Fonctionnalisés, Bordeaux, France

In searching of a suitable material for the magnetic hyperthermia we aimed our study on nanoparticles of zinc-substituted cobalt ferrite Co1-

xZnxFe2O4, in the range of 0.5≤x≤0.7. The samples were obtained by a co-precipitation method using ammonium hydroxide as the precipitating agent and subsequent annealing at 400, 500 and 550 °C. The XRD analysis revealed single-phase composition of the samples with cubic spinel structure and gradual increase of the mean size of nanoparticles of values 4, 14, 23 nm with increasing annealing temperature (agreement with TEM).

Profi le of hysteresis loops from dc magnetic measurements showed that nanoparticles are composed of more then one magnetic domain. The dc magnetic measurements at room temperature demonstrated a gradual increase of the magnetization and Curie temperature with composition, e.g. for the nanoparticles of the size 23 nm the value of σ1000 kA/m ~ 16, 36, 57 Am2kg-1 and Tc = 227, 322, 415 K for the composition of x = 0.7, 0.6, 0.5, respectively. A detail study by Mössbauer spectroscopy, neutron diff raction and magnetic measurements devoted to sample of x = 0.6 showed in a sharp contrast to the bulk samples high occupancy of the octahedral sites by zinc cations, namely 1.44 Fe, 0.52 Zn and 0.04 Co.

The power losses of the sample Co0.4Zn0.6Fe2O4 with the mean size of 14 nm measured at constant amplitude of the ac fi eld for Hmax= 24 kAm-1 and ν =100 kHz showed the reasonable heating power of 8.5 Wg-1 at 300 K descending to 5.7 Wg-1 at 315 K. Further experiments concerning to an improvement of the magnetic properties, e.g. by the shape anisotropy and preparation of the colloidal stable non-toxic suspension by silica shell encapsulation are carried out.

The support by projects GAAV KJB100100701 and ASCR KAN200200651 is gratefully acknowledged.

P - 063Nano-engineering biomimetic tactile sensorsM. Adams1

1University of Birmingham, Chemical Engineering, Birmingham, United Kingdom

Centre for Formulation Engineering, University of Birmingham, Edgbaston, Birmingham, B15 2TT, UK,

Tactile sensing in a physiological environment consists of sensory processing where nanoscale receptors in the skin transmit frequency and intensity coded neural signals to the brain. The brain in-turn processes the resulting information to determine the nature of the surface and whether the skin is in static or moving contact. Tactile sensing provides us with the ability to discriminate between diff erent surfaces in terms of their micro-geometry, to perceive surface morphology, and to control grip effi ciently.

The aim of the current project is to develop an artifi cial fi nger with a biomimetic sensor array based on nano-electro mechanical sensors (NEMS). The data resulting from these sensors was then interpreted using a neural network based model and compared with data collected from in vivo haptic experiments. This has required a multidisciplinary approach involving nanotechnology, psychology, neurophysiology, tissue engineering, robotics and computational modelling. The development of an artifi cial fi nger with tactile perception will be a valuable tool for high-throughput screening techniques in sectors such as personal care and textiles, and has potential applications in health care e.g. prosthetic limbs and remote surgery.

Psychological texture studies have been performed on healthy young adults analysing the ability to discriminate random and periodic textured surfaces under normal conditions and conditions where exploratory parameters such as contact force, sliding velocity and contact duration are changed. These data have been collated and utilised in the development of a prototype actuated tactile stimulation platform, which has been used to collect neurophysiological responses to texture in the form of microneurography and EEG recordings.Static and dynamic fi nite element models of the artifi cial fi nger when subjected to normal and shear forces comparable to those observed in the behavioural studies have been defi ned using purpose-developed computational methods. The information from the psychophysical, neurophysiological, and computer simulation activities have been processed to create a virtual model of taction which was applied within an artifi cial fi nger pad and has directed design strategies for the production of NEMS arrays that mimic the resolution, sensitivity and dynamics of spatial touch in the human fi nger.

To develop the biomimetic fi ngertip, investigations into a variety of synthetic polymers have been undertaken to evaluate mechanical properties in an eff ort to identify suitability for encapsulation of the sensor arrays. A tissue engineering approach has also been explored to deliver an actual bio-silicon interface that more accurately mimics the physiological and mechanical response to taction. To date fi ngerpad prototypes capable of passive touch have been developed with texture discrimination capabilities.

This work was funded by the EU 6th Framework Programme.


134

Posters

P - 064Polymer based multifunctional bactericidal materials developed in EMBEK1R. Förch1

1Max-Planck-Institute for Polymer Research, Mainz, Germany

The problem of Staphylococcus aureus and Pseudomonas aeruginosa colonisation and infection on prophetic and implant devices is a growing concern and is a key area which this project seeks to investigate further. The work is concerned with questions regarding the fundamental properties of bacteria that facilitate their attachment and will allow us to determine how genetic mutations aff ect the attachment of bacteria to surfaces. Smart nano-composite and nano-structured coatings are being developed which would (i) prevent initial bacterial attachment, (ii) prevent bio-fi lm formation on a wide variety of devices, parts and implants, (iii) enhance wound healing or (iv) prevent infection altogether.

A range of chemical and physio-chemical techniques are being used to develop new materials that will allow for a study of the fundamental aspects of bacterial attachment. New molecular microbiology techniques are being employed to understand the genetic components governing the interaction of a bacterial biotic cell surface with the novel antimicrobial surfaces being developed. The work presented here gives an insight into one strategy followed in this project and reports on a few initial results achieved so far. One particular approach couples naturally occurring reagents that have been used by man-kind for thousands of years with sophisticated nano-technological developments of the past few years. Terpin-4-ol is considered the primary active ingredient of tea tree oil, which has been used by aboriginal Australian traditional medicine for bruises, insect bites and skin infections. Its chemical composition has been well defi ned and has been shown to exhibit broad-spectrum anti-microbial activity. Terpin-4-ol can be incorporated into materials such as responsive hydrogels or surface immobilized responsive nano-capsules that can be designed to “recognise” bacterial toxins and to subsequently “release” the antimicrobial reagent. First results will be presented.

P - 065Development Of Novel Biomimetic Membrane Designs For Separation And Biosensor Applications S. Ibragimova1, J. Hansen2, M. Perry1, J. Vogel2, T. Vissing1, C. Hansen3, P.Y. Bollinger1, K. Pszon2, J. Emnéus2, C. Nielsen4

1Aquaporin, Aquaporin, Kgs Lyngby, Denmark2Technical University of Denmark, DTU Nanotech, Kgs Lyngby, Denmark3Copenhagen University, Nanoscience Center, Copenhagen, Denmark4Technical University of Denmark, DTU Physics, Kgs Lyngby, Denmark

Integral membrane proteins have a variety of functions e.g. as channels, transporters or receptors. In order to study transmembrane proteins under controlled circumstances they must be embedded into a matrix mimicking their in vivo environment. There has been a growing interest in developing a biomimetic platform technology for biosensor and separation applications.Current design criteria for free-spanning artifi cial membrane platform technologies are low leak membrane sealing, membrane stabilities above 1 day, absolute reproducibility, a scaff old consisting of multiple functional units, enablement of reconstitution of membrane spanning molecules, be robust for transportation and cost eff ective. For mass transfer fl ow and high throughput screening applications additional design criteria are required. These include a high perforation level of the membrane scaff old material, the functional membrane units are arranged in arrays to facilitate a screening platform (e.g. for microplate readers) and the artifi cial membrane platform is scalable to met various requirements for the individual technical applications. Recently, we have developed a model biomimetic membrane design and an automation technique for establishing multiple black lipid membranes (BLMs) in arrays of micro structured ethylene tetrafl uoroethylene fi lms, and supported by a micro porous material. Success rates for establishment of supported BLMs across multiple aperture arrays were above 95%. Currently, work is focused on characterization of nanoporous materials and surface modifi cations together with diff erent lipid compositions. Furthermore, to develop methods for the encapsulation of established membranes and for the controlled incorporation and distribution of transmembrane proteins into such encapsulated biomimetic membranes. Combined this work aims to meet all of the current design criteria for free-spanning artifi cial membrane platforms. This study has been undertaken in the MEMBAQ project (Incorporation of Aquaporins in Membranes for Industrial Applications) supported by the Sixth European Research Framework Programme under contract NMP4-CT-2006-033234.


135

Posters

P - 066Characterization of Nanoparticles−Erythrocyte InteractionG. Barshtein1, S. Yedgar1, L.D. Shvartsman2

1The Faculty of Medicine Hebrew University, Biochemistry, Jerusalem, Israel2Hebrew University, Racah Institute of Physics, Jerusalem, Israel

Great promise of Nanoparticles (NPs) for such key medical applications as drug delivery and imaging raises the issue of health concerns and adequate regulations. One of the obvious major concerns is the potential of NPs to interact with red blood cells (RBCs) in circulation and impair their function. Therefore, an in vitro method for pre-testing the toxicity of NPs, particularly drug-carrying NPs would be of great value and interest. This toxicity may result from extremely small size of NP and their interaction with the surface of RBC. This research targets the link between this interaction and fl ow-aff ecting properties of RBC. The main physiological role of RBCs is to supply oxygen to tissues. However, RBCs also have unique fl ow-aff ecting properties that assign them major roles in maintaining adequate blood circulation. These properties are mainly RBC deformability, self-aggregability, and potential adherence to blood vessel wall endothelial cells (EC). In recent studies we have shown that RBC fl ow properties, particularly their adherence to EC, are especially and considerably more sensitive to environmental changes, and are expressed earlier than changes in biochemical measures or signs of hemolysis. Therefore, alterations in RBC fl ow properties can be used as an especially sensitive method for monitoring damage of NPs to RBCs, but this has not been investigated as yet.

On these grounds, in the present study we have investigated the eff ects of polystyrene nanoparticles (PSNPs) on RBC deformability and adherence to EC, in parallel to hemolysis. Human RBCs (10% hematocrit) were incubated for 1 hour with PSNPs (average diameter 50 nm, at ratios ranging from 10 to 1000 NP/RBC) in PBS, and their adhesion to cultured human micro-vascular EC and deformability were determined as a function of shear stress, using a computerized cell fl ow-properties analyzer, designed and constructed in our lab. It was found that interaction of RBCs with PSNPs induced a slight increase in their rigidity (reduced deformability), but markedly elevated their adherence to EC as function of PSNPs concentration. While the elevation of RBC adherence was clearly observed at a low (100) PSNPs/RBC ration, hemolysis was detected only at a very high (1000) ratio, thereby further demonstrating the sensitivity of RBC fl ow properties and their potential for testing NPs toxicity. As noted above, RBC fl ow properties play key roles in blood circulation, and their alterations have been implicated in the patho-physiology of diverse pathological conditions associated with circulatory disorders. Therefore testing NPs’ eff ect on RBC hemodynamics, is also important for assessing their potential to impair blood fl ow, thus providing important clinically-relevant information, which is not given by the current routine biochemical and hematological tests.


136

Posters

P - 067Study of metal nanoparticle layers for environmental gas sensorsK. Zdansky1, J. Zavadil1, P. Kacerovsky1, F. Kostka1, R. Yatskiv1, M. Muller2, A. Fojtik2

1Institute of Photonics and Electronics, Material Characterization, Prague 8, Czech Republic2Czech Technical University, Faculty of Nuclear Sciences, Prague 8, Czech Republic

Plenty of gas sensors have to be used for controlling industrial processes, for detections of toxic environmental pollutions or for prevention against leaking of hazardous gases. Protection of human health against such gases as nitrogen oxides and the need of monitoring explosive gases like hydrogen in industrial production, distribution and traffi c stimulate research oriented to fi nding new gas sensors. Large dimensions and high costs is the main disadvantage of conventional gas sensors. Besides, most of them are passive elements needing additional equipments or convertors for signal analysis or amplifi cation. Thus, conventional sensors cannot work as intelligent ones and research of new sensitive, effi cient sensors of active type has become an important topic in modern industry. Gas sensors based on interfaces between metals and semiconductors of Schottky type play a signifi cant role in the research for their small sizes and expected low expenses.

Palladium or platinum are metals suitable for making hydrogen sensors based on Schottky barriers. The reason is in catalytic aff ectivity of these metals for atom dissociation of hydrogen molecules adsorbed on metal surfaces. Part of polarized hydrogen atoms can diff use through the metal to the interface with the semiconductor and change the barrier height and thus change the electrical properties of a sensor.

Hydrogen sensors made by deposition of metals in vacuum show lower sensitivity at higher deposition energy [1]. It is caused by fi xing the barrier height due to Fermi level pinning explained by a model of disorder-induced gap states (DIGS) [2]. Larger deposition energy causes larger disorder at the metal-semiconductor interface which induces larger density of gap states and thence stronger Fermi level pinning.

Interfaces of Pd or Pt with n-type InP are suitable for making sensitive sensors of hydrogen provided they are not subjected to a strong Fermi level pinning. Electroless plating is a better method for making sensitive Pd/n-InP hydrogen sensors than thermal evaporation [3]. However, the best sensors were made by electrophoretic deposition of Pd nanoparticles from colloid solutions prepared by reverse micelle technique [4]. The sensors show very good rectifying current-voltage characteristics and large Schottky barrier height 0.83 eV in comparison with 0.60 eV reached by electroless plating. Even larger barrier height of 1.07 eV was achieved by electrophoretic deposition and partial surfactant removing in our lab [5].

Herewith we report on our systematic research of layers of Pd, Ag, Au, Pt and Cu nanoparticles deposited on InP by electrophoresis from reverse micelle colloid solutions. The results should be useful for fi nding new effi cient sensors and other electronic and optoelectronic devices.

References [1] L. M. Lechuga, A. Calle, D. Golmayo, P. Tejedor and F. Briones, J. Electrochem. Soc. 138 (1991) 159-162. [2] H. Hasegawa: Metal-Semiconductor Interfaces, ed. A. Hiraki (IOS Press, Tokyo, 1995), p. 280. [3] H. I. Chen, Y. I. Chou and C. Y. Chu, Sens. Actuat. B 85 (2002) 10-18. [4] Y. I. Chou, C. M. Chen, W. C. Liu and H. I. Chen, IEEE Electron Device Letters 26 (2005) 62-65. [5] K. Zdansky, P. Kacerovsky, J. Zavadil, J. Lorincik and A. Fojtik, Nanoscale Research Letters 2 (2007) 450-455.


137

Posters

P - 068Highly sensitive NO2 sensing based on honeycombed In2O3 nanostructureC.T. Wu1, C. Cheng1, F.H. Ko1

1National Chiao Tung University, Institute of Nanotechnology, Hsinchu City, Taiwan

NO2 is the one of dangerous environmental pollutants and plays primarily a role to cause acid rain, smog, and ozone destruction. Exposure to NO2 concentration frequently higher than the air quality standard (53 ppb) may cause increased respiratory problems in asthma. Traditionally, porous fi lm made of metal oxide nanopartilces was operated in high temperature to detect NO2. The broad distribution of interconnection signifi cantly retards the transport dynamics and leads into a poor sensitivity. Further, the selective detection of NO2 operating at room temperature down to ppb levels using In2O3 nanowires was demonstrated but suff er from some problems of connection, locating and unindustrial fabrication. In this study, we report the self-aligned indium oxide honeycombed nanostructure under porous anodic alumina (PAA) template by sol-gel method. The PAA template, made of anodizing process from alumina fi lm onto a cleaned 200 nm-oxide-capped silicon substrates, was immersed in In(OH)3 gel and then calcined in a furnace of 600°C. The taper In2O3 honeycomb capped upon the PAA template regularly with a thickness of 300 nm (Fig. a). The diameter of top pore is larger than the 100-nm pore of underlying PPA template and the spacing is 140 nm. After fi nger-shape metal electrodes were patterned and, the device was mounted in a home-built gas delivery chamber equipped with feedthrough and gas inlet/outlet (Fig. b). We introduce the diluted NO2 mixed with air and sensing experiments were carried on by monitoring the real-time conductance under diff erent NO2 concentrations ranging from 5 to 500 ppb at room temperature (Fig. c). As the result, In2O3 honeycombed sensors showed a detective limitation of 5 ppb with a distinct respond, which is superior sensitivity to NO2 operating at room temperature compared with other types of metal oxide sensors such as nanowires and all established solid-state NO2 sensors, as well as great reproducibility and short recovery times. The developed simple and genuine synthetic approach may be highly valuable for the generation of diverse sensing devices.

P - 069Eff ect of mechanical milling parameters on synthesis and properties of iron aluminide alloy nanostructuresA. K. Kashani1, E. Salahi2, K. Pourazarang1, A. Kh. Vafadar1, A. K. Kashani3, M. Hemmatikia1

1Sharif Univeristy of Technology, Materials Science & Engineering, Tehran, Iran2Materials and Energy Research Center, Materials Science & Engineering, Karaj, Iran3Islamic Azad University, Mine Engineering, mahallat, Iran

Iron aluminide intermetallics have attracted considerable attention as high oxidation and sulfi dation resistance that have good prospects as high-temperature structural applications requiring excellent oxidation resistance. In this work, we have researched the structures of iron aluminides formed by planetary ball mill in an argon atmosphere. The structure of intermetallic iron aluminides was studied under diverse conditions such as diff erent compositions, milling time, ball-to-powder weight ratio (BPR) and diff erent process control agents (PCA). These nanostructures were characterized by X-ray diff ractometry (XRD) and scanning electron microscopy (SEM). Williamson-Hall method was used to determine grain-size reduction and nanostructure formation with increasing milling time. Scanning electron microscope was used for investigation on powder morphological changes during milling. MERCK iron and aluminium powders in the size range about 10 microns were milled with suitable ratio 86Fe-14Al (Fe75-Al25) and 67Fe-33Al (Fe50-Al50) by weight to form iron aluminide alloy nanostructures. It is seen that with increasing time of milling, nanocrystalline structure proportion will be accelerated.


138

Posters

P - 070Novel use of silicon nanocrystals and nanodiamonds in cell biologyA. Fucikova1, J. Valenta1, I. Pelant2, K. Kusova2, V. Brezina3

1Charles University in Prague Faculty of Mathematics and Physics, Department of Chemical Physics and Optics, Prague 2, Czech Republic2Institute of Physics AS CR v. v .i., Department of Thin Films and Nanostructures, Prague 6, Czech Republic3Institute of Systems Biology and Ecology AS CR v. v .i., Division of Physical Biology, Nove Hrady, Czech Republic

We are developing a new nontoxic nanocrystalline silicon (Nc-Si) fl uorescence labels, which are biodegradable in living body, and nanodiamonds with fl uorescence stable in the long term, mainly for in vitro use. These novel fl uorescencent labels could be very good substitutes for commercially used quantum dots (e.g. cadmium compounds quantum dots), which can be toxic according to the latest results [1]. Light-emitting silicon nanocrystals (Si-NCs) have a crystalline core with size between 1 to 5 nm and their surface is most often covered by SiO2, they emit fl uorescence in the visible part of the electromagnetic spectrum. The PL properties depend not only on the Si-NC size but the surface of nanocrystal plays a crucial role. Our target spectral region is around 600 nm, where the autofl uorescence from animal cells is very low. The second material studied in this work is nanocrystalline diamond, which exhibits luminescence over the whole visible range of the electromagnetic spectrum in dependence upon various doping. Nanodiamonds have core around 8 nm with surface covered by various carboxy- , keto- , hydroxyl- and oxygens groups.The bio-interaction of nanoparticles is studied on a cell culture L929 mouse fi broblast and HeLa cells by various optical and physical methods. The size and shape of nanocrystals were determined using atomic force microscopy. After the introduction into the cell culture the fl uorescence of Nc-Si is shifted to shorter wavelengths. A similar eff ect is observed when Nc-Si surface passivation is modifi ed by a layer of xylene-like molecules [2]. Nanocrystalline silicon and nanodiamonds are observed to enter the internal environment of cells by phagocytosis.

References[1] Bhatia S. N., Chan W. C. W., Derfus A. M. (2004): Probing the cytotoxity of semiconductor Quantum dots, Nanoletters Vol.4, No.1, 11-18. [2] Kůsová, K. et al. (2008). Yellow-emitting colloidal suspensions of silicon nanocrystals: Fabrication technology, luminescence performance and

application prospects, Physica E, DOI: 10.1016/j.physe.2008.08.02.


139

Posters

P - 071Nano-structured Catalytic Materials for Diesel Soot OxidationS. Lorentzou1, A. Zygogianni1, G. Kastrinaki1,2, C. Pagkoura1,2, A. Konstandopoulos1,3

1CPERI/CERTH, Aerosol and Particle Technology Laboratory, Thessaloniki, Greece2University of West Macedonia, Department of Engineering & Management of Energy Resources, Kozani, Greece3Aristotle University, Department of Chemical Engineering, Thessaloniki, Greece

Objectives The demands and strict regulations in diesel emission control lead to an ever increasing use of Catalytic Diesel Particulate Filters (CDPFs). The automotive industry is focusing in the development of CDPFs able to collect soot particles and accelerate direct oxidation at the prevailing exhaust conditions. Typical catalysts are based on base metal oxides.

In the current work, the materials investigated were perovskites as well as cerium based mixed oxides. In the case of the latter an investigation of the eff ect of doping on the activity of cerium oxide was performed.

MethodsPerovskites (designated as PI, PII, PIII) as well as cerium-based oxides were synthesized by three methods. PI was synthesized via a Liquid Route (LR) while PII, PIII and cerium-based oxides via Liquid Phase Self-propagating High temperature Synthesis (LPSHS). All of the above materials were synthesized via Aerosol Based Synthesis (ABS).

The materials were characterized via X-ray diff raction (XRD), Scanning and Transition Electron Microscopy (SEM, TEM) and Raman spectroscopy. Their catalytic activity was evaluated via Thermogravimetric Analysis (TGA). The best formulations were deposited on fi lters via Aerosol Based Deposition (ABD) and tested in an engine test cell bench.

Results-ConclusionsWith respect to crystal structure, ABS synthesized materials had lower degree of crystallinity compared to the materials from the other methods.

Considering the soot oxidation activity, an initial grinding (1h) of the LR as-synthesized PI catalyst, shifted soot oxidation to lower temperatures, while further grinding had no eff ect on its activity.

ABS synthesized PII and PIII had better soot oxidation activity compared to LPSHS ones with PIII having the best performance.

Doping of cerium oxide with other metal oxides aff ected its crystallinity, shifting the cerium oxide peak to higher diff raction angle. TEM analysis revealed the nanocrystalline structure of the ABS materials. The latter demonstrated improved soot oxidation activity compared to LPSHS catalysts due to their nano-structured nature.

In-situ Raman spectroscopy was conducted for the investigation of soot oxidation with and without the aid of catalysts, for the case of doped cerium oxide. A correlation between the TGA experiments and the in-situ Raman spectra acquired at several temperature regions was observed.

ABD catalyst coating of ceramic wall-fl ow monolithic segments lead to fi lters with improved behavior with respect to pressure drop and soot oxidation, compared to the uncoated fi lters.

A well known drawback for the development of active CDPFs is the contact of catalyst with soot. Catalyst chemistry may be masked when coated on the fi lter due to reduced contact with soot. On the other hand the geometric aspects that characterize a CDPF (design, formation of catalytic layer on the wall of the fi lter, etc.) can determine the degree of soot to catalyst contact and therefore the effi cient regeneration of the fi lter.


140

Posters

P - 072Ultrasound-Enhanced Nanoparticle-based Monitoring of Bacteria in WaterD. Bavli1, Y. Barenholz1, A. Priev1

1The Faculty of Medicine Hebrew University, Biochemistry, Jerusalem, Israel

Real-time monitoring of water contaminants is an essential component in the security and safety of any potable or reclaimed water system. The more we understand the risks from pathogens and toxins posed by water recycling, the greater the confi dence the public will have in its acceptance. In this paper, we describe a cylindrical standing-wave-based ultrasonic analyzer for continuous monitoring of quality of water. Our approach to reduce uncertainty is through the use of multiple indicators (i.e. specifi c gravity, turbidity, salinity, gases and microbes) for a better understanding of the types and concentrations of contaminants in water. For rapid identifi cation of Escherichia coli (E. coli) and Salmonella typhi (S. typhi) we use ultrasound-accelerated nanoparticle-based quantitative immunoassay. High accuracy and rapid water testing (30-40 sec) are achieved by combining high-intensity (10 W/cm2, 1 MHz) ultrasonic waves for separation and concentration of large particles (pathogens) with low-intensity (0.5 W/cm2, 10 MHz) ultrasonic waves for compositional analysis. Multiple ultrasonic parameters can be measured: propagation velocity, absorption, impedance, as well as frequency and temperature dependencies of these variables. High-intensity standing waves create an acoustic radiation force which forms two areas of pressure where the bacteria and nanoparticles can be trapped: A high acoustic pressure area (node) and a low acoustic pressure area (anti-node). We use high ultrasonic intensity and a laminar fl ow rate of 30-60 μl/min to trap and concentrate selectively bacteria attached to nanoparticles. Under these conditions, the acoustic radiation forces acting on the bacteria attached to nanoparticles drive them directly to the node. The acoustic pressure depends on the frequency of the ultrasonic resonator and on the density, compressibility, and size of the bacteria-nanoparticle complexes. Calculations of the bacterium surface area (8-10 μm2) and the cross-sectional area of the antibody-coated nanoparticles (ACN) show that up to 200 ACN can attach to each bacterium. Free nanoparticles, as well as free bacteria, are not trapped and are washed out of the separation area by the aqueous fl ow, resulting in specifi city and sensitivity of the assay. Our results demonstrate the potential to trap and measure very low concentrations of E. coli and S. typhi bacteria in real time using nanoparticles, ultrasonic standing-wave separation technology, and sound velocity or sound absorption monitoring. The results also illustrate the benefi ts of rapid nanoparticle-based ultrasonic monitoring of E. coli and S. typhi bacteria, as well as a direct ultrasonic determination of other parameters: specifi c gravity, turbidity, salinity, and gases. High sensitivity of ultrasound to composition and properties of water have been established. Since response time is critical, real-time monitoring is much more eff ective than physical sampling-based-monitoring with sample collection frequency of 24 hours.

This study is supported by a grant from the Water Authority of Israel (grant No 039-4229).

P - 073Towards direct RNA functionalisation of gold nanoparticles - application to biomolecular recognitionM. Moreira dos Santos1, J. Conde1, G. Doria1, P. Baptista1

1CIGMH/Dep. de Ciências da Vida, Faculdade de Ciências e Tecnologia/Universidade Nova de Lisboa, 2829-516 Caparica, Portugal

The unique physico-chemical properties of metallic nanoparticles have been exploited for the creation of nano-biosensors able to recognise and detect specifi c DNA and/or RNA sequences. We have used colloidal gold nanoparticles labelled with thiol-DNA oligonucleotides (Au-nanoprobes) in a simple, easy-to-perform and inexpensive colorimetric assay for the detection of specifi c DNA and/or RNA sequences. The assay is based on the increased stability of the Au-nanoprobes upon hybridisation with the complementary DNA and/or RNA target in solution, while non-hybridised Au-nanoprobes easily aggregate once the solution’s ionic strength is increased. Due to the optical properties of gold nanoparticles derived from localised surface plasmon resonance, this aggregation is accompanied by a change of colour from red to blue, providing the means for detection. Thus far, we have applied this strategy for detection of specifi c DNA sequences (pathogen detection, characterisation of mutation and/or SNPs) and specifi c RNA sequences (gene expression studies without previous retro-transcription and amplifi cation).

Here we present the use of gold nanoparticles functionalized with amine-RNA oligonucleotides towards the enhancement of current detection capabilities and potential application in therapy (siRNA). Direct functionalization of the Au-nanoparticles’ surface with amine-RNA was attempted and the resulting nanoconjugates were evaluated for the development of new biomolecular recognition systems.


141

Posters

P - 074Fabrication and implementation of CuO-nanowires for gas sensing applicationsM. Milnera1, T. Maier1, A. Tischner1, A. Köck1, C. Gspan2, G. Kothleitner2

1Austrian Research Centers GmbH, Nano-Systemtechnologies, Vienna, Austria2Graz University of Technology and Centre for Electron Microscopy Graz, Institute for Electron Microscopy and Fine Structure Research, Graz, Austria

Numerous applications ranging from industrial process control and environmental monitoring to disease diagnostics in medicine have a strongly increasing demand for highly sensitive gas detecting devices. Metal oxide based gas sensors, which rely on changes of electrical conductance due to the interaction with the surrounding gas, have been developed over the years to established devices. A most powerful strategy to improve sensor performance is the implementation of single crystalline nanowires as sensing elements, which have a high surface to volume ratio and thus a strong interaction between the surrounding gas and the material.

We report on the fabrication of CuO-nanowires and their implementation on Si-substrates for gas sensing applications. The CuO-nanowires are thermally grown by heating Cu-sheets in oxygen atmosphere up to temperatures between 450°C and 650°C. Scanning electron microscopy analysis shows extremely dense growth of nanowires approximately perpendicular to the surface. The nanowires have lengths up to 50 μm and diameters in the order of 100 nm and below. The nanowires have been investigated with a high resolution transmission electron microscope. The electron diff raction pattern reveals single crystalline CuO nanowires with [011] orientation.

The fabrication of the Cu-nanowire sensors is based on photolithography and requires no sophisticated e-beam lithography. Cu-sheets with thermally grown nanowires are embedded in isopropanol, where the nanowires are removed and transferred on SiO2-coated Si-substrates. After evaporation of the solvent the CuO-nanowires stick with random orientation on the surface. In the next step the Si-samples are coated with a photoresist, where a regular pattern of squares (size 100 x 100 μm2) is exposed to defi ne the contact pads. By developing the photoresist, the ends of the nanowire get exposed. Evaporation of Ti − Au contact pads followed by a fi nal lift-off process provides metal contacts to the CuO-nanowires and their fi nal fi xing to the substrate. Depending on the number of CuO-nanowires on the sample, the metal pads provide contact to single nanowires or to a few nanowires connected in parallel. The Ti − Au contact pads are directly employed to bond the sensor elements to a standard ceramic chip carrier with implemented micro heaters to allow for heating the sensor device up to operating temperatures between 200°C and 450°C.

The sensitivity of the CuO-nanowire sensors to the gases CO, CH4, SO2 and H2S, which are of high environmental concern, is investigated in detail. The sensing performance is characterized in a wide range of operating temperatures and gas concentrations in order to study the sensor selectivity.


142

Posters

P - 075Titania and silica dioxides, obtained by sol-gel method, as potential coatings for medical implantsJ. Krzak-Ros1, I.E. Kochanowska2, C. Pezowicz3, J. Filipiak3, M. Miller4, R. Bedzinski3

1Wroclaw University of Technology, Institute of Materials Science and Applied Mechanics, Wroclaw, Poland2Polish Academy of Sciences, Institute of Immunology and Experimental Therapy, Wroclaw, Poland3Wroclaw University of Technology, Institute of Machine Design and Operation, Wroclaw, Poland4Wroclaw University of Technology, Faculty of Chemistry EIT+ Wroclaw Research Centre, Wroclaw, Poland

New solutions in the fi eld of medical implants are searched. Past experience has shown that biocompatibility and corrosive resistant of applied metallic materials is insuffi cient.Researchers try to fi nd a way to improve properties of metallic medical implants during their work in tissue environment. One of the solutions is to coat metallic implants with oxide coatings.

In this study, the attempt to synthesize such coatings was undertaken. Syntheses were carried out by sol-gel process. Sol-gel titania and silica dioxide coatings have received a great deal of attention in area of bioactive surface modifi cation of metallic implants.

Moreover, physicochemical and biological investigations of obtained materials have been made.Silica and titania thin fi lms were synthesized by sol-gel method and coated by dip-coating method onto the metallic substrates. In the syntheses the following chemicals have been used:• the titanium alloy (Ti6Al4V) and iron alloy (316L) as the substrates;• the titanium isopropoxide (TIPO), tetraethyl orthosilicate (TEOS) and diethoxydimethylsilan (DEMS) as the precursors for sol-gel hydrolysis;• the iso-propanol (isoPrOH) and ethanol (EtOH) • acetylacetone (AcAc) • the titanium alloy (Ti6Al4V) and iron alloy (316L) as the substrates.

The TiO2 and SiO2 fi lms were annealed in air for one hour at 500ºC.

The structural properties of the coatings have been determined using X-ray diff raction and Raman spectroscopy. The continuous of the layers and the thickness have been studied by Scanning Electron Microscope (SEM). The biocompatibility has been checked by growing the cellular culture on the samples (substrate + coating).

The thin fi lm of titania and silica dioxide with no cracks or scratches was deposited on the metal substrate. The thickness of obtained layers was about few hundred nanometers. The studies have shown that comparing the XRD patterns with the corresponding Raman spectra is an excellent way to determine the phases present in sol-gel thin fi lms. XRD analyses carried out on the TiO2 showed that the fi lms consist the anatase crystal phase but SiO2 fi lms are amorphous. The Raman spectra have been shown that the TiO2 fi lms were free of organic group and the SiO2 layers have had the CH3 group in their structure. The biological investigations indicated that the cellular culture grown better on the coated substrates than on the pure substrates.

The sol-gel titanium and silica dioxides were synthesized. Obtained dioxides could be potential materials for medical application. Further medical investigations are necessary to improve attractiveness of ceramic coatings as biomaterials.

Acknowledgements

Investigation was fi nanced within the confi nes of grants No. N N507 4491 33 and N507 009 31/0275 supported by the Ministry of Science and Higher Education.

P - 076ANTI HIV NANOROBOTSN. Dutta1, P.R. Singh2, A.G. Gogoi1, H. Roy3

1Srm university, genetic engineering, Chennai, India2Srm university, electrical and electronics engineering, Chennai, India3Srm university, computer science engineering, Chennai, India

HIV is a family of retrovirus carrying RNA as its genome. Previously it was known as TLV (T lymphocyte virus) as it infects T helper cell and reduces CD4 receptor to cause immunodefi ciency in human body. At present the HIV infection rate is very high all over the world and in India this is pretty much alarming. Though there has no drugs been found which could destroy HIV genome due to its high mutation frequency, Zidovudine is used to control as it prevents reverse transcriptase to synthesize cDNA which is later integrated in the host genome. But any time zidovudine can lose its effi ciency as mutation at HIV genome (codon 67, 70,215,219) will change RT property as it is site specifi c and mutation cause it lose its specifi city. Now NANOROBOTS are believed to be useful against this virus. Size of a nanorobots is 0.1-10 micrometer in diameter .With the development of nanotechnology and nanoelectronics such nanorobots are being developed. This nanorobot will consist a nano biosensor, a nano tube fi xed at its tip, and two containers containing high concentration of DNase and RNase enzyme. The function of nano sensor is to identify the presence of a particular compound on the transmembrane (here gp120 & gp41, the unique HIV viral regulatory protein) of the infected cell by means of immunochemical reaction & sending signal. On the receiving end there will be a data convertor which in turn getting +ve signal injects the nanotubes in the nucleus and release DNase and RNase in. These enzymes will cleave the viral genomic DNA & all mRNA produced by it at that time into single nucleotides, as it is not site specifi c and mutation of HIV genome will have no eff ect on the effi ciency of the enzyme. In this way destroying all the infected cells & HIV genome in the infected body can be eliminated.


143

Posters

P - 078Complex system for detection of bioaffi nity complexes in microfl uidic chipsW. Schrott1, M. Nebyla1, M. Pribyl1

1Institute of Chemical Technology Prague, Department of Chemical Engineering, Prague, Czech Republic

This work deals with a complex laboratory system intended for bioapplications, particularly for medical diagnostics. The system contains multichannel microfl uidic devices used for fl uorescence detection of bioaffi nity complexes. The multichannel microfl uidic devices are fabricated from polydimethylsiloxane (PDMS) by a combination of various microfabrication techniques intended for low-cost production. Fluorescence detection of bioaffi nity complexes in microchannels is carried out by fl orescence microscope, and a more sensitive detection system consisting of a laser exciting source, optical fi bres and photomultiplier tube (PMT). The complex system is tested on a particular bioaffi nity in ferritin detection intended for quantifi cation of this important marker in human diagnostics. The microfl uidic devices are prepared by UV photolithography, micromilling, and casting techniques. The combination of these techniques is intended for possible low-cost and large-scale production of these devices. Microfl uidic device consists of eight parallel channels 60 um deep and 100 um wide. Multi-step sandwich ferritin immunoassy was proposed. Two types of detection are provided. First type of ferritin detection uses a mercury lamp for fl uorescence excitation and the fl uorescence signal is observed by a microscope equipped with camera. This type of detection is simple, cheap and easy to operate. Upper detection limit reached is 100 ug/ml of ferritin in the sample. Lower detection limit is 0.01 ug/ml of ferritin in the sample. More sensitive detection can be achieved by the complex laser-based detection apparatus. This detection system is composed of a laser exciting source, optical fi bres, refl exing probe, optical fi lter, PMT, step motors and measuring elements. The whole procedure of detection is controlled by computer and is fully automatic. The whole system is designed as a low cost, fully automatic and easy to operate. Complete detection of ferritin, from sample introduction to fi nal results, can be achieved within one hour. Consumption of biochemicals is very low.

P - 079Sol-Gel Derived Waveguide Immobilized DNA Biosensors for E. Coli O157:H7 Detection in Drinking Water ResourcesZ.B. Bahsi1, A. Buyukaksoy2, M.H. Aslan3, A.Y. Oral2

1Gebze Institute of Technology, Environmental Engineering, Kocaeli, Turkey2Gebze Institute of Technology, Materials Science and Engineering, Kocaeli, Turkey3Gebze Institute of Technology, Physics, Kocaeli, Turkey

SiO2 -TiO2 thin fi lms were fabricated by sol-gel dip coating technique to be used as fi ber optic guiding layers of optical DNA biosensors. The chemical structure of the fi lms was examined by Fourier Transformed Infrared Spectroscopy (FTIR, Bio - Rad Tropical Option for FTS 175 C) and the surface morphology of the fi lms was observed by Scanning Electron Microscopy (SEM, Philips XL 30 SFEG). The probe DNA was immobilized on the surface and the pores of the waveguide fi lms before the hybridization process was carried out. By using Metricon 2010 prism coupler, 12 diff erent spots were determined to be measured. Then the mean refractive index values and their standard deviations were calculated. The increased refractive index values after the DNA immobilization indicated that immobilization was successfully achieved. Further increase after the hybridization with complementary DNA showed the possibility of detection of the E. coli O157:H7 EDL933 species by using 20-mers (5’- TAATATCGGTTGCGGAGGTG -3’) sequence of GeneID: 957271.


144

Posters

P - 080The passage of nanoparticles from the middle ear to the cochlea through the round window membrane in the rat, J. Popelář1, D. Buckiová1, T. Chumak1, J. Syka1

1Institute of Experimental Medicine ASCR, Auditory Neuroscience, Prague 4, Czech Republic

Background and Objectives: The inner ear is an isolated, multicompartmental organ. The application of drugs directly to the cochlea is connected with a risk of causing irreversible damage. A less invasive approach is the application of a drug to the middle ear and its subsequent transport through the round window membrane (RWM) to the cochlea. For this purpose, nanoparticles (NPs) seem be a suitable tool for transport through the RWM.

Methods: Liposomes (UH.IB), block copolymer NPs (USOU) and silica NPs (ABO) ranging between 80-100 nm in size were tested. NPs, either unloaded (tagged with a fl uorescent dye only) or loaded with disulfi ram as a toxic drug, were applied on a small piece of gelfoam on the RWM in ketamine (35 mg/kg) and xylazine (6 mg/kg) anaesthetized rats, either as a single injection of a 10 μl suspension or by continuous delivery using an Alzet microosmotic pump (100 μl of NP suspension for 7 days). The rats’ hearing thresholds were periodically checked by the recording of auditory brainstem responses (ABR), while the physiological state of the outer hair cells was assessed by recording distortion-product otoacoustic emissions (DPOAEs). Histological evaluation was performed at the end of the experiment; the rats were sacrifi ced, and their auditory bullas were fi xed in paraformaldehyde (4%) and decalcifi ed. Paraffi n-embedded sections of the cochlea (10μm) were stained with Alexa Fluor 488-labeled phalloidin and DAPI. S100 staining was used as a marker of Schwann cells, and Bax staining was used as an indicator of cell death. A confocal microscope (Zeiss 510 DUO) was used for analysis of the samples; the extent of cellular damage was assessed with an optical dissector.

Results: All types of NPs were identifi ed within 24 hours in the cochlea. They entered the cytoplasm of cells in the organ of Corti (hair cells and supporting cells), neurons of the spiral ganglion and the cells of the lateral wall. NPs were present for at least six weeks in the rat spiral ganglion. Unloaded NPs did not cause any distinct morphological damage in the inner ear nor any pronounced changes in the hearing threshold or DPOAE amplitudes. However, an evident damaging eff ect of disulfi ram-loaded NPs on Schwann cells and neurons in the spiral ganglion was found. The morphological alterations were refl ected in a signifi cant increase of the hearing thresholds by 20-40 dB without aff ecting the DPOAE amplitudes.

Conclusions: All tested nanoparticles passed through the round window membrane. They entered the cytoplasm of the cells in the inner ear in rats without causing any change in hearing function. The application of disulfi ram-loaded NPs on the RWM produced morphological damage in the spiral ganglion refl ected in hearing threshold shifts. These preliminary results suggest that the passage of nanoparticles loaded with drugs or other active substances through the RWM to the inner ear might be useful in the treatment of patients, following appropriate clinical trials.


145

Posters

P - 081Responses of TiO2 layers prepared on the base of sol-gel technique to volatile organic compoundsI. Rutkowska1, A. Szczurek2, M. Rybaczuk3, K. Kozlowska3, B. Flisowska-Wiercik2

1Wroclaw University of Technology, Faculty of Chemistry, Wroclaw, Poland2Wroclaw University of Technology, Institute of Environmental Protection Engineering, Wroclaw, Poland3Wroclaw University of Technology, Institute of Materials Science and Applied Mechanics, Wroclaw, Poland

Titanium dioxide shows promising gas sensing properties for various applications. In the past decade it has been studied extensively.

This paper presents responses of TiO2 layers to diff erent volatile organic vapors (VOCs).

The sensing material was prepared by sol-gel technique. Titania thin fi lms were prepared from titanium n-butoxide (TNBT), butanol, acetylacetone and small amount of distilled water. The layers were deposited on polycrystalline alumina substrate with gold electrodes on one side and platinum heater on the other side by dip-coating method. The TiO2 thin fi lms were annealed in air for one hour at temperatures in the range 500°C to 950°C. This process was done three times so three layers fi lms were obtained fi nally. Morphology of TiO2 layers were studied by scanning electron microscopy (SEM) and atomic force microscopy (AFM). Microstructural studies were performed by Raman spectroscopy and X-ray diff raction (XRD).

The titania layers were tested in the environment of alcohols and organic acids. The responses of TiO2 fi lms were registered as current intensity changes versus concentration of volatile organic vapors at chosen temperature.

It was found that the sensor based on TiO2 layer exhibit overlapping sensitivity to various volatile organic vapors. The sensing characteristics of this material were dependent on the preparation conditions.

The results of our investigation demonstrate that TiO2 layers present promising sensing characteristics. Sensors based on this material can be used in sensor array for the measurement of gas mixtures. This requires, however, continuation of our studies.

P - 082Altering Water Treatment Outputs: Oxidation of Aromatic Compounds in the Presence of Quantum Dots NanoparticlesD. Leszczynska1, H. Kusic2, N. Koprivanac2

1Jackson State University, Civil and Environmental Engineering, Jackson, USA2University of Zagreb, Faculty of Chemical Engineering and Technology, Zagreb, Croatia

Typical water treatment plant may use ozone or UV radiation for the disinfection purposes. At the same time, it is well known that ozone in water acts as the strong oxidant, and it will react with trace organic and inorganic compounds found in treated water. An objective of our study was to evaluate possible altering of overall effi ciency of ozonation and UV irradiation in the presence of semiconductors, CdSe/ZnS core-shells nanoparticles. Because of their properties, we were assuming that their presence in water may enhance effi ciency of process by either lowering required dose, or altering typical mechanisms of oxidation to receive more effi cient removal of original pollutants. The characteristic of tested quantum dots is given below:

Emission peak [nm] Crystal diameter [nm-approx]

Molar extinction coeffi cient

Molecular weight [μg/nmol]

Approx. quantum yield

Color of QD suspension

600 5.0 2.0*105 270 >50% Orange

520 3.3 5.0*104 94 >50% Green

We carried out testing on model solutions containing standardized concentration of (a) phenol, (b) toluene, or (c) synthetic organic dye C.I Reactive Blue, in the presence of nanoparticles, and using ozone or UV as oxidants. The average reaction time was 1-2 hours; much longer that typical detention time used in water treatment plants, but needed to continue observation of reaction pathways. Obtained preliminary results have shown that the presence of chosen nanoparticles have altered the kinetic of oxidation, and produced diff erent by-products. The overall effi ciency of removal was diff erent when compared reactions under the same conditions, but without quantum dots.


146

Posters

Poster Session 4 - Future industrial technologies

P - 083Industrial engineering of light strong composite materials, reinforced by nanocrystal high-resistance polyethelene fi bersE. Sergeeva1

1Kazan State Tehnological University, plasmachemistry and nanotechnology department, Kazan, Russia

The composite material “Polyethylene plastic” reinforced by nanocrystal high-molecular strength modular polyethylene (SMPE) fi ber is developed. On specifi c durability, polyethylene plastic surpasses metals in 6-7 times, fi breglasses in 2,5 times, and coal-plastic in 1,5 times. Reception of polyethylene plastic is based on activation of the nanocrystal SMPE fi ber by nonequilibrium low-temperature plasma.

It is steady against moisture infl uence (sea and tropical), UV lights and chemical infl uence. It is radiolucent, dielectric, cold-resistant. Polyethylene plastic diff ers in low density up to 1,1 g/cm3, high durability, good sound-absorbing and chemical fi rmness.

These properties with the big effi ciency can be used in aviation, helicopter engineering, shipbuilding and motor industry, and also for manufacture of means of an individual defense. Application of polyethylene plastic in these areas will allow to save to 30-40 % of hydrocarbonic fuel that will improve environment ecology.

In the aviation industry, according to experts, it can be applied in following fi elds: manufacturing of pilotless fl ying machines, replacement of constructional materials of the internal equipment of passenger salons and cargo compartments of fl ying machines by easier and strong materials. In manufacture of auto parts, decrease in their weight at 10-20 times with preservation of strength properties is possible.

On each car there are systems of passive safety. Systems providing safety of units of a motor vehicle on small speeds of collision and preservation of vital space of passengers at the high speeds of collision can be made of polyethylene plastic. Having the specifi c durability surpassing steel in 15 times, polyethylene plastic will sharply lower weight of these details and will repeatedly improve protective functions of a safety zone.

Polyethylene plastic is suitable for manufacturing composite armor and screens for protection of crews and responsible units. Manufacturing of extra light case details of the weapon, equipment and the military technics working in excited environments. In bank cars replacement of the steel armor by the composite will lower a body weight of a vehicle from 300kg to 2000kg depending on car type.

According to the experts, the developed materials will fi nd wide application in shipbuilding for manufacturing of cases of yachts, deck superstructures; cases of high-speed courts on an air cushion, everywhere, where it is required high strength and operational characteristics of a material. It will provide equipment weight reduction in 10 - 30 times at absolute fi rmness to sea water. Wide application of “Polyethylene plastic” as a whole will result in rational use of hydrocarbons and will lower their consumption as fuel.

P - 084Supramolecular 2D network of PTMTC radical adsorbed onto Au(111) and Cu/Au(111)F. Grillo1, M. Oliveros2, V. Mugnaini2, J. Veciana2, S.M. Francis1, N.V. Richardson1

1University of St Andrews, EaStCHEM and School of Chemistry, St Andrews, United Kingdom2Institut de Ciencia de Materials de Barcelona-CSIC, Campus UAB, Bellaterra, Spain

A challenge in nanotechnology is controlling growth and properties of structures on a length scale down to molecular dimensions. Metal-organic frameworks (MOFs) are coordination polymers in which the open framework can be loaded with other metals/compounds by employing a guest-host chemistry which opens up application routes in the fi elds of catalysis, hydrogen storage, sensing. Existing strategies consist of anchoring pre-synthesized MOFs onto metal surfaces; the present project aims to use surfaces to initiate MOFs formation and to control their 3D growth. Previous work [1] has demonstrated that organic molecules related to the ligands used in MOFs (carboxylic acids for example) can form 2D networks on metal surfaces and lead to diff erent structures depending upon their surface coverage and the presence of other metal ions. In this context, the polychlorotriphenylmethyltricarboxyl radical (PTMTC) has been used to form non-interpenetrated networks with propeller-like nanochannels [2].

In this work, we present initial observations of anchoring PTMTC onto a Au(111) surface and a Cu doped Au(111) surface, in UHV conditions. Combined STM and vibrational spectroscopies (RAIRS, HREELS) results allow us to determine that PTMTC coordinates with the clean Au(111) surface through the chlorine atoms and forms racemic domains. With the addition of copper, the PTMTC radical appears to coordinate preferentially on the area surrounding the added metal in a disordered fashion. Reordering and copper incorporation, leading to the formation of a MOF, is initiated by mild annealing.

The SURMOF project is supported by the European Union under the contract NMP4-CT-2006-032109.

References[1] B.G. Fredrerick et al., Surf. Rev. Letters, 3 (1996) 1523; T. Bitzer et al., Surf. Sci., 427 - 428 (1999) 369;[2] D. Maspoch et al., J. Mater . Chem ., 14 (2004); D. Maspoch et al., J. Phys. and Chem. of Solids, 65 (2004) 819.


147

Posters

P - 085TERAEYE - A fully passive THz inspection system based on nanotechnology for security applicationsV. Pagnotta1

1C.Engineering Srl, Development & Innovation, Roma, Italy

Compared to the inspection techniques enabled by X-ray imaging, Terahertz radiation based applications off er advantages such as a low energy, increased image contrast for diff erentiation between various soft materials and the possibility of chemical identifi cation.

Although security applications that employ Terahertz waves have been under consideration for many years, at present there is no system that can be fully implemented in practical situations. Main reasons preventing the practical and wide use of THz in the security sector are the very high cost of the system components, the low brightness of incoherent far-infrared sources and the poor sensitivity of actual bolometric detectors. For this reason, a European consortium of research centres and private companies is currently studying an experimental technique to fabricate a cheap detector based on nano-fabricated semiconductor Quantum Dots coupled with metal single-electron-transistors. Under laboratory conditions, an experimental device working at sub K temperature able of converting a single THz Photon into 10 million electrons has been developed demonstrating the exceptional high gain of the sensor.

The objective of TERAEYE project, funded by European Commission within the Sixth Framework Programme, is to develop an innovative range of inspecting passive systems, based on the above described detector, to identify harmful materials for homeland security both by spectral analysis and imaging. Main applications will be related to airports security systems, surveillance of crowded areas such as railway and metro stations and detection of chemical and biological harmful substances and hazards in post and goods.

TERAEYE would constitute the basis for the introduction of totally new detection and scanning systems to be applied for security applications, thus opening up new market perspectives for a new set of products and services based on passive THz detection, and thereby supporting a radical transformation in the security sector.

P - 086Elucidation of the nanocrystal structure of amylopectin molecules by fl uorescent labeling K. Kasemwong1, K. Piyachomkwan2, D. Uttapap3, Y. Takeda4

1National Nanotechnology Center, National Science and Technology Development Agency, Pathum-thanee, Thailand2National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Pathum-thanee, Thailand3School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi, Bangkok, Thailand4Faculty of Agriculture, Kagoshima University, Kagoshima, Japan

Nanocrystal structure of amylopectin molecules from cassava, mungbean and canna were evaluated by fl uorescent labeling followed by gel-permeation high performance liquid chromatography. The number average degree of polymerization (dpn) was determined to be in range of 4,520 - 6,100. The molar-based distribution revealed the presence of three molecular species, large (dpn 15,300-22,100), medium (1,770 - 2,460) and small (210 - 800). Their molar proportions diff ered by plant origin. Each amylopectin cluster was suggested to comprise of 9.5 chains on average for mungbean, 7.5 chains for cassava and 5.3-5.5 chains for canna. From these values together with average chain length (cln) (20-27) and dpn of the species, calculation of the number of clusters per molecule of each species should be possible by the equation, (dpn)/[(cln) x (number of chains per cluster)]. The number of clusters per molecule diff ered by plant origin and appeared to be in range of 70-147 on average for the large species, 11-16 for the medium species, and 2-5 for the small species. Since a single cluster is 9-10 nm long, which is a similar size as for crystalline lamella, the diameter of the blocklet corresponded to be 2-50 cluster units in length arranged in tandem. Therefore, the number of clusters per molecule might imply that the molecule of the large and medium species itself was a blocklet. It was also possible that several molecules of these species formed a blocklet together, especially a fairly large blocklet. Some of the medium species, as well as the small species, was probably immature molecules or degraded products of the large species. These results suggested that the three species were basically similar in cluster structure but diff erent in number of clusters per molecule.


148

Posters

P - 087Microwaves electromagnetic interference shielding properties of magnetically functionalized multiwalled carbon nanotubesV. Labunov1, A. Prudnikava1, B. Shulitski1, V. Bogush2, M. Molodechkin2

1Belarusian State University of Informatics and Radioelectronics, Micro- and Nanoelectronics, Minsk, Belarus2Belarusian State University of Informatics and Radioelectronics, Metrology and Standardization, Minsk, Belarus

Increasingly expanding use of the electromagnetic resources and transition to the high and ultrahigh frequency appliances demand the development of the high effi ciency wideband electromagnetic radiation (EMR) screens.

The carbon composites are traditionally used as the shielding layers in EMR screens, as long as they possess the specifi c electrophysical and mechanical characteristics, accessibility and production simplicity.

In the present work the arrays of carbon nanotubes (CNTs) fi lled by the ferromagnetic nanoparticles, so called magnetically functionalized CNTs (MFCNTs) are investigated as a possible material for the electromagnetic interference (EMI) shielding

The CNT arrays were synthesized at the surface of Si substrates by the injection CVD method implying the high temperature pyrolysis of fl uid hydrocarbon (xylene) in a mixture with the volatile source of catalyst (ferrocene) at atmospheric pressure.

By this method the arrays of vertically aligned tightly packed CNTs fi lled with the nanoparticles of Fe, Fe3C, Fe5C2 were synthesized with 90% of cementite Fe3C.

The EMR refl ection and transmission properties of CNT arrays were investigated in the frequency ranges of 8..12 GHz and 26..37 GHz, which are used for the numerous applications such as the microwave location, navigation, imaging, satellite communication etc.

The obtained amplitude-frequency dependence of the refl ection coeffi cient is characterized by the high refl ection of EMR (0..-5 dB) in 8..12 GHz frequency range and its following decrease to -13 dB with the increase of the EMR frequency up to 37 GHz. The total effi ciency of the EMI shielding increases from 20 to 40 dB with the increase of the EMR frequency from 8 to 37 GHz.

The mechanism of EMI shielding and the perspectives of the applications of the developed structures in the technology of the hybrid miniature microwave devices and integrated signal processing microsystems are discussed.

P - 088Flexible sorption responses in a nanoporous framework material identifi ed through an integrated approachD. Bradshaw1, R. Heck1, J. Rabone1, S. Chong1, J. Bacsa1, M. Rosseinsky1

1University of Liverpool, Department of Chemistry, Liverpool, United Kingdom

Porous framework materials derived from the supramolecular self-assembly of metal ions with multitopic organic ligands are an important class of adsorbent with nanoscale pore structures that have potential applications in catalysis, separation and gas storage. These applications largely rely on framework fl exibility and functionality of the internal surface where guest molecules are adsorbed or transformed by interaction with the organic linkers (often at highly specifi c sites) or unsaturated metal centres. A simulation approach to these interactions is increasingly important as it allows properties to be predicted and ultimately the design of novel frameworks for specifi c applications. A major area of research is the simulation of adsorption isotherms for the storage or separation of strategically important gases; however, much less attention has been paid to the more diffi cult prediction of structural changes observed during the sorption process.

This presentation will report the gas selectivity and sorption properties (N2, H2, CO2, CH4, xylene) of a fl exible framework prepared from a new pyrene-derived ligand and discuss these results in the context of our recent simulation approaches. This has allowed the prediction of sorption behaviours of this phase and the evolution of the structure of the material during this process - particularly, the identifi cation of specifi c ligand rotations to maintain structural integrity and metal coordination requirements. All of the simulated isotherms, uptake selectivities and modelled structures have been verifi ed using experimental and diff raction methods. Such an integrated experiment and simulation approach is an extremely powerful strategy for metal-organic framework (MOF) materials permitting the classifi cation of structural units for specifi c physical properties, and elucidating often complex structural information. This is also relevant to the identifi cation of unknown phases of SURMOFs, thin fi lm framework materials grown onto appropriately functionalised substrates.

This work is funded by an EU FP6 STREP proposal ‘SURMOF’ (NMP4-CT-2006-032109); EPSRC grant number EP/F027443/1 funds JR.


149

Posters

P - 089Metal contacts on organic monolayers formed by electroless metal depositionH. Thomas1, L. Roeder1, B. Schuepbach2, A. Terfort2, M. Paradinas3, C. Ocal3

1Department of Chemistry, Chemistry, Marburg, Germany2Inorganic Chemistry, Chemistry, Frankfurt am Main, Germany3Ciencia de Materials, CSIC, Bellaterra, Spain

As part of our strategy to build devices based on self-assembled monolayers, the problem of effi cient electrical contacting of these layers comes up. This problem is of general interest, since the metalization of organic materials (even bulk ones) normally leads to penetration of the metal atoms into the bulk thus destroying the desired electronic properties.

We explore a deposition technique expected not to interfere with the integrity of the molecular material. Our approach is the use of micro-contact printing of nanoparticles onto a metal-affi ne substrate resulting in a latent image of the structure which is then amplifi ed either by chemical vapour deposition (CVD) or by catalytic electroless gold deposition. These electronic properties of these systems were characterized by a newly developed conductive-probe AFM method.

P - 090Eff ect of interaction of porphyrin-brucine conjugates modifi ed silver nanoparticles with anorganic anions on absorption spectraK. Zaruba1, J. Sarkady1, L. Veverkova1, P. Rezanka1, V. Kral1

1Institute of Chemical Technology Prague, Dpt. Analytical Chemistry, Prague 6, Czech Republic

Reliable control of silver colloid optical properties off ers the possibility of using these systems as sensing materials of the future. Physical and chemical interactions of silver nanoparticles with various chemical species result in a change of visible light absorption [1]. Rhenium in diff erent oxidation states is used as a model in development of novel radiotherapeutics based on radioactive technetium. Unfortunately, cationic forms of these metals are rather toxic. Our approach how to overcome the main drawback based on toxicity of cationic forms is the complexation of nontoxic anionic rhenium (ReO4

-) with porphyrin bidentate (chelating) ligands. Previously, the selectivity of our porphyrin derivatives was proved [2].

In this work modifi cation of silver nanoparticles with cationic porphyrin-brucine conjugates was chosen to try to visualize the selective interaction of the porphyrin-brucine conjugates with diff erent anions.

Aqueous silver colloids can be prepared by chemical reduction of silver(I) salts with various agents including sodium borohydride and sodium citrate [3]. Nanoparticles of diff erent size and shape are prepared by this approach. The silver colloid is stabilized with anions (borate or citrate) but further chemical modifi cation with thiol derivatives is preferred to prevent aggregation. 3-mercaptopropionic acid (3MPA) represents such a compound. It is immobilized on the silver surface by sulfur atom. According to pH, the carboxyl group of 3MPA can interact as carboxylate with cations and, consequently, cationic porphyrin derivatives can be immobilized in the next layer. Previously, we used such a sandwich system for study of interaction of immobilized porphyrin cations with aqueous solutions of nucleotide anions [4].

Porphyrin-tetra-brucine derivatives based on reaction of alkaloid brucine with 5,10,15,20-tetrakis-(4´-bromomethylphenyl)porphyrin or 5,10,15,20-tetrakis-(3´-bromomethylphenyl)porphyrin were immoblized on 3MPA-modifi ed silver nanoparticles. Concentration of nanoparticles, 3MPA and porphyrin conjugates were optimized. Resulting colloids were characterized with transmission electron microscopy and UV/Vis absorption spectrometry. Interaction of modifi ed nanoparticles with various oxoanions (NO3

-. HPO42-, SO4

2-, ClO3-, ClO4

-, HCO3-, ReO4

-) was monitored by means of absorption spectra evaluation. Results obtained in the system with nanoparticles were compared with those obtained in solution without nanoparticles. Diff erent selectivity of free and immobilized porphyrin conjugates will be discussed.

Financial support from the Ministry of Education, Youth and Sport of the Czech Republic, MSMT6046137307, and from the Academy of Sciences of the Czech Republic, KAN200200651, is gratefully acknowledged.

References[1] Y. Sun and Y. Xia, Analyst, 2003, 128, 686-691[2] K. Záruba, L. Veverková, J. Koukolová, P. Vanura, V. Král, Selective Interaction of Porphyrin-Brucine Conjugates with Rhenistan and Other

Oxoanions, manuscript in preparation[3] P. C. Lee and D. Meisel, J. Phys. Chem. 1982, 86, 3391-3395[4] P. Rezanka, K. Záruba, V. Král, Tetrahedron Lett. 2008, 49, 6448


150

Posters

P - 091Characteristics of root and tuber starch granules surface using nitrogen adsorptionK. Kasemwong1, N. Viriya empikul1

1National Nanotechnology Center, National Science and Technology Development Agency, Pathum-thanee, Thailand

Surface of commercial root and tuber starch granules (potato, cassava and arrowroot) are investigated using low temperature nitrogen adsorption. In addition, commercial cereal starch granules (corn) are also studied in comparison to root and tuber starches. The specifi c surface, the volume of mesopores and the mean pore diameter are determined using the BET method. Moreover, pore size distribution, cumulative surface area, volume and mean pore diameter in the range 1-100 nm are determined using the BJH method. From this study, we found that the selected root and tuber starch granules have minor diff erent surface and pore characteristics. However, surface and pore characteristics of the root and tuber starch granules have signifi cant diff erent in comparison to cereal starch granules. As results, these will lead to further studies in order to improve or modify properties of starches respectively to granule characteristic.

P - 092Structural investigations of copper-polypyrrole nanocomposites produced with a dual plasma processC. Walter1, V. Brüser1, A. Quade1, K.D. Weltmann1

1Leibniz Institute for Plasma Science and Technology, PPT, Greifswald, Germany

Background:Metal-polymer nanostructured composites are attracting a great deal of interest because of their various properties like antibacterial eff ect, superconductivity, protective eff ect versus atomar oxygen as well as catalytical activity and hence their possible applications in technologically relevant fi elds [1]. Polypyrrole-metal composites are thereby especially interesting because of Polypyrrole being a conductive polymer with a conductance up to 1000 Scm-1 (doped with PF6) and having a high chemical stability towards air[2].

Those composites are mostly prepared by electrochemical deposition methods which require several process steps as well as a high demand of chemical resources and can only be used on solid conductive electrodes. Coating of particles is hardly feasible.

It is however also possible to produce Polypyrrole thin fi lms by plasma enhanced chemical vapour deposition (PECVD) processes to overcome those problems [3]. By combining this method with a magnetron sputtering device, it is possible to insert metals into those polymer fi lms. To be able to determine the ratio of both processes, 2 plasma sources with independently controllable power generators were installed within the reaction chamber.

X-ray diff raction (XRD), X-ray photoelectron spectroscopy (XPS), cyclovoltammetric and Fourier transformed infrared (FT-IR) measurements as well as scanning electron microscope (SEM) and atomic force microscope (AFM) pictures will be presented.

Results:XRD measurements show, that depending on the power adjustment of the magnetron sputter device, diff erent composites can be produced. By using a low power output, copper atoms bound to the polymer structure are being produced. With increasing power level, copper(I)oxide nanoparticles (size about 2 nm) and copper nanoclusters up to a size of 50nm dispersed within the polymeric matrix can be created. The size of the particles has been calculated with the help of sherrer-equation in both cases.

By XPS-Measurements, the quantities of the elements present within the sample are calculated and show an increase of copper amount with increasing power from 3-30%, while carbon and nitrogen content decreases from 75-43% and 6-1% respectively.

Furthermore, by fi tting the Cu-2p-3/2-peaks obtained by XPS, one is able to determine the oxidation state of the copper atoms enclosed by the sample with the help of the modifi ed Auger-Parameter [4]. As can be calculated mostly Cu+ is present, but one can also see small peaks arising from Cu2+ inclusions as well as their corresponding shakeup peaks. Cyclovoltammetric measurements show the formation of a copper-polypyrrole complex which could be of use in the fi eld of gas and electrocatalytic sensors [4].

FT-IR spectra confi rm those results and indicate a copper-nitrogen binding by a shift of the N-H-stretching peak to lower values with increasing magnetron-power [5].

References[1] A. Malinauskas et al., Nanotech 16 (2005) R51-R62[2] A.B. Kaiser, Rep Prog Phys 64 (2001) 1-49[3] G.J.Cruz, et al., Thin solid fi lms 342 (1999) 119-126[4] Cioffi et al., J. Mater. Chem., 2001, 11, 1434-1440[5] Barthomeuf, J. Phys. Chem 1984, 88, 42-45


151

Posters

P - 093Selectivity of oxoanion binding with porphyrin-brucine conjugates in the solution and with modifi ed gold nanoparticlesL. Veverkova1, P. Rezanka1, K. Zaruba1, V. Kral1

1Institute of Chemical Technology, Analytical Chemistry, Prague 6, Czech Republic

The development of molecular sensors for detecting selectively chemically and biologically important anionic species has become a major research project in supramolecular chemistry. It is still a challenge to fi nd and study materials capable of recognizing and sensing anions in aqueous media [1]. The possible use of modifi ed porphyrins as selector is based on formation of non-covalent pi-pi complexes between porphyrins core and planar analyte together with additional binding modes, like H-bonding, coulombic interaction [2]. Immobilization of porphyrin derivative on surface of nanoparticles allows studying interaction in environment in which selector in insoluble [3].

The goal of this work was to study the interaction between oxoanions and porphyrin-brucine conjugates [4] in methanol-water solution, the infl uence of gold nanoparticles on the interactions was also studied.

Nowadays, gold nanoparticles are often prepared by chemical reduction of Au(III) [5]. Sodium citrate belongs to the most usable reducing agent [6]. Mercapto-derivatives have been used as stabilizers of gold nanoparticles in recent years. 3-Mercaptopropionic acid (3-MPA) represents such a compound. Nanoparticles modifi ed by 3-MPA have negative charge on the surface due to carboxylate groups. This allowed immobilization of porphyrin conjugates which have positive charge due to quaternary nitrogen atoms by ionic bond. This immobilization by ionic interaction can be also carried out by direct immobilization of porphyrin conjugates on non-modifi ed gold nanoparticles because of their negative surface charge.

The method (ref. 5) based on the reduction of K[AuCl4] by citrate was used to prepare 15 nm average size gold nanoparticles. The immobilization of porphyrin conjugates was carried out by two diff erent ways of ionic interaction. First, direct immobilization of conjugate on nanoparticles, second, immobilization of conjugate on 3-MPA premodifi ed gold nanoparticles. Such prepared nanoparticles were purifi ed by centrifugation and characterized. Interactions of oxoanions (NO3

-. H2PO42-, SO4

2-, ClO3-, ClO4

-, HCO3-, ReO4

-) with porphyrin-brucine conjugates in methanol-watersolution were studied by visible spectroscopy. Stability constants for complexes porphyrin-brucine conjugate with oxoanions were calculated and the infl uence of gold nanoparticles presence will be described.

The fi nancial support from the MSMT6046137307, LC512, KAN200100801 and KAN200200651 is gratefully acknowledged.

References[1] Boldyrev, A. I.; Gutowski, M.; Simons, J. Acc. Chem. Res.1996,29, 497[2] Záruba K., Setnicka V.,Charvátová J., Rusin O., Tománková Z., Hrdlicka J., Sýkora D., Král V.: Collect. Czech. Chem. Commun. 2001, 66, 693[3] Rezanka P., Záruba K., Král V.: Tetrahedron Lett. 2008, 49, 644[4] Král V., Pataridis S., Setni?ka V., Záruba K., Urbanová M., Volka K.: Tetrahedron 2005, 61, 5499-5506[5] Shipway N. A., Katz E., Willner I.: Chem. Phys. Chem. 2000, 1, 18, 1655[6] Turkevitch J., Stevenson P. C., Hillier J.: Discuss. Faraday Soc. 1951, 11, 55


152

Posters

P - 094Gas storage and separation in metal-organic frameworks with coordinatively unsaturated metal atomsR. Blom1, P.D.C. Dietzel1, R.E. Johnsen2, H. Fjellvåg2, S. Chavan3, E. Groppo3, S. Bordiga3

1SINTEF, Materials & Chemistry, Oslo, Norway2University of Oslo, Department of Chemistry, Oslo, Norway3University of Turin, Department of Chemistry, Turin, Italy

BackgroundThe activated microporous CPO-27 type framework resembles a porous honeycomb structure with unsaturated metal atoms inside the pores. The structure can be obtained using a number of diff erent metals like Mg, Co, Ni, Zn, and Mn [1-4], which allows for a comparative investigation of the properties of the otherwise isostructural compounds.

MethodsCPO-27 materials were synthesized by solvothermal methods from 2,5-dihydroxyterepthalic acid and suitable salts of Mg, Mn, Co, Ni, and Zn. Crystal structures of the isostructural compounds, the activated samples and host-guest complexes were determined from single crystal or powder diff raction data. The activation process itself was monitored by in-situ powder diff raction using synchrotron radiation for high time resolutions. Gas storage and selective gas separation was investigated by gas adsorption measurements (N2, H2, CO, CO2, and CH4) and by breakthrough experiments using CO/H2, CO2/CH4, and CO2/N2 mixtures. The host-guest interaction was also probed by spectroscopic methods.

Results and ConclusionDuring activation the water is removed in steps from the hydrated compounds leaving metal atoms with unsaturated square-pyramidal coordination environment [1-3]. Gas adsorption experiments using CPO-27-Ni reveal a strong interaction between the coordinatively unsaturated Ni site and H2, CO and CO2 [2,5,6,7]. For CO2, a crystal structure determination confi rms that the carbon dioxide molecule coordinates the Ni cation end-on through one of its oxygen atoms [7].

The CPO-27 materials are intriguing materials for a number of gas storage and separation applications. This is an eff ect of the high concentration of coordinatively unsaturated metal sites in the activated materials.

References[1] P. D. C. Dietzel, Y. Morita, R. Blom, and H. Fjellvåg, Angew. Chem. Int. Ed., 44 (2005), 6354[2] P. D. C. Dietzel, B. Panella, M. Hirscher, R. Blom, and H. Fjellvåg, Chem. Commun., (2006), 959[3] P. D. C. Dietzel, R. E. Johnsen, R. Blom, and H. Fjellvåg, Chem. Eur. J., 14 (2008), 2389.[4] P. D. C. Dietzel, R. Blom, and H. Fjellvåg, Eur. J. Inorg. Chem., (2008), 3624[5] J. G. Vitillo, L. Regli, S. Chavan, G. Ricchiardi, G. Spoto, A. Zecchina, P. D. C. Dietzel, and S. Bordiga, J. Am. Chem. Soc., 130 (2008), 8386[6] F. Bonino, S. Chavan, J. G. Vitillo, E. Groppo, G. Agostani, L. Regli, C. Lamberti, S. Bordiga, P. D. C. Dietzel, C. Prestipino, and A. Zecchina, Chem.

Mater., 20 (2008), 4957[7] P. D. C. Dietzel, R. E. Johnsen, H. Fjellvåg, S. Bordiga, E. Groppo, S. Chavan, and R. Blom, Chem. Commun. (2008), 5125


153

Posters

P - 095Controlling Mesoscopic Phase Separation (CoMePhS)E. Siranidi1, E. Liarokapis1

1National Technical University of Athens, Physics Department, Athens, Greece

In chemically homogeneous manganites one can achieve phase coexistence using a wide range of parameters: tweak sample’s chemical composition or microstructure, apply an electric or magnetic fi eld, strain the sample or illuminate it with electromagnetic radiation etc. The coexisting phases may form robust magnetic, electronic and crystallographic textures of “mesoscopic” length scales - that is, over tens or hundreds of nanometers. By controlling an array of textured phases CoMePhS aimed to control locally the electronic structure and properties without atomic-scale fabrication. The long-term goal of the research was to provide basis for a new set of electronic technology based on the manipulation of soft electronic matter. Knowledge and experience accumulated were constantly exploited and evaluated in order to identify optimal materials, nanostructures and texture manipulation techniques.

CoMePhS investigated a series of related compounds for which there was strong evidence that exhibit electronic phase separation, such as manganites, cuprates, vanadates, cobaltates, organic compounds, diborides or even the newly discovered pnictides. These compounds have been prepared in the form of high quality polycrystalline, single crystals or as thin layers and have been characterized by various techniques in order to identify regions of electronic phase separation and defect structures that can be exploitable. The activities of CoMePhS have lead to the systematic study of the possibility to manipulate phase separation by epitaxial strain. It has been demonstrated the feasibility of using epitaxial strain as a tool to manipulate the electronic systems of manganites. Spectacular images of inhomogeneous electronic states were constructed which map the static phase separation in the real space. Such space modulation in the physical properties provided clear evidence for the feasibility of controlling the phase separation for operational devices.

CoMePhS was also devoted to the full physical characterization of the textured states using a complete set of experimental techniques including transport, Raman, infrared, NMR, photoemission, etc and to the understanding of the infl uence of external parameters such as pressure or magnetic fi elds on the physical behavior of the materials or nanostructures. The texture manipulation by pressure or by using X-ray illumination, substrate tailoring or incisions by ion beam microscope on thin fi lms, and fi nally magnetic fi elds have also been studied in detail. The fi nal outcome was a series of examples where the manipulation of the texture was established as induced by various experimental techniques. Finally, CoMePhS aimed to systematize the knowledge generated by the whole project by structuring theoretically our understanding of the inhomogeneous electronic states and their manipulation means. Important new results that provide basis for a better focus of the whole activity in the project were generated.

P - 096Preparation of Cyclodextrin Functionalized Poly(vinyl pyrrolidone) Nanofi bers Using Electrospinning TechniquesK. Boonpavanitchakul1, W. Kangwansupamonkon1

1National Science and Technology Development Agency, National Nanotechnology Center, Pathumthani, Thailand

Cyclodextrin functionalized poly(vinyl pyrrolidone) nanofi bers (PVP/CD) were successfully produced by electrospinning technique. Bead-free uniform electrospun PVP/CD nanofi bers were obtained from a homogeneous solution of CDs and PVP in water/ethanol (40:60 wt%) using three diff erent types of CDs, Alfa-CD, Beta-CD and Gamma-CD. The electrospinning conditions were optimized in order to from bead-free PVP/CD nanofi bers by varying the concentrations of CDs in the solutions. The morphology of nanofi bers was characterized by scanning electron microscopy (SEM). The structure of composite was characterized by fourier transform infrared spectroscopy (FTIR). The x-ray diff raction (XRD) spectra of PVP/CD nanofi bers did not show any signifi cant diff raction peaks indicating that CD molecules are homogeneously distributed within the PVP matrix and does not form any phase separated crystalline aggregates. This suggests that these CD functionalized nanofi bers may have the potential to be used as chemical entrapment and /or nanofi bers for controlled release purposes.


