intrinsic gene expression during regeneration in arm explants of amphiura filiformis
TRANSCRIPT
Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
Contents lists available at SciVerse ScienceDirect
Journal of Experimental Marine Biology and Ecology
j ourna l homepage: www.e lsev ie r .com/ locate / jembe
Intrinsic gene expression during regeneration in arm explants of Amphiura filiformis
Gavin Burns a,⁎, Olga Ortega-Martinez b, Samuel Dupont b, Michael C. Thorndyke c,Lloyd S. Peck a, Melody S. Clark a
a British Antarctic Survey, Natural Environment Research Council, High Cross, Madingley Road, Cambridge CB3 0ET, UKb Department of Marine Ecology, University of Gothenburg, Sven Lovén Centre for Marine Sciences, Kristineberg, 45034 Fiskebäckskil, Swedenc Royal Swedish Academy of Sciences and Department of Marine Ecology, Sven Lovén Centre for Marine Sciences, Kristineberg, 45034 Fiskebäckskil, Sweden
⁎ Corresponding author. Tel.: +44 1223 221324; fax:E-mail address: [email protected] (G. Burns).
0022-0981/$ – see front matter. Crown Copyright © 20doi:10.1016/j.jembe.2011.12.001
a b s t r a c t
a r t i c l e i n f oArticle history:Received 11 August 2011Received in revised form 28 November 2011Accepted 2 December 2011Available online 31 December 2011
Keywords:AutotomyAxial patterningBlastemaEchinodermMicroarrayProliferation
The extensive regeneration ability of ophiuroids, particularly in relation to arm re-growth following amputa-tion, is becoming increasingly recognized as a useful model system for understanding cellular differentiationand regeneration in a whole animal context. Amputated ophiuroid arms are referred to as explants. These areable to survive for several months in seawater and, when amputated at both ends (“double amputated”), canundergo partial regeneration at one end and wound healing at the other. As such, they present a simplifiedand controlled regenerating model system which can potentially provide clues as to the mechanism involvedin the programming and polarity of cellular differentiation. In this first investigation of gene expression in anophiuroid explant we used cDNA microarrays in the transcriptional profiling of the proximal, medial and dis-tal sections of double amputated explants of the temperate brittle star Amphiura filiformis. The results dem-onstrated an active transcriptome with extensive differential gene expression focused at the original distalpart of the arm explant where the regenerating blastema was located. The transcription profiles also revealedthat expression patterns showed subtle differences in the levels of gene expression rather than the presenceor absence of certain genes. The sections of arm under study were no longer attached to the whole animal andtherefore reduced levels of activity of some transcripts e.g. ciboulot, a gene potentially involved in cell differ-entiation events such as neuronal development, suggest that transcript dosage and/or relative expression ofcertain gene combinations may play an important role in the progression of cellular differentiation events.
Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.
1. Introduction
Brittle stars (ophiuroids), like other echinoderms, have extensiveabilities to regenerate lost or damaged tissues, particularly their arms.Regeneration is a common place event which depends on location andhabitat, but often the majority of brittle stars in a population show evi-dence of arm damage and regeneration (Skold and Rosenberg, 1996).Indeed brittle star arms can be amajor source of nutrition for their pred-ators and have been shown to play a significant role in ecosystem func-tioning (Skold et al., 1994).
The process of autotomy (self amputation of an appendage) in ophi-uroids results in an animal with awound site which undergoes a regen-erative process by means of epimorphic and/or morphallactic eventsover a period of time varying fromweeks to potentially years. This pro-cess is not only species dependent, but is also affected by environmentalfactors such as temperature, food availability and also, in some species,the amount of tissue lost (Clark et al., 2007; Dupont and Thorndyke,2007). Previous studies have mostly focused on the regenerative pro-cess in brittle stars from an ecological perspective (Allen Brooks et al.,
+44 1223 362616.
11 Published by Elsevier B.V. All rig
2007; Bourgoin and Guillou, 1994; Makra and Keegan, 1999; Munday,1993; Skold and Rosenberg, 1996), as well as cellular events (Biressiet al., 2010) and timescales (Clark et al., 2007).
Amputated arm explants of some echinoderm species can surviveindependently from the main body for several weeks. When doubleamputated, the explants (with wound sites at both proximal and dis-tal ends) can undergo partial regeneration, although this only occursat the distal end, clearly indicating a programmed polarity within thearm (Candia Carnevali et al., 1998; Dupont and Thorndyke, 2006).Candia Carnevali et al. (1998) described in detail the cellular eventsoccurring in double amputated crinoid explants. The cellular process-es in forming a blastema at the distal end of the double amputated ex-plant were similar to that found in normal regenerating arms ofcrinoids albeit with some modification in cellular recruitment and agreater emphasis on morphallaxis and dedifferentiation. The proxi-mal end of the explant arms underwent wound healing only bymeans of cell proliferation and migration with no blastema forming,indicating a distinct polarity of response. As this process occurs whilstseparated from the donor animal, the factors controlling regenerationand polarity of response must already be present or be producedwithin the amputated arm. This observation of temporarily sustainedgrowth and repair, together with the maintenance of a strict proximal–distal axis must have significant implications for the presence of
hts reserved.
107G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
developmental factors that regulate positional information such as seg-ment polarity genes and presents great potential for gene expressionanalyses.
