interleukin-23–expressing bone marrow–derived neural …intracranial tumor-bearing mice with...

Interleukin-23–Expressing Bone Marrow–Derived Neural Stem-Like

Cells Exhibit Antitumor Activity against Intracranial Glioma

Xiangpeng Yuan,1Jinwei Hu,

1Maria L. Belladonna,

2Keith L. Black,

1and John S. Yu

1

1Maxine Dunitz Neurosurgical Institute, Cedars-Sinai Medical Center, Los Angeles, California and 2Department of Experimental Medicine,University of Perugia, Perugia, Italy

Abstract

Neural progenitor-like cells have been isolated from bonemarrow and the cells have the ability of tracking intracranialtumor. However, the capacity of the cells to deliver moleculesfor activating immune response against intracranial tumorand the identity of cellular and molecular factors that areinvolved in such immune responses have yet to be elucidated.Here, we isolated neural stem-like cells from the bone marrowof adult mice. The isolated cells were capable of producingprogenies of three lineages, neurons, astrocytes, and oligoden-drocytes, in vitro and tracking glioma in vivo. By geneticallymanipulating bone marrow–derived neural stem-like cells(BM-NSC) to express a recently discovered cytokine, interleu-kin (IL)-23, the cells showed protective effects in intracranialtumor-bearing C57BL/6 mice. Depletion of subpopulationlymphocytes showed that CD8+ T cells were critical for theantitumor immunity of IL-23–expressing BM-NSCs and thatCD4+ T cells and natural killer (NK) cells participated in theactivity. Furthermore, the IL-23–expressing BM-NSC-treatedsurvivors were resistant to the same tumor rechallengeassociated with enhanced IFN-;, but not IL-17, expression inthe brain tissue. Taken together, these data suggest that IL-23–expressing BM-NSCs can effectively induce antitumor immu-nity against intracranial gliomas. CD8+ T cells are criticalfor such antitumor activity; in addition, CD4+ T cells and NKcells are also involved. (Cancer Res 2006; 66(5): 2630-8)

Introduction

Malignant gliomas represent a significant cause of tumor-relatedmortality and continue to be associated with poor prognosisdespite extensive surgical excision and adjuvant radiotherapy andchemotherapy (1, 2). Their resistance to treatment is related tothe tumor cell’s exceptional migratory nature and ability to growextensively into normal neural tissue away from the main tumormass. These cells preclude complete surgical resection andeventually serve as a source for recurrent tumor growth. It is thischaracteristic that also makes it difficult for otherwise promisinggene therapeutic strategies and other local interventions toefficiently access the tumor cells (3). Recent evidence indicated anew strategy for targeting tumor cells within the central nervoussystem by using neural stem cells to deliver therapeutic gene and/or their products efficiently to treat brain tumors (4–6).Bone marrow represents an attractive source for generating

neural stem cells, which have an advantage over fetal neural stem

cells, or allogeneic cell lines as a cellular vehicle for brain tumortherapy because of their autologous characteristic. The bonemarrow–derived neural stem cells obviate the accessibility andethical problems associated with fetal neural stem cells as well aspotential immunologic incompatibility due to the requirement forallogeneic application (7–13). In the present study, we sought toisolate neural stem cells from murine bone marrow as a cellularvehicle for glioma therapy. Using bone marrow–derived neuralstem-like cells (BM-NSC) as a vehicle, we studied the antigliomafunction of a newly discovered cytokine, interleukin (IL)-23, whichconsists of a heterodimer of IL-12 p40 subunit and a novel protein,p19. It has been shown that IL-23 acts on memory T cells anddendritic cells directly to promote IL-12 and IFN-g productionin vitro (14, 15). Recently, IL-23–expressing tumor cell showedantitumor and antimetastatic function (16). We showed that neuralstem-like cells can be generated from adult bone marrow and thegenerated BM-NSCs can track migratory glioma cells and deliverIL-23 in situ . IL-23–expressing BM-NSCs when injected into brainare able to induce tumor-specific antitumor activity and protectiveimmunity against intracranial glioma.

Materials and Methods

Cell Cultures and Cell LinesWhole bone marrow was harvested from the femurs of adult C57BL/6

mice as described previously (11). Cells were plated on poly-D-lysine–coated24-well plates (BD Biosciences, San Jose, CA) and cultured in serum-free

DMEM/F-12 (Invitrogen, Gaithersburg, MD) supplemented with B27

(Invitrogen), 20 ng/mL basic fibroblast growth factor (Peprotech, Rocky

Hill, NJ), and 20 ng/mL epidermal growth factor (Peprotech) along withantibiotics. The cells were plated at a density of 1 � 106 per well. Fetal

neural stem cells were harvested from the frontoparietal regions of day 15

fetal C57BL/6 mice as described previously (17). The cells were grown in

culture under the same conditions as mentioned above. Spheres, formed inboth bone marrow cell and fetal neural stem cell culture, were processed

for immunocytochemistry staining. Bone marrow–derived spheres were

subjected to cell differentiation by plating onto laminin-coated 24-wellplates in growth medium devoid of growth factors containing retinoic acid

(1 Amol/L, Sigma, St. Louis, MO) and dibutyryl cyclic AMP (1 mmol/L,

Sigma). Medium was replenished every 3 days. Cells were differentiated for

7 to 14 days and processed for immunocytochemistry staining.NIH-3T3 cells (murine fibroblasts) and GL26 cells (murine glioma) were

grown in DMEM and RPMI 1640, respectively, supplemented with 10%

fetal bovine serum, 2 mmol/L L-glutamine, and antibiotics (all the reagents

from Invitrogen). Green fluorescent protein (GFP)–expressing GL26 cellswere derived from stable transfection of GL26 cells with pEGFP-N1 vector

(BD Biosciences) by calcium phosphate precipitation method as described

previously (18). The stable transfectants were selected with geneticin.

Adenoviral Vectors Construction and In vitro InfectionThe viral vector bearing the gene for murine IL-"23 (AdIL-23) was

constructed by subcloning the single-chain IL-23 cDNA (15) into a shuttle

vector pMH5 (Microbix Biosystems, Inc., Toronto, Ontario, Canada) down-

stream of the mCMV promoter. The resultant shuttle vector was

Note: X. Yuan and J. Hu contributed equally to this work.Requests for reprints: John S. Yu, Maxine Dunitz Neurosurgical Institute, Cedars-

Sinai Medical Center, Suite 800 East, 8631 W. 3rd Street, Los Angeles, CA 90048. Phone:310-423-0845; E-mail: [email protected].