154

Posters

P - 097Assessment of the infl uence of organoclays on ethylene polymers peroxide cross-linking processS. Kudla1

1Institute of Heavy Organic Synthesis, Polyolefi ns Dept., Kedzierzyn-Kozle, Poland

Cross-linked polyolefi ns are of great practical importance; they are used mainly for production of insulation of power electrical cables, heat-shrinkable materials or hot water pipes. The most popular methods of production of cross-linked materials rely on using organic peroxides as the source of free radicals necessary to initiate the process.

The main goal of the work is to fi nd reliable and relatively rapid procedure for evaluating the infl uence of fi llers, especially nanoclays, on the cross-linking process in order to prepare recipes of new, innovative kinds of cross-linked polymer materials of nanocomposites type.

Ethylene polymers and copolymers were used as polymer matrix while dicumyl peroxide was the cross-linking agent. Diff erent kinds of fi llers, that is particulate as well as organically modifi ed layered minerals, commercial products or experimental ones, were evaluated as components of cross-linked composites. The proportions of reagents and reaction parameters were varied. The samples were prepared using either Haake PolyLab QC internal mixer equipped with Rheomix 600 chamber or two-roll mill. Rheometric, mechanical and thermal properties of obtained cross-lined materials were analyzed.

Results obtained with the use of internal mixer are of particular interest. The procedure was worked out with the use of which the infl uence of any fi ller on the cross-linking process may be assessed very quickly and precisely. Results describing the cross-linking process carried out at relatively high shear stress conditions were compared with results obtained for low stress conditions experiments (oscillatory rheometer, Monsanto type).

In the result we can conclude that all mineral fi llers used aff ect peroxide initiated cross-linking process of ethylene polymers and copolymers. Organoclays exhibit diff erent behaviour during cross-linking process conducted in polymer matrix than particulate fi llers; one of the explanations may be insuffi cient thermostability of investigated organoclays. On the other hand, the eff ect of exfoliation of organoclays in polymer matrix could not be excluded. The results obtained are of great practical importance since applications of cross-linked, polyolefi n-based composites are very versatile.

P - 098Gas jet synthesis of nano-sized polymer-silver bactericid compounds N. Timoshenko1, A. Rebrov1, A. Safonov1

1Institute of Thermophysics, Lab.4.1, Novosibirsk, Russia

Authors of this paper elaborate new method - the deposition of silver clusters and polymers from low density supersonic jets. As one of alternatives to this idea is the deposition of silver vapour and precursor gas monomer C2F4. The engineering realization has demanded the manufacturing two high temperature sources: for C2F4 and silver vapour, and rotating drum (substrate) with the axis perpendicular to both sources axis. The insight of the experimental pattern is given by specifi c sizes: the critical diameters of C2F4 and Ag vapour nozzles were 10 and 3 mm, correspondingly, the drum diameter was 50mm. The typical mass fl ow rate of C2F4 and silver were less than 0.1 and 10-4 g/s, correspondingly. It was shown, that at average cluster size is about 20nm. The cluster size distribution strongly depends on a distance of Ag source from drum surface. The morphology of fi lms was studied on the scanning electron microscope image. The infrared radiation has given some information on polymer matrix molecular structure.

The obtained compounds were tested to understand their antibacterial activity on diff erent bacteria strains. It is occurred, that obtained composites (40nm clusters in the Tefl on-like matrix) destroy Salmonella typhus bacteria completely.

The advantages of the method developed is the wide possibility to provide deposit characteristics by gas state parameters in the stagnation chambers, background pressure, geometrical scheme of whole system and its specifi c sizes, substrate material and temperature. Very interesting and promising results were obtained by activation of supersonic C2F4 jet by hot wire net, inserted in the jet perpendicularly to its axis.

The full text will be supplied by illustration with experimental details and data on deposit characteristics.


155

Posters

P - 099Carbon nanomaterials in Czech Republic: production, characteristics, application.V. Padalko1

1Nanogroup sro, R&D, Prague 6, Czech Republic

A carbon materials, like carbon nanotubes and nanodiamond, come into focus in the last decades.

Due to its unique properties, this materials is not only interesting for the basic understanding , but it has a multitude of potential applications in the macroscopic world.

But a real development of nanotechnology is not possible without a basic production of this materials.

Nanodiamond powders produced by detonation of explosives in a closed chamber, now are commercially available in Czech Republic. Our company created a production capacity of ND -up to 10 tons per year.

Now, NanoDiamond is available as a dry powder and as a water (and other liquids) suspensions (slurry) .

Diamond particles of 2.5 -10 nm in size have attracted an attention in the past few years. Nanodiamond,also called

ultra dispersed diamond (UDD), is considered a promising material for various applications, including abrasives for the semiconductor and optical industries, extra durable and hard coatings, additives to lubricants for engines and moving gears, polymer reinforcements, protein adsorbents, and even medicinal drugs.

The main characteristics of ND :

¹ Characteristic 1 Bulk density 0.4 g/cm3 2 Particle density 3.3 g/cm3 3 The size of 95% of particles 2.5-10 nm 4 Specifi c surface area 300-400 m2/g5 Admixture: < 0.5 %

Except Nanodiamond (ND) , NanoGroup Co. produce up to 3 tons per year Carbon Multy Wall Nano Tubes (CMWNT) . We use a pyrolytic synthesis from methane (propane) with supported catalyst . The most effi cient catalyst are metals

- Fe, Co, Ni .CMWNT grows in a gas reactor .The temperature of pyrolysis is 650- 700î Ñ. The reactor works in automatic regime and can produce 450 grams of nanotubes per cycle (40 minutes) .

CMWNT have a number of excellent properties and numerous areas of applications as: • For modifi cation of diff erent materials. For instance as conductive additive in polymers • For production of ultra-strong materials used in automotive, aviation, space and sports applications • Electrically conductive, thus reduced static electricity charging of the vehicle • Flame retarding • Shielding of electromagnetic fi elds • Prime coat for attenuation of electromagnetic fi elds • Reliable protection from electrosmog • May be coated with dispersion paint • Prime coat for attenuation of electromagnetic fi elds

The main characteristics of CMWNT :

¹ Characteristic 1 External diameter , nm 10-80 2 Internal diameter , nm 6-203 Length of > 90% > 2 μì 4 Admixture - % 0.3-0.85 Bulk density , g/sm3 0.40-0.466 Specifi c surface area, m2/g ~100~160 7 Termostability (oÑ) up to 7008 Volume of pore , sm3/g 0,22


156

Posters

P - 100Designing new nanoporous metal organic frameworks (MOFs)C. Mellot-Draznieks1

1University College London, Chemistry Department, London, United Kingdom

The fi eld of metal organic frameworks (MOFs) is one of the major growth areas of materials chemistry. In the last decade, porous MOFs have attracted a lot of attention, due to an enormous chemical and structural diversity, spectacular gas adsorption/separation properties (H2, CO2, CH4) together with guest-induced framework fl exibility and solid-state transformations. In such a rich context, simulations have a crucial role to play in guiding the development of the fi eld. Here, we present how simulations, when combined with experiment, can address a variety of issues such as the structure solution of highly complex MOFs, their thermodynamics and their gas-induced transformations, while being among a powerful approach in the area of computational design.

First, we provide a general thermodynamic scheme for the understanding of guest-induced structural transitions in MOFs upon gas adsorption. The method is based on the analysis of experimental adsorption isotherms. It allows the determination of the free energy diff erences between host structures involved in the transitions, especially hard to obtain experimentally. We discuss the general case of adsorption in fl exible materials and show how a few key quantities, ie pore volumes and adsorption affi nities, entirely determine the phenomenology of adsorption, including the occurrence of structural transitions. We then propose a taxonomy of guest-induced structural phase transitions and the corresponding isotherms. In particular, we derive generic conditions for observing a double structural transition upon adsorption, often resulting in a two-step isotherm. We show the wide applicability and the robustness of the model through three case studies of topical MOFs: the hysteretic H2 adsorption in Co(1,4-benzenedipyrazolate), the guest-dependent gate-opening in Cu(4,4’-bipyridine)(2,5-dihydroxybenzoate)2 and the CO2-induced “breathing” of hybrid material MIL-53.

Secondly, we will illustrate the role of simulation in the area of materials design. One great challenge in the area of hybrid framework synthesis lies in the discovery of novel nanoporous topologies possessing enhanced performance for gas adsorption processes. Typically, there is a strong incentive to synthesise new MOFs with tuneable porous architectures. Interestingly, the “proof of concept” of MOFs possessing zeotype topologies has been recently given in the literature with the synthesis of a growing number of Zinc-based hybrid structures called ZIFs. With only ~20 topologies synthesized today to our knowledge, such achievements show the way to an immense new family of nanoporous hybrids with extra large pores. Here, we present how simulations allow to predict not-yet-synthesized ZIFs materials and evaluate their thermodynamical stability. Their potential adsorption properties are also explored and compared to the existing ZIFs, focussing on their CH4/CO2 selectivity.

P - 101OPTICAL AND MAGNETO-OPTICAL DETECTION OF SYMMETRIC AND ANTISYMMETRIC STATES IN DOUBLE QUANTUM WELLS AT ROOM TEMPERATURE J. Cebulski1, M. Marchewka1, E.M. Sheregii1, I. Tralle1, M. Ortenberg2, S. Hansel2, A. Marcelli3, M. Piccinini3

1Institute of Physics, University of Rzeszow, Rzeszow, Poland2Institute of Physics, Humboldt University, Berlin, Germany3Laboratori Nazionali di Frascati, Istituto Nazionale di Fisica Nucleare, Frascati (Roma), Italy

We studied an optical and magneto-optical transitions between electron states in the specially grown double quantum wells (DQW) characterized by a rectangular quantum well shape and high electron density at room temperature. Refl ectivity spectra in the mid-IR range enable to measure precisely the values of the SAS-gap (SAS-gap is not defi ned!) and the energies of the symmetric and anti-symmetric electron states in the DQW. These results are used for the interpretation of magneto-transmission spectra of the same DQW in megagauss magnetic fi elds. It is shown that the value of the SAS-gap increases proportionally to the number of subband and the optical and magneto-optical transitions between symmetric and anti-symmetric states belonging to diff erent subbands are allowed.It is confi rmed assuming in theoretical model of electron states in DQW taken into account the electron screening of exchange interaction by magnetic fi eld.


157

Posters

P - 102PTFE-based core-shell nanoparticles preparation and characterization: a route towards the assembly of ordered soft-matter layers with tuneable (photonic) propertiesG. Zuccheri1, R. Passeri1, K. Sparnacci2, M. Laus2

1University of Bologna, Department of Biochemistry, Bologna, Italy2Universite del Piemonte Orientale, Dipartimento di Scienze dell’Ambiente e della Vita, Alessandria, Italy

The assembly of ordered arrangements of nanoparticles can represent a route towards the preparation of materials with innovative physical properties stemming from the characteristics of the nanoparticles themselves and from the controlled interactions amongst them.

Composite materials could exhibit interesting photonic properties if diff erent components are spaced regularly in its bulk: the controlled 2D or 3D assembly of core-shell polymer nanoparticles results in such a regular spacing of the core material. The possibility of controlling the size of the core and the thickness of the shell represents a viable route towards the design of photonic properties towards the realization of nanostructured polymer opals.

PTFE latexes can be obtained with a narrow nanoparticle size distribution. Around such seeds, we could grow shells made of diff erent types of polymers or copolymers that will quantitatively coat the dispersed PTFE seeds. A control of the shell thickness can be obtained by varying the ratio between seed and shell monomer(s). A careful choice of monomers can lead to water-soluble core-shell nanoparticles with markedly diff erent properties. For instance the shell can swell in water (and respond to pH changes) or, alternatively be quite rigid and insensitive to the environment. The comonomers mix will lead to shells with markedly diff erent thermal properties.

In this communication, we report our success in preparing and characterizing a variety of diff erent PTFE-based core-shell systems with shells made with comonomers mixtures such as methylacrylate, ethylacrylate and methacrilic acid, or butylacrylate and methacrilic acid, or simply with methylmethacrylate. Such core-shell nanoparticles have been then used to make ordered layers that have been characterized by atomic force microscopy.

The success in the preparation of these core-shell systems might lead to materials that could exhibit the valuable properties of PTFE while reducing some of its disadvantages, such as its compatibility with other materials (adhesion and wettability). In the near future we will be investigating the possible applications and photonic properties of such regularly arrange nanoparticulate systems.

P - 103Covalent modifi cation of fused-silica capillary with cysteine modifi ed gold nanoparticlesP. Rezanka1, K. Záruba1, D. Sýkora1, V. Král1

1Institute of Chemical Technology Prague, Analytical Chemistry, Prague 6, Czech Republic

Gold nanopaticles (GNP) represent a novel material in various fi elds of chemistry, physics, materials, medicine, and optics due to their unique physical and chemical properties (ref. 1). However, their applications in the separation science are still relatively rare. Nanoparticles have been successfully used to enhance detection and separation (ref. 2). Most of the applications are related to capillary electrochromatography where nanoparticles have been added to the run buff er or coated to the walls of a capillary (ref. 3).

Here, a covalent modifi cation of a fused-silica capillary with gold nanoparticles carrying cysteine moiety and its application in capillary electrochromatography is described. As pure R enantiomer of cystein was solely utilized for GNP modifi cation the resulting capillary might be potentially applicable for the enantio-separation of selected aminoacids.

Gold nanoparticles usable in separation techniques can be prepared by several means. The most frequent approaches are: fi rst, citrate reduction of aqueous solution of a gold(III) salt; second, borohydride reduction of aqueous solution of a gold(III) salt; and third, two phase (water-toluene) reduction using borohydride as reducting agent and tetraoctylammonium bromide as transfer agent. Each method provides diff erent concentration and size of the generated nanoparticles as well as the diff erent potential for their subsequent modifi cation (ref. 3). The immobilization of the gold nanoparticles onto the inner surface of a fused-silica capillary can be carried out applying layer-by layer technique (ref. 4) or covalent modifi cation via (3-mercaptopropyl)trimethoxysilane (ref. 5).

In this work the gold nanoparticles were prepared by citrate reduction of a gold(III) salt. In the next step, the citrate stabilized nanoparticles were modifi ed with cysteine at diff erent concentrations. The resulting nanoparticles were characterized by absorption spectroscopy and transmission electron spectroscopy and used for the immobilization into the capillaries. The fused-silica capillaries were pre-derivatized by (3-mercaptopropyl)trimethoxysilane that allowed for a covalent modifi cation of the capillary walls with the modifi ed gold nanoparticles. These capillaries were used to separate the enantiomers of selected aminoacids and the eff ect of the concentration of immobilized cysteine, concentration of the immobilized nanoparticles, pH of the running buff er, and other factors is discussed.

References [1] M.-C. Daniel, D. Astruc, Chem. Rev., vol. 104, pp. 293-346, 2004. [2] P. Rezanka, K. Záruba, V. Král, Chem. Listy, vol. 101, pp. 881-885, 2007. [3] C. Nilsson, S. Birnbaum, S. Nilsson, J. Chrom. A, vol. 1168, pp. 212-224, 2007. [4] W. Wang, L. Zhao, F. Zhou, J.-J. Zhu, J.-R. Zhang, Talanta, vol. 73 , pp. 534-539, 2007. [5] L. Yang, E. Guihen, J. D. Glennon, J. Sep. Sci., vol. 28, pp. 757-766, 2005.

Acknowledgement: Financial support from The Ministry of Education, Youth and Sport of the Czech Republic, no. MSMT6046137307, and from The Czech Science Foundation, no. 203/09/0675, are gratefully acknowledged.


158

Posters

P - 104Creation of high-strength composite materials, reinforced by nanocrystalline high-modular polyethylene fi bres activated by nonequilibrium low-temperature plasmaE. Sergeeva1

1Kazan State Tehnological University, Plasmachemistry and nanotechnology of high-molecular materials, Kazan, Russia

High durability of a material is a primary factor at creation of structures. Today one of the most actual ways of achievement of high durability of materials is creation of composite materials (CM) reinforced by fi bres. Strong communication on border between a fi bre and a matrix is necessary for eff ective transfer of external loading on a fi bre and inclusions in work of all elements of structure of CM. Main objective of the given research is reception of extralight high-strength CM, on a basis of nanostructure multifi lament fi bres from high performance high-modular polyethylene (HPHMPE).

For activation of fi bers it was applied nonequilibrium low-temperature plasma (NLP) at the lowered pressure from 13 to 133 Pa. The orifi ce gases are argon, oxygen, air. The thermal component of cold plasma has been reduced to a minimum, due to low density of an ionic current arriving on a product, making 0,5 - 1 A/m2 and small duration of infl uence of plasma on a fi bre. Such plasma allows to process in it even higher-oriented HPHMPE fi bers which are sensitive to heating, not causing their distraction. As matrixes it is used epoxy resins on a basis of bisphenol A diglycedile ether hardened by polyethylene polyamines and polyurethane.

It is experimentally proved, that the application of plasma processing of fi ber improves its wettability by epoxy matrix in the air on 86 %. The wettability of not-processed HPHMPE fi bers sharply increased at replacement epoxy matrixes on polyurethane. In this case it is changed on 254 % or in 3,5 times. Plasma processing of the fi bre at impregnation by polyurethane in the air additionally increase wettability on 34 %. Joint action of plasma and vacuum gives additionally raise of wettability on 173 % or about 2,7 times.

Plasma are raised superfi cial energy of a fi bre that allowed to operate the character on fi bre-matrix interface interaction and strongly connect a fi bre to a matrix. It gives possibility to receive monolithic high-strength CM polyethylene plastic, surpassing in specifi c durability metals in 6-7 times, fi breglasses in 2 times, and coal plastic in 1,5 times.

P - 105A low cost instrumentation for the characterization of the electrical capacitance of an interface towards the characterization of self-assembled monolayersG. Zuccheri1, D. Gazzola1, V. Angeletti1, S. Bonetti1, C. Guiducci2

1University of Bologna, Department of Biochemistry, Bologna, Italy2Ecole Polytechique Federale De Lausanne, Institute of Bioengineering, Lausanne, Switzerland

The implementation of a large number of diagnostic screening tests requires a paradigm change from the classical hospital-centered analysis lab, towards a decentralized point-of-care testing that is expected to foster the birth of personalized medicine, in the near future. Low-cost, automatic fool-proof testing instrumentation and parallelized analyses will represent key technologies for the implementation of such epochal change.

Most parallelized surface-bound assays are nowadays performed with strategies that derive directly from ‘classical’ techniques, involving complex multi-step procedures that rely heavily on biochemical reactions optimized for the labelling of analytes that bind to surfaces. In a more modern (and still largely experimental) approach, most of the assay specifi city relies on the specifi c binding of an analyte to its probing molecule that has been covalently immobilized on a designed interface. The detection of such binding is then revealed with label-free techniques that are sensitive to a change of a physical property related to the binding of the analyte material, such as a change in dielectric constant, mass, ion conductivity. In order for such strategy to be successful, it is at least required that i) the probe molecules are highly specifi c, exposed effi ciently to the surface and bound stably, ii) the solid-liquid interface is stable over time in the conditions of the assay, iii) the measuring technique is sensitive enough. As an additional set of desired features, the entire process should be amenable of parallelization, be easy-to-use and to make, be inexpensive. Furthermore, the possibility to provide real-time data is a plus.

In this communication, we report the design, implementation and characterization of an innovative instrumentation for the automatic measurement of the electrical capacitance of an electrode-solution interface. Such instrumentation, employing a principle similar to chronoamperometry, can work in parallel on a large number of measuring micro-electrodes embedded in a microfl uidic system, and can provide real-time data. In our characterization, the instrumentation can be made to apply a very low measuring voltage (10 to 20 mV steps) that does not disrupt the fragile monolayers of biological probe molecules. It sports a low measuring noise (1 % over a 10 nF capacitance).

Such instrumentation was employed to study the assembly and substitution of self-assembled monolayers (SAM) on a clean gold surface, and it proved sensitive enough to follow such processes in real-time. Furthermore, we have optimized the preparation of mixed functional SAM that can be used to immobilize and expose biological probe molecules (oligonucleotides or proteins) to a solution. The electrical capacitance measurements on such interface is remarkably stable (less than 1 pF/min).

Such low noise and high stability represent promising features towards the use of the implemented instrumentation and SAM for point-of-care diagnostic assays.


159

Posters

P - 106Information properties of nanostructures based on interpolymer complexes of fi broinI. Suleimenov1, S. Rashidova2, A. Kholmuminov2, R. Milusheva2, G. Mun3, K. Proskura3, S. Pancenko4

1Inst of Power Engineering and Telecommunications, Telecommunications, Almaty, Kazakhstan2Institute of chemistry and physics of polymers Uzbekistan ASc, Polymer Chem., Tashkent, Other3Kazakh National University, Chemical Physics & Macromolecular Chemistry, Almaty, Kazakhstan4Inst. of Power Engineering and Telecommunications, Telecommunications, Almaty, Kazakhstan

Nowadays, formation of complexes based on fi broin is widely investigating mainly due to enlargement of assortment of fi bers obtaining from biopolymers. Nevertheless, such complexes are of suffi cient interest due to possibility of investigation of information properties of biological macromolecules.

It is shown, that local transition from spiral to elongated form of fi broin may be considered in terms of information recording in internal structure of a complex in present report. Local transition from one conformation to another takes place, for instance, during formation of complex with such polymers as carboxymethylcellulose, chitosan, etc. Hydrogen bonds, which form macromolecular spiral of fi broin, are destroying at defi nite segment of macromolecular chain due to formation of complex with other polymer in this case. This transition is similar to well-known transition from alpha- to beta-state of natural fi broin.

One can put in correspondence logical zero to spiral state of separate segment of macromolecular chain and logical 1 to elongated state; formation of complex may be analyzed as information recoding in forming structure in frames of such approach.

Formation of complex between fi broin and carboxymethylcellulose in presence of zinc chloride, as well as between fi broin and chitosan in presence of vinegar acid in water solution was investigated in present report. Formation of complex was proved with help of method of rotation of polarization plane, reological measurements, etc.

It is shown, that obtained complexes are water-soluble compounds. Degree of stability of obtained complexes at diff erent pH and ionic strength of surrounding medium is determined. It is shown, that the complexes are quite stable, but the system as whole is in dynamic equilibrium, i.e. complexes are forming and destroying continuously.

It is shown, that complexes having a quite defi nite sequence of logical “1” and logical “0” are forming in such dynamic equilibrium. In other words, the choice of polymer, witch form a complex with fi broin, determines concrete logical sequence that correspond to sequence of segments having diff erent conformation.

Thus, one can say, that macroscopic infl uence (formation of complex) results in recording of quite defi nite information in structure of fi broin. Such logical sequence may be changed by some other external infl uences (electric fi eld, etc.) too, as it is shown in present report. Particularly, electric fi eld changes structure of complex due to elongation of some fragments of macromolecule.

Formation of logical sequence strongly depends on frequency and magnitude of applied electric fi eld as well as on type of external signal. Consequently, complexes based on fi bril polymers may be considered as an example of system, which allows recording of molecular-level information with the help of macroscopic infl uence.

Solution of this problem is of pronounceable interest for development of molecular-level computing systems (nanoprocessors).


160

Posters

P - 107Sorption behaviour of oriented fi lms of metal-organic frameworksC. Scherb1, J. Williams2, R. Köhn1, T. Bein1

1University of Munich, Chemistry and Biochemistry, München, Germany2University of Edinburgh, Institute for Materials and Processes, Edinburgh, United Kingdom

BackgroundThe increasing interest in the assembly of porous crystals on defi ned surfaces is motivated by the potential application of these materials in the fi elds of catalysis, gas storage and sensor devices. Metal-organic frameworks (MOFs) or inorganic-organic hybrid materials, emerging as an important class in the family of porous solids,[1, 2] are good candidates for surface assembly. Due to the coexistence of organic and inorganic units in the framework, the MOF crystals can be attached to a substrate functionalized with an organic self assembled monolayer (SAM).[3-5] We recently demonstrated that the orientation and structure of porous MOFs based on iron terephthalate can be controlled by heterogeneous nucleation on self-assembled monolayers of mercaptohexadecanoic acid (MHDA).[6] The framework MIL-53 was shown to be the product of homogeneous nucleation, whereas in the same crystallization solution, oriented MIL-88B grows on the functionalized gold surface.

ObjectivesIn this study we present the sorption properties of oriented fi lms of fl exible MIL-88B crystals and the corresponding bulk material, investigated with the help of X-ray diff raction and volumetric sorption measurements.

ResultsWe have investigated the structural changes of fl exible, porous materials during adsorption and desorption of guest molecules. The fl exible MOF Fe-MIL-88B was investigated as bulk material and in the form of surface-grown, oriented thin fi lms. We were able to follow the structural changes of the Fe-MIL-88B crystals upon ad- and desorption of water. Due to the orientation of the crystals on the gold substrates, structural changes in [001] direction could be observed. For the randomly oriented bulk crystals the structural changes in all crystallographic directions are observable and the changes of the lattice constants a and c and the cell volume could be determined quantitatively by indexing of the diff raction patterns.

ConclusionsSurface grown porous MOFs with accessible pores are interesting candidates for sensor applications. This study further proves the validity of this approach; the selectivity of these materials towards guest molecules will be in focus of ongoing experiments.

Acknowledgments:

Financial assistance from DFG (SPP 1362) is gratefully acknowledged.

References [1] G. Ferey, Chemical Society Reviews 2008, 37, 191. [2] S. Kitagawa, R. Kitaura, S.-I. Noro, Angewandte Chemie, International Edition 2004, 43, 2334.[3] S. Hermes, F. Schroeder, R. Chelmowski, C. Woell, R. A. Fischer, Journal of the American Chemical Society 2005, 127, 13744. [4] D. Zacher, A. Baunemann, S. Hermes, R. A. Fischer, Journal of Materials Chemistry 2007, 17, 2785. [5] E. Biemmi, C. Scherb, T. Bein, Journal of the American Chemical Society 2007, 129, 8054. [6] C. Scherb, A. Schoedel, T. Bein, Angew. Chem., Int. Ed. 2008, 47, 5777.


161

Posters

P - 108The eff ect of Copper content on the Antibacterial and antifungal activities of Copper/Polystyrene nanocompositesB. Fattahi1, A. Irajizad1, A. Kazemi2, S.M. Mahdavi1

1Sharif University of Technology, Physics, Tehran, Iran2Sharif University of Technology, Chemical Engineering, Tehran, Iran

We have prepared Copper-polymer nanocomposites by blending of pre-formed colloidal copper nanoparticles with diff erent amount of copper into pre-synthesized polystyrene solution. Firstly, Colloidal copper nanoparticles were prepared by pulsed Nd:YAG laser ablation in acetone. Size and optical properties of the nanoparticles were characterized by transmission electron microscopy (TEM) and UV-visible spectrophotometry, respectively. The copper particles were rather spherical and their mean diameter in acetone was 9 nm. In addition the narrow optical absorption centered on 590 nm was measured for nano copper in acetone. Casting the solution of nano copper in a mixture of carbon tetrachloride, acetone and polystyrene leads to a transparent polymeric sheet in light yellow color. The Cu/PS nanocomposites were characterized by Scanning Electron Microscopy and Atomic Force Microscopy. The interfacial interactions between the copper nanoparticles and PS were also investigated with FTIR spectra. In this study, we also investigated the Antibacterial and Antifungal activity of copper nanocomposites against Escherichia coli, Staphylococcus aureus and Aspergillus niger as a model for Gram negative bacteria, Gram positive bacteria and Fungi. Antibacterial and Antifungal tests were performed in luria bertani agar (LBA) and potato dextrose agar (PDA) media for bacteria and fungi, respectively. These nanocomposites showed bactericide and fungicide eff ects. Antibacterial and antifungal tests were performed against bacteria and fungi on agar plates containing diff erent concentrations of nanoparticles dispersed in polymer. Our results showed that at all these concentrations, the copper nanoparticles caused a delay in growth of microorganisms. Increasing the concentration of the nanoparticles raises the delay in growth. Nanoparticle susceptibility constants (Z) were used to evaluate the Antibacterial and Antifungal characteristics of copper nanoparticles against Escherichia coli, Staphylococcus aureus and Aspergillus niger. The nanoparticle susceptibility constant Z (mL/μg) is defi ned by the following equation: Z=[-ln(N/N0)]/C where N is the bacterial colony forming units (CFUs) on the agar plate containing nanoparticles, N0 is the CFUs on the pure agar plate, and C is the concentration of nanoparticles (μg/mL). A higher Z value means that the bacteria are more sensitive to the nanoparticles, indicating that the nanoparticles are more eff ective in antibacterial and antifungal activity. Reaction of copper nanoparticles with A.niger has shown the highest susceptibility whereas that reaction with E. coli has shown the lowest one.

P - 109Characterization of Carbon Nanofi bers V. Puchy1, J. Dusza1, L. Hegedus2, J. Morgiel3, Z. Bastl4, P. Svec5

1IMR SAS, department of structural ceramics, Kosice, Slovak Republic2Technical University, Faculty of Metallurgy, Kosice, Slovak Republic3AGH University of Science and Technology, Faculty of Materials Science and Ceramics, Krakow, Poland4Academy of Sciences of the Czech Republic, J. Heyrovsky Institute of Physical Chemistry, Praha, Czech Republic5Slovak Academy of Sciences, Institute of Physics, Bratislava, Slovak Republic

Carbon micro/nanofi bers prepared by catalytic chemical vapor deposition with potential application in diff erent areas of industry have been characterized using scanning electron microscopy, transmission electron microscopy, high resolution electron microscopy and electron spectroscopy for chemical analysis. The dimensions, morphology of the fi bers, the crystal structure and graphic layers arrangement and the chemical composition of their surface have been investigated. The outer diameter of the fi bers is varied from 50 nm to 600 nm with the average diameter of 120 nm with length from several micrometers to several tens of micrometers and inner diameters from 20 nm to 230 nm. Two type of fi bers have been identifi ed; pipe - shaped and bamboo - shaped fi bers. The pipe - shaped fi bers are usually defects free and consist from distinct sandwich of graphite layers parallel to the fi ber axes. The bamboo - shaped fi bers often contains defects at the nano-level, their walls are built from domains with diff erent orientation of graphite layers. The fi bers contains 99.05 at.% graphic and 0.95 at.% oxygen with the binding energy of O (1s) electrons of 532.7 eV which corresponds to carbon in C-O bonds.


162

Posters

P - 110Formation of liquid crystalline-like nanostructures on the base of interpolymer complexesI. Suleimenov1, L. Zaitova1, S. Rashidova2, R. Milusheva2, A. Kholmuminov2, G. Mun3, K. Proskura3

1Institute of Power Engineering and Telecommunications, Department of Telecommunications, Almaty, Kazakhstan2Institute of chemistry and physics of polymers, Department of chemistry of polymers, Tashkent, Other3Kazakh National University, Department of Chemical Physics & Macromolecular Chemistry, Almaty, Kazakhstan

Liquid crystals are widely used in diff erent devices, particularly, in displays, TV-screens, etc. The fact determines importance of development of liquid crystalline-like systems on the base of natural polymers due to ecological factors. Natural fi bril biopolymers have circuit length about 100 nm; consequently, it is of interest to synthesize nanoparticles having properties of liquid crystals.

Complexes formed by fi broin and carboxymethylcellulose in presence of low-molecular salts are investigated in present report. It is shown, that fi broin in spiral form has some properties of liquid crystal itself in region on relatively low concentrations by using of polarization ultramicroscope.

Formation of a complex with carboxymethylcellulose increases the length of Kuhn’s segment, i.e. obtained structure is much stiff er, than initial polymers. Such system has pronounceable optic anisotropy that is typical for liquid crystals as it is shown in present report. Besides, it is shown, that stiff ness of obtained structures if quite high; circuit length of fi broin became equal to 7-8 Kuhn’s segment of complex. Consequently, two-line chain may be oriented in external hydrodynamic or electric fi eld. Obtained complex may be considered as stick-like nanoparticle, while circuit length of this structure approximately is equal to 100 nm.

It is of importance, that initial polymers usually have no properties of liquid crystals, while more than 25 Kuhn’s segment may be placed on their circuit length (depending on degree of spirality of fi broin). It is shown, that thermodynamic stability of obtained systems is enough for their using for regulation of optical transparency in diff erent devices in present report.

A system of information reproduction (screen) is an example of such devices [1]. Such screens are based on light scattering by polymer solution, which loses optical transparency under the infl uence of external signal. Transparent regions (pixels) of the screen are seen to by dark when additional source of light is used. Pixels, which scatter light, are seen to by bright, respectively.

Thus, stick-like nanoparticles obtained in present report may be considered as a suitable material for advance systems of information reproduction on the base of natural biopolymers.

References[1] Ergojin E.E., Zezin A.B., Suleimenov I.E., Mun G.A. Hydrophilic polymers in nanotechnology and nanoelectronics (in Russian). Almaty - Moscou,

2008, 234 p.


163

Posters

P - 112Using of nanoparticles in image reproduction systemsI. Suleimenov1, L. Zaitova1, Y. Reva1, G. Mun2, K. Proskura2, N. Semeniyakin2

1Institute of Power Engineering and Telecommunications, Department of Telecommunications, Almaty, Kazakhstan2Kazakh National University, Department of Chemical Physics & Macromolecular Chemistry, Almaty, Kazakhstan

Currently, liquid crystals are widely used in imaging systems (displays, television screens and screens of cell phones, etc…). One of the disadvantages of such systems is relatively slow response to the control signal. This response is determined by the solution’s transition velocity to an ordered phase.

In addition to existing screens, we can suggest imaging systems based on the phase transitions from the transparent medium to light scattering based on stimuli-sensitive polymers. Such phase transitions can be induced by optical radiation as well as by direct heating with electric pulses. In this work, display model based on the heat sensitive polymer is proposed. The main advantage of such screen is it’s complete optical transparency in the initial state.

However, the use of thermal or light-sensitive polymer alone will not bring to high phase transition velocity. Experimental results obtained in this report demonstrate that such conversions typically take several milliseconds, which is comparable with time of phase transitions in screens based on liquid crystals. It is therefore important to create systems that would increase the speed of phase transitions.

The velocity of phase transitions, accompanied by light scattering in solutions was studied in this paper. We used diff erent composition of the solutions on the base of hydrophilic polymers. Specially designed fotoregistration circuit allows to record the intensity of scattered signal with temporal resolution of approximately 0.2 ms. Carboxymethylcellulose and N-isopropylacrylamyd solutions with immersed nanoparticles of silver and zinc, which are chemically obtained in the liquid polymer matrices was used.

It was found that the nature of phase transition in solutions under the infl uence of an electric current heavily depends on the inhomogeneities, which are caused by non-linear electric current density distribution in space. This is due to the nonlinear dependence of the conductivity of the medium on current density. In particular, the local phase transition leads to a local increase of the conductivity and, therefore, concentrates the current lines in a certain regions.

Immersion of conductive particles into the solution strengthens this eff ect. Polarizable and conductive particles move in an inhomogeneous electric fi eld in the direction given by the squared modulus of a gradient electric fi eld. This eff ect is also non-linear in nature, as concentration of conductive particles in a certain point of space leads to an increase in the degree of heterogeneity of the electric fi eld and, consequently, increasing the gradient of the square of the electric fi eld.

It is shown that the use of compositions based on solutions of polymers and conductive nanoparticles enhances the speed of the phase transition induced by electric current, from 3 to 7 times compared to pure polymer solution.

Thus, the liquid-phase compositions based nanoparticles is a promising subject for improving imaging systems.


164

Posters

P - 113Electrical properties of tin/n-hexane nanocomposite fi lmsJ. Matousek1, J. Pavlik1, M. Svec1, L. Kovacik2

1J.E. Purkyne University, Department of Physics, Usti nad Labem, Czech Republic2Charles University, First Faculty of Medicine Institute of Cellular Biology and Pathology, Prague, Czech Republic

BackgroundNanocomposite fi lms metal/dielectric were studied in the second half of the 20th century [1]. Later metal/polymer and metal/hard carbon (C:H or a-C:H) composite fi lms were also considered [2-4]. In recent time, magnetron DC and RF sputtering from a metallic target in a working gas mixture argon and active (hydrocarbon) gas were used to deposit metal/hydrocarbon nanocomposite fi lms [5].

Nanocomposite fi lms of metal or metal oxide with plasma polymer matrix represent a class of promising materials. The main research attention has been paid to their attractive electrical and optical properties.

ObjectivesIn this work we investigate the relationship between electrical properties of tin/hydrocarbon plasma polymer nanocomposite fi lms and their deposition parameters and structure. Experimental results were compared with the computer simulation.

MethodsThin composite layers (tin in plasma polymer matrix) were prepared in a stainless steel vacuum chamber. RF powered magnetron with tin target was used to excite the discharge and to activate the monomer species. Working gas mixture was consisting of Ar and n-hexane vapours. The deposited fi lms were characterized by AFM, TEM and Electron tomography and XPS. Current-voltage characteristics were measured to examine the electrical properties of the layers and their dependence on the deposition parameters.

The TEM and Electron tomography was employed to allow comparison of the experiments with models. The computer experiments were done by self-made software analytical tools.

References[1] Abeles B. Appl. Solid State Sci. 1976;6:1.[2] Biederman H, Martinu L. Plasma deposition, treatment and etching of polymers, New York: Academic Press; 1990:269.[3] Heilmann A, Hamann C. Progr. Colloid Polym. Sci. 1991;85:102 - 110.[4] Reinhardt C, Heilmann A, Grunewald W, Hamann C. Thin Solid Films 1993;235:57 - 61.[5] Biederman H, Hlidek P, Pesicka J, Slavinska D and Stundzia V. Vacuum 1996;47:1385 - 1389.

P - 114Preparation and properties evaluation of nanoparticle ZnOE. Bretsnajdrova1, L. Svoboda1, J. Zelenka2

1University of Pardubice Faculty of Chemical Technology, Department of Inorganic Technology, Pardubice, Czech Republic2Synpo a.s., Czech centre of nanostructured polymers and polymers based on renewable resources, Pardubice, Czech Republic

Great attention to study of preparation and properties of nanomaterials usable in many applications is given at present. These materials are utilized in various fi elds of human activity - e.g. in electronics, medicine, cosmonautic, car industry etc. Very prospective area of usage nanocomposite systems is paint industry, when addition of small amount of suitable nanoparticles leads to positive aff ecting a number of properties of modifi ed materials (increased weather stability and thermostability, high resistance to action of diff erent solutions and solvents). Option of suitable nanoparticles, their compatibility with fi nal mediums, eventually suitable option of dispersing methods are important for application. For paint industry are very important nanoparticles, which positively infl uence several properties of paint fi lm at once. As a sample of such material it is possible to state nanoparticle zinc oxide, which has two very important functions for paint fi lm. Nanoparticle zinc oxide acts as UV fi lter and shows antibacterial eff ect at the same time. Our attention was oriented to preparation of nanoparticle zinc oxide with desirable physical properties and acceptable price. For preparation of zinc oxide precipitation method was selected, which was modifi ed for aqueous and nonaqueous systems. Fundamental signifi cance for nanoparticle size and polydispersity has suitable type and concentration of stabilizer. Acoustic spectrometry, AFM and TEM were utilized as methods suitable to study eff ect of stabilizer concentration on these parameters. The same methods were used to classifi cation of studied colloidal system stability. It was observed sedimentation of certain part of zinc oxide particles within system, whereas particle size decreases with increasing concentration of stabilizer. Fundamental question was, whether the sediment is formed by larger primary particles or by aggregates of them. To explain this eff ect, the shape and size of particles in colloidal solution and sediment were studied by AFM and TEM methods.

This work has been supported by the projects FT-TA3/055 and FT-TA4/074 of the Ministry of Industry and Trade of the Czech Republic.


165

Posters

P - 115Electronic conductance in arrays of DNA fi nite segmentsE.L. Albuquerque1, U.L. Fulco2, V.N. Freire3

1UFRN, Physics, Natal, Brazil2UFRN, Biophysics, Natal, Brazil3UFC, Physics, Fortaleza, Brazil

Intelligent composite biological materials have become a new interdisciplinary frontier in life science and material science. Nevertheless, the construction of nanometer-scale circuits remains problematic, and the use of molecular recognition processes and the self-assembly of molecules into supramolecular structures might help overcome these diffi culties. In this context, the ability to choose the sequence of nucleotides, and hence provide the addressability during the self-assembly processes, besides its inherent molecular recognition, makes DNA an ideal molecule for these applications.

The design of DNA-based devices for molecular nanoelectronics is crucially dependent upon elucidation of the mechanism and dynamics of electrons and hole transport in DNA. Unlike proteins, DNA is not primarily an electron/hole-transfer problem, and its suitability as a potential building block for molecular devices may not depend only on long-distance transfer of electrons and holes through the molecule. The reason for that lies in the mechanism itself: it fails to explain the persistence of effi cient charge transfer when the transfer rates do not decrease rapidly with the transfer distance. Numerous algorithms have been introduced to overcome this problem, generating representative pattern for certain sequences, or groups of sequences.

With this aim in mind, we report here a numerical study of electronic conduction in π-stacked arrays of DNA double-strand fi nite segments, made up from the nucleotides guanine, adenine, cytosine, and thymine, forming a Rudin-Shapiro (RS) quasiperiodic sequence, whose structure presents long-range pair-correlation. It is constructed starting from a guanine nucleotide as seed and following its infl ation rule. For comparison, we show also the electrical transport properties for a genomic DNA sequence considering a segment of the fi rst sequenced human chromosome 22 (Ch22). We obtained that the long-range correlations present in Ch22 and RS sequences are responsible for the slow vanishing of some transmission peaks as the segment size is increased, which may promote an eff ective electronic transport at specifi c resonant energies of fi nite DNA segments. On the other hand, much of the anomalous spread of an initially localized electron wave packet can be accounted by short-range pair correlations on DNA. This fi nding suggests that a systematic approach based on the inclusion of further short-range correlations on the nucleotide distribution can provide an adequate description of the electronic properties of DNA segments. Our theoretical method uses Dyson’s equation together with a transfer-matrix treatment, within an electronic tight-binding model Hamiltonian describing one electron moving in a chain, suitable to describe the DNA segments. The electronic density of states is calculated stressing the regions of frequency where the transfer function is complex.

We thank fi nancial support from CNPq, FAPERN and CAPES-PROCAD (Brazilian Agencies).


166

Posters

P - 116Characteristics of Low-Temperature Aluminum Oxide Dielectric Stacks Prepared by DC-Sputter of Aluminum target and followed by Compensation in Nitric AcidC.Y. Yang1, J.G. Hwu2

1National Taiwan University, Graduate Institute of Electronics Engineering, Taipei, Taiwan2National Taiwan University, Department of Electrical Engineering / Graduate Institute of Electronics Engineering, Taipei, Taiwan

MOS capacitors with Al2O3 gate dielectric prepared by dc-sputtering of Al injected with O2 and implemented with direct current superimposed with alternating-current anodization (DAC-ANO) compensated in HNO3 at room temperature was demonstrated. In this work, the 3 inch boron-doped (100) p-type silicon wafers with a resistivity of 1-10 Ω?Ecm were used as the substrate of the MOP (p) capacitors. After standard RCA cleaning process, thin SiO2 was grown by anodization (ANO-SiO2) which is a room temperature oxidation process in de-ionized (D.I.) water electrolyte. Subsequently, Al2O3 layers were deposited with a Ar fl ow rate of 15 SCCM, a O2 fl ow rate of 45 SCCM, a substrate temperature of 25 °C, a rf power of 65 W and a chamber pressure of 5 × 10−6 torr. Then, these samples were immersed and compensated in diluted HNO3 electrolyte. The anodization was carried out for 5 minutes, and a positive DC voltage of 15 V superimposed with an AC step oscillation of 1 V with a frequency of 500 Hz. The gate area was defi ned by photolithography and patterned by wet etching.

In this work, we fi nd some unusual phenomenon occurred in electrical characteristics. C-V characteristics for various frequencies are shown in Fig.1 . Intriguingly, it was observed that the C-V curves are frequency dependent. C-V characteristics have obvious dispersion corresponding to diff erent frequencies due to the existence of nanodot or interface trap density. Under low of frequencies, C-V characteristics are closer to ideal condition as the carriers could response to frequency. It was suggested that under measurement frequencies, the trapped hole which could be left inside the dielectric as the positive charges would not exchange in time. However, electrons can move between Al nanocrystal and the substrates simultaneously with low frequencies. Under low frequency, the electrons tunneling to the nanodot and compensate the positive charge. Therefore, the eff ective positive charges which introduce the C-V to shift rightward are reduced. It shifts +0.62V, +0.84V and +0.49V among 1M and 100k, 100k and 10k, and 10k and 1k Hz when fi xing Normalized Capacitance of 0.6. The possible reason for the SiO2 barrier height is the defect states caused by ion or the eff ect of including Al ions in the barrier region.

Figures 2(a) and 2(b) are for samples with initial treatments of +5V for 300s and -5V for 300s, respectively. It was observed in Figure 2(a) that at stress time of 300s, the current variation percentage ΔJ / J0 forVG = -1V is -77.5 %, but for VG = -5V -43.9 %. The larger the stress voltage applied, the smaller the current variation percentage exhibited. Similarly, in Figure 2(b) the ΔJ / J0 forVG = -1V at stress time of 300s is -89.1 %, but for VG = -5V -29.6 %. It was clearly observed that small constant voltage stress give rise to the large gate current density variation. It suggests that the electrons may face many traps in Al2O3 under low voltage stress when tunneling. However, under high voltage stress, the electrons would tunnel through SiO2 and then face fewer traps in Al2O3. Therefore, the trapping phenomenon is less signifi cant in comparison with that under low voltage stress.


167

Posters

P - 117Microstructure of a model system for Pb-free nanoparticle soldersJ. Bursik1, J. Sopousek2, J. Zalesak2

1Institute of Physics of Materials Academy of Sciences of the Czech Republic, Department of Structure, Brno, Czech Republic2Faculty of Science Masaryk University, Department of Chemistry, Brno, Czech Republic

Classical solders based on lead and tin represent a serious health risk and environmental problem. Since 2006, a requirement for lead-free solders was implemented into the EU legislation. The introduction of lead-free solders is associated with practical diffi culties as there is no single all-purpose replacement for the lead containing alloys. Lead-free solders presently used have worse mechanical properties and higher melting temperature Tm. Tm is of the primary concern for both economical and technological reasons. Tm of classical Sn-Pb solder is as low as 183°C. The need for low meeting points seriously limits the range of candidates amongst low toxic species. A promising approach in lowering meeting points is the use of lead-free solder pastes, which decrease their melting point in comparison with the corresponding bulk materials.

In this work, we studied the eff ect of lowering melting point of silver powder, as a potential low toxic constituent of novel solders. The melting point of bulk silver is 962°C (which is far too high even in a category of high-temperature solders, defi ned by Tm>230°C and limited usually by about 350°C due to polymer materials in substrates used in electronic industry). Using silver in its powder form may substantially lower the melting point and hence make silver and its powdered alloys applicable as high-temperature solders.

Copper disks 6 mm in diameter were polished; a layer of silver powder was evenly spread over one of them and covered by another one. The sandwich was put in a clamp and annealed at various temperatures for 1 hour and for 3 hours. Metallographic cross sections were prepared from annealed samples and studied using a JEOL JSM 6460 scanning electron microscope with Oxford Instruments INCA Energy analyser.

The results demonstrate that for powdered Ag the annealing temperature of 300°C is suffi cient to produce a continuous Ag layer and form a fi rm junction between copper plates. Shorter annealing time still leaves considerable density of pores in some regions of Ag layer, whereas 3-hour annealing produces a compact layer without pores. A transition layer is observed at the Cu-Ag interface, the thickness of which increases with annealing time. Energy dispersive X-ray analysis across the joints shows the increased amount of oxygen in the transition layer; hence the resulting structure can be described as Cu¦Cu-O¦Ag.

This research was supported by the Czech Science Foundation (Project 106/09/0700).

P - 118Fabrication of sensors by soft lithographyK. Barbe1, H. Thomas2, A. Terfort1

1Institute for Inorganic Chemistry, Chemistry, Frankfurt am Main, Germany2Chemistry, Chemistry, Marburg, Germany

Miniaturisation of electronic devices is becoming more and more important. The demmand for cheaper and smaller devices with high functionality increases rapidly. The standard procedure for the fabrication of micro-devices (either microelectronic or micromechnic) is photolithography. While this method demands for an extensive infrastructure, i.e. clean room techniques, and expensive materials, such as specialized resists, it is inherently limited to ultra fl at surfaces. As an alternative, a group of methods has been developed that is summarized under the name ‘soft lithography’. This name origins from the fact that most of these methods are based on the use of elastomeric materials carrying the required pattern in one form or the other. The best established of these metheds is micro-contact printing (μCP), which provides a simple and easy-to-use tool for the production of micro-devices with structures much smaller than 1 μm.

In our poster, we want to demonstrate how this method, alone or in combination with others, such as plasma processes or galvanic plating, can be used for the fabrication of micro-sensors and even sensor-arrays. Diff erent sensing principles were successfully implemented such as electrochemistry, adsorption-dependent resistance, or temperature-resistance. The respective fabrication steps as well as the performance of the fi nal devices will be presented.


168

Posters

P - 119Photonic band gaps in nanostructuresM.S. Vasconcelos1, P.W. Mauriz1, E.L. Albuquerque2

1IFMA, Physics, Sao Luiz, Brazil2UFRN, Physics, Natal, Brazil

We intend in this work to show the polaritonic band gap spectra, which arises from the propagation of a plasmon-polariton excitation in quasiperiodic multilayer nanostructures, forming a photonic crystal. They are made from alternating layers of both positive (medium A: SiO2) and negative refractive index materials (medium B) following a Fibonacci pattern, using a theoretical model based on a transfer matrix treatment.

The plasmon-polariton dispersion relation is obtained by solving the electromagnetic wave equation for p-polarized electromagnetic mode, within the layers A and B of its nth unit cell. The pass bands are then obtained when the absolute value of the trace of the transfer matrix is less than one, which means a real z-component kz of the wavevector. On the other hand, when it is bigger than one, we have a stop band. However, some complex value of kz can still make the left-hand side of the trace of the transfer matrix smaller than one, and these complex solutions may have physical signifi cance. This can be seen considering the dispersion curves corresponding to a fi xed common dimensionless in-plane wavevector kxL/2π, and a ratio dB/dA, where kx is the in-plane wavevector, L = dA +dB is the size of the unit cell of this structure, and dA (dB) is the thickness of layer A (B) in the nano scale. These dispersion curves are defi ned in the region where the average index of refraction of the superlattice vanishes, the so-called zero-<η> photonic region, where <η> = (ηAdA +ηBdB)/L = 0, with ηA = 2.19 being the refraction index for SiO2, and ηB = -3.53 the refraction index for the layer B, respectively. Here the edges of the bulk bands are not characterized by the Floquet- Bloch condition, QL = 0 and QL = π. Also, for small values of kxdA the transmission through the superlattice is zero, except in certain transmission bands and for some values of QL < π. The discrete frequencies are then determinate by the Fabry-Perot resonance condition kzA = mπ (m = ±1, ±2, ±3,...), where the waves refl ected at consecutive interfaces arrive out of phase at the input facet of the superlattice.

The continuous bulk bands are characterized by the reduced Brillouin zone, 0 < QL < Ξ , with Ξ being the values where the slope goes to minus infi nity. The <η> = 0 band structure can be better seen in the projected band profi le, where the consecutive pass bands are united to constitute a very large fragmented band, where we can observe discrete and continuous bulk modes.

The most important experimental techniques to probe these spectra are the Raman light scattering and attenuated total refl ection (ATR). In the case of Raman scattering, one uses a grating spectrometer to detect and analyze the scattered light. The typical shift of the frequency of the scattered light is in the range 0.6-500 meV, which makes this technique very appropriate for probing the polariton spectra.

We thank fi nancial support from CNPq, FAPERN and FAPEMA (Brazilian Agencies).

P - 120Grain refi nement by high pressure torsion of medium carbon steel J. Zrnik1, R. Pippan2, S. Stephan2, K. Tomas3, Z. Michal4

1COMTES FHT Inc., Materials Science, Dobrany, Czech Republic2Erich-Schmid Institute of Materials Science, Austrian Academy of Science, Leoben, Austria3West Bohemian University, UniversityDept. of Materials and Mechanical Metallurgy, Plzen, Czech Republic4COMTES FHT Inc., Numerical Simulation, Dobrany, Czech Republic

During the recent decade, bulk nanostructered materials produced by severe plastic deformation (SPD) have been investigated intensively. It has been already well known that SPD of metallic materials, involving processes such as equal angular pressing (ECAP), accumulative roll bonding (ARB) and high pressure torsion (HPT), is eff ective of producing ultrafi ne grained (UFG) materials with submicrometer and/or even nanometer grain size. The wide range of results available for various materials deformed by HPT confi rmed heterogeneity in microstructural refi nement and the strength and hardness increase as eff ective strain increases.

The aim of this work, when using the high pressure torsion deformation method at increased temperature, was to study ultrafi ne grain structure formation in medium carbon steel (AISI 45) in dependence of eff ective strain introduced. The infl uence of deformation processing parameters was investigated with respect to diff erent strain introduced by torsion. The eff ect of diff erent shear strain, varying across the deformed disc in time of process, on microstructure evolution was investigated by TEM of thin foils. Microstructure analysis confi rmed deformation heterogeneity in ultrafi ne grain structure formation across the disc due to the strain variation. While, regardless the number of revolution performed, the ultrafi ne grain structure was already formed at disc periphery, in central part of the discs inexpressive structure modifi cation was found. Mechanical properties pointed out on structure heterogeneity deformation eff ect as well. The drop in hardness was measured in the central area of disc. This softening eff ect, as substructure characteristics show, can be supported by progress in dynamic recovery process, which is more progressive with eff ective straining.

The development of strain and temperature distribution across disc as an eff ect of applying actual eff ective strain was simulated using DEFORM 3D method. The changes in strain size distribution across the disc were then related to real structure development in deformed disc.


169

Posters

P - 121Nanostructured materials by mechanical-chemical alloying technologyA. Bianchin1, P. Matteazzi2, A. Colella1, R. Rolli1

1CSGI-Interuniversity consortium, Nanomaterials, Vascon di Carbonera (TV), Italy2MBN nanomaterialia, Research, Vascon di Carbonera (TV), Italy

The main characteristic of mechanical alloying and high energy ball milling in particular is the possibility to act on the intimate materials structure to modify the behaviour and physical/mechanical properties of materials. Through this technology it is possible to refi ne crystal nanostructure and phase nanodispersion, to develop new phases to achieve the wished strengthening eff ects and performances improvement. On the base of mechano-chemical technology, MBN Nanomaterialia developed a proprietary production plants able to produce nano-materials on industrial scale (200ton/year). This process technology, called Mechanomade®, is essentially based on the “High energy ball milling” principles.Typical output of this process is constituted by nanocrystals and nanoparticles (i.e. <100nm) aggregated in micron-size range powders (i.e. 5-100?m). This kind of materials can fi nd application in many manufacturing chains especially in which the direct use of nanoparticles is not viable like, for instances, laser sintering nano-micromanufacturing and high thickness coating deposition. The introduction of nano-features inside bigger agglomerated particles represents also an alternative way and a solution in order to build up micro-nano applications avoiding safety restrictions and troubles related to nanopowders handling and direct use. The mechano-chemical approach is also suitable to treat materials of various kind and nature and, depending on working conditions, it can be driven (exploiting mechano-chemical principles like materials nanostructuring, materials alloying, reactive milling, etc. and the enlarged formulation possibilities) to produce materials pertaining both the inorganic and the organic fi eld like: nanophased materials as metals, ceramics, metal alloys and activated systems; nanodispersions, reinforced polymers, polymeric alloys; and their possible interactions on the composite fi eld: metal/ceramic - polymeric composites, nanocharges, nanofl uids. Nano-materials produced by MBN can fi nd applications in several fi elds. Some of the more representative in terms of production volumes are: Fe-Cu alloys for diamond grinding tools, WC-Co thermal spraying powders for extreme wear resistance, and Ti base biomedical alloys.Beside the industrial market, MBN?s mission is also focused on the continuous research and development of new high performance materials and new synthesis routes. Main results of research rely on the fi eld of materials for laser sintering (Metal and ceramic nanoalloys and polymers), nanomaterials for energy (Mg based for H2 storage and Ni-MH based for micro battery applications), materials for biomedical applications. Research activity is carried out through participation/ promotion of research projects both at National and European level in close collaboration with CSGI (Interuniversity Consortium).


170

Posters

P - 122Molecular-dynamic approach to calculation of nanostructure state equationE. Golovneva1, I. Golovnev1, V. Fomin1

1Khristianovich Institute of Theoretical and Applied Mechanics SB RAS, Physics Of Fast Process Laboratory, Novosibirsk, Russia

Both nanostructures forming in the modern nanotechnologies (the nanocluster condensation from gas phase, nanofi lms forming in CVD and ALD processes etc.) and their subsequent utilization are very often accompanied by sizeable thermal loads (at the electric current passing through contacts in microelectronic schemes etc.).

In this connection the necessity appears to investigate thermodynamic nanostructures properties. And also there is a need to take the state equation of nanostructures. This fundamental task is the independent interest.

The molecular-dynamics modelling stages.

Despite the fact that the Mee and Grjunaizen theory didn’t allow calculating the solids thermodynamics on the base fi rst principles, but it gave the structure of thermal and calorifi c state equations. It allowed to construct the molecular-dynamic calculation approach of nano-solids thermodynamics, and fi nally using the scaling property it gives the opportunity to build macro-solids thermodynamics.

2.1. As the nanostructures properties depend on shape and size, so on the fi rst stage it is chosen the proper atomic structure with ideal crystalline lattice.

2.2. Because of the nanostructure has large surface that its potential energy doesn’t correspond to potential energy minimum. Therefore on the second calculation stage there is a need to fi nd the global minimum of structure potential energy at zero temperature. The obtained atoms coordinates will be used as initial data for further computations.

2.3. There is a need to carry out the modeling of isothermal process of cluster pressing by controlled external pressure at zero temperature. It will allow to obtain such “cold” characteristics as pressure and internal energy dependences from volume.

2.4. On the fourth stage the isochoric warming-up of nanostructure is carried out using fi nal coordinates and pulses of atoms p.2.3 for various external pressures. At that such characteristics as “cold” energy and pressure stay constant. It permits to obtain the dependences of heat constituents of energy and pressure from the volume and temperature (the calorifi c and thermal state equations).

2.5. The calculated above calorifi c and thermal state equations are used for computation of nanostructure free energy with the help of Gibbs-Helmholtz equation.

So it is proposed the calculation method of nanostructures thermodynamic properties from fi rst principles and the method is approved for the case of spherical copper clusters.

The research showed that the results for volumetric part coincide with the results for macro-objects. The distinction of nanostructure properties from macro-bodies ones is caused by considerable infl uence of surface atoms in nanostructures.

The proposed method permits to compute the macro-bodies thermomechanical properties by means of the realization of similar calculations for micro-structures as the surface atoms infl uence can be neglected.


171

Posters

P - 123Characteristics of Al-doped ZnO nanorods fabricated by a wet chemical methodSang Kyoo Lim1, Sung-Ho Hwang1, Seong Hui Hong1, Hyun Jung Choi1

1Advanced Nano-Materials Research Team, Division of Nano & Bio Technology, Daegu Gyeongbuk Institute of Science & Technology, Daegu, Republic of Korea

In recent years, one-dimentional (1D) nanostructures in the form of nanorods, nanowires or nanotubes, appear as an exciting research area for their great potential of applications. Zinc oxide is a versatile material with many applications including transparent electrode in solar cells,

gas sensors and photo-luminescence devices. Also, the benefi ts of a utilizing solution-based method have also involved the considerable infl uence of reaction species on the size and morphology. In this aspect, many of the previous investigations on pure and transition metal doped ZnO prepared by solution based method, mainly utilized zinc hydroxide or salt as precursors and water or organic solvent as reaction media. Only few publications reported the relationship between amphiphile structure and pure and aluminum doped ZnO nanorods morphologies. Herein, we present microemulsion method toward the growth of well-proportioned and crystallized pure and aluminum doped ZnO nanorods using two types of amphiphiles as the modifying and protecting agent. The synthesis of aluminum doped ZnO nanorod was carried out in microemulsions, which were consisting of 5g of amphiphile such as dodexyl benzne sulfonate, sodium lauryl sulfonate and 2 mmol of ZnAc2x2H2O both dispersed in 60 ml xylene by stirring until a homogenous slightly-turbid appearance of mixture was obtained. After aluminum precursor (aluminum nitrate nonahydrate) was added depend on the doping ratios. Then hydrazine monohydrate 2 ml and ethanol 8 ml mixture solution was added drop-wisely to the well-stirred mixture at room temperature by simultaneous agitation. The resulting precursor-containing mixture was subsequently heated to the 140°C for refl uxing. After refl uxing for 5 hours, a milky-white suspension was obtained and centrifuged to separate the precipitate, which was rinsed with absolute ethanol and distilled water for several times and dried in vacuum oven at 70°C for 24 hours. In the present work we have investigated the infl uence of preparation conditions on the structural and electrical properties of pure and aluminum doped zinc oxide nanorods.

References[1] Pang, Z. W.; Dai, Z. R.; Wang, Z. L. Science 2001, 291, 1947-1949.[2] Pacholski, C.; Kornouski, A.; Weller, H. Angew. Chem., Int. Ed. 2002, 41, 1188-1191.[3] Hu, J. Q.; Li, Q.; Wong, N. B.; Lee, C. S.; Lee, S. T. Chem. Mater. 2002, 14, 1216-1219.[4] Monticone, S.; Tufeu, R.; Kanaev, A. V. J. Phys. Chem. B. 1998, 102, 2854-2862.[5] Majumder, S.B.; Jain, M.; Dobal. P.S.; Katiyar, R.S.; Mater. Sci. Eng. B. 2003, 103,16-25.


172

Posters

P - 124The density versus surface area plot - a new method for investigations of nanoparticles qualityW. Lojkowski1, A. Opalinska1, W. Dzwolak2, T. Chudoba1, E. Grzanka1, R. Pielaszek1

1Institute of High Pressure Physics PAS, Laboratory of Nanomaterials, Warszawa, Poland2Institute of High Pressure Physics PAS, Biophysics group, Warszawa, Poland

It is known that varius synthesis methods lead to formation of hydroxide (-OH) groups on the surface of nanoparticles. In nano-crystals of ZrO2 such groups increase their hydrophilic properties and may dump the luminescence of the optically active additives added to zirconium dioxide.

It was found that the presence of a layer of -OH groups on the nanoparticles surfaces leads to lowering of their pycnometric density. The higher is the surface area the lower is the density and this relationship could be used to determine the thickness of the surface layer.

We report the eff ect of annealing on the presence of -OH groups on the zirconium surface. The -OH groups persist on the zirconia surface even after annealing at 1100oC, despite the fact that bulk zirconia hydroxide decomposes into water and zirconia at much lower temperature.

To investigate the presence of -OH groups on the surface we used a deuterium substitution technique. The particles were produced using a hydrothermal process. However, instead of using in the synthesis water, we used heavy water. Further, to detect the -OD groups we studied the eff ect of annealing on the FTIR spectra. The -OD groups could not attach to the nanoparticles during their handling and transportation to the FTIR apparatus. Therefore, the presence of such groups even after high temperature annealing is evidence of their stability on the nanoparticles surface.

Hence, we presented two new techniques for investigations of the surface of nanoparticles: • heavy water substitution permits to avoid use of expensive FTIR systems combined with vacuum sytems and furnaces. • The BET/density diagram permits to evaluate the degree of crystalliinity of the nanoparticles and thickness of the surface layers as a function

of the nanoparticles processing method.

P - 125New chiral stationary phase based on stabilized by organic ligands gold nanoparticles on silica surface for separation β-blockersL. Agron1, P. Rudakovskaia1, A. Majouga1, I. Ananieva1, E. Beloglazkina1, O. Shpigun1, N. Zyk1

1Lomonosov Moscow State University, Chemistry, Moscow, Russia

Organic ligand-capped gold clusters have been known for a number of years. The practical formation of stable, isolable monolayer-protected clusters has only been demonstrated in 1994 year by Schiff rin and co-workers. Gold Nanoparticles are also attracted much attention for their outstanding, size-dependent chemical, electronic, physical and optical properties. The dimensions of these particles make them ideal candidates for the nanoengineering of surface and the fabrication of functional monostructures. Functionality of diff erent ligands is very important, which sorts defi ne the scope of application of corresponding gold clusters. For some time past, much eff ort has been expended on construction of functional interfaces.

Gold Nanoparticles have been prepared by reduction Н[AuCl4] in an aqua solution by sodium citrate, and then they were modifi ed by L-cystein. Prepared Nanoparticles have been adsorbed on silica.

Determination of optically active compounds is a subject of great interest in analytical chemistry, particularly in pharmaceutical domain. The fact that the enantiomers of the substances frequently exhibit diff erential pharmacological and toxicological properties has fostered the use of enantiomerically pure products.

The current interest in the resolution of the optical isomers is due to the growing awareness may be achieved by derivatizing the enantiomers with derivatizing agent, but much works in chiral separations have been directed to the development of new chiral selectors.

We suggest newest chiral selector for liquid chromatography - silica coated by adsorbtion of gold Nanoparticles modifi ed L-cystein. The optimal conditions for enantioseparation of some β-blockers in reversed phase mode and in polar organic mode were investigated.


173

Posters

P - 126Optical micro-spectroscopy of single semiconductor nanostructures: Observing individuality in the nanoworldJ. Valenta1 1Charles University in Prague, Faculty of Mathematics and Physics, Dept. Chemical Physics and Optics, Prague, Czech Republic

Optical spectroscopy can be applied to study individual nanometer-sized objects in spite of poor resolution of the optical imaging. The key features of such experiments are (i) specially prepared samples with low concentration of optically addressed objects and very low background signal, (ii) high quality of optical imaging and optimized detection effi ciency [1]. Diffi cult, but very important, task is incorporation of a cryostat to the micro-spectroscopic set-up in order to get deeper insight into observed phenomena by variable-temperature measurements [2]. Several micro-spectroscopy set-ups have been built by the author and applied to study semiconductor nanocrystals [3], nanowires, nanocrystalline waveguides [4], nanocrystals within photonic crystals [5] and light-emitting diodes [6] etc. Several phenomena like luminescence fi ne-spectral structure, polarization, and ON-OFF intermittency are unique features of single nano-object detection and cannot be seen in ensemble measurements. Moreover, surprising variability of single nano-object properties refl ects “individuality” of each object caused by variations in size, shape, surface passivation etc. The study of individual properties and their statistical distribution by means of optical micro-spectroscopy is extremely important for future applications of semiconductor nanostructures in e.g. optoelectronic devices.

References[1] J. Valenta & J. Linnros: Optical Spectroscopy of individual silicon nanocrystals, in Silicon Nanophotonics: Basic Principles, Present Status and

Perspectives, Ed. L. Khriachtchev, World Scientifi c Publishing Co. Pte. Ltd. 2009, p. 179-209.[2] I. Sychugov, R. Juhasz, J. Valenta, and J. Linnros, Physical Review Letters 94 (2005) 087405.[3] J. Valenta, A. Fucikova, F. Vácha, F. Adamec, J. Humplolíčková, M. Hof, I. Pelant, K. Kůsová, K. Dohnalová, and J. Linnros, Advanced Functional

Materials 18 (2008) 2666[4] I. Pelant, T. Ostatnický, J. Valenta, K. Luterová, E. Skopalová, T. Mates, and R.G. Elliman, Appl. Phys. B 83 (1) (2006) 87. [5] P. Janda, J. Valenta, , J.-L. Rehspringer, R.R. Mafouana, J. Linnros, and R.G. Elliman, J. Phys. D: Appl. Phys. 40 (2007) 5847.[6] J. Valenta, N. Lalic, and J. Linnros, Appl. Phys. Lett. 84 (2004) 1459.

P - 127Putting organic functionalities onto surfacesB. Schuepbach1, A. Terfort1

1Institute for Inorganic Chemistry, Chemistry, Frankfurt am Main, Germany

Located at the interface between organic, inorganic and physical chemistry, self-assembled monolayers (SAMs) are a powerful tool to modify the properties of surfaces. In particular the systems obtained from the chemisorption of thioles onto gold surfaces are well investigated and frequently used due to their high order and low defect density, as e.g. necessary for applications in organic electronics.

For a number of other advanced applications, such as sensing or surface-bound nano-architectures, surfaces need to be decorated with chemical functionalities in a predictable and reproducable manner. In the past it was proven that this cannot be achieved using the widely established alkanethiol chemistry [1].

In the past years, we showed that non-susbtituted thiols with a stiff aromatic backbone like terphenylalkanethiols form SAMs with superior long-range order [2]. In this poster, we wish to present the extension of these systems by the attachment of functional groups such as carboxyl, amino, and pyridyl groups. Our synthetic approach is based on a building block strategy, using Pd-catalysed cross coupling reactions. This new procedure is highly divergent.

First results on the preparation and characterisation of the respective monolayers will be presented. In addition the usefulness of these functionalized surfces for the growth and anchoring of metal-organic frameworks as well as the chemical modifi cation of the functional groups will be demonstrated.


174

Posters

P - 128Study of organic molecules immobilization via nitrogen atom binding on the surface of silver nanoparticlesP. Zvatora1, P. Rezanka1, K. Zaruba1, L. Veverkova1, V. Kral1

1Institute of Chemical Technology Prague, Department of Analytical Chemistry, Prague 6, Czech Republic

Direct immobilization of analytical important receptors on to the surface of nanoparticles often isn’t possible because receptors don’t contain suitable functional groups. In this case the use of diff erent multifunctional spacers is necessary. One functional group is used for surface binding and the second group is used for immobilization of a selected receptor. In many cases the better detection limit for selected analytes can be achieved by the using of appropriate detection method combined with surface immobilization of the receptor. This work deals with modifi cation of silver nanoparticles by compounds with functional groups containing nitrogen atom.

In this work, silver nanoparticles were prepared using diff erent reduction reagents[1,2,3]. Nanoparticles were purifi ed and characterized by variety of techniques including electron microscopy, absorption spectroscopy in UV-Vis range and Raman spectroscopy. The best reduction agent for preparing silver nanoparticles for our purpose was EDTA.

Further, solutions of nanoparticles and selected compounds (methylamine, triethylamine, 4,4´-bipyridine and 1,10-fenanthroline) were prepared, in each case in the concentration of three order of magnitude.

The study of interaction was done by absorption spectroscopy in UV-Vis range and Raman spectroscopy. Infl uence of increasing ionic power of solution on plasmon resonance of silver nanoparticles was studied.

The fi nancial support from the MSMT6046137307 and KAN200200651 MSMT 6046137307 and Nanomed is gratefully acknowledged.

References[1] Shu-Yi L., Yi-Ting T., Chien-Chih C., Chia-Mei L., Chun-hsien C.: J. Phys. Chem. 2004, 108, 2134. [2] Susanne M. H., Grieser F., Barraclough C. G.: Journal of Colloid and Science, 1983, 93, 545 [3] Cermakova K., Sestak O., Matejka P., Baumruk V., Vlckova B.:Collect. Czech. Chem. Commun. 1993, 58

P - 129Design and synthesis of novel reactive chromophore for copolymerized with styreneP. Piyakulawat1, R. Thiramanas1, D. Polpanich1, U. Asawapirom1

1National Science and Technology Development Agency, National Nanotechnology Center, Pathumthani, Thailand

Chromophore or dye encapsulated in polymer particles, colorant latexes, have received much attention to utilize in medical and biological diagnostics application [1]. Miniemulsion polymerization has been claimed to be an eff ective method for incorporation the chromophore into the particles [2, 3]. However, nowadays, these colorant latexes have suff ered from some disadvantages. The chromophore molecules, that formed physical interaction with the polymer matrix, brought about the migration of the dye out of colored particles [4]. To overcome this problem, the synthesis of self-colored polymer should be applied. In which, the polymer chains formed covalent bonds with the reactive chromophrore, which contained polymerizable functional groups to produce the colorant particles.

In this research work, the novel polymerizable chromophore, 2,3,6,7-tetra(2,2’-bithiophene)-1,4,5,8-naphthalenetetracarboxylic-N,N’-di(2-methylallyl)bisimide, was fi rstly designed and synthesized. The chromophore based on naphthalene and thiophene was accomplished via the Stille-type coupling reaction of tetrabromonaphthalene-tetracarboxylic acid anhydride and stannylthiophene using Pd(PPh3)4 as the catalyst. The resulted chormophore was then modifi ed by imidation reaction with allyl amine to produce polymerizable chromophore. It was characterized in term of structure and absorption properties by using 1H NMR and UV-vis spectroscopy, respectively.

The reactive polymerizable chromophore was incorporated into the polymer nanoparticle by copolymerization with styrene and acrylic acid monomers via miniemulsion polymerization. The conversion of the monomers was approximately 100 percent with polydispersity index (PDI) close to 0.01. The morphology and particle size of the colorant particles were investigated by scanning electron microscope (SEM) and photo correlation spectroscopy (PCS), respectively. The particles exhibited uniform spherical shape with diameter around 90 nm

Furthermore, the colorant particles comprising of carboxy groups originated from acrylic acid will be used as a solid support for biomolecule immobilization for using in diagnostic application such as immunobiological detection.

References: [1] M. Seydack, Biosensors and Bioelectronics, 2005; 20: 2454-2469. [2] S. Lelu et al., Polymer International, 2003; 54(4): 542-547. [3] Z. K. Hu et al., Journal of Applied Polymer Science, 2007; 104: 3036-3041. [4] Z. Hu et al., Dyes and Pigments, 2008; 76: 173-178.


175

Posters

P - 130Materials Nanotechnology: Risks & Benefi tsProf. Figovsky Oleg1

1Academician of EAS, RAASN & REAInternational Nanotechnology Research Center Polymate, Israel - Canada polymate@borfi g.com

Scientists and engineers believe nanotechnology can be used to benefi t human health now and in the future through applications such as better fi lters for improving water purifi cation, more eff ective methods of delivering drugs in medicine and new ways of repairing damaged tissues and organs. However, some nanotechnology experts believe that more assessments need to be made of the potential risks to human health posed by nanotubes and other nanoparticles, which may have the potential to be hazardous in unpredictable ways. Therefore the problem of risks of nanotechnology development is highly relevant. At the same time there are many discoveries in the area of biology and biotechnology. It makes the discussion of convergence of biological and physical approaches extremely important.

Israel is one of leaders in Nanotechnology, not only in fundamental academic researches but mainly in industrial researches and founding start-up companies. In our presentation we are presenting new elaboration of environment friendly nanotechnologies.