In this studyweutilized thebrittle star,A.filiformis, as amodel organ-ism to extend our knowledge on arm regeneration. Previous cytologicalanalyses have indicated that A. filiformis undergoes similar regenerationprocesses to those described in crinoids (Biressi et al., 2010) and is ame-nable to experimental manipulation. It is a small burrowing sublittoralbrittle star with a disc diameter of up to 10 mm found in depths from15 to 200 m in the North Sea and Mediterranean (Rosenberg, 1995).A. filiformis has a well characterized, predictable mode and rate of re-generation (Biressi et al., 2010; Dupont and Thorndyke, 2006), whichhas recently undergone transcriptional profiling using cDNA microar-rays (Burns et al, 2011). Explants of A. filiformis have been observed tosurvive for more than four weeks in natural seawater (Dupont andThorndyke, 2006). In this first study of transcriptional activity in anechinoderm explant we conduct gene expression profiling studies atthree sites along the explant (proximal, medial and distal sections(Fig. 1)) and compare these to non-regenerating arms to further eluci-date the mechanisms of polarity in regenerating brittle star arms.
2. Materials and methods
2.1. Animal collection
Amphiura filiformis specimens (disc diameter range 5–6.5 mm)were collected by Peterson mud grabs at a depth of 25–40 m in the vi-cinity of the Sven Lovén Centre for Marine Sciences, Kristineberg, onthe Gullmarn fjord, Sweden (58° 15′ N, 11° 25′ E). After carefully sort-ing the animals from the mud samples by rinsing with seawater, thebrittle stars were kept in flow through aquaria at 14 °C. Amputationwere performed in animals, after anaesthesia by immersion in 3.5%w/w MgCl2∗6H2O pH 8.3 in a 50:50 mixture of filtered seawaterand distilled water, to compensate osmolarity, by pressing a scalpelblade into the inter-vertebral autotomy plane. Amputated armswere subsequently amputated again at the distal end to produce anexplant of 4–6 mm in length with wound sites at the proximal anddistal ends (Fig. 1). Explants were cultured in flow-through aquariaat 14 °C.
2.2. Sampling and RNA extraction
Explants were sampled after seven days by separating into threesections: three segments from the proximal end, medial and threesegments from the distal end (Fig. 1). Only explants that showedmovement when disturbed were used in this study. Samples wereimmediately placed in Tri reagent for extraction using the RiboPureRNA extraction kit (Applied Biosystems). Approximately 30 sampleswere used in each of 6 pseudo replicates. Purified total RNA was
Fig. 1. A typical cultured explant at 7 days post autotomy showing the proximal (P),medial (M) and distal (D) sampled parts. The blastema formed at the distal end andthe wound healing only site at the proximal end can be seen.
quality checked and quantified using a NanoDrop spectrophotometer(Thermo Scientific) and by gel electrophoresis on a 1.2% TAE gel.Undamaged and non-regenerating arms were used as controls onthe microarray and total RNA was extracted in the same way as forthe explant samples.
2.3. Microarray hybridization and data analysis
500 ng of total RNA from six explant replicates from each of theproximal, medial and distal regions of the explant were amplified,fluorescently labelled with Cy3 dCTP (GE Healthcare) and hybridi-zation compared with Cy5 dCTP (GE Healthcare) labelled controlsamples as described in Purac et al. (2008). Amplified and labelledcDNAs were hybridized to a 9224 feature A. filiformis microarray de-scribed in Burns et al. (2011) and subsequently washed andscanned using a GenePix 4100 microarray scanner (MDS AnalyticalTechnologies) according to the method described in Purac et al.(2008).
Microarray images were analysed using GenePix 6.1 software(MDS Analytical Technologies) during which anomalous and low sig-nal features were flagged and excluded from future analysis. Theresulting intensity data were background corrected (subtract method)and normalized (print tip loess within microarray and R quantile be-tween microarray) using the limma GUI R package (Smyth, 2005;Wettenhall and Smyth, 2004). Clones were excluded from furtheranalysis if they were represented by fewer than 33% of the totaldata points i.e. less than 6 out of a total of 18 results. Normalizedand quality filtered data were imported into the MeV analysis package(Saeed et al., 2003, 2006). Cloneswith significant differential expressionbetween the explant samples and control arms and between proximal,medial and distal samples were determined using the SAM algorithm(Tusher et al., 2001) with a delta value adjusted for each test to excludefalse positive results. The list of significantly differentially expressedclones (p=b0.01) was then further filtered to remove any resultsthat showed less than a twofold difference in experimental treatments.All gene expression ratio data are presented as log2 and therefore nochange in expression has a log2 ratio of 0 and a twofold change in ex-pression is ±1. All microarray data were submitted to ArrayExpresswith the accession number E-MEXP-3413.
2.4. Clone sequencing and analysis
Library clones and selected differentially expressed clones were se-quenced using M13 reverse long primer (5′-AACAGCTATGACCATGAT-TACG-3′) by LGC Genomics (Germany), Macrogen (South Korea) andSource Biosciences (UK). Sequence data were processed to remove vec-tor and low quality bases in the Geneious program (Drummond et al.,2008). The resulting sequences were imported into Blast2GO (Conesaet al., 2005) for comparison to the NCBI non-redundant sequence data-base using BLASTX (Gish and States, 1993) with an E-value cutoff of1×10−6. All DNA sequence data were submitted to NCBI Genbankwith library accession LIBEST_027032.
