introduction to bioinformatics fall 2007-8 1: introduction
Post on 22-Dec-2015
223 views
TRANSCRIPT
![Page 1: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/1.jpg)
Introduction to Bioinformatics
Fall 2007-8
1: Introduction
![Page 2: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/2.jpg)
Teachers:Dr. Tal Pupko [email protected] Stern [email protected]
TA:Nimrod Rubinstein [email protected] Burstein [email protected] Doron [email protected]
Reception hours:by appointment. Britannia 405, 03-640-9245
1: Introduction
Administration
![Page 3: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/3.jpg)
Course Website1: Introduction
http://bioinfo.tau.ac.il/~intro_bioinfo/
WHAT ARE THE QUESTIONS IN THE EXAMS?
![Page 4: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/4.jpg)
Requirements1: Introduction
Final exam – 80% Exercises – 20%
Exercises that won’t be submitted on time will receive a grade of 0.
Do not copy!
![Page 5: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/5.jpg)
Exercises
• Each student participates once in 2 weeks:Sunday 16:00-18:00or Monday 12:00-14:00
or
Monday 14:00-16:00
Computer classroom Sherman 03
1: Introduction
![Page 6: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/6.jpg)
Goals
To familiarize the students with research topics in bioinformatics, and with bioinformatic tools
Prerequisites
• Familiarity with topics in molecular biology (cell biology and genetics)
• Basic familiarity with computers & internet
1: Introduction
![Page 7: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/7.jpg)
Ask, Ask, Ask!!
"אין הביישן למד"
1: Introduction
![Page 8: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/8.jpg)
What is Bioinformatics
• “The analysis of biological information using computers and statistical techniques; the science of developing and utilizing computer databases and algorithms to accelerate and enhance biological research “
www.niehs.nih.gov/dert/trc/glossary.htm
1: Introduction
![Page 9: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/9.jpg)
What do bioinformaticians study?
• Bioinformatics today is part of almost every molecular biological research.
• Just a few examples…
1: Introduction
![Page 10: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/10.jpg)
Example 1
• Compare proteins with similar sequences (for instance –kinases) and understand what the similarities and differences mean
1: Introduction
![Page 11: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/11.jpg)
Example 2
• Look at the genome and predict where genes are (promoters; transcription binding sites; introns; exons)
1: Introduction
![Page 12: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/12.jpg)
• Predict the 3-dimensional structure of a protein from its primary sequence
Example 3
Ab-initio prediction – extremely difficult!
1: Introduction
![Page 13: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/13.jpg)
• Correlate between gene expression and disease
Example 4
A gene chip – quantifying gene expression in different tissues under different conditions
May be used for personalized medicine
1: Introduction
![Page 14: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/14.jpg)
1: Introduction
Computational biology – revolutionizing science at the turn of the century.
![Page 15: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/15.jpg)
Three studies using bioinformatics which impacted science
1. Classifying life into domains2. Predicting drug resistance in HIV
and personalizing drug administration
3. Solving the mystery of anthrax molecular biology
1: Introduction
![Page 16: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/16.jpg)
Revolutionizing the Classification of Life
1: Introduction
![Page 17: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/17.jpg)
•Life was classified as
plants and animals
•When Bacteria were discoveredthey were initially classified as plants.
•Ernst Haeckel (1866) placed all unicellular organisms in a kingdom called Protista, separated from Plantae and Animalia.
In the very beginning
1: Introduction
![Page 18: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/18.jpg)
1: Introduction
![Page 19: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/19.jpg)
Thus, life were classified to 5 kingdoms:
When electron microscopes were developed, it was found that Protista in fact include both cells with and without nucleus. Also, fungi were found to differ from plants, since they are heterotrophs (they do not synthesize their food).
LIFE
FungiPlants Animals ProtistsProcaryotes
1: Introduction
![Page 20: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/20.jpg)
Later, plants, animals, protists and fungi were collectively called the Eucarya domain, and the procaryotes were shifted from a kingdom to be a Bacteria domain.
Domains EucaryaBacteria
FungiPlants Animals ProtistsKingdoms
Even later, a new Domain was discovered…
1: Introduction
![Page 21: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/21.jpg)
•The translation apparatus is universal and probably already existed in the “beginning”.
rRNA was sequenced from a great number of organisms to study phylogeny
1: Introduction
![Page 22: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/22.jpg)
Carl R. Woese and rRNA phylogeny1: Introduction
![Page 23: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/23.jpg)
A distance matrix was computed for each two organisms. In a very influential paper, they showed that methanogenic bacteria are as distant from bacteria as they are from eucaryota (1977).
1: Introduction
![Page 24: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/24.jpg)
One sentence about methanogenic “bacteria”
“There exists a third kingdom which, to date, is represented solely by the methanogenic bacteria, a relatively unknown class of anaerobes that possess a unique metabolism based on the reduction of carbon dioxide to methane”.
These "bacteria" appear to be no more related to typical bacteria than they are to eucaryotic cytoplasms.“
1: Introduction
![Page 25: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/25.jpg)
From sequence analysis only, it was thus established that life is divided into 3:BacteriaArchaeaEucarya
1: Introduction
![Page 26: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/26.jpg)
1: Introduction
The rRNA phylogenetic tree
![Page 27: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/27.jpg)
Revolutionizing HIV treatment
1: Introduction
![Page 28: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/28.jpg)
There are very efficient drugs for HIV
1: Introduction
A few viruses in blood
DRUG, +a few more days
Many viruses in blood
DRUG, +a few days
Many viruses in blood
![Page 29: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/29.jpg)
Explanation: the virus mutates and some viruses become resistant to the drug.