Nanostructured composites based on Interpenetrated Polymer Network are preparing nanocomposites based on interpenetrated polymer network, such as polyurethanes, epoxies and acrylate by way of creating nanoparticles of SiO2, TiO2 and other metal oxides during a technological stage from a liquid phase. Using as interpenetrating polymer networks principle in production of composite materials provides a unique possibility to regulate their both micro-and nano-structured properties Formulation of a new class of nanocomposite materials is characterized by the absence of contaminants for a network polymers technology. As a main component of such technology we are using branched (dendro)-aminosilanes that at the fi rst stage are curing agents for many oligomers. Additional hydrolysis of aminosilane oligomers creates the secondary nano-structured network polymer that improves service properties of the compound. By using a principle of forming nanostructure by creating nanoparticles during a technological process from a liquid phase, Polymate has elaborated a few of composites based on diff erent kinds of soluble silicates. Signifi cant increasing of silicate matrix strength and toughness was reached by incorporation of special liquid additives, such as TFS, which eff ect as a microcrystallizing nucleator on the technological stage and later they colmatage the pores of silicate matrix. Our last elaborations are mainly applying a novel type of soluble silicate contained organic cations, for example, the

DABCO (

N

N)-based organic alkali soluble silicate.

Novel metallic matrix nanoreiforced materials produced by method of super deep nenetrationsTechnological process of metallic matrix nanoreiforced materials elaborated on the basis of new physical eff ect “ superdeep penetration ”and allows to make from the known tool steels (for example, HSS) new composite materials. These materials possess the increased level of properties, can be used for replacement base steels in metal-cutting and stamp tool. In some cases new materials can be used for replacement of a hard metal(on the basis of WC) in the tool for mining (for example, cutters of coal and mining machines). The application of technology developed allow to increase the service life of tools up to 1.5-5.0 times compared to the common used tools. The technology can be applied for the volume strengthening practically any type of instrumental steels. Use of new physical eff ect “super deep penetration” (SDP) allows to receive composite materials on the basis of aluminium, with the set anisotropy of physical and chemical properties. Use of features of process SDP allows to change properties of a material qualitatively. In microvolume electroconductivity of aluminium can change in several times. In preparation it is received electroconductivity, in mutually perpendicular directions diff ering in 2 times. These materials are intended for new electric and electronic devices. The eff ect from use of a new aluminium material in electric installations and electronic control systems will make, due to reduction in expenses for expensive materials, hundred millions and billions dollars USA. Cost of process of rearrangement of structure of aluminium preparation does not exceed 40 USD/kg. By industrial production of such material its cost to decrease in 2-3 times. From individual preparation can be made tens electric and thousand electronic devices. Process SDP is high-effi ciency and does not demand the expensive equipment. The new technology of volumetric reorganization of aluminium, creation zones of nano-structures, the materials received on this basis, will fi nd wide application by manufacture of electric installations and electronic devices. The level of physical and chemical properties received on the basis of technical aluminium allows to approve, that reached qualitatively new scientifi c and technical result.

We have elaborated advanced bioactive coating with using silver nanoparticles. As found in numerous studies during the last two decades, particles with dimensions in nanometer scale (10-9 - 10-8 m) possess peculiar properties, diff erent from those of atoms and ions on the one hand and of bulk substance on the other. These silver nanoparticles was received by the novel BAR-synthesis. The biological activity of varnish-paint materials modifi ed by silver nanoparticles was estimated on the following microorganisms:• Escherichia coli (E. Coli 1257) as a conventional model of bacterial contamination of the environment;• Coliphage (RNA-phage MS-2) as a model of viral infection, including infl uenza A and B, hepatitis A, et al;• Mold fungi (Penicillinum Chrysogenum) as a typical representative of microfl ora of the dwellings and a model of fungicidal contamination;• Spores as a model of spores and other microfl ora.

The data of the testing confi rms the signifi cant advantages of elaborated water-born acrylic bioactive coatings.

The new nano-scale cellulose product (NanoCell) with CI crystalline modifi cation was prepared using advanced, environmentally friendly, resource-save and cheap technology. The developed technology permits producing NanoCell in pilot and industrial amounts. NanoCell product can be manufactured in the form of dispersions, high solid paste and dry powder. The FDA-approved aqueous polymer nanostructured


176

Posters

composition CreenCoat is applied for protective covering of paper and board. The coating layer imparts to material barrier properties against permeation of water, grease, oxygen and some other substances. Waste of coated material can be repulped and used in paper industry or decomposed in nature due to its biodegradability. The GreenCoat emulsion is coated on cardboard surface by means of bar - coater and dried at temperature 150-170 oC for 30-60 sec. Then the GreenCoat W glazing hot melt composition is coated on fi rst layer by means of bar-coater at temperature 130-135 oC and air cooled.

Our current elaborating is concentrated on using soluble fullerenes and nanotubes into polymer and silicate nanocomposites.

References: [1] O. Figovsky, D. Beilin, N. Blank: Advanced Material Nanotechnology in Israel.

Nanomaterials: Risks and Benefi ts (editors: I. Linkov and J. Steevens), Springer Science + Business Media B.V. 2009, pp. 275-286.[2] O. Figovsky, E. Badamshina, M. Gafurova, L. Shapovalov: Fullerene-containing nanostructured polyurethanes. PU Magazine, vol. 5, 2008,

pp. 309-316.[3] S. Usherenko, O. Figovsky: Superdeep penetration as the new: physical tool for creation of composite materials Advanced Materials Research

vols. 47-50 (2008) pp 395-402[4] Ioelovich, O. Figovsky: Nano-cellulose as Promising Biocarrier.

Advanced Materials Research vols. 47-50, 2008, pp. 1286-1289[5] A. Ponomarenko, V. Shevchenko, O. Figovsky: Multifunctional Polymer Composites for Intellectual Structures: Present State, Problem, Future.

Scientifi c Israel Technological Advantages, vol.10, No.2 2008, pp. 119-13[6] O. Figovsky, L. Shapovalov: Nanostructured Hybrid Nonisocyanate Polyurethane Coatings Paint and Coatings Industry, No. 6, 2005, pp.36-44.[7] O. Figovsky et al.: The physics of superdeep deep penetration phenomenon

Journal of Technical Physics, vol. 49. No.1, 2008, pp. 3-25.

P - 131Characteristics of copper-doped ZnO nanorods fabricated by a wet chemical methodSung-Ho Hwang1, Sang Kyoo Lim1, Seong Hui Hong1

Advanced Nano-Materials Research Team, Division of Nano & Bio Technology, Daegu Gyeongbuk Institute of Science & Technology, Daegu, Republic of Korea

One dimensional nanostructures such as nanowires, nanorods, and nanobelts have become the focus of intensive investigation in the past decade as potential building materials for versatile usages. Metal oxide nanorods have been widely studied due to their excellent electrical and optical properties. In these studies, the metal oxide nanorods are typically not intentionally doped and the carriers are normally generated by structural defects such as oxygen defi ciencies. The introduction of impurity atoms into semiconducting materials is the primary method for controlling the properties of the semiconductor, such as band gap or electrical conductivity. In this aspect, we synthesized copper doped ZnO nanorods. The synthesis of copper doped ZnO nanorod was carried out in microemulsions, which were consisting of 5g of amphiphile such as dodexyl benzene sulfonate, sodium lauryl sulfonate and 2 mmol of ZnAc2-2H2O both dispersed in 60 ml xylene by stirring until a homogenous slightly-turbid appearance of mixture was obtained. After copper precursor (copper nitrate trihydrate) was added depending on the doping ratios, then hydrazine monohydrate 2 ml and ethanol 8 ml mixture solution was added drop-wisely to the well-stirred mixture at room temperature by simultaneous agitation. The resulting precursor-containing mixture was subsequently heated to the 140°Cfor refl uxing. After refl uxing for 5 hours, a dark-brown suspension was obtained and centrifuged to separate the precipitate, which was rinsed with absolute ethanol and distilled water for several times and dried in vacuum oven at 70°C for 24 hours. In the present work, we have investigated the infl uence of preparation conditions on the structural and electrical properties of pure and copper doped zinc oxide nanorods.

References[1] Maensiri, S.; Laokul, P.; Promarak, V.; J. Cryst. Growth. 2006, 289, 102-106[2] Zhang, Z.; Yi, J. B.; Ding, J.; Wong, L. M.; Seng, H. L.; Wang, S. J.; Tao, J. G.; Li, G. P.; Xing, G. Z.; Sum, T. C.; Huan, C. H. A.; Wu, T; J. Phys. Chem. C, 2008,

112 (26), 9579-9585[3] Liu, T.; Xu, H.; Chin, W. S.; Ping Yang, P.; Yong, Z.; Wee, Andrew T. S.; J. Phys. Chem. C, 2008, 112 (35), 13410-13418[4] Viswanatha, R.; Chakraborty, S.; Basu, S.; Sarma, D. D.; J. Phys. Chem. B, 2006, 110 (45), 22310-22312[5] Pang, Z. W.; Dai, Z. R.; Wang, Z. L. Science 2001, 291, 1947-1949


177

Posters

P - 132Epitaxial overgrowth of InP micropores converted to microcavities or microlamellasD. Nohavica1, P. Gladkov2, Z. Jarchovsky1, J. Grym1, J. Zelinka2

1Photonics and Electronics Acad of Sci of the Czech Rep, Materials for Optoelectronics, Ptague 8, Czech Republic2Photonics and Electronics Acad of Sci of the Czech Rep, Diagnostics, Prague 8, Czech Republic

Over past few years an increasing attention has been paid to porous III-V semiconductors, considered primary as potential materials for photonic crystals, quantum size devices having blue shift in PL spectra, structures containing nanoparticles in micro or nanopores etc. Two types of pores are formed during the process of electrochemical dissolution:

a) Crystallographically oriented (CO) pores (oriented alongside the principal crystallographic axes),

b) Current line oriented pores (CLO) (oriented alongside the applied electrical fi eld).

The pore formation took place in an electrochemical cell containing aqueous HCl solution using a confi guration equivalent to four electrodes.

Heat treatment of porous InP was realized in hydrogen atmosphere under protective InP plate or high phosphorus vapour pressure i.e. “P shower” to prevent thermal dissociation. The main task of our research was to employ these porous substrates in homo and heteroepitaxial growth.

Before homo and heteroepitaxial growth, the micropores were converted to microcavities or microlamellar structures. Experimental observation of the conversion can be explained by the „mass transport“ during heat treatment, which transforms the structure to the one with a lower energy state. Heat treatment of the CO or CLO microporous InP substrates was performed up to 650oC under phosphorus protection. Both types of pores were transformed into microcavities. The cavities retained the same crystallographic orientation of the CO or CLO pores. Only a few structural imperfections could be revealed at the modifi ed pores after heating. The heat-treated porous InP was used as a buff er layer for the growth of both InP (homoepitaxy) and InAs (hetereroepitaxy) structures.

Growth of InAs on non-porous InP substrate by LPE deposition resulted in extremely poor structural quality fi lms. However, after the pore etching of the substrates the epitaxial monocrystalline InAs was obtained. The growth temperature in InAs growth and related pore treatment was 460oC. Conversion process of the micropores into microcavities is not entirely complete as at 650oC. The improved structural quality of InAs also implies that the micropores conversion into microlamellas at 460oC may be more suitable for lattice mismatch compensation during heteroepitaxial growth.

Resulting homoepitaxial laterally overgrown InP structures have also better structural properties, where dislocation density reduction approaches 0.6 of the original value in the substrate.

P - 133Synthesis of doped oxide nanoparticles for applications in photonics and as sensorsW. Lojkowski1, A. Opalinska1, T. Chudoba1, J. Fidelus1, T. Strachowski1, S. Yatsunenko2, E. Wolska2, M. Godlewski2, E. Grzanka1

1Institute of High Pressure Physics PAS, Laboratory of Nanomaterials, Warsaw, Poland2Institute of Physics PAS, Laboratory of Optical Materials, Warsaw, Poland

Solvothermal synthesis with the use of microwaves for heating the liquids enclosed in a high pressure vessel permits to produce nanoparticles with narrow and controlled size distribution, well crystalised (with no or very thin hydroxide layers) , and have a well controlled chemical composition. The process is non-expensive and suitable for scale up, environment friendly and safe. Using this technology we produced zirconia nanoparticles doped with a range of rare earth ions, which display size dependent optical properties. Ytria and calcia stabilized cubic or tetragonal phase zirconia could be easily produced. The particle size distribution was investigated The powders can be used in medical applications or as photonic material. The nanoparticles are being tested for use in prototype optical oxygen sensor and as light sources.

We produced also transition metals doped ZnO nanoparticles, and Al doped ZnO with superior luminescence.

The distribution of the dopands in the nanoparticles as a function of their annealing temperature has been studied, and it was found that high temperature annealing leads to their segregation. On the other hand, the solvohermal process permits to reach a relatively high doping level without segregation of the dopands.

P - 134Mechanical properties of Si3N4+SiC nanocomposites with rare-earth oxide additivesP. Tatarko1, S. Lojanová2, J. Dusza1, P. Šajgalík2

1IMR SAS, Structural ceramics department, Kosice, Slovak Republic2Institute of Inorganic Chemistry SAS, Department of ceramics, Bratislava, Slovak Republic

Infl uence of rare-earth oxide additives (La2O3, Y2O3, Yb2O3 and Lu2O3) on the microstructure and mechanical properties of hot-pressed silicon nitride and Si3N4+SiC nanocomposites have been investigated. The aspect ratio of the Si3N4 grains increased with decreasing ionic radius of rare-earth in all studied ceramics. The fracture toughness of nanocomposites was lower due to the fi ner microstructures and due to fewer amount of toughening mechanisms during the crack propagation. Materials with higher aspect ratio of the Si3N4 grains (Lu or Yb additives) exhibited crack defl ection more frequently compared to the Si3N4 doped with La or Y, which was responsible for the higher fracture toughness. Flexural strength of the nanocomposites were slightly lower than in the case of monolithic Si3N4 with the same additives. The mechanical properties at elevated temperatures were signifi cantly improved in the nanocomposite materials.


178

Posters

P - 135Nanocrystallization and magnetic behavior of Fe73.5-xCrxCu1Nb3Si13.5B9 amorphous alloysH. A. K. M. Abdul1, M.S. Mahmud2, S.M. Hoque1, S.S. Sikder3, P. Nordblad4

1Atomic Energy Centre Bangladesh Atomic Energy Commission, Materials Science Division, Dhaka, Other2University of Asia Pacifi c, Department of Physics, Dhaka, Other3Khulna University of Engineering and Technology, Department of Physics, Dhaka, Other4Uppsala University, Solid State Physics Dept. of Eng. Physics, Uppsala, Sweden

The present state of development and progress in various areas of materials science is closely related to the understanding of the properties of materials on their length scale. Fe-based ferromagnetic materials with nanocrystalline microstructure revealing excellent soft magnetic properties have been discovered by Yoshizawa in 1988 through controlled crystallization of Fe73.5Cu1Nb3Si13.5B9 amorphous alloys producing a homogenous ultrafi ne grain structure composed of a-FeSi crystallites with grain diameter of 10-15nm embedded in a residual amorphous matrix. The soft magnetic properties is due to the grain size smaller than ferromagnetic exchange length. The present report focuses on the eff ect of Cr substitution for Fe in the Fe73.5-xCrxCu1Nb3Si13.5B9 alloys (x = 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12.5, 15 & 17.5) on the crystallization, structural and magnetic behaviours. The report displays the low temperature magnetization with higher Cr content which are paramagnetic in the initial amorphous state at room temperature. The samples were prepared by melt-spinning technique and heat-treated around the crystallization temperatures. The crystallization and structural behaviour were investigated by XRD and DSC. Magnetization measurements as a function of temperature and fi eld were performed by SQUID magnetometer, VSM and LCR meter. It was found that the thermal stability of the amorphous alloys was enhanced against crystallization with Cr content. The average grain size of Fe(Si) phase decreases under identical annealing condition as Cr content is increased. However, the depression of Tc is observed for the sample annealed at temperature close to the crystallization temperature. The saturation magnetization and the Curie temperature of the amorphous alloys decrease linearly with the increase of Cr content for the entire composition range due to dilution of Fe magnetic moment and weakening of exchange interaction between magnetic atoms. The critical concentration for the onset of ferromagnetism of the studied system has been found to be 24±1 at.% Cr. Higher Cr content amorphous alloys show magnetic hardening at low temperature with the manifestation of divergence between fi eld-cooled and zero fi eld-cooled magnetization. Temperature dependence of magnetization, M(T) of the amorphous alloys in the temperature range, follow the Bloch’s spin-wave theory. Magnetization and Curie temperature of amorphous alloys increase with annealing temperature. However, the depression of Tc is observed for the sample annealed at temperature close to the crystallization temperature. Initial permeability strongly depends on the annealing temperature, which sharply increases with the nanocrystallization of bcc-Fe(Si) phase. An enhancement of initial permeability by two orders of magnitude and a subsequent decrease of relative loss factor have been observed for the optimum annealed samples.

P - 136Application of Nanotechnology for Pharmaceutical IndustryV. Kral1

1Institute of Chemical Technology, Analytical Chemistry, Prague 6, Czech Republic

Medical applications of nano-scale technologies have the potential to revolutionize healthcare by delivering powerful tools for diagnosing and treating disease at the molecular level. The development of a wide spectrum of promising nanoscale materials as a component of multifunctional platforms, is beginning to have a paradigm-shifting impact in medicine; they are changing the foundations of disease diagnosis, monitoring and treatment, and turning molecular discoveries into benefi ts for patients. Research into delivery and targeting of pharmaceutical, therapeutic, and diagnostic agents via intravenous and interstitial routes of administration with particulate drug carriers and nanoconstructs is at the forefront of projects in nanomedicine, but the biological performance of such delivery systems still requires optimization. As of mid-2006, 130 nanotech-based drugs and delivery systems and 125 devices or diagnostic tests are in preclinical, clinical or commercial development. The combined market for nanoenabled medicine (drug delivery, therapeutics and diagnostics) will jump from just over $1 billion in 2005 to almost $10 billion in 2010 and the US National Science Foundation predictsthat nanotechnology will produce half of the pharmaceutical industry product line by 2015. Ironically, crucial questions remain about the health and environmental impacts of nanomaterials that are being used to develop nanomedicines.

Expected result from nanotechnology for Pharma should be lower drug toxicity, reduced cost of treatments, improved bioavailability and an extension of the economic life of proprietary drugs.

Finally, nanotechnology is fi nding new applications in the area of toxin removal. Colloidal dispersions have been demonstrated to remove potentially lethal compounds from the bloodstream, including high concentrations of lipophilic therapeutics, illegal drugs, and chemical and biological agents. Favourable results to this end were achieved using biocompatible microemulsions. These oil-in-water systems have a rapid and effi cient absorption capacity for many target molecules that are frequently overdosed, whether this be intentional or accidental.

NanoMarkets expects the dosing benefi ts of nano-enabled drug delivery systems to be extended to compounds used in treating both infectious disease and cancer, and has identifi ed six types of drug delivery systems in which nanotechnology is likely to have a signifi cant impact.

For injectable drugs, nanotechnology is already generating new dosage forms that are easier to administer, more pleasant for the patient receive and confer a competitive advantage in the marketplace.

Acknowledgements

This work was supported by grants from the Ministry of Education of the Czech Republic - MŠMT 1M 6837805002, LC 512, MSM0021620857, AV0Z50520514, project LC06077 and MSM6036137307 and projects AV0Z50520514 and grant KAN200200651 awarded by the Grant Agency of the Academy of Sciences of the Czech Republic and Grant Agency of The Czech Republic No. 203/09/1311.


179

Posters

P - 137Double quantum wires as main element of forecasted quantum circuitsE. Sheregii1, M. Marchewka1, D. Ploch1

1University of Rzeszow, Department of Mathematics and Nature Science, Rzeszow, Poland

Forecasted applications of DQWs (both Double Quantum Wells and Double Quantum Wires) are related to the quantum computation and quantum circuits [1]. The results of the parallel magneto-transport investigations in the InGaAs/InAlAs/InP Double Quantum Wells structures (DQW’s), are presented in this report. The DQW’s were obtained by MOCVD with diff erent shapes of QW and levels of doping. The layer growth aspect is also considered. The magneto-transport measurements were performed in the wide temperature region (0.5 - 300 K) and at high magnetic fi elds up to 35 T (B perpendicular and current parallel to the plane of the QW). Three types of observed eff ects are analyzed: Quantum Hall eff ect (IQH) and Shubnikov-de Haas oscillations (SdH) at low temperatures (0.5 K - 6 K) as well as Magnetophonon Resonance (MPR) at higher temperatures (77 - 300 K). The beating-eff ect occurred in the Shubnikov-de Haas (SdH) oscillations was observed for all types of the structures at low temperatures in the parallel transport when magnetic fi eld was perpendicular to the layers. An approach to the calculation of the Landau levels energies for these structures taken into account the screening of exchange interaction, was developed and then applied to the analysis and interpretation of the experimental data related to the beating-eff ect. We also argue that in order to account for the observed magneto-transport phenomena (SdH and IQH), one should introduce two diff erent quasi-Fermi levels characterizing two electron sub-systems in the DQW structures, namely: the symmetric states and anti-symmetric ones. These two sub-systems diff er by the symmetry properties of their electron wave functions and are weakly interacting [2]. The Magnetophonon Resonances (MPR) caused by interaction of electrons with few kinds of LO-phonons (belonging to both OW and barriers) were appeared in above-mentioned structures. The removing of screening when the quantum limit is reached in strong magnetic fi elds, is demonstrated in experiments on MPR in DQWs [3]. It means that the two electron sub-systems in DQWs (belonging to symmetric and anti-symmetric states) exist at the room temperatures and can be used in quantum circuits.

References[1] S. F. Fischer, G. Apetrii, U. Kunze, D. Schuh and G. Abstreiter, Nature Physics 2, 91 (2006) [2] M. Marchewka, E.M. Sheregii et al., Physica E, 40, 894, (2008) [3] D. Ploch, E.M. Sheregii et al., submitted to Phys. Rev. B

P - 138Molecular dynamics study of the sintering of Cu nanoparticlesH.H. Kart1, T. Cagin2

1Pamukkale University, Department of Physics, Denizli, Turkey2Texas A&M University, Department of Chemical Engineering, Texas, USA

We have studied sintering processes of two Cu nanoparticles at diff erent temperatures by using molecular dynamics simulation techniques. Two model systems with 4 nm and 10 nm diameter of particles are selected to study the sintering process of the two nanoparticles. Orientation eff ects on the physical properties of consolidation of two nanoparticles with respect to each other are investigated. Temperature eff ects on the consolidation of two nanoparticles are also studied. The order of the values obtained in the simulation for the constant volume heat capacity and latent heat of fusion are good agreement with the bulk results. Moreover, we have investigated size eff ects on the consolidation of two diff erent sizes of nanoparticles, that is, one particle of diameter with 10 nm is fi xed while other one is changing from 1 nm to 10 nm. Melting temperatures of the copper nanoparticles are found to be decreased as the size of the particle decreases.

P - 139Laterally-ordered growth of gallium droplets on silicon substratesM. Kolibal1, M. Bartosik1, J. Mach1, J. Cechal1, D. Skoda1, T. Sikola1

1Brno University of Technology, Institute of Physical Engineering, Brno, Czech Republic

Gallium droplets are now intensively studied as a catalyst for the nanowire growth [1-2] and a potential candidate for phase-changing memories[3]. In our contribution, we will show two diff erent mechanisms for the lateral ordering of gallium droplets on silicon surfaces. First, the selective growth utilizes diff erent sticking coeffi cients on the bare silicon surface and on silicon oxide, formed by local anodic oxidation using a tip of atomic force microscope. Second, the focused ion beam was exploited for the creation of nucleation centers. In both cases, we will discuss optimum experimental conditions under which the perfectly ordered arrays of droplets are formed.

References[1] Chandrasekaran H et. al., J. Phys. Chem. B 110 (2006) 18351.[2] Zardo I. et. al., Nanotechnology 20 (2009) 155602.[3] Soares B. F., et. al., Phys. Rev. Lett. 98 (2007) 153905.


180

Posters

P - 140Guided growth of metallic nanostructures on the native SiO2 locally modifi ed by focussed ion beamJ. Cechal1, O. Tomanec1, D. Skoda1, J. Polcak1, M. Kolibal1, T. Sikola1

1Brno University of Technology, Institute of Physical Engineering, Brno, Czech Republic

We present a straightforward method for the fabrication of patterns of metallic nanostructures. The focused ion beam lithography (FIB) has been used to locally modify a native SiO2 layer on a silicon substrate. On the modifi ed areas the preferential nucleation of metallic islands is observed. The conditions for the island growth on modifi ed areas of diff erent metals (i.e. Co, Cu, Fe, and Ga) are discussed. The deposition has to be carried out at an elevated temperature (300 - 450 °C) since at lower temperatures there are kinetic restrictions for surface diff usion of adsorbed atoms. Further, the temperature has to be suffi ciently low to prevent the diff usion of metallic atoms through the oxide layer and desorption from the surface.

P - 141Novel nano-template technology and its applications to the fabrication of novel photonic devicesM. Heuken1, P.K. Baumann1, K. Forberich2, S. Abbott3, G. Cincotti4, K. Hingerl5, D. Allsopp6, F. Uherek7, V. Boerner8

1AIXTRON AG, Kackertstr. 15-17, 52072 Aachen, Germany2Konarka Technologies, Altenbergerstrasse 69, 4040 Linz, Austria3MacDermid Autotype Ltd, Grove Road, Wantage, Oxon OX12 7BZ, UK4University Roma Tre, Department of Applied Electronics, via della Vasca Navale 84 I-00146 Rome, Italy5Johannes Keppler Universität Linz, Altenbergerstrasse 69, A- 4040 Linz, Austria6University of Bath, Department of Physics, Claverton Down, Bath BA2 7AY, UK7International Laser Center, Ilkovicova 3, 812 19 Bratislava, Bratislava8Holotools GmbH, Wiesentalstr. 29, 79115 Freiburg, Germany

The project goal is to establish and deploy versatile nano-replication technologies based on porous alumina, for manufacturing novel sub-wavelength photonic elements with superior functionalities. The work has been carried out in the frame of the EC funded FP6 project N2T2 (NMP4-CT-2006-017481).

The new production processes bridge two paradigms for nanofabrication, one based on sub-micron semiconductor device fabrication, the other on high-resolution polymer replication methods. The approach of N2T2 is to link together the development of the fabrication technology with nano-photonic sample devices that range from the high volume, low cost application of large area organic solar cell arrays, through advancing GaN LED technology for high effi ciency solid-state lighting, to the nascent, high value added application of photonic crystals-based planar lightwave devices. This fl exibility gives this new technology the potential to become a strategic method for nanofabrication.

The new nano-template technology has been used to improve the functionality and/or the production processes of diff erent sample devices. Organic solar cells via anti refl ecting moth eye structures, GaN based LEDs via the realization of sophisticated, nanostructure based compliant substrates and the fabrication of optical fi bre to chip couplers based on mass produced tapers.

The defi nition of innovative device structures for advanced photonic-crystal devices and quantum dot based LED structures has been supported by intense modelling.

SEM, SIMS and AFM were used for the evaluation and consecutive optimization of the porous alumina formation technology, the nano-imprint technology development and the characterization of the device and moth eye structures.

Outstanding results are a breakthrough in delivering a prototype PET disposable master from a porous alumina template and the usage of moth eye structures in a new class of organic solar cells, resulting in a certifi ed effi ciency above 5.2%, at that time representing the world record performance for organic devices.


181

Posters

P - 142 Synthesis of nanoparticles and doped nanoparticles using novel microwave reactors W. Lojkowski1, T. Chudoba1, E. Reszke2, A. Majcher3, A. Mazurkiewicz3, D. Sibera4, A. Opalinska5, C. Leonelli6

1Institute of High Pressure Physics PAS, Laboratory of Nanomaterials, Warszawa, Poland2Ertec - Poland, , Wroclaw, Poland3Institute for Sustainable Technologies - National Research Institute, Innovation Strategies Team, Radom, Poland4Szczecin Institute of Technology, Faculty of Chermistry and Environment Protection, Szczecin, Poland5Institute of High Pressure Physics PAS, Laboratory of Nanomaterials, Warsaw, Poland6University of Modena, Faculty of Chemical Engineering and Environment Protection, Modena, Italy

Nanoparticles suitable for applications need to must have a narrow and controlled size distribution, be well crystalised (without unwanted amorphous phases or thick hydroxide layers), have a high purity and well controlled chemical composition. The process needs to be environment friendly, non-expensive and suitable for scale up. It needs also to be suitable for nanoparticles fuctionalisation.Safety rules for handling nanoparticles must be obeyed. To meet all these requirements at the same time is a challenge for the technology.

Solvothermal synthesis with the use of microwaves for heating the liquids enclosed in a high pressure vessel permits to fulfi ll all the above requirements. Fast and uniform heating is possible, so that the particle size distribution is narrow and the whole process is short. It is possible to add polymers or other molecules to the reacting liquids and obtain functionalised nanoparticles. The temperature of the process can be tuned in such a way that the particles are highly crystalline. The product is in suspension in a liquid so that risk of contamination of the environment is minimal. The by products are salts with no negative impact on environment.

We will present some reactors designed by our group for the synthesis of nanoparticles. We will also show some examples of nanoparticles produced by us, in particular zirconia doped with lanthanides for photonic applications

P - 143Novel nanohybrid materials based on transition metal complexesR. Romashkina1, E. Beloglazkina1, A. Majouga1, N. Zyk1

1Moscow State University, Chemistry, Moscow, Russia

Nowadays the research on gold nanoparticles is one of the most important topics in chemistry and material sciences. This is mostly due to the versatility of these systems: well-organized nanostructures often display valuable chemical, optical, catalytic, electronic and magnetic properties that are distinctly diff erent from those of their component parts or those of larger mass. One of the most urgent goal of modern nanotechnology is connected with controlled and reversible obtaining of gold nanoparticles ensembles - dimers, trimers and polymers. Such aggregates are expected to present unusual absorption, scattering and electronic properties as contrast both to properties of large aggregates and single particles.

In this work we for the fi rst time off er a novel approach to dimer aggregates based on coordination interaction of ligands, adsorbed on gold surface, with transition metal ions. The main advantage of our technique is that the process of dimer formation is controlled and reversible, such dimer aggregates may be further applied in nanoelectronics for nanoswitchers and nanowires production. We synthesized new organic ligands including benzimidazole group for transition metals coordination and disulfi de fragment, which is responsible for binding with gold. Benzimidazole derivative was fi rstly introduced into the reaction with CuCl2*2H2O to form a complex compound, which was used for citrate nanoparticles modifi cation. This resulted in dimer aggregates formation, which was proved using dynamic light scattering analysis, transmission electron microscopy and UV-vis electron spectroscopy. The average size of dimers was 25 nm, the distance between two nanoparticles - 1.7 nm which corresponds with the data obtained by quantum-chemical calculation. The concentration of dimers reached 60%, which is a result of great signifi cance at present time.

P - 144Fabrication of the spintronic nanostructures by focussed ion beamM. Urbanek1, V. Uhlir1, J. Spousta1, T. Sikola1

1Brno University of Technology, Faculty of Mechanical Engineering, Brno, Czech Republic

By using Scanning Electron Microscope (SEM) combined with Focussed Ion Beam (FIB) a magnetic nanostructures of various shapes and properties have been fabricated under various parameters of the ion beam. Morphology and magnetic properties of the nanostructures were then studied by SEM, AFM (morphology) and MFM, HRPEEM (magnetic properties). Electrotransport properties of the fabricated nanostructures were also studied. Optimal parameters of the ion beam have been found as follows - angle of incidence of the ions 55° from the surface normal and ion current 20 pA. These parameters ensure optimal morphology and minimal impact to magnetic properties of the nanostructures. Maximum allowable current density of prepared nanostructure has been estimated to 103 A/cm2.


182

Posters

P - 145Surface based Coordination Chemistry: The case of the selective grafting of Metal-Organic Radical Open FrameworksV. Mugnani1, M. Oliveros1, N. Roques1, M. Paradinas1, C. Ocal1, J. Veciana1, O. Shekhah2, H. Wang2, C. Wöll2

1Institut de Ciencia de Materials de Barcelona (CSIC), nnmo, Barcelona, Spain2Ruhr-Universität Bochum, Institut für Physikalische Chemie 1, Bochum, Germany

Metal Organic Frameworks (MOFs) are supramolecular networks able to combine in the same material porosity and additional structural, chemical or physical properties. The wide range of possible applications has made the design and synthesis of new MOFs one the most challenging issues for chemists [1]. Moreover, a new dimension in applications opened-up when the construction of MOFs on top of surfaces was achieved: Wöll et al., [2] showed that coordination bonds can be strong enough to successfully anchor diamagnetic organic molecules on top of coordination metal functionalized thiol SAMs.

In our work we demonstrate that it is also possible to use coordination chemistry to graft onto appropriate SAMs paramagnetic molecules, such as carboxylic-substituted polychlorotriphenylmethyl (PTM) radicals. Along the last few years, these organic free radicals have been used as effi cient ligands to build supramolecular magnetic and porous coordination polymers [3]. Thanks to their magnetic character, these molecules allow to enhance the strength of the magnetic interactions between magnetic metal ions and to combine antagonist properties such as magnetism and porosity within the same coordination polymer. Since we demonstrated that both chemisorption and physisorption onto a solid surface allow maintaining the magnetic and electroactive properties of these molecules [4], we proceeded to the grafting onto solid surfaces of extended porous and magnetic MOFs based on tri-carboxylic PTM radicals.

Preliminary experiments to prove the feasibility of this approach were performed using mono-carboxylic PTM derivatives, whose single -COOH function can bond only one metal ion, resulting in a coordination complex grafted to the surface. In following experiments, we also proved the selective growth of the tricarboxylic-PTM coordination polymer. The obtained surface have been extensively studied by diff erent surface techniques, such as SFM, XPS and SPR. The results will be illustrated in detail.

References[1] Maspoch, D., et al., Chem. Soc. Rev., 2007, 36, 770.[2] Shekhah, O., et al.,Langmuir, 2007, 23, 7440-7442[3] Maspoch, D., et al., Nature Mater., 2003, 2, 190; b) Maspoch, D., et al., Chem. Commun. 2005, 5035. [4] a) Crivillers, N., et al., Angew. Chem. Int. Ed. 2007, 46, 1; b) M. Mas-Torrent, et al.,J. Mater. Chem., 2009, DOI: 10.1039/B809875A[6] Shekhah, O., et al.,Langmuir, 2008,24, 6640.

P - 146Step by step approach for the synthesis and growth of metal-organic frameworks (MOFs) thin fi lms on organic surfacesO. Shekhah1, H. Wang1, R. Fischer2, C. Wöll1

1Ruhr University Bochum, Physical Chemistry I, Bochum, Germany2Ruhr University Bochum, Inorganic Chemistry II, Bochum, Germany

A new novel approach for the synthesis of metal-organic frameworks (MOFs) and controlling their growth by using functionalized organic surfaces as templates has been developed. The approach is based on the sequential immersion of the functionalized organic surfaces covered substrates, separately in the organic ligand and then in the metal precursor solutions the [1-3].

The synthesis and growth of diff erent types of MOFs on functionalized substrates (COOH, OH or pyridine terminated) were characterized with diff erent techniques like infrared refl ection-absorption spectroscopy (IRRAS), surface plasmon resonance (SPR), and atomic force microscopy (AFM). All the data showed a linear increase in the thickness of grown layers with the number of immersion cycles. The AFM and the scanning electron microscopy (SEM) results demonstrated also the selective growth of the MOFs layers.

We could also unambiguously demonstrate in the case of [Cu3BTC2(H2O)n] MOF on both COOH and OH terminated surfaces, where the X-ray diff raction (XRD) out-of-plane together with the in-plane data the presence of a highly ordered and preferentially oriented crystalline material, that exhibits the same structure as observed for the bulk compound [2-4]. This was also demonstrated for the case of (Zn (bdc)2(dabco)) MOF on the pyridine terminated surface [4].

The SPR in-situ monitoring of the step- by-step formation of MOFs allows also a novel mechanistic studies for the understating the nucleation and the formation of the secondary building units /SBUs) by investigating the deposition of the chosen primary building blocks separately. In particular, it off ers a convenient method to study the eff ect of chemically diff erent sources for the metal cation as precursors for the SBU

This new route opens up the possibility to synthesize completely new types of MOFs with compositions and structures not accessible by bulk synthesis routes and to quantitatively study the loading properties of MOFs.

References[1] O. Shekhah, H. Wang, S. Kowarik, F. Schreiber, M. Paulus, M. Tolan, C. Sternemann, F. Evers, D. Zacher, R. A. Fischer, C. Woll, J. Am. Chem. Soc. 2007,

129, 15118-15119. [2] O. Shekhah, H. Wang, T. Strunskus, P. Cyganik, D. Zacher, R. Fischer, C. Woll, , Langmuir 2007, 23, 7440-7442. [3] O. Shekhah, N. Roques, V. Mugnaini, C. Munuera, C. Ocal, J. Veciana, C. Wöll, Langmuir 2008, 24, 6640 - 6648. [4] O. Shekhah, et.al . in preparation.


183

Posters

P - 147Nanosized metal-polymer membrane catalyst for hydrogenation processes in aqueous mediumV. Lebedeva1, I. Petrova2, R. van der Vaart3, V. Volkov2, J. van Erkel4, G. Tereshchenko1

1A.V.Topchiev Institute of Petrochemical Synthesis RAS, Laboratory of study of catalytic processes on membranes, Moscow, Russia2A.V.Topchiev Institute of Petrochemical Synthesis RAS, Laboratory of polymeric membranes, Moscow, Russia3Shell Global Solutions International, Shell Global Solutions International, Rijswijk, The Netherlands4TNO, Science and Industry, Apeldoorn, The Netherlands

It is widely known that the palladium shows good catalytic activity in hydrogenation reactions. One drawback in the use of palladium is the high price. To overcome this problem, catalytic nanoparticles have been immobilized on the surface of porous polypropylene hollow fi ber membranes for providing a new type of catalytic membrane reactor.

Ultrapure water, which is essentially water free of contaminants, is required in industries such as semiconductor, pharmaceutical and biotechnology. For the removal of dissolved oxygen to very low levels, catalytic reduction with hydrogen is an attractive method. This work describes the development of a catalytic Pd-loaded polypropylene porous hollow fi ber membrane contactor/reactor for this purpose.

Two methods for the coating of porous polypropylene hollow fi ber membrane have been developed. The virgin and Pd-loaded PP porous hydrophobic hollow fi ber membranes were characterized by dynamic desorption porometry, SEM, EDX, X-ray. The coherent-scattering region (CSR) size is 10-40 nm (the CSR size can be considered as a measure of cluster’s size). Based on the results, it was concluded that reduction of palladium from aliphatic alcoholic solutions is a suitable method for the formation of metallic palladium nanoclusters on the outer surface of porous polypropylene hollow fi ber membranes. For the lab-scale modules, the base porous membranes used were Celgard polypropylene hollow fi ber (Celgard X50) that is being used in the commercially available Liquicel modules from Membrana. The method of palladium coating onto membrane surface was adapted for lab-scale membrane contactor and commercially available Membrana Liquicel contactor (1.4 m2 of membrane surface area), without its disassembly.

In this study the optimal conditions for in-situ coating of membrane contactors were developed. The intermediate step in coating method was changed for coating of membrane modules, because original method damages for packing of contactors. As the palladium salt was used palladium acetate, it allows carrying the coating of modules with shorter time and ambient temperature. The developed membrane contactor/reactor system excludes physical stripping and bubbling of hydrogen in to the water, as well as catalyst regeneration is not needed. The removal of dissolved oxygen from water by catalytic membrane contactor/reactor was studied in a fl ow-through system in both once-through and recirculation mode. The many diff erent conditions (e.g. water fl ow rate, temperatures) of removal of dissolved oxygen from water were used for tested of coated membrane contactor/reactor. The concentration of dissolved oxygen in water was reduced to the sub-ppb level by catalytic reaction.

P - 148Characterization of nanocrystalline ZrO2 doped with Rare-Earth elements synthesized via High Pressure Hydrothermal MethodA. Opalinska1, E.Y.S. Grzanka1, M. Godlewski2, W. Lojkowski1

1Institute of High Pressure Physics, Polish Academy of Science, Warsaw, Poland2Institute of Physics, Polish Academy of Science, Warsaw, Poland

Zirconia is one of the most important ceramic material with useful mechanical, thermal and electrical properties. Nanocrystalline zirconia powders doped with rare-earth (RE) elements have been successfully prepared via microwave hydrothermal process. The microwave driven hydrothermal synthesis permits to precisely control the reaction regime and in consequence provides expected properties of the resulting nanocrystalline powders. Using this method powders with the average grain size 5-10 nm with diff erent dopant (e.g. Eu, Nd, Lu, Gd, Tb) in the range 1 -10 mol% can be obtained.

The aim of this investigation is to evaluate a fundamental characteristics of the nanopowders: grain size, grain size distribution, density, phase composition (relative fraction of the monoclinic and tetragonal phases), lattice parameters for both phases and luminescence properties as a function of element and concentration of the RE dopant in ZrO2 nanopowders.


184

Posters

P - 149Optical absorption modeling of the copper carbon composite nanolayer based on the plasmonic eff ects of metallic nanoparticle chainA. Kokabi1, S. Saeedi1, M. Hosseini2, A. Moftakharzadeh1, T. Ghods-Elahi2, M.A. Vesaghi2, M. Fardmanesh1

1Sharif University of Technology, Department of Electrical Engineering, Tehran, Iran2Sharif University of Technology, Physics Department, Tehran, Iran

The infrared range optical absorption mechanism of Carbon-Copper composite thin layer coated on the Diamond-Like Carbon (DLC) buff er layer has been investigated in this work. This is done by considering weak interactions between copper nanoparticles in their network, which is modeled using their coherent dipole behavior induced by the electromagnetic radiation. The copper nanoparticles in the bulk of carbon are modeled as a chain of plasmonic dipoles, which have coupling resonance. Considering nearest neighbor interactions for this metallic nanoparticles considered as nanosphere chain, surface Plasmon resonance frequency (ω0) and coupled plasmon resonance frequency (ω1) have been computed. Using ω0 and ω1, the damping rate versus wavelength is derived and they have been applied to the derivation of the optical absorption spectrum. The dependency of the absorption peaks to the particle-size and the particle mean spacing is investigated. The absorption spectrum is also measured for diff erent Cu-C thin fi lms with various Cu particle size and spacing. The measurement results of some fi lms are compared with the obtained analytical ones.

P - 150Vacuum deposition of nanoparticles - A practical technology for nanofabricationA. Kean1, L. Allers1

1Mantis Deposition Ltd, Nanotechnology, Thame, United Kingdom

Nanoparticles may be generated using several techniques including chemical precipitation and physical vapour condensation. Once created the nanoparticles may be deposited by various schemes to produce functional nanomaterials. Such techniques provide challenges such as the control of nanoparticle size, surface contamination and thin fi lm deposition. This paper describes a scalable and practical technique which allows the generation of nanoparticles in vacuum and is known as ‘terminated gas condensation’. The technique has already been used to great eff ect in collaboration with academic and industrial partners. The nanoparticles are singly and negatively charged thereby allowing electrostatic manipulation such as mass spectrometry and control over their kinetic energy by providing a potential gradient between source and substrate. As the source material is thermalised at a relatively high pressure before being refi ned through two apertures the resulting nanoparticle beam carries no signifi cant heating to the substrate. The process has been developed to allow effi cient usage of source materials as well as the ability to coat relatively larger areas for production trials. We will describe the process and present mass spectroscopy data as well as nanoparticle characterisation by atomic force microscopy.


185

Posters

Poster Session 5 - Horizontal activities

P - 151Issues concerning the consequences of the application of emission mitigation measures and mercury utilization stipulated in EU strategy on mercuryV. Daescu1, E. Holban1

1The National Institute for Research and Development in Environmental Protection, politics environment strategies and waste management, Bucharest, Romania

Background

In 2002, The European Commission has submitted a Report to The European Council and Parliament, on the mercury generated as a result of various activities.

Consequently, it was required the elaboration of a strategy in order to present the measures which must be udertaken for protecting the human health and for preventing the environmental mercury pollution, along all „the life cycle”, by taking into account the production, utilization, treatment, as well as the waste generated by various activities. The Strategy is a landmark document for The European Community involvment in the international debate on mercury, which was held on february 2005 within UNEP managing board.

ObjectivesThe strategy has the following goals:Mercury emissions mitigation.Reduction of mercury spread within the community by limiting/stopping the demand/supplyLong-run solution of the mercury surplus and mercury accumulation within the community (still used products or stocks containing mercury).Prevention of mercury exposure.Improvement of mercury awareness issue and fi nding solutions concerning the mercury pollution mitigationSupport and stimulation provided to the local initiatives in the mercury fi eld.

Practical applicationThis inquiry campaign has provided many usable data in the impact assessment issue included in EU Strategy concerning mercury impacts on the Romanian socio-ecological system. A total number of 920 of companies have been notifi ed.As a result of these responses, 305 companies have stated that they use, consume, market or are liable for the mercury emissions.

ConclusionTaking into acount the performs tests recomandation and conclusion have been drawn up and they will be herein after presented in this study.

P 152“Sustainable Economy”: a good governance model for EU policy-making on nanotechnologyM. Bonazzi1

1European Commission, DG RTD Unit nano- and converging S&T, Brussels, Belgium

Overall, this paper has examined how sustainable economy can provide insights for good governance EU policies on nanotechnology. For doing this, the various dimensions of development i.e. techno-economic effi ciency, environment and equity, initially explored as independent, have been integrated into an holistic approach to address sustainable economy, due to their the mutual interdependencies. An integrated policy model for good governance has been proposed, promoting the simultaneous achievement of these dimensions of development, being concurrently viable, bearable and fair. In particular, the importance of incorporating and responsibility in the model has been highlighted, stressing this element as a priority for future research on good governance. Clearly, this model is applicable to various policy areas other than sustainability, and has therefore been proposed as a valuable tool to help shaping future EU policy-making leading towards good governance in nanotechnology.


186

Posters

P - 154Project NANOTOTOUCH: Nanosciences Live in Science Centres and MuseumsL. Kampschulte1, P. Hix2, U. Kernbach3, W. Heckl4

1Deutsches Museum, ZNT, München, Germany2Deutsches Museum, Research Institute, München, Germany3Deutsches Museum, MEP, München, Germany4Deutsches Museum, GD, München, Germany

The NANOTOTOUCH project aims to create innovative environments for the broad public to learn about and to discuss nano research by directly involving the actors of research themselves. We do this by taking the laboratory environment and the research work out of enclosed academic campuses and relocating them right in the midst of the public in science museums and science centres.

Three science museums and three science centres will closely cooperate with local university partners to create three permanent Open Nano Lab locations (in Munich, Milan and Gothenburg) and three Nano Researcher Live areas (in Mechelen, Tartu and Naples). In these places the visitors will experience “live” the day-to-day practices and processes of nano research conducted by young scientists.

This peer-to-peer dialogue on an equal basis between lay public and nano-researchers not only creates a bidirectional feedback, it also minimises the expert-to-lay bias (“top-down” approach) inherent present science communication processes with authoritative top researchers. In order to prepare the young scientists for this novel method of communication, NANOTOTOUCH also includes a strong communication skills training component.

NANOTOTOUCH will also establish new role models for choosing science as a career: young adults thinking of entering science will be able to discuss various aspects with young researchers who themselves made this decision recently, whilst upcoming researchers will learn that communication is a self-evident part of their professional identity.

Thus, NANOTOTOUCH pushes science communication to its extreme, merging communication and research in a powerful way and responding to the need for more transparency and accessibility in science. Furthermore, the strong synergetic network approach of the project enables contents and models to be developed for further distribution and implementation in educational and scientifi c communities.

P - 155The ActionGrid Project: Synergy between Biomedical Informatics and NanomedicineF. Martin Sanchez1, S. Barriuso1, J. De la Barrera1, E. De Andres1, L. Salamanca1, S. Benítez2, V. Maojo3

1Instituto de Salud Carlos III, Medical Bioinformatics Department, Madrid, Spain2Hospital Italiano de Buenos Aires, Medical Informatics Department, Buenos Aires, Argentina3Universidad Politecnica de Madrid, Artifi cial Intelligence Laboratory, Madrid, Spain

The development of Nanomedicine and a new and improved generation of medical devices and treatments need advancement in information technology and computer science areas to integrate it with existing and developing biomedical data sources to improve healthcare.

Over the past 50 years, Informatics has made important contributions to the study of data across the entire spectrum and levels of biocomplexity and many disciplines that contribute to informatics in biomedicine actually overlap. Public Health Informatics addresses information arising from populations, Medical Informatics focuses on the individual, Imaging Informatics works with tissues and organs, Bioinformatics deal with molecular and cellular processes, and the new and growing discipline of Nanoinformatics involves information relevant to the nanoscale science and engineering community. It is expected that it will provide the methods and tools needed for facilitating collaborative research and development in this area. Some examples of the contribution of Informatics to Nanomedicine are: -Databases for nanomaterial characterization (nanotubes, dendrimers, nanowires , scaff olds for growing cells, vectors for drug delivery), -Ontologies for the management of knowledge on platforms, analytes, applications and diseases, -image processing tools, - computational simulation and modelling environments.

In this way, ACTION-GRID represents the fi rst European Commission project that addresses the synergy between Nano and Biomedical Informatics (BMI) based on Grid capabilities in Latin America, the Western Balkans, North Africa and the European Union (EU).This support action includes among its main objectives: -surveying Grid-based, Biomedical and Nano Informatics initiatives, - developing an inventory of Grid/Nano/BMI methods and services (resourceome), -fostering training and mobility in Grid, BMI and nanoinformatics, -developing a White Paper in collaboration with a panel of recognized experts in these fi elds and disseminating the results.

The main objective of ACTION-Grid is acting as a multiplier of previous outcomes in Grid, Nano and BMI. ACTION-Grid will disseminate these outcomes in the mentioned regions and plans to explore the implications of these new engineering and scientifi c possibilities and directions in developing future research agendas for BMI, Grid and the nanoinformatics areas, particularly at the European level. The expected impact is to expand previous initiatives to create a common health information infrastructure in Europe, and extending it to other regions. It will enhance cooperation between research centers, universities, hospitals, SMEs, public entities, and others. ACTION-Grid will expand the impact of EC achievements in Grid , BMI and nanoinformatics to researchers, educators, and health practitioners world-wide.


187

Posters

P - 156NHECD: Creation of a critical and commented database on the health, safety and environmental impact of nanoparticles ? Challenges and objectivesA.M. Lemor1, O. Maimon2, B. Abel2, R. Korenstein2, F. Rossi3, H. Krop4, P. van Broekhuizen4, H. Wittig1

1tp21, GmbH, Saarbrucken, Germany2Tel Aviv, University, Tel Aviv, Israel3Joint Research, Centre Ispra, Ispra, Italy4Environmental and Occupational Health, Research Institute, Amsterdam, The Netherlands

The majority of electronic knowledge repositories (e.g. databases) currently existing worldwide in the fi eld of health, safety and environmental impact of nanoparticles focus mainly on what can be named metadata. Moreover, those repositories are manually operated, thus, allowing only a limited amount of data being processed, and utilize a rather unsystematic taxonomy and ontology in the documents categorization and information extraction processes.

NHECD aims at building a public sustainable system including knowledge repository on the impact of nanoparticles on health, safety and the environment. The system will include a robust content management system (Documentum) as its backbone, to hold unstructured data (e.g. scientifi c publications). It will also include a mechanism for automatically updating its documents repository, thus enabling the creation of a large and on growing collection of published data on these subject matters. The repository will be harmonized to be compatible at the metadata level with existing databases.

NHECD will be based on text mining methods and algorithms that will make possible the transition from metadata (e.g. author names, keywords) to the data itself, and the extraction of pertinent information from large amount of documents. A systematic domain model of concepts and terms that will support the categorization of published papers and the information extraction process will be developed within this project. Particular (probably domain-specifi c) zoning and text mining algorithms will be applied to reach the defi ned goals.

The unique features of this database will allow diff erent user groups - scientists, public representatives and general public - to easily access and retrieve information relevant to their needs. The creation of the NHECD knowledge repository will enrich public understanding of the impact of nanoparticles on health and the environments; will support a safe and responsible development and use of nanotechnology; and will represent a useful instrument for the implementation of relevant regulatory measures and legislation.

P - 157Study on Synthesis nanocrystalline Mg matrix composite reinforced with Mg2Cu intermetallic phase & investigation on properties and powder morphologyM. Hemmatikia1, P. Abachi1, E. Salahi2, A. Karbalaei Kashani1, A. Vafadar1

1Sharif University of Technology, Department of Materials Science and Engineering, Tehran, Iran2Materials and Energy Research Center (MERC), ceramic deprtment, Karaj, Iran

In the present work nanocrystalline Mg matrix reinforced with Mg2Cu intermetallic phase was synthesized by mechanical alloying of elemental Mg and Cu powder mixture with composition of Mg-6.4%wt Cu .X-ray diff raction (XRD) and scanning electron microscopy (SEM) used to study diff erent milling stage. Result shown that after 60h of milling, Mg2Cu peaks could be seen and Cu peaks disappeared. It was determined that Mg matrix has Average crystallite size of about 50nm and also composite powder has smaller grain size than pure Mg after 60h milling time. The density of the loose milled powders was measured using a helium pycnometer in diff erent milling time. SEM observation showed that powder morphological changed from fl ake-like shape in initial stages of milling to refi ned powder particle in the fi nal stages. Result of Vickers microhardness test showed that composite powder has higher hardness than pure Mg in equal milling time.


188

Posters

P - 158The NanoSost Project: information processing in the context of nanosafety F. Martin Sanchez1, S. Barriuso1, J. de la Barrera1, E. de Andrés1, L. Salamanca1, J. Campos2, M. Calderón3, J. López de Ipiña4

1Instituto de Salud Carlos III, Medical Bioinformatics Department, Madrid, Spain2Swiss Insitute of Safety and Security, Process Safety Department, Barcelona, Spain3AENOR, General Management, Madrid, Spain4LEIA, Logistic safety and innovation area, Álava, Spain

Nanotechnology is an emerging technology in which risks and side eff ects are not completely evaluated. Nowadays, nanoparticle exposure is restricted to laboratories and corporate research installations staff . Although the current population aff ected is not high, it is thought that there will be a rapid development of nanotechnological applications in the short to mid term period. This technological innovation is not necessarily followed with the knowledge of associated risks, and studies about the properties and risks of nanomaterials show the need for new measurement and protection systems.

The NanoSost (“Towards a sustainable, responsible and safe Nanotechnology”) project has been funded by the Ministry of Science and Innovation of Spain and has as its main objective to create the knowledge necessary to establish the scientifi c bases that guarantee the safe use of nanoparticles.

The structure of the project is based on seven subprojects to tackle all aspects related with safety use of nanoparticles, from the development of safer processes for the synthesis of nanomaterials to the development of good practice guides for the handling of nanotechnology in the laboratory. The subprojects are Characterization, Metrology and generation of references, Chemical risks, Toxicological risks, Evaluation of the risk, Control of the risk, Materials for barrier uses, Technical bases for the management of the risk.

This last subproject has as its main goal the development of a methodology that describes a risk management system of nanoparticles that guarantees a permanent level of security, protecting workers and consumer health and avoiding harm to the environment. AENOR (Asociación Española de Normalización y Certifi cación), Fundación LEIA (Centro de Desarrollo Tecnológico), Swiss Institute of Safety and Security and Instituto de Salud Carlos III (ISCIII), are the partners collaborating in this subproject.

A Handbook establishing good practices dealing with nanosafety, based on the information provided by the other subprojects will be written. It will be a point of reference in this area in Spain covering gaps of contrasted information available at this time.

The Medical Bioinformatics Dept. of the ISCIII (BIOTIC) has developed, to become part of the Handbook, a catalogue of resources in nanoinformatics and nanosafety distributed in several categories such as legal rules and reference documents, networks, institutes and relevant initiatives, news sources, congresses, standardization, article reviews, education, nanoinformatics (tools, software, data and knowledge bases), magazines and news. These resources are provided by BIKMAS 2.0, an informatics system developed by BIOTIC, that provides an effi cient and fl exible way of retrieving, aggregating and organizing the information found in the web 2.0 about nanotechnology. All are included in the platform LIVELINK (informatics system for the management of documents and information of AENOR) that is continuously updated to supply cutting edge contents to a planned referenced website in Spain on this matter.


189

Posters

P - 159Chemical and morphological characterization of nanoparticles/nanostructures using vibrational spectroscopy, atomic force microscopy and scanning electron microscopyM. Clupek1, V. Prokopec1, J. Cejkova2, A. Kokaislova1, M. Vyskovska1, P. Matejka1

1Institute of Chemical Technology, Analytical Chemistry, Prague 6, Czech Republic2Institute of Chemical Technology, Chemical Engineering, Prague 6, Czech Republic

The proper nanostructures, including nanoparticles, have been recently used for many chemical analytical applications. They can be used in separation processes, electroanalytical and spectroscopic methods as well in miniaturization of chemical devices like analytical sensors.

Nanomaterials of coin metals (Au, Ag, Cu, etc.) possess the eff ect of surface plasmon resonance that enhances electromagnetic fi eld in the vicinity of nanoparticles. This eff ect causes an enhancement of spectral intensities of the analytes adsorbed on the surface of nanostructures. Surface plasmons of nanostructured materials of these metals can oscillate at frequencies in the visible and near-infrared regions of electromagnetic spectrum. Therefore they are suitable for use with both visible and near-infrared excitation wavelengths, which are commonly used in vibrational spectroscopy (especially surface-enhanced Raman spectroscopy, SERS). An essential factor which infl uences the enhancement is the surface morphology on the nanoscale. An optimization of preparation procedures of nanomaterials should be used to tune the frequency of plasmon resonance and to maximize the increase of spectral intensities of analytes.

Diff erent techniques can be used to prepare metal nanomaterials as well as to fi x analytes in the vicinity of their surface. Several specifi c groups of compounds (e.g. thiols) have the ability to create the self assembled monolayers on the surface of fabricated nanomaterials. The self-assembled monolayers can play a crucial role in chemical recognition which is the essential step of sensing and separation analysis.

Hence, one of the main goals of our experimental work is the optimization of both preparation and measurement conditions for the combination of factors like diff erent analytes, diff erent excitation wavelength and types of metal nanomaterials. Commonly used techniques for the characterization of the morphology of surface nanostructure are atomic force microscopy (AFM), which is ideal for quantitative geometrical measurements on nanometer scale, evaluation of surface roughness and for visualization of surface topography, and scanning electron microscopy (SEM), which is suitable for particle size characterization. SERS spectra provide us with the chemical information about species on the nanomaterials. They enable monitoring of modifi cation processes on the nanostructured surface.

We develop a methodology based on combination of all above mentioned techniques for characterization of metal nanomaterials covered by several groups of organic compounds which are important from the point of view of bioanalytical application. The future goal is a development of quantitative methods, based on the selective response of tested nanostructures for diff erent types of excitation, which will be applied for the characterization of the nanomaterials, especially nanoparticles.

Financial support of Czech Grant Agency (grant GACR 203/09/0675) is gratefully acknowledged.

P - 161Research of nanostructured materials in SlovakiaJ. Dusza1 1Structural Ceramics, IMR SAS, Kosice, Slovak Republic

The presentation is an overwiev concerning the research activities in the nanomaterials research in Slovakia supported by diff erent national grant agencies in the following areas: • development of ceramic nanocomposites on the base of polymer precursors and ceramic nano composites strengthened by CNTs and CNFs

with excellent combination of their properties; • development of lightweigt alloys based on amorphous - quasicrystalline microstructure with improved structural stability up to 400 °C and

with strength at least 300 MPa at 300°C; • development of hard and superhard (hardness > 40 GPa) nanocomposite PVD coatings based on Ti and W by understanding relationships

between their microstructure and mechanical properties; • design of an eff ective structure of un-superconductive nanoparticles in the monocrystalline or textured superconductive matrice; • ex-situ syntesis of nanoparticles innert again the superconductive matrix; • synthesis and characterization of new systems of magnetic nanoparticles based on TM and RE metals as well as semiconductors, controlled

fabrication of 1-, 2- and 3-dimensional structures based on such nanoparticles; • development of new types of nanocomposite thin fi lms containing semiconducting and metallic quantum dots together with the proposal of

their applications; • development of new types of biomaterials based on biodegradable polymers with the addition of bioactive inorganic nanoparticles (calcium

phosphates) and nanofi bres (based on biopolymers); • preparation and characterization of nanoparticles, nanocrystaline semiconductors, nanowires, nanotubes (CNTs) and nanofi bres (CNFs); • preparation of nanoobjects (nanoparticles, nanocomplexes) with polymer network for basic building blocks for intelligent nanomaterials for

targeted drug delivery.

The supporting mechanisms are described and the most important results are summarized.


190

Posters

P - 162Kazakhstan initiative of development of nanoelectronics on hybrid spintronic and quasi-biological baseI. Suleimenov1, G. Mun2, A. Polyakov3, G. Yeligbayeva4

1Institute of Power Engineering and Telecommunications, Department of Telecommunications, Almaty, Kazakhstan2Kazakh National University, Department of Chemical Physics & Macromolecular Chemistry, Almaty, Kazakhstan3Physico-Technical Institute, Department of Spectroscopy, Almaty, Kazakhstan4Kazakh National Technical University, Department of Chemistry, Almaty, Kazakhstan

Nowadays the Government program of development of nanotechnology is forming in Kazakhstan. Development of nanoelectronics aimed to creation of computing devices having nanoscale logical elements is important part of the program.

Discussion of main ideas forming the basis of mentioned part of the program is the purpose of present report.

It is known well that biological systems have the highest density of information recording. Nevertheless, spin-spin interactions give possibility to reach the highest velocity of information processing. Hybrid systems, which have some distinguishing features of biological molecular structures on the one hand and spin-based electronics on the other hand, are able to demonstrate both mentioned above advantages, as it is shown in present report.

Such hybrid systems may be synthesized on the base of hydrophilic macromolecules that form complexes with single-atom magnets (atoms of iron, manganese, etc.). Using of macromolecules with changeable conformation gives possibility to realize quantum shutters due to possibility of variation of distance between neighboring single-atom magnets connected with polymer chain under the infl uence of external signal. Using of copolymers gives possibility for variation of spatial distribution of atomic magnets. The fact allows creation of logical elements on the base of separate fragments of macromolecule, as it is shown in present report. One should underline, that formation of complexes on the base of some biopolymers (fi broin, etc.) gives possibility to synthesize high-ordered systems due to self-ordering of such macromolecules. The fact is of importance for creation of set of logical elements, which are connected with each other. Molecular adder is one of most important examples of such structures.

Kazakhstan initiative of development of nanoelectronics as whole includes next items.

Development of hybrid elements on the base of semiconductors and hydrophilic macromolecules; such elements are proposed to use as adapters transferring usual electric signal into quantum-level one.

Development of principles of acting of molecular-level logical elements; such principles previously were considered in [1].

Development of methods of information recording in interpolymer complexes having single-atom magnets it their structure; information recording by structures on the base hydrophilic interpolymer are prototypes of such methods.

Development of methods of molecular programming of systems of nanoelectronics and spintronics and corresponded mathematical apparatus; the fi rst step of methods of molecular programming was made during investigations of complicates hydrophilic copolymers having diff erent functional gropes reacting to diff erent external infl uences.

Thus, hybrid systems on spintronic and quasi-biological base should be considered as perspective way of development of nanoelectronics as whole; main part of Kazakhstan scientifi c organizations involved in nanotechnological investigations plan to concentrate eff orts namely in this way.

References[1] Ergojin E.E., Zezin A.B., Suleimenov I.E., Mun G.A. Hydrophilic polymers in nanotechnology and nanoelectronics (in Russian), Almaty - Moscow,

2008


191

Posters

P - 163Optical spectroscopic methods as unique tools for characterization of chemically modifi ed metal nanoparticles and nanostructures P. Matejka1, M. Clupek1, P. Rezanka1, L. Veverkova1, K. Zaruba1, M. Vyskovska1, V. Prokopec1, H. Korenkova1, A. Kokaislova1, V. Kral1

1Institute of Chemical Technology Prague, Dept. of Analytical Chemistry, Prague 6, Czech Republic

Chemically modifi ed metal nanoparticles are used widely in many analytical applications (spectroscopy, electrochemistry, chromatography, electrophoresis etc.) considering their physical and chemical properties. Nevertheless, any assembly of nanoparticles and nano-structured materials has to be characterized using an extensive set of analytical methods both from the morphological and chemical point of view. The optical spectroscopic methods represent very powerful and relatively cheap tools to provide comprehensive information on nanoparticle assemblies. Although the methods analyze macroscopic systems of large number of nanoparticles, detailed information on nanoscale can be achieved.

Firstly, the ultraviolet (UV) - visible transmission spectroscopy provides information on metal nanoparticles themselves. Very detailed information can be obtained especially for the coin metals (Au, Ag, Cu) which nanoparticles exhibit frequently a surface plasmon resonance (SPR) in the visible region. The SPR curves are given primarily by the optical properties of nanoparticles that are characteristic for individual metals. For freshly prepared nanoparticles their size can be derived from the position of maxima of SPR curve. The shape of SPR curve is aff ected by the size distribution, eff ects of inter-particle interaction (aggregation processes), presence of inorganic salts in the surroundings, and fi nally by the deposition of organic molecules on the nanoparticle surface. We demonstrate that the presence and moreover the concentration of both inorganic salts and organic molecules in the systems can be estimated using multivariate chemometric analysis of the whole range of UV-visible spectra.

Secondly, the near-infrared (NIR) transmission spectra can confi rm or exclude the aggregation of nanoparticles. Furthermore, our results show that a detailed analysis of spectral data for chemically modifi ed nanoparticle assemblies (after the subtraction of reference - “blank” spectra) provide us with information on the molecules deposited on the surface of nanoparticles.

Thirdly, specifi c information on molecular modifi cation of metal nanoparticles can be obtained from the mid-infrared spectra measured using the attenuated total refl ection (ATR) technique. The SEIRA (surface-enhanced infrared absorption) spectra are relatively weakly enhanced, but we can demonstrate that the spectral information is complementary to the fourth optical spectroscopy mentioned.

Fourthly, the surface-enhanced Raman spectroscopy (SERS) possess exceptionally giant enhancement of spectra which correspond to molecular species located in the vicinity of nanoparticle surface. Besides detailed information on the structure/orientation parameters of the chemically modifi ed assemblies of nanoparticles, the eff ects related to metal SPR can be obtained form the sets of spectra measured at diff erent excitation wavelengths.

Financial support of Czech Grant Agency (grant GACR 203/09/0675) is gratefully acknowledged.

P - 164Processing and spectroscopic characterization of Vycor glass - BaTiO3 nanocomposite P. Vanek1, D. Nuzhnyy1, J. Petzelt1, R. Krupkova1, K. Jurek2, V. Studnicka3

1Institute of Physics ASCR v.v.i., Department of Dielectrics, Prague 8, Czech Republic2Institute of Physics ASCR v.v.i., Department of Structure Analysis, Prague 8, Czech Republic3Institute of Physics ASCR v.v.i., Department of Metals, Prague 8, Czech Republic

Processing and characterization of various BaTiO3 (BTO) nanocomposites is of great interest, mainly in order to study their dielectric properties and size eff ect of ferroelectricity. This is a hot topic in connection with the present miniaturization of electronics. Here we report on processing and spectroscopic characterization of Vycor glass - BTO nanocomposite by a sol-gel technique.

Vycor Brand Porous Glass 7930 (Corning, density 1.5g/cm3, porosity 28 vol.%, pore diameter 4-7 nm and length ~30 nm, 96-98% SiO2) was used as the matrix. The matrix was repeatedly (21x) soaked by BTO sol in Schlenk vessel under dried nitrogen and annealed in air at 600°C (1hr heating, 1hr dwell, slow free cooling of the furnace to 250°C, rapid cooling after removing from the furnace). Higher annealing temperature cannot be used because the nanoporous structure of the Vycor glass could be damaged. The BTO sol was prepared from Ti-ethoxide, Ba-methoxyethoxide, acetylacetone as modifi er and methoxyethanol as solvent. The concentration of Ti and Ba in sol was 0.227M. After the 21st cycle the pyrolysis of organics was slowed down substantially, therefore the soaking - annealing procedure was stopped. It is obvious that complete fi lling of the Vycor pores cannot be achieved by this procedure. The concentration of BTO in the sample was 32 mass%, 42% of the pore volume was fi lled (determined by weighing, supposing BTO density of 6.02g/cm3). Powder X-ray diff raction showed amorphous-like structure. The results of electron probe microanalysis were in a relatively good agreement with the desired composition.

The polar phonon properties of confi ned BTO were studied by FTIR refl ection and time domain THz transmission spectroscopy. The resulting spectra of the composite as well as pure Vycor glass were fi tted with a standard factorized form of the dielectric function for generalized damped harmonic oscillators and compared with the model eff ective dielectric function of the composite assuming bulk polar phonon spectra of the BTO nanoparticles and using the data of pure Vycor. Two model functions were calculated using the Bruggeman and Lichtenecker formulas for the dielectric response of the composite. From comparison of the fi tted and modelled polar phonon spectra, a possible size eff ect in BTO nanoparticles is discussed.


192

Posters

P - 165NanoSost, towards to a sustainable, responsible and safe nanotechnologyJ. Sempere1, R. Nomen1, E. Serra1, M. Grillo1, J. López de Ipiña2, C. Vaquero2, F. Balas3, M. Arruebo3, J. Santamaría3

1Institut Quimic de Sarria IQS-URL, Ingenieria Quimica, Barcelona, Spain2Fundación LEIA CDT, Seguridad Industrial, Miñano (Alava), Spain3Universidad de Zaragoza-Instituto de Nanociencias de Aragón (INA), Nanoparticulas e interfases nanoestructuradas, Zaragoza, Spain

Background The potential of Nanotechnology is becoming a reality in the form of new materials with innovative and, in some cases, amazing characteristics. Nowadays this is a technological area of a fast growing number of consumer products, currently with more than 700 in the market. Moreover, new diagnosis systems with extremely sensitive and specifi c properties, highly selective and effi cient chemical catalysts, drug carriers able to recognize their targets, and others, are just some examples of Nanotechnology. Nevertheless, what is still unknown is its eff ects on the health of people, environment, and industrial installations.

Nanoparticles sized lower than 100nm have special characteristics which singularize their toxic potential, catalytic eff ects, fi re or explosion hazards against those of similar chemical composition, but in larger sizes. Moreover, when inhaling a lower size of particles it is predicted that they could pass through the human respiratory tract, the dermis, and are capable to pass through impassable barriers. Therefore it is important to establish the basis for assessing these risks.

Objective NanoSost (PSE-420000-2008-3) is being funded by the Spanish Ministry of Science and Innovation, and aims at the creation of knowledge, and setting the scientifi c basis to guarantee the safe use of the engineered nanoparticles. The investigation covers the fi nal products, and total life cycle up to their elimination, in benefi t of the sustainable industrial development in line with social considerations. It has been divided into seven subprojects (SP) as follows:

SP 1 will do the synthesis and characterisation of various types and sizes of engineered nanoparticles, measuring them under conditions which mimic those of the industrial processes. Its outputs will be a list of references which will be the starting point to assess the chemical and toxicological risks. SP 2 will create the knowledge needed to set specifi c techniques to asses and control the potential risks coming from the increased chemical reactivity. SP 3 will investigate the mechanism underlying nanoparticle toxicity and provide information leading to a proposal for the establishment of a diagnosis-assay to detect them in the human body. SP4 will focus on the study and modelling of nanoparticles behaviour in the atmosphere. SP 5 will create knowledge of how to control risks by proposing measurement and monitoring protocols. SP 6 will focus on protection and prevention systems in the stages of research, development, scale up of process, production, recycling, and disposal. New materials to prevent contamination by nanoparticles will be developed, as well as trials to measure the effi cacy of the existing materials. SP 7 will use the results obtained by the rest of the working groups in order to prepare a manual for risk management.

The consortium Members belong to 21 Spanish organisations drawn from universities, technological centres, and industrial companies.

P - 166Spectroscopic characterization of nanostructured surfaces at molecular levelJ. Mielczarski1, J. Dong2, E. Mielczarski1

1Nancy -University/CNRS, LEM, Vandoeuvre les Nancy, France2University of Alberta, Chemical and Materials Engineering, Edmonton, Canada

In situ, label-free qualitative and quantitative evaluations of adsorbed sub-monolayers and multilayers of protein Concanavalin A on hydrophobic solid surfaces were carried out by the use of refl ection infrared spectroscopy. Infl uence of pH and adsorption time on the composition and structure of the adsorbed protein layers were investigated by comparison of the experimental spectra with simulated spectra of hypothetical multilayer systems with the assumed composition, thickness, and structure. This methodology allows diff erentiation of observed spectral changes that result from pure optical eff ects, associated with passing of incident beam through multilayer system, from the chemical and structural changes caused by physicochemical interactions of protein with solid surface. The applied methodology provides a deeper insight of structure and composition of the adsorbed layers at molecular level. The composition, structure, kinetics of the adsorption of Concanavalin A and hydration level of the adsorbed layers were evaluated in detail.


193

Posters

P - 167Investigation of nanostructure intermetallic ordered Fe3Al wear behavior A. K. Kashani1, E. Salahi2, K. Pourazarang1, A. Kh. Vafadar1, A. K. Kashani3, M. Hemmatikia4

1Sharif Univeristy of Technology, Materials Science & Engineering, Tehran, Iran2Materials and Energy Research Center, Materials Science & Engineering, Karaj, Iran3Islamic Azad University, Mine Engineering, Mahallat, Iran4Sharif Univeristy of Technology, Materials Science & Engineering, Materials Science & Engineering, Iran

Iron aluminide nanostructures have attracted considerable favor as high oxidation and sulfi dation resistance that have good prospects as high-temperature structural applications requiring excellent oxidation resistance. Room temperature dry-sliding research has been conducted on nanostructure intermetallic Fe3Al compound. Pin-on-disk dry-sliding wear test was performed on Fe75-Al25 samples. These samples were mechanically alloyed for 60 h in an argon atmosphere and followed by uniaxially hot-pressing in a graphite die. Scanning electron microscopy, X-ray diff ractometry and optical microscopy were employed to study surfaces of the samples. The dry-sliding wear rates were compared with characterized wear-resistant materials. It was seen an increase in the wear rate of nanocrystalline structure iron aluminide with increasing sliding rate and perpendicular applied load. Also a decrease in wear rate of iron aluminide was found with increasing sliding distance.

P - 168Study programmes in nanotechnology at Technical University of OstravaJ. Trojkova1

1VSB Technical University of Ostrava, Institute of Physics, Ostrava, Czech Republic

VSB - Technical University of Ostrava off ers a Bachelor of Science and a Master of Science degrees in Nanotechnology since 2007. The related study programmes, their structure and academic background are introduced here.

The Bachelor of Science degree programme takes three years. The lectures and tutorials are designed to provide the students a solid foundation in mathematics, physics, chemistry, and selected areas of nanotechnology as well as a broad overview of the entire area of nanotechnology and nanoscience. Within extensive practical training the students attain experience and skills necessary to work as a team members at research centres or in a commercial environment. They are also well prepared to go on to the Master of Science degree programme.