2.5. Quantitative PCR validation of gene expression
Four clones Af_127P7 (Sox1), Af_126D24 (CREB-binding protein),Af_141E14 (Selenoprotein W) and Af_Contig_50 (DSP1) were chosenfor further investigation to verify the results from themicroarray exper-iment (Table 1). Primers were designed using the Primer3 program(Rozen and Skaletsky, 2000) implemented in Geneious (Drummond etal., 2008) to produce an amplicon sizes of b250 nucleotides. cDNA wasproduced from 100 ng of total RNA from each of the three explantsamples using the QuantiTect reverse transcription kit (Qiagen). Q-PCRwas performed using Brilliant SYBR Green SideStep QPCRMasterMix (Agilent) on aMX3000P Q-PCRmachine (Stratagene) following themanufacturer's instructions and the following cycling conditions: 95 °C
Table 1Clones used in Q-PCR mass interpolation and associated primer sequences.
Clone ID Primer sequence (5′ to 3′)
Af_127P7 (Sox1) Forward: AGGACAGCGCCGAAAAATGGCAReverse: GGGTCTTGGTCTTACGGCGTGG
Af_126D24 (Creb binding protein) Forward: GGTGCTGCCACGAGGCCTTTTAATReverse: TGGCCAACATTTGTTGTGGGTGCT
Af_141E14 (Selenoprotein W) Forward: GAAGGCGTTGGCATTCCAGGTACTReverse: AAGGGCTAACCTGCCAGAGCCAAT
Af_Contig_50 (DSP1) Forward: AGGTGGAAGGACATGGGCGACReverse: CGCCTCTGGCGTCATTGCTGAA
Fig. 2. Venn diagram of (A) positively and (B) negatively differentially expressed clonescompared to control non-regenerating arms in the three sampled parts of the explant.
Fig. 3. A heat map demonstrating expression of selected clones throughout the explantsamples. The scale is log2 of gene expression ratios.
108 G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
for 10 min, 40 cycles of 95 °C for 30 s, 60 °C for 1 min and 72 for 45 s. EachQ-PCR was performed using three biological and three technical repeatsfor each explant group. A Q-PCR standard curve was produced from am-plifications of a 10 fold serial dilution of highly purified kanamycinmRNA(Promega) withmasses ranging from 5 ng to 50 fg using kanamycin spe-cific primers (forward 5′-GCCATTCTCACCGGATTCAGTCGTC-3 and re-verse 5′-AGCCGCCGTCCCGTCAAGTCAG-3). From this standard curveinitial masses of mRNA for each transcript from the explant groupswere interpolated and significance of differential expressionwas calculat-ed by ANOVA (all results presented with p-value=b0.05).
3. Results and discussion
After seven days post amputation double amputated explants of A.filiformis demonstrated a regenerative bud at the distal end that wascomparable in structure to that of normal (attached) regeneratingarms at seven day amputation stage (Biressi et al., 2010).
In this first investigation of gene expression in an echinoderm ex-plant, a surprising aspect of the results was the extent of gene expres-sion in seven day post-amputated samples, with the range of clonesdetected in the microarray data similar to that observed in other mi-croarray experiments on this organism (Burns et al., 2011). A total of1733 clones met the criteria for differential expression between all ofthe explant groups compared with control samples by SAM analysis(summarized in Fig. 3). These results demonstrate how remarkablyactive the explants, with regard to gene expression profiles, areafter seven days post amputation. A subset of the 1733 differentiallyexpressed clones was selected for sequencing based on their expres-sion profiles in this study and from Burns et al. (2011), of which791 were successfully sequenced resulting in 356 blast hits (approx-imately 199 of which were unique).
3.1. Gene expression profiles within the explant
Of the 1733 differentially expressed clones, 794 (46%) were com-monly represented throughout the explant (Fig. 2). Sequencing andidentification of the upregulated transcripts indicated a general increasein the transcriptional and translational machinery in this tissue. These in-cluded four clones with strong sequence similarity to ribosomal proteins,two with similarity to eukaryotic translation initiation factors and a sin-gle clone with similarity to the yeast translation factor Sui1 (Af_130O14,e-value 2.06E33), which is essential for the initiation of translation(Naranda et al., 1996) (Supplementary Table 1 and Fig. 3). Similarly, pro-tein productionwas also enhanced, as shown by the upregulation of sev-eral clones (Af_130O24, Af_130H14 and Af_134P2) with high sequencesimilarity to the protein folding complexes chaperonins. These results to-gether indicate increased protein production in the explant arm aswould be expected during the extensive cellular and tissue remodellingthat occurs during the regenerative process at the distal end and woundhealing at the proximal end.
3.1.1. Polarity of gene expression within the explantOf the remaining 54% transcripts differentially expressed in the
explant, the comparison of gene expression between proximal and
distal regions was of particular interest. The obvious morphological dif-ferences between each end (blastema formation and regeneration atthe distal end and wound healing only at the proximal end) (Fig. 1)were mirrored by a polarity in gene expression profiles (Fig. 2). Atotal of 342 clones were differentially expressed only in the distal partof the explant when compared to control non-regenerating arms andonly 31 so in the proximal part (Fig. 2). These results demonstrate ageneral increase in the amount of differential expression in the distalpart of the explant.