Solution 1: combination of drugs (cocktail).
Solution 2: not to give drugs for which the virus is already resistant. For example, if one was infected from a person who receives a specific drug.
The question: how do one knows to which drugs the virus is already resistant?
1: Introduction
![Page 30: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/30.jpg)
Sequences of HIV-1 from patients who were treated with drug A:
AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCGTTCGATCGTACG
Sequences of HIV-1 from patients who were never treated with drug A:AAGACGCATCGATCGATCGATCTTACGAAGACGCATCGATCGATCGATCTTACG AAGACGCATCGATCGATCGATCTTACG
1: Introduction
![Page 31: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/31.jpg)
drug A+AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCGTTCGATCGTACG
drug A-AAGACGCATCGATCGATCGATCTTACGAAGACGCATCGATCGATCGATCTTACG AAGACGCATCGATCGATCGATCTTACG
This is an easy example.
1: Introduction
![Page 32: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/32.jpg)
drug A+AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCATTCGATCATACG
drug A-AAGACGCATCGATCTATCGATCTTACGAAGACGCATCGATCTATCGATCTTACG AAGACGCATCGATCAATCGATCGTACG
This is NOT an easy example. This is an example of a classification problem.
1: Introduction
![Page 33: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/33.jpg)
1: Introduction
2006: Five machine learning tools were compared:•Decision trees•Linear regression•Linear discriminant analysis•Neural networks•Support vector regression
~80% accuracy
![Page 34: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/34.jpg)
1: Introduction
Revolutionizing our understanding of the anthrax molecular mechanism
![Page 35: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/35.jpg)
1: Introduction
•Anthrax is a disease whose causative agent is the gram positive Bacillus anthracis.
•It infects mainly cattle, swine, and horses but it can also infect humans.
•Humans are infected from milk or meat from infected animals.
•In humans it causes skin problems, in cattle – fatal blood poisoning.
![Page 36: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/36.jpg)
1: Introduction
•A vaccine was found by Pasteur.
•Koch was the first to isolate the bacterium.
•Airborne anthrax, such as that induced by weaponized strains used forbioterrosrism is almost always fatal in humans (respiratory distress, hemorrhage).
![Page 37: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/37.jpg)
1: Introduction
How does the bacterium Bacillus anthracis work?It secretes three proteins: protective antigen (PA), edema factor (EF), and lethal factor (LF).
PA monomer first binds to a host-cell surface receptor. This binding triggers proteolytic cleavage (a part of the N terminus is cut out).
The (remaining) PA monomers oligomerize, forming heptamers.
![Page 38: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/38.jpg)
1: Introduction
LF and EF bind the heptamer and the entire complex is internalized into an endosome.
The acidity in the endosome causes a conformational change in the complex, thus it penetrates the endosome membrane and forms a pore.
The story continues…
![Page 39: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/39.jpg)
1: Introduction
Researchers from the group of David Baker wanted to know how LF and EF bind to the heptameric PA. They used a method called docking…
![Page 40: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/40.jpg)
1: Introduction
This is where the two proteins interact!
![Page 41: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/41.jpg)
1: Introduction
Once they had a prediction, they performed mutagenesis experiments. Changing residues in the predicted interface cancelled the binding.
![Page 42: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/42.jpg)
1: Introduction
How does docking work? Each 3D conformation is given a score. The pair with the best score is chosen.
![Page 43: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/43.jpg)
1: Introduction
Challenges: what is the best score?How to go over as many conformations as possible?How to take into account that proteins are flexible?
![Page 44: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/44.jpg)
Gregor Mendellaws of inheritance,“gene”1866
Watson and Crick
DNA Discovery 1953
Genome
Project 2003
1: Introduction
![Page 45: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/45.jpg)
Genome
Project 2003
1: Introduction
![Page 46: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/46.jpg)
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 47: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/47.jpg)
BioinformaticsBioinformatics
• Organize, store, analyze, visualize genomic data • Utilizes methods from Computer Science,
Mathematics, Statistics and Biology
The marriage of Computer Science and Biology
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 48: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/48.jpg)
• At the convergence of two revolutions: the ultra-fast growth of biological data, and the information revolution
Biology is becoming an information science
22 Aug 2005:100,000,000,000 bases
1: Introduction Bioinformatics)Slide from Prof. Ron Shamir(
![Page 49: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/49.jpg)
Bioinformatics – a short CV
• Born ~1990• Grown rapidly.• Experience: essential part of modern life
science and medicine• Now a separate multidisciplinary scientific
area• Is one of the cornerstones of 21st Century
medical and biological research
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 50: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/50.jpg)
1: Introduction
•Academic research: where it all started•Biotechnology companies•Big Pharmas and big AgBio•National and international centers
The Bioinformatics Actors
Find me gene (gin?)
![Page 51: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/51.jpg)
Bioinformatics in Israel
• World class player in research
• Ranked 2-3 in absolute number of papers in the most prestigious and competitive conferences
• Maintaining our competitive global position is nontrivial
1: Introduction )Slide from Prof. Ron Shamir(
![Page 52: Introduction to Bioinformatics Fall 2007-8 1: Introduction](https://reader035.vdocument.in/reader035/viewer/2022062320/56649d7a5503460f94a5e065/html5/thumbnails/52.jpg)
Bioinformatics in TAU
• TAU is the Israeli leader in the field…
1: Introduction
)Slide from Prof. Ron Shamir(