The standard length of study in the Master of Science degree programme is two years. All the students acquire more insight into the electronic structure of materials, their optical and magnetic properties, advanced experimental methods of study and characterization of nanomaterials, and their computer design. The students can further choose from two specializations, which are closely related to research activities of the two guaranteeing departments.

The physical direction, guaranteed by the Physics of Nanostructures Section of the Department of Physics, focuses on the applications of nanomaterials and nanotechnologies in optoelectronics, photonics, integrated optics, magnetic recording, spintronics, and sensors. The chemical direction, guaranteed by the Nanotechnology Centre, is aimed at preparation of

nanomaterials for applications in catalysis, photocatalysis, sorption and degradation of organic pollutants, nanocomposites as protective layers, photofunctional and antibacterial nanocomposites.

The graduates will have interdisciplinary intellectual capacity and knowledge to work in research and development oriented commercial subjects in the ever-expanding world of nanotechnology. Some of them are also expected to continue in PhD programmes and make their career in academia.

Both the programmes are accredited in Czech and in English. Not only during their studies the students can benefi t from our long-time cooperation with other academic and scientifi c institutions and industry from the Czech Republic and worldwide, and they can participate in national and international research projects.


194

Posters

P - 169Communication outreach in nanotechnology: focus on young audiencesM. Bonazzi1

1European Commission, DG RTD Unit nano- and converging S&T, Brussels, Belgium

From a general point of view, “Nanotechnolgy” is the new frontier of technology in Europe and in the world: nanotechnology is the development and application of materials and processes at the nanoscale - the scale of individual molecules. Nanomaterials are particles, tubes, membranes and other materials measured in nanometres. Nanotechnology encompasses the scientifi c principles and properties of nanoscience, that can be understood and mastered when operating in the nanoscale domain, and applies them at technology level. Some nanotechnology applications have already emerged and many others are under development. Together, they are expected to impact the life of every citizen, perhaps as much as other technologies as electricity and electronics have done over the last century. However, as in any other fi eld, some nanotechnology applications may be harmful as well as benefi ts. Therefore, informing and engaging the public about nanotechnologies are essential for the responsible development of this new frontier: as nanotechnology is mainly projected in the future, it is expected to involve young people, thus communicating to them is a priority. In fact, this early stage of development, when just a few applications have reached the market: therefore this is a critical moment for potential communication on nanotechnology. In fact, outreach, open dialogue and debate are declared to be key elements of the European approach to science and technology, where nanotechnology takes a very special place. In fact, information, communication and fostering societal debate on nanotechnology have already become integral constituent of many European policy initiatives. Therefore, this paper will demonstrate that: (i) communication on nanotechnology is critical for Europe and particularly European institutions, and (ii) young audiences are a priority. In this light, this paper will fi nally contribute to identifying how nanotechnology can be eff ectively communicated to young audiences.

P - 170Communicating nanotechnology to European youthY. Rothschild1

1ORT Israel, Moshinski R&D Center, Tel Aviv, Israel

NANOYOU will design and undertake a communication and outreach program in nanotechnology (NT) aimed at European youth. The project will reach 11-18 year olds through school programs to take place in at least 20 EU Member States and Associated States. Additional programs aimed at young adults aged 19-25 will be off ered in science centres. The school programs are planned to involve at least 400 schools and reach more than 25,000 students. The science centres program is expected to reach an initial 4,000 young adults during NANOYOU and many more subsequently as more science centres adopt the program.

Recent surveys show that most European citizens have poor understanding of NT, its potential and risks. This needs to be rectifi ed if the European public is to contribute positively to future decision-making about the use of NT. In focusing on ages 11-25, NANOYOU recognizes that eff ective programming needs to be tailored to the educational capabilities and interests of the target population. Programming specialization will be provided for subgroups within this youth population. While some FP6 programs have made an excellent start in informing the public about NT, they have not focused on youth nor have their activities taken places in the schools.

NANOYOU will combine temporary exhibitions, innovative computer games, experiments and other online content, with workshops aimed at promoting dialogue that will raise participants’ awareness of ethical, legal and societal aspects of NT. NANOYOU’s content will be balanced and up-to-date, and teacher training materials will be prepared to equip science teachers and other personnel to present the NANOYOU programs.

NANOYOU has assembled a strong consortium with partners experienced in nanotechnology, educational methodology and science communication, as well as organizations highly suited and experienced at arranging outreach/communication activities in schools and science centres.


195

Posters

P - 171Characterizing the cluster-nature solvent features of single-wall carbon nanohornsF. Torrens1, G. Castellano2

1Universitat de Valencia, Institut de Ciencia Molecular, Valencia, Spain2Universidad Catolica de Valencia San Vicente Martir, Instituto de Medio Ambiente y Ciencias Marinas, Valencia, Spain

Background.The existence of single-wall carbon nanotubes (SWNTs) in organic solvents, in the form of clusters, is discussed. A theory is developed based on a bundlet model for clusters, describing the distribution function of clusters by size.Objectives.The main objective is to perform a comparative analysis between the droplet model for fullerene clusters, the bundlet model for SWNT clusters and the model for nanocone clusters.Methods.The phenomena have a unifi ed explanation in the bundlet model of clusters, in accordance with which the free energy of an SWNT, involved in a cluster, is combined from two components: a volume one, proportional to the number of molecules n in a cluster, and a surface one proportional to n1/2. The bundlet model for clusters enables describing the distribution function of SWNT clusters by size. The droplet model is formally analogous to the one for fullerene clusters.Results.From purely geometrical diff erences the models predict diff erent behaviours. Single-wall carbon nanocones (SWNCs) of various disclinations are investigated via energetic and structural analyses. Several SWNC?s terminations are studied, which are diff erent amongst each other because of the type of closing structure and the arrangement of them. The SWNC packing effi ciencies, and interaction-energy parameters, are intermediate between the ones of fullerene and SWNT clusters; an in-between behaviour is expected. However, SWNC properties are calculated closer to those of fullerene and more distant from those of SWNT.Conclusion.(1) Close packings are the tightest way to pack spheres. Atoms and fullerenes being nothing but tiny spheres often arrange in this way. Furthermore it is also possible to deduce atomic structures of metal alloys, salts and oxides by fi tting the voids of close-packed spheres. Several criteria have been selected to reduce the analysis to a manageable quantity of packing properties and objects, from the enormous set of equal objects. The former ones refer to three properties: packing closeness, packing dimension and packing effi ciency. For the dataset employed in this study, we found that a model can reliably predict a packing object’s property, if the object is suffi ciently similar in structure to the group of objects used to generate that model. The two-step approach, involving object clustering and property prediction, provided an effi cient way to assess the reliability of a model’s prediction. (2) The single-wall carbon nanocone/nanohorn packing effi ciencies, and interaction-energy parameters, are intermediate between those of fullerene and single-wall carbon nanotube clusters. Therefore an in-between behaviour is expected. However, the single-wall carbon nanohorn properties are calculated closer to those of fullerene and more distant from those of single-wall carbon nanotubes.

P - 172Molecular modelling in design and characterization of functional nanostructuresP. Capkova1, T. Tokarsky1

1Technical University of Ostrava, Nanotechnology Centre, Ostrava, Czech Republic

Molecular modeling - molecular mechanics and classical molecular dynamics - using empirical force fi eld represents very effi cient tool in nanomaterials design, which enables the structure characterization and properties prediction for large supramolecular systems, where the diff raction analysis fails due to the lack of 3D periodicity. Molecular dynamics helps in understanding the dynamical processes (sorption, diff usion, phase transition…etc.) and in prediction of thermal and mechanical properties. The main task in supramolecular chemistry is the search for the optimum host-guest combination, the analysis of the host-guest interaction and consequently the estimation of the capability of complexation, the structure and stability of supramolecular system. Thanks to the simple concept of the empirical force fi eld one can get results useful for technology with “reasonable accuracy in reasonable time”, anyway the strategy of modeling in this case is quite crucial. Modeling strategy, which includes the generation of starting models, choice of the force fi eld, the strategy of energy minimization (the boundary conditions, fi xed and variable structure parameters, the search for the global energy minimum, etc.) must be based on available experimental data.

In our research team the strategy of modeling has been worked out for the following fi elds in nanomaterials design:

Supramolecular structures like: various intercalated layered structures, inclusion compounds, liquid crystalline polymeric systems, nanocomposites based on surface modifi cation of various crystalline matrices, where the modifying species were nanoparticles of metals, metal oxides and sulfi des and organic molecules, organometalic complexes, etc.

Study of diff usion kinetics, sorption, of the phase transitions mechanism in molecular crystals and phenomena on the phase boundaries.

All these results of modeling have been used in technology of preparation of nanomaterials with a large scale of practical applications and for the understanding of the structure-properties relationship in the following cases:

Sorbents for organic pollutants in water,

Catalysts, photocatalysts and chemical sensors

Nanocomposites polymer-layer silicate, nanocomposites with fl uorescent dyes

Antibacterial nanocomposites,

Drug carriers and study of conformational behavior of drug molecules

Liquid crystalline polymers

Phase transitions in coco-butter

In the end it should be emphasized that the reliable results can be achieved only by the close cooperation of modeling with experiment (IR, NMR spectroscopy, X-ray powder diff raction).


196

Posters

P - 173Electrochemical deposition of iron group metals in porous siliconV. Kashkarov1, A. Lenshin1, E. Domashevskaya1

1Voronezh State Universtiy, Physics, Voronezh, Russia

Morphological structure of porous silicon makes it possible to introduce diff erent materials inside the pores including various metals. A lot of metals in this case get some new properties that are not peculiar for the bulk state. Iron group metals can be deposited into porous layer only electrochemically.

The aim of the work was to obtain Fe and Co clusters in sub-microporous silicon under electrochemical deposition. Porous silicon was obtained by electrochemical etching of Si (100) doped with phosphorus with a resistivity of 0.3 Ohm * cm. Etching was performed in solution of fl uoric acid in isopropyl alcohol under natural lighting. The current density was of 15 mA/sq.cm. Thickness of porous layer was of 10 ?Ým while porosity was of 75-80%. After that the samples were rinsed in distilled water and immediately arranged to aqueous solution of Fe or Co sulphates and soaked for 20 minutes. Metal deposition was performed 1 mA/sq.cm. for 20 minutes and solution was acidifi ed with sulphuric acid up to pH = 2-3. After that the samples were again rinsed and dried in air.

The investigated samples were analyzed by scanning electron microscopy, soft X-ray emission spectroscopy (depth of analysis ~ 12 nm) and X-ray absorption spectroscopy (depth of analysis ~ 5 nm). Rather large pores in the sample of pure por-Si were observed to grow perpendicular to the sample surface with a lot of smaller pores of less than 100 nm in diameter in [111] direction. According to X-ray spectroscopy data silicon in porous layer is present in the form of crystalline phase, disordered crystalline Si and imperfect oxide SiOx. Under iron deposition the surface of the pores and interpore space is covered with a uniform deposit. Unlike of iron, cobalt deposition resulted in appearance of discontinuous fi lm on the surface while deep inside of pores with a diameter of 50-200 nm the clusters are formed.

Analysis of X-ray emission and absorption spectra demonstrated that the surface of porous layer after the iron deposition became less oxidized. Deep inside the pores iron can interact with the pores surface forming iron silicates of variable composition. Iron in por-Si sample is oxidized and it can be represented by a mixture of iron oxides. Unlike of iron cobalt did not really interact with the surface and penetrated inside the pores more readily than iron. It consisted of metallic cobalt and Co2O3. It is interesting to note that Co deposition was accompanied by a partial enhancement of silicon oxide in the surface layers of the sample.

It was found that under iron deposition photoluminescence intensity of por-Si was enhanced by an order of magnitude and it remained stable for a long time (~ 10 months) unlike of pure por-Si, while under Co deposition photoluminescence was slightly reduced.

Thus, iron group metals can be successfully deposited inside por-Si. Iron can form silicate-like bonds on the surface of pores. Cobalt penetrates inside the pores and exists in the form of metallic cobalt and cobalt oxide. Moreover, iron enhances and stabilizes por-Si photoluminescence, while cobalt is accumulated inside the pores and forms separate clusters.


197

Posters

P - 174Integrated NanoScience Platform for Ireland - INSPIREP. Miney1, D. O’Brien1, J. Boland1, R. Whatmore2, E. Magner3, G. O’Connor4, L. Barry5, H. Byrne6, K. Dawson7, G. Huyet8, J. McLaughlin9, R. Bowman10

1Centre for Research on Adaptive Nanostructures and NanoDevices (CRANN), Trinity College Dublin (TCD)2Tyndall National Institute, University College Cork (UCC)3Materials and Surface Science Institute (MSSI), University of Limerick (UL)4LightHOUSE Centre for Applied Photonics, National University of Ireland, Galway (NUIG)5Research Institute for Networks and Communications Engineering (RINCE), Dublin City University (DCU)6FOCAS Institute, Dublin Institute of Technology (DIT)7Centre for BioNano Interactions (CBNI), University College, Dublin (UCD)8Photonics Device Group (PDD), Cork Institute of Technology9Nanotechnology & Advanced Materials Research Institute, University of Ulster (UU)10Centre for Nanostructured Media, Queens University, Belfast (QUB)

Introduction:Nanotechnology has been identifi ed as a key discipline around which Ireland will establish and sustain its knowledge economy. Ireland has all the key elements required to thrive and succeed in this competitive discipline - world class-research, signifi cant industry activity and well organised national infrastructure. We have a proven track record of publishing research in the highest impact journals. Nature Nanotechnology recently determined Ireland was ranked 6th globally for impacts of nanoscience research as measured by citations (2006, 1, 81). Ireland is home to many of the worlds largest and most innovative companies across a range of sectors including ICT, Biomedical Sciences and Biopharma, and Food. These sectors are dependent on nanotechnology to enable improvements in their products, processes or services. In recent years Ireland has successfully focussed on leveraging its signifi cant research investment by estalishing shared infrastructure programmes linking all the major nanoscience research activities on an all-island basis. All of these required components for national success are contained within the INSPIRE consortium, an all-island nanoscience consortium with eight institutional partners in the Republic of Ireland and two in the Northern Ireland. INSPIRE now provides an opportunity to interface in an integrated manner Ireland’s nanoscience research activity with Europe. This paper will describe nanoscience activity in Ireland and highlight the key lessons learnt in establishing a nanoscience infrastructure network.

Activities:Ireland has focused on three areas where an integrated inter-institutional approach would provide the best return on national investment. The fi rst was the establishment of a shared national infrastructural capability in the areas of microscopy, photonics, electronic materials, and bionanosciences serviced eff ectively by trained support staff . This open access infrastructure enhances the national capacity for delivering innovative research for both academia and industry. The second area was the establishment of an internationally leading national graduate programme which would succeed in attracting the best students internationally. The fi nal element was the development of eff ective research collaborations across all leading universities and ultimately internationally, across institutions and disciplines.

Conclusions:Ireland’s establishment of a national nanoscience programme has raised the level of research carried out, resulting in scientifi c outputs having greater impact internationally. It has greatly improved both the training facilities for our graduate researchers and the reputation of Ireland as a place to carry out science. Finally, it has enabled increased collaboration across research institutes and with industry, enabling the generation of economic return. We believe this approach has value on a European scale.


198

Posters

P - 175A National Framework Planning for The Development of Nanotechnology in IranA.M. Soltani1, S. Sarkar2

1Allama Tabatabai University, Management of Technology, Tehran, Iran2Tehran University of Medical Sciences, Research Center for Science and Technology in Medicine, Tehran, Iran

In view of the vast applications and implications of nanoscience and nanotechnology, policy-makers in diff erent countries are interested in drawing a comprehensive policy to manage and support all activities in the innovation cycle from science to market in this fi eld. They intend to materialize the vision and the national goals through incentives in each activity. In this paper by reviewing the fi rst period of the national plan for nanotechnology in Iran and the functions of National Innovation Systems, a new framework is presented to classify all activities into six sections as follow:1. promotion of public awareness2. science and technology infrastructures3. science and technology push4. technology transfer and diff usion5. production and market6. policy and evaluation

Each section is divided into a total of thirty activities. For increasing public awareness, activities such as k-12 educational programs, encouraging mass media and information dissemination are introduced.

The science and technology infrastructure is comprised of national laboratory network, standardization, safety, intellectual property, international collaborations, nanometrology and regulatory issues. In the section of science and technology push, the activities are supporting post graduate research, encouraging researchers to be innovative and to contribute in science production and to promote setting up human resources training programs. For the section of technology transfer and diff usion, activities such as supporting incubation centers, encouraging companies to absorb and to incorporate nanotechnologies in their existing products, venture capital investment and techno market are planned. The activities of production and market include nurturing companies to produce nano-products and to market these products at local and international marketplace. Finally in the section of policy and evaluation, activities such as programs’ evaluation, institutional evaluation and ranking, priority setting are planned as well as monitoring the position of the country at global level.

Each activity needs to have an action plan and the percentage of the governmental budget for each section is determined in each period (one or several years).

The implementation of the national framework showed that this framework off ered a transparent system for the government to support activities and to evaluate the outputs.

P - 176TIME for Nano - Tools to Increase mass Engagement in NanotechnologiesG. Maglio1, A. Zanazzi1

1Fondazione IDIS-Citt? della Scienza, Science Centre, Naples, Italy

A large consortium of science centres in Europe with artists and social scientists have joined their eff orts to engage the general public, with a special attention to young people, on benefi ts and risks related to nanoscale research, engineering and technology, through specifi c informal education products, namely the nano-kit and the organisation of a web contest in the next two years. many relted events will be organised for the public with scientists and opinions and feedbacks from the participants will be collected. The nano.kit and web constest will use an inquiry-based learning approach, specifi cally developed in science centres/museums, where people understand by doing. The nano-kit will contain small exhibits, nano-objects and materials, scripts for experiments and card games. It is a tool for stimulating the participation of youngsters in the nano-olympics and for engaging in debate scientists, stakeholders and the public in general. The web platform will be a resource centre and an attractor for the whole community of N&N communicators, through its contents (continuous addition of new information etc), its innovative tools ( web contest) and the artistic approach, the online feedback collection.

The web contest will engage groups of young people, from 8 to 14, and from 14 to 18, in the preparation of projects based on dialogue and creative languages and expressing their perception about risks and benefi ts linked to nanotechnologies in society.

A great added value of the project is that of “growing” a community of people engaged in N&N communication, through the realisation of training courses in each of the participating Science Centres (at national level) and by Ecsite (at European level) intended to reach a number of at least 450 multipliers (experts working in outreach and education eff orts), carefully chosen among three main groups: explainers in science centres and PhD students in science communication; teachers from primary and high schools. The public participation to the web-contest is ensured by the organisation of many events in science centres of 9 countries each year: launch event, nano days, fi nal event with award prizes, intended as occasions for informing/educating, on one hand, and for engaging youngsters, collecting perceptions and opinions, on the other.


199

Posters

P - 177Fabrication of bulk nanocrystalline magnesium matrix composite by mechanical alloying process and hot press consolidationM. Hemmatikia1, E. Salahi2, P. Abachi1, A. Vafadar1, A. Karbalaei Kashani1

1Sharif University of Technology, Department of Materials Science and Engineering, Tehran, Iran2Materials and Energy Research Center (MERC), ceramic deprtment, Karaj, Iran

In this study fabrication of bulk nanocrystalline Mg matrix composite prepared by mechanical alloying and hot pressing were investigated. Mg and Cu powder mixture were milled by a planetary ball mill and then hot pressed (HP) in a uniaxial die. After 60h of milling, Mg2Cu peaks revealed in X-ray pattern as an intermetallic reinforced phase in magnesium matrix and Cu peaks disappeared. Hot pressing of 60h milled powders were done in diff erent pressure and temperature to get fully dense bulk nanocrystalline magnesium alloy. Scanning electron microscopy (SEM) and X-ray diff raction (XRD) were used to structural characterization. Compressive test reveal that the nanocrystalline Mg composite exhibit higher strength than pure Mg.

P - 178The nanoBasque StrategyI. Campillo1

1nanoBasque Agency, nanoBasque, San Sebastian, Spain

On December 3 2008, the Department of Industry, Trade and Tourism of the Basque Government launched the nanoBasque Strategy in the framework of the Basque Science, Technology and Innovation Plan 2010. The nanoBasque Strategy is an initiative designed to develop a new economy sector enabled by nanotechnology. It sees nanoscience and micro and nanotechnologies as instruments that can stimulate the transformation and diversifi cation of the Basque business environment. The nanoBasque Strategy is an open and integrating approach made up of vectors an initiatives that covers three main areas of action, namely: company, knowledge an Society. It sets itself the purpose of creating a new model of relations in which both national and international companies, scientifi c, technological, political and social agents are involved. The expected result is an effi cient and integrating ecosystem of innovation that is clearly aimed at the market, based on the cooperation between all parties, where knowledge is both input and result, talent the most precious asset of all, and with the involvement of the entire Basque society. The nanoBasque Strategy strives to boost Basque companies and research agents’ presence on international nanotechnology initiatives and markets. The assessment of the nanoBasque Strategy’s degree of progress will be set by a means of a combination of metrics in terms of productivity, capacity to diversify the industry fabric, competitiveness and the openness of the Basque nanotechnology ecosystem. Five hundred and fi fty million euros are expected to be mobilized in the 2009-2015 period, with a proportion of public funding of 52% on the total funding.

The launch of the nanoBasque Strategy has been accompanied by the creation of a dynamic support agency, the nanoBasque Agency, with the mission of coordinating and managing the development of the Strategy.


200

Posters

P - 179New international activities in relation to nanotechnologyM. Vomastkova1

1Department of Environment Hazards, Ministry of Environment, Prague, Czech Republic

Nanotechnology is an enabling technology that is expected to result in major changes across many industry sectors and to contribute to novel materials, devices and products. Nanotechnologies and manufactured nanomaterials, as any new technology, may bring many advances to society and benefi ts for the environment, but also pose new challenges in health, environment safety (HSE) and possible impacts on society. Because of the very broad range of potential applications using nanotechnology and the wide variety of characteristics displayed by manufactured nanomaterials, detailed discussion of both benefi ts and heath and environmental risks should take place at the level of individual nanotechnology applications. Rapid growth of nanotechnology includes possible infl uence on health and environmental risks. Nanotechnology and manufactured nanomaterials have to be considered not only as a chemical industry issue rather than an issue also related to other industrial sectors (textile-, paint-, coating-, metal-industry), if not all.

It has been known for many decades that inhaled particles cause damage to lungs and also to the lining of arteries. Recent research has shown that majority of the damage appears to be caused by the smallest particles. Classical toxicology examines eff ects of single molecules on living systems. We have known about the properties of bulk materials for a long time. However the space in between, when bulk materials are transformed into very small particles of just a few hundred atoms, leads to changes in their physical and chemical properties. That is the reason why manufactured nanomaterials are of interest for many applications however we are only just at the beginning to understand how nanomaterials eff ect human health and the environment.

Currently available data prompt conduct us to determine rules of conduct for production with nanomaterials. Therefore OECD has established two working parties. Working Party on Manufactured Nanomaterials (WPMN), which aims to promote human health and environmental safety implications of manufactured nanomaterials in order to assist in their safe development (limited to mainly the industrial chemicals sector) and Working Party on Nanotechnology (WPN). Its aim is to look at the responsible development and use of nanotechnology and the potential benefi ts nanotechnology can bring to society, taking into account public perceptions related to advances in nanotechnology and its convergence with other technologies, without forgetting legal, social and ethical issues.

At present, existing chemical legislation in force is also applied to nanomaterials. European Commission (EC) is currently working a regulatory inventory covering EU regulatory frameworks that are applicable to nanomaterials (chemicals, worker protection, environmental legislation, product specifi c legislation etc.). REACH (Regulation (EC) No 1907/2006) attempts to cover nanomaterials as bulk materials. Moreover, there is a work on European standards, regulatory and technical guidance documents may have to be adapted in order to cover HSE risks in relation to nanomaterials. EC has also determined a decisive criterion whether a nanomaterial is a new or existing substances.


201

Posters

Poster Session 6 - Late abstracts

LP-01Improving energy generation technologies for residential application through nanotechnologiesS. Carosio1, I. Paspaliaris2

1D’Appolonia S.p.A., Research & Innovation Division, Genova, Italy2School of Mining and Metallurgical Engineering, National Technical University, Athens, Greece

More than 40% of the total energy consumed in the EU is used to cover the needs for heating, cooling and electricity of buildings. As the major part of this energy is produced from combustion of oil and natural gas, both the EU and the EU Building’s Sector are highly dependant on imported fossil fuels. Moreover, the Sector is also a major contributor to Green-House Gas (GHG) emissions. To address issues concerning EU security of energy supply, EU contribution to climate change and in line with the Kyoto protocol and ongoing discussions in the European and International community, the EC has set the objectives of 30% reduction of its GHG emissions by 2020 and 20% increase of the share of renewable energy. The Building’s Sector has to signifi cantly contribute to the realisation of these objectives too. As such, the trend for the Building’s Sector is to move from fossil fuels based energy production to the use of Renewable Energy Sources (RES) and green fuels to produce the required energy to cover the building’s energy needs.

Within this framework, and within the vision of moving to a hydrogen-based economy, energy production exploiting hydrogen as a chemical energy storage means is becoming increasingly interesting. This paper reports about the H2SusBuild project, co-funded from the European Community’s Seventh Framework Programme (FP7/2007-2013) under Grant Agreement No. NMP2-LA-2008-214395, dealing with the development of a self-sustained and zero CO2 emission hybrid energy system to cover electric and thermal energy needs of buildings or districts of buildings. The poster integrates RES, water electrolysis and fuel cells for the hydrogen-based generation of electricity and heat. Moreover, since fuel cells do not guarantee suffi cient coverage of the thermal energy requirement, a further portion of the heat is provided by novel hydrogen burners. Though, in order to enhance current technologies for water electrolysis and hydrogen burning, effi ciencies need to be improved through the aid of nanostructured catalytic coatings.

LP-02HYDROMEL - Hybrid ultra precision manufacturing based on positional and self-assemblyA. Steinicker1

1CSEM - Centre Suisse d’ Electronique et de Microtechnique S.A., Alpnach, Switzerland

The integrated project HYDROMEL aims at developing a technology platform for new versatile 3D ultra precise automated production systems. Manufacturing of complex micro-devices is targeted. Based on ultra precision robots improved by the innovative knowledge-based self-assembly technology, this groundbreaking combination will participate in the massive production of high-added value strategic and emerging micro-products.

The combination of positional assembly - where objects are mechanically manipulated and positioned one by one - and self-assembly (autonomous organization of components into patterns or structures without human intervention) - where objects arrange themselves into ordered structures by physical or chemical interactions- off ers a new and fl exible production concept permitting the development of a fully innovating hybrid automated tool for assembly of micro-products at an industrial scale.

Thanks to the fl exibility of the process, HYDROMEL will be capable of meeting requirements in wide range of applications and, as a consequence, dynamize existing markets and open new ones to generate employment. Increase of European competitiveness in the following strategic markets will be targeted: mechanics, electronics, biological engineering, microfl uidics and IT.

Relying on the latest scientifi c developments in robotics and self-assembly, HYDROMEL’s academic, R&D and industrial partners will enable the availability of a hybrid/self-assembly technology in Europe at an industrial scale. The innovative approach will push Europe as leader in the fi eld of high added value micro-products manufacturing.

HYDROMEL is an integrated European project with 22 contributing partners. The FP6 project started in October 2006 and lasts 48 months. Having passed the mid-term event end of the last year important milestones have been reached. A variety of systems and tools for high-precision robotics have been developed. Those will be combined with self-assembly mechanisms. Diff erent self-alignment principles have been developed based on switchable surface or hierarchical self-assembly. A proof of concept of the technologies has been achieved. The upcoming project phase will focus on industrialization of the technologies and on demonstration of their benefi t in selected demonstrator setups.


202

Posters

LP-03Assembled Structures of Semiconductor Nanocrystals and Polymers for PhotovoltaicsA. Berlin1, G. Zotti2

1Consiglio Nazionale delle Ricerche, Istituto di Scienze e Tecnologie Molecolari, Milano, Italy2Consiglio Nazionale delle Ricerche, Istituto per l’Energetica e le Interfasi, Padova, Italy

BackgroundHybrid systems consisting of inorganic nanoparticles and organic compounds became an interesting research topic in recent years. The integration of nanoparticles into polymer matrixes has attracted substantial research eff orts directed to the development of hybrid materials for new catalytic, electronic, and optoelectronic applications.

Inorganic nanocrystals (NCs) such as cadmium selenide (CdSe-NCs) are a very interesting class of low-dimensional, semiconducting materials. The integration of inorganic semiconductor nanoparticles and organic polymers leads to composite materials of facile synthesis through consolidate polymerization route with interesting physical properties and important potential applications. Particularly interesting is the employment of semiconductor QDs in solar cells.

ObjectivesFor a preliminary approach to structures of conjugated organics connecting semiconductor particles for improved charge transport, we have undertaken the direct preparation of layer-by-layer structures of CdSe-NCs and polymers. In our study we have used colloidal, monodisperse, amine- and oleate-capped CdSe quantum dots produced by the hot-injection route as a well-established approach to generating nanoparticles in an organic solvent. Polymers used as linkers are acid-based, pyridine- and amine-based polymers.

Methods and ResultsMono and multilayers build up was monitored by means of UV spectroscopy and electrochemical measurements.

Generally the layer growth is linear, regular and strongly dependent on the nature and branching of the functional group of the polymer.

The electrochemical analyses of the fi lms evidence a progressive shift of the oxidation potential with the layering and the presence of two oxidation peaks at a higher number of layers, which could be ascribed to the oxidation of the outer and inner CdSe units in the nanocrystal, respectively.

Photoconductivity determinations have shown that the pyridine moiety is blocking in all cases. Carboxylic acids are a medium photoconductor whereas the sulfonate and phosphonate spacers are the best.

ConclusionsWe have prepared a fi rst generation of hybrid structures consisting of strongly luminescent semiconductor nanocrystals and organic polymers. These results off er favourable perspectives for the synthesis of similar materials with semiconducting organic polymers, which could fi nd applications in the fi eld of hybrid organic-inorganic light-emitting diodes and solar cells.

LP-04Wastewater treatment by Phanerochaete chrysosporium pretreated for Pb(II) nanoparticles productionM. Fazilati1, H. Dastjerd2

1Isfahan university of technology, agricaltule, Isfahan, Iran2Nanozistfanavar ApadanaCo., Isfahan, Iran

The biosorption of Pb(II) nanoparticls from wastewater by Phanerochaete chrysosporium, a fi lamentous fungus, were examined as a function of initial pH, temperature treatments and initial metal concentration..At fi rst biomass was inactivated by formaldehyde cross-linking and subsequent boiling in alkaline for 45 min,Therefor was used in the determinationof optimum conditions.The biosorption of Pb (II) had the optimum adsorption conditions in common, which were the solution pH 4.5, temperature 27 °C.and initial concentration of pb(II) nanoparticls 50 mg l−1, could reach 12.41 mg g−1. The eff ect of initial metal concentration on the biosorption capacity of P. chrysosporium¸.At the solution pH 4.5, temperature 27 °C was investigated.With increasing initial metal concentration biosorptiob increased until initial concentration of metal nanoparticles ,becoming saturated at 400 mgl-1 , subsequent with increasing initial metal concentration decreased biosorption capacity. The biosorption data obtained under the optimum conditions were well described by the Freundlich isotherm model. The results indicated that P. chrysosporium is a suitable biosorbent for the removal of Pb(II)nanoparticles from aqueous solution.


203

Posters

LP-05Surface species of copper-iron spinel catalysts in dimethyl ether steam reformingK. Faungnawakij1, N. Viriyaempikul1, R. Kikuchi2, K. Eguchi3

1National Science and Technology Development Agency, National Nanotechnology Center, Pathumthani, Thailand2 The University of Tokyo, Department of Chemical System Engineering, Tokyo, Japan3 Kyoto University, Department of Energy and Hydrocarbon Chemistry, Kyoto, Japan

Well-crystallized spinel CuFe2O4 in tetragonal phase is obtained by calcination at 900 oC of the cubic CuFe2O4 prepared via a citrate sol-gel method. Composites of CuFe2O4 spinel and gamma-Al2O3 were investigated for catalytic production of hydrogen from dimethyl ether steam reforming (DME SR). X-ray photoelectron spectroscopy coupled with Auger electron spectroscopy (AES) showed Cu1+-rich surface species (Cu1+/Cu0 = ca. 3/2 with negligible Cu2+) over the calcined CuFe2O4 subjected to in situ H2 reduction. The spinel-oxides with lower content of reducible Cu species possessed higher amount of Cu1+ species under the reducing atmosphere, corresponding to higher DME SR activity. Copper clusters highly dispersed in the matrix of iron oxides were reduced from the spinel structure, and the strong interaction between them should result in the high activity and durability.

LP-06Low temperature thermo chemical compression of hydrogen using metal nanoparticlesJ. Rogut1, M. Wiatowski1, K. Svoboda2, M. Steen2, D. Baxter2, Z. Szafran3, V. Harrison2, J. Grabowski3

1Glowny Instytut Gornictwa, Energy Saving and Atmosphere Protection, Katowice, Poland2 Institute for Energy, JRC EC, Petten, The Netherlands3 Glowny Instytut Gornictwa, Waste Management, Katowice, Poland

Various pure metals generate hydrogen when in contact water or steam. When reacting zero-valent iron with liquid water in a closed space, pressures of gaseous hydrogen up to hundreds of bars could be achieved under thermodynamically favorable conditions. Due to kinetic restrictions this process is of no practical value at ambient temperatures when carried out with standard forms of metals. Based on the work of Bergius in high pressure technologies (Nobel prize in 1931) hydrogen generation-compression using the iron-water system at elevated temperatures has been applied at large scale for the production of synthetic fuels during World Word II. Nowadays, hydrogen production using the iron - steam processes is carried out at high temperatures (> 800 o C), requiring the use of expensive construction materials. Therefore they only aim at hydrogen generation and do not include compression.

Mechanical compression of gaseous hydrogen to the pressures required for storage in tanks for mobile or stationary applications consumes a substantial part of the energy contained in the original fuel. Standard hydrogen compressors are rather complex and expensive units, especially in small scale application. Further development of the hydrogen economy could benefi t a lot from the availability of low cost, fl exible and simple thermo-chemical generation - compression systems, especially when driven by low value waste heat. Present thermo-chemical compressors for hydrogen exploit expensive solid metal hydrides sensitive to impurities. The most advanced systems are working in cycles exploiting the thermal swing mode. Other compressor designs use electrolysis of water at high pressures to deliver dense gaseous hydrogen.

This contribution presents the experimentally proven novel concept of low temperature thermo-chemical compression of hydrogen using water slurries of nanostructured iron and iron containing nanocomposite for integrated generation-compression of hydrogen. Laboratory tests have confi rmed that in contacting reactive forms of nano-dispersed metallic iron with hot, compressed water a continuous stream of compressed gaseous hydrogen at pressures as high as 15 MPa is generated. The process can be performed at temperatures as low as 180°C. Moreover, reuse of the exhausted (oxidized) iron reagent after drying to powder and reducing back to nano-metal form using hydrogen or CO atmospheric pressures and at remarkably low temperatures (below 500°C) has been demonstrated. It is worth noting that these results were obtained without the use of any catalysts.

The work has been conducted at GIG in the frame of PBZ-KBN-117/T08/2005 Project: “Materials and technologies for hydrogen economy” funded by the Polish Government and at the IE JRC European Commission in the frame of the Exploratory Research ”Nanotechnology in energy applications”


204

Posters

LP-07Inverse gas chromatography in reactivity studies of nanostructured ironJ. Rogut1, D. Nowak2, M. Ludwik Pardala2, A. Spychalowicz2, M. Wiatowski2, A. Tokarz2, J. Grabowski3, Z. Szafran3

1Institute for Energy, JRC European Comission, Petten, The Netherlands2Glowny Instytut Gornictwa, Energy Saving and Atmosphere Protection, Katowice, Poland3Glowny Instytut Gornictwa, Waste Management, Katowice, Poland

Highly reactive forms of nanodimensional iron metal receive growing interest because of their potential in industrial, medical environmental and geological applications. Due to their pyrophoric nature safe and convenient methods for in-situ studies of highly reactive metal nanoparticles are required. Reactivity of iron metal to oxygen and water is highly dependent on the surface area density of solid-gas-liquid contacting and on the way this surface is accessible to reagents. Physical and chemical stability of highly dispersed iron depends on the dimensions of the original metal crystals and their arrangement into clusters.

The contribution presents the background and results of a novel inverse gas chromatography (IGC) method developed for reactivity studies of various nano irons participating in redox reactions. Experiments have been carried out in a tubular reactor fi lled up with iron metal fl akes acting as inert support. For the reactivity studies the surface of the fl akes has been covered with iron nanoparticles. The bed was used in dual function; either as chemical reactor for redox studies or as the column to be employed directly in the IGC tests. Oxidation of iron nanoparticles has been performed using liquid water or oxygen diluted with inert carrier gas. Reduction of iron oxides back to the metal state has been performed inside the column using a stream of dry hydrogen. After processing, the oxidation or reduction products were dried and conditioned in situ in a stream of argon, and fed back to the IGC system. Hydrogen, oxygen and water were used as tracers. IGC studies were performed at normal pressure for various fl ow rates of carrier gas. Contact times of tracers with iron particles ranged from 1 to 100 seconds. Temperatures for IGC as well as for the redox studies were in the range from 298 to 678 K.

To compare reactivity of various irons the values of zero moments (areas under the peaks) were used to calculate the mass of tracer consumed during passage of impulse over the samples. They were plotted next as function of temperature and of contacting time giving the reactivity response surfaces. These surfaces visualized the diff erences in reactivity of irons as a function of their original structure and of exposure history. Samples of pure nano iron, zero-valent iron for environmental applications, Fe/Al2O3 nanocomposite and milled irons have been studied for their reactivity in redox processes. The IGC parameters have been compared with data obtained from thermo gravimetric analysis. The IGC method was found to be a precise and reliable tool in studies of reactivity of nano iron.

The work has been conducted at GIG as PBZ-KBN-117/T08/2005 Project: “Materials and technologies for hydrogen economy” and at the IE JRC as Exploratory Research ”Nanotechnology in energy applications”


205

Posters

LP-08Nano-Asymetric Hybrid capacitor employing NiO/C electrode coupleS.P. Savari Rathinam1, M. Cloke2, T. Ludu Nathan3

1University of Nottingham, Electrical and Electronics Engineering, Semenyih, Malaysia2University of Nottingham, Chemical Engineering, Semenyih, Malaysia3University of Nottingham, Department of Electrical and Electronics Engineering, Semenyih, Malaysia

Electrochemical capacitors (ECs) are becoming an imperative energy storage device that plays a key role as a promising technology in today’s energy fi eld. It has been gaining signifi cant importance in various applications such as telecommunication (cell phones, PDAs, remote communication, walkie-talkies etc), standby power systems, and electric hybrid vehicles in the form of storage components (batteries, supercapacitors and fuel cells). Its ability to delivering high power and energy is certainly creating new possibilities to integrate its use in electricity industry as a support to supplement the feasibility of utilizing renewable energy such as solar, wind and hydroelectric power. Transition metal oxides are amongst the potential electrode materials that are capable of off ering high specifi c capacitance. Many transition metal oxides have been investigated and reported to give specifi c capacitances as high as 863 Fg-1 [1]. Nickel oxide is one the most investigated metal oxide as electrode material for ECs because of its high conductivity. Many has reported values ranging from 50 Fg-1 to 300 Fg-1 using various techniques such sol-gel, co-precipitation, electodeposition, electrochemical route and solvothermal [2] wet chemical methods. But it is still far from its theoretical value of 2584 Fg-1 within 0.5 V [3]. Nevertheless, nickel oxide remains to be the material of interest due to it eco-friendly, inexpensive and largely available. In the present work, well-refi ned spherical sized nickel oxide nano particles (Fig.1), exhibiting porous morphology was prepared using combined ultrasonication-solvothermal synthesis process. Dispersion of the precursor by means of ultrasonication has resulted in a highly phase pure structure of nickel oxide (NiO) which was observed under HR-TEM/SAED techniques. The size of the spherical particles thus observed was within 7-10 nm. In addition to its single electrode characteristics as shown in fi g.2 with a specifi c capacitance 270 F/g at 5mV/s in 6M of KOH within 0 - 0.4 V versus SCE, an asymmetric electrochemical capacitor (EC) using NiO nanospheres as positive electrode and a mesoporous carbon black as negative electrode has been fabricated in aqueous medium containing 6M KOH. Cyclic voltammetry (fi g.3), electrochemical impedance spectroscopy and galvanostatic charge-discharge measurements were applied to investigate the capacitance performance of asymmetric hybrid capacitor (AHC). Theresults demonstrated that the capacitive performance of AHC turned even better compared to a symmetric carbon based ECs in terms of measured energy and power density (1.6Whkg-1 and 6456 Wkg-1) making the former confi guration well fi tted in applications that demands high power and energy density without compromising its cost and size.

References:[1] Kim H.S., Branko N. and Popov B.N. (2002) J. Power Sources 104, 52[2] Teressa Nathan, Aziz.A , Noor A. F. and S. R. S. Prabaharan (2008) J Solid State Electrochem, 12, 1003[3] Nam KW, Lee ES, Kim JH, Lee YH, Kim KB (2005) J Electrochem Soc., 152, A2123


206

Posters


207

Posters

LP-09Chemical reaction engineering modelling of nanoreactors for medical applicationsJ. Rogut1, A. Spychalowicz1, D. Nowak1, W. Spychalowicz2

1Glowny Instytut Gornictwa, Glowny Instytut Gornictwa, Katowice, Poland2Medical University of Silesia, Clinic of Hematology and Chemotherapy, Katowice, Poland

Nanoreactors are nanodimensional systems in which in addition to mass and heat exchange with the environment the the chemical changes are performed. In the scientifi c sense nanoreactors are located at the border of biology, chemistry and physics while in the application sense they are deeply embedded in chemical and biochemical reaction engineering.

Our contribution is aimed at presenting the similarities that could be identifi ed in the nanobio- and chemical processes of nanomedicine when the objects of analysis are described employing the language and models of chemical reaction engineering (CRE). The energy and mass transfer phenomena which infl uence the therapy effi ciency of drugs in targeted drug delivery in leukemia chemotherapy treatment has been taken as the case study.

The leukemia illness has been chosen as the working example because it perfectly illustrates the complexity of a responsible application of nanotechnology. During the leukemia chemotherapy the treatment processes are infl uencing the performance of human organisms at the macro (lymph and blood circulation systems of human body), meso (changes in the integrity of vessel circulation and transport effi ciency due to the side-eff ects of chemotherapy), micro (changes in the productivity of marrow cells) and nano (DNA destruction or recovery) levels.

LP-10The NAD project: Nanoparticles for therapy and diagnosis of Alzheimer‘s DiseasePreliminary results with nanoliposomesF. Re1, M. Masserini1, M. Gregori1, V. Cassina1, M. Stravalaci2, M. Salmona2, M. Gobbi2

1Univ. Milano-Bicocca, Experimental Medicine, Monza, Italy2Mario Negri Institute, Biochemistry, Milano, Italy

BACKGROUND: Production and accumulation of beta-amyloid peptide (Aß), a 40-42 AA fragment of the Amyloid Precursor Protein (APP), plays a central role in the onset and development of Alzheimer Disease. Aß aggregate in the brain to form oligomers, fi brils and plaques that induce a progressive degeneration of neurons. OBJECTIVES: One of the goals of the NAD project, developed in the fi eld of nanotechnologies, is to create nanoparticles (NPs) able to bind Aß?nand possibly to inhibit its aggregation or to destroy the aggregates. Within the present investigation we describe preliminary results concerning the preparation of liposomes (LIP) able to specifi cally interact with Aß. METHODS: Human Aß1-42 (Sigma-Aldrich, Italy) or synthetic Aß1-42 were used. Monomers, oligomers and fi brils of Aß were prepared as described previously (Dahlgren KN et al., JBC 2002) and analyzed by Atomic Force Microscopy (AFM). LIP were prepared by extrusion through polycarbonate fi lters with pores of 100nm diameter and were composed of cholesterol/sphingomyelin (Chol/Sm:1/1) and glycerophospholipids or glycosphingolipids (gangliosides). The interaction between LIP and Aß in diff erent aggregation state was assessed using i) ultracentrifugation on a density gradient to separate Aß-bound to LIP from Aß free, followed by ELISA assay and ii) Surface Plasmon Resonance (SPR),performed fl owing LIP onto immobilized Aß?nand vice versa. Moreover, the LIP eff ect on Aß aggregation was evaluated by AFM. RESULTS: Our results provide evidence that the lipid composition strongly aff ects the ability of LIP to bind Aß. In particular, LIP composed of Chol/Sm/anionic phospholipids (phosphatidic acid or cardiolipin) display a much better ability to bind Aß in comparison with Chol/Sm, Chol/Sm/zwitterionic phospholipids or Chol/Sm/sphingolipids. The ability of LIP to bind Aß was dependent on the proportion of embedded anionic phospholipids tested, in the range 5 to 40% molar. The best performance was attained at 5% molar. LIP-embedded anionic phospholipids displayed a Kd value in the nanomolar range. Moreover, LIP containing phosphatidic acid or cardiolipin seem to inhibit the formation of fi brils from Aß monomers. CONCLUSION: The results suggest that LIP containing phosphatidic acid derivatives interact with Aß?nand inhibit the aggregation of monomers. Therefore LIP will be utilized in further experiments in vitro, using biological fl uids and cellular models, and then in vivo on animal models of AD.


208

Posters

LP-11“NAD” Nanoparticles for Therapy and Diagnosis of Alzheimer’s DiseaseM. Masserini1

1Univ. Milano-Bicocca, Experimental Medicine, Monza, Italy

NAD is a project funded by the European Union‘s 7th Framework Program, FP7-NMP-2007-LARGE-1: Substantial innovation in the European medical industry: development of nanotechnology-based systems for in-vivo diagnosis and therapy. The project (website: www.nadproject.eu) started in September, 2008 and has a duration of 5 years. University of Milano-Bicocca is the leading partner. The project includes 19 research centers and enterprises in a multidisciplinary partnership from Italy, Spain, Portugal, France, Slovakia, Sweden, the Netherlands, Denmark, Hungary, Finland, Greece, Belgium and the UK.

BACKGROUND: In Europe there are more than 5 million cases of dementia, 3 million of which are classifi ed as Alzheimer Disease (AD). Figures are expected to double by 2040 in Western Europe and to triple in Eastern Europe. Although substantial progress has been made in the scientifi c understanding of AD, there remains an urgent need to identify eff ective therapies and early detection strategies, in order to avert a overwhelming public health problem.

OBJECTIVES: Progressive production and subsequent accumulation of beta-amyloid peptide (Aβ), plays a central role in the onset and development of AD. This peptide is released from cells in a soluble form that progressively forms oligomeric, multimeric and fi brillar aggregates, ending with extracellular plaques, one of the morphological hallmarks of the disease, detectable post-mortem in Alzheimer brains. Finally, brain and blood Aβ are in equilibrium through the blood brain barrier (BBB), and sequestration of Aβ in the blood may shift this equilibrium, drawing out the excess from the brain (“sink” eff ect). All these premises strongly suggest an approach to both the therapy and diagnosis of AD, based on Aβ as the target.

METHODS: The aim of this project is to create diff erent stealth nanoparticles multiple-functionalized, able to bind and remove Abeta from the brain and from the blood.

Stealth nanoparticles (NPs) (liposomes, solid lipid nanoparticles, polymeric nanoparticles) will be prepared using commercially available molecules and newly synthetic polymeric conjugates. NPs will be subsequently conjugated to : i) molecules interacting with Aβ; ii) molecules stimulating BBB crossing; ii) loaded with PET or MRI contrast agents. Diff erent Aβ ligands will be selected, designed and synthesized and their affi nity for Aβ tested. Parallely, diff erent ligands to cross the BBB will be tested using in vitro models. Once the best-performing ligands will be selected, nanoparticles carrying the double functionalization will be prepared and carefully characterized. This strategy will lead to the production of two side-products: NP able to bind Aβ in the periphery and NPs able to cross the BBB. Several artifi cial and cellular models will be use to improve such features and NPs biocompatibility. Finally NPs ability to remove and detect Aβ deposits will be studied in-vivo fi nally transgenic rodent models of AD.


209

Posters

LP-12Modifi cation strategy for gold and silver NP with C-glycosylated porphyrin derivativesP. Rezanka1, L. Veverkova1, P. Zvatora1, K. Zaruba1, O. Simak2, J. Kralova3, P. Drasar2, V. Kral1

1Institute of Chemical Technology Prague, Analytical Chemistry, Prague 6, Czech Republic2Institute of Chemical Technology Prague, Chemistry of Natural Compounds, Prague 6, Czech Republic3Academy of Sciences of the Czech Republic, Institute of Molecular Genetics, Prague 4, Czech Republic

Gold and silver nanoparticles have many unique properties such as large optical absorption, resonance light scattering and surface-enhanced Raman scattering that make them very promising optical probe materials for biomolecular imaging and detection (ref. 1). However, there are many remaining problems and challenges that prevent the extensive applications of gold nanoparticles in analytical chemistry. The surface chemistry of the nanoparticles plays a critical role in retaining the analytical (ref. 2) and diagnostic function of nanoparticles (ref. 3).

Through our study, we have explored two methods for surface modifi cation of silver and gold nanoparticleswith thiol substituted porphyrin and Zn(II) metalloporphyrin The former is based on AgS and AuS bond formation, the latter on coordination bond formation between citrate (which is used to nanoparticles stabilization) and Zn.

Gold and silver nanoparticles can be prepared by several means. The most frequent approaches are: fi rst, citrate reduction of aqueous solution of a gold(III) and silver(I)salts; second, borohydride reduction of aqueous solution of a gold(III) and silver(I) salts; and third, two phase (water-toluene) reduction using borohydride as reducting agent and tetraoctylammonium bromide as transfer agent. Each method provides diff erent concentration and size of the generated nanoparticles as well as the diff erent potential for their subsequent modifi cation. Immobilization of desired compounds on the nanoparticles can be carried out for example by ionic interaction, coordination bonding, covalent bonding or direct bonding to the surface trough sulphur atom.

In this work the gold and silver nanoparticles were prepared by citrate reduction of a gold(III) and silver(I) salts. In the next step, the citrate stabilized nanoparticles were modifi ed with two porphyrin derivatives, fi rst by direct bonding to the surface trough sulphur atom and the second by coordination bonding to metal atom. The resulting nanoparticles were characterized by absorption spectroscopy, transmission electron spectroscopy and electron circular spectroscopy and used for the analytical application and cell imaging.

References:[1] M.-C. Daniel, D. Astruc, Chem. Rev., vol. 104, pp. 293-346, 2004.[2] P. Rezanka, K. Zaruba, V. Kral, Chem. Listy, vol. 101, pp. 881-885, 2007.[3] K. Peters, R. E. Unger, A. M. Gatti, E. Sabbioni, R. Tsaryk, C. J. Kirkpatrick, Int. J. Immunopathol. Pharmacol., vol. 20, pp. 685-695, 2007

Acknowledgement: Financial support from The Ministry of Education, Youth and Sport of the Czech Republic, no. MSMT6046137307, Projects No. MSM6046137305, 2B06024 (SUPRAFYT), are gratefully acknowledged.

LP-13Ultrasonic quantifi cation of nanoparticle-based immunoassay of salmonella in waterD. Bavli1, Y. Barenholz1, A. Priev1

1The Faculty of Medicine Hebrew University, Biochemistry, Jerusalem, Israel

Real-time, low-cost identifi cation and quantifi cation of specifi c bacteria (e.g., E. coli, Salmonella) in water has been a major goal for a long time. Nanoparticle-based immunoassay (NBI) is a basic and economical technique for rapid identifi cation of pathogens. By using ultrasonic standing wave (USW) technology, we accelerate the NBI for quantitative determination of bacterial concentration by monitoring changes in the amplitude and frequency of the ultrasonic waves at diff erent concentrations of bacteria and antibody -coated nanoparticles. The ultrasonic standing waves create an acoustic radiation force which forms two areas of pressure where the particles and bacteria can be trapped: high acoustic pressure (node) and low acoustic pressure (anti-node). This is exemplifi ed for Salmonella typhimurium. Using USW technology and sound velocity monitoring, we have been able to identify and quantify down to ~ 6.4 x 103 Salmonella bacteria , compared to ~ 6.4 x 106 salmonella bacteria achieved by the standard NBI . Additional sensitivity ( ~ 4 x 103) is achieved by using USW intensity of 10 mW/cm2 and a laminar fl ow rate of 30 ml/min after 1 min of centrifugation at 14,000 RPM. Under these conditions the acoustic radiation forces acting on the nanoparticles attached to the Salmonella fl agellum drives the complex to the node area. Free nanoparticles, as well as free bacteria, are not trapped and are washed out of the separation area by the aqueous fl ow, resulting in specifi city and sensitivity of our assay. Our results demonstrate the potential to trap and measure in real time, using low-cost technology, a small number of bacteria by the use of NBI, USW technology and sound velocity measurements. This study is supported by a grant from the Water Authority of Israel (grant No 039-4229)].


210

Posters

LP-14Fabrication and Characterization of High Performance Ceramic Membrane Having Nanometer poresA. Sadigzadeh1, R. Soltani2

1Nuclear Science and Technology Research Institute Nuclear Science Research School Tehran Iran, Materials, Tehran, Iran2Department of Physics Faculty of science Mazandaran University University pardiss Babolsar Iran, Physics, Babolsar, Iran

In this study, Carbon Nanotubes (CNTs) were grown directly in the pores of micro porous Pyrex membranes and consequently ceramic membranes with very fi ne pores and high porosity were achieved. Our experiment was done in two stages. Initially cobalt powder with diff erent percent was homogeneously mixed with Pyrex powder. In order to produce row membranes, each of these mixtures were compacted in the form of tablet by use of an uniaxial cold press and in a stainless steel mould, and then the tablets were sintered at diff erent temperature in an electric furnace. In second stage chemical vapor deposition (CVD) method was used to grow CNTs within the pores of the membranes. Argon and ammonia were used as carrier and reactive gas respectively and acetylene was used as the carbon feedstock. Morphology of the membranes before and after CVD process was studied by scanning electron microscopy (SEM). After CVD process CNTs were grown in the pores of membranes and the pores size was decreased but total porosity of the membrane was not changed considerably. In this way membranes with high porosity and fi ne pores were fabricated.

LP-15Surface-modifi ed iron nanoparticles for reductive dechlorination of organic contaminantsS. Klimkova1, T. Pluhar1, J. Nosek1, M. Cernik1

1Technical University of Liberec, Institute of Novel Technologies and Applied Informatics, Liberec, Czech Republic

Reductive dechlorination in-situ by zero-valent iron nanoparticles (nZVI) is one of the perspective technologies usable for decontamination of the rock environment polluted by chlorinated organic hydrocarbons. Organic compounds are not very soluble in the groundwater and hence the classical pump-and-treat technologies for their treatment are not eff ective. The principle of the chemical reduction method is substitution of chlorine for hydrogen with consequent contaminant transformation into substantially less toxic non-chlorinated compounds. Besides high reactivity, transportability in saturated zone is the main nanoparticle advantage in comparison to macroscopic iron fi lling used in permeable reactive barriers. The application of nanoparticles into the subsurface environment is easier and the effi ciency of the decontamination process is higher.

Iron particles of the size about tens to hundreds nanometres prove specifi c catalytic, electric and magnetic characters linked with applying the surface phenomena escalating chemical activity of nanoparticle surface atoms. Among iron nanoparticles, particularly the surface unmodifi ed ones, attractive van der Waals, electrostatic and magnetic forces aff ect, and hence, nZVI aggregates relatively rapidly. Aggregate formation rate is growing up with higher nZVI concentration. Unmodifi ed nZVI is adsorbed on material of which pores it should go through, besides the pore plugging caused by big aggregates. Aggregate decomposition by ultrasonicating or intensive stirring is possible to a large extent before nZVI application but not more in the rock environment. In order to make the real decontamination application more eff ective, it is necessary to create stable nZVI dispersion.

The research on optimization of the surface properties of nZVI by electrostatical, sterical or electrosterical modifi cations using surfactants, (co)polymers, oils and others is under way. Our research has been chiefl y focused on nZVI newly produced in the Centre of Nanomaterial Research (Olomouc). The surface modifi er choice is carried out with the aspect of its biodegradability and economical accessibility. The effi ciency and the reaction kinetics of variously modifi ed nZVI with certain contaminants are accomplished by batch experiments, the transportability in the rock environment by column experiments. Size distribution and ζ-potential of the particles is analysed using Zetasizer Nano ZS, Malvern. Moreover a sedimentation device consisting of cylinder, scale for monitoring amount of sedimented particles, camera for taking photos in selected time and computer with our programs for controlling components and saving data was developed. Nowadays we are about to monitor magnetic properties of nanoparticles in consequence of their size distribution. The aim of this research is to optimize this relatively new decontamination technology.

The research has been supported by MSMT CR grants 1M0554 and FRVS/2008/98/A and by GA CR grant 102/08/H081.


211

Posters

LP-16Fluorophore doped luminescent silica nanospheres as effi cient labels in DNA microarraysF. Enrichi1, L. Manodoril1, R. Ricco’1, A. Meneghello1, R. Pierobon1, F.Marinello1, P. Schiavuta1

1CIVEN / Nanofab, R&D, Venezia, Italy

In this work we present the use of fl uorescent doped silica nanoparticles as effi cient labels for DNA microarray. A DNA microarray is a high-throughput technology that consists of an arrayed series of spots of ssDNA, called probes, each containing a specifi c nucleotide sequence. Probe molecules have the ability to hybridize a target sample and this event (probe-target interaction) is usually identifi ed and quantifi ed by means of optical, fl uorescence-based detection. To improve the sensitivity of the microarray and to avoid limitations related to common dyes (i.e. photobleaching, chemical stability, low quantum effi ciency, etc…) the development of new and better biolabels would be desiderable. In particular, luminescent dye-doped nanoparticles could be excellent candidates for biological applications because (1) they can be analyzed with the standard existing tools (microarray scanners), which are fi tted for fl uorophore excitation and emission curves, (2) a large number of dye molecules can be incorporated in a single particle, increasing the optical signal and (3) the silica matrix provides a protective barrier minimizing photobleaching and photodegradation.

In our study, dye doped nanoparticles (NPs) were synthesized by using the well-known Stober synthesis in basic environment. Spherical and uniform NPs of diff erent colours were obtained by means of incorporation of Alexa 555 (green), Alexa 647 (red) or both of them (yellow), showing a very intense luminescence signal and better photobleaching stability with respect to the molecular fl uorophores. The NPs were functionalized with streptavidin on their surface and used as biomarkers for biotinylated DNA target molecules on a DNA microarray slide. Dye doped NPs demonstrated a very high effi ciency in the detection of the hybridization events and were compared with commercial quantum dots (QDs), revealing more than one order of magnitude higher signal intensity. This result is very promising for high sensitivity DNA detection, even if some improvements are nevertheless possible by optimizing the size and dye doping of the NPs and their distribution on the microarray DNA spots.

LP-17New Immunosensor Design For Diagnostic Applications Based On Three-Dimensional μ-Interdigitated ElectrodesJ. Ramon-Azcon1, A. Bratov2, N. Abramova2, C. Dominguez2, F. Sanchez-Baeza1, M.P. Marco1

1Instituto de Química Avanzada de Cataluna (IQAC-CSIC)/CIBER-BBN, Chemical & Biomolecular Nanotechnology, Barcelona, Spain2 Centro Nacional de Microelectronica (CNM-CSIC), Chemical Transducer Group, Barcelona, Spain

An immunosensor has been developed based on a novel electrochemical transducer design. Planar Interdigitated μ-electrodes (IDμE) devices present certain limitations as biosensors, independently on whether the biomolecules are immobilized on top or within the electrodes. Thus, when bioreceptors are within the electrodes, the digit dimensions and interspacing would need to be comparable to the biomolecule length, for maximum eff ect on the impedance properties. However, this is diffi cult to achieve with conventional microelectronic technology. It is known that 80% of the total signal is close to the electrode surface and that the electric fi eld penetrates within a distance equal to the distance between centers of two adjacent electrode digits1. According to it, the new transducer incorporates insulating barriers within the electrodes of the same order of magnitude than the distance between the electrode digits2. This three dimensional transducer used as immunosensor shows a considerable improvement compared with the standard planar design as demonstrated by immobilizing immunoreagents specifi cally developed to detect sulfonamide antibiotics. A signifi cant increase on the absolute signal is recorded as a consequence of the binding reaction if compared to the planar electrodes. The immunosensor allows direct detection of sulfapyridine with an IC50 value of 5.6±3.2 μg L-1, which is far below of the required detectability for food safety studies according to the EC Regulations3. Moreover, the analysis is fast and can be easily adapted to on site or point-of-care (PoC) diagnostic systems.

[1] Mamishev et al. 2004 Proceedings of IEEE 92 (5) 808. (2) Bratov et al. 2008 Electrochem.Commun. 10 (10) 1621. (3) Bratov et al. 2008 Biosens.Bioelectron. 24 (4) 729


212

Posters

LP-18Novel approach to obtain micro and nanostructured biopolymers for biotechnological applicationsC. Palocci1, L. Chronoupoulou1, A. Masotti1, F. Bordi2

1Sapienza University of Rome, Chemistry, Roma, Italy Sapienza University of Rome, Physics, Roma, Italy

Nanomaterials, such as inorganic or organic nanoparticles and nanorods, exhibit similar dimensions to those of biomolecules, such as proteins (enzymes, antigens, antibodies) or DNA. The integration of nanoparticles, which exhibit unique electronic, photonic, and catalytic properties, with biomaterials, which display unique diff erent biological properties such as recognition, catalytic, and inhibition properties, yields novel hybrid nanobiomaterials of synergetic properties and functions [1-4].

At the industrial level, the challenges related to the development of processes calling for nanometric control of the dimensions of materials are a problem for the scale-up of nanotechnologies. Therefore, there is an evident need to provide alternative and aff ordable methods for industrial production. Owing to their peculiar structures, most nanostructured biopolymers cannot be produced by bottom-up procedures. In those cases, a “top-down” approach must be used. Methods for preparing polysaccharide-based micro and nanoparticles are based on a variety of approaches including interactions with counterions, chemical crosslinking, solvent evaporation, coating on preformed microparticles and spray-drying.

Our research group has patented a method [5] for controlling the dimensions and the morphology of polymers, that is innovative, simple and of general application. The method provides polymers with diff erent morphologies starting from polymers synthesised with any procedure, without the use of emulsifi ers. The infl uence of the physico-chemical properties of the reaction medium on the particles size and morphology was also evaluated. By using this methodology we achieved nano and microparticles of diff erent biopolymers, such as chitosan, polylactic acid and its copolymers with glycolic acid, hyaluronic acid derivatives, pullulan and dextrane with diff erent dimensions (30-200 nm) and morphology (e.g. spheres, sponges, disks and fi bres). The nanostructured biopolymers were characterized by SEM, TEM experiments and DLS measurements. The ability of such polymers to give hybrid nanobiomaterials [6-7] with diff erent biomolecules such as as nucleic acids ( linear DNA and pDNA), drugs (5-fl uorouracil and dexamethasone) and enzymes (lipolytic enzymes from yeast) was also evaluated toghether with their biological activity in in vitro experiments.

References[1] Kippelen, B. Springer Ser. Opt. Sci. 2007, 114, 487-534.[2] Biondi, M.; Ungano, F.; Quaglia, F.; Netti, P.A. Adv. Drug Delivery Rev. 2008, 60(2), 229-242.[3] Heath, F.; Haria, P.; Alexander, C. AAPS Journal. 2007, 9(2), E 234-240.[4] Payne, G.F. Cur. Opin. Chem. Biol. 2007, 11(2), 214-219.[5] Palocci, C.; Russo, M. V.; Belsito, C. M. A.; Cernia, E.; D’Amato, R.; Fratoddi, I.; Panzavolta, F.; Soro, S.; Venditti, I. PCT/IT20057000653 International

Publication Number WO 2006-051572 A3.[6] Palocci, C.; Chronopoulou, L.; Venditti, I.; Cernia, E.; Diociaiuti, M.; Fratoddi, I.; Russo, M.V. Biomacromol. 2007, 8(10), 3047-3053.[7] Masotti, A.; Bordi, F.; Ortaggi, G.; Marino, F.; Palocci, C. Nanotech. 2008, 19, 055302-055307.


213

Posters

LP-19Intelligent stickS. Samrat Sarkar1

1Srm University, Genetic Engineering, Chennai, India

Intelligent stick is a companion for the blind people that uses the latest technologies like Artifi cial Intelligence and WiFi to ensure the safety while walking alone. The emphasis in this project is to control and prevent the people from meeting with accidents. Three vibrating sensors are mounted on the blind stick to warn the user.

The power of Science and Technology can not be proved if it is not useful to the physically challenged people. An aff ordable design for the blind people is proposed in this project. Extreme care is given and this stick will act as eyes for the blind people.

A totally wireless solution with audio & video interface is used in this project with 3-level detection using IR sensors, which is implemented for the real time safety while usage.

This intelligent stick contains six modules whose details are given below.• Head sensor module - To indicate obstacle above or around head area.• Side sensor module - To indicate obstacle aside the user.• Ground sensor module - To indicate obstacle on the ground surface.• Object Identifi cation Module - To capture the image of the objects and to give signal to the user and monitoring agent (remote).• Vibration sensing module - To sense the vibration of the user.• Alarm Module - To produce sound to alert the user.

A camera is interfaced in this system with video option, it transfers all the images in the way in which blind person is proceeding. The images are transferred to receiver (television) through a composite transfer medium.

The person who is watching the movements of the blind from a remote location can interact and guide him through the audio option. The speech is transferred in to the mike which is interfaced to the stick. This intelligent stick uses embedded technology and the process is controlled by the micro controller PIC16f877A. The above activities can be remotely monitored and controlled in a span of 250 meters radius.

Salient Features:• Compact model.• Cost eff ective.• Totally wireless.• Audio & video interface.• Less power consumption.• Compact embedded design.

LP-20Removal of pollutants from aquatic system with nanocatalystsG. Akcin1, N. Akcin1

1Yildiz technical University, Chemistry, Istanbul, Turkey

Objective of this project is synthesis of nanosized catalyst selective for specifi c organic pollutant in aquatic systems and their characterization.

Nanosized noble metals supported on ceramic oxides and biomass that act as good catalysts for the removal of organic pollutants from wastewater.

Organic compounds can be important environmental contaminants. They are known or potential threats to public health and the environment, so there is an urgent need to understand their transport and fate in the environment and develop eff ective control methods because many are mobile, persistent, and toxic. [1-2]

It is well known that the catalytic activity of supported metal particle catalysts is strongly dependent on the size and shape of the particles. Nanoparticle catalysts are highly active since most of the particle surfaces can be available to catalysis. Novel structural tools are keys to understanding their nanostructures. [3]

Current treatment methods, that they may are often not eff ective on the entire range of contaminants at a site. As a result of these inadequacies, treatment technologies which provide on-site destruction of a wide range of Halogenated organic compounds (HOCs) in water at ambient conditions are needed.

This products are applicable to wastewater treatment technology in lab scale and up-scaling of the process to the pilot scale; industrial wastewater application (Textile, Dye, Agriculture, Plastic, Pharmacy and Chemical Industries etc.)[1] M.S. Wong, P. J.J. Alvarez, Y.L. Fang, N. Akcin, M. O. Nutt, J. T. Miller, K. N.Heck, “Cleaner Water using Bimetallic Nanoparticle Catalysts” J.

Chem. Tech. &Biotech. 84,158-166(2009).[2] N. Akcin, N. Soultanidis, K. Heck, Y.L. Fang,G. AkcinM. S.Wong “Hydrodechlorination of Dissolved Chloroform Using Palladium-Gold

Nanocatalysts” In Press.[3] N. Akcin, G. Akcin, M. S.Wong “Hydrodechlorination OfChloroform Using Nanoparticle Supported Catalyst” NanoTRIV 9-13 June 2008.


214

Posters

LP-21Single molecule experiments of bacterial endonuclease tailored to serve as a molecular motor in biotechnologyM. Weiserová1, E. Sisáková1, A. Guzanová1

1Institute of Microbiology, Cell and Molecular Microbiology, Prague 4, Czech Republic

Restriction-modifi cation systems (RM) provide the host bacteria with immunity to infection by foreign DNA and protect cellular DNA from restriction by methylation of adenosyl residues within the sequence recognised by the restriction enzymes. In the complex Type I R M systems, restriction and modifi cation activities are catalysed by one enzyme composed of three diff erent subunits, which are encoded by the hsdR, hsdM and hsdS genes. The HsdS subunit plays a key role in the function of Type I R-M enzymes being responsible for both the specifi c recognition of the target DNA and interaction with HsdM and HsdR subunits, while the HsdR subunit is representing the motor component of this enzyme being responsible for ATP-binding, ATP- hydrolysis and subsequent DNA translocation. We focus on identifi cation of amino acids residues of both the HsdR and HsdS subunits involved in subunit assembly of the Type I R-M enzyme EcoR124I, with an aim to produce stable R1 complex capable of unidirectional translocation. The putative mutants were screened for restriction defi ciency, and then examined for their stoichiometry and DNA translocation activity. This provides us with a unidirectional motor and together with the already available mutations in the endonuclease motif ensures the motor cannot cut DNA.

This modifi ed molecular motor can serve as a nanoactuator by pulling the magnetic bead attached to immobilised DNA past the sensor in DNA translocation process. The sensor could switch a silicon-based device.

LP-22Carbon nanotubes for nuclear waste management: a study on mechanical properties variation in irradiated samplesA. Mangione1, G. Lanzara2, F. Belloni3

1ITA-Istituto Tecnologie Avanzate and Universit? di Palermo, Nanotechnology, Trapani (I), Italy2ITA-Istituto Tecnologie Avanzate and Stanford University, Nanotechnology, Trapani (I), Italy3European Commission, Institute for Transuranuim Elements, Karlshue, Germany

Carbon nanotubes (CNTs) has attracted considerable attention due to their unique structural and physicochemical properties, which allow them to be applied to a number of applications ranging from (nano)electronic devices to optics, from fuel cells to natural gas storage, and also to the enhancement of electrical and mechanical properties of composite materials. In the environmental fi eld, CNT application is regarded as extremely promising for the development of novel energy-storage techniques, sensors, and sorbent materials for myriad uses including waste management.

The enhanced CNTs properties, together with the possibility to use them for mechanical/thermal compaction, processing with epoxy resins, or incorporation into ceramics, make them interesting to play a role in nuclear waste management.

In principle, it is ascertained that CNTs, as produced or in composites, could ensure better performances than currently most used materials in this fi eld, where properties as adsorption capacity, impregnation, solidifi cation, thermal stability, breaking strength, toughness and mechanical resistance, in general, are concerned. The inherent radioactivity of (most) nuclear waste, in fact, introduces another variable as radiation-induced damage suff ered, which can aff ect the structural stability of materials used for storage.

In the present work, the dose-rates that a dry MWNT powder would undergo in a realistic application has been estimated, after the adsorption of fi xed values of a decaying radionuclide, among the radiotoxic fi ssion products usually abundant in waste streams.

Using the resulting values to irradiate carbon nanotube buckypapers samples, a series of indentation have been performed on the samples in the micro scale.

The resulting data, together with the Scanning Electron Microscopy images have been used to get indications about the possibility to make CNTs a very attractive material for nuclear waste sequestration.


215

Posters

LP-23Surface modifi cation of biodegradable polymer drug carrier by chemical coupling of poly(ethylene glycol)E. Kiss1, E. Kutnyánszky1, I. Bertóti2

1Eotvos Lorand University, Institute of Chemistry, Budapest, Hungary2Chemical Research Centre, Research Laboratory for Materials and Enviromental Chemistry, Budapest, Hungary

Biodegradable polyesters such poly(lactic acid) and poly(lactic/glycolic) acid copolymers (PLGA) are preferred biomaterials although their surface hydrophobicity limits the application[1-3]. In this work linear and star like poly(ethylene glycol) (PEG) molecules were chemically coupled to the PLGA surface to improve its compatibility with biological systems when applying it as drug delivery vehicle or tissue scaff old. A two-step chemical reaction route was developed including controlled aminolysis as a fi rst step [4] and coupling of activated derivative of PEG. In case of star like PEG a similar approach was attempted for attachment the even more eff ective six armed PEG by using bifunctional glutaraldehyde as a mediating agent. In both cases the chemical attachment was accomplished and clearly detected by X-ray photoelectron spectroscopy (XPS).

The PEG coupling resulted in a considerable increase of hydrophilic character and wetting tension of the modifi ed PLGA surface. As a fi nal goal signifi cantly reduced protein adsorption was achieved on PEG-modifi ed PLGA demonstrated surface analysis (XPS) and AFM imaging as well. As an additional benefi t, the application of star-PEG off ers a number of unreacted amine groups on the surface allowing attachment of directing molecules in potential drug carrier application.

[1] É. Kiss, I. Bertóti, E. I. Vargha-Butler, J. Colloid Interf. Sci. 2002, 245, 91-98.[2] Santander-Ortega, A.B. Jódar-Reyes, N. Csaba, D. Bastos-González, J.L. Ortega-Vinuesa, J. Colloid Interf. Sci. 2006, 302,522-529.[3] Š. Popelka, L. Machová, F. Rypácek, J. Colloid Interf. Sci. 2007, 308, 291-299.[4] T. I. Croll, A. J. O’Connor, G. W. Stevens, J. J. Cooper-White, Biomacromolecules 2004, 5, 463-473.

Financial support of the Hungarian Research Foundation (OTKA K68120 and K60197) is acknowledged.

LP-24NEW ED, a nano/micro/macro scale approach to higher performance in bipolar electrodialysisC. Fritzmann1, T. Melin1

1RWTH Aachen University, Aachener Verfahrenstechnik - Chemical Process Engineering, Aachen, Germany

NEW ED - advanced bipolar membrane processes for remediation of highly saline waste water streams - is a project within the Cooperation program of the EU 7th framework program.

Electrochemical membrane processes have become a mature technology in desalination of brackish or the production of ultra-pure water. A relatively new electrochemical membrane process is bipolar membrane electrodialysis (BPMED), which produces acids and bases from their corresponding salts. BPMED so far has been applied only in niche markets like organic acid recovery from fermentation broth due to limitations of the current state of membrane and process development. Major drawbacks of the classic BPMED process are:• insuffi cient product purity due to limited selectivity of the membranes,• limited current density, increased electrical resistance and membrane deterioration due to dry-out of the membranes because of limited

diff usive water transport into the membrane,• formation of metal hydroxides at or in the bipolar membrane.

The objective of project NEW ED is to overcome these limitations by developing a new type of bipolar membrane and membrane module with active, i.e. convective instead of diff usive water transport to the transition layer of the bipolar membranes. Whereas in classical BPMED, water transport has to occur by counter-current diff usion, it now is accomplished by convection through a nano- to micro-porous intermediate ion-conducting layer incorporated between dense outer ion exchange membrane layers. This new membrane structure leads to a number of decisive advantages:• current densities are no longer limited by back-diff usion of water,• undesired transport of ions towards the transition layer is suppressed by the net water transport away from the transition layer and the

possibility to use denser membranes,• multivalent metal ions tending to form poorly soluble hydroxides are kept from entering the bipolar membrane.