I2006 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-05-1682

Cancer Res 2006; 66: (5). March 1, 2006 2630 www.aacrjournals.org

Research Article

Research. on May 20, 2020. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from Research.

on May 20, 2020. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from Research.

on May 20, 2020. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/



cotransfected with pBHGE3 (Microbix Biosystems) into 293 cells (MicrobixBiosystems). Recombinants were subsequently subjected to three rounds of

plaque purifications. The purified viral vector was clarified by Southern

hybridization and immunocytochemistry to confirm the bearing of IL-23

expression cassette within the vector genome and the expression of IL-23from the vector transduced cells, respectively.3 The viral vectors bearing the

gene for LacZ (AdLacZ) or a 2.4-kb noncoding stuffer DNA (AdEmpty) were

constructed the same way as AdIL-23. The construction of IL-12-bearing

vector (AdIL-12) was described previously (6). For in vitro genetransduction, BM-NSCs, fetal neural stem cells, and NIH-3T3 cells were

infected with 100 multiplicities of infection of AdIL-23, AdEmpty, AdLacZ,

and AdIL-12 as indicated. Twenty-four hours after infection, the cells were

washed thrice with PBS to ensure that final intracranial injections orin vitro analysis were devoid of free viral particles. NIH-3T3 cells were

treated by either mitomycin C (25 mg/mL, Sigma) or irradiation (5,000 rads)

to induce growth arrest.

Animal Studies In vivoIntracranial tumor implantation. C57BL/6 wild-type mice, athymic

nude mice, and CD4 T-cell knockout mice (6-8 weeks old, all from The

Jackson Laboratory, Bar Harbor, ME) were anesthetized with i.p. ketamine

and medetomidine and stereotactically implanted with 1 � 104 GL26 cells

or GFP-expressing GL26 glioma cells in 2.5 AL of 1.2% methylcellulose/PBSin the right striatum as described previously (6).

BM-NSC migration and transgene delivery. To determine whether

BM-NSCs were able to track glioma cells, deliver transgenes to tumortargets, and generate progenies of different phenotype, AdLacZ and AdIL-23

infected BM-NSCs (2 � 105 cells) were peritumorally (1 mm lateral and 3

mm behind the tumor implantation site) and intratumorally (at the tumor

implantation site) injected into the brain with a 7-day established glioma.Animals were euthanized on days 12, 24, 28, and 42 after the BM-NSC

injection by intracordic perfusion-fixation with 4% paraformaldehyde.

Animal brains were cut into 40-Am coral sections and processed for

immunohistochemistry staining.Animal survival and brain tissue evaluation. For C57BL/6 mice

survival experiments, the intracranial glioma-bearing mice were randomly

divided into four groups 3 days after tumor implantation and treated withintratumoral injections of saline (3 AL, n = 12), 2 � 105 BM-NSCs infected

with either AdEmpty (BM-NSC-E, n = 18) or AdIL-23 (BM-NSC-IL-23, n =

17), or NIH-3T3 cells infected with AdIL-23 (NIH-3T3-IL-23, n = 20) in 3 ALserum-free medium. Animals used for histologic evaluation were treatedsimilarly to the survival experiment and euthanized 4 weeks after the BM-

NSC injections by intracordic perfusion-fixation as mentioned above.

Depletion of CD4+ and CD8+ T cells and natural killer cells. Fordepletion with monoclonal antibodies (mAb), each mouse was injected i.p.with 0.5 mg rat anti-mouse CD8 (53-6.7) and anti-CD4 (GK1.5, both from

American Type Culture Collection, Manassas, VA) mAb or normal rat IgG as

control antibody in 200 AL PBS 1 day before tumor implantation, once dailyfor the following 3 consecutive days and then twice weekly. Natural killer

(NK) cells were depleted by i.p. injection of 20 AL rabbit anti–asialo GM1

antiserum (Wako Chemicals, Richmond, VA) or normal rabbit serum as

control using the same schedule as above. Intracranial tumor-bearing micewith specific cell population depletion and CD4 T-cell knockout mice with

intracranial tumor implantation were treated with either BM-NSC-IL-23 or

BM-NSC-E and were followed for survival.

Animal rechallenge. C57BL/6 wild-type mice that survived intracranialtumor implantation due to BM-NSC-IL-23 treatment were rechallenged

with GL26 cells or GL26 cells plus either BM-NSC-IL-23 or BM-NSC-E.

Age-matched naive mice were challenged as control. After the rechallenge/

challenge, animals were followed for survival. Some animals were euthanizedon days 1, 3, 5, 7, 10, and 14 after the rechallenge/challenge for reverse

transcription PCR (RT-PCR) analysis of the brain tissues. All of the animals

used were done in strict accordance with Institutional Animal Care and UseCommittee guidelines in force at Cedars-Sinai Medical Center.

ELISA and RT-PCRSupernatants from BM-NSCs and fetal neural stem cells, which were

infected with AdEmpty, AdIL-12, or AdIL-23 for 24 hours, were analyzed by a

sandwich ELISA specific for p40 as described previously (15). The cell pellets

were subjected to total RNA extraction with a RNeasy Mini kit (Qiagen,Valencia, CA). Brain tissues from the rechallenged/challenged animals as

described above were subjected to total RNA extraction with a RNeasy Lipid

Tissue Mini kit (Qiagen). The RNA was reverse transcripted by using a

Bioscript kit (Bioline, Randolph, MA) and oligo(dT)12-18 primer (Invitrogen).The PCR was carried out in a 20 AL reaction mixture that contained 1 ALcDNA as template, specific oligonucleotide primer pairs (Table 1), and

Accuzyme (Bioline). Each specific gene was concurrently amplified with

internal control h-actin in the same reaction tube as described previously(19). The amplified products were identified by agarose gel electrophoresis

and ethidium bromide staining.