3.1.2. Distally-specific upregulated gene expressionThiswas clearly a region of active regeneration as evidenced by blas-
tema formation and expression of genes involved in cell proliferation
109G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
and differentiation. Among thesewere a clone with sequence similarityto a Sox transcription factor (Af_127P7 similar to Sox-1) (Fig. 4A) andthree clones with similarity to the receptor protein Notch1. All fourclones demonstrated increased expression in the distal part of the ex-plant compared to the proximal and medial sections (Fig. 3). Notch sig-nalling and Sox transcription factors are both involved in neuronaldetermination (Holmberg et al., 2008). Notch signalling has the abilityto maintain the neuronal stem cells in an undifferentiated state by re-ducing the expression of proneural proteins and requires the activityof SoxB1 transcription factors (Holmberg et al., 2008). Sox transcriptionfactors act in a similar way to prevent stem cells from terminally differ-entiating into neurons by blocking the activity of proneural proteins(Bylund et al., 2003) but can do so independently of Notch signalling(Holmberg et al., 2008). An additional clone (Af_126D24) showing se-quence similarity to a transcription factor was differentially expressedonly in the distal part of the explant (Fig. 4B). This was identified as aCREB-binding protein (Fig. 3). Among its many functions as a transcrip-tion factor CREB-binding protein is expressed in the early stages of regen-eration inHydra and is involved in nerve cell differentiation (Fenger et al.,1994; Galliot et al., 1995).
Other distal specific upregulated clones identified included repre-sentatives involved in cell proliferation, migration, differentiation andadhesion. Two clones showed low sequence similarity to a frizzled relat-ed protein (Fig. 3). Frizzled proteins are found in the plasmamembraneand act as receptors toWnt proteins (Huang andKlein, 2004) and there-fore play a critical role in polarity of both cells and tissues and the regu-lation of cell proliferation. Sequence matches of Af_141E14 showedmoderate similarity to selenoprotein W, an antioxidant protein thathas been shown to have increased expression in early differentiating
Fig. 4.Graph depicting interpolatedmasses ofmRNA in ng/μl (blue columns) and log2microarraprotein) (B) p-value=0.033, Af_141E14 (Selenoprotein W) (C) p-value=0.020 and Af_Contideviation.
myoblasts (muscle cell precursors) (Loflin et al., 2006; Noh et al.,2010). This correlates with previous observations of differentiatingmyo-cytes being involved in the early stages of regeneration in A. filiformis(Biressi et al., 2010) and the utilization of dedifferentiated myocytes asa source of stem cells in explants (Candia Carnevali et al., 1998). Accord-ingly Af_141E14 showed an increase in expression in the distal part ofthe explant only (Fig. 4C). A further clone (Af_129B18, Fig. 3) with se-quence similarity to the transmembrane protein tetraspanin was alsopresent in this region of the explants. Tetraspanin proteins have beenshown to be involved in cell migration, adhesion (Deissler et al., 2007)and wound healing in mice and humans (Cowin et al., 2006; Penaset al., 2000).
Three clones with similarity to the HMG box containing transcrip-tion factors DSP1 (Af_Contig_50, e value 6.42E-52) were significantlydifferentially expressed in the proximal and distal parts compared tocontrol arms (Fig. 4D). DSP-1 has been shown to form complexes thatregulate Hox gene expression which subsequently determine the ante-rior–posterior axis and segmentation and identity of body parts duringdevelopment (Decoville et al., 2001; Lamiable et al., 2010; Rappailleset al., 2005). Additionally high mobility group box containing proteinshave also been linked to stem cell migration by acting as a chemoattrac-tant for mesodermal stem cells (Palumbo and Bianchi, 2004; Palumboet al., 2004) and inducing inflammatory response and signalling tissuedamage by being released by necrotic cells (Palumbo et al., 2004;Rovere-Querini et al., 2004), of which all three functions could be likelyin regenerating arms and explants.
Formation of the blastema requires recruitment of new cells andcellular aggregation. This process was represented by three clones:Af_134O2 which showed sequence similarity to thromboxane A
y ratio (red columns) for Af_127P7 (Sox1) (A) p-value=0.043, Af_126D24 (CREB-bindingg_50 (DSP1) (D) p-value=0.008 in each experimental group. Error bars depict standard
110 G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
synthase 1, Af_133K1 with similarity to calx-beta domain-containingprotein and Af_125F19 which is similar to the calcium and integrinbinding protein CIB. All of these are known to be involved in cellular ag-gregation (Alonso-García et al., 2009; Naik and Naik, 2003; Shen andTai, 1998). These results showed that mechanisms active in the distalpart of the explant are involved in forming andmaintaining an undiffer-entiated stem cell pool contained within the blastema. Also since theexplant was separated from the animal body these results demonstrat-ed that the basic mechanisms for blastema formation and polarity areinstigated from sites within the explant itself and, initially, do not re-quire a central control or signalling mechanism. How polarity is deter-mined cannot be deduced from these data and may require finer scaleexpression analyses over a more detailed time course to identify thegene networks involved.
3.1.3. Proximally specific gene expressionAlthough 1109 clones were differentially expressed in the proxi-
mal part of the explant when compared to control non-regeneratingarms, only three clones were greater than twofold and significantlydifferentially expressed between the proximal and distal parts ofthe explant as determined by SAM analysis. Of these the cloneAf_129N19 received a blast hit that matched tropomyosin. HoweverAf_129N19 was one of three clones that showed similarity to tropo-myosin but the only one that was differentially expressed in the prox-imal part. This lack of large-scale differential expression between thetwo parts of the explant demonstrates the fine scale alterations ingene expression that were found throughout the explants andhence some of the effects shown between the two ends may havebeen due to subtle alterations in transcript dosage.