Several promising intermediate layer materials together with diff erent monopolar ion-exchange layers will be tested. Membrane manufacturing and new module concepts will be investigated to exploit the full potential of the new bipolar membrane technique. Integration of the developed membranes and modules into relevant production processes is an essential part of NEW ED to evaluate the potential of the new concept.

Applications to be investigated are large-scale industrial production processes that generate either saline waste water streams, such as the polycarbonate production or other ecologically harmful waste streams like phosphate or ammonium salt solutions. NEW ED thus aims at closing industrial water cycles and at reducing the amount of waste water streams with highly concentrated salt loads stemming from a broad range of industrial production processes.


216

Posters

LP-25Drug delivery of anti-cancer gene using nanorobotsS. Samrat Sarkar1, S. Sujeet Kumar Singh1

1Srm University, Genetic Engineering, Chennai, India

One of the most important treatment in today’s medicine world is treatment of cancer.Using anti cancer drugs by using nano robots we can treat the disease.First of all we have to sequence the entire genome of the diseased patient and then we have to compare the genome of this patient with that of normal individual.We have to compare the sequence and have to identify that on which gene the mutation is present.On identifying the gene responsible we can develop drugs which have an anti-cancer eff ect on that gene.The drug can be loaded on the nanorobot and is injected into the immune system of the patient.On doing so the drug carrying the anti cancer gene will identify the target and will elicit an immune response against that gene.This it will suppress the source of cancer causing gene by leading to apoptosis of that cell.

LP-26Novel nanostructured materials accelerating angio- and osteo-genesisB. Shivachev1, J. Karadjov2, B. Trajkovski3, V. Stavrov4, S. Stavrev2, M. Apostolova3

1Central Laboratory of Mineralogy and Crystallography Bulgarian Academy of Sciences, X-ray analysis, Sofi a, Bulgaria2Institute for Space Research Bulgarian Academy of Sciences, Space materials and Nanotechnology, Sofi a, Bulgaria3Institute of Molecular Biology Bulgarian Academy of Sciences, Medical and Biological Research Lab, Sofi a, Bulgaria4NanoToolshop, Ltd, Botevgrad, Bulgaria

Osteoporosis is a disease in which the mineral density of the bone is reduced, its microarchitecture disrupted, and the expression profi le of non-collagenous proteins altered. The fracture treatment is a complicated, multistage process, aff ected by cells evidence and regulated by local and systematic factors.

The objective of the study was to develop new bioactive nanostructured materials, in both acellular and autologous cell-seeded forms to enhance the bone fracture fi xation and healing thought creating highly porous structures which will promote angio- and osteogenesis.

The approach to develop highly eff ective hydrogels for counteracting the eff ects of osteoporosis followed diff erent ways: (a) synthetic and biological polymer chemistry, by using of thermal gelling polymer and nanodiamonds (b) experiments with cell models - endothelial progenitor cells.

The results showed that nanodiamonds applied on diff erent implant materials can enhance the mineralization and the diff erentiation of endothelial progenitor cells. Nanodiamonds were also incorporated in “intelligent” gel matrixes and they have functioned as scaff olds attracting calcium ions and inducing hydroxyapatite crystals growth.

Our investigations demonstrated that in vitro endothelial progenitor cells transformation to osteoblasts was enhanced in the presence of osteoprogenitor medium and nanodiamonds. These results provided initial evidence that synthetic nanomaterials may exhibit certain properties that are comparable to natural ones, and nanomaterial architecture may serve as superior scaff olding for promoting endothelial progenitor cells diff erentiation and biomineralization.


217

Posters

LP-27Hydro-MiNa Robotic System for Biological and Industrial Micro/Nano ApplicationsK. Kostadinov1, A. Shulev1, T. Tiankov1

1Bulgarian Academy of Sciences, Institute of Mechanics, Sofi a, Bulgaria

Nowadays many scientifi c and industrial tasks require micro/nano operations combined with large up to several centimeters manipulations or transport operations. In most cases, such complex tasks need one large range robot and one low range manipulator with high-precision. Depending on the end eff ector of the robot system, diff erent applications are possible for biological and industrial micro and nano technological operations. In the frame of the European project FP6- HYDROMEL a Hydro-MiNa robot with 7 degrees of freedom has been developed for cell manipulations and injections. A glass pipette mounted on the robot end eff ector is used for cell penetration with quite diff erent dimensions - (20 μm to 800μm).

We present a modular robotic system with large working range having high precision and integrated two-dimensional vision control. The large range robot provides working space of the glass-pipette with dimensions up to 50x50x50mm and realizes rough positioning to the cell membrane with accuracy of 1μm. The integrated linear measuring system is used to provide the robot control system with 0.1μm resolution feedback.

Fine positioning, orientation and cell-penetration are realized by micro-manipulator, actuated by 3 piezo-stack actuators equipped with positioning sensor with resolution of 0.6nm. They are providing the injection motion up to 800 μm and pipette orientation motions in accordance with the cell size.

Appropriate optical system provides high-resolution imaging of the injection pipette over the working area defi ned by the cells holder dimensions. Numerical algorithms for pipette point detection and tracking during the working process are developed. The sub-pixel accuracy of these algorithms and high precision linear measuring system integrated in the large range robot allow precise calibration of the image space. In this way, the visual feedback is used to control the whole Hydro-MiNa robot system and the pipette position with respect to the target cell. Once the cell’s position detected and defi ned in the image space, the injection process could be teleoperated or completely automated.

LP-28Development of photosensitive hydrogels as materials for UV-NILA. Gaston1, L. Bilbao1, V. Sáez-Martínez1, A. Corrés1, I. Obieta1

1Inasmet-Tecnalia, Health Unit, San Sebastian, Spain

1. BackgroundHydrogels are three-dimensional crosslinked networks of hydrophilic polymers that resemble the physical characteristics of natural tissues. They have become crucial for many chemical and biological applications as materials for tissue engineering and biosensing. The ability to pattern the topography of the gels at the micro- and nano-scale is desirable in such applications.

2. ObjectivesUV-Nanoimprinting Lithography (UV-NIL) provides a suitable method to pattern the surfaces of photocrosslinkable prepolymers. We have applied UV-NIL to study photosensitive PEG based and acrylic polymers because of their biocompatibility, photosensitivity and transparency. These materials form from a liquid prepolymer (no need of solvent). Acrylic acid or NIPPAm were chosen for their response to pH or temperature respectively which opens to applications as active materials. The study has focused on the comparison of imprinting with diff erent molecular weight polymers.

3. MethodsMaterials: Poly(ethylene glycol) dimethacrylate PEG-DMA, Poly(ethylene glycol) diacrylate PEG-DA, poly(L-lactic acid)- co-poly(ethylene glycol)-co-poly(L-lactic acid) dimethacrylate PLLA-PEG-PLLA, Acrylic Acid (AA), and N-Isopropylacrylamide (NIPAAm), were included in the study.

Equipment: A mask aligner model EVG®620 with micro-contact printing and UV-NIL, equipped with a 365nm UV-lamp of 350W, was used for all the imprints.

Stamp: Ormostamp (Micro Resist Technology) for master replication has been tested. The replication process is a UV-NIL patterning itself using a quartz master with nanometric geometries.

4. ResultsPEGs: Exposure, pressure and photoinitiator concentration were adjusted for each material. High molecular weight polymers did not show good pattern reproducibility. Long chains and low crosslinking density made them fl ow poorly and swell considerably with water. Lower molecular weight prepolymers like PEGDMA (M.w. 550) yielded defi ned patterns and less swelling.

AA and NIPAAm: Polymerisation of AA and NIPAAm was attempted under similar conditions. However, the shortcomings of handling low viscosity liquid monomers like AA, or the diffi culties to dissolve solid NIPAAm, led to a fi nal decision for a co-polymer formulation that would avoid problems associated to the monomers when polymerised on their own.

5. Conclusion/Application to practiceThe results obtained with PEG-DMA, indicate that low molecular weight PEG derivatives could lead to good nanopattern transfer. Other materials such as AA and NIPAAm, which are pH and Temperature-sensitive, can be more diffi cult to use, and it is very important to optimize the photopolymerization parameters to obtain good yields, low monomer residues and good pattern-transfer.


218

Posters

LP-29Metal nanoparticles containing polymer composites for advanced optoelectronic applicationsJ. Pfl eger1, K. Podhajecka1, A. Sharf1, S. Kazim1

1Institute of Macromolecular Chemistry ASCR v.v.i., Dept. of Polymer Materials, Prague, Czech Republic

Polymers fi lled with metal particles have been traditionally used in electronic industry as conductive varnishes for creating conductive patterns or for electromagnetic shielding, and as substitutes of soldering alloys for electrically or thermally conductive attachment of components. In such applications metallic conductivity of particles is combined with a good processibility and mechanical properties of polymers, mostly epoxy resins that, from the point of view of the electronic functionality of the composite, play only a role of a passive matrix.

New properties and functionality appear in the composites when decreasing the size of metal nanoparticles to a nanometer scale. Such metal nanoparticles (NPs) were found to induce spatially strongly localized optical phenomena due to a resonance interaction of surface plasmons with incident light or with excited states of molecules located in a close vicinity of a NP surface. These plasmonic phenomena are applicable in various optoelectronic devices where local enhancement of optical fi elds or photoinduced transitions is desirable, like optical memories based on photochromic transitions, local enhancement or quenching of light emission etc. It showed to be extremely promising to combine conjugated semiconductive polymers that bring their own?plasmonic NPs with pi- optoelectronic functionality. For example, in organic photovoltaic devices plasmonic nanoparticles can modify the photoinduced charge transfer from donor to acceptor, modify the deactivation processes of excited molecules and locally increase optical absorption due to a surface plasmon extinction and/or increased electric fi eld in the vicinity of nanoparticles.

Since the eff ect of surface plasmons decays rapidly with increasing distance the functional polymer molecules must be in a close contact with the nanoparticle surface.

We report on various routes of preparation of pi-conjugated polymer nanocomposites, based on soluble derivatives of polythiophene and containing Ag or Au NPs. The thiophene group of the polymer was found to posses an affi nity to the Au NP surface that allowed the replacement of an original ammonium based NP stabilizer and made the observation of surface enhanced optical phenomena in polythiophene possible. The derivatization of the polymers by imidazolium, pyridinium or carboxylic groups led to even better adsorption abilities of the polymer on the NP surface and, also to the possibility to prepare alternating polymer/NPs structures by self-assembling technique on supporting substrates. Besides usual chemical procedures a laser ablation was tested as an effi cient method of the preparation of NPs with clean surface capable of better interaction with the polymer. The presence of fractal aggregates were detected in some nanocomposites, which yield a very strong enhancement of local optical fi elds in „hot spots“ formed within such nanoparticle assemblies.

Acknowledgement: Financial support No. KAN100500652 of the Grant Agency of the Academy of Sciences of the Czech Republic, Program Nanotechnology for Society, is greatly acknowledged.

LP-30Biosynthesis of metal nanoparticles using cyanobacteriaA. Schröfel1, G. Kratosová1, I. Vávra2

1VSB Technical University of Ostrava, Nanotechnology Centre, Ostrava, Czech Republic2Slovak Academy of Sciences, Institute of Electrical Engineering, Bratislava, Slovak Republic

Nanoparticles may be synthesized using chemical approaches, but now it is possible to use biological materials. There is wide spectrum of possible microorganisms in the synthesis of nanoparticles. The unique chemical, magnetic, optical, and electronic properties of nanoparticles are leading to higher interest in their synthesis. Metal nanoparticles can have wide spectrum of usage such as catalysis, biosensing, biological labeling, electronics, and controlled drug delivery. Nanotechnology involves the production, manipulation and use of materials in sizes close to single atoms.

Although the chemical methods of the metal nanoparticles synthesis are relatively successful, the biological synthesis has recently gained signifi cant interest due to use of mild experimental conditions of temperature, pressure, and pH. With successive methodological improvement, biological synthesis might acquire some extra advantages such as higher productivity, higher stability of nanoparticles, and lower cost. The synthesis and assembly of nanoparticles would benefi t from the development of nontoxic and clean procedures. In last few years, the synthesis of metallic nanoparticles has been reported from bacteria, yeast, fungi, and other biological sources.

The work proposed is focused on the preparation of metal and metal oxides nanoparticles mainly, using biotechnological approaches associated with their subsequent chemical and morphological characterization and further modifi cation. Experiments leading to synthesis of free metal nanoparticles or bionanocomposites by biologically driven processes employing cyanobacteria were performed.


219

Posters

LP-31Optical properties of silicon nanocrystals studied by time-resolved spectroscopyK. Zidek1, F. Trojanek1, P. Maly1, I. Pelant2, K. Dohnalova2, K. Kusova2

1Charles University in Prague Faculty of Mathematics and Physics, Department of Chemical Physics and Optics, Prague 2, Czech Republic

Institute of Physics, Academy of Sciences of the Czech Republic v.v.i., Prague 6, Czech Republic

Starting with the demonstration of intense photoluminescence (PL) of silicon nanocrystals (Si NCs) in 1990, nanocrystalline silicon is ranked among the most studied semiconductor materials. Spatial confi nement of carriers in NCs, which causes the effi cient light emission, opens the way for using silicon as a photonic source. Main prospect is assigned to the possibility of constructing a silicon-based laser, which could be easily integrated into present CMOS technology.

Light amplifi cation by stimulated emission (i.e. a positive optical gain) is an inherent property of an active material in laser. For tailoring Si NCs so as to achieve a useable value of optical gain, it is important to investigate and identify processes of carrier relaxation and recombination, and eventually avoid mechanisms competing with the optical gain, in particular the free-carrier absorption and nonradiative Auger recombination.

We used time-resolved PL spectroscopy to probe the paths of carrier relaxation and recombination in Si NCs. They can be resolved from the PL decay shape and decay time, e.g. there is a typical decay shortening with increasing the excitation intensities for the Auger recombination. Time scales of processes in Si NCs are extending from hundreds of femtoseconds to milliseconds. That is why we used several PL measurements methods (up-conversion technique, streak camera and photomultiplier) to cover the whole range. We studied two diff erent Si NC systems with a high potential in future applications: Si NCs prepared by Si+ ion implantation (fully CMOS compatible technology) and Si NCs prepared by electrochemical etching (very cheap preparation method). Both consist of Si NCs with sizes of a few nanometers embedded in SiO2 matrix.

We observed that carrier relaxation and recombination pathways depend on the parameters of excitation light. The excitation wavelength (aff ecting the initial carrier population of the NC core and defect energy states) and the light pulse duration (aff ecting the rates of the carrier population build-up and decay) can be critical for attaining the positive value of optical gain in Si NCs. We also observed a signifi cant eff ect of Si NC passivation on PL properties. After excitation, carriers are rapidly trapped to NC-SiO2 interface states and they relax to lower interface states. Since the quasi-direct recombination of carriers in the NCs core states is believed to lead to the stimulated light emission, we suggest that the type and quality of NC passivation can be used as a tool for suppression the surface-trapping of carriers, enhancing in turn the optical gain.

LP-32Investigation of physical and mechanical properties of Al nanocomposite reinforced with CNTsF. Ghaharpour1, H. Rajaei1

1University of Mazandaran, Physics, Babolsar, Iran

Abstract: In this paper the physical and mechanical properties of Al Nano composite reinforced with CNTs were investigated. High purity Al powder and Carbon Nanotubes (CNTs) with diff erent percentage were mixed by ball milling method and the composite was fabricated by cold pressing followed by sintering technique. The variation of density and hardness of composite with CNT content were investigated. The micro structure of composite was evaluated by SEM (Scanning Electron Microscope) and XRD (X -Ray Diff raction). The results show that the density and hardness increase with CNT percentage.


220

Posters

LP-33The promises of graphene structures nano-patterned using high resolution Focused Ion BeamsD. Lucot1, J. Gierak1, A. Ouerghi1, E. Bourhis1, B. Schiedt2, L. Auvray2, R. Jede3, L. Bruchhaus3, B. Stegemann3

1Laboratoire de Photonique et de Nanostructures, Essone, Marcoussis, France2Université d‘Evry, Essone, Evry, France3Raith GmbH, 44227, Dortmund, Germany

Graphene is generating a considerable interest in materials science and condensed-matter physics [1]. Nevertheless a crucial technological problem, that will govern future applicability of this material, is related to the patterning of graphene structures while keeping intact the exceptionally high crystallinity and electronic properties of this material. This presentation is aiming at presenting our preliminary investigations in ultra-thin (2-3 nm) graphene sheets manipulation and nano-patterning using a high resolution FIB technique.

The interest of using a fi nely focused pencil of gallium ions for patterning high quality graphene structures is the direct consequence of the energy deposition mechanisms occurring within suspended membranes having thicknesses considerably lower than the projected range of the incoming ions. Such a target structure limits considerably lateral scattering and collision cascades, thus leading to a “stamping-type” FIB patterning process. We will describe the method we have developed for exfoliating and deposing in a clean and controlled way graphene sheets having only few nanometres thicknesses. This methodology allowed us to place onto existing devices suspended graphene sheets with good mechanical and electrical contacts. After graphene sheets exfoliation and position monitoring in optical microscopy or SEM, using the ultra high resolution FIB nanowriter (sub-5 nm) developed in our laboratory [2], we have patterned structures directly onto these suspended sheets. As expected the ion dose necessary for cutting highly resilient graphene sheets is very high. For instance a graphene sheet having a thickness about 3 nm to be drilled requires a point dose of 3.106 ions. As a comparison a 10 nm SiC membrane, for the same conditions, only requires a point dose of 1.106 ions. Also very important we will present the FIB cutting methods we have developed to avoid drifts and reorganization of the graphene foil due to the internal stress.

Finally preliminary characterization results will be presented confi rming the interesting potential of high resolution FIB direct patterning of low dimensional graphene structures that are found to preserve the characteristics of this material.

References:[1] A.K. Geim and K.S. Novoselov, Nature Materials, Vol. 6 March 2007[2] J. Gierak, A. Madouri, et al., Mic. Eng., Vol. 84 (5-8), May-August 2007, Pages 779-783

LP-34Reconstruction of lamellar structure of polyolefi ns and prediction of eff ective diff usivity and mechanical propertiesH. Hajova1, R. Pokorny1, L. Seda1, Z. Grof1, J. Kosek1

1Institute of Chemical Technology Prague, Department of Chemical Engineering, Prague 6, Czech Republic

Semi-crystalline structure of polymers is responsible for their optical and mechanical properties and signifi cantly aff ects the diff usion of small-molecule penetrants through these polymers. Diff usion of monomers is important in reactors and in down-stream processing. The dependence of membrane permeability on its nano-structure is also not suffi ciently understood. This study reports on the development of an algorithm for digital reconstruction of spatially three-dimensional structure of semicrystalline spherulites. Crystalline phase is organized in lamellae of characteristic thickness of 10 nm. Individual spherulites are reconstructed by growing, branching, twisting, stacking and lateral growth of individual lamellae. The result of this reconstruction is converted into spatially 3D matrix of voxels, where each voxel is occupied either by amorphous or crystalline phase. Spherulitic structures with a crystallinity up to 70% can be obtained by the developed program.

In the second part we describe our attempt to statistically characterize lamellar morphology from AFM images of etched polyethylene samples of various origins. We report on our experience with dry etching of real polymer samples, i.e., we do not investigate artifi cial morphologies prepared under well-defi ned laboratory conditions, but real samples.

The third part of this study deals with the understanding of the structure-property relationship between the semi-crystalline structure of spherulites and the eff ective transport and mechanical properties. Thus we demonstrate reconstructed polyethylene materials with the same crystallinity but with diff erent diff usivity of small penetrants. We also describe our fi rst attempt to predict eff ective mechanical properties of semi-crystalline polymers by the discrete element method.


221

Posters

LP-35Positioning of nanostructures by surface anchored DNA synthesis and molecular ink lithographyE. Reiss1, M. Breitenstein1, A. Christmann1, R. Hoelzel1, F. Bier1

1Fraunhofer Institute for Biomedical Engineering IBMT, Nanobiotechnology and Nanomedicine, Potsdam, Germany

For a controlled interaction of DNA based nanodevices with the macroscopic world a well defi ned contact to surfaces is advisable. For this purpose we have developed two complementary methods:DNA based self-organisation allows the assembly of nanodevices into larger structures, since distinct positions on a DNA-scaff old can be specifi cally addressed by their base sequence. For this we have developed a system for the surface anchored synthesis of single stranded DNA by rolling circle amplifi cation. Being integrated into a fl ow-through system with optical access, the DNA molecules can be fl uorescently stained, hydrodynamically stretched and then hybridised with complementary nucleotides that are tagged to nano-objects. Surface properties have been adjusted to control the adhesion of both educts and products. Parallel, stretched ssDNA molecules of several tens of micrometres have been synthesised.For the second method the tip of a scanning force microscope is used to „write“ oligonucleotides onto surfaces by molecular ink lithography with great positional accuracy. Coupling to the surface is accomplished with methods adapted from microarray technology, in this case covalent coupling of amino-modifi ed oligonucleotides to epoxy-functionalised glass surfaces. Since the supply of molecules from the scanning tip to the surface is mediated by a water meniscus, temperature and relative humidity are controlled by placing the setup into a climatised chamber. Loading of the tip is performed through a fl uidic system. The system currently allows the routine preparation of nanoarrays with 3x3 spots of 300 nm size at arbitrary positions.

LP-36Strained fi lm nanophases in the transition metal-silicon system: formation and stabilityN. Plusnin1, V. Iliyashenko1, S. Kitan‘1

1IACP FEB RAS and VSUES, Surface science department of IACP FEB RAS, Vladivostok, Russia

Bulk phases of the transition metal - silicon system fi nd a wide application in the present-day technology of electronics. However, when the layer thickness is reduced down to nanometer, requirements of saving the substrate structure arises after fi lm formation. Here, it has been presented the review of experimental results devoted to formation and stability of strained fi lm nanophases of transition metals (Cr, Co and Fe) and their silicides on silicon substrates. A systematical investigation of the Cr-Si(111) system [1-5] showed that formation of strained fi lm nanophase of silicide on silicon is connected with the intermixing of metal with silicon. And it turned really out, that it is observed the intermixing rate decrease and tendency to the layer-by-layer growth during increase of the deposition rate and decrease of source material temperature. As a result of investigation of the deposition regime infl uence on the process, it was reached the success in realization of the layer-by-layer growth of Cr fi lm nanophases on Si(111) up to the thickness of 3-4 ML [2]. Father investigation was carried out in the Co-Si(111), Fe-Si(111) and Fe-Si(001) systems [1-11]. In addition to previous parameters of the deposition, they showed else that it is necessary to optimize the time of deposition and the rate of substrate indirect heating from source radiation. The layer-by layer growth of fi lm nanophases of Co on Si(111) [3, 9], Fe on Si(111) [6-8] and Fe on Si(001) [9, 10] was obtained with assistance of the optimal regimes beginning from the thickness of 1 ML and fi nishing the thickness of ten and more ML. It was discovered that the composition and morphology of atomic thin (1-2 ML) fi lm nanophases of Fe on Si(001) are stable in relation to moderate (up to 250 oC) annealing [10] and also to oxidation [11]. And vice versa, the nanophases with the thickness of 3-7 ML are metastable and mix with silicon of the substrate already at 100-150 oC with formation of silicides having composition from FeSi up to Fe3Si [10].

References:[1] N.I. Plusnin et al, Appl. Surf. Sci. 166, 125 (2000).[2] N.I. Plusnin et al, Phys. Low-Dim. Str. 9/10, 129 (2002).[3] N.I. Plusnin et al, Phys. Low-Dim. Str. 11/12, 39 (2002).[4] N.I. Plusnin, J. Electr. Spec. & Rel. Phenom. 137, 161 (2004).[5] N.I. Plusnin, Surface investigation (Rus). 1, 17 (2005).[6] V.M. Il’yashenko et al, Phys. Low-Dim. Str. 2, 42 (2006).[7] N.I. Plusnin et al, Tech. Phys. Lett. 33, 486 (2007).[8] N.I. Plusnin et al, Appl. Surf. Sci. 253, 7225 (2007).[9] N.I. Plusnin et al, Key Eng. Materials. 381-382, 529 (2008).[10] N.I. Plusnin et al, J. Physics: Conf. Ser. 100, 052094 (2008).[11] S.A. Kitan’ et al, Proc of 16th Int. Symp. “Nanostructures: Physics and Technology”, Vladivostok, Russia, 2008, Ioff e Institute, 122 (2008).


222

Posters

LP-37Loading of porous coordination polymers with metalorganic precursors and metal nanoparticlesM. Meilikhov1, K. Yusenko1, D. Zacher1, D. Esken1, R.A. Fischer1

1Ruhr University Bochum, Inorganic Chemistry II, Bochum, Germany

Polymeric coordination frameworks with microporous regular channel structures, which are regarded as porous coordination polymers (PCPs), are promising materials for applications in catalysis, gas storage and sensoring. Looking at the catalytic applications of such adsorbate systems of type “metal@PCP” or “precursor@PCP” the host guest chemistry aspects have to be better investigated. Our attention was concentrated on the packing of guest molecules inside the 1D channels of MIL-53(Al). Ferrocene (Fc) and its derivatives were selected as test guest molecules. The incorporation of 1,1’-ferrocenediyl-dimethylsilane inside the channel of MIL-53(Al) gives the fi rst known post-synthetic functionalization of the bridging OH-group of the SBU units. After the performed functionalization the material shows catalytic activity in the hydroxylation reaction of benzene. The shown possibility of the modifi cation can give new electro- and catalytically active PCPs. Metal nanoparticles incorporated into a PCP are highly dispersed and may show stronger catalytic activity due to the high surface area. The synthesis of copper nanoparticles inside MIL-53(Al) was performed using suitable precursors [CpCu(CNtBu)] and [Cu(acac)2]. The resulting copper particles size after the hydrogenation of the loaded material is 5-8 nm. The synthesis of ruthenium nanoparticles (1-2 nm) inside MIL-101(Cr) were obtained using [Ru(cod)(cot)] as a suitable precursor. Another interesting system for metal particle incorporation is ZIF-8 (Zeolitic-Imidazolate-Framework) with narrow pore aperture windows and very high thermal stability. [(CO)AuCl] was used to obtain gold nanoparticles inside ZIF-8 with a particle size of 1-2 nm. All the experiments are preliminary work aiming on possible loading of thin PCP fi lms deposited on diff erent kind of substrates. First experiments on in situ loading of PCP fi lms with dye were also performed during the growth process of it. [1] Meilikhov, M., Yusenko, K., Fischer, R.A. Dalton Trans., 2008, 600. [2] Meilikhov, M., Yusenko, K., Fischer, R.A. J. Am. Chem. Soc., submitted.

LP-38Advanced characterization of polymer-clay nanocomposites: application of in-line near infrared spectroscopy and on-line extensional rheologyM. Kracalik1, S. Laske2, M. Feuchter2, G. Maier3, G. Pinter2, G.r Rüdiger Langecker1, C. Holzer1

1Institute of Plastics Processing, University of Leoben, Leoben, Austria2Institute of Materials Science and Testing of Plastics, University of Leoben, Leoben, Austria3Materials Center Leoben Forschung GmbH, Leoben, Austria

Characterization of polymer-clay nanocomposites comprises typically X-ray diff raction, mechanical, thermal and rheological analysis sometimes supplemented by transmission electron microscopy. From the industrial point of view, these methods are not attractive due to the necessity of samples preparation and complexity of the measurements. Furthermore, results of conventional measuring methods have to be compared with each other in order to get reliable information about material behavior. An interesting approach for the industrial application is the use of in-line near-infrared (NIR) spectroscopy and on-line extensional rheology. The chemical and physical interactions between the fi ller and polymer matrix during compounding manifest themselves by diff erences in NIR spectrum. Therefore, it is possible to correlate material properties with NIR spectra as dependency on diff erent processing conditions and material composition. Extensional rheometry performed through a by-pass system in the extruder has been applied in order to identify changes in the melt elongational behaviour. Individual silicate platelets form a nanoscale network (cardhouse structure) and raise the melt strength of the composite. In this way, on-line assessment of the material reinforcement is possible. The chemometrical modelling based on evaluation of NIR data together with specifi c material characteristics (e.g. melt strength, tensile strength, level of fi ller dispersion) allows to predict these characteristics for the further compounds (diff ering e.g. in screw speed, screw geometry, processing temperature) directly during the extrusion process. It was confi rmed that prediction of melt as well as tensile strength or interlayer distance of the organoclay in polypropylene nanocomposites possesses high reliability (at least 0.95 coeffi cient of regression) of the chemometrical models. In this way, it is possible to assess the infl uence of processing conditions (e.g. screw speed, screw geometry) on the material properties directly during compounding. Consequently, development time of the new materials based on polymer composites and blends can be signifi cantly shortened.


223

Posters

LP-39Preparation of nano-arrays by an atomic force microscopeM. Breitenstein1, A. Christmann1, R. Hoelzel1, F. Bier1

1Fraunhofer Institute for Biomedical Engineering IBMT, Nanobiotechnology and Nanomedicine, Potsdam, Germany

Nanoscale constructs based on nucleic acids can be prepared exploiting self-assembly processes. To apply these constructs they usually have to be connected to the macroscopic world. This contact to a surface can be accomplished with the help of an atomic force microscope (AFM). For this the AFM tip is loaded with a reaction partner which is released upon contact to the surface („dip pen nanolithography“). This phenomenon can be explained by diff usion through a water meniscus that is built up between surface and tip.In by far most cases a gold-to-thiol reaction is used for coupling to the surface. Here we present results exploiting covalent coupling between an epoxy-modifi ed glass surface and amino-modifi ed oligonucleotides. This should pave the way for downscaling methods that have already been well established in micro-array technology for the production of nano-arrays.The supply of molecules from the AFM tip to the surface strongly depends on the water meniscus‘ properties and, hence, on temperature and relative humidity. Therefore we have placed the complete AFM head into a climatised chamber. A fl uid system was designed that allows loading of the tip with diff erent substances and that still gives good reproducibility concerning tip position. The infl uence of physical parameters as well as of additives to the DNA solution was tested.Currently nano-arrays with 3x3 spots of 300 nm diameter each are routinely prepared. Micro-arrays of more than 100 spots with 2 μm size can be produced with slight modifi cations of the protocol. The method will be applied to the analysis of minute volumes, e.g. of single cells, as well as to the anchoring of nanodevices.

LP-40Gold nanorods for biotechnology applicationsF. Novotny1, A. Fojtik1, M. Giersig2

1Czech Technical University in Prague Faculty of Nuclear Sciences and Physical, Department of Physical Electronics, Prague, Czech Republic2Freie University Berlin, Institute for experimental physics, Berlin, Germany

Gold nanorods (GNRs) are very interesting material due to the appearance of localized surface plasmon resonance (LSPR). The LSPR of GNRs is splitted into two modes where the frequency of the longitudal one is strongly dependent on the rod aspect ratio. Therefore one can tune optical properties of the sample by controlling the aspect ratio of rods. As gold nanomaterials also have a good chemical stability under various conditions and with regard to their biocompatibility, these materials are interesting candidates for bioconjungation and usage in biological systems.

A number of methods of gold nanorod synthesis were explored and some of them were refi ned to the point, where one can grow large volumes of high-yield samples directly in solution. Such colloidal aqueous solution is very convenient for further biofunctionalization. We use the seed mediated growth in the presence of silver nitrate to obtain aqueous solutions of monodisperse rods with controlable aspect ratio. The monodispersity is the key issue for futher successful deployment and addressability in biological systems. Sample characterisation is then carried out by the means of absorption spectroscopy of LSPR bands, SEM, and TEM imaging.

GNRs show potential in biological/biomedical fi elds, especially photothermal therapy, biosensing, imaging, and gene delivery for the treatment of cancer.

This work has been supported by the Czech Ministry of Education, Youth and Sports in the framework of the Research Plan 60840770022 and by the Grant Agency of the Academy of Science of the Czech Republic, project KAN400670651, grant GACR c. 202/07/0818 and CTU0804114.


224

Posters

LP -41Molecular design of novel small molecular semiconductors for molecular electronicsM. Weiter1, M. Vala1, J. Vynuchal2

1Brno University of Technology, Faculty of chemistry, Brno, Czech Republic2Research Institute of Organic Syntheses, 533 54, Rybitvi, Czech Republic

ObjectivesNowadays, we can see a strong eff ort in seeking for highly performing materials for cheap organic electronics such as organic light emitting diodes and displays, thin fi lm transistors, RFIDs, sensors and others. Together with high performance of the materials, the usual second requirement is their high photo- and thermal- stability. In contrast to frequently used semiconducting polymers, some of the small molecular semiconductors posses a remarkable chemical, heat, light, and weather fastness. Therefore a novel derivatives of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (thereinafter referred as DPP) was designated, synthesized and characterized. DPPs represent recent industrially important class of high-performance pigments. Some of their physical properties such as high melting points are exceptional in view of the low molecular weight relative to pigment standards.

ResultsSeveral diff erent derivatives of DPP with alkyl side groups were synthesized to increase their solubility. Simultaneously, groups with various electron donating or withdrawing ability were linked to the basic pyrrolinone core to improve some of their optical and electrical properties such as absorption molar coeffi cient, conductivity, photogeneration yield and others. Thermal and thermooxidative stability was studied by thermal gravimetry and diff erential scanning calorimetry at temperature range from 40°C to 650°C in either nitrogen or air. Relationship between the molecular structure of DPPs, organic thin fi lm morphology and their optical and optoelectronic properties such as charge transport, electroluminescence, photogeneration and sensing properties were studied. The experimental characterizations were accompanied with quantum chemical calculations.

ConclusionIt was shown, that depending on the side groups substitution, studied DPPs exhibit high molar absorption coeffi cient as well as high quantum yield of fl uorescence or signifi cant quantum yield of photogeneration. The sensing properties of the molecules were tuned by substitution of appropriate side group. Prototypes of organic light emitting diodes, solar cells and sensors were constructed to demonstrate the application possibility of DPPs.


225

Posters

LP - 42Nanostructures and mechanical/optical properties: a new approach for transparent „intelligent“ PECVD coatingsS. Costacurta1, L. Manodoril1, F. Enrichi1, R. Ricoco1, A. Patelli1, S. Vezzu1, P. Falcaro1, F. Marinello1, E. Zanchetta2, M. Guglielmi2

1CIVEN / Nanofab, Thin fi lm deposition, Venezia, Italy2 Universita di Padova, Dipartimento di Ingegneria Meccanica, Padova, Italy

Nanoparticles are increasingly used in coating technology, embedded in sol-gel or polymer matrices to impart specifi c properties to diff erent materials and surfaces. On the other hand, the weak mechanical properties and low fl exibility exhibited by polymers and sol-gel coatings limit the range of applications of such coatings. Coatings obtained by PECVD are good candidates as matrices with improved mechanical properties and are expected to widen the industrial application fi elds of such nanostructured coatings.

The fundamental aspects of this process such as density and size of the nanoparticles and evaluation of their functional effi ciency were considered.

The eff ects of the nanostructure on the mechanical properties were studied introducing silica nanoparticles into a silica coating obtained by PECVD. The diameter of the silica nanoparticles was varied between 60 and 300 nm, and diff erent densities of nanoparticles (n° particles per coating volume) were tested. These coatings were characterised by AFM, SEM, FTIR and GDOES, while the mechanical tests were performed by microscratch and nanoindentation.

In particular conditions of nanoparticle density and matrix thickness, the coating showed an increase in toughness, avoiding fracture propagation and leading to a plastically deformable hard silica coating. Results on coating resistance on stainless steel sheet bending are shown in order to evaluate the possibility to perform the deposition on the sheet before the processing. Surface roughness was studied as a function of thickness and nanoparticle density. Optimised conditions have been found in order to avoid the interference fringes, maintaining transparency.

These silica matrices may be used in combination with diff erent kinds of nanoparticles in order to obtain coatings exhibiting functional properties. In particular, UV fi lters for protecting plastic and organic materials can be prepared by the introduction of ZnO nanoparticles in the silica coating.

LP-43Pulsed sliding discharge enhanced chemical vapor deposition system for the catalytic growth of dense carbon nanotubes forestsE. Shulga1, A. Treschalov2, S. Tsarenko2, V. Tsubin2

1Institute of Physics, Laboratory of nanostructure physics, Tartu, Estonia2Institute of Physics, Laboratory of Laser Techniques, Tartu, Estonia

Development of pulsed sliding discharge enhanced chemical vapor deposition (CVD) system for the catalytic growth of dense aligned carbon nanotubes (CNTs) is presented and discussed. Methane and hydrogen gas mixture fl ow was processed in the pulsed sliding discharge reactor operated at 2,7 kPa. Low temperature plasma was produced in high current sliding discharge on sapphire surface (discharge voltage 5-15 kV, pulse repetition rate 10 - 300Hz, pulse duration ~10ns). Catalyst layer was obtained by coating a silicon substrate with aluminum and cobalt salts and further heated until respective oxides were formed on the surface. CNT growth occurred at substrate temperature range from 500C to 750C. Infl uence of substrate temperature and discharge properties on length, diameters and morphology of CNTs will be discussed.


226

Posters

LP-44Photoluminescence spectroscopy of multicolour photochromic silver - titanium dioxide nanocompositeJ. Preclikova1, P. Galar1, F. Trojanek1, P. Maly1

1Charles University in Prague, Faculty of Mathematics and Physics, Prague, Czech Republic

The unique multicolour photochromic response of the nanocomposite material consisting of silver nanoparticles embedded in titanium dioxide matrix was found in 2003 [1]. The presence of Ag nanoparticles of diff erent shapes and sizes results in an inhomogeneous broadening of the extinction spectrum of the nanocomposite. The selective light excitation of Ag nanoparticles initiates microscopic processes leading to changes of the extinction spectra in the spectral neighbourhood of the excitation wavelength. The irradiated spots seem to get the colour of the exposing light. The foreseen applications of the multicolour photochromic materials could be multiwavelength optical memories or postdeposition recoulourable paints.

We implemented technology of preparation of thin fi lms of Ag-TiO2 nanocomposite and found optimal values of parameters leading to a pronounced photochromic response [2]. On basis of the detailed investigation of early stages of the photochromic transformation we proposed a phenomenological model to quantify the evolution of the extinction spectrum [3]. Despite of our eff ort and of the research activity of other groups [4,5], the exact microscopic mechanism of the multicolour photochromic transformation is still unknown.

In the present study, we aim to complete the information on the photochromic process using photoluminescence spectroscopy. We concentrate on the sub-band gap energy states of the unloaded TiO2 matrix and also of the Ag-TiO2 nanocomposite. The photoluminescence spectrum of the TiO2 matrix is dominated by a broad band centred at 2.4 eV. The deposition of the Ag nanoparticles results in a decrease in the intensity of this band and in a creation of a new band in the UV region at 3.7 eV. The intensity of the latter band increases during the photochromic transformation of the nanocomposite under laser irradiation (594 nm). The UV band can be attributed to Ag cations the number of which increases during the light illumination. Our results support the hypothesis, that the silver nanoparticles are oxidized during the photochromic transformation.

References:[1] Y. Ohko et al., Nature Materials 2, 29 (2003)[2] J. Preclíková et al., Phys. Stat. Sol. (c) 5, 3496 (2008)[3] J. Preclíková et al., Journal of Nanoscience and Nanotechnology, in print[4] Y. Ohko et al., Chem. Commun. 1288 (2005)[5] C. Dahmen et al., Appl. Phys. Lett. 88, 011923-1-3 (2006)


227

Posters

LP-45Direct FIB fabrication and integration of single nanopore devices for the detection of macromoleculesB. Schiedt1, L. Auvray2, L. Bacri2, A.L. Biance3, A. Madouri1, E. Bourhis1, G. Patriarche1, J. Pelta2, R. Jede4, J. Gierak1

1LPN/CNRS, Laboratoire de Photonique et de Nanostructures, Marcoussis, France2Universite d‘Evry Val d‘Essonne, Laboratoire MPI (Materiaux Polymeres aux Interfaces), Evry, France3Universite Claude Bernard Lyon 1, LPMCN UMR 5586, Villeurbanne, France4RAITH GmBH, , Dortmund, Germany

Since several years, nanopores in thin solid state membranes, individual or as arrays, have found a growing number of applications, for example to use them as stencils or masks to grow or depose nanostructures, or to fabricate single molecule electronic detectors or sensors. The latter is probably one of the most prominent among them and consists in using the membrane as a dividing wall in an electrolytic cell and drawing charged molecules by an electric fi eld through the pore. The resulting current blockage signal reveals information about the passing molecule so that e.g. DNA or proteins can be manipulated and studied at a single molecule level in native conditions.

Among the diff erent techniques currently capable to achieve this demanding task, one promising approach is to use a FIB system, which can produce such holes directly at specifi ed locations with customised organisation and shape.

Here we propose to detail an innovative FIB instrumental approach and processing methodologies we have developed for sub-10 nm nanopore fabrication. The main advantage of our method is fi rst to allow direct fabrication of nanopores in relatively large quantities with an excellent reproducibility (Fig. 1). Second our approach off ers the possibility to further process or functionalize the vicinity of each pore on the same scale keeping the required deep sub-10 nm scale positioning and patterning accuracy.

We will summarise the optimisation eff orts we have conducted aiming at fabricating thin (10-100 nm thick) and high quality dielectric fi lms to be used as a template for the nanopore fabrication, and at performing effi cient and controlled FIB nanoengraving of such a delicate media. We have successfully demonstrated the possibility to apply FIB technology for the direct fabrication of devices drilled with pores having diameters down to a few nanometres (Fig. 2 a,b).

Finally, we will describe the method we have developed for integrating these “single nanopore devices” in electrophoresis experiments and fi rst translocation measurements (Fig. 2 c).

The fi nal advantage of our FIB processing technique is to allow the realization of a large number of identical membranes within a single processing batch, yielding the advantage of combining the advanced FIB processing technique together with parallel fabrication such as conventional lithography and etching processes. Such an effi cient combination demonstrates that FIB processing can be put in line with the advanced technologies thus allowing new fabrication routes to be open.


228

Posters

LP-46On the Development of Fiducials Mark Design and Calibration Methods for Micro and Nano-CMM Multi-Probe and Multi-orientation Measurement StrategiesB. de la Maza1

1Innovalia Association, Bilbao, Spain

The importance of micro- and nano-metrology in the area of manufacturing is becoming increasingly important in order to ensure that the potential of such manufacturing technologies can be leveraged in a repeatable form. To this eff ect, the need of fl exible and universal micro and nano CMM means to carry out metrology tasks, similar to the meso and macro world are still to be realised. The FP6 European project Nano-CMM (http://www.nanocmm.net/) is carrying out with this aim. Within the NanoCMM European project there is a focus on the development of probe systems and the integration of such probes into 3D Micro/Nano CMM. Such fl exible equipment is used to measure geometric properties of parts manufactured employing micro and nano technology processes, exploiting suitable reference and calibration artefacts.

LP-47Similarities and diff erences in the development of bio- and nanotechnologiesJ. Rogut1, A. Rogut1, K. Czaplicka1

1Glowny Instytut Gornictwa, Glowny Instytut Gornictwa, Katowice, Poland

Nanotechnology is the strong “new kid on the block” on the list of emerging technologies attacking the globalised society with highly contradictory messages. Similarly to the bio-energy, clean coal technologies, hydrogen economy and large scale geoengineering (as some examples) it is presented either as the silver bullet by the supporters or as the defi nite reasons for future disaster by the opponents. In contradiction to the other technologies mentioned earlier, the nanotechnology products contribute now in a signifi cant part of high-tech markets (computers, cameras, electronic gadgets, cosmetics), moreover, the branch is expected to be the key medium for the recovery of the world economy from the recent fi nancial troubles. Taking the above into account, very recently, the European Parliament has decided to elaborate the resolution on the regulatory aspects of nanomaterials to control the level of potential risks which could arise from this technology.

Our presentation identifi es the lessons which could be derived and applied in a responsible policy of further development of nanotechnology involving the economic and environmental analysis of the experiences as well as the successes and faults of the preceding technologies of a similar controversial nature. This analysis has allowed us to specify a check list of questions which need to be answered before the novel nanotechnology products and processes could obtain a green light for further development. Including these considerations into progressing the technology may prove essential.”

The work has been conducted at GIG in the frame of PBZ-KBN-117/T08/2005 Project: “Materials and technologies for hydrogen economy” funded by the Polish Government.

LP-48Optoelectroactive Organic Polymer Nanocomposites: PAni-PEDOT E. Chimamkpam1, A. Engel2, R. Hauert3, A. Schilling2, G. Patzke1

1University of Zuerich, ACI, Zuerich, Switzerland2University of Zuerich, Physics, Zuerich, Switzerland3Empa - Swiss Federal Laboratories for Materials Testing and Research, Nanoscale Materials Science, Dübendorf, Switzerland

Conducting polymers are promising materials that have attracted increasing attention due to their tunable electronic and optical properties. Innovative developments can be achieved by synergistic blending of two building moieties of such polymers on the nanometer scale to form new organic nanocomposites. Polyaniline and Poly(3,4-ethylenedioxythiophene) are famous family members of conducting polymers. Besides their respective optical and electronic properties, both exhibit excellent chemical and environmental stability and they excel through cost-eff ective processing. These characteristics render them important for applications in integrated electronic and optoelectronic devices. Enhancement of these properties for better device performance and for a wider range of applications triggered our quest for a simple bottom-up combinatorial approach to obtain new materials that incorporate units of both polymeric species in a rational proportion. Here, we present the optical and electrical behaviour of the new copolymer nanostructures that indeed expounded on their intriguing nature and applicative potentials.

Depending on the compositional amount of the two building blocks in the nanocomposites, varying optical band gaps that span almost the entire visible region were observed. In fact, there are obvious diff erences between the band gaps of the nanocomposites and those of their parent species, which affi rms that they are not mere admixtures. Such diff erences are also evident in their electrical properties, where the organic nanocomposites display an increased room-temperature conductivity and a temperature-dependent conductive behaviour that extends down to below 20 K, which points to an improved electronic transport mechanism as compared to polyaniline [1]. The combination of these useful properties is expected to allow for the fabrication of novel device architectures based on the optoelectroactivity of the new materials.[1] E.F.C. Chimamkpam, F. Hussain, A. Engel, A. Schilling, G. R. Patzke, Z. Anorg. Allg. Chem. 2009, 635.


229

Speakers’ Profi les

Rob Aitkenis Director of Strategic Consulting at the Institute of Occupational Medicine (IOM) and the Direc-tor of the SAFENANO initiative. SAFENANO (www.safenano.org) is one of UK’s 23 Nanotechnol-ogy Centres of Excellence and has the unique remit to interpret and disseminate the emerging health safety and environmental information about nanoparticles to help industry understand and mitigate the potential risks. He also leads IOM’s work programme on nanotechnology risk which currently encompasses eight EU framework projects, a series of major public reviews for Government Departments in the UK and elsewhere as well as other research or consultancy activities. He is also the co-ordinator of SnIRC, www.snirc.org a multidisciplinary research collaboration working on nanoparticle risk issues which also included Napier and Edinburgh Universities.

Robert J AitkenDirectorInstitute of Occupational MedicineResearch Avenue North, RiccartonEdinburgh, UK0044 131 449 [email protected]

Livio Baldi was born in Tortona (Alessandria) in 1949. He graduated in Electronic Engineering in 1973 at the University of Pavia. In 1974 he joined SGS-ATES (now STMicroelectronics), in the Central R&D of Agrate Brianza, working at the development of MOS and CMOS processes. He has been responsible for the development of CMOS processes for EEPROM memories and multifunction logic. In 1999 he has been put in charge of the NVM Design Platform Development Group, with the mission to provide design tools, design methodology and libraries support to the develop-ment of stand-alone and embedded Non Volatile Memories. From 2001 to 2008 he has taken the responsibility for the coordination of cooperation research projects, and represented ST-Italy in the MEDEA+ Steering Group-Technology and in the Support Group of the European Technology Platform (ENIAC). He has acted as consultant for the Commission in the defi nition of Framework Programmes and he is member of the Expert Advisory Group for Theme 4 (Nanoscience, Materials and Production Technology) of FP7. From March 31st, 2008 he has moved to Numonyx, the new ST-Intel joint venture on Flash memories, in charge of External Relations and Funding in Central R&D. He holds 32 US patents, 17 European patents, and is author of more than 65 papers and communications to conferences.

Baldi LivioNumonyxVia C.Olivetti 2, 20041 Agrate Brianza (Mi), ItalyTEL.: +39-39-603-5015FAX.: +39-39-603-5055E-MAIL: [email protected]


230


Flemming Besenbacher Academic experience: 2008: Professor Honoris Causa from Huazhong Normal University, Jilin University, and Zhejiang University of Technology, China; 2007: Honorary Prof. at Henan University (China) and Tianjin University (China); 2004-09: Honorary Prof. at Aalborg University; 1997: Visiting Prof., Lawrence Berkeley Nat. Lab., USA; 1996: Full Prof., Aarhus University; 1994: D.Sc., Aarhus University; 1989-95: Associate Prof., Aarhus University; 1986-89: Assoc. Res. Prof. by the Danish Council for Research Policy; 1982-86: Associate Prof., Aarhus University; 1982 and 1983: visiting scientist, Sandia Nat. Lab., Albuquerque; 1978: graduated from Institute of Physics, Aarhus University. Research awards: 2009: Aarhus Trade Prize. 2008: Recipient of one of the prestigious ERC advanced research grants from the European Research Council. 2008: Bird-Steward- Lightwood Lectureship award at the Dept. of Chemical and Biological Engineering at University of Wisconsin-Madison, 2007: The Knight’s Cross of the Order of the Dannebrog; 2007: Honoris Causa from Henan University and Tianjin University, China. 2006: The Grundfos award for outstanding research within nanoscience; 2004: Industrial Prize of the Danish Academy of Natural Sciences; 2003: Villum Kann Rasmussen Award for outstanding research achievements in science and great eff orts in nanotechnology; 2002: co-recipient of grant for center of excellence: “Towards a new hydrogen economy”; 2001: Co-recipient of grant for center of excellence: “Nanoscience and Tissue Engineering approaches to improved biocompatibility; 2000: member of Scientifi c Advisory Board, Max-Planck-Institut für Festkörper-forschung, Germany; 1995: Danish Physical Society’s Research Prize for research achievements in surface science using scanning tunneling microscopy; 1993-2003: Corecipient of grant for the center of excellence: Center for Atomic-scale Materials Physics (CAMP) by the Danish National Research Foundation.Leadership: 2008: Board member of the MedTech Innovative Center, Aarhus, Denmark. 2005-: Member of the board of the Carlsberg Foundation; 2005: Member of the board of the Carlsberg research Laboratories; 2005-:Member of board of the Carlsberg Breweries; 2005-: Board member of the Tuborg Foundation; 2005-:Appointed Director of the NANOFOOD consortium; 2004: Danish representative on EU Program Comm. for 7th Framework Programme; 2002-: Head of iNANO graduate school (iNANOschool), Aarhus University; 2002-: Head of Interdisciplinary Nanoscience Center (iNANO) Aarhus University; 2001: Danish representative on Phys. and Eng. Sciences unit, European Science Foundation; 2001: Danish representative on EU COST-Nanoscience; 2001: advisory comm. on nanotechnology, Danish Ministry of Education; 2001: Head of scientifi c advisory comm. on nanotechnology, Danish Research Ministry; 1999: EU expert comm. on Nanotechnology in 6th Framework Program; 1993-2002: Vice-director of “Center for Atomic-scale Materials Physics” (CAMP) sponsored by the Danish National Research Foundation; Research Areas: Nanoscience, nanotechnology, nanocatalysis, structure and reactivity of clean, adsorbate-covered and alloy surfaces, scanning tunnelling microscopy, atomic force microscopy, nucleation and growth of nanoclusters, interaction of hydrogen with defects in metals, hydrogen storage, quantized conductance in nanowires, diff erent penetration phenomena, adsorption of bio-molecules at surfaces, biocompatibility, biosensorsMemberships of committees: International Organizing Committee of NTNE09 (2009); International Advisory Committee of ISSS-5 (2008), International Organizing Committee of NTNE08 (2008); Scientifi c Advisory Committee, NANOMAT Programme (2008); Member of international evaluation committee of MESA+ (2008); Danish National Network for the 7th EU Framework Programme (2007-); Scientifi c Advisory Board, Centre for Molecular (Bio) medicine, Trieste, Italy (2005-); Member of the Danish Natural Science Research Council (1998-2004); Scientifi c Committee of the Fifth Nordic Conference on Surface Science (Finland 2004);Chair of the Programme Committee for NANO-7 & ECOSS-21; International Advisory Board of ECOSS-22; Elected Fellow of the Royal Danish Academy of Sciences, 1998, of the Danish Academy of Technical Sciences (ATV), 1997, of the Danish Academy of Natural Sciences (DNA) 1997, and Fellow of the Institute of Nanotechnology. Editorial board of: NANOMEDICINE: Nanotechnology, Biology and Medicine (2008-); ACS-NANO (2008-); Advanced Biomaterials (2008-); Open Condensed Matter Physics Journal (2007-); Journal of Nano Education (2007-2009); Nano Today (2006-); Nanoscale Research Letters (2006-); Physical Review Letters (2006-2008); Journal of Scanning Probe Microscopy (2006-2008); Journal of Nanotechnology (2004-2008); Small (2004- ); Nanoletters (2003- ) Surface Science (2003-2008); Journal of Physics - Condensed Matter (2001-); Journal of Nanoscience (2002-); Journal of Nanoscience and Nanotechnology (2001- ); Progress in Surface Science (1999-); Probe Microscopy (1999-); Surface Review and Letters (1998-); Chemical Physics Letters (1996-2000) Referee for: Science, Nature , Nature Materials, Nature Nanotechnology, Phys. Rev. Letters, Phys. Rev. B, JACS, ACS-NANO, Surface Science, Jour. Chem. Phys., Langmuir, Angewandte Chemie, Nanotechnology, NanoLetters, Europhysics Letters, Chemical Physics Letters, Surface Review and Letters, Probe Microscopy; Progress in Surface Science, European Research Council. I have been referee for larger research proposal for the research councils in Japan, US, Sweden, Italy, Netherlands, Switzerland, Ireland, Germany, Austria and Norway. Invited talks: Plenary at int. conf.: 159 since 1990, at research institutions and universities: approx. 90 since 1990 EU grants: ERC, Advanced research grant, European Research Council, VIN; Integrated project, the 6th Framework, PICOINSIDE; Network of Excellence the 6th Framework, FRONTIERS; STREP under the 6th Framework, Nanocues; Research Training Network, Atomic and molecular manipulation as a new tool for science and technology (AMMIST); Research Training Networks, Reactivity of clean and modifi ed oxide surfaces (OXIDESURFACES); Information Society Technology, Bottom-Up-Nanomachines (BUN); Training and Mobility of Researchers (TMR) Programme. Publications: As per January 2009, my publication list contains 12 patents and more than 390 entries in international, refereed journals, including: Book chapters and Reviews: 19, Nature: 3, Nature Materials: 3, Nature Nanotechnology: 1, Science: 10, Physical Review Letters (PRL): 48, Journal of Applied Physics: 12, Applied Physical Letters: 6, JACS: 11. My published articles have been cited more than 10.634 times and my H- index is 57. Supervision 1999 - 2009: 26 PhD students am currently supervising 13 PhD students. I have supervised 18 Master of Science students. Since 1994 I have been a member of the PhD Committee at the Department of Physics and Astronomy and as such been head of the evaluation committee at more than 20 PhD exams. Since 2003 I have been the director of the graduate school, iNANOschool, in which 125 PhD students are currently enrolled.


231


Patrick Boisseau is graduate from the Institut National Agronomique in 1983 and from the Ecole Nationale du Génie Rural, des Eaux et des Forêts en 1985.He has a Master’s Degree in Human Nutrition. He joined the French Atomic Energy Commission - CEA - in 1987 to work for 7 years as academic research fellow in plant biology. He then moved for 4 years to the Foresight & Strategy Division at the CEA headquarters as expert on strategy in life sciences and environment. From 2001 to 2004, he is committed to the design, the organisation and the funding of the NanoBio innovation centre in Grenoble. The NanoBio innovation centre brings together engineers, physicists, chemists, biologists and medical doctors to develop new miniaturised tools for biological applications (130 people involved incl. SMEs). The Nanobio center has been established with the University of Grenoble. Fundamental and applied research in nanobiotech is performed by several institutes and universities in Grenoble in cooperation with leading industrial companies in the diagnostics and biochips sector. The NanoBio center is linked to the Minatec Innovation Center, the 1st European centre for micro- and nanotechnologies and will rely on its technological facilitiesFrom 2004 to September 2008, he is the coordinator of the European network of excellence in nanobiotechnology, Nano2Life (www.nano2life.org). This network of excellence integrates 23 full academic partners and 41 associate companies in a comprehensive joint programme of activity. More than 400 scientists are participating to this network.Since 2006, he is Member of the Executive Board of the European Technology Platforms, and chairman of its working group on “nanotechnology based diagnostics and imaging”In December 2007, he founded the French Technology Platform on Nanomedicine and he is member of its Executive Board.Since 2008, he is in charge of the business developer in NanoMedicine at CEA-Leti-MiNaTec.

MandatesFoundation in 2004 of the nanobiotech section at the European Federation of Biotech.Member in 2004-2005 of the steering committee of the European Science Foundation Forward Look on Nanomedicine, responsible for the working group on “nanodiagnostics”.Chairman since late 2005 of the working group on “nanotechnology based diagnostics and imaging” at the European Technology Platform on Nanomedicine, and thus member of its Executive Board.CEA representative at the group “medical technologies” of the European Technology Platform on Smart Systems Integration (EPoSS)Founder and Executive Board member at the French Technology Platform on Nanomedicine.(2007 onward)Experts for several international organizations like European Science Foundation, and the European Commission


232


J. Anthony ByrneReaderNanotechnology and Integrated BioEngineering CentreSchool of EngineeringFaculty of Computing and EngineeringUniversity of UlsterNorthern IrelandUnited Kingdom

J Anthony (Tony) Byrne is a Reader based in the Nanotechnology and Integrated BioEngineering Centre, School of Engineering, at the University of Ulster. He obtained his DPhil in chemistry from the University of Ulster in 1997 and has continued his research into photocatalysis for environmental and medical applications. In 2000 he took over, from Brian Eggins, as Head of the Photocatalysis Group at Ulster. His research has focused on the fabrication and characterisation of photocatalytic materials and their application for water and wastewater treatment, surface decontamination and the photoelectrolytic splitting of water. Byrne has been involved in FP4 and FP5 projects focused on water and wastewater treatment. He is currently PI at Ulster as a lead partner in the European FP6 SODISWATER project which is aimed at the solar disinfection of water for application in developing countries. He has established collaborations with leading international researchers in the area of photocatalysis and has published widely. Byrne teaches nanotechnology at undergraduate and masters level and is Course Director for the new BEng Hons Clean Technology degree at Ulster. He is Secretary to the Northern Ireland Section Royal Society of Chemistry and a committee member of the RSC Photochemistry Special Interest Group.

http://www.ulster.ac.uk/staff /byrne-1.html

Stefano CarosioD’Appolonia SpAResearch and innovation Division Manager

Stefano Carosio areas of interest are Innovation and Technology Transfer. His specialty is to sup-port industry, and in particular SMEs, in the product development cycle by identifying suitable technological solutions which provide both incremental improvements and breakthroughs to innovate products, processes or services. Overall Stefano Carosio has been involved as Project Manager and Technical Supervisor in more than 50 EC projects since FP4, mainly dealing with nano and multifunctional materials. He is member of the High Level Group of the European Construction Technology Platform and cover high level positions in several European Technol-ogy Platforms and initiatives. Because of the cross-sectorial and interdisciplinary experience he developed, Stefano Carosio is currently Italian Director of the ESA’s (European Space Agency) Technology Transfer Network, dealing with identifi cation of industrial needs, technology assessment and commercialisation.


233


Jean Frédéric ClercDirector of Strategy, Prospective and Evaluation,Technological Research Division atCEA (Commissariat à l’Energie Atomique)Diplôme d’ingénieur de l’Ecole Supérieure d’Electricité en 1977

Born in France in 1955, French citizen.Graduated from SUPELEC (Paris).From 1977 to 1988, J.F. Clerc has been involved in R&D in the fi eld of Liquid Crystal Displays (LCD’s) at CEA-Léti.In 1988, he joined the Japanese company Stanley Electric (Japon). As project leader, he carried out the industrial development of the fi rst production line of color LCD based on the so called « Vertically Aligned » technology, what is today to main stream for TV LCD’s. In 1992, the production starts at Hatano factory and J.F. Clerc came back to Europe to take in charge the research activities of Seiko-TECDIS in Italy and then the research and development activities of Pixtech, a U.S. spin off utilizing CEA-Léti patents.In 1995, he joined CEA. He had been successively Manager of the Microsystems Program at Léti, Vice President of Léti, and since 2005 Director of Prospective, Strategy and Evaluation of the Technological Research of CEA. He is member of the board of the French national evaluation agency AERES.He is Vice President of the AI Carnot, the Association of the Carnot institutes.

Mike Eaton has worked in the pharmaceutical industry for over 35 years, unusually working on both NCEs and NBEs. After a Ph.D. training as a nucleic acid chemist at Warwick University he worked at G D Searle for 7 years as a senior research investigator in DNA synthesis. He was a founding member of Celltech in 1980 where as Head of Chemistry he set up the Chemistry group and built the fi rst European DNA synthesiser, which is now in the Science Museum in London. Working with Lederle, now Wyeth, he was part of the international team to research Mylotarg, the fi rst antibody drug conjugate to get to the market. He is currently chair of the drug delivery working group and Executive board member of the ETP on nanomedicines. Mike is a Special Professor at Nottingham University and an Editorial Board member of Nanomedicine and Future Medicinal Chemistry.


234


Maximilian FichtnerInstitute for NanotechnologyKarlsruhe Research Center (FZK)

Dr. Maximilian Fichtner studied Chemistry at the University of Karlsruhe and did his Ph.D. work in Surface Science. After three years as an assistant to the Board of Directors at the former Karlsruhe Nuclear Research Center he left the Board to build up his own group in the fi eld of Micro Process Engineering, with a focus on heterogeneous catalysis in microchannels. Then he was called to build up a new activity in the fi eld of energy storage, at the new Institute of Nanotechnology at the Research Centre Karlsruhe (FZK), where he started in 2001. The group has 16 members at the moment.He is spokesman of the “HyTecGroup”, the biggest research activity on hydrogen in Germany, and represents his country at the Hydrogen Implementation Agreement of the International Energy Agency (IEA), Task 22 and in the International Steering Committee of the ‘International Symposium on Metal Hydrogen Systems’. In 2005 he was called to the advisory council ‘Hydrogen and Fuel Cells’ of the Federal Ministry of Economy. He has also been co-ordinator of several collaborative research projects, e.g. the EU project ‘NANOHy’ which started in 2008. He is author of 90 papers, 12 patents and received the Hermann-Billing Award.

www.fzk.de/energystorage


235


Elzbieta FrackowiakDate of birth: November 17th,1950 - Poland

Affi liation and address:Institute of Chemistry and Technical Electrochemistry, Poznan University of Technologyul. Piotrowo 3, 60-965 Poznan, [email protected]

Education:1972 Master’s degree in Electrochemistry, University of Adam Mickiewicz, Poznan1988 PhD thesis in Electrochemistry, Poznan University of Technology, Poznan2000 Habilitation in Chemical Technology, Poznan University of Technology

Employment:1973-1978 Academy of Mining and Metallurgy, Cracow - researcher1979-2002 Institute of Chemistry and Applied Electrochemistry, Poznan University of Technology - researcher, associated professor2003-present Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology - professor

Research areas:Storage/Conversion of Energy• Supercapacitors • Intercalation and insertion processes• Electrode materials for primary and secondary cells • Composites from conducting polymers and metal oxides for electrochemical applications• Electrodes from doped carbons (nitrogenated, oxygenated, boronated etc.)• Electrochemical hydrogen storage• Carbon nanotubes and nanofi laments in electrochemistry• Lithium-ion batteries• Fuel cells, catalysis• Ionic liquids as novel electrolyte

General responsibilities:• Member of the Advisory Board of the International Conferences on Intercalation Compounds-

ISIC (1996-2008), CESEP (2005-2008), CARBON (2009); Organizer of ISIC12 in Poznan (2003) • Chair Elect of Division 3 (Electrochemical Energy Conversion and Storage) of International

Society of Electrochemistry • Coordinator of NATO Science for Peace Programme (SfP 973849) from Polish side (2000-2005) • Coordinator of Polish-French programme POLONIUM (1998, 2001, 2002, 2005, 2006)• Coordinator of Polish-Spanish cooperation (2004, 2005)• Participant in European Cooperation in the fi eld of Scientifi c and Technical Research, COST

542• Member of the Advisory Board of Journal “Energy & Environmental Science” RSC Publishing

(2008)Author: publications - 150, chapters - 12, patents - 6, conference communications - 450 Citations: 2300Research stays: DAAD - Duisburg, Germany (1991); visiting prof. - Orléans, France (1993-2001)


236


Akira FujishimaChairman, Kanagawa Academy of Science & TechnologyKSP West 614, 3-2-1 Sakado, Takatsu-ku, Kawasaki-shi, Kanagawa 213-0012, JapanTel: +81-44-819-2020 Fax: +81-44-819-2038E-mail: [email protected]

Professor Fujishima was born in 1942 in Tokyo. He received his Ph.D. in Applied Chemistry at the University of Tokyo in 1971. He taught at Kanagawa University for four years and then moved to the University of Tokyo, where he became a Professor in 1986. In 2003, he retired from this position and took on the position of Chairman at the Kanagawa Academy of Science and Technology. His main interests are in photocatalysis, photoelectrochemistry and diamond electrochemistry.

Curriculum VitaeName Akira FujishimaDate of Birth March, 1942Nationality JapanesePresent Position Chairman, Kanagawa Academy of Science & Technology Address KSP West 614, 3-2-1 Sakado, Takatsu-ku, Kawasaki-shi, Kanagawa 213-0012, Japan Tel: +81-44-819-2020 Fax: +81-44-819-2038E-mail: [email protected]

Academic Qualifi cationsB. Eng. Yokohama National University 1966Ph D. The University of Tokyo 1971

AppointmentsAssistant Professor, Faculty of Engineering, Kanagawa University 1971-1975Assistant Professor, Department of Applied Chemistry, The University of Tokyo 1975-1978Associate Professor, Department of Applied Chemistry, The University of Tokyo 1978-1986Professor, Department of Applied Chemistry, The University of Tokyo 1986-2003 President of the Chemical Society of Japan 2006-2008Professor Emeritus, The University of Tokyo 2003-present Chairman, Kanagawa Academy of Science & Technology 2003-presentSpecial University Professor Emeritus, The University of Tokyo 2005-present

Main Awards*Asahi Award form the Asahi Shinbun newspaper 1983*Award for Research Excellence from The Electrochemical Society of Japan 1987*Harushige Inoue Award (for technical innovation) 1998*Innovations in Real Materials Award 1998*Award of the Electrochemical Society of Japan 1999*Award of the Chemical Society of Japan 2000*The Heinz Gerischer Award (of the European Section of the Electrochemical Society) 2003*The Medal with a Purple Ribbon 2003*The Japan Prize 2004*The Japan Academy Prize 2004*National Commendation for Invention Award 2006*Kanagawa Culture Award 2006

Research Interests*Photoelectrochemistry *TiO2 Photocatalysis *Photofunctional Materials *Diamond Electrochemistry Original papers: 740Review papers: 440Patents: 280


237


Michael GraetzelProfessor at the Ecole Polytechnique de Lausanne, Michael Graetzel directs there the Laboratory of Photonics and Interfaces. He discovered a new type of solar cell based on dye sensitized mesoscopic oxide particles and pioneered studies of semiconductor nanoparticles, nanocrystal-line junctions and their use in electroluminscent and electrochromic displays as well as lithium ion batteries and bioelectronics. Author of over 800 publications, two books and inventor of more than 50 patents, his work has been cited over 50’000 times (h-factor 107). He has received numerous prestigious awards, including the Harvey prize, the Galvani Medal, the Faraday Medal, the First International Prize of the Japan Society of Coordination Chemistry, the Dutch Havinga award, the ENI-Italgas prize, the European Innovation Prize 2000, the 2005 World Technology award and the Gerischer award. He was selected by the Scientifi c American as one of the 50 top researchers in the world.Over the last 5 years alone, Professor Graetzel was invited to present the 2009 Perrin lecture in Paris France, the 2009 Bailor lectures at University of Illinois Urbana, USA, the 18th Brdicka Lecture at the Karl’s University Prague, the 2008 AD Little lecture at the MIT in Boston, USA, the 2008 “Lecture at the Leading Edge” at the University of Toronto, Canada, the 2008 Earl L. Muetterties Memorial Lectures at the University of California in Berkeley, the 2007 William Lloyd Evans Lectures at Ohio State University, the 6th Distinguished Gouq-Jen Su lecture, at the University of Rochester, USA, the 2006 Rohm&Haas lecture, at Stanford University, the 2006 Arthur Birch Lectures at the Australian National University in Canberra, the 2006 Cady Lectures at the University of Wash-ington in Seattle, USA, the 2006 Johnson Lectures at Cornell University in Ithaca, USA, the 2005 Weissberger Williams Distinguished Scientist Lecture at Kodak Rochester USA and the 2003 Dupont Centennial Lecturer, Dupont Wilmington, USA. Professor Graetzel has been the Mary Upson Visiting Professor at the University of Cornell Ithaca N.Y. USA and is currently a Distinguished Invited Professor at the National University of Singapore. From 2003-2006 he was a Honorary part time Chemistry Chair, at Delft University of Technology Netherlands. He has was invited Professor and held visiting appointments as a Fellow of the Hanse Scientifi c College, Bremen, Germany, at the National Renewable Energy Laboratory in Golden, Colorado USA at the Ecole Nationale Supérieure de Cachan in Paris, France and at the University of California at Berkeley, USA.He is a member of the editorial board or editorial advisory board of several scientifi c journals. He received a doctor’s degree in Natural Science (Dr. rer. nat.) from the Technical University of Berlin and honorary doctors degrees from the Universities of Delft, Uppsala and Turin. He is a member of the Swiss Chemical Society as well as of the European Academy of Science and was elected honorary member of the Société Vaudoise de Sciences Naturelles.


238


Karl-Heinz HaasFraunhofer-Institut für Silicatforschung, Head of business unit construction and environmentSpokesman Alliance Nanotechnology of Fraunhofer-Society Fraunhofer ISCNeunerplatz 2, 97082 Wuerzburg - Germany Phone: ++49-931-4100-500Fax: ++49-931-4100-559 e-mail: [email protected]://www.ormocer.de, www.nano.fraunhofer.de

Current interests and projects:Nanoscaled hybrid inorganic-organic polymers and sol-gel-based inorganic materials as thin fi lms, membranes, fi bers and composites for applications in surface fi nishing, microelectronics, optics etc. nanomaterials for construction and environment, lecturer for nanotechnology

Personal data:Born May 4, 1955 Maulbronn/Enzkreis (Germany); Married, one child

Education:Ph. D. Physical Chemistry - Electrochemistry, University of Karlsruhe, 1983M. S. Diploma-Thesis, University of Karlsruhe, 1980

Professional Experiences:since April, 2008Head of business unit “Construction and environment” at Fraunhofer ISC

since April, 2004Spokesman Alliance Nanotechnology of Fraunhofer-Society

April, 2002 - February 2009Deputy Director of Fraunhofer-Institut für Silicatforschung, Würzburg

August 1, 1995 - March 30, 2002 Head of Hybrid Polymer Department at Fraunhofer ISC

April 1, 1988 - July 31, 1995R&D Scientist and Project Leader at Central Polymer Research BASF AG, Ludwigshafen and Tsukuba/Japan (2,5 years) working on hybrid polymers (nanoreinforcement of thermoplastics) and functional polymers for 3rd order nonlinear optics

Jan 1, 1984 - March 30, 1998 R&D Scientist, Project and Group Leader at Fraunhofer ISC in the fi eld of hybrid polymers


239


Peter HattoDr Peter Hatto has been chairman of the International Organization for Standardization Technical Committee for Nanotechnologies, ISO/TC 229, since it was established in June 2005, and was appointed chairman of the equivalent European (CEN) Technical Committee, TC 352 in August 2008. He is also chairman of the UK BSI committee in the area, NTI/1, a position which he has held since its inception over fi ve years ago.

Peter is Director of Research for IonBond Ltd, a leading producer of advanced, thin fi lm, ceramic coatings. His research activities have covered subjects ranging from erosion protection for aircraft engines to enhanced osseo-integration of dental and orthopaedic implants, includ-ing two major nanotechnology projects - one on the preparation and characterization of nanostructured multilayer coatings and the other, currently ongoing, on the development and use of nanocomposite coatings for the control of friction and wear in engineering components. His long association with ceramics coatings industry led to his appointment in the late 90’s as convenor of working groups for standardization in the fi eld of ceramic coatings in both CEN and ISO, position which he still holds.

Jens A. Hauch is the Director of R&D Operations and the manager of the German R&D site of Konarka Technologies. He is responsible for substrate and electrode development for Konarka’s innovative Power Plastic®, a new type of solar module based on semiconducting organic polymers. He holds a Bachelor of Science degree in physics from the University of Illinois at Urbana-Champaign, where he was a member of the Center for Complex Systems Research. He holds a PhD degree from the Center for Nonlinear Dynamics at the University of Texas at Austin. Before joining Konarka in 2004, he was active in the development of thin-fi lm magnetic sensors, electrochromic displays, and organic photodetectors at Siemens Corporate Technology. He is author and co-author of numerous patents, patent applications and scientifi c papers in organic photovoltaics, thin fi lm magnetics and dynamic fracture.

Hauch can be reached by e-mail at [email protected].


240


Harry Heinzelmann Rue du Crêt-Taconnet 10, 2000 Neuchâtel, Switzerlandfon +41 (32) 725 9734 ∙ cell +41 (76) 588 9734 ∙ [email protected] 28 January 1962 in Hameln, GermanyGerman citizenship, married, three children

is Vice President and Head of the Division Nanotechnology and Life Sciences at the CSEM Swiss Center for Electronics and Microtechnology, a privately held innovation center. Before joining CSEM in 1998, he was visiting scientist at the IBM Almaden and IBM Rueschlikon Research Laboratories. Dr. Heinzelmann received his Ph.D. from Basel University, as well as a Habilitation and a Master of Advanced European Studies MAES. Current activities in research include nano-structuring both with top-down (MEMS based) as well as bottom-up (molecular self-assembly based) techniques, nano-biotechnology and biosensing, nanoscale optics and nanoscale materials, with long-dating experience in scanning probe microscopy techniques. His general interest is in nanoscale science and technology and their impact and applications in today’s innovation process, as well as societal issues of nanotechnology. He is currently Secretary of the Nanotechnology Section of the Swiss Society of Optics and Microscopy SSOM, and member of the Advisory Board of NanoDimension, a company that is providing early-stage venture capital support to the nanotechnology industry.