Relative Quantitative Real-Time PCRTotal RNA isolation and cDNA preparation were done as described

above. Detection of IFN-g mRNA level was done by a real-time PCR assayusing the iCycler iQ system (Bio-Rad Laboratories, Hercules, CA). A 12.5

AL reaction mixture containing 1 AL cDNA and 200 nmol/L of each

primer was mixed with 12.5 AL of 2� iQ SYBR Green Supermix (Bio-Rad

Laboratories). The reaction conditions were designed as follows: 95jC for3 minutes to activate the iTaq DNA polymerase followed by 40 cycles with

30 seconds at 95jC and 30 seconds at 60jC. PCR amplification of the

endogenous h-actin was done for each sample to control for sampleloading and to allow normalization between samples. The threshold cycle

(Ct; the cycle number at which the amount of amplified gene of interest

reached a fixed threshold) was determined subsequently. Each data point

was examined for integrity by analysis of the amplification plot anddisassociation curves. All amplifications were conducted in triplicates. The

relative quantitation of IFN-g mRNA expression was calculated by the

comparative Ct method. The relative quantitation value of target, norma-

lized to endogenous control h-actin and relative to a calibrator, is calcu-lated as follow: fold increased = 2�[DCt (survived animal) � DCt (naive animal)],

where DCt = Ct (IFN-g) � Ct (h-actin).

Cytotoxicity AssaysSpleen cells were harvested from each mouse. The harvested cells

(5 � 106/mL) were restimulated in vitro by coculture with mitomycinC–treated GL26 cells (5 � 105/mL) for 5 days and used as effector cells in a

lactate dehydrogenase release assay. GL26 parental tumor cells or p815 cells

(1 � 104/well) and serial dilutions of effector cells were incubated in a

96-well U-bottomed plate at 37jC for 5 hours. Supernatants then wereanalyzed with a cytotoxicity detection kit (Roche Applied Science,

Indianapolis, IN) according to the manufacturer’s instructions. Results

were expressed as the percentage of specific lysis.

H&E, Luxol Fast Blue, and Immunohistochemistry Stainingof Brain SectionsThe perfusion-fixed brains were cut into 10-Am coronal sections

and stained with either H&E or luxol fast blue as per standard protocol.

3 X. Yuan et al., unpublished data.

Table 1. Oligonucleotides for PCR

mRNA

targets

Oligonucleotides (5V!3V) Product

size (bp)

p19 Forward: CAGCAGCTCTCTCGGAATCT 361

Reverse: TAGAACTCAGGCTGGGCATC

IFN-g Forward: GGCTGTTTCTGGCTGTTACTG 427

Reverse: GAATCAGCAGCGACTCCTTTIL-17 Forward: TCTCTGATGCTGTTGCTGCT 408

Reverse: CACACCCACCAGCATCTTCT

h-actin Forward: GGACTCCTATGTGGGTGACG 293Reverse: TACGACCAGAGGCATACAGG

IL-23–Expressing Neural Stem Cell Antiglioma

www.aacrjournals.org 2631 Cancer Res 2006; 66: (5). March 1, 2006

Research. on May 20, 2020. © 2006 American Association for Cancercancerres.aacrjournals.org Downloaded from


To characterize the brain tissue by immunohistochemistry, free-floating40-Am sections were treated with 10% donkey serum (Sigma) for 30 minutes

at room temperature and then stained with primary antibodies for anti-

h-galactosidase protein (mouse mAb, 1:1,000, Promega, Madison, WI),

anti-p40 subunit of murine IL-23 (mouse mAb, 1:50, BD Biosciences), anti–h-tubulin III (TuJ1, mouse mAb, 1:200, Chemicon, Temecula, CA), anti–glial

fibrillary acidic protein (GFAP; rabbit polyclonal, 1:1,000, Chemicon), anti-

myelin/oligodendrocyte (mouse mAb, 1:1,000, Chemicon), anti-F4/80 (rat

mAb, 1:50, Serotec, Raleigh, NC), anti-CD4 (rat mAb, 1:50, BD Biosciences),anti-CD8 (rat mAb, 1:100, BD Biosciences), and isotype control antibodies.

The primary antibodies were detected with either Texas red–conjugated

donkey anti-mouse, anti-rat IgG (1:200, The Jackson Laboratory) before

mounting the sections or Vector Elite ABC kit (Vector Laboratories,Burlingame, CA) and developed with diaminobenzidine (Sigma) and

counterstained with hematoxylin before mounting the sections.

Results

Neural stem-like cells can be generated from adult mousebone marrow. We harvested adult mouse whole bone marrow cellsand cultured the cells under the conditions described previously thatare permissive for neural stem cells (11, 20). Free floating sphereswere formed after 8 to 12 days of culture. These bone marrow–derived spheres were morphologically indistinguishable from theneurospheres of fetal brain neural stem cells and were stainedpositive for the neural stem cell marker, nestin (Fig. 1A). Upon beingswitched into differentiation conditions (11), the spheres attachedand spread out. After 7 to 14 days of in vitro differentiation, weanalyzed the culture for cells expressing neural and glial markers.TuJ1-positive (neuron-specific h-tubulin III), GFAP-positive (astro-cyte marker), and myelin/oligodendrocyte-positive (oligodendrocytemarker) cells were clearly identified in the differentiated progenies ofthe bone marrow–derived spheres (Fig. 1B).BM-NSCs can track intracranial tumors and express trans-

gene both in vitro and in vivo. We sought to determine whetherbone marrow–derived sphere cells have migratory propertiessimilar to that of fetal neural stem cells (4–6). To investigate theirability to migrate toward intracranial gliomas, the bone marrow–derived sphere cells were transduced with AdLacZ and injectedintratumorally or peritumorally (at a site distant from the tumorbed) into mouse brain harboring an established glioma. TheAdLacZ transduced cells migrated into the tumor mass (Fig. 2A, a)or tumor ‘‘satellite,’’ which was away from the main tumor mass(Fig. 2A, b). Some h-galactosidase-positive cells were seen inimmediate proximity to and intermixed with invading tumor‘‘islands’’ (Fig. 2A, c, arrow). Based on the above characteristics, thesphere cells were named BM-NSCs. To test the ability to expresstransgenes, the BM-NSCs were transduced with adenoviral vectorscarrying either stuffer DNA, IL-12, or single-chain IL-23. In parallel,fetal neural stem cells were also transduced as controls. After24 hours, the transduced cells and conditioned medium wereharvested for mRNA analysis and protein assay, respectively. Onesubunit of IL-23, p19, was detected as mRNA in both BM-NSC andfetal neural stem cell lysate by RT-PCR (Fig. 2B, a). Another subunitof IL-23 and of IL-12, p40, was detected in the protein format byELISA in the conditioned medium (Fig. 2B, b). The mRNA of p19and the protein of p40 were similarly expressed by both BM-NSCsand fetal neural stem cells after the adenoviral vectors transduc-tion. To test their ability to delivery transgene in vivo , the BM-NSCstransduced with AdIL-23 were injected into tumor-bearing micebrain. The p40 expression was detected both in and around thetumor mass (Fig. 2C). To examine the phenotype of BM-NSCs afterintracranial implantation, brain sections were double stained with