3.2. Comparison of explant gene expression profiles with those of normalregenerating arms
Whilst the explants showed considerable gene expression activity(1713 differentially expressed clones), this was almost 50% lower thanthat detected in normal regenerating arms (4072 clones in Burns et al.,2011). A comparison between regenerating explants and regeneratingattached arms was most effectively conducted using the blastema re-gions as this was an area common in both samples and experiments.This study which comprised 1454 and 3458 differentially expressedclones respectively. Of these, 959 clones (66%) were common to both(Table 2). These included clones previously identified in Burns et al.(2011), such as transcripts for a receptor protein Notch1, frizzled relatedprotein, tetraspanin, CREB-binding protein, sox transcription factor andselenoprotein W although the expression of the latter three clones wastwo-fold higher in regenerating blastema from normal regeneratingarms. These data are not unexpected, given that similar processes in-volved in the production and maintenance of the blastema might beexpected to occur in each condition. However the differences betweenthe two could be important in providing further insights into the geneticprocesses involved in regeneration in this organism by demonstrating
Table 2The number of clones commonly and uniquely differentially expressed between distalexplant and the blastema stage of normal regenerating arms.
Condition Number of clones
Upregulated clonesIn both normal blastema and explant 524Normal blastema only 1074Explant only 331
Downregulated clonesIn both normal blastema and explant 435Normal blastema only 1425Explant only 164
the intrinsic mechanisms present in normal (attached) regeneratingarms but absent in explants.
3.2.1. Explant-specific expression profilesAsmight be expected in tissues that have been isolated from the sup-
port mechanisms (for example nutrition and energy production) of thehost body for a period of time, clones relating to apoptosiswere differen-tially expressed throughout the explant. These were Af_141L21with se-quence similarity to serpin peptidase clade b member 1 and Af_125E17with similarity to prosaposin, (Fig. 3). Serpin peptidase clade b member1 (SERPINB3) is a serine protease inhibitor that has been shown to in-hibit apoptosis in cultured cell lines (Suminami et al., 2001; Vidalino etal., 2009). Prosaposin has also been shown by knockout/over expressionstudies to be involved in the suppression of apoptosis and the promotionof cell proliferation by interactingwithfibrocystin/polyductin (Sun et al.,2010). The increased expression of these clones was unique to the ex-plant and indicated an enhanced requirement to combat apoptosis andcell turnover, as during normal regeneration both transcripts had de-creased expression (Burns et al., 2011).
Similarly, transcripts for the anti-apoptosis protein bax inhibitor 1(BI-1) were strongly downregulated during early regeneration in nor-mal regenerating arms of A. filiformis (log2 ratio−3 to−4), returningto normal levels in late regeneration (Burns et al., 2011). However inthe explant this transcript was expressed at a similar level to thatfound in non-regenerating arms. We previously postulated that theexpression pattern of BI-1 could be due to its ability to slow the rateof cell division. Programming the rate of cell division during regener-ation is essential, as in the early stages of regeneration, there is exten-sive cellular and tissue remodelling (which requires cell turnover). Inthe later stages, as an increasing proportion of cells in the regenerat-ing arm reach full differentiation and maturity, the cell turnover ratewill be lower. The finding described here further supports the func-tion of BI-1 acting to slow the rate of cell turnover and subsequentdifferentiation. Hence A. filiformis explants display limited and sloweddifferentiation (Dupont and Thorndyke, 2006) and this may be relat-ed to the energetic constraints within the amputated tissue.
Further identifications of explant specific clones included twotranscripts related to muscle development, repair and regeneration.Clones Af_132K8 (myoferlin isoform 2) and Af_134H7 (similar toneprilysin) were consistently upregulated throughout all explantparts (Fig. 3). Myoferlin is a membrane associated protein that is es-sential for myoblast fusion in producing new muscle fibres duringgrowth and regeneration (Demonbreun et al., 2010; Doherty et al.,2005) and has also been shown to be essential for endocytosis in en-dothelial cells (Bernatchez et al., 2009). Neprilysin is a zinc depen-dant metalloprotease that is involved in myoblast differentiation(Broccolini et al., 2006; Carmeli et al., 2004), as well as neuropeptideregulation (Turner et al., 2001), and the inhibition of cellular migra-tion (Sumitomo et al., 2000). The reason for the increased expressionof genes related to muscle growth and regeneration in all parts of theexplant is unclear as a proximal/distal bias (due to wound site loca-tions) would be expected. However, in the study of crinoid explantsCandia Carnevali et al. (1998) determined that the major source ofnew cells contributing to regeneration came from muscle tissuesand more recently a role for dedifferentiating myocytes in A. filiformisregeneration has been discussed (Biressi et al., 2010). If myocyteswere being recruited to the blastema to supplement the regenerationprocess then the mechanisms for muscle growth and repair could beactivated in an attempt to replace the lost tissue.