Summary Management Professional active in strategic development and transfer of technologies from academia to innovative solutions for industry, with excellent scientifi c background in Nanotech-nology and strong communication skills.

Education 1968 - 1980 Schools in Germany and Switzerland1986 - 1989 Master and PhD in Physics, University of Basel, Switzerland1995 Habilitation (venia docendi), Experimental Physics, University Basel1994 - 1996 Master of Advanced European Studies MAES, Europe Institute, Basel (studies in economy, European law, politics; thesis on EU Tech Transfer)2007 International Executive Program IEP, INSEAD, Fontainebleau

Professional Experience1990 - 1992 Postdoctoral Fellow, IBM Almaden, San Jose, California1992 - 1993 Postdoctoral Fellow, IBM Zurich Research Lab, Switzerland1993 - 1998 Research Group Leader, University of Baselsince 1998 at the Centre Suisse d’Electronique et de Microtechnique CSEM SA

currently as Vice President, Head of Nanotechnology & Life Sciencesand member of the Board of Directors and the Scientifi c CommitteeCSEM SA, Case Postale, 2002 Neuchâtel, Switzerland, www.csem.ch

since 2003 Member of the Scientifi c Advisory Board of Nanodimension, a Nanotech Venture Capital fi rm based in Zurich, Switzerland

Scientifi c• Author and co-author of more than 100 scientifi c publications, more than 100 invited/plenary

presentations; peer referee of numerous scientifi c journals• Referee for national and international funding agencies, as well as for EU programs• Teaching for academic curricula at Universities of Basel and Neuchâtel (Lecturer, Chargé des

cours), courses for professionals throughout Europe, “Public University”• Member of the Swiss, German and American Physical Societies, Secretary of the• Nanotechnology Section of the Swiss Society for Optics and Micrscopy SSOM

Personal• (Swiss) German mother tongue, written and spoken in English and French• interested in politics and current aff airs, sailing, photography, sports (former assistance coach

of the Swiss National Volleyball Team)


241


Göran HermerénProfessor of Medical ethics, Lund University, Sweden since 1991, professor of philosophy, Lund University since 1975. Previously visitng fellow at Princeton University, University of Michigan and Trinity College, Dublin. Has published books and papers on aesthetical and ethical problems in international periodicals. Partner in several research projects funded by the EU. Member of the National Council on Medical Ethics in Sweden since its start. Chairman of the ethics committee of the Swedish Research Council (Stockholm), chairman of the advisory board of the German reference centre for ethics in the life sciences DRZE (Bonn) and President of the European Group on Ethics in Science and New Technologies (Brussels) since 2002. Research interests: research ethics, ethical problems raised by emerging technologies, and priority setting in health care.

J.W. (Hans) HofstraatHans Hofstraat completed his thesis (Free University, Amsterdam) and post-doctoral work (Eid-genössische Technische Hochschule, Zürich, Switzerland) on low-temperature high-resolution luminescence spectroscopy. Subsequently he turned to marine environmental research on phytoplankton and eutrophication, and on organic trace contaminants in the laboratory of the Dutch Public Works Department in Rijswijk, The Netherlands. He then went to industry conducting research in the areas of optical spectroscopy, photonic polymers and in-vitro diagnostics at Akzo Nobel Central Research in Arnhem, the Netherlands. From 1998-2008 he was part-time professor at the University of Amsterdam. Also in 1998 he was appointed department head at Philips Research in Eindhoven (the Netherlands), at fi rst of the Department Polymers & Organic Chemistry, and subsequently of the Department BioMolecular Engineering. In 2003 he was appointed Vice President Philips Research. In 2005 he became Sector Head Molecular Medicine in Philips Research Europe, and globally responsible for the Focal Area Molecular Medicine in Philips Research. Since January 15, 2007 he is responsible for Healthcare Strategic Partnerships in Philips Research worldwide, actively driving the Open Innovation approach to Philips’ Healthcare research program. Next to his work at Philips he holds several positions in (inter)national advisory bodies. Amongst others he is member of the Expert Advisory Group of the European FP7 research program on Nanosciences, Nanotechnologies, Materials and New Production Technologies (NMP), member of the Dutch Advisory Council on Health Research (RGO), and initiator, and chairman of the Advisory Board, of the Center for Translational Molecular Medicine, a Dutch-based public-private partnership. Hofstraat authored over 180 publications with an h-index of 29, and holds 25 patent applications.


242


Pavel JelínekDate of birth: 17.11.1972Nationality: czech Current position: Scientist Offi ce address: Institute of Physics Czech Academy of ScienceDepartment of Thin FilmsCukrovarnicka 10 CZ- 162 53 Praha 6tel: +420-2-20318-523fax: +420-2-333-43184email: [email protected]: www.fzu.cz/~jelinekp

Education: 1997- 2001 PhD. Study at the Czech Technical University, the fi eld of study: Physical and Material Engineering. (the date of PhD. award: 22.1.2001)Doctoral Thesis: “Modeling Infl uence of the Turbulent Flows in the Crystal Growth of II-VI Semiconductors.” 1991-1997 M.Sc. study at the Czech Technical UniversityAwarded scholarship (3 years).Master Thesis: “Numerical Solution of Diff usive Equation in Two-dimensional Space.”

Working experience:1999 - at present:Institute of Physics ASCR, department of Thin Films.September 2001 - February 2005PostDoc position in group of prof. F. Flores Sintas Departamento de la Física Teórica de la Materia Condensada, Universidad Autónoma de Madrid, Spain.2008 (8 month) visiting researcher (Fulbright Scholar) Department of Physics and AstronomyArizona State University, USA

Research interests: 1. Development of ab-initio fast local orbital TB-MD-DFT FIREBALL code (http://fi reball.phys.wvu.

edu/LewisGroup/fi reballHome)2. Theoretical description of SPM methods (single atom manipulations, dissipative mechanism

at atomic scale, chemical identifi cation, imaging processes).3. Ab initio simulations of the mechanical and the transport properties of nanostructures.4. Transport processes in nanostructures and surfaces using Green’s function formalism.5. Dynamical processes and phase transition on semiconductor surfaces (e.g. SiC(100),

Pb/Si(111)) using combination of kinetic Monte Carlo method and fi rst principles DFT simulations.

Selected international collaborations:• University of Madrid, Madrid, Spain. Prof. F. Flores, Theory of STM, metals on semiconductors.• Arizona State University, USA, Prof. O.F. Sankey, ab inito DFT fast local orbital code Fireball

development • West Virginia University, USA, Prof. J.P. Lewis, deveopment of ab inito DFT fast local orbital

code Fireball; catalytic properties of TiO2 surface• CSIC Instituto de Materiales, Madrid, Spain. Dr. P. de Andres, fi rst principles DFT simulations

of surface reconstruction of TiO2 surface.• Osaka University, Osaka, Japan. Prof. S. Morita, atomic manipulations, chemical atomic

identifi cation on semiconductor surfaces using nc-AFM method.• IBM Almaden Research Center, Dr. M. Ternes, USA, STM/AFM operating in the contact mode• Univerity of Regensburg, Prof. F.J. Giessibl, analysis of experimental data obtained by AFM/

STM

Scholarship, Awards :1. Ministerio de Educación, Cultura y Deporte, „Ayudas para la movilidad de profesores e

investigadores espanoles y extranjeros“, September 2004-February 20052. Otto Wichterle award for young outstanding researchers, Czech Academy of Science (2007)3. Fulbright Scholarship (Arizona State University, 2008)


243


Professional Memberships :1. Member of Fireball commitee, fast local basis set TB-MD-DFT code (http://fi reball.phys.wvu.

edu/LewisGroup/fi reballHome).2. Member of the EUROCORES FANAS Review Panel3. Guest Editor of Central European Journal of Physics Referee: Physical Review (B,E), Physical Review Letters, Surface Science, Nanotechnology, Journal of American Chemical Society

Publications:In total 23 publications with more than 200 citations; Science (1), Nature (1), Phys. Rev. Lett. (4) (~150 excluding self-citation)

Selected publications1. Y. Sugimoto, P. Pou, M. Abe, P. Jelinek, R. Perez, S. Morita and O. Custance, “Chemical identifi ca-

tion of individual surface atoms by atomic force microscopy” Nature 446, 64 (2007). (33 citations excluding self-citation)

2. Y. Sugimoto, P. Pou, O. Custance, P. Jelinek, M. Abe, R. Perez, S. Morita “Complex Pattering by Vertical Interchange Atom Manipulation Using Atomic Force Microscopy” Science 322, 413 (2008). (0 citations excluding self-citation)

3. P. Jelínek, R. Peréz, J. Ortega and F.Flores : “H2 dissociation over Au-nanowires and the fractional conductance quantum” Phys. Rev. Lett. 96, 046803 (2006). (13 citation excluding self-citation)

4. N. Oyabu, P. Pou, Y. Sugimoto, P. Jelinek, M. Abe, S. Morita, R. Perez, O. Custance: “Single Atomic Contact Adhesion and Dissipation in Dynamic Force Microscopy” Phys. Rev. Lett. 96, 106101 (2006). (15 citation excluding self-citation)

5. Y. Sugimoto, P. Jelinek, P. Pou, S. Morita and O. Custance, R. Perez and M. Abe, “Mechanism for room-temperature single atom lateral manipulations on semiconductors using dynamic force microscopy” Phys. Rev. Lett. 98, 106104 (2007). (7 citation excluding self-citation)


244


Tomáš JungwirthBorn: October 23, 1967, Praha, Czech RepublicHome page: http://www.fzu.cz/ jungw

Education and professional career:2007-present Head of Dept. of Spintronics and Nanoelectronics, Institute of Physics

ASCR 2004-present Professor, University of Nottingham2001-present Senior Research Scientist, Institute of Physics ASCR Praha2002-2005 Adjunct Professor, University of Texas2000-2002 Research Fellow, University of Texas1997-1999 Postdoctoral Fellow, Indiana University1997 PhD. degree in theoretical condensed matter physics, Charles University Praha1991 M.S. degree in theoretical physics, Charles University Praha

Professional experience:Field: theoretical condensed matter and many-body physicsTopics: electronic properties of semiconductor heterostructures and nanostructures, metal and semiconductor spintronics, carrier-induce ferromagnetism in diluted magnetic semiconductors, quantum, anomalous, and spin Hall eff ect

Accomplishments, awards, and international recognition:• 120 publications in international peer-reviewed journals (including 22 Physical Review Letters,

Nature and Nature Materials articles, and a Reviews of Modern Physics article); 3700 citations in the scientifi c literature.

• Praemium Academiae, 2008• Marquis Who’s Who in America, 2007 Edition• Thomson Scientifi c: In Cites - The Top 3 Hot Papers in Physics: January 2007, March 2007, May

2007; Sci Bytes - Hot Paper in Physics 2006; Essential Science Indicators - 5th most cited author in ”The Hall Eff ect” Special Topic in 1995-2005, Special Topics Interview 2006; ScienceWatch The Hottest Research of 2004-2005 (37th most cited article in all sciences), What’s hot in Physics: March/April 2006 (9th most cited in physics), May/June 2006 (9th), July/August 2006 (6th), September/October 2006 (2nd a 8th), January/February 2007 (10th)

• Academy of Sciences of the Czech Republic Prize, 2005• Otto Wichterle Prize of the Academy of Sciences of the Czech Republic, 2002• NATO-NSF Advanced Fellowship, 1999• Bolzano Foundation Prize of the European Physical Society, 1996• Josef Hl´avka Prize, 1996• Milan Odehnal Prize of the Union of Czech Mathematicians and Physisists, 1996


245


Edward W. KeeferPOSITION TITLE: InstructoreRA COMMONS USER NAME: EDWARD1414EDUCATION/TRAINING: (Begin with baccalaureate or other initial professional education, such as nursing, and include postdoctoral training.)INSTITUTION AND LOCATION / DEGREE (if applicable) / YEAR(s) / FIELD OF STUDYUniversity of North Texas, Denton, TX; MS; 1998; NeuroscienceUniversity of North Texas, Denton, TX; Ph.D.; 2001; NeuroscienceThe Neurosciences Institute, San Diego, CA; 2001-2005; Postdoctoral fellow

A. Positions and Honors.

Positions and Employment2001-2005 Postdoctoral Fellow, The Neurosciences Institute2006-2007 Research Fellow, University of Texas Southwestern Medical Center2007-current Instructor, UTSW Medical Center

Other Experience and Professional Memberships1998-Present Member, Society for Neuroscience

B. Selected peer-reviewed publications (in chronological order). 1. Morefi eld, S.I., Keefer, E.W., Chapman, K.D., and Gross G.W. (2000) Drug evaluations using

neuronal networks on microelectrode arrays: characteristic eff ects of cannabinoid agonists anandamide and methanandamide on cortical and spinal cultures. Biosens Bioelec-tron.15(7-8): 383-396

2. Keefer, E.W., Boyle, N.A.J., Norton, S.J., Talesa, V., and Gross G.W. (2001) Acute toxicity screening of novel AChE inhibitors using neuronal networks on microelectrode arrays. Neurotoxicology 22(1): 3-12

3. Pancrazio, J.J., Keefer, E.W., Ma W., Stenger, D.A., and Gross, G.W. (2001) Neurophysiologic eff ects of chemical agent hydrolysis products on cortical neurons in vitro. Neurotoxicology 22(3): 395-400

4. Stenger, D.A., Gross, G.W., Keefer, E.W., Shaff er, K.M., Andreadis, J.D., Ma, W., and Pancrazio, J.J. (2001) Detection of physiologically active compounds using cell-based biosensors. Trends Biotechnol.19(8): 304-309

5. Keefer, E.W., Gramowski A., Stenger D.A., Pancrazio J.J., and Gross G.W. (2001) Characteriza-tion of acute neurotoxic eff ects of trimethylolpropane phosphate via neuronal network biosensors. Biosens Bioelectron.16(7-8): 513-525

6. Keefer, E.W., Gramowski A., and Gross, G.W. (2001) NMDA receptor dependent periodic oscillations in cultured spinal cord networks. J Neurophysiol.86(6):3030-3042

7. Loock J., Stange J., Mitzner S., Schmidt R., Keefer E.W., Gross G.W. (2001) Infl uence of albumin dialysis (MARS) on neuronal network activity in vitro. Z Gastroenterol 39 Suppl 2:40-45

8. Mistry, S.K., Keefer, E.W., Cunningham, B.A., Edelman, G.M., and Crossin, K.L. (2002) Rat hippocampal neural progenitors generate spontaneously active neural networks. Proc Natl Acad Sci 99(3): 1521-162

9. Edelman, D.B., Keefer, E.W., (2005) A cultural renaissance: in vitro cell biology embraces three-dimensional context. Exp. Neurol. 192(1): 1-6

10. Adachi M, Keefer E.W., Jones F.S., (2005) A segment of the Mecp2 promoter is suffi cient to drive expression in neurons. Hum Mol Genet 14(23):3709-22

11. Galvan-Garcia P, Keefer EW, Yang F, Zhang M, Fang S, Zakhidov AA, Baughman RH, and Romero MI. (2007) Robust cell migration and neuronal growth on pristine carbon nanotube sheets and yarns. J Biomater Sci Polym Ed. 18(10):1245-61.

12. McCoy MK, Martinez TN, Ruhn KA, Wrage PC, Keefer EW, Botterman BR, Tansey KE, and Tansey MG. (2008) Autologous transplants of Adipose-Derived Adult Stromal (ADAS) cells aff ord dopaminergic neuroprotection in a model of Parkinson’s disease. Exp Neurol. 210(1):14-29.

13. Wrage PC, Tran T, To K, Keefer EW, Ruhn KA, Hong J, Hattangadi S, Treviño I, and Tansey MG. (2008) The Neuro-Glial Properties of Adipose-Derived Adult Stromal (ADAS) Cells Are Not Regulated by Notch 1 and Are Not Derived from Neural Crest Lineage. PLoS ONE. 3(1):e1453.

14. Keefer EW, Botterman BR, Romero MI, Rossi AF, and Gross GW. (2008) Carbon nanotube coating improves neuronal recordings. Nat. Nano. 3:434-439

15. Garde Kshitija, Keefer EW, Botterman BR, Galvan-Garcia, P, and Romero MI. (2009) Neuroin-terfacing of chronically amputated nerves. Front. Neuroengin.. (in press)

C. Research Support2001-2005 Neurosciences Research Foundation2002-2004 Alafi Family Foundation2007-2008 Carter-Crowley FoundationCurrent NIH SBIR- 00322425 Improved neuroelectrode characteristics using nanomaterialsCurrent Plexon Inc. sponsored research fellowship


246


Jose’ M. KennyProfessor José M. Kenny is the President of the Board of Directors of the European Centre on Nanostructured Polymers legally constituted in Florence with the support of 12 European Research Centres (www.ecnp.eu.org). He is also Full Professor of Material Science and Technol-ogy at the University of Perugia, where he also teaches Polymer Technology and Materials Nanotechnology. Moreover, Prof. Kenny is the Director of the International PhD Program on Materials Nanotechnology coordinated by the University of Perugia in collaboration with several European Universities.He has coordinated many European research projects in FP5 and FP6 including the recently fi nished Network of Excellence NANOFUN-POLY on nanostructured polymers.During his career Prof. Kenny has been visiting and research professor in the following universi-ties: University of Naples (1984-1991), University of Connecticut: (1989) University of Washington (1990), Washington University of Saint Louis (1991). He has published more than 300 papers in the scientifi c literature on the following subjects: mathematical modelling of the processing of composites and polymers, materials for aerospace applications and automotive applications, mathematical modelling of reactive processes, interfaces and surface treatments on polymeric, metallic, ceramic and composite materials; nanotechnologies of polymeric materials, processing and characterization of carbon nanotubes and of their polymer nanocomposites. Moreover, Prof. Kenny has directed more than 100 theses in Materials Engineering and 25 PhD theses on Industrial Engineering and Materials Nanotechnology.Prof. Kenny has coordinated several Italian and international research projects and is member of several scientifi c societies. He is currently Past-President of the SAMPE Europe (Society for the Advancement of Material and Process Engineering) and Vice-president of SAMPE Italy, and has served in the Board of the Italian Industrial Association of Composite Materials.


247


Costas Kiparissides

Academic Education and DegreesDiploma in Chemical Engineering, 1966-1971 - National Technical University of Athens, GreeceM.Eng. in Chemical Engineering, 1974-1975 - McMaster University, Hamilton, Ontario, CanadaPh.D. in Chemical Engineering, 1975-1978 - McMaster University, Hamilton, Ontario, Canada

Present Professional PositionProfessor of Chemical Engineering, Aristotle University of Thessaloniki Director of Central Administration and Chairman of the Board of Directors of Center for Research and Technology Hellas (CE.R.T.H.)

Special Remarks Fundamental studies in polymer reaction engineering, molecular and morphological charac-terization of polymers, novel micro- and nano-encapsulation technologies, development of functional micro- and nano-particles/structures for health, food and environmental applications employing various synthesis methods, development of molecularly imprinted polymeric NPs (MIPs) for selective recognition and separation of biological molecules and production of novel high-added value functional biopolymers from renewable sources using biosynthesis and biocatalysis.

Scientifi c and Academic Achievements:He has supervised more than forty Ph.D. graduate students and he has presented more than two hundred invited seminars and lectures at international scientifi c conferences, industrial research centres, Institutes and Universities in North America and Europe. In addition he has published:Publications in Refereed Journals : ~ 170Conference Papers : ~ 300Citations : ~ 2000Books : 6Diploma Thesis : 120Doctorate Thesis : 40


248


Mikhail V. Kovalchuk21 September 1946 , Leningrad, USSR.

Education: Leningrad State University, Physical Faculty, Department of X-ray and condensed matter

Scientifi c degrees: Doctor (PhD) of Physical and Mathematical Sciences, Full Professor on X-Ray scattering and condensed (soft condensed) matter,Member of Russian Academy of Sciences(Physics and Astronomy Department).

Research fi elds: X-ray physics and optics; X-ray and synchrotron radiation (SR); nano-bio-organic materials and systems; X-ray and SR in material sciences and crystallography; protein crystallography; condensed and soft matter physics; X-ray and SR instrumentation; multiple diff raction.

Positions:• General Director of Russian Research Center “Kurchatov Institute”• Director of A.V. Shubnikov Institute of Crystallography Russian Academy of Sciences• Scientifi c Secretary of Council of Science, Technology and Education of the President of

Russian Federation • Chairman of Public Chamber Commission on Education and Science• Head of the chair “Physics of nanosystems” of the Faculty of physics of Moscow State

University • Editor-in-chief of “Crystallography report” Russian Academy of Sciences • Chairman of advisory board of Nanotechnologies in Russia (Rossiiskie Nanotekhnologii)

journal• Author about 200 scientifi c publications in the leading international scientifi c journals and

patents

Harold (Harry) KrotoSir Harold (Harry) Kroto was one of three recipients of the Nobel Prize for Chemistry in 1996, the same year that he was knighted for contributions to chemistry. He is a Fellow of the Royal Society of London, and holds an emeritus professorship at the University of Sussex in Brighton, United Kingdom. He is currently on the faculty at Florida State University, where he started an educational initiative known as the Global Educational Outreach for Science, Engineering, and Technology, or GEOSEl He obtained a fi rst class BSc honors degree in chemistry (1961) and a PhD, in molecular spectroscopy (1964) at the University of Sheffi eld in South Yorkshire, United Kingdom. After a post-doctoral position at the National Research Council in Ottawa from 1964 to 1966, he spent a year at the Murray Hill Bell Laboratories in New Jersey, and in 1967 he started his academic career at the University of Sussex. In 1970 his team conducted laboratory and radio astronomy studies on long linear carbon chain molecules, and discovered that these molecules existed in interstellar space. In 1985, he worked with Richard Smalley and Robert Curl at Rice University in Texas, performing laboratory experiments which simulated the chemical reactions in the atmosphere of red giants, and uncovered the existence of C60 Buckminsterfullerene, a new form of carbon. Smalley, Curl, and Kroto received the Nobel Prize in Chemistry for their work. In 1995, he inaugurated the Vega Science Trust (www.vega.org.uk) to create science fi lms of suffi ciently high quality for network television broadcast. He holds 29 honorary degrees from universities in the UK and abroad, as well as many scientifi c awards. From 2004 he has been on the Board of Scientifi c Governors at Scripps Institute. He was elected to the National Academy of Sciences in 2007. His research program at Florida Tech focuses on the range of molecular constituents of carbon vapor; the development of novel 20 arrays and associated open framework systems of metal cluster/organic linkers as well as peptides; the stabilization of small fullerenes; and carbon nanotube based devices.


249


Péter KrügerHead of Bayer Working Group NanotechnologyBayer MaterialScience AG51368 Leverkusen, ChemPark, Bldg. Q 23Phone: +49 214 30 53647Mobile: +49 175 30 53647E-Mail: [email protected]

Since June 2006 Dr. Péter Krüger is heading the Bayer “Working Group Nano-technolgy” with the responsibility for the global coordination of nanotechnology activities in all Bayer Subgroups and Service Companies with a reporting line to the “Coordination Board Technology, Innovation and Environment” of the Bayer Holding. In addition he is currently also the Head of the Physics Department within the Business Unit Coatings, Adhesives and Sealants of Bayer Ma-terialScience AG. Since the beginning of 2008 he furthermore took over the leadership of the project cluster “Innovation Alliance Carbon Nanotubes”, funded partly by the German government. During his 16 years with Bayer he held several positions in R&D, starting as a research scientist for polymer physics of thermoplastics within the Physics Unit of the former Central Research. Later he took over the responsibility for the entire Polymer Physics Department within the Central Research and in Bayer Polymers as well.Péter Krüger is an elected member of several advisory boards of scientifi c organizations and associations.Péter Krüger was born in Budapest (Hungary), has studied physics at the Technical University of Braunschweig (Germany) and fi nalized it with Master Thesis in theoretical quantum mechanics. He obtained his PhD in Braunschweig for his research in experimental physics and material sciences on the fi eld of relaxation and crystallization kinetics of amorphous and crystalline metallic materials.He is married and has a daughter and two sons.

Vito Lambertini

Responsible of the “Nanomaterials and nanodevices” group at FIAT Research Center (CRF)Dr. Ing. Industrial Chemistry, Politecnico of Torino, 1994. Vito has worked at CRF since 1994 contributing in the development of several automotive prototypes in the fi eld of lighting systems, MEMS and energy generation; diff erent facilities are present at Micro and Nanotechnology laboratories which includes today Micro and Nanofab-rication (microlithography, nanoimprinting, thin and tick fi lm processing, self assembling), Metrology (SEM/FIB, AFM, Photometry) and Cleanroom. He has developed various techniques for mass replication of optical elements. He mastered the development of micro-optical elements based on microlitography and by mass transfer on polymers compositions to fabricate lighting systems prototypes for automotive applications; he contributed in the development and transfer to mass production of the fi rst taillight based on diff ractive optics installed on Lancia Lybra in 1996. He worked since 1998 in fabrication of organic based lighting sources and display (OLED/PLED) for thin backlight and dashboard. Currently, he is responsible for diff erent EU projects on deposition, synthesis and patterning of organic and inorganic materials for displays (NaPANIL, MULTIFLEXIOXIDES), LEDs lighting systems (MULTILAYER) and energy production (INNOVASOL, DEPHOTEX).


250


Pierre-Noël LirsacFunction: Deputy Director Technology for HealthAffi liation: Atomic Energy commissionCEA/Saclay, Bâtiment 136, point courrier N° 18 91191 Gif sur Yvette cedex [email protected]

Dr. Pierre-Noël LIRSAC, 45, is Deputy Director of the technologies for health programme at the French Atomic Energy commission (CEA). He is also the present chairman of the Mirror Group and member of the Executive Board of the European Technology Plateform in Nanomedicine. Since January 2009 he coordinates the EuroNanoMed ERA-Net initiative in Nanomedicine.After A PhD in biochemistry, microbiology and bioconversion, PN Lirsac started as researcher in radiation biology. at the life Science Directorate of the French atomic Energy Commission. From 1996 to 2002 he was Head of the Radiation protection, Biology and Medicine department of the National Institute for Sciences and Nuclear Technologies.Early 2002 he joined the Directorate for Enterprises of the French Ministry of Industry as Head of the Biotech and Health Department to elaborate an action plan for biotechnology and to support the attractiveness and competitiveness of the bio industry including innovation, R&D, regulatory, economic and fi scal aspects. In 2004, he initiated and chaired during 2 years the ERANET Eurotransbio.Since End of 2006, he is Deputy Director of technology for health programme. In june 2008 he was elected Chairman of “Adebiotech”, the French association of biotechnology actors.

Jaroslav MacháňŠKODA AUTO a.s.He graduated from the Czech Technical University in Prague in 1975, Faculty of Machine Engineering, Field of Study - Instrumentation Engineering of Regulation and Automatization. In 1983, he graduated the undergraduate training from the Czech Technical University in Prague, Faculty of Machine Engineering, Field of Study - Measuring Engineering. In 1987, he defended the theses at the Czech Technical University in Prague, Faculty of Machine Engineering, Field of Study - Engineering Cybernetics and he received his degree CSc (equivalent to PhD). In 2008 successfully defended his inaugural disertation dealing with “Quality assurance methods applied at the product development stage - application in automotive industry” at the Czech Technical University in Prague, Faculty of transportation sciences and received the associate professor degree (docent) in the fi eld of the “Engineering informatics in transportation and communications”. After graduating from the University in 1975, he started working at the Research institute of the machine tools in Prague. Since 1979, he has held various positions in Škoda Auto company. The most important among them are: 1984 head of dynamic testing-room, 1994 head of technical calculation, since 1996 head of the development department of electric and electronics and since 2003 he has been in charge of special projects in electro-strategy and research.


251


Kristan MarkeyUSEPA · 1200 Pennsylvania Ave. NW · Mail Code: 7405M · Washington,

Professional Experience

Program Manager and Chemist, United States (USEPA) 5/2008-presentEnvironmental Protection AgencyOversees multi-disciplinary regulatory reviews of new nanoscale materials under the Toxic Substances Control Act (TSCA). Works with stakeholders to develop appropriate regulatory and testing approaches for nanoscale materials. Develops and represents Agency policy positions on nanotechnology in the New Chemicals Program for workgroup, intergovernmental, and public meetings. Manages and contributes to special projects and initiatives associated with nanoscale materials across the Agency.

Major Accomplishments• Led analysis and development of the Nanoscale Materials Stewardship Program (NMSP)

Interim Report. Leading workgroup on NMSP submission reviews.• Programme Chair of the OECD Conference on Potential Environmental Benefi ts of

Nanotechnology: Fostering Safe Innovation Led Growth.

Consultant 2/2008 - 5/2008Breast Cancer FundClean Production Action, Tides CenterProvided scientifi c direction to program activities and chemical hazard analysis.

Research Analyst, Environmental Working Group (EWG) 12/2004-5/2008Acquired and integrated disparate databases to predict emerging pollutants. Provided chemical and policy expertise on human and environmental exposures, personal care products, polyfl uorinated chemicals, and nanotechnology. Researched and developed chemical profi les and directions for future research.Regularly represented EWG to media, scientists, and offi cials in areas of expertise. Designed interactive websites and tools for research and public dissemination fi ndings.

Major Accomplishments• Served as lead designer for chemical information system that links properties, toxicity,

exposure, and regulatory data from 30 primary sources to allow comparisons on over 250K chemicals. Used system to evaluate industry chemical data under EPA’s High Production Volume program and evaluate chemical profi les in nationally featured cosmetics and sunscreen database and website.

• Developed and implemented chemical hazard evaluation framework, data gap analysis system, and sunscreen effi cacy models for nationally featured cosmetics and sunscreen database and website.

• Lead author on three reports on EPA changes to the Toxics Release Inventory (TRI) and advised California legislators leading to successful passage of state TRI.

• Served as EWG representative on the steering committee and as a working group rapporteur for international OECD conference on polyfl uorinated chemicals.

• Developed technical analysis and organizational policy positions for Toxics Release Inventory Rule, Final Sunscreen Rule, and national legislation to reform the Toxic Substances Control Act.

• Developed software systems to automatically acquire and process online databases, linguistically recognize and convert physical units on-the-fl y, and track media and public policy impacts.

Educational Program Specialist, Holy Cross Hospital 8/2004-6/2005Developed and instituted data management systems for hospital wide educational programs. Completed data and statistical analyses to meet internal and regulatory requirements. Oversaw student nurse clinical experience program throughout hospital.

Science Teacher, St. John’s College High School 8/2002 - 8/2004Taught physical science and astronomy to grades 9, 11 and 12. Supervised students in academic, laboratory, and non-academic settings. Created course and independent learning materials and maintained all materials on website. Moderated Ski Club, Chess Club, and Student Pugwash.

Research Fellow, Physicians for Social Responsibility 6/2003 - 9/2003Developed and presented organizational technical comments and legislative briefi ng materials evaluating the science of plutonium aging and the need for modern plutonium pit production facilities. Coordinated among scientists, policy experts, and decision-makers. Developed media materials and handled press inquiries.

Research and Teaching Assistant, University of Georgia 1/2000 - 12/2001Developed novel algorithm for improving gaussian basis sets in density functional theory to better describe hydrogen bonding. Edited scientifi c manuscripts and peer-reviewed papers and grants. Prepared and presented talks and posters on research and literature topics. Led undergraduate chemistry and physics labs and intensive writing sections

Research Assistant, Universität Göttingen 6/1997 - 12/1999Developed novel algorithm for improving gaussian basis sets in density functional theory. Investigated properties of carbon chains to assist experimental detection in interstellar gas. Developed a potential energy surface for combustion chemistry molecules.


252


Education

University of Georgia, Athens, GA 1/2000 - 12/2001Doctoral student in theoretical chemistry with Chemistry and Physics master’s coursework.Received prestigious National Science Foundation Graduate Research Fellowship. GPA: 3.5

Universität Göttingen, Göttingen, Germany 10/1996 - 8/1997, 6/1999 - 12/1999German and Chemistry studies with Max Kade Fellowship (1996-1997). Undergraduatecoursework in German, graduate coursework in chemistry and physics.

The Colorado College, Colorado Springs, CO 8/1994 - 5/1999Bachelor of Arts, Distinction in Chemistry, ACS certifi ed Chemistry degree, Senior thesisAwarded full-tuition Otis A. Barnes Chemistry Scholarship. GPA: 3.5Summer Research Ctr. for Comp. Quantum Chem., U. of Georgia 6/1996 - 9/1996Chemistry Dept., Colorado College 5/1995 - 12/1995Performed density functional studies on clusters of catalytic interest. Attended computationalchemistry summer school. Investigated oscillating reactions theoretically and experimentally.President Student Affi liates of the American 1/1995 - 5/1996Chemical SocietyInitiated, organized and ran K-12 science demonstrations, fi eld trips, and chemistry events.Recruited participants and trained chemistry students to assist and lead demonstrations.

Publications and ReportsUSEPA (2009), “Nanoscale Materials Stewardship Program Interim Report.” United StatesEnvironmental Protection Agency. January, 2009. Accessed from:http://www.epa.gov/oppt/nano/nmsp-interim-report-fi nal.pdf.

Gray, S.; Lunder, S.; Markey, K.; Sutton, R.; Leiba, N.; Houlihan, J. (2008). ”Sunscreens: What works and what’s safe.” Environmental Working Group. Retrieved fromhttp://www.cosmeticsdatabase.com/special/sunscreens/summary.php.

Markey, K. , Herget, C., Gouldin, C (2008). “ChemIndex - A Chemical Information OrganizationalSystem.” Environmental Working Group. Retrieved from http://www.ewg.org/chemindex/.

Markey, K. and Houlihan, J. (2007). “Comments from EWG on the U.S. FDA’s Proposed Amendment of Final Monograph for Sunscreens.” Environmental Working Group. Retrieved fromhttp://www.ewg.org/node/25705.

Invited Presentations

Markey, K. (2009) “EPA Progress and the Emerging Regulatory Role for Industrial Nanoscale Materials.” NanoRegulation - Anticipating the Smallest Threats and the Largest Opportunities, Sacremento, CA, March 19, 2009.

Markey, K. (2008) “How is EPA regulating industrial nanoscale materials? A look at national and international approaches.” Environmental Nanoparticles: Science, Ethics, and Policy, Newark, DE, University of Delaware, November 10-11, 2008.

Markey, K. “Emerging EPA perspectives on industrial nanoscale materials.” International Congress of Nano-Bio & Clean Tech, San Francisco, CA, October 27-30, 2008.

Markey, K. “Nanotechnology - An EPA perspective.” Nanotech Advanced Product Manufacturing and Related Considerations for Toxicology, Fayetteville, AR, University of Arkansas, August 14-15, 2008.

Markey, K. (2006). “Using Existing Chemical Datasets to Assess the HPVIS: Finding PBTs in HPVs.” Characterizing Chemicals in Commerce. Austin, TX, U.S. EPA Offi ce of Pollution Prevention and Toxics, December 12-14, 2006.


253


Marcel MayorAffi liations and AddressesProf. Dr. Marcel MayorDepartment of Chemistry Institute for NanotechnologyUniversity of Basel Forschungszentrum Karlsruhe GmbHSt. Johannsring 19 P. O. Box 3640CH-4056 Basel D-76021 KarlsruheTel. : 0041 (0)61 267 10 06 0049 (0)7247 82 6392FAX : 0041 (0)61 267 10 16 0049 (0)7247 82 5685e-mail : [email protected] [email protected]

Education1986 - 1991 Studies of Chemistry (diploma) at the University of Berne (Switzerland)1995 Dissertation (Ph.D.) at the University of Berne (Switzerland)2002 Habilitation (H.D.R) at the Université Louis Pasteur in Strasbourg (France)

Professional Positions1995 - 1996 Postdoc fellow of the Swiss National Science Foundation (Prof. J.-M. Lehn) at the

Université Louis Pasteur in Strasbourg (France)1996 - 1997 Research Associate at the Université Louis Pasteur in Strasbourg (France)1997 - 1998 Maître de Confèrence invité at the Collège de France in Paris (France)1998 - 1999 Research Associate at the Institute for Nanotechnology at the Forschungszentrum

Karlsruhe GmbH, Karlsruhe (Germany) since 1999 Manager of the study group “Synthetic Chemistry” of the Institute for Nanotechnol-

ogy at the Forschungszentrum Karlsruhe GmbH, Karlsruhe (Germany)since 2005 Associate Professor of Chemistry at the University of Basel (Switzerland)

Distinctions, Honors and Awards2000 Awardee of the support program for excellent scientifi c/technical off spring of the

Forschungszentrum Karlsruhe GmbH, Karlsruhe (Germany)2004 Erwin Schrödinger Award of the Helmholtz Foundation and of the Stifterverband

für die Deutsche Wissenschaft

Scholarships and Fellowships1991 PhD supported by the Verband der Chemischen Industrie1995 Post doc fellowship of the Swiss National Science Foundation

Publications

Over 50 Research Papers, 2 Book Chapters, 2 Patents, 8 Proceedings Papers & Others Invited Lectures and Addresses

> 100 Invited Talks and Department Seminars

Research Interests• Molecular electronics• New functions emerging from order• Design and synthesis of molecular nano-objects• Self-assembly of nano-objects• Functional materials• New functions emerging from order• Molecule based structuring and surface functionalization

Others

Marcel Mayor and his research groups are currently actively involved in several national and international collaboration programs (CFN-DFG, FUNMOL, Volkswagen Foundation, ESF-Euro- Quasar, MAECENAS, NCCR Nanoscience, SNF-KTI). Furthermore, the group at the University of Basel cooperates with the IBM research laboratory in Rüschlikon (Switzerland) and the SONY materials lab in Stuttgart (Germany). Furthermore, the group participates at the Swiss Nanoscience Institute (SNI). Marcel Mayor is a founding member of the DFG research center for functional materials (CFN) in Karlsruhe (Germany).


254


Mark Morrison

EducationBSc (Hons) First class, Molecular Biology, University of Glasgow, 1990.PhD Biochemistry and Molecular Biology, University of Manchester, 1994.

CEO, the Institute of NanotechnologyThe IoN is a charitable organization established to inform and educate the wider community on developments in nanotechnology. It works with industry, academia, government and NGOs to achieve this, and is highly active in European initiatives, in addition to its own activities in education (nanomedicine courses in association with Cranfi eld University, and establishing a committee of course coordinators of nanotechnology Masters courses) and business support (NanoMicroClub). Prior to taking on the role of CEO he was largely responsible for EU projects in which IoN participates including coordination of the 4 M€ observatoryNANO project funded under FP7 (2008-2012) to provide analysis on technological and socioeconomic impacts of nanotechnol-ogy to the EU; coordination of the 1.4 M€ ICPCNanoNet project funded under FP7 (2008-2012) to provide support to and network nanoscientists across the EU and emerging nations; coordina-tion of the 2.7 M€ Nanoforum project funded under FP5 to provide a central point for public access to what is happening in nanosciences and nanotechnologies in Europe; the NanoRoad-Map project (partner) which provided technology roadmaps in energy, materials and health and medicine; NanoSci ERA (as a subcontractor to the EPSRC) to provide recommendations for wider public engagement with regards to the outcomes of EU nanoscience research; EuroIndiaNet (partner) which fostered closer relationships between EU and Indian nanotechnologists. Through these roles he has been part of advisory groups, been an invited speaker at a number of major international conferences and workshops, and written a number of articles and papers for trade magazines and journals. He is also a member of the UK’s NTI/1 committee (coordinated by BSI) for standards in nanotechnology.Prior to joining the IoN in 2003 he was a post doctoral research fellow at the University of Glasgow, where he was supported initially through the BBSRC and then secured funding from Intervet International to develop animal viruses as vaccine and gene therapy vectors.

Ewald NiehuisDr Ewald Niehuis is the managing director of ION-TOF GmbH in Muenster, Germany. He studied physics at the University of Muenster and received a Ph. D. with his thesis on surface physics in the year 1988.In 1989, Dr Niehuis founded ION-TOF GmbH in Muenster together with Professor A. Benninghoven and T. Heller in order to commercialise and further develop the Time-of-Flight Secondary Ion Mass Spectrometers (TOF-SIMS) developed at the University of Muenster.Over the last few years, ION-TOF has become the leading European manufacturer of TOF-SIMS instrumentation and currently employs about 60 people. The TOF-SIMS instruments are used in industry and research for trace and nano analysis with a high surface sensitivity. Among ION-TOF‘s customers, there is a large number of well-known companies from the microelectron-ics sector, from chemical and pharmaceutical industry as well as from material testing and standardisation institutions.For further extending its leading position, ION-TOF GmbH is intensely engaged in research and development. Dr Niehuis is the head of several research projects which are supported by NRW, BMBF and the EC. He has also been an active member of two Networks of Excellence (NoE) of the European Union. ION-TOF’s research activities go from basic research to technology and application development. Dr. Niehuis is also a member of the organising committee of the SIMS Europe conference series.In 1997, Dr Niehuis founded TASCON GmbH together with Dr B. Hagenhoff , Professor A. Benninghoven and T. Heller as an innovative service provider in the fi eld of surface analysis.


255


Matthew M. Nordan President and Co-Founder, Lux Research Inc.Matthew Nordan is the President of Lux Research. Under Matthew’s leadership, the Lux Research analyst team has become a globally recognized authority on the business and economic impact of emerging technologies, focusing on energy, the environment, and advanced materials. Lux Research advises corporations, start-ups, fi nancial institutions, and governments seeking to harness science-driven innovation for competitive advantage. Matthew has counseled decision-makers on technology change for a decade. Prior to Lux Research, he held a variety of senior management positions at emerging technology advisor Forrester Research, where he headed the fi rm’s North American consulting line of business. Earlier, Matthew lived for four years in the Netherlands growing Forrester’s operations in Europe, where he launched and led research practices in a variety of industries.Matthew has delivered advice to clients in Europe, the Middle East, Southeast Asia, Japan, Australia, and South Africa. Beyond the corporate sphere, he has testifi ed before the U.S. Congress four times on emerging technology issues, advised the Committee to Review the National Nanotechnology Initiative of the National Academies, and been an invited speaker at universities including Harvard, MIT, and Columbia. He is a member of the World Economic Forum’s Global Agenda Council on the challenges of nanotechnology, and has participated in developing public-sector technology strategy for the European IT Observatory and the Dutch transportation ministry. In addition, Matthew has been frequently cited by news outlets including CNN, CNBC, The Wall Street Journal, and The Economist. Matthew is a summa cum laude graduate of Yale University, where he conducted cognitive neuroscience research on the neural pathways mediating emotion and memory.

Martin OertelBorn 1963 in Muenster, Germany.Diploma degree in physics at Westfaelische Wilhelms University in Muenster 1988.Research scientist at the center for renewable energies of the DLR in Stuttgart, Germany 1988-1991.PhD in natural science at the University of Stuttgart 1993.Since then emplyoed at Omicron NanoTechnology GmbH.Position nowadays International Sales Manager.


256


Markus Pridöhl Evonik Degussa GmbH

1984-1990 Diploma in chemistry, TU Berlin1991-1994 PhD on sulfur selenium polymers, TU Berlin.1991-1995 Teaching assistant, TU Berlin1995 Head of quality control ceramic colors, Cerdec AG, Frankfurt.1996 Degussa AG, trainee on Carbon Black production site DGW, Dortmund.1998 R&D manager Carbon Black, Cologne.2000 R&D manager Project House Nanomaterials, Degussa, Hanau.2002 Senior Manager R&D, fi nancial controlling, Project House Nanomaterials, Degussa2004 Head R&D and member of the management team of the internal start-up Advanced

Nanomaterials, Degussa AG, Hanau.6/2005 Coordinator and spokesman Nanotechnology, Evonik

Current external memberchips/functions in nanotechnologyChair DECHEMA/VCI* working group “Responsible Production and Use of Nanomaterials”Head of German´s ISO delegation on nanotechnologyVCI* Group on Communication of NanotechnologyVCI* Coordination Group NanotechnologyGermany´s federal stakeholder project Nano DialogueOECD´s Working Party on Manufactured NanomaterialsAdvisory Board NanoCareSpeaker on several international conferences and workshops*VCI: German Chemical Industry Association

Jean-Philippe PutaudScientifi c Offi cer. JRC-Ispra EMEP-GAW station responsible.Obtained in 1993 at Paris (VII) his PhD on ‘Dimethylsulfi de fl ux, concentration and atmospheric oxidation products’, started with a 13-month stay at Amsterdam Is (38ºS, 77ºE). Short post-doc period (1994) in Stockholm (MISU) dedicated to ppt-level SO2 monitor development and 3-D modeling practice (MOGUNTIA). Took part to numerous large fi eld experiments (Oceano-NOx, FieldVOC, EUMELI 3, SOFIA, OMEX, ACE-2, PiPaPO, MINATROC, ESCOMPTE, INTERREG III-Cμ, Krakow project campaign). Current research activity focused on aerosol chemistry and mass closure, aerosol optical properties and radiative forcing. Responsible of the aerosol EMEP-GAW station for atmospheric research at JRC-Ispra since February 2002.


257


Andrea E. Reinhardt is working in the fi eld industrial applications of micro- and nanotechnologies since 1996 at microTEC team as part of the management. microTEC is focused on development and production of components based on nano enhanced materials and latest state of the art mems production technologies RMPD® and 3D-CSP: samples are e.g. high integrated nand-stacks for consumer electronics, lab on chip systems for diagnostics, self lubricant micro gear wheels. In 2001 she co-founded NTC www.ntcgmbh.com, a company active in the fi eld of Sol-Gel materials. Mrs. Reinhardt has worked within customer- and EC funded cooperative R&D projects. She has given invited presentations, published peer reviewed articles about customized series produc-tion of mems, polymer and multimaterial micro components, diversity, innovation and SME as an element of European growth. She is experienced as reviewer of R&D projects on national and European level, is member of the industry board of MINAM www.micromanufacturing.eu and ZIRP www.zirp.de

Walter Riess Department Head, Science & Technology

IBM Research GmbH, Zurich Research LaboratoryDr. Walter Riess joined the IBM Zurich Research Laboratory in 1995. From 1998 to 2003 he was Manager of the Display Technology Group working on Organic Light Emitting Devices for Display applications. From 2004 to 2008 he was managing the Nanoscale Structures and Device group where he was working on ultimate and post CMOS devices. Since November of 2008, Dr. Riess has been the Department Head of the Science & Technology Department at the IBM Zurich Research Laboratory. Research activities in the department span: chip cooling, advanced thermal packaging, optical interconnects, silicon photonics, nanofabrica-tion, 3D integration, self-assembly and patterning, experimental biology, magnetism, spintron-ics, AFM & STM imaging, III-V and Ge on silicon, semiconducting nanowires and molecular electronics. Dr. Walter Riess studied Physics at the University of Bayreuth, Germany, where he received a Masters, a Ph.D and a habilitation.


258


Gilbert M. Riosis Professor and Head of the Department of Chemical Engineering at the Ecole Nationale Supèrieure de Chimie de Montpellier (France). He is expert in Membrane Technologies. His other points of interest are Supercritical Fluids and Fluidization. He is the author of more than 120 papers in International Journals or Congress Proceedings, and more than 100 oral or poster presentations in International Conferences. He is also involved in a lot of other tasks : reports, patents, scientifi c expertises, Congress Boards…He is a Fellow of the Institution of Chemical Engineers (London), as well as a Member of the European Membrane Society (EMS) and of the Working Party on Membranes of the European Federation of Chemical Engineering (EFCE). He is also strongly involved in EC projects : former coordinator of the European Network of Excellence on “Nanoscale-based membrane Technologies” (NanoMemPro -FP6 NMP - Sept. 2002-Febr. 2009); coordinator of the new Membridge project (FP7 - NMP - CSA May 2009-April 2011); Executive Director of the European Membrane House, the legal entity created to ensure the sustainability of the NanoMemPro project.

Per RudquistPer Rudquist is Assoc. Prof. in Liquid Crystal Physics at he Department of Microtechnology and Nanoscience (MC2) at Chalmers University of Technology. He got his MSc degree in 1992, and PhD degree in 1997 at Chalmers. In 1997-1999, Rudquist worked several periods at the Liquid Crystal Materials Research Center, University of Colorado at Boulder, USA.His main fi eld of research is chiral polar liquid crystalline systems, especially ferroelectric and antiferroelectric liquid crystals.Today Rudquist is heading liquid crystal research at the department of MC2.Rudquist was Director of the Chalmers International Master Programme “Nanoscale Science and Technology” in 2003-2005, and is since 2005 the Chalmers coordinator for the Erasmus Mundus Master Programme “Nanoscience and Nanotechnology” (EMM-nano) run by KU Leuven, (Belgium, coordinator), Chalmers (Sweden) TU Dresden (Germany), Delft/Leiden (The Netherlands).


259


Walter Schützfounder and managing director of FutureCarbon GmbH Born 1967, Walter Schütz studied phys-ics at University of Bayreuth, and made his doctoral thesis in the fi eld of Fullerenes and related Carbon-Nanomaterials in 1997. In 1997 he joined Mannesmann Pilotentwicklung in Munich, the Think Tank of the former Mannesmann Group. There he worked in the fi eld of new energy technologies and new materials. He was responsible for several projects in the fi eld of hydrogen storage, fuel cells and new materials. He was leader of the fuel cell development center of Man-nesmann. In 2001, after the take over of Mannesmann by Vodafone he founded FutureCamp as a spin-off company together with two partners. In 2002 he founded FutureCarbon as daughter company of FutureCamp. This company focuses on the development and production of carbon nanomaterials based products.


260


Karen Louise Scrivener 21st August 1958Married, Two childrenBritish nationality, Swiss resident (Permit C)

Education:76- 79 Clare College, Cambridge, Natural Sciences Tripos BA Hons Class 2.I (major, Metallurgy and Materials Science)79-80 University of Pennsylvania, USA , funded by Thouron Award Studied in Master of

Engineering, Met & Mat Sci Program80-84 Imperial College, London, PhD: “The development of microstructure during the hydration of Portland cement” Awarded Armstrong Medal and Prize 1985 (annual prizes of Imperial College for best work of industrial relevance)

Appointments:2001- Professor (ordinaire)

Director of Laboratory of Construction Materials, Ecole Polytechnique Federale de Lausanne, Switzerland

95 - 01 Senior Scientist and Head of Calcium Aluminates Department, Lafarge, Central Research Laboratory, FranceResponsible for research team of 10 people, budget 2 M€;Negotation of research programmesExpertise on Concrete Durability.

91 - 95 Lecturer, Department of Materials, Imperial College Head of research group on cement and concrete86 - 91 Warren Research Fellow of the Royal Society, Imperial College

independent research on characterisation and quantifi cation of cement microstruc-tures by electron beam techniques”

83-86 Postdoctoral Research Assistant, Imperial College.,

Prizes, Membership of professional bodies, learned societies, prizes, etc.:• Klaus Dyckerhoff Prize 2007

for outstanding lifetime contribution to the fi eld of cement and concrete research, • Fellow of RILEM 2006

(International Union of Laboratories and Experts for Construction Materials, Structures and Systems)

• Editor in Chief of Cement and Concrete Research since 2005• Co-ordinator of Nanocem research network a European industrial academic partnership for

fundamental research on cementitious materials, with 30 partners, since 2001• Leslie Holiday prize of the Institute of Materials 1991• Awarded Armstrong Medal and Prize, Imperial College 1985• Chartered Engineer, Member Institute of Materials (since 1988)• Member American Concrete Institute

Conference organisation (all as main organisaer except where stated)2008 Calcium Aluminate Cement: the centenary conference, Avignon (210 participants)2006 Advances in cement and Concrete X: Sustainability of cementitious Materials, Engineer-

ing Conferences International, (~100 participants) Davos, Switzerland Co-chair Perforamnce based indicators for Concrete Durability, (~100 participants)

Madrid, Spain2005 Cementitious Materials as Model Porous Media: Nanostructure and Transport Processes,

(~80 participants) Monte Verita, Swtzerland2004 Conference to Celebrate the Contribution of Hal Taylor to Cement and Concrete Science,

Diableret, Switzerland (~80 participants)2003 Nanoscience of cementitious Materials, symposium within EUROMAT, Lausanne2003 Co-chair,“ Advances in Cement and Concrete IX:Volume Changes, Cracking, and Durabil-

ity”, United Enineering Foundation Conferences, Copper mountain, Colarado, USA2002 Delayed Ettringite Formation workshop (40 participants) Villars, Switzerland2001 Microstructure and micro-macro modelling of concrete and cementitious composites,

seminar (110 participants), Lausanne1995 Mechanisms of Deterioration of Cementitious Materials, Materials Research Society

Symposium (80 Participnts), Boston, USA1991 - Co-chair “Advances in Cement and Concrete”, , United Engineering Foundation Confer-

ence, Potosi, USA,


261


Invited Keynote Conference presentations (last 2 years)

2008• 100 Years of Calcium Aluminate Cements:

Calcium Aluminate Cement: the centenary conference, Avignon, June 30-July 2 2008• Cement and Concrete Advances: The arrival of Nano-technologies:

Cemtech London: 28th September - 1st October 2008• The Importance of Microstructural Understanding for Durable and Sustainable Concrete:

First International Conference on Microstructure Related Durability of Cementitious Composites, 13-15 October 2008, Nanjing, China

• The Importance of Microstructural Understanding for Durable and Sustainable Concrete: 2nd International Conference on Concrete Repair, Rehabilitation and Retrofi tting, Cape Town, South Africa, 24 - 26 November 2008

2007• Challenges for Basic Research on Cementitious Materials:

27th Cement and Concrete Science, Royal Holloway College, 17, September UK• Biogenic corrosion in Sewers:

Performance of Cement-Based Materials in Aggressive Aqueous Environments, Ghent Belgium 3 September 2007

• Innovation in Use and Research on Cementitious Material, 12th ICCC, Montreal, 9-12 July

• Modelling Cement Microstructure: Modelling of Heterogeneous Materials. 27-28 June, Prague

• Application of Nanotechnology on the Sustainability of Cement and Concrete • TCMB 3rd International Symposium, Sustainability in Cement and Concrete, Istanbul 21-23 May

Dr. Eckhard Schollmeyerborn 1940, studied textiles at Textilingenieurschule Neumünster and physics at Universität Kiel, since graduation 1971 (Dipl.-Phys., Dr. rer. nat) on physical chemistry, he started working as a postdoctoral research fellow at the Universität Regensburg. From 1973 - 1980 he worked at Institut für Chemiefasern of Institute für Textil- und Faserforschung, Denkendorf. He got his habilitation 1978. Since 1980 he works at the Deutsches Textilforschungszentrum Nord-West e.V. (DTNW). Now he is the managing director of the DTNW, Director of the Öff entliche Prüfstelle Krefeld e.V. (ÖP), and professor of physical chemistry at the Gerhard-Merartor-Universität Duisburg.

Deutsches Textilforschungszentrum Nord-West e.V.Adlerstraße 1 - 47798 KrefeldTelefon: 0049-2151/843-143, Telefax: 0049-02151/843-143


262


Clivia M. Sotomayor TorresProfessor Clivia M. Sotomayor Torres obtained her BSc. (Hons.) Physics in 1979 (Southampton University, UK) and her Dr. Phil. in Physics in 1984 (Manchester University, UK) with a thesis on semiconductor physics. During 1983-1984 she was a research assistant at the University of St. Andrews (UK). This appointment was followed by: 1984-87 Lecturer in Physics, St. Andrews University (UK), 1986-1996 Lecturer and Senior Lecturer in Electrical Engineering at the University Glasgow (UK). Clivia has received three prestigious awards from the Royal Society of Edinburgh, the Nuffi eld Foundation and an Amelia Earhart Fellowship from ZONTA International (USA) in 1993, 1990 and 1982, respectively. From August 1996 to February 2004 she was Profes-sor of Materials Sciences in Electronics at the University of Wuppertal, Germany. From 2004 till 2007 she was a research professor at University College Cork (NMRC-Tyndall). Since 2008 she is full-time ICREA Research Professor at the Catalan Institute of Nanotechnology where she set up the Phononic and Photonic Nanostructures group. She carries out research in the fi eld of science and engineering of optical nanostructures, especially novel lithography methods for their realisation, such as nanoimprint lithography, light propagation and emission in periodic and quasi-periodic media and more recently confi ned phonons in silicon-on-insulator thin fi lms and nanometrology. She is author of over 350 scientifi c publications and has edited six books. She is member of the Management Team of the Scientifi c Community Council of the European Technology Platform on Nanoelectronics ENIAC.She has participated in several EU projects since 1989. Clivia currently participates in NANOPACK, NAPANIL, NANOICT and TAILPHOX.She coordinated the EU IST Network of Excellence “Nanophotonics to realise molecular-scale technologies” (PHOREMOST) between 2004 and 2008.


263


Eva SykováProfessor Eva Syková, M.D., Ph.D, D.Sc., was born in Czechoslovakia, received her M.D. from Charles University in Prague in 1970 and her Ph.D. from the Institute of Physiology of the Czechoslovak Academy of Sciences in 1976. In 1983 she became the Head of the Laboratory of Neurohumoral Regulations at the Institute of Physiological Regulations in Prague; in 1990 she was awarded a D.Sc. from Masaryk University and became the Head of the Department of Neuroscience at the Institute of Experimental Medicine, Academy of Sciences of the Czech Republic (IEM ASCR) in 1991. In 1996 she was also appointed Chairman of the Institute of Neuroscience at Charles University as the founder of that Institute. Since 2000 she has been Professor of Physiology and Head of the National Center for Cell Therapy and Tissue Repair. From 2001 up to now, she is the Director of the Institute of Experimental Medicine ASCR. The Institute was selected as an EU Centre of Excellence with Prof. Syková serving as Principal Coordinator. Professor Syková has published more than 720 scientifi c communications, including 156 papers in peer-reviewed journals and 35 book chapters. She is the author of 1 book (Springer-Verlag) and the co-editor of 4 books. Her publications have been cited more than 2766 times by other authors, and her Hirsch index is 38. In addition, she is a co-holder of 4 patents. She has given more than 100 invited lectures and seminars at foreign universities and international confer-ences and has co-organized 14 international meetings and 3 teaching workshops for young scientists. Among her 12 scientifi c awards are the prizes of the Czech Physiological Society, the Czech Neuroscience Society, the Czech Medical Society, the Czech Academy of Sciences, and the Purkyně medal for her merit in biological sciences. She has been elected a member of Academia Europea, the European Academy of Sciences, the Czech Medical Academy the Russian Academy of Natural Sciences and Czech Medical Academy. She serves on the editorial boards of 5 international journals and also as a member of the executive committees of a number of Czech and international scientifi c societies and boards. Since 2005 she has been a member of the Scientifi c Council of the Ministry of Health of the Czech Republic and the President of the Czech Neuroscience Society.The scientifi c interests of Professor Syková include both basic and clinical research, namely the origins, mechanisms and maintenance of ionic and volume homeostasis in the CNS; the extracellular space as the microenvironment of nerve cells and a communication channel; extrasynaptic “volume” transmission in the CNS, mediated by diff usion in the extracellular space; changes in the size and geometry of the extracellular space, studied using ion-selective microelectrodes and magnetic resonance imaging; the role of glial cells in health and disease; the diff usion properties and underlying mechanisms of many pathological states including ischemia, Parkinson’s disease, Alzheimer’s disease and tumors; spinal cord physiology; the use of biomaterials as tissue bridges, nanofi bers as 3D stem cell carriers and nanoparticles for stem cell imaging; and the role of stem cells in the rescue and replacement of damaged tissue.


264


Christos TokamanisHead of Unit “Nano-and converging Sciences and Technologies”Directorate “Industrial Technologies”Research Directorate GeneralEuropean CommissionBrussels

Trained as chemical, material engineer, he holds a degree in Business Administration. He has worked in the chemical and electrical engineering industries before joining the European Commission in 1987Since then, he has been working in the Research fi eld of advanced materials, new production systems and transport technologies.He has been, for 5 years, Head of Unit responsible for Sub-Priority 6.2 “Sustainable Surface Transport” in the FP6 Specifi c Programme “Integrating & Strengthening ERA”.In 2004, he was appointed responsible for the Unit ““New generation of products” within Directorate “Industrial Technologies” of “Directorate General “Research”.On the 1st of July 2008, he took the responsibility of the “Nano- and Converging Sciences and Technologies” unit within this same Directorate “Industrial Technologies”

Nicola Trevisan

Position:CEO, Veneto Nanotech Scpa - The Italian Cluster of Nanotechnologies, Padua, ItalyCEO, Nanofabrication Facility, Marghera, Venice, ItalyMember of the Board of ADITE - Italian Association of the Hi Tech Clusters, Rome

Background:CUOA - University Consortium for the Studies of Company Organization - Master in Administration and International Finance, Altavilla Vicentina (VI) 1985Università degli Studi di Padova, Padua, Italy, Law, 1984.

Experience:2007 - Nanofab, Venice, Italy, CEO2004 - Veneto Nanotech Scpa, Padua, Italy, CEO 1999 - 2004 Consultant in the fi eld of credit guarantee schemes and management in the international cooperation projects for the fi nancial growth of the SMEs, by Inter-American Development Bank, European Commission, Italian Minister of External Aff airs, Veneto Region, Industrial Associations and private companies1998 - 1999 Partner of BTS Srl - Business & Technic Systems, Consultant Firm operating in the areas of Internationalization, Management of the R&D Project and Training1991 - 1998 Palladio Finanziaria S.p.A. Investment Bank, Vicenza, Italy, Chief Financial Offi cerTel: + 39 049 7705500 / 11Fax: + 39 049 7705555Email: [email protected]; [email protected]


265


Karel Ulbrich

PersonalDate of Birth: February 27, 1947Citizenship: Czech RepublicMarital Status: Married, three children

EducationM.S., Macromolecular Chemistry, Institute of Chemical Technology, Prague 1970Ph.D., Polymer Chemistry, Institute of Macromolecular Chemistry, Czechoslovak Academy of Sciences, Prague. Czechoslovakia 1975,D. Sc., Macromolecular chemistry, Academy of Sciences of the Czech Republic, 2001Assistant Professor, Institute of Chemical Technology, Prague 2000Professor, Institute of Chemical Technology, Prague 2005

AppointmentsPh.D. Student, Institute of Macromolecular Chemistry, Czechoslovak Academy of Sciences, Prague 1971 - 1975Research Scientist, Laboratory of Biomedical Polymers, Institute of Macromolecular Chemistry, Czechoslovak Academy of Sciences, Prague 1975 - 1980Senior Research Scientist since 1980, Deputy Head of Laboratory of Biomedical Polymers, Institute of Macromolecular Chemistry, Czechoslovak Academy of Sciences, Prague 1980 - 1987Head of Department of Biomedical Polymers, Institute of Macromolecular Chemistry, Czecho-slovak Academy of Sciences, since 1992 Academy of Sciences of the Czech Republic, Prague, 1987 - presentProfessor, Institute of Chemical Technology, Prague, since 2005Deputy Director of the Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Prague, 1994 - 1998Director of the Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Prague, 1998 - 2007

Study staysVisiting Lecturer, Department of Organic Chemistry, Johannes Guttenberg University Mainz, FRG, 1983Visiting Associate Professor, Department of Bioengineering, University of Utah, Salt Lake City, USA 1989Adjunct Associate Professor, Department of Pharmaceutics and Pharmaceutical Chemistry, University of Utah, Salt Lake City, USA, 1992

Membership in organizations and other bodiesMember of the Learned Society of the Czech Republic, 2003 - presentMember and deputy chairman of Scientifi c Board of the Academy of Sciences of the Czech Republic since 2008Member of Scientifi c Board of the University of Chemical Technology, Prague, since 2003Member of Scientifi c Board of the Faculty of Chemistry, University of Chemical Technology, Prague, 1992 - presentMember of Scientifi c Board of the Tomas Bata University, Zlin, Czech Republic, 2001 - presentMember of Scientifi c Board of the Faculty of Medicine, Charles University, Prague, Czech Republic since 2008Member of Scientifi c Board of the Faculty of Natural Sciences, Charles University, Prague, Czech Republic, since 2009Member of Scientifi c Board of the Polymer Institute, Slovak Academy of Sciences, 1999 - presentChairman of a Gremium for conferring the D.Sc. degree at the Academy of Science of the Czech RepublicChairman of the Committee for conferring the D.Sc. degree in Macromolecular Chemistry at the Academy of Science of the Czech RepublicChairman of the Committee for Conferring the D.Sc. Degree in Macromolecular Chemistry and Technology of Macromolecular Compound at the Slovak Academy of ScienceIUPAC FellowMember of Editorial Board of the Journal of Controlled ReleaseMember of Editorial Board of the Journal of Bioactive and Biocompatible PolymersMember of Editorial Board of the Central European Journal of ChemistryMember of Editorial Board of the Journal of Biomaterial Science, Polym.. Ed.


266


Member of International Editorial Advisory Board of the journal Polymer (Korea)Member of Editorial Board of the European Journal of Pharmaceutical SciencesMember of Editorial Board of the Journal of Drug Delivery Science and Technology

AwardsAward of the Learned Society of the Czech Republic, 1996Award of the Minister of Education, Youth and Sports for Results in Science, 2002Honorary Medal of the Polymer Institute of Slovak Academy of Sciences, 2004Award “Invence“, Česká hlava, Czech Republic 2005Award “Praemium Academiae 2008”, Academy of Sciences of the Czech Republic

Publications210 refereed original papers, 3 chapters in monographs 31 patents and patent applicationsover 400 oral or poster presentations at conferences with published abstractsCitations (SCI): over 3000 without any kind of autocitations

Research interestsMacromolecular chemistry, drug targeting (antibody, peptide and hormone targeted polymer drug conjugates), water-soluble polymer drug delivery systems, micellar drug delivery systems, polymer conjugates with anti-cancer activity, polymer diagnostics, non-viral and polymer associated viral gene delivery systems.

M.H. Van de VoordeBelgian nationality

University studiesDegrees in Chemistry and Physics and PhD in Nuclear Engineering: Belgium and France

Academic careerProfessor at Louvain and Ghent Universities in Belgium but mainly at the University of Technol-ogy in Delft in the NetherlandsHonorary Professor and Doctor Honoris Causa from various universities in Europe and the Tsinghua University in Beijing

Scientifi c careerResearch direction functions at European Research Organisations: CERN (Geneva), and the European Commission ResearchMember of multiple European and International Research Councils in Europe, Japan, China, e.a. CNRS (FR), CNR (IT), CSIC (ES), NIMS (JP), NATO (BE), CEN (BE), LNETI (PT), ESA (FR), NASA (US), etc.Max Planck Institute - Stuttgart: 1999 - European research programmes and strategy studiesFellow of scientifi c societiesCommander in the Order of the Crown (BE) Member of the European Honorary SenateAdvisor to Government, Directors of Research Institutes and Industries: NL, BE, PT, PO, etc.• 35 years experience in research and management in European research organisations. • Familiar with the research and technology and industrial innovation in the EU and EFTA

countries, USA and Japan; close contacts with universities, national research centres and industries in Europe and international organisations


267


Erno Vandeweert received his Ph.D. in Physics in 1997 from the Katholieke Universiteit Leuven, Belgium. He worked as a Fulbright-Hays Research Fellow at the Pennsylvania State University before returning to Belgium. After 15 years of active research in solid-state physics and nanoscience, he joined the European Commission in 2005 where he currently is a Programme Offi cer focused on value-added materials for energy applications.

Peter Venturini

Personal Data:Born on November 21, 1966 in Ljubljana, SloveniaMarried, two children

Home Address: Magajnova 7, 1231 Ljubljana, SloveniaE-mail: [email protected]

Education:Ph.D. Chemistry (1996), University of Ljubljana, Slovenia MBA (2000) The University of Kansas, Lawrence, USA B.Sc. Chemistry (1991), University of Ljubljana, Slovenia

Work Experience:2008 - Assistant Chairman of the Managing Board fot Research and Development, Helios

Domzale, d.d., Slovenia1999 - 2008 Director, National Institute of Chemistry, Ljubljana, Slovenia1996 - 1999 Project Manager, Lek d.d. Pharmaceutical Company, Ljubljana, Slovenia 1991 - 1996 Researcher, Jozef Stefan Institute, Ljubljana, Slovenia1992 - 1993 Researcher University of California Santa Barbara, Institute for Polymers and Organic

Solids, USA

Selected Memberships and Professional Activities:• Assistant professor (University of Maribor, 2006-),• European Science Foundation; Standing Committee for Physical and Engineering Sciences

(Member, 2003-, Member of a core group 2005-2008), • The Slovenian Science Foundation (Vice President of the Council, 2001-), • The House of Experiments, Slovenia (President of the Board, 2002-),• European Technology Platform on Nanomedicine (Panel member 2004-),


268


• Materials and Technology (Member of the Editorial Board, 1999-),• Slovenian Chemical Society (Member 1995-, Member of the Board 2001-).

Patents:1. VENTURINI, Peter, MRZEL, Aleš, MIHAILOVIĆ, Dragan. Method for separation of fullerenes:

SI 9200284, date of patent 30.06.1994. 2. MIHAILOVIĆ, Dragan, MRZEL, Aleš, VENTURINI, Peter. Method for encapsulation of fullerenes

and their derivatives: SI 9600073 A. 1997.3. KOFLER, Bojan, REBIČ, Ljubomira Barbara, ŠIRCA, Judita, VENTURINI, Peter. Pharmaceutical

formulation with controlled release of active substances : United States Patent US 6,576,258 B1, date of Patent June 10, 2003 : also published as WO9903453 (A1), EP1003487 (A1), SI9700186 (A), AU756884 (B2).

A selection of publications 1. VENTURINI, Peter, MIHAILOVIĆ, Dragan, BLINC, Robert, CEVC, Pavel, DOLINŠEK, Janez,

ABRAMIČ, Darija, ZALAR, Boštjan, OSHIO, H., ALLEMAND, P. M., HIRSCH, A., WUDL, F. Magnetic resonance investigation of the magnetic transition in TDAE-C60. Int. j. mod. phys. b, 1992, vol. 6, pp. 3947-3951.

2. BLINC, Robert, CEVC, Pavel, ARČON, Denis, MIHAILOVIĆ, Dragan, VENTURINI, Peter. Time decay of the remanent magnetization in TDAE-C60. Phys. rev., B, Condens. matter, 1994, vol. 50, pp. 13051-13053.

3. SARICIFTCI, N. S., HEEGER, Alan J., KRAŠEVEC, Viktor, VENTURINI, Peter, MIHAILOVIĆ, Dragan, CAO, Y., LIBERT, J., BREDAS, J. L. Symmetry-specifi c electron-phonon coupling for electronic states near the Fermi energy of metallic polyaniline : resonant Raman scattering. Synth. met., 1994, vol. 62, pp. 107-112.

4. MIHAILOVIĆ, Dragan, ARČON, Denis, VENTURINI, Peter, BLINC, Robert, OMERZU, Aleš, CEVC, Pavel. Orientational and magnetic ordering buckyballs in TDAE-C60. Science, 1995, 268, pp. 400-402.

5. ARČON, Denis, DOLINŠEK, Janez, BLINC, Robert, POKHODNIA, Konstantin, OMERZU, Aleš, MIHAILOVIĆ, Dragan, VENTURINI, Peter. Proton NMR in a TDAE-C60 single crsytal. Phys. rev., B, Condens. matter, 1996, 53, pp. 14028-14031.

6. DOMINKO, Robert, ARČON, Denis, MRZEL, Aleš, ZORKO, Andrej, CEVC, Pavel, VENTURINI, Peter, GABERŠČEK, Miran, REMŠKAR, Maja, MIHAILOVIĆ, Dragan. Dichalcogenide nanotube electrodes for Li-ion batteries. Adv. mater. (Weinh.), 2002, vol. 14, pp. 1531-1534.

7. HASSANIEN, Abdou, HOLZINGER, Michael, HIRSCH, Andreas, TOKUMOTO, Madoka, VENTURINI, Peter. Ropes of carbon nanotube intramolecular junction. Synth. met.. [Print ed.], 2003, vol. 137, no. 1/3, pp. 1203-1204.

8. VRBANIČ, Daniel, REMŠKAR, Maja, JESIH, Adolf, MRZEL, Aleš, UMEK, Polona, PONIKVAR, Maja, JANČAR, Boštjan, MEDEN, Anton, NOVOSEL, Barbara, PEJOVNIK, Stane, VENTURINI, Peter, COLEMAN, J. C., MIHAILOVIĆ, Dragan. Air-stable monodispersed Mo6S3I6 nanowires. Nanotechnology (Bristol), 2004, vol. 15, pp. 635-638.

9. HASSANIEN, Abdou, TOKUMOTO, M., UMEK, Polona, VRBANIĆ, Daniel, MOZETIČ, Miran, MIHAILOVIĆ, Dragan, VENTURINI, Peter, PEJOVNIK, Stane. Selective etching of metallic single-wall carbon nanotubes with hyrogen plasma. Nanotechnology (Bristol), 2005, vol. 16, pp. 278-281.

10. BELE, Marjan, HRIBAR, Gorazd, ČAMPELJ, Stanislav, MAKOVEC, Darko, GABERC-POREKAR, Vladka, ZORKO, Milena, GABERŠČEK, Miran, JAMNIK, Janko, VENTURINI, Peter. Zinc-decorated silica-coated magnetic nanoparticles for protein binding and controlled release. Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 2008, vol. 867, no. 1, str. 160-164.


269


Dominique Vuillaume is CNRS research director at the Institute for Electronics, Microelectronics and Nanotechnology (IEMN) located at the university of Lille. He is head of the « Molecular Nanostructures & Devices » research group at IEMN. He was scientifi c advisor for industrial compagnies (Bull R&D center) and he is presently scientifi c advisor for the CEA “Chimtronique” research program. His research interests (1984-1992) covered Physics and characterization of point defects in semiconductors and MIS devices, Physics and reliability of thin insulating fi lms, hot-carrier eff ects in MOSFET’s. Since 1992, he is now engaged in the study of the physical and electrical properties of organized organic monolayers (self-assembled monolayers), and more generally in the fi eld of Molecular Electronics. He is involved in the study of the electrical transport through organic monolayers and of the relationship with their structural properties; in the studies of monolayers of functionalized molecules; in the electrical transport through organic unimolecular devices; in the applications of organic monolayers and organic molecules to nanometer-scale devices and molecular-scale electronics. He is the author or coauthor of 138 scientifi c (peer-reviewed) papers in these fi elds.

Stefan WeigelDr. Stefan Weigel currently works at RIKILT - Institute for Food Safety , within Wageningen University and Research Centre in The Netherlands, as Senior Project Manager and Deputy Programme Manager for veterinary drugs and contaminants. His main research interests are in the area of trace determination of organic residues and contaminants by means of mass spectrometry and biosensor technology. This spectrum was recently extended to the analysis of nanoparticles in food.Stefan Weigel graduated in Chemistry (MSc) at the University of Hamburg/Germany where he also obtained a PhD in Analytical Chemistry, working on the ultra-trace analysis of organic contaminants in marine environments, mainly North Sea, with focus on occurrence, distribution and transformation of residues of pharmaceuticals.At Eurofi ns | Wiertz-Eggert-Jörissen (Hamburg/Germany), part of the international Eurofi ns Scientifi c group, he was responsible for the coordination and management of research and development activities and was head of the Eurofi ns Technology Transfer and Training Centre.