anti-h-galactosidase or anti-p40 antibodies together with celltype–specific markers. The implanted cells were differentiated intopositive staining of TuJ1, myelin/oligodendrocyte, or GFAP. Therewere no F4/80 (specific for macrophage)–positive cells noted(Fig. 3). Taken together, these data suggest that BM-NSCs have theability to track glioma cells in vivo , to express transgenes bothin vitro and in vivo after transduction with adenoviral vectors,and to differentiate into the neural cell types of the central nervoussystem.Intracranial tumor-bearing C57BL/6 mice show prolonged

survival after IL-23–expressing BM-NSC treatment. To deter-mine whether the IL-23–expressing BM-NSCs provided a thera-peutic benefit for brain tumor, we delivered BM-NSCs transducedwith AdIL-23 or AdEmpty or delivered NIH-3T3 cells transducedwith AdIL-23 into established intracranial gliomas in C57BL/6mice. BM-NSC-IL-23–treated mice showed significantly prolongedsurvival compared with mice treated by BM-NSC-E (Fig. 4A).Approximately 60% of the BM-NSC-IL-23–treated mice survivedbeyond day 120 with tumor-free condition, which was verifiedby histology staining of the brain sections. Only 20% of the NIH-3T3-IL-23–treated mice survived. BM-NSC-E treatment was notprotective and had the same ‘‘effect’’ as the saline controltreatment. Statistical analysis revealed that the effects of bothBM-NSC-IL-23 and NIH-3T3-IL-23 were significantly different fromthat of the BM-NSC-E (P < 0.001, BM-NSC-IL-23 versus BM-NSC-E;P = 0.0018, NIH-3T3-IL-23 versus BM-NSC-E, log rank). There wasalso a significant difference in effect between BM-NSC-IL-23 andNIH-3T3-IL-23 (P = 0.0310, log rank).Based on the known ability of IL-23 to induce proliferation of

memory T cells, we sought to assess whether the BM-NSC-IL-23treatment could induce enhanced intratumoral T-cell infiltration.Stained by immunohistochemistry, brain tumors from the micetreated with BM-NSC-IL-23 showed robust infiltration of CD8+ andCD4+ T cells (Fig. 4B, a, b, d , and e). There was negligible CD8+ andCD4+ T-cell infiltration, however, within tumors from mice treated

Figure 1. Generation of neural stem-like cells from adult mouse bone marrow.A, neurospheres were formed within the culture of adult mouse bone marrowcells (a). The formed spheres were self-renewing in the free-floating pattern (b),morphologically indistinguishable from the neurospheres of fetal neural stemcells (c ), and expressed a similar pattern of nestin (d) as that expressedby fetal neural stem cells (e ). B, bone marrow–derived spheres were ableto differentiate into h-tubulin III–expressing neurons (a), GFAP-expressingastrocytes (b), and myelin/oligodendrocyte marker–expressing oligodendrocytes(c ). Bar, 50 Am.

Cancer Research




with BM-NSC-E (Fig. 4B, c and f ). The NIH-3T3-IL-23 treatmentalso resulted in intratumoral T-cell infiltration, but the intensityof that infiltration was significantly lower than that seen in theBM-NSC-IL-23–treated tumors (data not shown). Analyzing thebrains that were treated with transduced BM-NSCs revealed thatthere was no morphologic difference between BM-NSC-IL-23– andBM-NSC-E–treated mice after either luxol fast blue staining, whichwas used to identify neural demyelination, or H&E staining. Bothgroups of treated mice showed a similar staining pattern of brain

tissue compared with that of naive control mice (Fig. 4C). Thesedata indicated that IL-23–expressing BM-NSCs have a strongprotective effect against intracranial tumor and that there is nodeleterious effect with morphology significance associated withIL-23–expressing BM-NSCs.Involvement of tumor-specific CTL and CD8+ and CD4+

T cells in the antitumor activity of IL-23–expressing BM-NSCs.To examine whether a tumor-specific immunity was involved in theprotective activity of IL-23–expressing BM-NSCs, mice thatsurvived intracranial tumor implantation for 12 weeks after BM-NSC-IL-23 treatment and age-matched naive mice were subjectedto CTL activity assay. CTL activity against parental tumor GL26 butnot irrelevant tumor p815 was augmented in spleen cells, whichwere obtained from mice that survived intracranial tumorimplantation after BM-NSC-IL-23 treatment and were restimulatedin vitro with mitomycin C–treated GL26 for 5 days (Fig. 5A, a). Todetermine whether IL-23 mainly contributed to this CTL activity,spleen cells from brain tumor-bearing mice treated with either BM-NSC-IL-23 or BM-NSC-E were analyzed 4 weeks after treatment. Asshown in Fig. 5A , GL26-specific CTL activity was detected only inBM-NSC-IL-23–treated mice. To examine the involvement ofparticular lymphocytes in the BM-NSC-IL-23–induced antitumoractivity, depleting anti-CD4 or anti-CD8 mAb were injected beforeand after BM-NSC-IL-23 treatment. Normal rat IgG at the samedose and schedule was included as control. Flow cytometryshowed that the injection of mAb depleted the appropriate cellpopulation by 95% (data not shown). Depletion of CD8+ T cellsgreatly impaired the protective effect of BM-NSC-IL-23 inintracranial tumor-bearing mice (P = 0.0010, CD8 depletion versuswild type, log rank). There was no long-term survival observedin the CD8+ T-cell–depleted mice (Fig. 5B). Similarly but lesssignificantly, the impairment of the protective effect was alsoobserved in the CD4+ T-cell–depleted mice (P = 0.0097, CD4depletion versus wild type, log rank). When compared with BM-NSC-E, BM-NSC-IL-23 showed different protective activity on CD8+

versus CD4+ T-cell–depleted mice (Fig. 5B). In addition, on CD4+ T-cell knockout transgenic mice BM-NSC-IL-23 produced an effectcomparable with that of produced on the CD4+ T-cell–depletedwild-type mice (data not shown). These data suggest that BM-NSC-mediated IL-23 delivery induces a potent tumor-specific protectiveimmunity, that CD8+ T cells play critical role in the antitumoractivity of BM-NSC-IL-23, and that CD4+ T cells are also involved inthe process.NK cells are involved in the antitumor immunity induced by