3.2.2. Expression profiles specific to normal regenerating armsClones that were differentially expressed only in the blastema of
normal regenerating arms and not in the distal explant included a sin-gle clone (Af_133N6) with similarity to β-thymosin repeat containingprotein thypedin (e value 3.45E-34). Thypedin is a precursor proteinof the Hydra Pedin peptide which has been shown to be involved in
111G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
the differentiation of foot tissue (Hoffmeister, 1996). However, blast se-quence similarity searches with Af_133N6 also demonstrated similarityto a termite homologue of the ciboulot gene from Drosophila melanoga-ster (e value 6.21E-31) which contains four β-thymosin repeats, thesame number as found in Af_133N6. Boquet et al. (2000) demonstratedthat the ciboulot gene is essential in brainmorphogenesis inD.melanoga-ster by the re-arrangement of the actin cytoskeleton during axonalgrowth. Furthermore, the termite Hodotermopsis sjostedti homologue ofciboulot is involved in neural reorganization in soldier specific morpho-genesis (Koshikawa et al., 2010). Af_133N6 had no significant changein expression compared to non-regenerating arms throughout the ex-plant (mean log2 ratio −0.28, std. dev. 0.28 for all explant samples)but had increased expression at the blastema stage of normal regenerat-ing arms (mean log2 ratio 1.00, std. dev. 0.20). The reason for the relativelack of expression in the explant could be due to the lack of cellular dif-ferentiation and cellmaturation that has previously been observed in ex-plants of A. filiformis (Dupont and Thorndyke, 2006). This result also is inagreement with that previously described for the expression of the anti-apoptosis protein bax inhibitor (BI-1) (above), which may also act toslow cell turnover and differentiation in the explant.
4. Conclusions
These results demonstrate the extensive gene expression activity inthe double amputated explant arms of A. filiformis seven days post am-putation. Themajority of genes expressed relating to growth and devel-opment normally found in attached, early regenerating arms were alsopresent in the explant. Transcriptional profiling indicated that the signalsfor cellular differentiation for both blastema formation andwound heal-ing were intrinsic to the arm and not dependant on signals or controlfrom the main ophiuroid body. These profiles also revealed that suchpatterning was related to subtle differences in the levels of gene expres-sion rather than presence or absence of certain genes. Thus transcriptdosage and/or relative expression of certain gene combinationsmay play an important role in determining cellular differentiationin A. filiformis regenerating arms.
Supplementary materials related to this article can be found onlineat doi:10.1016/j.jembe.2011.12.001.
Acknowledgements
This paper was produced within the British Antarctic Survey PolarSciences for Planet Earth core programme, Adaptations and Physiolo-gy Work Package. GB was funded via an EU FP7 research infrastruc-ture initiative ASSEMBLE grant agreement no. 227799 to carry outthe fieldwork and sampling at The Sven Lovén Centre for MarineSciences (Kristineberg). This work was partially funded by the EUNetwork of Excellence, Marine Genomics Europe. OOM was fundedby an EMBO postdoctoral fellowship; SD by the Linnaeus Centre forMarine Evolutionary Biology at the University of Gothenburg (http://www.cemeb.science.gu.se), and supported by a Linnaeus-grant fromthe Swedish Research Councils VR and Formas. Also supported byfunds to MT from Swedish Research Council VR and the Royal SwedishAcademy of Sciences.[RH]
References
Allen Brooks, R., Nizinski, M., Ross, S., Sulak, K., 2007. Frequency of sublethal injury in adeepwater ophiuroid, Ophiacantha bidentata, an important component of westernAtlantic Lophelia reef communities. Mar. Biol. 152, 307–314.
Alonso-García, N., Inglés-Prieto, A., Sonnenberg, A., de Pereda, J.M., 2009. Structureof the Calx-beta domain of the integrin beta4 subunit: insights into functionand cation-independent stability. Acta Crystallogr. D: Biol. Crystallogr. 65,858–871.
Bernatchez, P.N., Sharma, A., Kodaman, P., Sessa, W.C., 2009. Myoferlin is critical for en-docytosis in endothelial cells. Am. J. Physiol. - Cell Phys. 297, C484–C492.
Biressi, A.C.M., Zou, T., Dupont, S., Dahlberg, C., Di Benedetto, C., Bonasoro, F., Thorndyke,M., Candia Carnevali, M.D., 2010. Wound healing and arm regeneration in
Ophioderma longicaudum and Amphiura filiformis (Ophiuroidea, Echinodermata):comparative morphogenesis and histogenesis. Zoomorphology 129, 1–19.
Boquet, I., Boujemaa, R., Carlier, M.-F., Préat, T., 2000. Ciboulot regulates actin assemblyduring Drosophila brain metamorphosis. Cell 102, 797–808.
Bourgoin, A., Guillou, M., 1994. Arm regeneration in two populations of Acrocnida brachiata(Montagu) (Echinodermata: Ophiuroidea) in Douarnenez Bay, (Brittany: France): anecological significance. J. Exp. Mar. Biol. Ecol. 184, 123–139.
Broccolini, A., Gidaro, T., Morosetti, R., Gliubizzi, C., Servidei, T., Pescatori, M., Tonali,P.A., Ricci, E., Mirabella, M., 2006. Neprilysin participates in skeletal muscle regen-eration and is accumulated in abnormal muscle fibres of inclusion body myositis. J.Neurochem. 96, 777–789.
Burns, G., Ortega-Martinez, O., Thorndyke, M.C., Peck, L.S., Dupont, S., Clark, M.S., 2011.Dynamic gene expression profiles during arm regeneration in the brittle starAmphiura filiformis. J. Exp. Mar. Biol. Ecol. 407, 315–322.
Bylund, M., Andersson, E., Novitch, B.G., Muhr, J., 2003. Vertebrate neurogenesis iscounteracted by Sox1-3 activity. Nat. Neurosci. 6, 1162–1168.