270


Klaus-Michael Weltring

Personal dataBorn: 15.9.1954Place of Birth: Bad Rothenfelde, GermanyCitizenship: GermanFamily status: married, three children

Current positionsSince 1.4.2001 Managing Director of “Gesellschaft für Bioanalytik Münster e. V.“

Other positions1.8.2000 - Coordinator of the Münster proposal for the region contest 31.1.2001 “BioProfi le” of the Minister for Education and Science of Germany.2004 - 2008 Deputy Coordinator of the EU Network of Excellence Nano2Life and Leader of

the ELSA Board2006 - 2008 Chair of ELSA working group of the ETP NanomedicineSince 2006 Member of the Executive Board of the ETP Nanomedicine

Scientifi c positions1.6.1983 - Postdoc at the Lehrstuhl für Biochemie der Pfl anzen at the 31.7.1984 University of Münster. 1.8.1984 - Postdoc with Prof. Dr. H. D. VanEtten and Prof. O. Yoder at the31.12.1986 Department of Plant Pathology at Cornell University, U.S.A.1.1.1987 - Postdoc at the Lehrstuhl für Biochemie der Pfl anzen at the31.12.1988 University of Münster. 1.1.1989 - Assistant position at the Lehrstuhl für Allg. Botanik/ Mikrobiologie31.12.1994 of Prof. P. Tudzynski at the Botanical Institute at the University of Münster.1.4.1995 - Research associate position with Prof. Tudzynski continuing to 30.9.1995 work on the above projects.1.1.1996 - Scholarship of the Deutsche Forschungsgemeinschaft to fi nish 31.12.1997 the Habilitation1.1.1998 - Research associate position with Prof. Tudzynski continuing to 31.3.2000 work on own projects.4.2.1998 Habilitation with venia legendi for botany.1.4.2000 - Substitution of a C3 professorship position at the Botanical 31.3.2001 Institute at the University of Münster.

Gesellschaft für Bioanalytik Münster e.V.The association Gesellschaft für Bioanalytik Münster e.V. was founded by the two Münster universities, local companies, the city of Münster, the Technology Park Muenster and scientists in November 2000. It serves as a central communication and information agency for researchers, companies, investors, institutions and the public interested in nanobiotech. Bioanalytik-Muen-ster simplifi es consultations among all partners, promotes dialogue with the public, motivates interdisciplinary projects and ensures coordinated actions for developing and marketing of the Münster region as a leading nanobiotech location.

Dr. Klaus-Michael Weltring is the Managing Director of Bioanalytik-muenster and for fi ve years he was the deputy-coordinator of the Nano2Life Network of Excellence and Leader of the “ELSA” work package in this network. Furthermore he co-manages the Round Table on Nanomedicine (FP7 CSA Project), which started at 1st January 2009. In addition he is a member of the Executive Board of the ETP Nanomedicine leading the ELSA workgroup of this platform. For the last six years he has been responsible for the function and marketing of the regional bioanalytics network including universities, regional development agencies, the Chamber of Commerce, companies and scientists.


271


Miklós Zrínyi corresponding member of Hungarian Academy of Science,Semmelweis University, Faculty of Pharmacy, Department of Pharmaceutics

Personal Details:Name: Miklos ZrinyiMailing Address: H-1092 Budapest, Hungary, Hőgyes E. 7Contact phone number(work): +36 20-4144124E-mail: [email protected]

Academic qualifi cation:Year: 1975 diplom (Chemistry), L. Eötvös University, HungaryYear: 1977 Ph.D (Colloid Chemistry), L. Eötvös University, HungaryYear: 1987 C.Sci, (Colloid Chemistry, Physical Chemistry), L.Eötvös University, HungaryYear: 1993 D Sci (Polymer Science), Technical University of Budapest, HungaryYear: 2007 Corresponding Member of Hungarian Academy of Sciences,

Present Appointment:Full Professor, Head of Laboratory of Soft Matter, Department of Pharmaceutics, Semmelweis University

Previous Appointment:2004-2008 Vice-Rector, Budapest University of Technology and Economics,1994-2007 Head of the Department of Physical Chemistry, Budapest University of Technology

and Ecoomics,1993-2008 Professor of Physical Chemistry, Department of Physical Chemistry and Material

Sciences, Budapest University of Technology and Ecoomics,1988-1992 Associate Professor, Department of Colloid Science, L. Eötvös University Budapest, 1981-1987 First Assistant, Department of Colloid Science, L. Eötvös University Budapest, 1977-1980 Fellow, Department of Colloid Science, L. Eötvös University Budapest, 1974-1976 Post Graduate Student, Department of Colloid Science, L. Eötvös University

Budapest,

Academic Awards an Distinctions:János Proszt Award (2005), István Náray-Szabó Award (2004), Ányos Jedlik Award (2003), István Kruspér Award (2002), Canon Award (2000), Visiting professorship: Ventura Business Laboratory, Yamagata University, Japan (2000, 2001), Albert Szent-Györgyi Award (1999), László Erdey Award ( 1997), Visiting professorship: Hokkaido University, Graduate School of Biological Sciences, Sapporo (1996), Fellowship given by the Commission of the European Com-munities (1992), Alexander von Humbold Fellowship (1991), Honor of Hungarian Cultural and Educational Ministry (1987), Aladár Buzágh Prize given by the Hungarian Academy of Sciences (1981), Winner of the National Chemical Competition for High Scool Students (1967)

Research Interests and expertisephysical chemistry of smart materials, stimuli responsive polymer gels, magnetic fi eld responsive gels and elastomers, magnetic nanoparticles,

Publications and Patents4 books (in Hungarian), 8 chapters in various books (in English, Japanese and Chinese) more than 230 papers and articles in scientifi c journals, 6 patents


272

Authors’ Index

Abachi P. P-157, P-177

Abbott S. P-141

Abdul H. P-135

Abel B. P-156

Abramova N. LP-17

Adams M. O-35, P-063

Afanasiev A. O-86

Aglietto I. O-30

Agron L. O-19, P-125

Ahopelto J. O-43

Airinei A. P-111

Aitken R.J. KL-10

Akcin G. LP-20

Akcin N. LP-20

Albu P. S. P-010

Albuquerque E.L. P-115, P-119

Alexandru E.C. O-07

Alexandru M. P-111

Alfano B. P-037

Al-Jamald K.T. P-049

Allers L. P-150

Allsopp D. P-141

Aloupogiannis P. O-31

Althues H. O-71

Amadou J. O-68

Amsharov N. P-049

Ananieva I. P-125

Angeletti V. P-105

Anson S. P-001

Antipin R. O-19

Antonio T. P-023

Anzlovar A. O-64

Apostolova M. LP-26

Arrigo P. O-63

Arruebo M. P-165

Asawapirom U. P-021, P-129

Aslan M.H. P-079

Aublant J.M. O-78

Auvray L. LP-33, LP-45

BBabchenko O. P-059

Bacakova L. P-059

Bacri L. LP-45

Bacsa J. P-088

Badea M. P-033

Bahsi Z.B. P-079

Balas F. P-165

Bald D. P-058

Baldi L. PL-16

Ballerini L. O-34

Ballesteros B. P-040

Baptista P. P-073

Barbe K. P-118

Bardi G. P-049

Barenholz Y. LP-13, P-072

Barinka R. P-017

Barriuso S. P-155, P-158

Barry L. P-174

Barshtein G. P-066

Barton D.E. O-77

Bartosik M. P-139

Bastl Z. P-109

Baumann P.K. O-69, P-141

Bavli D. LP-13, P-072

Baxter D. LP-06

Bedzinski R. P-075

Bein T. P-107

Belforte L. O-27

Belloni F. LP-22

Beloglazkina E. O-19, P-125, P-143

Belotelov V. O-56

Benguria P. P-050

Benítez S. P-155

Benninghoven A. O-89

Bennink M.L. O-88

Bergonzo P. O-36

Berlin A. LP-03

Bert S. O-68

Bertóti I. LP-23

Bertrand P. O-89

Besenbacher F. PL-08

Beyer E. P-017

Beyersdorff T.F. O-01

Bhasin J. O-48

Biance A.L. LP-45

Bianchin A. P-002, P-024, P-121

Bier F. LP-35, LP-39

Bilbao L. LP-28

Bilkova Z. O-12, P-035, P-061

Biscarini F. O-76

Bittnar Z. O-05

Blind K. O-79

Blom R. P-094

Bocek J. P-013

Boerner V. P-141

Bogush V. P-087

Boisseau P. PL-13

Boland J. P-174

Bollinger P.Y. P-065

Bonazzi M. P-152, P-169

Bonetti S. P-105

Boonpavanitchakul K. P-096

Bordi F. LP-18

Bordiga S. P-094

Borsella E. P-056

Böttcher H. O-46

Bourhis E. LP-33, LP-45, O-44

Bowman R. P-174

Bradshaw D. P-088

Brandenburg R. O-83

Bratov A. LP-17

Braun S. O-29

Breitenstein M. LP-35, LP-39

Brennan D. O-77

Bretsnajdrova E. P-114

Brezina V. P-070

Brignone M. O-27

Briza T. P-044

Broz A. P-059

Bruchhaus L. LP-33, O-44

Brüser V. P-092

Buck M. O-18

Buckiova D. P-080

Budzioch J. O-17

Burghard M. P-049

Burlet H. O-70

Bursik J. P-117

Busse M. O-13

Buyukaksoy A. P-079

Bystrenova E. O-76

Byrne H. P-174

Byrne J.A. KL-08

CCagin T. P-138

Calderón M. P-158

Callow J. O-25

Campillo I. P-178

Campos J. P-158

Caneva Soumetz F. O-63

Capkova P. P-172

Capraro B. O-68

Caroline M. P-023

Carosio S. LP-01, PL-06

Carotenuto G. O-56

Cassina V. LP-10

Castellano G. P-171

Cazacu M. P-111

Cebula I. O-18

Cebulski J. P-101

Cechal J. P-139, P-140

Cejkova J. P-159

Cernik M. LP-15, O-11

Cerník M. P-041

Cerny J. P-053

Chandrasekhar N. KL-12

Chavan S. P-094

Chelli B. O-76

Chen D. O-73

Chen G. O-32

Chen X. O-09

Cheng C. P-068

Cherniy A. P-058

Chiewpattanakul P. P-046

Chimamkpam E. LP-48

Choi H.J. P-123

Chong S. P-088

Christiansen S. O-42

Christmann A. LP-35, LP-39

Chronoupoulou L. LP-18

Chudoba T. P-124, P-133, P-142

Chumak T. P-080

Chvojka J. O-48

Cincotti G. P-141

Clarke L. O-77

Cloke M. LP-08

Clupek M. P-159, P-163

Coelho M. P-042

Colella A. P-002, P-024, P-121

Conde J. P-073

Corrés A. LP-28

Costa M. P-049

Costacurta S. LP-42

Cott D. O-68

Authors’ Index


273

Authors’ Index

Cox I. P-058

Critto A. O-10

Crnjak Orel Z. O-64

Cuschieri A. P-049

Cyganik P. O-17

Czaplicka K. LP-47

DDaescu V. P-033, P-151

Dalton P. O-62

D‘Amato R. P-056

Dani I. O-71, P-017

Das G.K. P-051

Dastjerd H. LP-04

Dawson K. P-174

De Andres E. P-155, P-158

De la Barrera J. P-155, P-158

de la Maza B. LP-46

de Miguel Y. P-050

De Schrijver I. O-47

Del Rio C. P-039

Delgado G.C. O-82

Della Sala D. P-037

Di Francia G. P-037

Dietzel P.D.C. P-094

Dijon J. O-68

Dimov S. O-59

Dobson M.G. O-77

Doerfl er S. O-71

Dogan O. P-043, P-077

Dohnalova K. LP-31

Domashevskaya E. P-173

Dominguez C. LP-17

Dong J. P-166

Doria G. P-073

Drasar P. LP-12

Drdacky M. O-04

Druri M. P-018

Dryden D. P-058

Durand A. P-046

Dusza J. P-109, P-134, P-161

Dutta N. P-076

Dzwolak W. P-124

EEaton M. PL-12

Efi mov M. P-015

Eguchi K. LP-05

Elizetxea C. O-23

Emnéus J. P-065

Engel A. LP-48

Enrichi F. LP-16, LP-42

Erbil H.Y. P-007

Ermilova M. P-003, P-009, P-015

Esken D. LP-37

Esser N. O-37

Eufi nger K. O-47

FFahlman M. O-29

Falaras P. O-31, P-010

Falcaro P. LP-42

Falconieri M. P-056

Falteisek L. P-053

Fardmanesh M. P-149

Faria L. J. P-054

Fasihi J. P-030

Fattahi B. P-108

Faungnawakij K. LP-05

Fazilati M. LP-04

Fejfar A. P-022

Fernandez Santos F. P-004

Feuchter M. LP-38

Fidelus J. P-133

Fierro J.L.G. P-016

Figovsky O. P-130

Fichtner M. KL-03

Filipiak J. P-075

Fillon B. O-26, O-61, P-014

Fisher M. O-85

Fischer R. P-146

Fischer R.A. LP-37

Fjellvåg H. P-094

Flisowska-Wiercik B. P-081

Fojtik A. LP-40, P-057, P-067

Fomin V. P-122

Forberich K. P-141

Förch R. P-064

Forsberg S. O-67

Frackowiak E. KL-22

Francis S.M. P-084

Freire V.N. P-115

Freitas P.J. O-77

Fries T. P-012

Fritzmann C. LP-24

Fucikova A. P-070

Fujishima A. KL-04

Fulco U.L. P-115

GGalar P. LP-44

Galvin P. O-77

Garcia-Bordeje E. P-026

Garg A. O-48

Garrido J.A. O-36

Gaston A. LP-28

Gauch S. O-79

Gazzola D. P-105

Gehrke I. O-33

Genne I. O-10

Ghaharpour F. LP-32

Ghanbarizadeh P. P-028

Ghera L. P-049

Ghicov A. P-010

Ghods-Elahi T. P-149

Gielgens L. O-84

Gierak J. LP-33, LP-45, O-44

Giersig M. LP-40

Giugliano M. O-34

Gladkov P. P-132

Gobbi M. LP-10

Godlewski M. P-133, P-148

Godlewski S. O-17

Godnjavec J. KL-15

Gogoi A. G. P-076

Golovnev I. P-122

Golovneva E. P-122

Gonin M. O-42

Gorokh G. P-032

Grabowski J. LP-06, LP-07

Gradimir M. O-89

Graetzel M. PL-24

Granberg H. O-67

Grausova L. P-059

Gravalos J. O-03

Green M.L.H. P-040

Greco P. O-76

Gregori M. LP-10

Grieten L. O-37

Grillo F. P-084

Grillo M. P-165

Grimm H. O-40

Groeseneken G. O-68

Grof Z. LP-34

Groppo E. P-094

Groth E. O-13

Grunwald I. O-13

Grunwaldova V. P-055

Grym J. P-132

Grzanka E. P-124, P-133, P-148

Gspan C. P-074

Guglielmi M. LP-42

Guiducci C. P-105

Gutierrez A. O-03

Guzanová A. LP-21

HHaas K.H. KL-16

Haenen K. O-37

Hagler R. O-40

Hahn R. P-010

Hajova H. LP-34

Hakim A.K.M.A. O-52

Hansel S. P-101

Hansen C. P-065

Hansen J. P-065

Harrison V. LP-06

Hatefi A. P-038

Hatto P. KL-24

Hauert R. LP-48

Haufe H. O-46

Hauch J.A. KL-07

Heck R. P-088

Heckl W. P-154

Hegedus L. P-109

Heidari B. O-57

Heinzelmann H. KL-05

Hemmatikia M. P-069, P-157, P-167, P-177

Herlin N. P-056

Hermeren G. KL-25

Hernychova L. P-035

Herynek V. P-055

Heuken M. O-69, P-141

Hingerl K. P-141

Hinrichs K. O-37

Hix P. P-154

Hoelzel R. LP-35, LP-39

Hofstraat J.W. KL-23

Holban E. P-151

Holmqvist J. O-67

Holzer C. LP-38

Homola J. O-74

Hong S.H. P-123, P-131

Hopfe V. P-017

Hoque S.M. P-135

Hospodkova A. P-019

Hossain K. O-78

Hosseini M. P-149

Hrabal J. P-041

Hristea G. O-07


274

Authors’ Index

Huang F. O-73

Hulicius E. P-019

Husain S.W. P-030

Huyet G. P-174

Hwang S. P-123, P-131

Hwu J.G. P-116

IIamraksa P. P-021

Ibragimova S. P-065

Ihde J. O-21

Iliyashenko V. LP-36

Ioanid A. P-111

Irajizad A. P-108

Ivanov A. O-90

Ivanov E. P-019

JJackman R.B. O-36

Jagutzki O. P-058

Jankovicova B. P-035, P-061

Janssens S. O-37

Jarchovsky Z. P-132

Jary D. O-77

Jede R. LP-33, LP-45, O-44

Jelinek P. KL-11

Jendelova P. P-053, P-055

Jie D. KL-12

Jirkovsky J. O-80

Joachim C. KL-12

Johnsen R.E. P-094

Johnson R. O-81

Johnstone J. O-85

Joyeux X. O-68

Jumadilov T. P-048

Jungwirth T. KL-21

Jurek K. P-164

Juzenas P. P-042

KKacenka M. P-053

Kacerovsky P. P-067

Kahwa I.A. P-027

Kalousek V. P-036

Kaman O. O-15, P-053, P-055, P-062

Kampschulte L. P-154

Kangwansupamonkon W. P-096

Karadjov J. LP-26

Karachalios T. P-049

Karbalaei kashani a. P-157, P-177

Karjoo Z. P-038

Karpacheva G. P-015

Kart H.H. P-138

Kasemwong K. P-086, P-091

Kashkarov V. P-173

Kashani K. A. P-069, P-069, P-167, P-167

Kaskel S. O-71, P-017

Kaspar P. P-055, P-062

Kastrinaki G. P-071

Katalagarianakis G. O-92

Kautt M. P-001

Kazemi A. P-108

Kazim S. LP-29

Kean A. P-150

Keawprajak A. P-021

Keck L. O-40

Keefer E.W. KL-09

Kejik Z. P-044

Kemnitz K. P-058

Kemp M. O-85

Kenny J.M. PL-15

Kernbach U. P-154

Keuter V. O-33

Kh. Vafadar A. P-069, P-167

Khakhanov Y. O-86

Khatko V. P-032

Khayatzadeh Mahani M. P-030

Khinsky A. P-026

Kholmuminov A. P-106, P-110

Kikuchi R. LP-05

Kim D. P-010

Kim K.H. P-011

Kiparissides C. KL-19

Kiss E. LP-23

Kitan S. LP-36

Klementova M. P-055

Klemkaite K. P-026

Klima J. O-42

Klimkova S. LP-15, O-11

Knizek K. P-062

Ko F.H. P-068

Koci P. P-052

Köck A. P-074

Kocka J. P-022

Koeble J. KL-12

Köhn R. P-107

Kochanowska I.E. P-075

Kokabi A. P-149

Kokaislova A. P-159, P-163

Kolacinski Z. P-018

Kolacyak D. O-21

Kolbacova M. P-059

Kolibal M. P-139, P-140

Konecny I. O-22

Konstandopoulos A. P-071

Koprivanac N. P-082

Korecka L. P-035

Korenkova H. P-163

Korenstein R. P-156

Kormunda M. P-006

Kornemann H. O-20

Kornievskaya V. P-005

Korolev D. O-56

Kortschack A. O-42

Kosek J. LP-34

Kostadinov K. LP-27

Kostarelos K. P-049

Kostka F. P-067

Kotek J. P-053

Kothleitner G. P-074

Kovacik L. P-113

Kovacik P. P-057

Kozlowska K. P-081

Kracalik M. LP-38

Kral V. LP-12, P-044, P-090, P-093,

P-103, P-128, P-136, P-163

Kralova J. LP-12, P-044

Kratosova G. LP-30

Kromka A. P-059

Krop H. P-156

Kroto H. Opening Session

Krüger P. PL-01

Krupkova R. P-164

Kruppa A. P-005

Krzak-Ros J. P-075

Kubicek M. P-052

Kudla S. P-097

Kunze J. P-010

Kupcik J. P-053

Kurg A. O-77

Kusic H. P-082

Kusova K. LP-31, P-070

Kutnyánszky E. LP-23

Kutter J. P-061

Kvapil P. O-11

LLa Ferrara V. P-037

Labunov V. P-087

Lacinova L. O-11

Lacinová L. P-041

Lafosse X. O-44

Lalayan A. P-034

Lambertini V. PL-07

Landsiedel R. O-39

Langecker G.R. LP-38

Lanzara G. LP-22

Laperre J. O-47

Laske S. LP-38

Laus M. P-102

Lazar A. O-76

Lebedeva V. P-147

Ledinsky M. P-022

Lee J. P-011

Lehnen P. O-69

Lechuga L.M. O-75

Lemor A.M. P-156

Lenhert S. O-60

Lenshin A. P-173

Leonat L. O-07

Leonelli C. P-142

Leshina T. P-005

Leszczynska D. O-50, P-082

Leszczynski J. O-50

Li L. P-045

Liarokapis E. P-095

Likodimos V. O-31

Lim S.K. P-123, P-131

Linaschke D. P-017

Lindell L. O-29

Lindner J. O-69

Lirsac P.N. PL-22

Liu X. O-29

Loeschner H. O-58

Logothetidis S. O-65

Löchel B. O-51

Lojanová S. P-134

Lojkowski W. P-124, P-133, P-142, P-148

Lommatzsch U. O-21

López de Ipiña J. P-158, P-165

Lopez E. P-017

Lorentzou S. P-071

Lubica G. P-059

Lucot D. LP-33, O-44

Ludu Nathan T. LP-08

Ludwik Pardala M. LP-07

Luchinin V. O-90

Lukas D. O-48

Lukes I. P-053


275

Authors’ Index

MM.T. Silva A. P-054

Macek M. O-77

Madouri A. LP-45, O-44

Maggi N. O-63

Maglio G. P-176

Magner E. P-174

Mahdavi S.M. P-108

Mahltig B. O-46

Mahmud M.S. P-135

Mach J. P-139

Machado F. B. P-054

Machan J. PL-26

Maier G. LP-38

Maier M. KL-12

Maier T. P-074

Maimon O. P-156

Maistros G. O-24

Maiwald M. O-13

Majcher A. P-142

Majouga A. O-19, P-125, P-143

Makolli S. P-047

Malkov A. P-003

Maly P. LP-31, LP-44

Malygin A. P-003

Mangione A. LP-22

Maojo V. P-155

Marcelli A. P-101

Marco Colas M.P. P-004

Marco M.P. LP-17

Marcomini A. O-10

Marek M. P-052

Marchewka M. P-101, P-137

Marie E. P-046

Marinello F. LP-42

Marini A. P-024

Markaide N. O-23

Markey K. P-160, PL-10

Marounek M. P-029

Martasek P. P-044

Martin Sanchez F. P-155

Martínez-Huerta M.V. P-016

Martin-Sanchez F. P-158

Martyla A. P-020

Marysko M. P-055, P-062

Masotti A. LP-18

Massera E. P-037

Masserini M. LP-10, LP-11

Matejka P. P-159, P-163

Matousek J. P-113

Matteazzi P. O-91, P-002, P-024,

P-121, PL-20

Mauriz P.W. P-119

Mayer J. O-89

Mayor M. KL-06

Mazurkiewicz A. P-142

McLaughlin J. P-174

Meilikhov M. LP-37

Melichar K. P-019

Melin T. LP-24

Mellot-Draznieks C. P-100

Meneghello A. LP-16

Mertsch O. O-51

Meyer A. O-71

Mielczarski E. P-166

Mielczarski J. P-166

Mieres J.M. O-03

Migeon H.N. O-89

Mihailescu N. P-033

Michal Z. P-120

Michiels L. O-37

Michler J. O-42

Mikes P. O-48

Mikhailova M. P-019

Mikhailovski S. P-003

Milanese C. P-024

Miller M. P-075

Milnera M. P-074

Milusheva R. P-106, P-110

Miney P. P-174

Miserocchi G. P-056

Mittermayr C. P-039

Moftakharzadeh A. P-149

Mohamadi M.R. P-061

Mohamadi R. P-035

Moiseev K. P-019

Molodechkin M. P-087

Monzon A. P-026

Monzon O. P-050

Moreira dos Santos M. P-073

Morgiel J. P-109

Morisson M. PL-19

Morrison M. O-90

Mozalev A. P-032

Mugnaini V. P-084

Mugnani V. P-145

Muller M. P-067

Mun G. P-106, P-110, P-112, P-162

Music B. KL-15

NNavabpour P. O-53

Navratil Z. O-80

Nebyla M. P-078

Ng S.C. P-045

Nguyen P.T.H. P-011

Niehuis E. PL-14

Nielsen C. P-065

Niring U. O-67

Nitodas S. P-049

Nohavica D. P-132

Nomen R. P-165

Nordan M.M. PL-02

Nordblad P. O-52, P-135

Nosek J. LP-15

Novak V. P-052

Novotny F. LP-40

Nowak D. LP-07, LP-09

Nunes A. P-049

Nüsse N. O-51

Nuzhnyy D. P-164

OO’Brien D. P-174

O’Connor G. P-174

Obieta I. LP-28

Ocal C. P-089, P-145

Oertel M. KL-12

Off enhaeusser A. O-36

Oheim M. P-058

Olejnik B. P-020

Olivato I. O-41

Oliveros M. P-084, P-145

Onah E. P-025

Onofri M. P-060

Opalinska A. P-124, P-133, P-142, P-148

Oral A.Y. P-079

Orekhova N. P-003, P-009, P-015

Ortenberg M. P-101

Ouerghi A. LP-33

PPadalko V. P-099

Pagkoura C. P-071

Pagnotta V. P-085

Palocci C. LP-18

Pancenko S. P-106

Pangrac J. P-019

Paradinas M. P-089, P-145

Pasko S. O-69

Paspaliaris I. LP-01

Passeri R. O-14, P-102

Pastorino L. O-63

Patelli A. LP-42

Patriarche G. LP-45, O-44

Patzke G. LP-48

Pavlik J. P-006, P-113

Peña M.A. P-016

Pelant I. LP-31, P-070

Pelta J. LP-45

Pereira M.d.C. P-042

Pérez-Alonso F.J. P-016

Perry M. P-065

Pesch M. O-40

Peterka F. O-80

Petkov V. P-009

Petrik S. P-008

Petrova I. P-147

Petrova S. P-005

Petzelt J. P-164

Pezowicz C. P-075

Pfl eger J. LP-29

Picaud S. O-36

Piccinini M. P-101

Pielaszek R. P-124

Piksova K. P-057

Pina M.P. O-08

Pinson J. O-68

Pinter G. LP-38

Pippan R. P-120

Piyachomkwan K. P-086

Piyakulawat P. P-021, P-129

Pizzorusso T. P-049

Platzgummer E. O-58

Ploch D. P-137

Pluhar T. LP-15

Plusnin N. LP-36

Podhajecka K. LP-29

Poe D. O-62

Pojana G. O-10

Pokorny R. LP-34

Polcak J. P-140

Pollert E. O-15, P-053, P-055, P-062

Polpanich D. P-129

Polyakov A. P-162

Polyakov N. P-005

Pop S.D. O-37

Popelar J. P-080


276

Authors’ Index

Porro A. P-050

Poruba A. P-017

Pouckova P. P-044

Pourazarang K. P-069, P-167

Prato M. O-34

Prauzner-Bechcicki J. O-17

Preclikova J. LP-44

Pribyl M. P-078

Priev A. LP-13, P-072

Prokopec V. P-159, P-163

Proskura K. P-106, P-110, P-112

Prudnikava A. P-087

Przekop R. P-020

Pszon K. P-065

Puchy V. P-109

Putaud J.P. PL-09

Pyykkö I. O-62

Quade A. P-092

RR.N. Marques R. P-054

Rabone J. P-088

Racles C. P-111

Raff a V. P-049

Raisanen M. O-18

Rajaei H. LP-32

Ramezani M. P-038

Ramon-Azcon J. LP-17

Raniszewski G. P-018

Rapposelli P. O-68

Rashidova S. P-106, P-110

Rasulev B. O-50

Rathousky J. P-036

Razborsek T. KL-15

Re F. LP-10

Reader A. O-85

Rebrov A. P-098

Regula C. O-21

Rehor I. P-053

Reinhardt A.E. PL-04

Reiss E. LP-35

Reszke E. P-142

Reva Y. P-112

Reymond F. P-061

Rezanka P. LP-12, P-090, P-093,

P-103, P-128, P-163

Rezek B. P-022, P-059

Ricco‘ R. LP-16

Riess W. PL-25

Riggio C. P-049

Richardson N.V. P-084

Rios G.M. KL-01

Rivolta I. P-056

Rob G. B. P-023

Robson K. O-85

Roeder L. P-089

Rogut A. LP-47

Rogut J. LP-06, LP-07, LP-09, LP-47

Rocha S. P-042

Rolli R. P-002, P-121

Romashkina R. O-19, P-143

Roques N. P-145

Rosseinsky M. P-088

Rossi F. P-156

Rothschild Y. P-170

Roy H. P-076

Rudakovskaia P. O-19, P-125

Rudquist P. KL-27

Ruggiero C. O-63

Rutkowska I. P-081

Ruys L. O-47

Rybaczuk M. P-081

SSavari Rathinam S.P. LP-08

Sabino A. P-026

Sadigzadeh A. LP-14

Saeedi S. P-149

Saekung C. P-021

Sáez-Martínez V. LP-28

Safonov A. P-098

Saha I. O-52

Sachar K. O-48

Sachweh B. O-39

Salahi E. P-069, P-157, P-167, P-177

Salamanca L. P-155, P-158

Salmona M. LP-10

Samitier J. O-87

Samori‘ B. O-14, P-060

Samrat Sarkar S. LP-25

Sancini G. P-056

Sanchez Baeza F. P-004, LP-17

Santa-Coloma O. P-050

Santamaría J. P-165

Santhosh P. P-049

Sarkady J. P-090

Sarkar S. LP-19, P-175

Savolainen K. O-38

Scifo L. P-050

Scrivener K. KL-02

Seda L. LP-34

Sehati P. O-29

Semeniyakin N. P-112

Sempere J. P-165

Senzaki Y. O-69

Sepehrian H. P-030

Sergeeva E. P-083, P-104

Serra E. P-165

Shao L. P-040

Sharf A. LP-29

Sheikh Manjura H. O-52

Shekhah O. P-145, P-146

Shen C. O-18

Sheregii E. P-137

Sheregii E.M. P-101

Shivachev B. LP-26

Shpigun O. P-125

Shulev A. LP-27

Shulga E. LP-43

Shulitski B. P-087

Shvartsman L.D. P-066

Scherb C. P-107

Schiedt B. LP-33, LP-45, O-44

Schilling A. LP-48

Schleunitz A. O-51

Schlottgayer A. P-005

Schmuki P. O-28, P-010

Schoepfer R. O-36

Schollmeyer E. KL-13

Schrepp W. P-031

Schröfel A. LP-30

Schrott W. P-078

Schubert T.J.S. O-01

Schuepbach B. P-089, P-127

Schumacher J. O-13

Schütz W. KL-28

Sibera D. P-142

Siebentritt S. O-89

Siegel N. O-78

Sikder S.S. P-135

Sikola T. P-139, P-140, P-144

Silien C. O-18

Sill A. O-42

Sillanpaa M. O-32

Simak O. LP-12

Simecek T. P-019

Singh P. R. P-076

Sinha R.C. O-52

Siranidi E. P-095

Sisáková E. LP-21

Sivan V. PL-22

Skeren T. P-057

Skoda D. P-139, P-140

Skrivanova E. P-029

Slovakova M. P-035

Smilauer V. O-05

Sokolov A. O-86

Solar M. O-78

Solovei D. P-032

Soltani A.M. P-175

Soltani R. LP-14

Sopousek J. P-117

Sotomayor Torres C.M. KL-17

Sparnacci K. P-102

Spielvogel J. O-40

Spousta J. P-144

Spychalowicz A. LP-07, LP-09

Spychalowicz W. LP-09

Stahel P. O-80

Stavrev S. LP-26

Stavrov V. LP-26

Steen M. LP-06

Stegemann B. LP-33

Steinicker A. LP-02

Stepanek F. P-052

Stephan S. P-120

Stergiopoulos T. P-010

Stiemke F.M. O-01

Stoliar P. O-76

Strachowski T. P-133

Stravalaci M. LP-10

Strzhemechny Y.M. O-64

Studnicka V. P-164

Stuchlík J. P-022

Su X. O-53

Sujeet Kumar Singh S. LP-25

Sukhanov M. P-009

Suleimenov I. P-048, P-106, P-110,

P-112, P-162

Svec M. P-113

Svec P. P-109

Svoboda K. LP-06

Svoboda L. P-114

Syka J. P-080

Sykora D. P-103

Syková E. PL-11

Syla A. P-047


277

Authors’ Index

Szafran Z. LP-06, LP-07

Szczurek A. P-081

Szymanski L. P-018

Szymonski M. O-17

Šajgalík P. P-134

TTakeda Y. P-086

Talebbeydokhti N. P-028

Tan T.T.Y. P-045, P-051

Taraban M. P-005

Tatarko P. P-134

Taube K. O-06

Taverna M. P-061

Teer D. O-53

Tekiel A. O-17

Tereshchenko G. P-003, P-009, P-147

Terfort A. P-089, P-118, P-127

Terreros P. P-016

Textor T. KL-13

Thanomsub B. P-046

Thiramanas R. P-129

Thomas H. P-089, P-118

Tiankov T. LP-27

Timoshenko N. P-098

Tischner A. P-074

Tobias G. P-040

Tofail S. O-45

Tokamanis C. PL-23

Tokarsky T. P-172

Tokarz A. LP-07

Tomanec O. P-140

Tomas K. P-120

Tomellini R. PL-18

Toropov A. O-50

Torrens F. P-171

Trajkovski B. LP-26

Tralle I. P-101

Trave E. P-056

Treschalov A. LP-43

Trevisan N. PL-03

Trojanek F. LP-31, LP-44

Trojkova J. P-168

Troyon M. O-42

Tsarenko S. LP-43

Tsiouvaras N. P-016

Tsubin V. LP-43

Turbin E. P-058

Tuutijarvi T. O-32

Txapartegi M. O-23

UUherek F. P-141

Uhlir V. P-144

Ulanski J. O-66

Ulbrich K. KL-18

Ulysse C. O-44

Urbanek M. P-144

Uttapap D. P-086

Uysal U. P-077

VVacek J. P-058

Vafadar A. P-157, P-177

Vahala R. O-32

Vala M. LP-41

Valenta J. P-070, P-126

Valle F. O-76

van Broekhuizen P. P-156

van de Laar R. O-58

Van de Voorde M.H. PL-21

van Delft F. O-58

van der Vaart R. P-147

van Erkel J. P-147

Van Noyen J. O-68

Vandeweert E. PL-18

Vanecek M. P-059

Vanek P. P-164

Vanhaecke E. O-73

Vanneste M. O-47

Vaquero C. P-165

Vasconcelos M.S. P-119

Vasseur S. P-062

Vávra I. LP-30

Veciana J. P-084, P-145

Veliu A. P-047

Venturini P. KL-15

Vermeeren V. O-37

Verpillot R. P-061

Verschuuren M. O-58

Vesaghi M.A. P-149

Vetushka A. P-022

Veverka M. O-15, P-055, P-062

Veverka P. O-15, P-055, P-062

Veverkova L. LP-12, , P-090, P-093, P-128,

P-163

Vezzu S. LP-42

Villaluenga I. P-050

Vinelli A. P-060

Viovy J.L. O-12, P-035, P-061

Viriya Empikul N. P-091, LP-05

Visser P. O-54

Vissing T. P-065

Vittorio O. P-049

Viviente J.L. O-23

Vlad A. P-111

Vlcek T. O-49

Vodsedalkova K. O-48

Vogel J. P-065

Volkov V. P-147

Vomastkova M. P-179

Vuillaume D. PL-17

Vynuchal J. LP-41

Vyskovska M. P-159, P-163

WWagberg L. O-67

Wagner P. O-37

Walter C. P-092

Wang D. P-056

Wang H. P-145, P-146

Wang S. O-53

Weber U. O-69

Weigel S. KL-14

Weimar U. O-02

Weir I. O-78

Weiserová M. LP-21

Weiter M. LP-41

Weltmann K.D. P-092

Weltring K.M. KL-26

Wenmackers W. O-37

Whatmore R. P-174

Wiatowski M. LP-06, LP-07

Wilken R. O-21

Williams J. P-107

Willm A. O-01

Winklehner P. P-039

Wirth I. O-13

Wittig H. P-156

Wlosnewski J. P-021

Woell C. O-16

Wöll C. P-145, P-146

Wolska E. P-133

Wu C.T. P-068

XXu D. O-53

Xu H. P-056

YYakovlev Y. P-019

Yang C.Y. P-116

Yatskiv R. P-067

Yatsunenko S. P-133

Yedgar S. P-066

Yeligbayeva G. P-162

Yetiz E. P-077

Yusenko K. LP-37

ZZacher D. LP-37

Zaitova L. P-048, P-110, P-112

Zalesak J. P-117

Zanazzi A. P-153, P-176

Zanchetta E. LP-42

Zaruba K. LP-12, P-090, P-093, P-128,

P-163

Zavadil J. P-067

Zaveta K. P-062

Zayats A.V. O-55

Zdansky K. P-067

Zdenek J. P-062

Zelenka J. O-49, P-114

Zelinka J. P-132

Zemtsov L. P-015

Zetkova K. O-49

Zhang X. O-53

Zhang Y. P-051

Zhao Q. O-53

Zhu H. O-09

Ziaei A. P-049

Zidek K. LP-31

Ziegenbalg G. O-04

Ziggiotti A. O-27

Zigon M. O-64

Znoj B. KL-15

Zollmer V. O-13

Zotti G. LP-03

Zou J. O-62

Zrínyi M. KL-20

Zrnik J. P-120

Zuccheri G. O-14, P-060, P-102, P-105

Zuin S. O-10

Zuschratter W. P-058

Zvatora P. LP-12, P-128

Zverinova Z. P-035

Zvezdin K. O-56

Zygogianni A. P-071

Zyk N. O-19, P-125, P-143


278

The EuroNanoForum 2009, a 4-day conference, was organized at the Prague Congress Centre from 2nd to 5th of June, as an event of the Czech Presidency, under the auspices of the Czech Ministry for Education Youth and Sports and with the support of the Industrial Technologies Directorate of the Directorate General for Research of the European Commission. The conference examined the nanotechnology contribution to the sustainable development of European industry and society while underlining the up-to-date industrial technologies and the role of products and services enabled by nanotechnologies in today’s world.

• The Forum provided a communication platform between the main European and international stakeholders (industrialists, researchers, universities and policy makers) in nanotechnology research and development. The conference was attended by more than 700 participants from 36 countries.

• The conference highlighted spectrum of nanotechnologies, which could signifi cantly contribute to the industries including aeronautics, automotive, chemicals, biotechnology and healthcare, construction electronic and electrical engineering, food, shipping, manufacturing, power generation and storage, remediation of the environment and textiles. Various technical details e.g. technology readiness, end-user needs, benefi ts and risks, have been assessed at each of 33 conference sessions. The detailed summary of each session will be used to guide future political actions in research on nanosciences, nanotechnologies and converging sciences.

Following the presentations and a panel discussion, the participants arrived at the conclusions listed below:

Eco- & energy- effi cient industrial production: • The interest in nanomaterials and metal nanoparticles as catalysts is increasing, for energy-cost reduction, improvement of selectivity

and minimisation of waste streams. Among particular examples that were shown was the use of superparamagnetic nanoparticles as heterogeneous catalysts. Other promising concepts to improve energy effi ciency are microreactors and novel reactive media - ionic liquids.

• Nanotechnologies could contribute to a signifi cant decrease in energy demand during the construction of new buildings, and to lower green gas emissions from existing ones.

• For new-generation cars, as well as ships and aircraft, nanotechnologies will impact on production and operating costs, and lower the environmental impact.

Energy and environment • Rapidly expanding fi elds of nanoscience and nanotechnology could contribute to a clean, energy-effi cient society and to a plentiful supply

of low-cost sustainable and renewable energy (photovoltaics, wind) and thermoelectric conversion systems. Any new technologies should be suitable for large-scale application, and capable of providing reliable, stable solutions. One of the highlighted research results fulfi lling these criteria is dye-sensitised nanocrystalline titanium dioxide solar cells.

• The environmental benefi ts may in some cases be compromised by unintended consequences of using nanoscale materials, but further data is needed to assess and mitigate possible risks. The climate-forcing eff ects of natural and engineered nanoparticles in the atmosphere should also be investigated.

Nanotechnology for sustainable healthcare • Despite the coordination eff ort and of funding increases to nanomedicine, industrial concerns about the maturity of these technologies

still exist. However, nanotechnology is helping to bring about important advances in areas such as regenerative medicine, drug delivery and diagnostics. Presentations showed how in-vitro diagnostics is more and more connected to new drug propositions; in-vivo imaging is combining diff erent reagents and biomarkers; and biodegradable nanofi bre scaff olds are helping to treat previously incurable conditions. The conference calls for better cooperation among researchers, hospitals (i.e. clinicians) and industries.

Prospects for industrial nanotechnologies • Despite the advances in characterisation and analytical tools, some gaps remain. The incremental improvements in silicon-based electronics

and improved design of devices are evidenced. Breakthroughs from bottom-up approaches (e.g. molecular electronics) are still in their infancy. The recommendation is to strengthen e public-private partnerships and improve education in Europe.

Governance of nanotechnology • To respond to wider interdependent concerns expressed by industry, various ETPs and European policies (e.g. Research and Development,

Health, Environment, Consumer protection, Competitiveness ...), the need for more eff ective Europe-wide cooperation on horizontal nanotechnology issues (Standardisation; Education; Ethical, Social and Legal Aspects; Communication and Outreach) was discussed.

• Further dialogue and joint actions between governments, funding agencies, industries and research entities are essential to achieve a prosperous sustainable economy in Europe. Only these interactions will overcome the infrastructural and knowledge barriers. They are vital to maximise the benefi ts of cooperative research in nanosciences and nanotechnologies. Also vital is a dialogue with society at large, in order to overcome misconceptions created by ill-informed media comment.

• In order to support the continuation of nanotechnology’s industrialisation, encourage the development of new products and services, and to respond to broad public demand for safe and responsible research, wider international cooperation and greater fi nancial support is needed in the fi elds of safety, health and environmental protection.

• Market success of nanotechnology applications depends very much on the establishment of corresponding standards, and continuous development of measurement and testing methods.

Conclusions of EuroNanoForum 2009 conference


279

Organisation management EuroNanoForum 2009

Nanotechnology for Sustainable EconomyEuropean and International Forum on NanotechnologyPrague, Czech Republic, 2-5 June 2009

OrganisersTechnology Centre ASCR Rozvojová 135, 165 02 Prague 6, Czech Republic

European Commission, Directorate-General for ResearchIndustrial Technologies Directorate, Nano- and converging Sciences and Technologies UnitBrussels, Belgium

International Advisory BoardGerd Bachmann, Future Technologies Division of VDI TZ GmbH, Düsseldorf, DE

Patrick Boisseau, CEA-LETI, MiNaTec, Grenoble, FR

Roberto Cingolani, Instituto Italiano di Tecnologia, IT

Sophia Fantechi, European Commission, Directorate-General for Research, Industrial Technologies, Nano- and converging Sciences and Technologies Unit

Michael Graetzel, Swiss Federal Institute of Technology (EPFL), Lausanne, CH

Costas Kiparissides, Aristotle University of Thessaloniki, EL

George Kotrotsios, CSEM, Marketing and Sales Division, Neuchatel, CH

Josef Michl, University of Colorado, Institute of Organic Chemistry ASCR, USA/CZ

Mark Morrison, Institute of Nanotechnology, Glasgow, UK

Markus Pridöhl, Evonik Degussa GmbH AG, Hanau, DE

Ottilia Saxl, Institute of Nanotechnology, Glasgow, UK

Eckhard Schollmeyer, Deutsches Textilforschungszentrum Nord-West e.V., Krefeld, DE

Christos Tokamanis, European Commission, Directorate-General for Research, Industrial Technologies, Nano- and converging Sciences and Technologies Unit

Nicola Trevisan, Veneto Nanotech Scpa - The Italian Cluster of Nanotechnologies, Padova, IT

Marcel Van de Voorde, DELFT University of Technology, Natural Applied Science Faculty, Delft, NL

Miklos Zrinyi, Semmelweis University, Faculty of Pharmacy, Department of Pharmaceutics, Budapest, HU

Scientifi c CommitteeFlemming Besenbacher, Interdisciplinary Nanoscience Center, University of Aarhus, DK

Jean Philippe Bourgoin, CEA, Saclay, FR

Kenneth Dawson, University College Dublin, IE

Elzbieta Frackowiak, Poznan University of Technology, Institute of Chemistry and Technical Electrochemistry, Poznan, PL

Péter Krüger, Bayer MaterialScience AG, Leverkusen, DE

Karen Scrivener, Swiss Federal Institute of Technology (EPFL), Lausanne, CH

Peter Venturini, Helios Domzale d.d., Research and Development, Domzale, SI

Joan-Albert Vericat, Noscira S.A., Madrid, ES

National Advisory BoardZdeněk Bittnar, Czech Technical University in Prague, Prague

Eduard Brynda, Institute of Macromolecular Chemistry ASCR, Prague

Miroslav Černík, Technical University of Liberec, Liberec

Jiří Homola, Institute of Photonics and Electronics ASCR, Prague

Eduard Hulicius, Institute of Physics ASCR, Prague

Ladislav Kavan, J. Heyrovsky Institute of Physical Chemistry ASCR, Prague

Jan Kočka, Institute of Physics ASCR, Prague

Vladimír Král, Institute of Chemical Technology, Prague

David Lukáš, Technical University of Liberec, Liberec

Martin Navrátil, SYNPO a.s., Pardubice

Miloš Nesládek, Hasselt University, Belgium

Jiří Pfl eger, Institute of Macromolecular Chemistry ASCR, Prague

Michael Solar, Czech Technical University in Prague, Prague

Tomáš Šikola, Brno University of Technology, Brno

Karel Šperlink, Assocation of Innovative Entreprenuership CR, Prague

Karel Ulbrich, Institute of Macromolecular Chemistry ASCR, Prague

Jiří Vohlídal, Charles University in Prague, Faculty of Science, Prague

Tomáš Wágner, University of Pardubice, Pardubice

Local conference management & exhibition organiserCZECH-IN, s.r.o.Professional Congress Event Organiser5. května 65, 140 21 Prague 4, Czech RepublicPhone: +420 261 174 301, Fax: +420 261 174 307Email: [email protected]

Conference venuePrague Congress Centre5. května 65 140 21 Prague 4 Czech RepublicWeb: www.kcp.cz

Conference websitewww.euronanoforum2009.eu

The editors do not guarantee the topicality, correctness, completeness or quantity of the information provided in this publication. Liability claims against the editors related to claims of a material or intangible kind that were caused by the use or non-use of the presented information respectively by the use of defective and incomplete information are fundamentally excluded.


280


281

Annex 1Final programme


282

Programme at a glance

REGISTRATION7:30 - 22:00

TUESDAYJune 2

WORKSHOPS ON DEMAND

see pages 303-305

OPENINGSESSION

Coffee break with opening of industrialand poster exhibition

PLENARYSESSION 1

see page 290

PANEL DISCUSSION 1see page 290

WELCOMERECEPTION

WEDNESDAYJune 3


PARALLEL SESSIONS A1-A6

see pages 294-295

Coffee break

PLENARYSESSION 2

see page 291

Lunch

PARALLEL SESSIONS B1-B6

see pages 296-297

Coffee break

WORKSHOPS ON DEMAND

WORKSHOP

see page 305

PLENARYSESSION 3

see page 291

PANELDISCUSSION 2

see page 291

OFFICIAL DINNERZOFIN PALACE


283


THURSDAYJune 4

see pages 298-299Coffee break

PARALLEL SESSIONSC1 - C4

FRIDAYJune 5


BROKERAGE

EVENTS

PLENARY SESSION 4

see page 292

WORKSHOP

see page 306

Lunch

see pages 299-300

PARALLEL SESSIONSD1 - D4

Coffee break with posters presentation

PLENARY SESSION 5

see page 292

see pages 300-302

PARALLEL SESSIONS

E1 - E7

Coffee breakWORKSHOPS

see pages 306-307

PLENARY SESSION 6

see page 293CLOSING SESSION

Lunch


284

Programme overview

Tuesday, June 2

07:30-22:00 Floor 1 - Registration AreaRegistration of participants

09:00-14:00 Floor 2 - Poster AreaInstallation of posters

09:30-13:00 South HallWorkshop: Nanomaterials for energy see page 303

09:30-13:00 Meeting Hall 1Workshop: Nanotechnology for environment and water treatment see page 303

09:30-13:00 Club BWorkshop: Sustainable chemistry see page 303

09:00-13:00 Club CWorkshop: Czech Nanoteam meeting - Education in the Czech Republic see page 304

09:30-13:00 Club EWorkshop: Industrial nanotechnologies see page 304

09:30-13:00 Club HWorkshop: Application of standards within nanotechnology see page 305

14:00-15:30 Congress HallOPENING SESSION OF EURONANOFORUM 2009

15:30-16:30 Coffee break with opening of industrial and poster exhibition opening by Herbert von Bose, Director, European Commission, Director-General for Research, Industrial Technologies and Karel Klusáček, Director, Technology Centre ASCR Note: Industrial and Poster Exhibitions will be opened during the whole conference until June 5

16:30-18:15 Congress HallPlenary session 1 - Nanotechnology and sustainable growth see page 290

18:15-19:15 Congress HallPanel Disucussion 1 - Industrial innovation in nanotechnology see page 290

19:30-21:30 Floor 2 - Congress Hall FoyerWelcome Reception at the Industrial and Poster Exhibition

TuesdayJune 2


285

Programme overview WednesdayJune 3

Wednesday, June 3


09:00-10:30 Club AParallel session A1 - 1.1 Nanotechnology in Eco-& Energy-effi cient industrial productionSustainable production of chemicals see page 294

09:00-10:30 Meeting Hall 4Parallel session A2 - 1.3 Nanotechnology in Eco- & Energy-effi cient industrial productionApplication in construction see page 294

09:00-10:30 Meeting Hall 5Parallel session A3 - 2.2 Nanotechnology for energyNanotechnology for H2 production & storage; Fuel cells see page 294

09:00-10:30 South HallParallel session A4 - 3.1 Nanotechnology for health and environmentNanotechnology in pollution monitoring and remediation see page 295

09:00-10:30 Club HParallel session A5 - 4.5 Future industrial technologiesBionanotechnology see page 295

09:00-10:30 Congress HallParallel session A6 - 4.1 Future industrial technologiesSupramolecular chemistry - Molecular electronics see page 295

10:30-11:00 Coffee break

11:00-13:00 Congress HallPlenary session 2 - Eco-& Energy-effi cient industrial production see page 291

13:00-14:30Lunch

Programme overview for Wednesday continues on the next page.


286

Programme overview WednesdayJune 3

Programme overview for Wednesday continues from the previous page.

14:30-16:00 Meeting Hall 4Parallel session B1 - 1.2 Nanotechnology in Eco- & Energy-effi cient industrial productionApplications in transportation see page 296

14:30-16:00 Meeting Hall 5Parallel session B2 - 2.1 Nanotechnology for energyPhotovoltaics and Thermoelectrics see page 296

14:30-16:00 South HallParallel session B3 - 3.2 Nanotechnology for health and environmentNanotechnology applications for water treatment see page 296

14:30-16:00 Club HParallel session B4 - 3.6 Nanotechnology for health and environmentBio non-bio interfaces in medical applications see page 297

14:30-16:00 Club AParallel session B5 - 5.4 Horizontal activitiesSafety, environmental and health protection, LCA see page 297

14:30-16:00 Congress HallParallel session B6 - 5.6 Horizontal activities - Nanoengineering: From nanostructure characterisation to processing technologies see page 297


16:30-19:15 Club HWorkshop: Neuroprosthetics and biomedicine through nanotechnology solutions: imaging, interfacing and device see page 305

16:30-17:50 Congress HallPlenary session 3 - Nanotechnology for energy and environment see page 291

17:50-18:50 Congress HallPanel Disucussion 2 - The impact of nanotechnology see page 291on global environmental and societal challenges

20:00-22:00 Žofín PalaceOffi cial dinner


287

Programme overview ThursdayJune 4

Thursday, June 4


09:00-10:30 Meeting Hall 4Parallel session C1 - 1.4 Nanotechnology in Eco-& Energy-effi cient industrial productionApplications in textile industry see page 298

09:00-10:30 Panorama HallParallel session C2 - 4.4 Future industrial technologiesNanophotonics, (O)LEDS see page 298

09:00-10:30 Club HParallel session C3 - 1.6 Nanotechnology in Eco- & Energy-effi cient industrial productionNanotechnology in food and other consumer products see page 298

09:00-10:30 Congress HallParallel session C4 - 4.6 Future industrial technologiesNanotechnology based materials see page 299

09:00-10:30 Meeting Hall 5On the fl y sessionSelected on the spot: nanoelectronics, photonics, sensing biosystems, ...

09:00-18:00 Club HNano Brokerage Event Prague 2009

09:00-18:00 Club B+CHealth Brokerage Event Prague 2009

10:00-12:00 Club AWorkshop: ČSNMT - Nanotechnology in the Czech Republic see page 306


11:00-12:30 Congress HallPlenary session 4 - Nanotechnology applications for sustainable health care see page 292

12:30-14:00 Lunch

Programme overview for Thursday continues on the next page.


288

Programme overview ThursdayJune 4

Programme overview for Thursday continues from the previous page.

14:00-15:30 Club AParallel session D1 - 1.7. Nanotechnology in Eco- & Energy- effi cient industrial productionNanomanufacturing see page 299

14:00-15:30 Congress HallParallel session D2 - 4.3 Future industrial technologiesNanoelectronics see page 299

14:00-15:30 Meeting Hall 4Parallel session D3 - 3.4 Nanotechnology for health and environmentNanomedicine - Drug delivery see page 300

14:00-15:30 Club HParallel session D4 - 4.2 Future industrial technologiesPolymer nanocomposites & membranes see page 300

15:30-16:30 Coffee break with poster exhibition

16:30-19:00 Congress HallPlenary session 5 - Prospects for industrial nanotechnologies see page 292


289

Programme overview FridayJune 5

Friday, June 5


09:00-10:30 Meeting Hall 1Parallel session E1 - 2.3 Nanotechnology for energyRechargeable batteries; Supercapacitors see page 300

09:00-10:30 Congress HallParallel session E2 - 3.3 Nanotechnology for health and environmentNanomedicine - Diagnostics see page 301

09:00-10:30 Club AParallel session E3 - 5.5 Horizontal activitiesStandardization see page 301

09:00-10:30 Meeting Hall 4Parallel session E4 - 5.1 Horizontal activitiesELSA see page 301

09:00-10:30 Panorama HallParallel session E5 - 5.2 Horizontal activities - From national initiatives to integrating activities - Roadmap to paneuropean funding see page 302

09:00-10:30 Meeting Hall 4Parallel session E6 - 5.3 Horizontal activitiesEducation see page 302

09:00-10:30 Small TheatreParallel session E7 - 5.7 Horizontal activitiesEuropean Technology Platforms see page 302

09:00-11:00 Meeting Hall 2Workshop: Communication and outreach of nanotechnology see page 306


10:30-13:00 Meeting Hall 1Workshop: Nucleation and growth of metal-organic frameworks on substrates: Surface-inspired aspects of supramolecular chemistry see page 307

11:00-12:40 Congress HallPlenary session 6 - Integrated, safe and responsible see page 293nanotechnology governance in the EU

12:40-13:15 Congress HallClosing session


290

Plenary sessions & Panel discussions TuesdayJune 2

Tuesday, June 2

Congress Hall Plenary session 1 - Nanotechnology and sustainable growth

Chairs: Herbert von Bose, Director, European Commission, Director-General for Research, Industrial Technologies Flemming Besenbacher, Interdisciplinary Nanoscience Center, University of Aarhus, DK

Rapporteur: Marcel Van de Voorde, DELFT University of Technology, Natural Applied Science Faculty, Delft, NL Sustainable development: a challenge for nanotechnology Péter Krüger, Head of Bayer Working Group Nanotechnology, Bayer MaterialScience AG, Leverkusen, DE Nanotechnology Commercialization: Stealth Success, Broad Impact Michael Holman, Lux Research, US Nanotechnology and the Future of Information Technology Walter Riess, IBM Zürich, CH From research to nanotechnology business - a case study: the Nanochallenge initiative Nicola Trevisan, CEO, Veneto Nanotech Scpa - The Italian Cluster of Nanotechnologies, Padova, IT Nano-Bio-Info-Cognitive sciences - the base of a new convergent NBIC technology Mikhail V. Kovalchuk, General Director, Kurchatov Institute, Moscow, RU

Congress Hall Panel Disucussion 1 - Industrial innovation in nanotechnology

Chairs: Mark Morrison, Institute of Nanotechnology, Glasgow, UK Pietro Perlo, Centro Ricerche Fiat (CRF), IT

Rapporteur: Marcel Van de Voorde, DELFT University of Technology, Natural Applied Science Faculty, Delft, NL Michael Holman, Lux Research, US Walter Riess, IBM Zürich, CH Nicola Trevisan, CEO, Veneto Nanotech Scpa - The Italian Cluster of Nanotechnologies, Padova, IT Mikhail V. Kovalchuk, General Director, Kurchatov Institute, Moscow, RU Pekka Koponen, CEO, Spinverse, FI


291

Plenary sessions & Panel discussions WednesdayJune 3

Wednesday, June 3

Congress Hall Plenary session 2 - Eco-& Energy-effi cient industrial production

Chairs: Jose-Lorenzo Valles, Head of Unit, European Commission, Directorate-General for Research, Industrial Technologies Directorate, New Generation Products Unit Péter Krüger, Head of Bayer Working Group Nanotechnology, Bayer MaterialScience AG, Leverkusen, DE

Rapporteur: Tomáš Wágner, University of Pardubice, Pardubice, CZ Make Money by Nano and respect Eco- and Energy effi ciency? Nano based products in construction, cleaning, health, cosmetics and other industries Andrea E. Reindhardt, CEO, microTEC, MINAM platform, DE Nanotechnology in Sustainable Chemical Production Markus Pridöhl, Coordinator Nanotechnology, Evonik Degussa GmbH, Hanau, DE Energy effi ciency in buildings: opportunities for sustainable innovations and the role of the E2B Association to make them happen Stefano Carosio, Division Manager, D’Appolonia SpA, IT Nanotechnologies Enabling Clean and Energy Saving mobility Vito Lambertini, Centro Ricerche Fiat (CRF), Micro an Nanotechnologies Department, Orbassano, IT

Congress Hall Plenary session 3 - Nanotechnology for energy and environment

Chairs: Eva Hellsten, European Commission, Directorate-General Environment, Water, Chemicals and Cohesion George Kotrotsios, CSEM, Marketing and Sales Division, Neuchatel, CH

Rapporteur: Mark Morrison, Institute of Nanotechnology, Glasgow, UK Catalytic model systems studied by high-resolution, video-rate Scanning Tunneling Microscopy Flemming Besenbacher, Interdisciplinary Nanoscience Center, University of Aarhus, DK Functionalized Nanomaterials for Solar Power Conversion and Storage Michael Graetzel, Swiss Federal Institute of Technology Lausanne (EPFL), Lausanne, CH The role of atmospheric nanoparticles in climate forcing Jean-Philippe Putaud, European Commission, Joint Research Centre, Institute for Environment and Sustainability Getting the good stuff and avoiding the bad: Government’s role in maximizing environmental benefi ts and avoiding unintended consequences of nanotechnology Kristan Markey, Program Manager and Chemist, Environmental Protection Agency (EPA), Washington, USA

Congress Hall Panel Disucussion 2 - The impact of nanotechnology on global environmental and societal challenges

Chairs: Antje Grobe, University of Stuttgart, DE Kristan Markey, Program Manager and Chemist, Environmental Protection Agency (EPA), Washington, USA

Rapporteur: Mark Morrison, Institute of Nanotechnology, Glasgow, UK Flemming Besenbacher, Interdisciplinary Nanoscience Center, University of Aarhus, DK Michael Graetzel, Swiss Federal Institute of Technology Lausanne (EPFL), Lausanne, CH Péter Krüger, Head of Bayer Working Group Nanotechnology, Bayer MaterialScience AG, Leverkusen, DE Richard A. Johnson, Arnold & Porter LLP, N/A, Washington DC, USA Eva Hellsten, European Commission, Directorate-General Environment, Water, Chemicals and Cohesion


292

Plenary sessions & Panel discussions

Thursday, June 4

Congress Hall Plenary session 4 - Nanotechnology applications for sustainable health care

Chairs: Carmelina Ruggiero, University of Genoa, Genova, IT Joan-Albert Vericat, Noscira S.A., Madrid, ES

Rapporteur: Pavel Matějka, Institute of Chemical Technology, Prague, CZ Nanotechnologies in regenerative medicine Eva Syková, Director, Institute of Experimental Medicine ASCR, Prague, CZ Getting Nanomedicines to Patients - The Therapeutic Nanomedicine Priorities Mike Eaton, UCB, Slough, UK Application of nanotechnology in medical diagnostics Patrick Boisseau, Head of BD in Nanomedicine, CEA-LETI, MiNaTec, Grenoble, FR

Congress Hall Plenary session 5 - Prospects for industrial nanotechnologies

Chairs: Jiri Vohlidal, Charles University, Faculty of Science, Prague, CZ Christos Tokamanis, Head of Unit, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit

Rapporteur: Péter Krüger, Head of Bayer Working Group Nanotechnology, Bayer MaterialScience AG, Leverkusen, DE Characterisation of nanostructures and process technologies Alfred Benninghoven, Ewald Niehuis, General Manager, ION-TOF GmbH, Muenster, DE Processing-structure-properties in advanced polymer nanocomposites José M. Kenny, European Centre on Nanostructured Polymers, University of Perugia, Terni, IT Nanoelectronics: there plenty of complexity at the bottom Livio Baldi, Numonyx Italy S.r.l. Agrate Brianza, IT Prospects in molecular electronics devices based on supramolecular chemistry Dominique Vuillaume, Research Director, Institute for Electronics, Microelectronics and Nanotechnology, CNRS and University of Lille, Molecular Nanostructures and Devices group, Villeneuve d’Ascq, FR Value-added materials: prospects and barriers Renzo Tomellini, Erno Vandeweert, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Value-added materials Unit Experience in the fi eld of research activities with universities - Nanotechnologies in cars Jaroslav Machan, Skoda Auto, Mlada Boleslav, CZ

ThursdayJune 4


293

Plenary sessions & Panel discussions FridayJune 5

Friday, June 5

Congress Hall Plenary session 6 - Integrated, safe and responsible nanotechnology governance in the EU

Chairs: Göran Hermerén, Lund University, President of the European Group on Ethics, SE Nicola Trevisan, CEO, Veneto Nanotech Scpa - The Italian Cluster of Nanotechnologies, Padova, IT

Rapporteur: Rudolf Frycek, Technology Centre ASCR, AMIRES.EU, Prague, CZ observatoryNANO - supporting informed decisions on nanotechnology developments Mark Morrison, CEO, Institute of Nanotechnology, Glasgow, UK European Technology Platforms - Responsible development of Industrial Nanotechnologies Paolo Matteazzi, MBN Nanomaterialia SpA, IT Support to a prosperous nanotechnology industry in Europe Marcel Van de Voorde, DELFT University of Technology, Natural Applied Science Faculty, Delft, NL Integration of nanosciences and nanotechnologies into ERA: Are ERA-Nets real assets? Pierre-Noël Lirsac, CEA, DSV/DPTS, Gif-sur-Yvette cedex, FR Innovative Nanotechnologies for Sustainable Growth Christos Tokamanis, Head of Unit, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit


294

WednesdayJune 3Parallel sessions A1-A3

Wednesday, June 3

Club A SESSION A1 - 1.1 Nanotechnology in Eco-& Energy-effi cient industrial production Sustainable production of chemicals

Chairs: Markus Pridöhl, Evonik Degussa GmbH AG, Hanau, DE Helge Wessel, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Value-Added Materials Unit

Rapporteur: Jiří Vohlídal, Charles University, Faculty of Science, Prague, CZ

Keynote: Industrial applications of membrane technologies for sustainable production Gilbert M. Rios, Head of the Department of Chemical Engineering, Ecole Nationale Superieure de Chimie de Montpellier, Montpellier, FR Ionic Liquids: Novel Eco-Effi cent and Green Tenside-like Materials for the Preparation of Dispersions of Nanoparticles Tom F. Beyersdorff, IoLiTec Ionic Liquids Technologies GmbH, Denzlingen, DE

Meeting Hall 4 SESSION A2 - 1.3 Nanotechnology in Eco-& Energy-effi cient industrial production Application in construction

Chairs: Zdeněk Bittnar, Czech Technical University, Faculty of Civil Engineering, Prague, CZ Christophe Lesniak, European Commission, Directorate-General for Research, Industrial Technologies, New Generation Products Unit

Rapporteurs: Hana Baarova, Technical University of Liberec, Liberec, CZ Pavel Hrabak, Technical University of Liberec, Liberec, CZ

Keynote: Application of nanoscience to understand the micro and nanoscale processes governing the performance of cementitious materials Karen Scrivener, Swiss Federal Institute of Technology Lausanne (EPFL), Lausanne, CH Nanomaterials and System Concepts for the Construction Industry: A Holistic Approach reported from a European Project Udo Weimar, University of Tuebingen, Institute of Physical Chemistry, Tuebingen, DE The use of nanomaterials in composite components to improve the energy storage performance of systems integrated in energy effi cient buildings Javier Gravalos Moreno, Acciona Infraestructuras, R&D, Madrid, ES STONECORE - a European project to develop and apply nano-materials for the refurbishment of buildings Gerald Ziegenbalg, IBZ-Freiberg, Freiberg, DE Multiscale simulations and experiments - tools for design of durable and new construction materials Vít Šmilauer, Czech Technical University, Faculty of Civil Engineering, Prague, CZ

Meeting Hall 5 SESSION A3 - 2.2 Nanotechnology for energy Nanotechnology for H2 production & storage; Fuel cells

Chairs: Carlos Saraiva Martins, European Commission, Directorate-General for Research Elzbieta Frackowiak, Poznan University of Technology, Institute of Chemistry and Technical Electrochemistry, Poznan, PLRapporteur: Jan Zitka, Institute of Macromolecular Chemistry ASCR, Prague, CZ

Keynote: Nanomaterials for Energy Applications: Challenges and prospects Maximilian Fichtner, Institute for Nanotechnology, Forschungszentrum Karlsruhe, Karlsruhe, DE Nanostructured Materials for Solid State Hydrogen Storage Klaus Taube, GKSS-Forschungszentrum Geesthacht GmbH, Geesthacht, DE ZEOCELL Project: An Innovative Membrane for High Temperature PEMFCs Pilar Pina, INA, University of Zaragoza, ES


295

WednesdayJune 3Parallel sessions A4-A6

South Hall SESSION A4 - 3.1 Nanotechnology for health and environment Nanotechnology in pollution monitoring and remediation

Chairs: J. Anthony Byrne, University of Ulster, Nanotechnology and Integrated BioEngineering Centre, Newtownabbey, N. Ireland / UK George Katalagarianakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit

Rapporteur: Esther Barrutia, LOIBA Consulting, BE

Keynote: Foundamentals and Applications of TiO2 Photocatalysis Akira Fujishima, Chairman, Kanagawa Academy of Science and Technology, Kanagawa, JP Visible Light Driven Oxidation of Volatile Organic Compounds with Gold Nanoparticles Supported on Oxides X. Chen, Queensland University of Technology, Faculty of Science, Brisbane, Australia Nanotechnology and the environment: perspectives on potential applications and implications of nanoparticles for water treatment Antonio Marcomini, University Ca Foscari of Venice, Environmental Science, Venezia, IT Recent experiences and future perspectives of nanoscale zero-valent iron applications for groundwater remediation Miroslav Černík, Technical University of Liberec, NTI, Liberec, CZ

Club H SESSION A5 - 4.5 Future industrial technologies Bionanotechnology

Chair: Karl Heinz Haas, Head of Fraunhofer Nanotechnology Alliance, Fraunhofer-Institut für Silicatforschung ISC, Würzburg, DE

Rapporteur: Oliver Panzer, European Research Services GmbH, Münster, DE

Keynote: Nanotechnology Tools for Life Sciences Harry Heinzelmann, Vice President, CSEM, Nanotechnology & Life Sciences Division, Neuchatel, CH Integrated Micro-Nano-Opto Fluid systems for high-content diagnosis and studies of rare cancer cells as early precursors of metastasi Zuzana Bílková, University of Pardubice, Faculty of Chemical Technology, Dpt. of Biological and Biochemical Sciences, Pardubice, CZ Functional printing of biosensor structures Ingo Wirth, Fraunhofer IFAM, Functional Structures, Bremen, DE DNA self-assembled nanostructures can serve as addressable vessels for positioning functional chemical moieties Giampolo Zuccheri, University of Bologna, Department of Biochemistry, Bologna, IT New hybrid magnetic nanoparticles for magnetic fl uid hyperthemia and magnetic resonance imaging Emil Pollert, Institute of Physics ASCR v.v.i., Magnetics and Superconductors, Prague 8, CZ

Congress Hall SESSION A6 - 4.1 Future industrial technologies Supramolecular chemistry - Molecular electronics

Chairs: Jean Philippe Bourgoin, CEA, Saclay, FR Nicholas Deliyanakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and convergiing Sciences and Technologies Unit

Rapporteur: Zdenek Broz, CZ

Keynote: Molecules in Electronic Circuits: from Molecular Design to New Integration Strategies Marcel Mayor, University of Basel, Department of Chemistry, Basel, CH SURMOF: Anchoring metal-organic frameworks, MOFs, to surfaces Christof Wöll, Ruhr University Bochum, Physikalische Chemie I, Bochum, DE High-resolution scanning tunneling microscopy studies of terephthalic acid molecules on rutile TiO2(110)-(1x1) surfaces Piotr Cyganik, Jagiellonian University, Physics, Krakow, PL Solution Based Supramolecular Self-Assembly on Surfaces: Towards a Toolbox for the Nanoscale Manfred Buck, University of St Andrews, School of Chemistry, St Andrews, UK Synthesis of novel organic ligands for gold nanoparticles decoration and architectures based on them Alexander Majouga, Lomonosov Moscow State University, Chemistry, Moscow, RU


296

WednesdayJune 3Parallel sessions B1-B3

Meeting Hall 4 SESSION B1 - 1.2 Nanotechnology in Eco- & Energy-effi cient industrial production Applications in transportation

Chair: Horst Soboll, ERTRAC

Rapporteur: Oliver Panzer, European Research Services GmbH, Münster, DE Nano applications in Continental Horst Kornemann, CONTINENTAL, DE Atmospheric pressure plasma jet treatment for eco- & energy-effi cient industrial production in the transportation sector Uwe Lommatzsch, Fraunhofer IFAM, Surface Technology, Bremen, DE The Real World Ivan Konečný, ELMARCO, CZ The LAYSA project: Multifunctional layers for safer aircraft composite structures José Luis Viviente, INASMET-TECNALIA, San Sebastian, ES Aerospace Nanotube Hybrid Composite Structures with Sensing and Actuating Capabilities - the NOESIS project George Maistros, INASCO Hellas, Greece Does surface nanostructuring infl uence ship-fouling organisms? James Callow, University of Birmingham, Biosciences, Birmingham, UK

Meeting Hall 5 SESSION B2 - 2.1 Nanotechnology for energy Photovoltaics and Thermoelectrics

Chairs: Michael Graetzel, Swiss Federal Institute of Technology Lausanne (EPFL), Lausanne, CH Jiří Pfl eger, Institute of Macromolecular Chemistry ASCR, Prague, CZ

Rapporteur: Witold Lojkowski, Institute of High Pressure Physics, Polish Academy of Sciences, Warszaw, PL

Keynote: Organic Photovoltaics - a scalable nanotechnology for energy harvesting Jens Hauch, Director of R&D Operations, KONARKA, DE Nanotechnologies for PV application new trends Bertrand Fillon, CEA, LITEN, Grenoble, FR Enabling nanotechnologies in photovoltaics and thermoelectrics for effi cient and clean transportation Mauro Brignone, Centro Ricerche FIAT, Micro & Nanotechnologies, Turin, IT Self-Organized Titanium Oxide Nanotube-Layers:Application in Dye Sensitized Solar Cells Patrick Schmuki, LKO, Uni-Erlangen, Materials Science, Erlangen, DE Integer charge transfer model - application to donor-acceptor heterojunctions Slawomir Braun, Linkoping University, Department of Physics, Linkoping, SE

South Hall SESSION B3 - 3.2 Nanotechnology for health and environment Nanotechnology applications for water treatment

Chairs: Michel Schouppe, European Commission, Directorate-General for Research, Environmental technologies and pollution prevention Unit Enrique Garcia-Bordeje, Instituto de Carboquímica, Spanish National Research Council, ES

Rapporteur: Esther Baruttia, LOIBA Consulting, BE

Keynote: Photocatalysis for Water and Wastewater Treatment J. Anthony Byrne, University of Ulster, Nanotechnology and Integrated BioEngineering Centre, Newtownabbey, N. Ireland / UK EWAT®: electrocoagulation and advanced oxidation wastewater treatment process involving nanostructure materials Ivano Aglietto, SA Envitech s.r.l., IT Nanotechnology for clean water: Water detoxifi cation using innovative visible nanophotocatalysts Polycarpos Falaras, NCSR “Demokritos”, Institute of Physical Chemistry, Athens, EL Removal of arsenate from water by magnetic nanoparticles T. Tuutijarvi, Helsinki University of Technology, Department of Civil and Environmental Engineering, Espoo, FI Development of advanced nano-engineered membranes for water purifi cation Ilka Gehrke, Fraunhofer UMSICHT, Process Technology, Oberhausen, DE


297

WednesdayJune 3Parallel sessions B4-B6

Club H SESSION B4 - 3.6 Nanotechnology for health and environment Bio non-bio interfaces in medical applications

Chairs: Miloš Nesládek, Institute of Physics ASCR, Prague, CZ Matteo Bonazzi, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit

Rapporteurs: Michele Giugliano, University of Antwerp, Department of Biomedical Sciences, Wilrijk, BE Patrick Wagner, Hasselt University, IMO-IMOMEC, Diepenbeek, BE