IL-23–expressing BM-NSCs. To examine the involvement of NKcells in the antitumor activity induced by BM-NSC-IL-23, the firstseries of experiments were carried out with athymic nude mice,in which T lymphocytes are absent. As shown in Fig. 6, no micesurvived the intracranial GL26 glioma after either BM-NSC-IL-23 orBM-NSC-E treatment. However, there was a significant differencein survival time between the two treatments (P = 0.0195, log rank).A longer survival rate was observed in mice treated with BM-NSC-IL-23 compared with those treated with BM-NSC-E (Fig. 6A).Furthermore, after depleting NK cells in the athymic mice byinjecting an anti–asialo GM1 antibody, no significant difference(P = 0.8801, log rank) in the survival rate between BM-NSC-IL-23and BM-NSC-E treatments was observed (Fig. 6B). In C57BL/6wild-type mice, anti–asialo GM1 antibody injection, which depletedNK cells in the wild-type animals, greatly impaired the protectiveeffect of BM-NSC-IL-23 against intracranial tumor. Only 20% of themice survived intracranial glioma implantation, but there was an

Figure 2. BM-NSCs displayed strong tropism for intracranial gliomas andwere able to express transgenes after transduction with adenoviral vectors.A, BM-NSCs (red) distributed throughout the intracranial tumor mass (green )and intermingled among green tumor cells after peritumoral implantation intobrain (a). BM-NSCs migrated away from the main tumor mass to a tumor satellitefollowing intratumoral implantation (b), and BM-NSCs were also seen in theimmediate proximity to and intermixed with an invading tumor islanddeep into normal neural tissue (c ). The BM-NSCs were identified byimmunohistochemistry as h-galactosidase-positive cells (red) due to AdLacZvector transduction before the cells were implanted. Tumor cells were GFPstably transfected (green ). Arrowheads, tumor edge; arrow, tumor island. Bar,100 Am. B, BM-NSCs transduced by adenoviral vectors to express transgenesin vitro . BM-NSCs and fetal neural stem cells were transduced by AdEmpty (E),AdIL-23 (23), and AdIL-12 (12), respectively. BM-NSCs were capable ofexpressing transgene with a similar pattern as that of fetal neural stem cells,which were verified with either RT-PCR to amplify the p19 subunit of IL-23 (a) orELISA to detect the p40 subunit of IL-23 and IL-12 (b). Columns, mean oftriplicate determinations; bars, SD. ND, not detected. C, BM-NSC, as atumor-targeting cellular vehicle, delivered transgene into intracranial tumor.After BM-NSCs were transduced with AdIL-23, when implanted into brain,the cells were able to deliver the transgene into glioma as identified byimmunohistochemistry staining of p40 in both wild-type C57BL/6 mice (a and b)and athymic nude mice (c and d ) intracranial tumor models. Isotype controlantibody was stained negative for both wild-type mice (e and f ) and athymicnude mice (g and h ). Bar, 100 Am.





f60% survival rate after normal rabbit serum injection, whichserved as control (Fig. 6C). The survival rate between the twogroups was significantly different (P = 0.0457, log rank). These datasuggest that NK cells are involved in the antitumor activityproduced by IL-23–expressing BM-NSCs.IL-23–expressing BM-NSCs induce long-term immune mem-

ory and enhanced IFN-; expression in brain. To examinewhether a memory protective immunity was established in thoseanimals that survived intracranial GL26 glioma after IL-23–expressing BM-NSC treatment, the surviving C57BL/6 mice weresubjected to rechallenge with intracranial injection of parentalGL26 glioma cells. All of the rechallenged animals survived beyondday 90 after the rechallenge and were tumor-free upon sacrificeas verified by H&E staining of the brain sections. In contrast,age-matched naive mice were uniformly susceptible to GL26glioma challenge and died of brain tumor within 35 days of thechallenge.To study the possible molecules that may involve in the activity

of IL-23–expressing BM-NSC in brain, we focused on IL-17 andIFN-g, because these molecules have been shown to play importantroles for the dendritic cell and T-cell activation states, whichwere promoted by IL-23 (14, 15, 21). The BM-NSC-IL-23–treatedsurvivors of the earlier experiment were rechallenged with parentalGL26 cells alone or GL26 with either BM-NSC-IL-23 or BM-NSC-E.After the rechallenge, brain tissues were analyzed by RT-PCR.We were consistently unable to detect any IL-17 expression.

However, IFN-g was detected from day 1 and reached themaximum level 5 to 7 days after the rechallenge (Fig. 7A). Then,the expression declined to an undetectable level 2 weeks afterthe rechallenge. The IFN-g expression was always higher in theGL26 plus BM-NSC-IL-23 rechallenged animals than in the GL26plus BM-NSC-E or the GL26 alone rechallenged animals. Age-matched naive animals did not have detectable IFN-g expressionin their brains after GL26 plus BM-NSC-IL-23 or GL26 alonechallenges (Fig. 7B). To further examine the IFN-g expressionlevel, we used relative quantitative real-time PCR to analyze thebrain samples 7 days after tumor rechallenge. As shown in Table 2,IFN-g mRNA was up-regulated in all rechallenged mice thatsurvived the earlier experiment compared with the age-matchednaive mice that were challenged with GL26 plus BM-NSC-IL-23 orGL26 alone. We did not find IFN-g mRNA up-regulation in micethat survived the earlier experiment but without rechallenge. Thesedata suggest that IL-23–expressing BM-NSCs used to treatintracranial gliomas can induce long-term antitumor memory thatis associated with enhanced IFN-g, but not IL-17, up-regulation inthe brain.

Discussion

In this study, we have presented evidence that neural stem-likecells can be isolated from whole bone marrow of adult mice. Themice BM-NSCs were able to be propagated and differentiated into

Figure 3. In vivo differentiation ofintracranial implantation of BM-NSCs.BM-NSCs transduced by AdIL-23 in vitrowere intracranially implanted into micebearing experimental brain tumor. Thetransplanted BM-NSCs (green) wereidentified within the brain (A, E, I , and M ).The cells (red) showed neural differentiationas stained positive for Tuj1 (B-D ),oligodendroglial differentiation as stained bymyelin/oligodendrocyte-specific antibody(F-H), and astrocytic differentiation asidentified by GFAP antibody (J-L ).Macrophage marker-positive cell was notfound in the implanted BM-NSC (N-P ).The sections were labeled also with4V,6-diamidino-2-phenylindole (blue ) toidentify nuclei (D, H, L , and P ). Bar, 100 Am.