Candia Carnevali, M.D., Bonasoro, F., Patruno, M., Thorndyke, M.C., 1998. Cellular andmolecular mechanisms of arm regeneration in crinoid echinoderms: the potentialof arm explants. Dev. Genes. Evol. 208, 421–430.
Carmeli, E., Moas, M., Reznick, A.Z., Coleman, R., 2004. Matrix metalloproteinases andskeletal muscle: a brief review. Muscle Nerve 29, 191–197.
Clark, M.S., Dupont, S., Rossetti, H., Burns, G., Thorndyke, M.C., Peck, L.S., 2007. Delayed armregeneration in the Antarctic brittle star Ophionotus victoriae. Aquat. Biol. 1, 45–53.
Conesa, A., Gotz, S., Garcia-Gomez, J.M., Terol, J., Talon, M., Robles, M., 2005. Blast2GO: auniversal tool for annotation, visualization and analysis in functional genomics re-search. Bioinformatics 21, 3674–3676.
Cowin, A.J., Adams, D., Geary, S.M., Wright, M.D., Jones, J.C.R., Ashman, L.K., 2006.Wound healing is defective in mice lacking tetraspanin CD151. J. Investig. Dermatol.126, 680–689.
Decoville, M., Giacomello, E., Leng, M., Locker, D., 2001. DSP1, an HMG-like protein, isinvolved in the regulation of homeotic genes. Genetics 157, 237–244.
Deissler, H., Kuhn, E.-M., Lang, G.E., Deissler, H., 2007. Tetraspanin CD9 is involved inthe migration of retinal microvascular endothelial cells. Int. J. Mol. Med. 20,643–652.
Demonbreun, A.R., Lapidos, K.A., Heretis, K., Levin, S., Dale, R., Pytel, P., Svensson, E.C.,McNally, E.M., 2010. Myoferlin regulation by NFAT in muscle injury, regenerationand repair. J. Cell Sci. 123, 2413–2422.
Doherty, K.R., Cave, A., Davis, D.B., Delmonte, A.J., Posey, A., Earley, J.U., Hadhazy, M.,McNally, E.M., 2005. Normal myoblast fusion requires myoferlin. Development132, 5565–5575.
Drummond, A., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas, S.,Thierer, T., Wilson, A., 2008. GeneiousAvailable from http://www.geneious.com/2008.
Dupont, S., Thorndyke, M.C., 2006. Growth or differentiation? Adaptive regeneration inthe brittlestar Amphiura filiformis. J. Exp. Biol. 209, 3873–3881.
Dupont, S., Thorndyke,M., 2007. Bridging the regeneration gap: insights from echinodermmodels. Nat. Rev. Genet. 8.
Fenger, U., Hofmann, M., Galliot, B., Schaller, H.C., 1994. The role of the cAMP pathway inmediating the effect of head activator on nerve-cell determination and differentiationin hydra. Mech. Dev. 47, 115–125.
Galliot, B., Welschof, M., Schuckert, O., Hoffmeister, S., Schaller, H.C., 1995. The cAMPresponse element binding protein is involved in Hydra regeneration. Development121, 1205–1216.
Gish, W., States, D.J., 1993. Identification of protein coding regions by database similaritysearch. Nat. Genet. 3, 266–272.
Hoffmeister, S.A.H., 1996. Isolation and characterization of two newmorphogeneticallyactive peptides from Hydra vulgaris. Development 122, 1941–1948.
Holmberg, J., Hansson, E., Malewicz, M., Sandberg, M., Perlmann, T., Lendahl, U., Muhr,J., 2008. SoxB1 transcription factors and Notch signaling use distinct mechanisms toregulate proneural gene function and neural progenitor differentiation. Development135, 1843–1851.
Huang, H.-C., Klein, P.S., 2004. The Frizzled family: receptors formultiple signal transductionpathways. Genome Biol. 5, 234.
Koshikawa, S., Cornette, R., Matsumoto, T., Miura, T., 2010. The homolog of Ciboulot inthe termite (Hodotermopsis sjostedti): a multimeric β-thymosin involved insoldier-specific morphogenesis. BMC Dev. Biol. 10, 63.
Lamiable, O., Rabhi, M., Peronnet, F., Locker, D., Decoville, M., 2010. Rm62, a DEAD-boxRNA helicase, complexes with DSP1 in Drosophila embryos. Genesis 244–253.
Loflin, J., Lopez, N., Whanger, P.D., Kioussi, C., 2006. SelenoproteinW during developmentand oxidative stress. J. Inorg. Biochem. 100, 1679–1684.
Makra, A., Keegan, B., 1999. Arm regeneration in Acrocnida brachiata (Ophiuroidea) atLittle Killary, west coast of Ireland. Biol. Environ. Proc. R. Ir. Acad. 99B, 95–102.
Munday, B.W., 1993. Field survey of the occurrence and significance of regeneration inAmphiura chiajei (Echinodermata: Ophiuroidea) from Killary Habrour, west coastof Ireland. Mar. Biol. 115, 661–668.
Naik,M.U., Naik, U.P., 2003. Calcium-and integrin-binding protein regulates focal adhesionkinase activity during platelet spreading on immobilized fibrinogen. Blood 102,3629–3636.
Naranda, T., MacMillan, S.E., Donahue, T.F., Hershey, J.W., 1996. SUI1/p16 is required forthe activity of eukaryotic translation initiation factor 3 in Saccharomyces cerevisiae.Mol. Cell. Biol. 16, 2307–2313.