Keynote: Applications of carbon nanotube neural interfaces Edward Keefer, University of Texas Southwestern (UTSW) Medical Center, Dallas TX, USA The interactions between carbon nanotubes and neuronal networks: fi rst steps in Nanoneurosciences Michele Giugliano, University of Antwerp, Department of Biomedical Sciences, Wilrijk, BE Principles of tactile sensing Mike Adams, University of Birmingham, Chemical Engineering, Birmingham, UK Diamond to retina artifi cial micro-interface structures Philippe Bergonzo, CEA LIST, Diamond Sensor Laboratory, CEA/Saclay Gif-sur-Yvette, FR Label-free real-time biosensors Patrick Wagner, Hasselt University, IMO-IMOMEC, Diepenbeek, BE

Club A SESSION B5 - 5.4 Horizontal activities Safety, environmental and health protection, LCA

Chairs: George Katalagarianakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit Joan-Albert Vericat, Noscira S.A., Madrid, ES

Rapporteur: Harry Heinzelmann, Vice President, CSEM, Nanotechnology & Life Sciences Division, Neuchatel, CH

Keynote: Research into the health and safety and environmental risks of nanomaterials; current perspectives and landscape Rob Aitken, Director of Strategic Consulting, Institute of Occupational Medicine (IOM), Edinburgh, Director of the SAFENANO, UK NANODEVICE - Technology Promoting Safety of Engineered Nanomaterials in Workplaces Kai Savolainen, Finnish Institute of Occupational Health, New Technologies and Risks, Helsinki, FI Safe Use and Application of Nanomaterials by Integrated Production Processes and Toxicological Testing Robert Landsiedel, BASF SE, Product Safety - Regulations - Toxicology and Ecology, Ludwigshafen, DE A fast measuring method for airborne nanoparticles Jürgen Spielvogel, GRIMM Aerosol Technik, Nano Particles, Ainring, DE Nanoparticles monitoring in workplaces devoted to nanotechnologies Iolanda Olivato, Veneto Nanotech, Padova, IT

Congress Hall SESSION B6 - 5.6 Horizontal activities Nanoengineering: From nanostructure characterisation to processing technologies

Chairs: Jan Kočka, Institute of Physics ASCR, Prague, CZ Sophia Fantechi, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit

Rapporteur: Tomas Sikola, Brno University of Technology, Brno, CZ

Keynote: Atomic Force Microscope: eyes and hands for Nanoworld Pavel Jelínek, Institute of Physics ASCR, Department of Thin Films, Prague, CZ

Keynote: A Novel Route Towards Electrical Connection and Probing of Molecular Nano-scaled Devices Martin Oertel, International Sales Manager, Omicron NanoTechnology GmbH, Taunusstein, DE FIBLYS - a unique ‘multi-nano’-tool Silke Christiansen, IPHT, Jena, DE Consolidation of Nanoimprinting for Production Jouni Ahopelto, VTT Technical Research Centre of Finland, VTT Micro and Nanoelectronics, Espoo, FI Challenges and opportunities for Focused Ion Beam processing at the nanoscale Jacques Gierak, CNRS, LPN, Marcoussis, FR


298

ThursdayJune 4Parallel sessions C1-C3

Thursday, June 4

Meeting Hall 4 SESSION C1 - 1.4 Nanotechnology in Eco-& Energy-effi cient industrial production Applications in textile industry

Chairs: Stanislav Petrik, ELMARCO, Liberec, CZ Miroslav Černík, Technical University of Liberec, NTI, Liberec, CZ

Rapporteur: Stepanka Klimkova, Technical University of Liberec, Liberec, CZ

Keynote: Functionalisation of Textiles with Nanotechnology Eckhard Schollmeyer, Managing Director, Deutsches Textilforschungszentrum Nord-West e.V., Krefeld, DE Ecological considerations in designing nanoparticle-loaded textiles Tofail Syed, University of Limerick, Materials and Surface Science Institute, Limerick, IE Refi ning textiles by using nanotechnology Helfried Haufe, GMBU e.V., Functional Coatings, Dresden, DE Nanotechnology in textile applications: research @ Centexbel Jan Laperre, Centexbel, Gent, BE Needleless electrospinning using linear and circular clefts David Lukáš, Technical University of Liberec, Faculty of Textiles, Department of Nonwoven Textiles, Liberec, CZ

Panorama Hall SESSION C2 - 4.4 Future industrial technologies Nanophotonics, (O)LEDS

Chairs: Christoph Helmrath, European Commission, Directorate-General Information Society and Media Věra Cimrová, Institute of Macromolecular Chemistry AS CR, Prague, CZ

Rapporteur: Eduard Hulicius, Institute of Physics ASCR, Prague, CZ

Keynote: Nanophotonics contributes to future industrial technologies Clivia M. Sotomayor Torres, ICREA Research professor and Group Leader of the Photonic and Photonic Nanostructures Group of ICN, Catalan Institute of Nanotechnology and Centre for Research in Nanoscience and Nanotechnology, ES Effi cient Organic Lighting: Options and future from European perspective Peter Visser, Philips Lighting, OLED development, Aachen, DE Plasmonic nanophotonics Anatoly V Zayats, Centre for Nanostructured Media, IRCEP, The Queen’s University of Belfast, Belfast, UK HB-LED devices - from Laboratory to High Volume Production Babak Haidari, Obducat AB, Malmö, SE

Club H SESSION C3 - 1.6 Nanotechnology in Eco- & Energy-effi cient industrial production Nanotechnology in food and other consumer products

Chair: George Kotrotsios, CSEM, Marketing and Sales Division, Neuchatel, CH

Rapporteur: Naďa Koníčková, Technology Centre ASCR, Prague, CZ

Keynote: Nanotechnology in food - Safe to eat? Stefan Weigel, Senior Project Manager, RIKILT - Institute of Food Safety, Wageningen UR, NL

Keynote: Nanobased coating Peter Venturini, Helios Domzale d.d., Research and Development, Domzale, SI Nanoparticles and nanocomposites for industrial applications Jiří Zelenka, SYNPO a.s., Czech centre of nanostructured polymers and polymers based on renewable resources, Pardubice, CZ


299

ThursdayJune 4Parallel sessions C4-D2

Congress Hall SESSION C4 - 4.6 Future industrial technologies Nanotechnology based materials

Chairs: Helge Wessel, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Value-Added Materials Unit Karel Šperlink, Association of Innovative Entrepreneurship, Prague, CZ

Rapporteur: Martin Navrátil, SYNPO a.s., Pardubice, CZ

Keynote: Material developments with chemical nanotechnologies: Examples from the Fraunhofer-Alliance Nanotechnology Karl-Heinz Haas, Head of Fraunhofer Nanotechnology Alliance, Fraunhofer-Institut für Silicatforschung ISC, Würzburg, DE The interactions between carbon nanotubes and neuronal networks: fi rst steps in Nanoneurosciences Danuta Leszczynska, Jackson State University, Civil and Environmental Engineering, Jackson, USA Nano Patterned Materials for Future Products Bernd Löchel, Helmholtz-Zentrum Berlin für Materialien und Energie GmbH, Berlin, DE Development of nanostructured diamond-like carbon coatings with biofouling-resistant property Q. Zhao, University of Dundee, UK

Club A SESSION D1 - 1.7 Nanotechnology in Eco- & Energy- effi cient industrial production Nanomanufacturing

Chairs: Bertrand Fillon, CEA, LITEN, Grenoble, FR Kai Peters, European Commission, Directorate-General for Research, Industrial Technologies Directorate, New Generation Products Unit

Rapporteur: Witold Lojkowski, Institute of High Pressure Physics, Polish Academy of Sciences, Warszaw, PL

Keynote: Industrial nanotechnologies - The MINAM SRA and industrial Nanomanufacturing examples Svetan Ratschev, University of Nottingham, UK Charged particle nanopatterning of masters for substrate conformal imprint lithography F. van Delft, Philips Research, Mi Plaza, Eindhoven, NL Micro and Nano Manufacturing: Challenges and Opportunities Stefan Dimov, Cardiff University, Manufacturing Engineering Centre, Cardiff, UK Bottom up surface functionalization by dip-pen nanolithography at the Karlsruhe NanoMicro Facility (KNMF) Steven Lenhert, Forschungszentrum Karlsruhe, Institute of Nanotechnology, Eggenstein Leopoldshafen, DE Effect of surface nanotexturing on friction and wear during lubricated sliding Caroline Chouquet, CEA, LITEN, Grenoble, FR

Congress Hall SESSION D2 - 4.3 Future industrial technologies Nanoelectronics

Chairs: Livio Baldi, Numonyx Italy S.r.l. Agrate Brianza, IT Gisele Roesems-Kerremans, European Commission, Directorate-General Information Society and Media

Rapporteur: Dušan Nohavica, Institute of Photonics and Electronics ASCR, Prague, CZ

Keynote: Physics and Applications of Spintronics Tomáš Jungwirth, Institute of Physics ASCR, Prague, CZ

Keynote: Present redistribution of cards in European nanoelectronics and some key technical challenges for the future (tbc) Marie-Noëlle Semeria, Deputy Head, LETI-MINATEC, Grenoble, FR CARBonCHIP: Carbon Nanotubes Technology on Silicon Integrated Circuits; some key results Paulo Rapposelli, Intel Ireland Ltd., Leixlip Co. Kildare, IE Atomic vapor deposition of new materials for nano-electronic device technologies Peter Baumann, AIXTRON AG, Aachen, DE


300

FridayJune 5

ThursdayJune 4 &Parallel sessions D3-E1

Meeting Hall 4 SESSION D3 - 3.4 Nanotechnology for health and environment Nanomedicine - Drug delivery

Chairs: Joan-Albert Vericat, Noscira S.A., Madrid, ES Patrick Boisseau, Head of BD in Nanomedicine, CEA-LETI, MiNaTec, Grenoble, FR

Rapporteur: Pavel Matějka, Institute of Chemical Technology, Prague, CZ

Keynote: Polymer Carriers for Specifi c Delivery of Biologically Active Molecules Karel Ulbrich, Head of Dept. of Biomedicinal Polymers, Institute of Macromolecular Chemistry ASCR, Prague, CZ

Keynote: Nanotechnology Challenges in Targeted Delivery of Biopharmaceutics Costas Kiparissides, Professor of Chemical Engineering, Aristotle University of Thessaloniki, Director of Central Administration and Chairman of the Board of Directors of Center for Research and Technology Hellas, EL Nanotechnology based drug delivery system in the inner ear: cochlear implant as example for delivery system - the NANOEAR project Ilmari Pyykkö, University of Tampere, Otolaryngology, Tampere, FI Drug design and nanosensing for cardiovascular diseases Carmelina Ruggiero, University of Genoa, Genova, IT

Club H SESSION D4 - 4.2 Future industrial technologies Polymer nanocomposites & membranes

Chairs: Jiří Pfl eger, Institute of Macromolecular Chemistry ASCR, Prague, CZ Nicholas Deliyanakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies

Rapporteur: Jiří Vohlídal, Charles University, Faculty of Science, Prague, CZ

Keynote: Nano- and micro structured smart polymer composites Miklos Zrinyi, Semmelweis University, Faculty of Pharmacy, Department of Pharmaceutics, Budapest, HU UV protective zinc oxide/poly (methyl methacrylate) nanocomposites with enhanched thermal properties Majda Zigon, National Institute of Chemistry, Polymer Chemistry and Technology, Ljubljana, SI Materials & Technologies for Manufacturing of Flexible Electronic Devices Stergios Logothetidis, Aristotle University of Thessaloniki, Lab for Thin Films - Nanosystems & Nanometrology (LTFN), Physics Department, Thessaloniki, EL Nanostructured organic semiconductors for opto-electronic applications Jacek Ulanski, Technical University, Lodz, Molecular Physics, Lodz, PL Interactive coloured interference fi lms made from microfi brillated cellulose applied onto paper Hjalmar Granberg, STFI-Packforsk AB, FMM, Stockholm, SE

Friday, June 5

Meeting Hall 1 SESSION E1 - 2.3 Nanotechnology for energy Rechargeable batteries; Supercapacitors

Chairs: Erno Vandeweert, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Value-added Materials Unit Gerd Bachmann, VDI Technologiezentrum GmbH, Düsseldorf, DE

Rapporteur: Jakub Peter, Institute of Macromolecular Chemistry ASCR, Prague, CZ

Keynote: Nanocarbons and their composites for supercapacitors Elzbieta Frackowiak, Poznan University of Technology, Institute of Chemistry and Technical Electrochemistry, Poznan, PL Potential benefi ts of nanomaterials for Li ion batteries Hélene Burlet, CEA, Liten, Grenoble, FR Synthesis of carbon nanotube forests on metallic substrates for supercapacitor electrodes Holger Althues, Fraunhofer IWS, CVD thin fi lm technology, Dresden, DE Aligned carbon nanotubes array in conductive polymer composite, a design for new energy and energy storage Estelle Vanhaecke, Norvegian University of Technology and Science, Chemical Engineering Department, Trondheim, NO


301

FridayJune 5Parallel sessions E2-E4

Congress Hall SESSION E2 - 3.3 Nanotechnology for health and environment Nanomedicine - Diagnostics

Chairs: Karel Ulbrich, Head of Dept. of Biomedicinal Polymers, Institute of Macromolecular Chemistry ASCR, Prague, CZ Nicholas Deliyanakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies

Rapporteur Eduard Brynda, Institute of Macromolecular Chemistry ASCR, Prague, CZ

Keynote: Nanomedicine: breakthroughs in healthcare, enabled by nanotechnology J.W. Hofstraat, Vice President, Philips Research, Healthcare Strategic Partnerships, Eindhoven, NL Surface plasmon resonance biosensors - a tool for medical research and diagnostics Jiří Homola, Institute of Photonics and Electronics ASCR, Department of Optical Sensors, Prague, CZ Advanced lab-on-chip nanobiosensors tools for early diagnostics in nanomedicine Laura M. Lechuga, Research Center on Nanoscience and Nanotechnology, Nanobiosensors and Molecular Nanobiophysics Group, Barcelona, ES Sensing biosystems and their dynamics in fl uids with organic transistors Eva Bystrenova, CNR-Istituto per lo Studio dei Materiali Nanostrutturati, Bologna, IT Development of an integrated EWOD based POC system for Genetic Analysis Des Brennan, Tyndall National Institute, LSI, Cork, IE

Club A SESSION E3 - 5.5 Horizontal activities Standardization

Chairs: Stefaan Vandendriessche, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Iseult Lynch, University College, Dubli, IE

Rapporteur Tasilo Prnka, CZ

Keynote: Adding value to nanotechnology Framework Projects through standardization Peter Hatto, Director of Research, IonBond Ltd, Chairman of ISO/TC 229 and CEN/TC 352 nanotechnologies standardization committees, UK Measurement and standardization priorities for Nanotechnologies Michael Solar, Czech Technical University in Prague, Faculty of Mechanical Engineering, Prague 6, CZ Frictions at the interface between research and standardisation in nanotechnology Stephan Gauch, Berlin University of Technology, Faculty Economics and Management, Berlin, DE Towards an increased contribution from standardisation to innovation in Europe George Katalagarianakis, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Photocatalytic applications, standardization and testing methods František Peterka, Research Centre for Nanosurfaces Engineering - NANOPIN, Prague, CZ

Meeting Hall 5 SESSION E4 - 5.1 Horizontal activities ELSA

Chairs: Maurizio Salvi, Bureau of European Policy Advisers Josef Syka, Institute of Experimental Medicine ASCR, Prague, CZ

Keynote: Nano-ethics beyond risk-assessment Göran Hermerén, Lund University, President of the European Group on Ethics, SE

Keynote: Ethical, legal, social and economic aspects of Nanomedicine Klaus-Michael Weltring, Managing Director, Gesellschaft für Bioanalytik Münster e.V., Münster, DE The Evolving Global Framework for Nanotechnology: 10 Key Legal, Policy and Regulatory Drivers Richard A. Johnson, Arnold & Porter LLP, N/A, Washington DC, USA Nanotechnology governance and ELSA studies in Mexico Gian Carlo Delgado, CEIICH, UNAM., Torre II de Humanidades 4to piso, Ciudad Universitaria, MX


302

FridayJune 5Parallel sessions E5-E7

Panorama Hall SESSION E5 - 5.2 Horizontal activities From national initiatives to integrating activities - Roadmap to paneuropean funding

Chair: Pierre-Noël Lirsac, Deputy Director Technology for Health, Atomic Energy commission, CEA/Saclay, FR

Rapporteur: Alena Blažková, Ministry of Education, Youth and Sport, Prague, CZ

Keynote: French “Nano-INNOV” initiative Jean-Frederic Clerc, Director of Strategy & Prospective, Technological Research Division, CEA Grenoble, FR MNT-ERANET: Micro and Nano Technologies for a highly competitive European industry Roland Brandenburg, FFG, Austrian Research Promotion Agency, Vienna, AT The Netherlands and nanotechnology: NanoNed & the Netherlands Nano Initiative Leon Gielgens, NanoNed, Program Offi ce, Utrecht, NL Facilitating Nanotechnology activities in the UK James Johnstone, Centre for Process Innovation, Nanotechnology KTN, Newcastle Upon Tyne, UK Foresight, roadmaps and indicators for nanotechnology and nanoindustry in Russia Anatoliv Afanasiev, Russian Corporation of Nanotechnologies (RUSNANO), Foresight Department, Moscow, RU Spanish initiatives to promote transnational research on nanomedicine Josep Samitier, Spanish Technology Platform on Nanomedicine, CIBER of Bioengineering, biomaterials and nanomedicine, Institute for Bioengineering of Catalonia - University of Barcelona, Barcelona, ES

Meeting Hall 4 SESSION E6 - 5.3 Horizontal activities Education

Chairs: Mark Morrison, CEO, Institute of Nanotechnology, Glasgow, UK Sophia Fantechi, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies

Rapporteur: Antonín Fejfar, Institute of Physics ASCR, Prague, CZ

Keynote: Teaching Across Scientifi c and Geographical Boarders: A European Master Programme on Nanoscience and Nanotechnology Per Rudquist, Chalmers University of Technology, Department of Microtechnology and Nanoscience, Göteborg, SE Interdisciplinary nanotechnology education at MESA+ / University of Twente Martin Bennink, MESA+ Institute for Nanotechnology, University of Twente, Zuidhorst, NL European PhD School on “Nanoanalysis using focussed ion and electron beams” Gradimir Misevic, Gimmune GmbH, RTD, Zug, CH Facilitating the Russian Universities Nanonetwork entry into the European Research Area in Nanoscience and Nanotechnology Alexey Ivanov, St Petersburg Electrotechnical University “LETI”, Nanotech REC, Saint Petersburg, RU

Small Theatre SESSION E7 - 5.7 Horizontal activities European technology platforms

Chair: Hans Hartmann Pedersen, European Commission, Directorate-General for Research, Industrial Technologies Directorate, Nano- and converging Sciences and Technologies Unit

Rapporteur: Oliver Panzer, European Research Services GmbH, Münster, DE Nanoscience and technology implementation in industry: planning the new nano-ETP Paolo Matteazzi, MBN Nanomaterialia SpA, IT Sustainable Chemistry Platform Suschem Bernhard Schleich, Evonik Degussa GmbH, DE European Technology Platform on Smart Systems Integration EPOSS Wolfgang Gessner, VDI/VDE Innovation + Technik GmbH, DE Nanotechnologies for Medical Applications Sebastian Lange, VDI/VDE Innovation + Technik GmbH, DE European Nanoelectronics Initiative Advisory Council ENIAC Livio Baldi, Numonyx Italy S.r.l. Agrate Brianza, IT Future Textiles and Clothing FTC Jan Laperre, Centexbel, Gent, BE Other invited platforms for the round table: Industrial Safety ETP - Olivier Salvi; European Road Transport Research Advisory Council ERTRAC - Horst Soboll; Photovoltaics ETP - Eleni Despotou; Photonics21 ETP - Markus Wilkens

Presentations (10 min) from related platforms - followed by round-table discussion on the planned platform co-operations and implementation of the nano-ETP.


303

TuesdayJune 2Workshops

Tuesday, June 2

South Hall Nanomaterials for energy

Chair: Erno Vandeweert, European Commission, Brussels, BE

Rapporteur: Markéta Zukalová, J. Heyrovsky Institute of Physical Chemistry ASCR, Prague, CZ Introduction Erno Vandeweert, European Commission, Brussels, BE Nanoconcepts in thin fi lm photovoltaics Thomas Dittrich, Helmholtz Institute, Berlin, DE Nanomaterials for hydrogen production Kevin Sivula, EPFL, Lausanne, CH Nanomaterials for electrical energy storage systems Rosa Palacin, CSIC, Bellaterra, ES Advanced nanostructured complex hydrides for Solid State Hydrogen Storage Klaus Taube, GKSS Geesthaacht, DE

Meeting Hall 1 Nanotechnology for environment and water treatment

Chair: Costas Kiparissides

Rapporteur: Esther Barrutia MEMBAQ, Incorporation of Aquaporins in Membranes for Industrial Applications Hans G. Enggrob and Sania Ibragimova NAMETECH, Development of intensifi ed water treatment concepts by integrating nano- and membrane technologies Inge Genné WATERMIM, Water Treatment by Molecularly Imprinted Materials Costas Kiparissides NEW ED, a nano/micro/macro scale approach to higher performance in bipolar electrodialysis Thomas Melin and Clemens Fritzmann MONACAT, Monolithic reactors structured at the nano and micro levels for catalytic water purifi cation Enrique García-Bordejé Clean Water, Nanotechnology for Clean Water Polycarpos Falaras

Club B Sustainable chemistry

Chair: Martin Navrátil, SYNPO, a.s., Pardubice, CZ

Rapporteur: Alessandro Fraleoni Morgera, Synchrotron Trieste, IT Energy managing nanomaterials Erik Kelders, TU Delft, NL Designing and safeguarding bio-interactions Wendel Wohlleben, BASF SE, DE Materials innovation in construction Laszlo Bax, Smart Energy Home consortium manager, ES Effi ciency by light-weight materials Frank-Martin Petrat, Evonik - Degussa, DE


304

TuesdayJune 2Workshops

Club C Czech Nanoteam meeting - Education in the Czech Republic

Introduction to the Czech nanoteam activities Jan Kočka TiO2 fi bres: Novel materials with unusual properties Ladislav Kavan Nanostructures based on ZnO Dušan Nohavica RTG difraction for characterisation of semiconductor nanostructures Václav Holý Nanotechnology education programmes at Brno University of Technology and other universitites in the Czech Republic T. Šikola, M. Liška Posters presentations of nanotechnology education programme at universities in the Czech Republic: Faculty of Mathematics and Physics, Charles University in Prague Palackeho University Olomouc Technical University of Liberec VŠB - Technical University of Ostrava Faculty of Mechanical Engineering, Brno University of Technology Faculty of Nuclear Sciences and Physical Engineering, Czech Technical University in Prague Faculty of Biomedical Engineering, Czech Technical University in Prague

Club E Industrial nanotechnologies

Chair: Svetan Ratchev, University of Nottingham, UK Intro on MINAM SRA update with overview of its industry examples Svetan Ratchev, University of Nottingham, UK Fully Automated Multi Sensor Metrology for use in PV, MEMS and semiconductor Thomas Fries, FRT Fries Research & Technology GmbH, DE Industrial nano application out of the materials perspective Manfred Diehl, UMICORE Hybrid ultra precision manufacturing process based on positional-and self-assembly for complex micro-products Maddalena Rostagno, DIADgroup Materials and Equipment for Nano-Manufacturing Technology - overview of our ALD activities Bas van Nooten, ASM International, NL Inkjet technologies for micro and nanofabrication process - how use ink jet technologies to reach nano aspect” (FP7 NMP European project Multilayer) Hervé Monchoix, Altatech Direct deposition of nanoparticles. A new technology for micro/nanofabrication Alistair Kean, Mantis deposition Round table discussion on barriers to industrialisation and commercialisation of nanotechnologies, and the importance of communicating examples of good practice and success stories like the above Svetan Ratchev, University of Nottingham, UK


305

Workshops

Club H Application of standards within nanotechnology

Chair: James Johnstone, The Nanotechnology Knowledge Transfer Network, UK Opening Remarks by Chairman

The Importance of Standards to the Nanotechnology Industries Steffi Friedrichs, Nanotechnology Industry Association, BE Application of Documentary Standards in the Characterisation of Manufactured Nanoparticles Gert Roebben, Institute for Reference Materials and Measurements, BE Metrological Challenges in Surface Nano Analysis Wolfgang Unger, Federal Institute for Materials Research and Testing, DE Nanosafety Measurements and Testing: Standardisation and Harmonisation Needs Hermann Stamm, Institute for Health and Consumer Protection, IT Standards for Scanning Probe Microscopy Thorsten Dziomba, Physikalisch-Technische Bundesantalt (PTB), DE Discussion

Closing Remarks

Wednesday, June 3

Club H Neuroprosthetics and biomedicine through nanotechnology solutions: imaging, interfacing and device

Chair: Michele Giugliano, University of Antwerp, BE Neuroengineering microdevices and nanotechnologies for the monitoring of brain activity: the next frontier in biomedical sciences E. Claverol, ALERIA BIODEVICES, ES Towards biologically integrated tactile sensors Mike Adams, University of Birmingham, UK Three-dimensional nanobiostructure-based self-contained devicesfor biomedical application S. Shleev, Malmö University, SE Bioelectronic Olfactory Neuron Device J. Samitier, Institut de Bioenginyeria de Catalunya- Univ. Barcelona, ES BISNES: Bio-Inspired Self-assembled Nano-Enabled Surfaces D. Nicolau, University of Liverpool, UK Plasma deposited organometallics for antimicrobial coatings: The Embek1 Consortium T. Jenkins, University of Bath, UK Selective osteoblastic cell micro-arrays induced by diamond surface atoms B. Rezek, Institute of Physics ASCR, v. v. i., CZ

WednesdayJune 3

TuesdayJune 2 &


306

Workshops

Thursday, June 4

Club A Workshop of the nanosection of the ČSNMT - Nanotechnology in the Czech Republic

Chair: Tasilo Prnka Public support of nanotechnology R&D in the Czech Republic Karel Šperlink, president of the ČSNMT Nanotechnology R&D in the Czech Republic Jiřina Shrbená, manager of the nanosection of the CSNMT Results of applied nanotechnology R&D in our life: Elmarco: products NS Acoustic WebTM-sound absorbing materials, fi ltration materials Stanislav Petrik Rokospol: utilisation of nanoparticles in materials and paints-product Detoxy ColorTM

Antonin Kocar Contipro Group: nanofi bres from polymers Eva Jurová Nanotrade: Antibacterial appliactions NanosilverR, additives for fuel and lubricants Ladislav Torcik Aquatest: Several pilot applications of nanoiron in bioremediation works Miroslav Černík Comments & Questions

Friday, June 5

Meeting Hall 2 Communication and outreach of nanotechnology

Chair: Matteo Bonazzi NANO-TV project Mario Martinoli NANO2TOUCH project Lorenz Kampschulte TIME4NANO and NANODIALOGUE projects Guglielmo Maglio NANOYOU project Anna Parnes and Vered Ehrlich

FridayJune 5

ThursdayJune 4 &


307

FridayJune 5Workshops

Meeting Hall 1 Nucleation and growth of metal-organic frameworks on substrates: Surface-inspired aspects of supramolecular chemistry

Step-by-Step Approach for the synthesi and Growth of Metal-Organic Frameworks (MOFs) Thin Films on Organic Surfaces O. Shekhah*, H. Wang , R. A. Fischer, C. Wöll, Ruhr-Universität, Bochum, DE Functional Metal-Organic Frameworks as Heterogeneous Catalysts - the MOFCAT project R. Blom, SINTEF, NO Surface Structure of Metal-Organic Frameworks P. Cyganik, K. Szelagowska-Kunstman, M. Goryl, M. Szymonski, Jagiellonian University Krakow, PL Flexible sorption responses in a nanoporous framework material identifi ed through an integrated approach R. Heck, J. Rabone, S. Chong, J. Bacsa, M. J. Rosseinsky, D. Bradshaw, University of Liverpool, UK Surface based Coordination Chemistry: The case of the selective grafting of Metal-Organic Radical Open Frameworks V. Mugnaini, M. Oliveros, N. Roques, M. Paradinas, H. Wang, O. Shekhah, C. Wöll, C. Ocal, J. Veciana Consejo Superior de Investigaciones Cientifi cas, ES Donor-terminated Self-Assembled Monolayers as Anchoring units for Suface-Mounted MOFs Schüpbach, A. Terfort, Goethe-Universität Frankfurt, DE Interplay between simulations and experiment in the study of metal organic frameworks surfaces C. Mellot-Draznieks, F.-X. Coudert, A. Torrisi, University College London, UK Supramolecular Networks on Gold Surfaces Prepared from Solution I. Cebula, C. Shen, C. Silien, M. Buck, University of St. Andrews, UK Supramolecular 2D network of PTMTC radical adsorbed onto Au(111) and Cu/Au(111) F. Grillo, M. Oliveros, V. Mugnaini, J. Veciana, S. M. Francis, N. V. Richardson, University of St. Andrews, UK


308


309

Annex 2Exhibitors catalogue


310

A-BExhibitors catalogue

AIST-NT

AIST-NT European branch Tel.: + 31-555 400 500Phoenix Nano Technologies BVSeradellaweg 10 Fax.: +31-555 400 501NL-7325 WH Apeldoorn E-mail: [email protected] Netherlands Internet: www.nanophoenix.com

AIST-NT is the revolution in Scanning Probe Microscopy today. Unparalleled in combining speed, ultra-resolution, scan size, metrology, vibration insensitivity and automation in one single instrument. A concept that is both completely modular and therefore application scalable. At the same time it is designed for integration with spectral surface analysis techniques like Raman, Laser confocal imaging etc., allowing direct optical access from the top, the side and the bottom. It can operate in air, liquids and controlled environment as well as in vacuum and at variable temperatures. All SPM techniques AFM, STM and SNOM are full-mode available in one set-up.

With her large product range and het integrated turn-key solutions, AIST-NT covers all fi eld of nano scale surface analysis. With AIST-NT’s fast and top quality surface data you will dramatically boost the competitive position in your fi eld.

ANAMET, s.r.o.

Ing. Jiří Hrdlička, Managing director Tel.: +420 257 31 93 48Anamet s.r.o. Mob.: +420 602378625Kováků 26 E-mail: [email protected] 150 00 Praha 5 Internet: www.anamet.cz

Company ANAMET s.r.o. (www.anamet.cz) supplies instrumentation for general laboratories, research institutes and process measurement. We have been supplying Czech and Slovak market with high-tech instruments for over two decades (we are authorized to represent more than 30 brands). Nano topics are covered by following companies, which we are authorized to represent:

Malvern UK (particle sizing, MW and Zeta potential), Nanosurf AFM Switzerland, Quantachrome U.S.A. (porosity, density, sorption) and Netzsch GermanyThermal Analyses.

We provide tailor-made solution, warranty and regular service including spare parts and consumables supplies for all delivered instruments.

BZKG - Bayreuth Center for Colloids & Interfaces

BZKG - Bayreuth Center for Colloids & Interfaces Phone: (+)49 - 92 15 54 373University of Bayreuth Fax: (+)49 - 92 15 54 393Universitätsstraße 30 E-Mail: [email protected] D-95440 Bayreuth, Germany Web: www.bzkg.de

The Bayreuth center for colloid and interface science is a central institution of the university of Bayreuth. Its main purpose is the intensifi cation of the university’s collaboration with regional, national and international companies in handling colloidal systems. The central functions of the center are: combining and strengthening colloid and interface research ranging from fundamental questions to industrial applications, providing aid in problem solving and optimization of industrial processes and making the knowledge and experimental infrastructure at Bayreuth University accessible for industrial companies.

More information concerning the BZKG Management Board and the infrastructure of the central institution you will fi nd at www.bzkg.de.

Contact PersonsProf. Dr. Andreas FERY. Head of Institute - Managing Director Ms. Christine THUNIG, Marketing Management-Public RelationPhone: (+)49 - 92 15 52 753 Phone: (+)49 - 92 15 54 373Fax: (+)49 - 92 15 52 059 Fax: (+)49 - 92 15 54 393E-Mail: [email protected] E-Mail: [email protected]


311

CExhibitors catalogue

CARE-MAN - HealthCARE by Biosensor Measurements And Networking

University of Tübingen - EU-Project CARE-MAN, NMP4-CT-2006-017333 Phone +49 (0)7071 29-76927Prof. Dr. G. Gauglitz (Coordinator) Fax +49 (0)7071 29-5772Auf der Morgenstelle 18 [email protected] Tübingen www.care-man.eu

Within the Integrated Project CARE-MAN, funded by the European Commission since November 2005 with a grant of 11.5 Mio € (NMP4-CT-2006-017333), 28 partner organizations from 11 European countries are working on the development of a modular biosensor system for further use in Point-of-Care Testing.

This comprises the development and modifi cation of biological recognition elements (antibodies, aptamers, scaffolds) for use in the biosensor based multi-parameter assays for e.g. CRP, Interleukines, TNF-a, Procalcitonin, setting up suitable fl uorescence based detection systems including data handling and evaluation, as well as the generation of interfaces to the established laboratory and clinical software environment.

Contact at ENF2009Manuel Kemmler, Exhibition area, stand no. 20

Cluster Nanotechnologie

Nanoinitiative Bayern GmbH Phone: (+)49 - 93 13 59 86 501Oberer Kirschberg 2 Fax: (+)49 - 93 14 60 88 469D-97218 Gerbrunn E-Mail: [email protected] Web: www.nanoinitiative-bayern.de

The Nanoinitiative Bayern GmbH is responsible for the management of the network institution “Cluster Nanotechnology” in Bavaria / Germany. Main objective is the further development of a nanotechnology competence network to support an effi cient transfer of latest scientifi c results into industrial applications. For this purpose, it is essential to closely link the research, industrial and teaching sectors. Primary target groups are enterprises with application potential for nanotechnologies. A special focus is on small and medium-sized enterprises (SMEs), universities, universities of applied sciences and public research institutes. The network association Nanonetz Bayern e.V. acts as a platform for the cluster activities.

Contact PersonsDr. Matthias NUECHTER, Member of Management Board Sonja PFEUFFER, Assistant to Management BoardPhone: (+)49 - 93 13 59 86 144 Phone: (+)49 - 93 13 59 86 501Fax: (+)49 - 93 14 60 88 469 Fax: (+)49 - 93 14 60 88 469E-Mail: [email protected] E-Mail: [email protected]

CORDIS: the Community Research and Development Information Service

CORDISRue Mercier, 2L-2985 Luxembourg

CORDIS, the Community Research and Development Service, offers a gateway to the Seventh Framework Programme, with news, upcoming events, guidance and frequently asked questions to assist users to understand what FP7 is, who can participate in it and who takes decisions on the allocation of the budget to the research projects that will be funded.

To fi nd project partners, to participate in FP7 programme and to explore other unique opportunities, please visit- http://cordis.europa.eu/fp7

To request more information on CORDIS, please send an e-mail to [email protected]

CORDIS is a free service provided by the Publications Offi ce of the EU.


312

C-DExhibitors catalogue

COTEC

Cotec GmbH Phone: +49 (0) 6188.994.62 0Frankenstrasse 19 Telefax: +49 (0) 6188.994.62 6263791 Karlstein E-mail: [email protected] Web: www.cotec-gmbh.com

COTEC® is an independend German company. In close collaboration with our customers and partners we develop and provide systems, processes, materials, wear and tear parts, e-beam guns, APS parts and equipment for PVD, CVD thin fi lm applications focusing on optical coatings, metallization, nano coatings and sputtering processes. In addition, Cotecs ultra-hydrophobic material DURALONUltraTec provides an ever-lasting “easy-to-clean” effect on optical lenses. Easy-to-clean -a special kind of protection coating, hydrophobic and oleophobic, against watermarks, fi ngerprints, dust and grease.

Our business processes are certifi ed according to DIN EN ISO 9001:2000

CSEM - an innovation center

CSEM Centre Suisse d’Electronique et de Microtechnique SAJaquet Droz 1Case postaleCH 2002 Neuchâtel www.csem.ch

Established in 1984, CSEM (Centre Suisse d’Electronique et de Microtechnique SA) is a private R&D centre specializing in microtechnology, nanotechnology, microelectronics, systems engineering and communications technologies. It provides its industry customers and partners with tailor-made, innovative product solutions based on its commercial and technological expertise, further expanded by the results of its applied research. Additionally, through the establishment of start-up businesses, it actively contributes to developing Switzerland as a centre of industry and commerce.

To date, CSEM has established a total of 29 new enterprises with more than 500 employees. About 400 highly-qualifi ed employees from the most varied scientifi c and technical fi elds work for CSEM in Neuchâtel, Zurich, Basel, Landquart and Alpnach. They represent more than 20 different nationalities and constitute the basis of the company’s creativity, dynamism and innovation potential. Further information is available at www.csem.ch

Presence on site Media & PR Contact Olga Kubova - Nanotechnology & Life Sciences Florence Amez-Droz - [email protected] [email protected] Harry Heinzelmann - Vice President Nanotechnology & Life Sciences

DME

DME - Danish Micro Engineering A/S Tel.: +45 4484 9211Transformervej 12 Fax: +45 4484 9196DK-2730 Herlev [email protected] www.dme-spm.com

DME, founded in 1979 in Copenhagen by Dr. Curt Sander, is an engineering company, since 1987 active in developing, producing, and selling SPM microscopes and related scientifi c equipment. Besides having a standard product palette of SPM microscopes, DME is also active in the development of customized products for highly specialized scientifi c applications.


313

D-EExhibitors catalogue

DTIHK

Czech-German Chamber of Industry and Commerce T +420 224 221 200Vaclavske namesti 40 F +420 224 222 200 E [email protected] www.dtihk.cz

The German-Czech Chamber of Industry and Commerce (DTIHK) actively promotes the bilateral economic relations between the Czech Republic and Germany. With its excellent services and extensive contacts within the Czech economical and political sector, the DTIHK is able to assist its members not only with planned investments in the Czech Republic, but also in making the best use out of their position on the Czech market.

With more than 560 members, the chamber is the largest bilateral Chamber of Commerce Abroad in the Czech Republic.

The DTIHK supports the implementation of research and development in the Czech Republic, to further the development of the country as a business location. Therefore we organize conferences to provide a platform for the dialogue between German and Czech scientists, politicians and companies and promote the innovation hub Germany in Czech Republic.

Enterprise Europe Network

Enterprise Europe Network CR Tel.: 234 006 160Technology Centre ASCR E-mail: [email protected]. Daniela Váchová www.enterprise-europe-network.cz www.een.cz

Objective of the “Enterprise Europe Network” sought by the European Commission is a complete geographical coverage of European regions and another cooperative countries by services supporting development of innovative business without duplication of activities in any geographic area. Activities of the Enterprise Europe Network Czech Republic are realized by a consortium of eleven project partners coordinated by the Technology Centre ASCR. Members of the consortium are experienced providers of services supporting research and innovation activities of businesses.

The Czech network offers three types of services: consultancy for entrepreneurs (concerning the European market), innovation and technology transfer (consultancy and assistance by technology transfer, participation in international fairs, brokerages and help with Intellectual Property Rights) and project management (how to apply for a grant etc.).

More info: www.enterprise-europe-network.cz / www.een.cz.

EIT+

Wroclawskie Research Center EIT+ Ltd. Phone: +48 71 354 33 62Stablowicka Str. 147/149 Fax: +48 71 354 33 62 int. 3154-066 Wroclaw E-Mail: [email protected] Poland Web: www.eitplus.pl

The Wroclaw Research Center EIT+ Ltd (WRC EIT+) has objective to commercialize research and development results to build the Knowledge Based Economy in Lower Silesia. The shareholders of the Company are Municipality of Wroclaw, Lower Silesia Region and the following academic institutions of Wroclaw: University, University of Technology, University of Environmental and Life Sciences, Medical University and University of Economics. WRC EIT+ develops the Research and Technology Park, to concentrate potential within the areas of IT, nanomaterials, biotechnology and clean energy projects. Company is leading a research programs “Nanotechnologies in the - advanced materials - NanoMat” and “Biotechnologies and advanced medical technologies - BioMed”, executed within European Regional Development Found for Operational Program for Innovative Economy. WRC EIT+ has close collaboration with Foundation for Supporting Nanosciences and Nanotechnologies - Nanonet.pl

Contact PersonsDr. Lukasz NIERADKO, Peter HOMA,Coordinator of Nanotechnology Laboratories Liason Offi cer for International CollaborationPhone: +48 71 354 33 62 int 29 Phone: +49 (916) 399 78 75, Fax: +49 (916) 399 70 09E-Mail: [email protected] E-Mail: [email protected]


314

EExhibitors catalogue

ELMARCO

ELMARCO s.r.o. Tel.: +420 489 209 200 V Horkách 76/18 Fax: +420 489 209 999 460 07 Liberec 9 E-mail: [email protected] Czech Republic Web: www.elmarco.com

ELMARCO, a world leader in the nanofi ber industry, is the fi rst and still the only company in the world that offers machines for industrial production of nanofi bers to its customers.

Industrial lines and laboratory units - so called Nanospider™ - produce nanofi bers using the electrospinning technology. The Nanospider™ technology has already been improved and modifi ed for three types of polymers - organic, inorganic, and melts.

The technology is very fl exible therefore the parameters of the produced nanofi bers can be changed very easily.

ENVItech

ENVItech Bohemia s.r.o. Phone: +420 257 312 750Ovocná 34, 161 00 Prague Fax: +420 257 311 780Czech Republic E-mail: [email protected] www.envitech.eu

Established Air, Wind, Water - three most important elements of the environment where we live. Clean air, fresh wind and clear water are what we are looking for when we want to fi nd the right place to relax. We are running away from the exhausts of our cars, incineration plants, where they process our waste, paint shops where they polish our furniture… To fi nd balance between a reasonable consumption and its impact on the environment means to know the real conditions of the air we breathe, wind that breaks up the clouds of smog and water the cradle of all living. Our company has been providing environmental measurements since its foundation in 1992. We have overcome the problem of 1990s when the most polluting substance was SO2 and we are overcoming problems today when there has been an improvement in theoretical and practical levels of monitoring. Our devices fully comply with EU legislation and standards, our services help customers to comply with EU legislation. Moreover, we don’t breath only outside…we also want clean air at work, theatres, our houses...

ENVItech Bohemia, s.r.o. is your stable partner which will not abandon you and which you can always rely on. Our expertise and experiences are here for you.

EXPLORA

EXPLORA S.r.l. Phone: +39 06 400 40 358Via G. Peroni, 386 Fax: +39 06 400 40 364IT-00131, Rome [email protected] www.explora-biotech.com

EXPLORA S.r.l. is a privately owned Italian company committed to the development of next generation of protein bio-conjugation techniques. EXPLORA’s SiteLink technology exploit proprietary peptide scaffolds specifi cally recognized by recombinant enzymes that catalyze the covalent addition of reactive groups in a site specifi c manner. Available bioconjugation techniques involve random conjugation which yields an heterogeneous population of labeled proteins negatively affecting intra- and inter-assay reproducibility, batch-to-batch consistency and may dramatically reduce protein. Conversely, the SiteLink technology ensures covalent conjugation of proteins with full control on position and number of reactive groups conjugated to the target protein improving protein functionality and reproducibility.

Contract Research Servicec/o Scientifi c Park VEGAVia della Liberta, 9 Phone: +39 041 5093 865Building “Auriga” - Laboratory n° 29 Fax: +39 041 5093 88130175, Marghera Venezia - Italy [email protected]


315

G-IExhibitors catalogue

Gimmune

Gimmune GmbHPostrasse 246300 ZugSwitzerland

Gimmune GmbH sells, distributes and makes three classes of custom tailored products:

1. Novel compounds which stimulate selective proliferation of human and other mammalian Natural Killer (NK) cells.2. Monoclonal antibodies directed against cellular markers for cell differentiation and malignant transformation stages.3. Nano and micro scale devices for diagnostics and monitoring of disease/therapy states.

HVM Plasma

HVM Plasma, spol. s r.o. Tel.: +420 251 087 111Na Hutmance 347/2 Fax: +420 251 612 400158 00 Prague [email protected] Republic http://www.hvm.cz

HVM Plasma is specialized in thin fi lm coating technology by PVD and PACVD. We are focused on:

• development, design and manufacturing of vacuum components and equipment • job coating (hard, decorative, tribological and biocompatible coatings)• development of new coating technology including nanoclusters applications• measurement of thin coating properties and plasma diagnostics

Linking of applied science, manufacturing and technology in:

• research projects and cooperation with research institutes and universities • consultancy in vacuum technique and surface technology

This goal is realized thanks to creative and responsible team with open relationship with customers and permanent emphasis on quality.

Innovationsallianz Carbon Nanotubes (Inno.CNT)

Innovationsallianz Carbon Nanotubes (Inno.CNT) Phone: +49 (0) 180 5-133 422Information Offi ce Fax: +49 (0) 180 5-133 423PO Box 11 08 31, 40508 Düsseldorf E-mail: [email protected]

The Innovation Alliance Carbon Nanotubes (Inno.CNT) is a closely networked research alliance in Germany involving around 80 reputable partners from science and industry. Inno.CNT seeks to establish a foundation for building up a lead market for CNT technologies and products. In 18 closely networked projects, Inno.CNT concentrates on the development of basic technologies and applications. These include three overarching technology projects that focus on the manufacture, functionalization and dispersion of CNTs. The 14 application projects target topics in the energy and environment, mobility and lightweight construction sectors. Another basic development project addresses the safe handling of carbon nanotubes.


316

IExhibitors catalogue

INNOVENT

INNOVENT e.V. Phone: (+)49 - 3641 28 25 10Technologieentwicklung Jena Fax: (+)49 - 3641 28 25 30Pruessingstr. 27B E-Mail: [email protected] Jena, Germany Web: www.innovent-jena.de

INNOVENT Technology Development Jena is the major non-profi t research facility of Thuringia / Germany working on the areas of physical and chemical surface engineering with a strong emphasis on biomaterials and magnetically and optical systems. It develops and optimizes processes and products aiming at a fast translation into industrial practice.

The competences are• surface activation and coating (CVD, PVD, R-CCVD) • Development and adaptation on chemical surface treatment methods and adhesive coupling methods • Plasma chemical processes for surfaces on light metals • Corrosion protection of magnesium alloys by anodic oxidization • Biomaterials for medicine, pharmacy and biotechnology • Magnetic materials/devices, optical measurement system

Contact PersonsDr. Bernd Gruenler, Managing Director, Executive Board Dr. Arnd Schimanski, Managing Director, Executive BoardHead of Department Surface Engineering Head of Department Surface EngineeringPhone: (+)49 - 3641 28 25 10, Fax: (+)49 - 3641 28 25 30 Phone: (+)49 - 3641 28 25 10, Fax: (+)49 - 3641 28 25 30E-Mail: [email protected] E-Mail: [email protected]

Institute of Nanotechnology

Institute of Nanotechnology T: +44 (0) 141 303 8444Del Stark, Business Development Manager F: +44 (0) 141 552 7499Lord Hope Building, 141 St James Road E: [email protected] Glasgow, G4 0LT, UK http://www.nano.org.uk

Established in 1997, the Institute of Nanotechnology (IoN) is a membership organisation which works closely with government, industry, and academia to provide world class information and analysis on nanotechnology developments and how these can benefi t wider society.

Further information on IoN events, training and educational initiatives, business support, and the projects we are delivering can be found at www.nano.org.uk or by contacting our head offi ce on +44 (0)1786 458020.

The IoN is a registered Scottish Charity, No. Sc025709.

IOLITEC

IOLITEC Phone: +49-(0)7666 / 913929Ionic Liquids Technologies GmbH Fax: +49-(0)7666 / 9129345Ferdinand-Porsche-Strasse 5/1 Email: [email protected] / [email protected] Denzlingen http://www.iolitec.com

Established IOLITEC is a company active in the fi eld of ionic liquids and nano materials with a strong focus on cleantech applications. The company was founded in 2003 and has currently 10 employees. With more than 600 customers worldwide IOLITEC is surely the most established start-up-company in the fi eld of ionic liquids.

In 2004 IOLITEC established its Special Chemistry devision in order to supply high quality ionic liquids to customers worldwide. The current portfolio consists of more than 200 different ionic liquids which in many cases can be supplied from stocks in quantities from 25g to 10kg. While increasing production capacities, new production technologies namely microreaction technology were adapted to the synthesis of ionic liquids. Current yearly production capacities are in the range of 10mt for selected products.

In 2006 IOLITEC started activities in the fi eld of nano-materials, focusing on ultra small nano-sized metal particles with narrow size distributions. Another important fi eld is the dispersion of nano-particles. Due to their potential risks like toxicity or infl ammability safe handling of nano particles has become more and more an important issue.

IOLITEC has already experience as coordinator and partner in joint projects founded by german gouvernmental organisations. In two projects new electrolytes using microreaction technology and dyes for DSSCs have been developed. The company has a strong interest to extend this knowledge in co-operation with international partners.


317

I-NExhibitors catalogue

IRLBACHER BLICKPUNKT GLAS

IRLBACHER BLICKPUNKT GLAS GMBH Tel.: +49 (0)9674/9200-166Bahnhofstraße 12 Fax +49 (0)9674/9200-150D-92539 Schönsee Mail: [email protected] Homepage: www.irlbacher.com

Technical glass, DIN sight glasses, armatury glass, glass cylinder, fi lterglass, optical glass, precision optics, sensoric, display technic, touchable glass, borosilicate glass, quartzglass, glass ceramic, microscope slides.

MAGISTER - Magnetic scaffolds for in vivo tissue engineering

Contact PersonsDr. Alek Dediu, Project Coordinator [email protected] Dr. Tommaso Foglia, for General Info [email protected] www.magister-project.eu

MAGISTER is a frontier research project aiming to develop new conceptually type of magnetic scaffolds (MagS) for tissue regeneration and orthopaedic surgery. The magnetic moment of the scaffolds introduces the fascinating possibility to continuously control and reload them with scaffold precursors and active factors (e.g. VEGF).

Such MagS can be imagined as fi xed “stations” that offer a long-living assistance to the tissue engineering via a controlled in vivo supply of bio-agents functionalized to Magnetic Nanoparticles injected in the proximity of the scaffold.

This approach offers the unique possibility to adjust the scaffold activity to the personal needs of each patient.

Nanopharma

Nanopharma a.s. Tel.:420 271 016 111, 420 604 241 672Ukrajinská 1488/10 Fax: 420 271 016 221101 00 Praha 10 E-mail: [email protected] Republic www.nanopharma.cz

Characteristic topics for Nanopharma, Inc., are development and production of nanofi bers from several polymeric materials, such as PCL, PVA, PLGA and other, suitable for cell seeding, namely by chondrocytes and mesenchymal stem cells. Composite scaffolds based on nanofi bers prepared by coaxial spinning as well as the biodegradable liposome enriched nanofi bers can be also found on the product list. Biodegradable nanofi bers produced by Nanopharna, Inc., can also be applied as covering and protecting material or for separation and sealing.


318

NExhibitors catalogue

NETSZCH

NETZSCH-Feinmahltechnik GmbH Phone: (+)49 - 92 87 79 70Sedanstraße 70 Fax: (+)49 - 92 87 79 71 49D-95100 Selb E-Mail: [email protected] Web: www.netzsch-grinding.com

NETZSCH-Feinmahltechnik GmbH is the world‘s leader in wet grinding, mixing and kneading. The product line encompasses a comprehensive laboratory program, production machines in various sizes and complete plants. The bundling of processing know-how, our extensive machine program, solutions for customer-specifi c problems and our global presence are unique and hence the strength of the business unit Grinding & Dispersing.

The company headquarters is located in Selb. Machines and plants are manufactured in facilities in Selb and Tirschenreuth. NETZSCH-Feinmahltechnik GmbH is equipped with a state-of-the-art applications laboratory and leads the world in the development of grinding and dispersing technology.

Contact PersonsHans-Georg KISSWETTER, Technical Sales Dr. Stefan MENDE, Product ManagerPhone: (+)49 - 92 87 79 72 03, Fax: (+)49 - 92 87 79 71 49 Phone: (+)49 - 92 87 79 72 15, Fax: (+)49 - 92 87 79 71 49E-Mail: [email protected] E-Mail: [email protected]

NMP - European Commission

NMP Programme - Nanosciences, nanotechnologies, Materials & new Production technologiesEuropean Commission, 7th Framework Programme for Research and Technological Development

The core objective of the “Nanosciences, nanotechnologies, Materials and new Production technologies (NMP)” programme is to improve the competitiveness of European industry and generate the knowledge needed to transform it from a resource-intensive to a knowledge-intensive industry.

NMP research aims to strengthen the competitiveness of European industry by generating ‘step changes’ in a wide range of sectors and implementing decisive knowledge for new applications between different technologies and disciplines.

New, high-tech industries and higher-value, knowledge-based traditional industries will benefi t through the funding of the NMP research theme, which also puts special focus on the appropriate dissemination of research results to SMEs.

Contact personsEuropean Comission, Directorate-General for Research, Directorate G-Industrial TechnologiesMrs Pascale Dupont, Unit G.1 Dr Sophia Fantechi, Unit G.4 Dr Christos Tokamanis, Unit G.4, Head of UnitHorizontal aspects and coordination Nano- and converging Sciences and Technologies Nano- and converging Sciences and Technologies Email: [email protected] Email: [email protected] Email: [email protected]: +32-2-2990411 Phone: +32-2-2956469 Phone: +32-2-2959565Internet http://ec.europa.eu/research/industrial_technologies/index_en.html http://cordis.europa.eu/fp7/cooperation/nanotechnology_en.html http://cordis.europa.eu/nanotechnology/

Cluster NanoMicro+Materials.NRW/NRW.INVEST

Cluster NanoMicro+Materials.NRW Telefon +49 (0) 211385459-0Merowingerplatz 1 Telefax +49 (0) 211385459-19D - 40225 Düsseldorf [email protected] www.nmw.nrw.de

With 61 university institutions, 470.000 students and additional 50 research institutes North Rhine-Westphalia (NRW) owns the densest network of science and research in all over Europe. Furthermore NRW is one of the most important European industrial sites. The Cluster NanoMicro+Materials.NRW has been inaugurated by the state of NRW to strengthen the excellence in research and the industrial development. One particular focus will be to support the transfer of outstanding research into new innovative products and thereby transform NRW into the most innovative state by 2015. The mission of NRW.INVEST is to market NRW as an investment location and to acquire foreign investments to NRW.


319

P-TExhibitors catalogue

Palacky University

Přírodovědecká fakulta, Univerzita Palackého Tel.: 585 634 970, 585 634 971Šlechtitelů 11, 783 71 Olomouc Mobil: 733 690 459Prof. RNDr. Miroslav Mašláň, Csc., Project Coordinator [email protected]. Michaela Holecová, Project Manager [email protected]

The project of the Regional Centre of Advanced Technologies and Materials follows upon the extraordinarily successful scientifi c activities in the fi eld of applied research, carried out by the staff of the Faculty of Science of Palacky University. The highly successful grant policy allowed building up a device and technology park that is incomparable within the Czech Republic, mainly in material and optical research.

The Regional Centre of Advanced Technologies and Materials is aimed to become a connecting element between the research activities, carried out at Palacky University, and the industrial subjects in the region or in the whole Czech Republic, mainly in nanotechnologies, optical technologies, analytical processes and instrumentation and development of biologically active compounds. The centre will act as the key technological link between research and the industrial application of the research outcomes.

At present, the group of clients of the university research departments includes for example ČTCAP Corp. Přerov, Farmak Corp. Olomouc, Meopta Corp. Přerov, Altermed Corp. Olomouc, EPCOS Ltd. Šumperk, Stomix Ltd. Žulová or IVAX Pharmaceuticals Ltd. Opava.

R M I

R M I, s.r.o.Pernstynska 116 Tel./fax: +420-466 921 885533 41 Lazne Bohdanec Tel./fax: +420-466 921 404Czech Republic E-mail: [email protected]

Production and distribution of the scientifi c, laboratory and testing equipment, scanning probe microscopy, nanotechnology, vibration isolation systems, lasers and laser optics, preparation of high purity water and acids, accessories for sample preparation and wide range of consumables for all kind of spectroscopy.

Representatives: NT-MDT - Scanning Probe Microscopy (AFM, STM, SNOM, TERS, AFM Tomography), Hysitron - Nanoindentation, Evex - miniSEM, microanalysis, Lyncée Tec - Digital Holography Microscopy, Air Sense, Ahura Scientifi c, Berghof, Carbolite, CeramOptec, Cetac, Claisse, Duratec, Elvatech, GBC, Glass Expansion, HWL, Lambda Solutions, Lightpath Optical, Lotis TII, Lumex, Photron, Spectron NPO, SCP Science, SG, Solar TII, Spex CertiPrep, StellarNet, Van Der Heijden, Wilks Enterprise, Zeutec.

Technology Centre ASCR

Technology Centre ASCR Tel.: +420 234 006 100Rozvojová 135 Fax: +420 220 922 698165 02 Prague 6 E-mail: [email protected] Czech Republic www.tc.cz

The Technology Centre of the Academy of Sciences of the Czech Republic (TC ASCR) was established in 1994. TC ASCR acts as the National Information Centre for European Research and is involved in transnational technology transfer activities. TC ASCR carries out analytical and strategic studies in the area of science, technology and innovation for the public administration of the Czech Republic. TC ASCR works in a close cooperation with the Ministry of Education, Youth and Sports which is responsible for administration of research including international cooperation in this fi eld, Ministry of Industry and Trade and the Ministry for Regional Development. TC ASCR cooperates with the Council for Research and Development and is involved in a number of projects supported by European Commission and also cooperates with United Nations Industrial Development Organization.


320

T-ZExhibitors catalogue

TÜV SÜD Industrie Service

TÜV SÜD Industrie Service GmbHWestendstrasse 199D-80686 MunichGermany Web: www.tuev-sued.com

TÜV SÜD is a leading international service group catering to the business segments INDUSTRY, MOBILITY and PEOPLE. With over 11,000 employees, we are represented at more than 600 locations worldwide. As partners in our customers’ processes, our specialist teams ensure that technology, systems and know-how are optimized, thus strengthening our customers’ global competitiveness.

CENARIOS® is the world’s fi rst risk management and monitoring system for nanotechnology. It has been developed jointly by TÜV SÜD Industrie Service GmbH and Die Innovationsgesellschaft mbh (St. Gallen). CENARIOS® has been developed on the special needs of industry in this rapid developing technology. All the uncertainties of a risk management system in this special case have been considered. “nanoGMP“ is the fi rst quality standard for nanotechnology processes. With nanoGMP the quality, capability and reliability of nanospecifi c processes are ensured.

Contact PersonMr. Gerhard Klein, PhysicistPhone: (+)49 - 89 57 91 1579, Fax: (+)49 - 89 57 91 2888, E-Mail: [email protected]

UK Nanotechnology

Nanotechnology Knowledge Transfer Network (NanoKTN) Tel.: +44 (0)191 490 9373c/o Centre for Process Innovation Mobile: +44 (0)7826 902 204Gateshead International Business Centre Fax: +44 (0)191 490 9365Mulgrave Terrace, Gateshead, NE8 1AN www.nanoktn.com

The Nanotechnology Knowledge Transfer Network (NanoKTN) is one of the UK’s primary knowledge-based networks for micro and nanotechnologies and acts as a single point of access for overseas companies and academics wishing to fi nd UK partners for research and business.

The NanoKTN’s Directory is an online guidebook to the UK’s world-class MNT sector, featuring over 600 frontline academics and over 400 organisations active in nanotechnology in the UK.

The NanoKTN works closely with the 22 MNT Facilities across the UK, one of which is co-exhibiting with the NanoKTN at ENF2009 - NanoCentral.

NanoCentral, the alliance of leading companies created to unlock the commercial and societal potential of nanomaterials by:

• Forging industry wide collaborations across markets and supply chains • Providing you with access to key enabling technologies, facilities and expertise • Helping you to safely revitalise existing & develop new, nano-enabled, products

Veneto Nanotech

Veneto Nanotech ScpA Tel.: +39 049 7705500Via S. Crispino, 106 Fax +39 049 770555535129 Padova [email protected] www.venetonanotech.it

The Italian Cluster for nanotechnologies was built in 2002 in Veneto by Veneto Region, the Italian Ministry for University and Research (MiUR), Venetian Universities, local administrations and other public/private institutions, due to the presence of very strong scientifi c and research competences orientated towards industrial applications along with a high concentration of enterprises interested in nanotechnologies. Veneto Nanotech is the company devoted to promote process and product innovation as well as the creation high-tech companies. It aims at fostering and developing private investments in research and at supporting high-tech centres for the development of research projects and promotion of high-tech transfer.

Zeiss

Carl Zeiss NTS GmbH Phone: +49 (0)7364 / 20 4488Carl-Zeiss-Strasse 56 Fax: +49 (0)7364 / 20 434373447 Oberkochen Germany http://www.smt.zeiss.com/nts

Carl Zeiss SMT - Nano Technology Systems division (NTS) offers a broad range of systems based on its core competencies in electron- and particle-beam technology. Among these are scanning and transmission electron microscopes (SEM / TEM) with ultra-high resolution, complemented by CrossBeam® focused-ion beam technology designed for sub-surface 3D volumetric characterization and the new ORION™ Helium-Ion technology offering unrivalled opportunities for sub-nanometer imaging, depth-of-focus capabilities and new image contrast features.


321

Exhibition fl oorplan

Exhibition area fl oorplan

1 UK Nanotechnology2 ENVItech3 Palacky University4 RMI5 NanoMikro+Werkstoffe.NRW6 CSEM7 AIST-NT8 Institute of Nanotechnology9 DTIHK10,11 Nanotechnology in Bavaria12 Cordis

13 NMP14 Enterprise Europe Network15 Technology Centre ASCR16 Gimmune + DME17 MAGISTER18 IOLITEC19 Inno.CNT20 CARE-MAN21 Nanosurf + Anamet + Malvern22 Carl Zeiss SMT23 Veneto Nanotech

Exhibition Area - Stands

Industrial Poster Area

CESLAB, Elmarco, Explora, HVM Plasma, NanoMikro+Werkstoffe.NRW, Nanopharma


322

Venue fl oorplans

Floor 0

Floor 1


323

Venue fl oorplans

Floor 2

Floor 3


324

A-CFurther information A-Z

A

AccommodationIf you are looking for an accommodation in Prague - please contact our staff at the registration desk.

AirportPrague International airport handles fl ights from within Europe and from overseas. It is located 30-45 minutes by car from the centre of Prague. There are good connections between the airport and the city centre by public transport - buses and taxis.

Letiste Praha, a. s.Letiste Praha - Ruzyne, 160 08 Praha 6Tel.: +420 2 2011 1111, +420 2 9666 1111Fax: +420 2 3535 0922

AFTN: LKPRYDYXSITA: PRGCZ7X, PRVCZ7X

http://www.prg.aero

Arrival by public transportPrague has a very sophisticated underground, tram and bus transportation system. The Prague underground is quite new and effi cient. During the peak hours, trains runs every 1 or 2 minutes, and during off-peak hours at least every 10 minutes. For more information about Prague public transportation visit www.dpp.cz.

B

BadgesA long with your registration, you will receive your badge. Name badge must be worn when attending the sessions and offi cial dinner. Admittance to the sessions and dinner without badge is not possible. Only full participants may attend the session.

C

Cash pointsKomercni Banka cash point is located right between the entrances No. 5 and 6. Ceska sporitelna cash point is located right next to the underground station Vysehrad entrance.

Komercni banka Ceska sporitelnaPrague Congress Centre Na Pankráci 127, 14000 Praha 45. kvetna 65, 140 00 Praha 4 Vysehrad underground station Availability 24 hours Availability 24 hoursLowest value - bank note 500 CZK Lowest value - bank note 200 CZK

wheelchair access


325

C-DFurther information A-Z

C

Certifi cate of attendanceCertifi cate of attendance will be hand over to each participant at the registration desk from Thursday June 4, 2009.

City mapsAlong with your conference documents you will receive a city map together with other brochures about Prague. Further information is available at the info counter on the fi rst fl oor at the registration.

Cloak roomA cloak room is located in the ground fl oor, it is free of charge to all registered participants. Opening hours are as follows:

June 2, 2009 8:00 - 22:00June 3, 2009 7:30 - 19:00 June 4, 2009 7:30 - 19:00June 5, 2009 8:00 - 14:00

Conference languageThe conference language is English no translation is to be provided.

Currency/ExchangeThe Czech currency is called the Czech crown (CZK). Its circulation is in the form of banknotes of the following value: 5,000, 2,000, 1,000, 500, 200, 100 and 50 crowns and coins of the following value: 50, 20, 10, 5, 2, 1 crowns. Exchange offi ces are located all around the city centre (exchange offi ces, banks, post offi ces).

ALL RATES given in the program are in EUROS (€).

D

Doctor / First AidBudejovicka clinic is located at the station Budejovicka - 3 underground stations from the station Vysehrad (the location of the venue).

MEDICON a.s. - Poliklinika Budejovicka (Budejovicka clinic)Antala Staska 1670/80, 140 46 Praha 4Tel.: +420 261 006 111, fax: +420 261 006 210E-mail: [email protected], http://www.mediconas.cz

Emergency medical service at the Prague Congress Centre is available. If necessary please contact registration staff.

Tel.: +420 261 177 010


326

E-GFurther information A-Z

E

ElectricityElectricity used in the Czech Republic is 220 Volts; standard European system of round pins with two holes. Plan to bring a transformer for your electrical or electronic equipment using different voltage (ie. USA, Canada).

Emergency callPolice 158Fire Department 150Medical Service 155

ExhibitorsAll exhibitors are listed in the exhibition catalogue (see pages 31-42).All related information in regards to exhibition was provided directly to the exhibitors.

Exhibition openingThe opening of exhibition will take place on Tuesday June 2, 2009 - from 15:00, foyer Floor 2.

Evaluation formTo assist in the improvement of the conference, please complete the evaluation form will be available on the conference website after the conference.

F

Food and beveragesCoffee-breaks and lunches are included in the registration fee. Vegetarian lunchboxes are marked. Lunch box will be distributed upon valid voucher.

G

Guided toursFor all questions regarding tours please refer to the tour desk at the registration in the Floor 1.Meeting point for all tours is at the registration - 15 minutes before departure.


327

H-MFurther information A-Z

H

HealthcareWhen travelling around the Czech Republic you might need medical assistance. You can be sure you will be treated with high European standards. However, we strongly recommend arranging travel insurance before leaving your country. If any assistance is needed please contact our registration staff.

I

InformationAt any time information is available at the info point on the Floor 1 of the Prague Congress Centre.

Insurance and LiabilityThe Organizers will accept no liability for personal injuries sustained by or for loss or damage to property belonging to Conference participants, accompanying persons either during or as a result of the Congress or during all tours and events. Participants are strongly recommended to seek insurance coverage for health and accident, lost luggage and trip cancellation.

InternetInternet corner is available at the poster area in the Floor 2 during the programme times.

L

Lost & FoundA lost and found service is available at the information desk at the registration.

M

MessagesA message board will be located in the registration area. You can post your messages here.

Mobile PhonesParticipants are kindly requested to keep their mobile phones in the off position in the meeting rooms while sessions being held.


328

PFurther information A-Z

P

ParkingParticipants arriving by car are advised to use the underground parking space, which is available in the Prague Congress Centre. Parking fees are not included in the registration fee.

ParticipantsA complete list of participants is included in the conference documents. Participants registered after May 22, 2009 are not included in the printed list.

PharmacyNearest pharmacy is located in the shopping centre Arkady Pankrac - 2 underground stations from the Vysehrad station (venue location)Shopping Centre Arkady Pankrac - ground fl oorHvezdova 2860/24, Praha 4 - PankracTel./Fax: +420 225 111 211, +420 225 111 212 Opening hours: Monday - Sunday 9:00 - 21:00

PostersPoster area is placed in the foyer at the Floor 2. All authors of poster abstracts received a poster guidelines with assigned poster number. Please mount your poster to the assigned poster board (marked by your number). Posters are to be placed from June 2 - June 5, 2009. In case any assistance is needed please ask the hostess at the poster desk in the poster area.

Poster area opening hoursJune 2, 2009 08:00 - 22:00 (08:00 - 15:30 mounting)June 3, 2009 08:00 - 19:00 June 4, 2009 08:00 - 19:00June 5, 2009 08:00 - 13:00 (13:00 - 15:00 dismantling)

All poster abstract are printed in the Proceedings.Voting tickets for ‘Best poster’ competition will be available at the registration - Floor 1. Please submit fi lled tickets to the staff at the poster desk.All poster presenters should be present at the Poster area on June 2 and June 4 (15:30 - 16:30).

Prague Information ServiceAll information about Prague can be required at:

Tel.: + 420 221 714 444http://www.pis.cz/en

Either you can ask our staff at the information counter at the Floor 2 at the registration.

Presentation submissonPower Point presentations only (CD, USB stick) may be used. In the lecture rooms a video projector and laptop will be at your disposal. Personal laptops are not permitted. Please take your presentation to the Speakers preview room no later than 120 minutes prior to your lecture and approach the media technician. All authors were provided by presentation guidelines directly before the conference.


329

P-RFurther information A-Z

P

PressAt any time information is available at press counter at the registration in the Floor 1.

Press conference room is located in room 1.1. at the fi rst fl oor.Press working room is located in room 1.2 at the fi rst fl oor.

For furter information please contact:Mrs. Radka Zakova at +420 777 093 290

Programme ChangesThe organizers cannot assume liability for any changes in the programme due to the external or unforeseen circumstances.

R

RegistrationPlease register at the registration counters on the Floor 1 of the PCC, where a hostess will assist you with the online registration. Based on your confi rmation of registration you will receive a conference bag along with the name badge and assorted documents. If you are preregistered via online system, please make sure to take your confi rmation of registration if any confusion appears.

Onsite registrations can be done using an onsite registration form available at the registration.Participants onsite fee 390 EURStudent reduced onsite fee 170 EUR Please note that you have to proof your student status by a confi rmation from the institution. Please note the onsite student fee only applies for those who have accepted abstract.

Conference documents and bags cannot be guaranteed for those participants registering onsite.

In case your payment was not recognized or did not reach us until May 22, 2009 copy of bank transfers will not be considered as a proof of payment. Therefore you will be asked to pay an onsite registration. All double payment will be reimbursed after the conference.

Cancellation policy / Name changesAll onsite cancellations (not communicated before to the secretariat) will automatically lead into 100% cancellations. Name changes not communicated before will be treated as a new registration.

Registration fee includes- Admission to all sessions, poster area and industrial exhibition- Admission to opening Welcome Reception and Offi cial dinner- Conference documents in the Conference bag - Proceedings, Final Programme, Pocket Programme, City map, List of participants,

Evaluation Form - Name badge + vouchers for day lunches and tours if required and paid - Coffee breaks and lunches

Accompanying fee includes- Admission to welcome reception and Offi cial dinner- Guided tour on Thursday June 4, 2009 13:00-17:00 - Grand tour of PraguePlease note that accompanying persons are not allowed in the sessions and in the exhibition area.

Opening hoursJune 2, 2009 7:30 - 22:00June 3, 2009 8:00 - 19:00 June 4, 2009 8:00 - 19:00June 5, 2009 8:00 - 13:00


330

S-TFurther information A-Z

S

SafetyPrague is among the most popular destinations in the world. Statistics show that when compared to other major European cities like Paris, Rome or Madrid the rate of crime is much lower in Prague. A night walk around the city is relatively safe but, of course, like in all other big cities with a high culmination of people we recommend handling your personal belongings with utmost care.

Smoking policyFor the comfort and health of all participants, smoking is not permitted at any conference premises. This includes sessions, workshops, other meetings, meal premises and also registration areas and foyers.

Speakers preview roomIs located in the Meeting hall 3 in the Floor 2. Please make sure to hand in your presentation at least 120 minutes prior to the start of your assigned session. Our staff in the speakers preview room will be happy to assist you.

T

TaxiIn the city centre taxis are easy to hail from the street but we strongly recommend that you use hotel taxis or obtain taxis by phone through the radio taxi service e.g. AAA (+ 420 14 014), City taxi (+420 257 257 257) or Speed cars (+420 224 234 234). Registration staff will be happy to assist you with taxi service at the PCC.

Boarding charge approximately 30 CZKJourneys within the city approximately 28 CZK/kmWaiting time approximately 10 CZK/per minute

TemperaturePrague is a city with a mixture of oceanic and continental weather, average summer temperature is 20 degrees C.

Time DifferenceThe Czech Republic is in Central European Time Zone. Central European Time (CET) is 1 hour ahead of Greenwich Mean Time (GMT+1). After the last Sunday in March the time in the Czech Republic is shifted back by 1 hour to Central European Time and this lasts until the end of September.

TippingService is usually included in the bill in bars and restaurants but tips are welcome. If you consider the service good enough to warrant a tip, suggested level is around 10%.


331

VFurther information A-Z

V

VATThe Czech legislation requires that all congress costs include the Czech VAT. In case the VAT rate changes, the change will automatically be applied to the service ordered.

VenuePrague Congress Centre5 kvetna 65140 21 Prague 4Czech Republic

The Prague Congress Centre is located in a unique position on the top of one of Prague hills, offering a beautiful view of the famous skyline of Prague, with the silhouette of the Prague Castle. Only two underground stops from the downtown. (Line C, stop Vysehrad).

Z

Zofi n Palace locationZofi n Palace is the selected venue for the Offi cial conference dinner.

Address:Slovansky ostrov 226, 110 00 Prague 1

Transfers from Prague Congress Centre are arranged. You can as well use the tram (9, 17, 22, 23) to station Narodni divadlo (highlighted in the map bellow).


332

Notes


333

Notes


How to obtain EU publicationsPublications for sale:• via EU Bookshop (http://bookshop.europa.eu);• from your bookseller by quoting the title, publisher and/or ISBN number;• by contacting one of our sales agents directly. You can obtain their contact details on the Internet (http://bookshop.europa.eu) or by sending a fax to +352 2929-42758.

Free publications:• via EU Bookshop (http://bookshop.europa.eu);• at the European Commission’s representations or delegations. You can obtain their contact details on the Internet (http://ec.europa.eu) or by sending a fax to +352 2929-42758.


Interested in European research?

Research*eu is our monthly magazine keeping you in touch with main developments (results, programmes, events, etc.). It is available in English, French, German and Spanish. A free sample copy or free subscription can be obtained from:

European Commission Directorate-General for ResearchCommunication UnitB-1049 BrusselsFax (32-2) 29-58220E-mail: [email protected]: http://ec.europa.eu/research/research-eu

EUROPEAN COMMISSION

Directorate-General for ResearchDirectorate G - Industrial TechnologiesUnit G.4 - Nano- and converging Sciences and Technologies

Contact: Dr Christos Tokamanis, Dr Sophia Fantechi

Email:

[email protected]

[email protected]

Internet: http://cordis.europa.eu/nanotechnology

European Commission

EUR 23733 - EuroNanoForum 2009

Luxembourg: Offi ce for Offi cial Publications of the European Communities

2009 — 334 pp. — 21.0 x 29.7 cm

ISBN 978-92-79-12973-5DOI 10.2777/38933

euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-cover-04.indd 2euronanoforum2009-proceedings-plus-final-programme-and-exhibitors-cover-04.indd 2 16.10.2009 10:30:2916.10.2009 10:30:29

interested in european research? · 2015-08-11 · interested in european research? research*eu is...

Documents