Cancer Research




neural and glial cells in vitro and were able to track intracranialglioma cells when implanted into glioma-bearing brain. Moreimportantly, these cells displayed the ability to track invadingtumor islands that had infiltrated deep into normal neural tissue

well away from the main tumor mass. By incorporating the tumortropic properties of NSCs with a novel cytokine, IL-23, which actson memory T cells and dendritic cells (14, 15), we found that IL-23–expressing BM-NSCs when injected into brain showed antitumoractivity against intracranial glioma. Mice that survived brain tumor

Figure 4. Effect of IL-23–expressing BM-NSCs on the experimental glioma inC57BL/6 mice. A, Kaplan-Meier survival curve of intracranial glioma-bearingC57BL/6 mice that were injected intracranially with BM-NSC-IL-23,NIH-3T3-IL-23, BM-NSC-E, or saline. Representative of three independentexperiments. B, intratumoral CD8+ and CD4+ T-cell infiltration 4 weeks after thetransduced BM-NSCs were injected. BM-NSC-IL-23 treated mice showed robustinfiltration of CD8+ (a and b ) and CD4+ (d and e) T cells within the tumor mass.BM-NSC-E–treated mice showed negligible CD8+ (c ) and CD4+ (f) T-cellinfiltration. C, histology staining of glioma-bearing mice brains that were treatedwith either BM-NSC-IL-23 (a and d) or BM-NSC-E (b and e). Age-matched naivemice were included as control (c and f ). Both H&E (a-c ) and luxol fast blue(myelin stain) showed no evidence of demyelination (d-f ). Bar, 100 Am.

Figure 5. Involvement of tumor-specific CTL activity and CD8+ and CD4+ T cellsin the effect of BM-NSC-IL-23. A, tumor-specific CTL activity of spleen cellsinduced by BM-NSC-IL-23. Spleen cells obtained from mice that survivedintracranial GL26 glioma implantation for 12 weeks after BM-NSC-IL-23treatment (n = 3) or from age-matched naive mice (n = 3) were restimulated withmitomycin C–treated GL26 cells for 5 days, and the CTL activity of the resultanteffector cells was measured against parental GL26 tumor target in a lactatedehydrogenase release assay. Irrelevant p815 was also used as a tumor targetfor the effector cells that were from BM-NSC-IL-23–treated mice (a). Spleen cellsobtained from glioma-bearing mice that were intracranially injected with eitherBM-NSC-IL-23 (n = 3) or BM-NSC-E (n = 3) for 4 weeks were restimulated withmitomycin C–treated GL26 cells for 5 days, and the CTL activity of resultanteffector cells was measured against parental GL26 tumor target in a lactatedehydrogenase release assay. Irrelevant p815 was also used as a tumor targetfor the effector cells that were from BM-NSC-IL-23–treated mice (b ). Points,mean of three mice; bars, SD. Representative of three independent experiments.B, Kaplan-Meier survival curve of intracranial glioma-bearing C57BL/6 mice.Mice were randomly divided into four groups, in which one group wasintracranially injected with BM-NSC-E plus i.p. injections of normal rat serum andthe other three groups were intracranially injected with BM-NSC-IL-23 plus i.p.injections of either CD8+ T-cell depleting antibody, CD4+ T-cell depletingantibody, or normal rat serum, respectively. Representative of three independentexperiments.





implantation after BM-NSC-IL-23 treatment acquired a tumor-specific protective immunity. CD8+ T cells were crucial for thispotent antitumor activity; in addition, CD4+ T cells and NK cellswere also involved in the induction of this antitumor activity.Furthermore, enhanced IFN-g production in the brain tissue wasimportant for the BM-NSC-IL-23–elicited immune memory re-sponse against subsequent parental tumor rechallenge.Effective eradication of primary or metastatic brain tumors and

generation of a long-lasting immune response with an effectivegene delivery system are important goals for cancer geneimmunotherapy. Most gene delivery strategies employ viral vectorsto deliver genes directly to tumor cells in vivo ; however, thelimitation of transgene distribution to extensive areas, especiallythe invading tumor foci, has limited the efficacy of suchapproaches. The present study sought to take advantage of themigratory ability of neural stem cells to track brain tumors andto deliver therapeutic molecules into expansive tumor regions. Wegenerated neural stem-like cells from adult mice bone marrow.The BM-NSCs displayed the ability to track brain tumor in a mouse

intracranial glioma model. After intratumoral or peritumoralimplantation, the BM-NSCs extensively migrated throughoutthe established tumor mass. In addition, the BM-NSCs trackedinto the invading tumor islands that had migrated away fromthe main tumor mass. This tracking characteristic has not beenshown previously in bone marrow–derived neural progenitor-likecells (12).By transducing the BM-NSCs with an adenoviral vector encoding

a newly discovered cytokine, IL-23, we were able to deliver themolecule into intracranial tumor sites. It has just been shown thatIL-23–expressing tumor cells produced antitumor activity (16).Delivering IL-23 by using BM-NSCs in the current study resulted ina protective effect in intracranial glioma-bearing mice with a sig-nificant prolongation of survival. These results strongly suggestthat IL-23–expressing BM-NSCs produce antiglioma activity. Toverify the potential role of IL-23 in this antiglioma activity, wecompared the effect of IL-23–transduced BM-NSCs with that of anempty control vector transduced BM-NSCs. All of the intracranialglioma-bearing mice died within 40 days after treatment withthe empty control vector transduced BM-NSCs. To further verifythe potential benefit of the migration of BM-NSC in producingantiglioma activity, we compared the survival benefit offered byBM-NSC-IL-23 to that conferred by IL-23 secretion by nonmigra-tory NIH-3T3 cells, which produce similar levels of IL-23 to BM-NSC-IL23 in vitro and in vivo . NIH-3T3-IL-23 treatment producedsignificantly less protective effect compared with BM-NSC-IL-23.Taken together, the antiglioma activity of IL-23–expressingBM-NSCs may be a direct combined consequence of the abilityof BM-NSCs to target migrating tumor cells and the ability ofIL-23 to activate immune responses against tumor cells.It has been shown that IL-23 can act directly on dendritic cells to

promote tumor peptide presentation to T cells (15). In addition,T-cell responses may be amplified by the potent effect of IL-23 on

Figure 6. Involvement of NK cells in the antitumor immunity induced byBM-NSC-IL-23. A, Kaplan-Meier survival curve of intracranial glioma-bearingathymic nude mice that were intracranially injected with either BM-NSC-IL-23 orBM-NSC-E. B, Kaplan-Meier survival curve of intracranial glioma-bearingathymic nude mice that were depleted of NK cells with an anti–asialo GM1antibody injection and intracranially injected with either BM-NSC-IL-23 orBM-NSC-E. C, Kaplan-Meier survival curve of intracranial glioma-bearingC57BL/6 mice that were intracranially injected with BM-NSC-IL-23 plus i.p.injection of either anti–asialo GM1 antibody for NK cell depletion or normal ratserum as control. Representative of three independent experiments.