Noh, O.J., Park, Y.H., Chung, Y.W., Kim, I.Y., 2010. Transcriptional regulation of selenoproteinW by MyoD during early skeletal muscle differentiation. J. Biol. Chem. 285,40496–40507.
Palumbo, R., Bianchi, M.E., 2004. High mobility group box 1 protein, a cue for stem cellrecruitment. Biochem. Pharmacol. 68, 1165–1170.
112 G. Burns et al. / Journal of Experimental Marine Biology and Ecology 413 (2012) 106–112
Palumbo, R., Sampaolesi, M., De Marchis, F., Tonlorenzi, R., Colombetti, S., Mondino, A.,Cossu, G., Bianchi, M.E., 2004. Extracellular HMGB1, a signal of tissue damage, inducesmesoangioblast migration and proliferation. J. Cell Biol. 164, 441–449.
Penas, P.F., Garcia-Diez, A., Sanchez-Madrid, F., Yanez-Mo, M., 2000. Tetraspanins arelocalized at motility-related structures and involved in normal human keratinocytewound healing migration. J. Investig. Dermatol. 114, 1126–1135.
Purac, J., Burns, G., Thorne, M.A.S., Grubor-Lajsic, G., Worland, M.R., Clark, M.S., 2008.Cold hardening processes in the Antarctic springtail, Cryptopygus antarcticus:clues from a microarray. J. Insect Physiol. 54, 1356–1362.
Rappailles, A., Decoville, M., Locker, D., 2005. DSP1, a Drosophila HMGprotein, is involved inspatiotemporal expression of the homoeotic gene Sex combs reduced. Biol. Cell 97, 779.
Rosenberg, R., 1995. Benthic marine fauna structured by hydrodynamic processes andfood availability. Neth. J. Sea Res. 34, 303–317.
Rovere-Querini, P., Capobianco, A., Scaffidi, P., Valentinis, B., Catalanotti, F., Giazzon, M.,Dumitriu, I.E., Müller, S., Iannacone, M., Traversari, C., Bianchi, M.E., Manfredi, A.A.,2004. HMGB1 is an endogenous immune adjuvant released by necrotic cells. EMBORep. 5, 825–830.
Rozen, S., Skaletsky, 2000. Primer3 on the WWW for general users and for biologistprogrammers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Pro-tocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386.
Saeed, A.I., Sharov, V.,White, J., Li, J., Liang,W., Bhagabati, N., Braisted, J., Klapa,M., Currier, T.,Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich,E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V., Quackenbush, J., 2003. TM4: a free,open-source system for microarray data management and analysis. Biotechniques34, 374–378.
Saeed, A.I., Bhagabati, N.K., Braisted, J.C., Liang,W., Sharov, V., Howe, E.A., Li, J., Thiagarajan,M., White, J.A., Quackenbush, J., 2006. TM4microarray software suite. Meth. Enzymol.411, 134–193.
Shen, R.F., Tai, H.H., 1998. Thromboxanes: synthase and receptors. J. Biomed. Sci. 5,153–172.
Skold, M., Rosenberg, R., 1996. Arm regeneration frequency in eight species of Ophiuroidea(Echinodermata) from European sea areas. J. Sea Res. 35, 353–362.
Skold, M., Loo, L.O., Rosenberg, R., 1994. Production, dynamics and demography of anAmphiura filiformis population. Mar. Ecol. Prog. Ser. 103, 81–90.
Smyth, G., 2005. Limma: linear models for microarray data. In: Gentleman, R., Carey, V.,Huber, W., Irizarry, R., Dudoit, S. (Eds.), Bioinformatics and Computational BiologySolutions Using R and Bioconductor. Statistics for Biology and Health. Springer,New York, p. 473.
Suminami, Y., Nagashima, S., Murakami, A., Nawata, S., Gondo, T., Hirakawa, H., Numa,F., Silverman, G.A., Kato, H., 2001. Suppression of a squamous cell carcinoma (SCC)-related serpin, SCC antigen, inhibits tumor growth with increased intratumor infil-tration of natural killer cells. Cancer Res. 61, 1776–1780.
Sumitomo, M., Shen, R., Walburg, M., Dai, J., Geng, Y., Navarro, D., Boileau, G., Papandreou,C.N., Giancotti, F.G., Knudsen, B., Nanus, D.M., 2000. Neutral endopeptidase inhibitsprostate cancer cell migration by blocking focal adhesion kinase signaling. J.Clin. Invest. 106, 1399–1407.
Sun, L., Wang, S., Hu, C., Zhang, X., 2010. Regulation of cell proliferation and apoptosisthrough fibrocystin–prosaposin interaction. Arch. Biochem. Biophys. 502, 130–136.
Turner, A.J., Isaac, R.E., Coates, D., 2001. The neprilysin (NEP) family of zinc metalloendo-peptidases: genomics and function. BioEssays 23, 261–269.
Tusher, V.G., Tibshirani, R., Chu, G., 2001. Significance analysis of microarrays applied tothe ionizing radiation response. Proc. Natl. Acad. Sci. U. S. A. 98, 5116–5121.
Vidalino, L., Doria, A., Quarta, S., Zen, M., Gatta, A., Pontisso, P., 2009. SERPINB3, apoptosisand autoimmunity. Autoimmun. Rev. 9, 108–112.
Wettenhall, J.M., Smyth, G.K., 2004. limmaGUI: a graphical user interface for linearmodeling of microarray data. Bioinformatics 20, 3705–3706.