Figure 7. RT-PCR assay of cytokine expression within brain after therechallenges/challenges. A, IFN-g expression was detected in the brain tissuesof mice that survived earlier experiment and rechallenged with GL26 alone(lane 4) or GL26 with either BM-NSC-IL-23 (lane 2 ) or BM-NSC-E (lane 3 ). IL-17expression was not detected whether GL26 alone (lane 8) or GL26 with eitherBM-NSC-IL-23 (lane 6) or BM-NSC-E (lane 7) was used in the rechallenges.Neither IFN-g nor IL-17 expression was detected in age-matched naive miceafter the GL26 plus BM-NSC-IL-23 challenge (lanes 5 and 9). B, IFN-gexpression profile in brain tissue of different animals and different rechallenges/challenges. IFN-g expression was detected in mice that survived earlierexperiments and rechallenged with GL26 alone (lanes 4 and 7) or GL26 witheither BM-NSC-IL-23 (lanes 2 and 5) or BM-NSC-E (lanes 3 and 6). IFN-gexpression was not detected in age-matched naive mice that were challengedwith GL26 plus BM-NSC-IL-23 (lane 8 ) or GL26 alone (lane 9). Brain tissuesharvested on day 7 after the rechallenge/challenge. Representative of threeindependent experiments. L, 1 kb plus DNA ladder.

Cancer Research




memory-activated T cells (14). Our experiments in immunocom-promised hosts and in animals selectively depleted of variouslymphocyte populations suggest that T-cell immune responses areimportant for antitumor function of IL-23–expressing BM-NSCsand that CD8+ T cells play a crucial role in BM-NSC-IL-23–mediatedantitumor activity, because the immune protective effect wasgreatly impaired in T-cell–deficient athymic nude mice and in wild-type mice depleted of CD8+ T cells. In CD4 knockout mice and inwild-type mice depleted of CD4+ T cells, we found that CD4+ T cellswere also involved in the antitumor activity of BM-NSC-IL-23 albeitto a lesser extent than CD8+ T cells. In addition, in both athymicnude mice and wild-type mice, we observed the role of NK cells inthe immune protective effect of BM-NSC-IL-23. NK cell depletionabolished and reduced the protective effect in athymic nude andwild-type mice, respectively. Lo et al. described the role of CD8+ Tcells in the antitumor activity of IL-23–expressing tumor cells in acolon adenocarcinoma model (16). Our results confirmed that CD8+

T cells are crucial to the IL-23–mediated antitumor activity.However, the finding that CD4+ T cells and NK cells were involvedin the IL-23 activity in our current study represents a significantdivergence from the results forwarded by Lo et al. (16), in which IL-23–expressing tumor cells induced antitumor activity but did notrequire CD4+ T cells or NK cells. This may possibly be explained bytheir use of a different tumor cell line (CT26) in their colonadenocarcinoma s.c. tumor model, which is distinct from the GL26glioma we used in our study as an intracranial brain tumor model.Alternatively, this difference may be attributable to the uniqueenvironment of the central nervous system with regard to antigenpresentation by microglia or recruited dendritic cells. Interestingly,when we used B16-F10 cells as intracranial tumor model, we alsoobserved the involvement of NK cells in the antitumor activity ofIL-23 (data not shown). The variance in the cellular subsets crucialto an antitumor effect needs further delineation.IL-23 can activate macrophages to produce proinflammatory

cytokines that may contribute to autoimmune inflammation of the

brain (21–24). In the present study, we found that BM-NSC-IL-23–treated long-term survivors showed enhanced IFN-g expression inbrain tissue upon tumor rechallenge. We were consistently unable,however, to detect IL-17, a cytokine involved in the IL-23 signalingpathway and which induces inflammation (21, 23, 24), even whenwe delivered IL-23 with the tumor rechallenge. These findingswere consistent with the results that elucidated that mice brainsmaintained normal morphologic characteristics after BM-NSC-IL-23 treatment as shown by H&E and demyelination-specificstaining. These data suggest that BM-NSC-IL-23 treatment usedin the current study does not induce detectable inflammation inthe brain either because the IL-23 level delivered by BM-NSCsis not high enough to do so or because the in vivo expression ofexogenous IL-23 predominantly enhances long-lasting memoryT-cell immunity, such as antigen-specific CTL and IFN-g–producing Th1 immune responses (25). To understand this, it willbe required to closely investigate the signal pathways that areinvolved in inflammation and in protective immune responsesinduced by exogenous IL-23 expression.In summary, in this study, we showed that neural stem-like

cells generated from adult bone marrow can be used as a targeting

vehicle to track migratory and invasive tumor cells within the

central nervous system. In combination with the unique actionof IL-23 on tumoricidal potency, autologous neural stem-like cell–

mediated tumor targeting immune therapy represents an attractive

new treatment modality for malignant brain tumors.

AcknowledgmentsReceived 5/16/2005; revised 12/9/2005; accepted 12/27/2005.

Grant support: NIH grants 1K23 NS02232, 1R01 NS048959, and 1R21 NS048879(J.S. Yu).

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Sebastian Wachsmann-Hogiu and Daniel H. Farkas for their kindassistance in obtaining images of stained brain sections, Dr. Scot Macdonald for thecritical review of the article and helpful comments, and Dr. Hong Zhou for discussions.

Table 2. Relative IFN-g mRNA up-regulation in brain tissue

Survived mice

GL26 rechallenge GL26/BM-NSC-E rechallenge GL26/BM-NSC-IL-23 rechallenge No rechallenge

Compared with naive mice +

GL26 challenge

10.607 F 1.177 10.733 F 0.802 12.406 F 1.049 1.132 F 0.106

Compared with naive mice +

GL26/BM-NSC-IL-23 challenge

10.049 F 1.231 10.168 F 1.008 11.753 F 1.061 1.079 F 0.055

NOTE: Mean F SD fold of increase. When 2�[DCt (survived animal) � DCt (naive animal)] = 1, there is no IFN-g up-regulation.

References1. Maher EA, Furnari FB, Bachoo RM, et al. Malignantglioma: genetics and biology of a grave matter. GenesDev 2001;15:1311–33.

2. Peter McL, Loeffler JS. Cancer of the nervous system.Cambridge (MA): Blackwell Publishers; 1997.

3. Kramm CM, Sena-Esteves M, Barnett FH, et al. Genetherapy for brain tumors. Brain Pathol 1995;5:345–81.

4. Benedetti S, Pirola B, Pollo B, et al. Gene therapy ofexperimental brain tumors using neural progenitor cells.Nat Med 2000;6:447–50.

5. Aboody KS, Brown A, Rainov NG, et al. Neural stemcells display extensive tropism for pathology in adultbrain: evidence from intracranial gliomas. Proc NatlAcad Sci U S A 2000;97:12846–51.

6. Ehtesham M, Kabos P, Kabosova A, Neuman T, BlackKL, Yu JS. The use of interleukin 12-secreting neural

stem cells for the treatment of intracranial glioma.Cancer Res 2002;62:5657–63.

7. Mezey E, Chandross KJ, Harta G, Maki RA, McKercherSR. Turning blood into brain: cells bearing neuronalantigens generated in vivo from bone marrow. Science2000;290:1779–82.

8. Brazelton TR, Rossi FM, Keshet GI, Blau HM. Frommarrow to brain: expression of neuronal phenotypes inadult mice. Science 2000;290:1775–9.





9. Woodbury D, Schwarz EJ, Prockop DJ, Black IB. Adultrat and human bone marrow stromal cells differentiateinto neurons. J Neurosci Res 2000;61:364–70.

10. Sanchez-Ramos J, Song S, Cardozo-Pelaez F, et al.Adult bone marrow stromal cells differentiate intoneural cells in vitro . Exp Neurol 2000;164:247–56.

11. Kabos P, Ehtesham M, Kabosova A, Black KL, Yu JS.Generation of neural progenitor cells from whole adultbone marrow. Exp Neurol 2002;178:288–93.

12. Lee J, Elkahloun AG, Messina SA, et al. Cellular andgenetic characterization of human adult bone marrow-derived neural stem-like cells: a potential antigliomacellular vector. Cancer Res 2003;63:8877–89.

13. Nakamizo A, Marini F, Amano T, et al. Human bonemarrow-derived mesenchymal stem cells in the treat-ment of gliomas. Cancer Res 2005;65:3307–18.

14. Oppmann B, Lesley R, Blom B, et al. Novel p19protein engages IL-12p40 to form a cytokine, IL-23, withbiological activities similar as well as distinct fromIL-12. Immunity 2000;13:715–25.

15. Belladonna ML, Renauld JC, Bianchi R, et al. IL-23and IL-12 have overlapping, but distinct, effects onmurine dendritic cells. J Immunol 2002;168:5448–54.

16. Lo CH, Lee SC, Wu PY, et al. Antitumor andantimetastatic activity of IL-23. J Immunol 2003;171:600–7.

17. Martens DJ, Tropepe V, van Der Kooy D. Separateproliferation kinetics of fibroblast growth factor-responsive and epidermal growth factor-responsiveneural stem cells within the embryonic forebraingerminal zone. J Neurosci 2000;20:1085–95.

18. Graham FL, van der Eb AJ. A new technique for theassay of infectivity of human adenovirus 5 DNA.Virology 1973;52:456–67.

19. Yuan X, Curtin J, Xiong Y, et al. Isolation of cancerstem cells from adult glioblastoma multiforme. Onco-gene 2004;23:9392–400.

20. Reynolds BA, Weiss S. Generation of neurons andastrocytes from isolated cells of the adult mammaliancentral nervous system. Science 1992;255:1707–10.

21. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ,Gurney AL. Interleukin-23 promotes a distinct CD4T cell activation state characterized by the production ofinterleukin-17. J Biol Chem 2003;278:1910–4.

22. Cua DJ, Sherlock J, Chen Y, et al. Interleukin-23rather than interleukin-12 is the critical cytokine forautoimmune inflammation of the brain. Nature 2003;421:744–8.

23. Langrish CL, McKenzie BS, Wilson NJ, de WaalMalefyt R, Kastelein RA, Cua DJ. IL-12 and IL-23: masterregulators of innate and adaptive immunity. ImmunolRev 2004;202:96–105.

24. Langrish CL, Chen Y, Blumenschein WM, et al. IL-23drives a pathogenic T cell population that inducesautoimmune inflammation. J Exp Med 2005;201:233–40.

25. Ha SJ, Kim DJ, Baek KH, Yun YD, Sung YC. IL-23induces stronger sustained CTL and Th1 immuneresponses than IL-12 in hepatitis C virus envelopeprotein 2 DNA immunization. J Immunol 2004;172:525–31.

Cancer Research





In the article on IL-23–expressing neural stem cell antiglioma inthe March 1, 2006 issue of Cancer Research (1), there was an errorin Figure 4A . The correct figure appears below.

1. Yuan X, Hu J, Belladonna ML, Black KL, Yu JS. Interleukin-23–expressing bonemarrow–derived neural stem-like cells exhibit antitumor activity against intracranialglioma. Cancer Res 2006;66:2630–8.

I2006 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-66-17-COR1

Correction

www.aacrjournals.org 8925 Cancer Res 2006; 66: (17). September 1, 2006

2006;66:2630-2638. Cancer Res Xiangpeng Yuan, Jinwei Hu, Maria L. Belladonna, et al. Intracranial GliomaStem-Like Cells Exhibit Antitumor Activity against

Derived Neural−Expressing Bone Marrow−Interleukin-23

Updated version

http://cancerres.aacrjournals.org/content/66/5/2630

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/66/5/2630.full#ref-list-1

This article cites 24 articles, 14 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/66/5/2630.full#related-urls

This article has been cited by 11 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/66/5/2630To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/66/5/2630.full#ref-list-1

http://cancerres.aacrjournals.org/content/66/5/2630.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



interleukin-23–expressing bone marrow–derived neural …intracranial tumor-bearing mice with...

Documents